EP4747378A1 - Use of let-7b or mir-21 inhibitors for the treatment inflammatory bowel diseases - Google Patents

Abstract

Intestinal microbiota and fecal microRNAs (miRNAs) play a critical role in regulating gut homeostasis, but their interaction and its influence on chronic intestinal disorders remain unclear. Here, the inventors identified miR-21 and let-7b as colitis-associated miRNAs increased during colitis. Further research in different in vivo and in vitro models uncovered distinct mechanisms of action. While miR-21 primarily caused significant alterations in intestinal barrier function in a microbiota-independent manner, let-7b targeted the microbiota, both impacting the host's inflammatory response. Most importantly, their research revealed that the inhibition of these miRNAs, by orally administering anti-miR-21 or anti-let-7b, has a powerful anti-inflammatory effect, improves intestinal permeability, and prevents dysbiosis in vivo. Thus, the present invention relates to the use of let-7b and miR-21 inhibitors for the treatment of inflammatory bowel diseases and functional bowel disorders.

Description

USE OF LET-7B OR MIR-21 INHIBITORS FOR THE TREATMENT INFLAMMATORY BOWEL DISEASES

FIELD OF THE INVENTION:

The present invention is in the field of medicine, in particular gastroenterology.

BACKGROUND OF THE INVENTION:

Inflammatory Bowel Diseases (IBD), predominantly Crohn’s disease (CD) and ulcerative colitis (UC), are characterized by chronic inflammation of the gastrointestinal tract. IBD’s etiology is multifactorial and involves both environmental and genetic factors that lead to a disrupted intestinal barrier, immune dysfunction, and exacerbated responses against gut microbes. IBD are also strongly associated with an imbalance of the gut microbial community. While inflammation and other triggers can affect the microbiota, studies with IBD patients and mouse models have consistently supported dysbiosis as a key event in the pathogenesis of inflammatory disorders¹'⁴.

The intestine harbors a complex community of microorganisms, collectively referred to as the microbiota, which includes 100-300 bacterial species and promotes host health. The microbiota and the host interact in a bidirectional manner through various factors, and the maintenance of symbiotic interaction appears crucial for intestinal homeostasis and for preventing inflammation. Recent studies have found numerous microRNAs (miRNAs) in feces⁵'⁷, which suggests that they could play a role in these interactions. MicroRNAs are small noncoding RNAs (18-25 nucleotides) that regulate several biological processes by binding to the 3'- untranslated regions (3’-UTRs) of the target messenger RNAs (mRNAs) and inducing post- transcriptional gene expression regulation. Since miRNAs are also present in extracellular human body fluids, such as serum, plasma, saliva, urine, and feces, they could be important players in inter-organ communication. Remarkably, miRNAs are highly resistant to RNase degradation and can be detected in different biofluids. They have been reported to be deregulated in serum⁸, mucosa, and stool samples of IBD patients⁹'¹¹.

In the gastrointestinal tract, miRNAs are secreted mostly from intestinal epithelial cells into the lumen and accumulate in feces¹². The first observation of crosstalk between host-derived miRNAs and the intestinal microbiota was made in germ-free mice colonized with the microbiota of pathogen-free mice¹³. Dalmasso et al. identified for the first time in 2011 that miRNAs are involved in microbiota-mediated regulation of host gene expression¹³. Since then, miRNAs have been increasingly viewed as possible mediators of host-microbiota interaction able to influence the expression of both host and bacterial genes. This can result in shifts in microbiota composition, together with miRNA-driven host response to pathogens^12,14'¹⁶ and regulating mucosal immune tolerance¹⁷. Liu et al. reported the link between Dicer deficiency, a protein complex responsible for maturing miRNAs, and dysbiosis in mice. Notably, mice lacking Dicer exhibited increased vulnerability to colitis, demonstrating the impact of miRNAs on shaping the microbial community and influencing intestinal well health¹². Furthermore, we have previously reported that fecal matter transplantation in mice was sufficient to impact host fecal miRNA profile¹⁸. In addition, we identified correlations between specific members of the microbial community and fecal miRNAs, suggesting that microbiota could modulate the expression of host miRNAs¹⁸. A recent study showed that bacterial taxon abundance and fecal miRNAs have a complex interaction, targeting both host and bacterial genes¹⁹, without, however, providing further insight into how this could participate in IBD pathogenesis. Together, studies suggest that miRNAs found in the luminal content can act on both the host and the microbiota and are critically relevant in the maintenance of intestinal homeostasis. But although the fascinating research on miRNA in health and disease has increased significantly in recent years^12,14'^16,18,19, the mechanisms through which miRNAs and microbiota are together involved in intestinal inflammation are still unsolved¹⁴.

SUMMARY OF THE INVENTION:

The present invention is defined by the claims. In particular, the present invention relates to the use of let-7b and miR-21 inhibitors for the treatment of inflammatory bowel diseases.

DETAILED DESCRIPTION OF THE INVENTION:

Intestinal microbiota and fecal microRNAs (miRNAs) play a critical role in regulating gut homeostasis, but their interaction and its influence on chronic intestinal disorders remain unclear. Here, the inventors identified miR-21 and let-7b as colitis-associated miRNAs increased during colitis. Further research in different in vivo and in vitro models uncovered distinct mechanisms of action While miR-21 primarily caused significant alterations in intestinal barrier function in a microbiota-independent manner, let-7b targeted the microbiota, both impacting the host's inflammatory response. Most importantly, their research revealed that the inhibition of these miRNAs by orally administering anti-miR-21 or anti-let-7b has a powerful anti-inflammatory effect, improves intestinal permeability, and prevents dysbiosis in vivo. Altogether, this study provides evidence of the functional significance of fecal miRNAs in microbiota-host communication and suggests their potential therapeutic role, multi-faceted, in dysbiosis-related conditions and intestinal inflammation, a new concept that appears particularly relevant for inflammatory bowel diseases.

Accordingly, the first object of the present invention relates to a method of treating an inflammatory bowel disease (IBD) in a patient in need thereof comprising administering to the patient a therapeutically effective amount of at least one miRNA inhibitor selected from the group consisting of let-7b inhibitors and miR-21 inhibitors.

As used herein, the term “patient” or “subject” refers to any mammal, such as a rodent, a feline, a canine, and a primate. Particularly, in the present invention, the patient is a human. In some embodiments, the patient is a human who is susceptible to having inflammatory bowel disease, as described above.

As used herein, the term “inflammatory bowel disease” has its general meaning in the art and refers to any inflammatory disease that affects the bowel. The term includes but is not limited to ulcerative colitis, Crohn’s disease, especially Crohn’s disease in a state that affects specifically the colon with or without ileitis, microscopic colitis (lymphocytic colitis and collagenous colitis), infectious colitis caused by bacteria or by virus, radiation colitis, ischemic colitis, pediatric colitis, undetermined colitis, and functional bowel disorders (described symptoms without evident anatomical abnormalities), such as irritable bowel syndrome.

As used herein, the term "treatment" or "treat" refer to both prophylactic or preventive treatment as well as curative or disease-modifying treatment, including the treatment of patients at risk of contracting the disease or suspected to have contracted the disease as well as patients who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a patient having a medical disorder or who ultimately may acquire the disorder in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a patient beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a patient during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a patient during the treatment of an illness, e.g., to keep the patient in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of particular predetermined criteria [e.g., disease manifestation, etc.]).

As used herein, the term “microRNA” or “miRNA” refers to an RNA molecule that is approximately 21-23 nucleotides (nt) in length. miRNAs can range between 18-26 nucleotides in length. Typically, miRNAs are single-stranded. However, in some embodiments, miRNAs may be at least partially double-stranded. In some embodiments, miRNAs may comprise an RNA duplex (referred to herein as a “duplex region”) and may optionally further comprises one or two single-stranded overhangs. In some embodiments, the miRNA comprises a duplex region ranging from 15 to 29 in length and optionally further comprising one or two singlestranded overhangs. A miRNA may be formed from two RNA molecules that hybridize together or may alternatively be generated from a single RNA molecule that includes a self-hybridizing portion. In general, free 5 ’ends of miRNA molecules have phosphate groups, and free 3’ ends have hydroxyl groups. The duplex portion of a miRNA usually, but does not necessarily, comprise one or more bulges consisting of one or more unpaired nucleotides. One strand of a miRNA includes a portion that hybridizes with a target RNA. In some embodiments, one strand of the miRNA is not precisely complementary with a region of the target RNA, meaning that the miRNA hybridizes to the target RNA with one or more mismatches. In some embodiments, one strand of the miRNA is precisely complementary with a region of the target RNA, meaning that the miRNA hybridizes to the target RNA with no mismatches. Typically, miRNAs are thought to mediate the inhibition of gene expression by inhibiting the translation of target transcripts. However, in some embodiments, miRNAs may mediate the inhibition of gene expression by causing the degradation of target transcripts.

As used herein, the term “miR-21” has its general meaning in the art and refers to the miRNA available from the database http://mirbase.org under the miRBase accession number MI0000077 (hsa-mir-21). The term encompasses the mature sequences hsa-miR-21-5p (MIMAT0000076, SEQ ID NO:1) and hsa-miR-21-3p (MIMAT0004494, SEQ ID N0:2).

SEQ ID NO : 1 >hsa-miR-2 l-5p MIMAT0000076

UAGCUUAU CAGACU GAU GUU GA

SEQ ID NO : 2 >hsa-miR-2 l-3p MIMATO 004494 CAACACCAGUCGAUGGGCUGU

As used herein, the term “let-7b” has its general meaning in the art and refers to the miRNA available from the database http://mirbase.org under the miRBase accession number MI0000063 (hsa4et-7b). The term encompasses the mature sequences hsa4et-7b-5p (MIMAT0000063, SEQ ID N0:3) and hsa-let-7b-3p (MIMAT0004482, SEQ ID N0:4).

SEQ ID NO : 3 >hsa-let-7b-5p MIMAT0000063 U GAGGUAGUAGGUU GU GU GGUU

SEQ ID NO : 4 >hsa-let-7b-3p MIMAT0004482 CUAUACAAC CUACU GCCUUCCC

As used herein, the term “miRNA inhibitor” refers to any compound that blocks miRNA expression, processing, and/or function. The miRNA inhibitor of the present invention is a compound that inhibits or reduces the activity of let-7b or miR-21. However, decreasing and/or reducing the activity of let-7b or miR-21 can also be obtained by inhibiting let-7b or miR-21 expression. The term “inhibiting let-7b or miR-21 expression” means that the production of let-7b or miR-21 after treatment is less than the amount produced prior to treatment or neutralize the activity of an existent amount. One skilled in the art can readily determine whether let-7b or miR-21 expression has been inhibited, using, for example, the techniques for determining miRNA transcript level.

In some embodiments, the miRNA inhibitor of the present invention is a compound such as nucleic acid that hybridizes with let-7b or miR-21 or has sequence complementarity to that of let-7b or miR-21. In some embodiments, the miRNA inhibitor of the present invention is a compound such as nucleic acid having at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% sequence complementarity to that of let-7b or miR-21.

Suitable miRNA inhibitors include double-stranded RNA (such as short- or small-interfering RNA or "siRNA"), antagomirs, antisense nucleic acids, and enzymatic RNA molecules such as ribozymes. Each of these compounds can be targeted to a given miRNA and destroy or induce the destruction of the target miRNA. For example, expression of a given miRNA can be inhibited by inducing RNA interference of the miRNA with an isolated double-stranded RNA ("dsRNA") molecule which has at least 90%, for example, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% sequence homology with at least a portion of the miRNA.

In some embodiments, the dsRNA molecule is a "short or small interfering RNA" or "siRNA". siRNA useful in the present methods comprises short double-stranded RNA from about 17 nucleotides to about 29 nucleotides in length, preferably from about 19 to about 25 nucleotides in length. The siRNA comprises a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base-pairing interactions (hereinafter "basepaired"). The sense strand comprises a nucleic acid sequence that is substantially identical to a nucleic acid sequence contained within the target miRNA. As used herein, a nucleic acid sequence in a siRNA that is "substantially identical" to a target sequence contained within the target mRNA is a nucleic acid sequence that is identical to the target sequence or that differs from the target sequence by one or two nucleotides. The sense and antisense strands of the siRNA can comprise two complementary, single-stranded RNA molecules or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area. The siRNA can also be altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides. Such alterations can include the addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, or modifications that make the siRNA resistant to nuclease digestion, or the substitution of one or more nucleotides in the siRNA with deoxyribonucleotides. One or both strands of the siRNA can also comprise a 3 overhang. As used herein, a "3' overhang" refers to at least one unpaired nucleotide extending from the 3 '-end of a duplexed RNA strand. Thus, in some embodiments, the siRNA comprises at least one 3' overhang of 1 to about 6 nucleotides (which includes ribonucleotides or deoxyribonucleotides) in length, preferably from 1 to about 5 nucleotides in length, more preferably from 1 to about 4 nucleotides in length, and particularly preferably from about 2 to about 4 nucleotides in length. In some embodiments, the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("uu").

The siRNA can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described above. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in U.S. published patent application 2002/0173478 to Gewirtz and in U.S. published patent application 2004/0018176 to Reich et al., the entire disclosures of which are herein incorporated by reference.

Expression of a given miRNA can also be inhibited by an antisense nucleic acid. As used herein, an "antisense nucleic acid" refers to a nucleic acid molecule that binds to target RNA by means of RNA-RNA or RNA-DNA, or RNA-peptide nucleic acid interactions, which alters the activity of the target RNA. Antisense nucleic acids suitable for use in the present methods are single-stranded nucleic acids (e.g., RNA, DNA, RNA-DNA chimeras, PNA) that generally comprise a nucleic acid sequence complementary to a contiguous nucleic acid sequence in a miRNA. Preferably, the antisense nucleic acid comprises a nucleic acid sequence that is 50- 100% complementary, more preferably 75-100% complementary, and most preferably 95- 100% complementary to a contiguous nucleic acid sequence in a miRNA. Without wishing to be bound by any theory, it is believed that the antisense nucleic acids activate RNase H or some other cellular nuclease that digests the miRNA/antisense nucleic acid duplex.

Antisense nucleic acids can also contain modifications of the nucleic acid backbone or the sugar and base moieties (or their equivalent) to enhance target specificity, nuclease resistance, delivery, or other properties related to the efficacy of the molecule. Such modifications include cholesterol moieties, duplex intercalators such as acridine, or the inclusion of one or more nuclease-resistant groups.

Antisense nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described below. Exemplary methods for producing and testing are within the skill in the art; see, e g., Stein and Cheng (1993), Science 261 : 1004, and U.S. Pat. No. 5,849,902 to Woolf et al., the entire disclosures of which are herein incorporated by reference. In some embodiments, the miRNA inhibitor is an antagomir. As used herein, the term “antagomir” refers to a chemically engineered small RNA that is used to silence let-7b or miR- 21. The antagomir is complementary to the specific miRNA target with either mispairing or some sort of base modification. Antagomirs may also include some sort of modification to make them more resistant to degradation. In some embodiments, the antagomir is a chemically engineered cholesterol- conjugated single- stranded RNA analogue.

Inhibition of let-7b or miR-21 can also be achieved with antisense 2'-O-methyl (2'-0-Me) oligoribonucleotides, 2'-O-methoxyethyl (2'-0-M0E), phosphorothioates, locked nucleic acid (LNA), morpholino oligomers or by use of lentivirally or adenovirally expressed antagomirs (Stenvang and Kauppinen (2008), Expert Opin. Biol. Ther. 8(1 ): 59-81). Furthermore, MOE (2'- O-methoxyethyl phosphorothioate) or LNA (locked nucleic acid (LNA) phosphorothioate chemistry)-modification of single-stranded RNA analogous can be used to inhibit miRNA activity.

Expression of a given miRNA can also be inhibited by an enzymatic nucleic acid. As used herein, an "enzymatic nucleic acid" refers to a nucleic acid comprising a substrate binding region that has complementarity to a contiguous nucleic acid sequence of a miRNA and which is able to specifically cleave the miRNA. Preferably, the enzymatic nucleic acid substrate binding region is 50-100% complementary, more preferably 75-100% complementary, and most preferably 95-100% complementary to a contiguous nucleic acid sequence in a miRNA. The enzymatic nucleic acids can also comprise modifications at the base, sugar, and/or phosphate groups. An exemplary enzymatic nucleic acid for use in the present methods is a ribozyme. The enzymatic nucleic acids can be produced chemically or biologically, or can be expressed from a recombinant plasmid or viral vector, as described below. Exemplary methods for producing and testing dsRNA or siRNA molecules are described in Werner and Uhlenbeck (1995), Nucl. Acids Res. 23:2092-96; Hammann et al. (1999), Antisense and Nucleic Acid Drug Dev 9:25-31; and U.S. Pat No. 4,987,071 to Cech et al., the entire disclosures of which are herein incorporated by reference.

The miRNA inhibitor of the present invention can be obtained using a number of standard techniques. For example, the miRNA inhibitor of the present invention can be chemically synthesized or recombinantly produced using methods known in the art. Typically, miRNA inhibitors of the present invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic RNA molecules or synthesis reagents include, e.g., Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, 111., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA), and Cruachem (Glasgow, UK).

In some embodiments, a synthetic miRNA inhibitor of the present invention contains one or more design elements. These design elements include but are not limited to: (i) a replacement group for the phosphate or hydroxyl of the nucleotide at the 5' terminus of the complementary region; (ii) one or more sugar modifications. In some embodiments, a synthetic miRNA inhibitor of the present invention has a nucleotide at its 5' end of the complementary region in which the phosphate and/or hydroxyl group has been replaced with another chemical group (referred to as the “replacement design”). In some cases, the phosphate group is replaced, while in others, the hydroxyl group has been replaced. In some embodiments, the replacement group is biotin, an amine group, a lower alkylamine group, an acetyl group, 2'0-Me (2'oxygen-methyl), DMTO (4,4'-dimethoxytrityl with oxygen), fluorescein, a thiol, or acridine, though other replacement groups are well known to those of skill in the art and can be used as well. In some embodiments, the sugar modification is a 2'0-Me modification. In some embodiments, there are one or more sugar modifications in the first or last 2 to 4 residues of the complementary region or the first or last 4 to 6 residues of the complementary region.

In some embodiments, the miRNA inhibitor of the present invention is resistant to degradation by nucleases. One skilled in the art can readily synthesize nucleic acids which are nuclease resistant, for example, by incorporating one or more ribonucleotides that are modified at the 2'- position into the miRNAs. Suitable 2'-modified ribonucleotides include those modified at the 2'-position with fluoro, amino, alkyl, alkoxy, and O-allyl.

In the present methods, a miRNA inhibitor can be administered to the patient either as naked RNA, in combination with a delivery reagent, or as a nucleic acid (e.g., a recombinant plasmid or viral vector) comprising sequences that express the miRNA inhibitor. Suitable delivery reagents include, e g, the Minis Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polyethylenimine which become a nanoparticle (less than 50 nm) when mixed with glucose solution; or e.g, polylysine), and liposomes. One skilled in the art can readily determine a therapeutically effective amount of the miRNA inhibitor to be administered to a given patient, by taking into account factors such as the size and weight of the patient; the extent of disease penetration; the age, health and sex of the patient; the route of administration; and whether the administration is regional or systemic. An effective amount of said compound can be based on the approximate or estimated body weight of a patient to be treated. Preferably, such effective amounts are administered parenterally or enterally, as described herein. For example, an effective amount of the compound administered to a patient can range from about 5-10,000 micrograms/kg of body weight and is preferably between about 5-3,000 micrograms/kg of body weight, and is preferably between about 700- 1,000 micrograms/kg of body weight, and is more preferably greater than about 1,000 micrograms/kg of body weight. One skilled in the art can also readily determine an appropriate dosage regimen for the administration of the compound to a given patient. For example, the compound can be administered to the patient once (e.g., as a single injection or deposition).

The methods herein disclosed include the local administration to the bowel (i.e. intestine or colon) of the miRNA inhibitor. In some embodiments, the miRNA inhibitor of the present invention is orally administered to the patient. In some embodiments, the miRNA inhibitor of the present invention is rectally administered to the patient. Colonic drug delivery systems are well known in the art, including enemas; rectal foam and delayed oral release formulations in the form of enteric-coated capsules, which disintegrate at pH 7 in the terminal ileum.

In some embodiments, the miRNA inhibitor of the present invention is administered to the patient in combination with one or more immunosuppressive drugs.

As used herein, the term “immunosuppressive drug” refers to any substance capable of producing an immunosuppressive effect, e.g., the prevention or diminution of the immune response. The typical medical regimen of inflammatory bowel disease include in first lines administration of corticosteroid and second lines administration of anti-TNF drug and/or additional immunosuppressive drugs.

As used, the term “corticosteroid” has its general meaning in the art and refers to a class of active ingredients having a hydrogenated cyclopentoperhydrophenanthrene ring system endowed with anti-inflammatory activity. Corticosteroid drugs typically include cortisone, cortisol, hydrocortisone (l ip,17-dihydroxy, 21-(phosphonooxy)-pregn-4-ene, 3,20-dione disodium), dihydroxy corti sone, dexamethasone (21-(acetyloxy)-9-fluoro-ip,17-dihydroxy- 16a-m-ethylpregna-l,4-diene-3, 20-dione), and highly derivatized steroid drugs such as beconase (beclomethasone dipropionate, which is 9-chloro-l l-P, 17,21, trihydroxy- 16P- m ethyl pregna- 1,4 diene-3, 20-dione 17,21 -dipropionate). Other examples of corticosteroids include flunisolide, prednisone, prednisolone, methylprednisolone, triamcinolone, deflazacort, and betamethasone. corticosteroids, for example, cortisone, hydrocortisone, methylprednisolone, prednisone, prednisolone, betamethesone, beclomethasone dipropionate, budesonide, dexamethasone sodium phosphate, flunisolide, fluticasone propionate, triamcinolone acetonide, betamethasone, fluocinolone, fluocinonide, betamethasone dipropionate, betamethasone valerate, desonide, desoximetasone, fluocinolone, triamcinolone, triamcinolone acetonide, clobetasol propionate, and dexamethasone.

As used herein, the term “anti-TNF drug” is intended to encompass agents including proteins, antibodies, antibody fragments, fusion proteins (e g., Ig fusion proteins or Fc fusion proteins), multivalent binding proteins (e.g., DVD Ig), small molecule TNF antagonists and similar naturally- or normaturally-occurring molecules, and/or recombinant and/or engineered forms thereof, that, directly or indirectly, inhibit TNF activity, such as by inhibiting interaction of TNF with a cell surface receptor for TNF, inhibiting TNF protein production, inhibiting TNF gene expression, inhibiting TNF secretion from cells, inhibiting TNF receptor signaling or any other means resulting in decreased TNF activity in a subject. The term “anti-TNF drug” preferably includes agents which interfere with TNF activity. Examples of anti-TNF drugs include, without limitation, infliximab (REMICADE™, Johnson and Johnson), human anti- TNF monoclonal antibody adalimumab (D2E7/HUMIRA™, Abbott Laboratories), etanercept (ENBREL™, Amgen), certolizumab pegol (CIMZIA®, UCB, Inc.), golimumab (SIMPONI®; CNTO 148), CDP 571 (Celltech), CDP 870 (Celltech), as well as other compounds which inhibit TNF activity, such that when administered to a subject in which TNF activity is detrimental, the disorder (i.e. acute severe colitis) could be treated.

Examples of additional immunosuppressive drugs include, without limitation, thiopurine drugs such as azathioprine (AZA) and metabolites thereof; anti-metabolites such as methotrexate (MTX); sirolimus (rapamycin); temsirolimus; everolimus; tacrolimus (FK-506); FK-778; antilymphocyte globulin antibodies, anti-thymocyte globulin antibodies, anti-CD 3 antibodies, anti- CD4 antibodies, and antibody-toxin conjugates; cyclosporine; mycophenolate; mizoribine monophosphate; scoparone; glatiramer acetate; metabolites thereof; pharmaceutically acceptable salts thereof; derivatives thereof; prodrugs thereof; and combinations thereof.

In some embodiments, the immunosuppressive drug is a cyclosporine. As used herein, the term “cyclosporine” has its general meaning in the art and refers to an immunosuppressive drug. Cyclosporine (also named “cyclosporine A” or “CyA” was the cornerstone of rescue medical therapy for steroid-refractory acute severe colitis until the advent of anti-TNF agents. CyA is a competitive calcinuerin inhibitor with potent immunosuppressive properties.

The miRNA inhibitors of the present invention are preferably formulated as pharmaceutical compositions, prior to administering to a patient, according to techniques known in the art. The pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, "pharmaceutical formulations" include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the present invention are within the skill in the art, for example, as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference. The present pharmaceutical formulations comprise miRNA inhibitors (e.g., 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a pharmaceutically-acceptable carrier. The pharmaceutical formulations of the present invention can also comprise miRNA inhibitors which are encapsulated by liposomes and a pharmaceutically-acceptable carrier. Preferred pharmaceutically-acceptable carriers are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid, and the like. Pharmaceutical compositions of the present invention can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality-adjusting agents, buffers, and pH-adjusting agents. Suitable additives include, e.g., physiologically biocompatible buffers (e g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (such as, for example, calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the present invention can be packaged for use in liquid form or can be lyophilized. In some embodiments, the miRNA inhibitor of the present invention is administered to the colon in the form of an enema formulation, which is rectally administered to the lower colon. Useful enema formulations comprise an effective amount of the miRNA inhibitor dissolved or dispersed in a suitable flowable carrier vehicle, such as water, alcohol or an aqueous-alcoholic fluid. The carrier vehicle is preferably thickened with natural or synthetic thickeners such as gums, acrylates or modified celluloses. The formulation can also comprise an effective amount of a lubricant such as a natural or synthetic fat or oil, i.e., a tris-fatty acid glycerate or lecithin. Nontoxic non-ionic surfactants can also be included as wetting agents and dispersants. Unit dosages of enema formulations can be administered from prefilled bags or syringes. The carrier vehicle may also comprise an effective amount of a foaming agent such as n-butane, propane, or i-butane. Such formulations can be delivered from a preloaded syringe pressurized container so that the vehicle is delivered to the colon as a foam, which inhibits its escape from the target site.

In some embodiments, the miRNA inhibitor is administered via oral ingestion. The effective amount of the miRNA inhibitor can be locally administered to the colon of the patient by oral ingestion of a unit dosage form such as a pill, tablet, or capsule, comprising an effective amount of the miRNA inhibitor which is enterically coated so as to be released from the unit dosage form in the lower intestinal tract, e.g., in the ileum and in the colon of the patient. Enteric coatings remain intact in the stomach, but will dissolve and release the contents of the dosage form once it reaches the region where the pH is optimal for dissolution of the coating used. The purpose of an enteric coating is to substantially delay the release of the miRNA inhibitor until it reaches its target site of action in the ileum or colon. In particular, a useful enteric coating is one that remains intact in the low pH environment of the stomach, but readily dissolved when the optimum dissolution pH of the particular coating is reached. This can vary between pH 3 to 7.5 depending upon the chemical composition of the enteric coating. The thickness of the coating will depend upon the solubility characteristics of the coating material and the site to be treated. The most extensively used polymer for enteric coating is cellulose acetate phthalate (CAP). However, CAP has an optimum dissolution pH greater than 6, thus early drug release may occur. Another useful polymer is polyvinyl acetate phthalate (PVAP) which is less permeable to moisture and gastric fluid, more stable to hydrolysis and able to dissolve at a lower pH, which could also result in early release of the miRNA inhibitor in the duodenum. The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

Figure 1. The powerful therapeutic anti-inflammatory potential by inhibiting endogenous miR-21 and let-7b. (A) Schematic representation of the experimental design, where IL-10 mice were orally treated for 10 weeks with anti-miRNAs (a -miR-21 and a-Let-7b). (B) Survival curve of mice during the 10 weeks of treatment. (C-H) Anti-miRNAs treatment had strong anti-inflammatory effects detected macroscopically and molecularly. (C) Measurement of colon weight/length ratio. (D) Colonic myeloperoxidase (MPO) amounts normalized to the PBS group. (E-G) Colonic mRNA expression levels of the pro-inflammatory cytokines (E) TNF, (F) IL-6, and (G) IL- 10 at day 71. (H) The colon of IL- 10 mice were paraffin-embedded, sectioned, and stained with H&E (bar = 200pm), and histological scored. (I) Paracellular passage of FITC-Dx 4kDa was measured over 120 min in colonic samples mounted in Ussing chambers. (J-L) Treatment also prevented dysbiosis. (J) Principal coordinates analysis (PCoA) of the Jaccard matrix of oc-miR-21 (top) and oc-let-7b (bottom) treated mice microbiota assessed by 16S rRNA gene sequencing before developing colitis at days 7 (left) and during colitis at day 71 (right). (K) Microbiota samples were compared at the class level after treatment. (L) The two most significantly modified bacterial species were compared per treatment over time. For bar plot graphs, values are given as mean ± SEM. Statistical analyses were performed using Kruskal -Wallis followed by Dunn’s post hoc tests. Significant differences were recorded as *p<0.05, **p<0.01, ****p<0.0001, vs PBS. For the heatmap, the color represents the average mean per group.

Figure 2. Long term administration of anti-miRs during chronic inflammation in IL10-/- mice model. A total of 51 IL 10-/- mice 4 weeks old were treated 3 times per week during 10 consecutives weeks in 3 independent experiments (PBS n = 14, anti-miR-21 [O.lnmol/mouse] n = 13, anti-let-7b [O.lnmol/mouse] n = 13, combined anti-miR-21 [O.lnmol/mouse] + anti-let- 7b [0. Inmol/mouse] n = 11), of which 12 were male (PBS n = 4, anti-miR-21 n = 4, anti-let-7b n = 4). A, Colonic levels of miR-21 and let-7b after inhibitory treatment. B, C, Macro- and microscopic anti-inflammatory effects. D-I, Molecular anti-inflammatory effects. J, Improvement of the barrier function. Figure 3. Short-term administration of anti-miRs during acute inflammation in WT mice DSS model. Colitis was induced to a total of 24 female mice with 1% DSS diluted in the drinking water from day 0 to 7 and treated daily with anti-miRs from day 1 to 7 in 1 independent experiment (water + PBS n = 6, 1% DSS + PBS n = 6, 1% DSS + anti-miR-21 [0. Inmol/mouse] n = 6, 1% DSS + anti-let-7b [0. Inmol/mouse] n = 6). A-D, Macroscopic anti-inflammatory effects. E-J, Molecular anti-inflammatory effects. K-N, Tight junction expression.

EXAMPLE:

Methods:

Mice experiments and housing

Screening of fecal miRNAs in IL-10~ ~ mice

For the initial screening experiment, we used 6 female mice which are known as a model of spontaneous colitis⁴⁰. IL- 10 mice (B6.129P2-I110tmlCgn/J, Jackson Laboratory, Bar Harbor, USA) were randomly grouped and housed at Georgia State University under an institutionally approved protocol (Institutional Animal Care and Use Committee # A17044) and kept on for 13 weeks. Fecal samples were collected at age 37 and 115 days old, respectively, before and during colitis. A total of 752 miRNAs were screened using high-throughput qPCR- based technology. Only miRNAs with at least 3 values per group were included in the analysis. After the average of the normalized Cp values was calculated, t-student tests followed by a Benjamini-Hochberg procedure were performed.

Induction of colitis with miRNAs in C57BI/6 mice with/out microbiota presence

The 6-week-old wild-type (WT) C57B1/6 female mice (Charles River, France) were acclimatized for 1-week prior to experiments and kept under Specific Opportunist Pathogen Free (SOPF) conditions. Mice were randomly grouped, housed n=3 per cage, and fed autoclaved standard rodent diet ad libitum. Experiments were approved by the institutional animal care and use committee (APAFIS#23855-2020012916328162, Paris, France). Mice were exposed to water (control group, n=20), miR-21a-5p (miR-21) [200nM] (n=18), or let-7b- 5p (let-7b) [200nM] (n=15) diluted in the drinking water for 4 days. Fresh feces were collected on days 0, 2, and 4. In order to study the inflammation and microbiota evolution after miRNA- induced changes in vivo, a set of 18 mice (n=6 per group) were treated as previously described. After the 4-day treatment, drinking bottles were replaced with fresh water, and mice were kept for another 17 days for a post-treatment phase. Fresh feces were collected on days 0, 2, 4, and 21. In parallel and to study if the miRNAs’ inflammatory potential was dependent on the microbiota, the presence of bacteria was abolished by using an antibiotic cocktail diluted in the drinking water (Ampicillin Img/mL and Neomycin 0.5mg/mL) for 14 days prior the 4-days treatment with water (N=9), miR-21 [200nM] (N=9), or let-7b [200nM] (N=6). Fresh feces were collected on days 0, 7, 14, 16, and 18. Notice that the possible unspecific effects of our selected miRNAs were previously tested. The pilot experiment included an additional group of n=6 mice treated with negative control miRNA [200nM] (Qiagen) for 4 days. Body weight and colonic bleeding were monitored during all the experiments. After each respective treatment, mice were euthanized. Macroscopic evidence of inflammation was evaluated by measuring colon length, colon weight, and spleen weight. Blood and colonic samples were collected for further analysis, as detailed below.

Long-term therapeutic administration of anti-miRNAs in IL- 10^ mice

A total of 26 in-house bred 4-5 weeks-old IL- 10 mice, 12 males and 14 females, were kept under SOPF conditions with ad libitum access to food and water until 14-15 weeks of age. The experiment was approved by the institutional animal care and use committee (APAFIS#23855- 2020012916328162, Paris, France). Mice were randomly divided into 3 groups per sex, 6 cages in total. Each group was gavaged from day 0 with either 150pl of PBS (control group), anti- miR-21a-5p (a-miR-21) [0. Inmol], or anti-let-7b-5p (a-Let-7b) [0. Inmol] 3 times per week. Body weight and fresh fecal samples were collected every 7 days. After 10 consecutive weeks of treatment (day 71), mice were euthanized. The schematic experiment design is represented in Figure 1A. Macroscopic evidences of inflammation were evaluated by measuring colon length, colon weight, and spleen weight. Blood and colonic samples were collected for further analysis, as detailed below.

Intestinal permeability assay with Ussing Chamber

Intestinal permeability was assessed in Ussing chambers as previously described⁶³. Briefly, proximal colonic samples were opened along the mesenteric border and mounted in Ussing chambers (Easy Mount P2312; Physiologic Instrument, San Diego, CA, USA). Mounted samples were equilibrated for 20 min in 4 ml of 10 mM glucose (pH 7.4) on the serosal side and 4 ml of 10 mM mannitol (pH 7.4) on the mucosal side. Chambers were kept at a constant temperature of 37°C and gassed with 95% 02/5% CO2. The permeability assay started when adding Img/mL of the paracellular probe FITC-Dx 4 kDa (Sigma) and 10'⁵M of the transcellular marker horseradish peroxidase 45 kDa (HRP, Type VI, Sigma)⁶⁴. Serosal samples were collected at 0, 30, 60, 90, and 120 min. FITC-Dx 4 kDa passage was measured at 488 nm in a SPARK 10M plate reader. HRP 45 kDa was measured using the QuantaBlu™ Fluorgenic Peroxidase Substrate Kit (Pierce, Rockford, USA) according to a previously described protocol⁶⁵. Briefly, a 96-well plate was coated with 5 mg/ml anti-HRP mouse IgG monoclonal antibody diluted in carbonate buffer (pH 9.6) and incubated overnight at 4°C. Wells were washed and blocked with 5% BSA solution for 1 h at room temperature. Diluted samples were added after washing the plate and incubated for 1 h at room temperature. After washing, the working solution was incubated for 30 min and stopped with stop-solution. HRP amount was measured at 325 nm (Aex) and 470 nm (Xem) in a SPARK 10M plate reader. The passage of both markers was calculated using standard curves and expressed as A120-30 min.

Serum immunoreactivity to LPS by ELISA

Serum immunoreactivity to LPS was examined by ELISA as previously described⁶⁶. High- binding ELISA plates were coated overnight with purified LPS from E. Coli 0128:B 12 (Sigma, 2 pg/well) in 9.6 pH bicarbonate buffer. Pre-diluted sera (1 :200) were added to the wells and incubated at 37°C for 1 h. Wells were washed and incubated with HRP-conjugated anti-mouse IgG (1 : 1,000) at 37°C for 1 h. After washing, the peroxidase substrate tetrame-thylbenzidine (TMB) was added and stopped after 15 min incubation with TMB stop solution. Plates were then read at 450 nm with wavelength correction set at 540 nm in a SPARK 10M plate reader. Data are reported as percentage to control.

Staining of colonic tissue and histopathologic analysis

Mouse proximal colons were fixed in 4% formaldehyde, dehydrated, and embedded in paraffin blocks. Tissues were sectioned at 4 pm thickness and stained with H&E using standard protocols. Images were acquired using a Lamina Slide Scanner (Perkin Elmer) at the Hist’IM platform (INSERM U1016, Paris, France). H&E stained samples were blindly scored to study the mucosa status and colitis level. The score was based on the infiltration of inflammatory cells as follows: (0) no cell infiltration, (1) light infiltrate in the lamina propria, (2) small lymphoid follicle 500 pm² - 2,000 pm², (3) medium lymphoid follicle 2,000 pm² - 30,000 pm², (4) large lymphoid follicle >30,000 pm².

Colonic myeloperoxidase (MPO) assay The activity of MPO, a neutrophil enzyme and marker of inflammation, was analyzed as previously described⁶⁷. Distal colonic tissues were mechanically homogenized at 50 mg/ml in 0.5% hexadecyltrimethylammonium bromide (Sigma) diluted in 50 mM PBS (pH 6.0), sonicated, freeze-thawed 3 times, and centrifuged for 15 min at 14,000 rpm 4°C. The collected supernatant (50 pL) was mixed with freshly prepared Reactive Buffer (200 pL) consisting of 1 mg/mL of dianisidine dihydrochloride (Sigma) and 5x10-4% H2O2. The change in optical density was measured at 450 nm in a SPARK 10M plate reader. Human neutrophil MPO (Sigma) was used to create the standard curve.

Preparation of fecal supernatant

Fecal samples were reconstituted in PBS to a final concentration of 100 mg/mL, vortexed for 15 min, and centrifuged for 10 min at 14,000 g 4 °C. Fecal supernatant was collected, serially diluted and stored at -80°C until further use.

Quantification of fecal lipocalin-2 (LCN-2) by ELISA

Lipocalin-2 was measured in previously processed fecal supernatant following the manufacturer’s instructions of the murine Lipocalin-2/NGAL ELISA kit (R&D Systems). Optical density was read at 450 nm (Versamax microplate reader). Samples were normalized per group to Day 0 for each experiment.

Colonic mRNA isolation and quantitative Real-Time qPCR assays

Colonic tissues were collected during euthanasia, placed in RNA-later (Invitrogen), and kept at -80°C until further use. NucleoSpin RNA kit was used to isolate the total mRNA from colonic samples according to manufacturer’s instructions. Extracted mRNAs were quantified using NanoDrop One Spectrophotometer (Ozyme, France). After cDNA synthesis, inflammatory cytokines were measured by RT-qPCR with Taqman using a LightCycler 96 system (Roche). The mRNA expressions levels of tight junction proteins, mucus, and defensins were measured by RT-qPCR with SYBR Green (Qiagen). Changes in mRNA expression were determined by calculating the fold-changes using the comparative threshold cycle (Ct) method.

Fecal and colonic miRNA extraction and quantification

Small RNA molecules (<200 nt) were obtained from the colonic and fecal samples collected using the mirVana isolation kit (Thermo Fisher) according to manufacturer’s instructions. Briefly, samples were disrupted and homogenized in Lysis buffer using TissueLyser (Qiagen, France). The homogenate was mixed with chloroform and centrifuged. The aqueous phase was mixed with 1/3 volumes of ethanol and loaded into a RNeasy spin column. Collected filtrate was mixed with 2/3 volumes of ethanol and filtered for a second time. After 3 washes, small RNAs were eluted with RNase-free water. Quality and quantity of small RNAs were analyzed using NanoDrop One Spectrophotometer (Ozyme, France). The miRCURY LNA RT kit (Qiagen) was used for the cDNA synthesis from the pre-diluted small RNA samples (10 ng/pil ) Obtained cDNA was mixed with the 2X miRCURY SYBR Green Master Mix and qPCR was performed in a LightCycler 96 system (Roche). The UniSp6 RNA spike-in was used as an interpolate calibrator. Changes in miRNAs expression were determined by calculating the foldchanges using the comparative threshold cycle (Ct) method with a normalization with miR- 194-5p, chosen for its stability index in colitic mice.

Quantification of fecal LPS and flagellin load

Fecal load of LPS and flagellin were quantified using HEK-Blue-mTLR4 and HEK-Blue-mTL5 cells, respectively (Invivogen). Previously processed fecal supernatant was applied to the mammalian cells and incubated for 24 h at 37 °C. Cell culture supernatants were applied to QUANTI-Blue medium (Invivogen) and alkaline phosphatase activity was measured at 620 nm after 30 min. Purified LPS from E. coli (Sigma) and flagellin from Salmonella typhimurium (Sigma) were used for standard curve determination.

Localization of bacteria by FISH immunostaining

To analyze bacteria localization at the surface of the intestinal mucosa, colonic tissues were analyzed after mucus immunostaining paired with fluorescent in situ hybridization (FISH), as previously described⁶⁸ Briefly, proximal colonic tissues were placed in Camoy’s fixative solution and stored at 4°C. Samples were washed in methanol (2x30min), absolute ethanol (2xl5min), 50% ethanol 50% xylene (15min), and xylene (2 x 15min). Tissues were then embedded in paraffin blocks and cut in 4 pm. Sections were dewaxed by xylene (2xl0min) at 60°C and ethanol 99.5% (5min). Samples were incubated overnight at 50°C with hybridization solution (20 mM Tris-HCl, pH 7.4, 0.9 M NaCl, 0.1% SDS, 20% formamide) containing 10 mg/ml of EUB338 probe (with a 5’ labeling using Alexa 647). Samples were then washed (lOmin) with washing buffer (20 mM Tris-HCl, pH 7.4, 0.9 M NaCl) and quickly with PBS. Slides were incubated with block solution (5% fetal bovine serum in PBS) for 30min at 4°C, and then with rabbit mucin-2 primary antibody (1 : 100, Genetex, GTX100664) overnight at 4°C. After washing in PBS (3xl0min), secondary anti-rabbit Alexa 488 (1:200, Sigma) was diluted together with Phalloidin-TRITC (100 mg/mL, Sigma) and Hoechst 33258 (10 mg/ml, Sigma), and incubated at room temperature for 2h. Slides were washed (3xl0min) in PBS and mounted using Prolong anti-fade mounting media. An average of 5 images were collected per slide with LSM 780 (ZEISS Optique France, France) 20x objective and processed with ImageJ Fiji. The distance of the 25 closest bacteria to the intestinal epithelial layer was measured per image. The average of all the images per slide was calculated per mouse and represented as the average distance Bacteria - Epithelium (pm).

Microbiota analysis by 16S rRNA gene sequencing using illumina technology

Microbiota analyses were performed before and after each respective treatment. The 16S rRNA gene amplification and sequencing were performed using the Illumina MiSeq technology following the protocol of the Earth Microbiome Project with their modifications to the MOBIO PowerSoil DNA Isolation Kit procedure for extracting DNA (https://press.igsb.anl.gov/earthmicrobiome (accessed on 1 April 2023)). Bulk DNA was extracted from frozen feces using a PowerSoil-htp kit from MoBio Laboratories (Carlsbad, CA, USA) with mechanical disruption (bead-beating). The 16S rRNA genes, region V4, were RT- qPCR amplified from each sample using a composite forward primer and a reverse primer containing a unique 12-base barcode, designed using the Golay error-correcting scheme, which was used to tag RT-qPCR products from the respective samples). We used the forward primer 515F 5 ^Z -AATG ATAC GGCG ACCA CCGA GATC TACACGCT XXXX XXXX XXXXTATG GTAATT GT GTGYCAGCMGCCGCGGTAA-3 (SEQ ID NO: 5): the italicized sequence is the 5^Z Illumina adaptor, the 12 X sequence is the Golay barcode, the bold sequence is the primer pad, the italicized and bold sequence is the primer linker, and the underlined sequence is the conserved bacterial primer 515F. The reverse primer 806R used was 5^Z -CAAG CAGA AGAC GGCA TACGAGAT AGTCAGCCAG CC GGACTACNVGGGTWTCTAAT- 3 (SEQ ID NO:6): the italicized sequence is the 3^Z reverse complement sequence of Illumina adaptor, the bold sequence is the primer pad, the italicized and bold sequence is the primer linker, and the underlined sequence is the conserved bacterial primer 806R. RT-qPCR reactions consisted of Hot Master RT-qPCR mix (Quantabio, Beverly, MA, USA), 0.2 mM of each primer, 10-100 ng template, and reaction conditions were 3 min at 95 °C, followed by 30 cycles of 45 s at 95 °C, 60 s at 50 °C, and 90 s at 72 °C on a Biorad thermocycler. RT-qPCR products were purified with Ampure magnetic purification beads (Agencourt, Brea, CA, USA) and visualized by gel electrophoresis. Products were then quantified (BIOTEK Fluorescence Spectrophotometer, Winooski, VT, USA) using Quant-iT PicoGreen dsDNA assay. A master DNA pool was generated from the purified products in equimolar ratios. The pooled products were quantified using Quant-iT PicoGreen dsDNA assay and then sequenced using an Illumina MiSeq sequencer (paired-end reads, 2A-250 bp, San Diego, CA, USA) at Cornell University, Ithaca. The 16S rRNA sequences were analyzed using QIIME2 -version 2019.51 Sequences were demultiplexed and quality filtered using the DADA2 method with QIIME2 default parameters to detect and correct Illumina amplicon sequence data, and a table of Qiime2 artifacts was generated. A tree was next generated, using the align-to-tree-mafft-fasttree command, for phylogenetic diversity analyses, and alpha and beta diversity analyses were computed using the core-metrics-phylogenetic command. PCoA plots were used to assess the variation between the experimental group (beta diversity).

Statistical analysis

Data are expressed as mean ± SEM and statistical analyses were performed using GraphPad Prism software (V.8). Significance was determined using a One-way analysis of variance (ANOVA) followed by a Bonferroni post hoc test or Kruskal-Wallis followed by Dunn’s post hoc tests when data were normally or non-normally distributed, respectively. For data collected at different time points in line chart form, a two-way repeated measures ANOVA or a mixed- effects model (if missing values) with a Bonferroni post hoc test was performed. Significance was noted as follows: compared to water, * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001. Results were considered significant at p < 0.05.

Results:

Fecal miR-21 and let-7b are associated with colonic inflammation in mice

We used mice, known to spontaneously develop chronic enterocolitis with massive infiltration of lymphocytes, activated macrophages, and neutrophils²⁰, to identify miRNAs associated with colitis Fecal miRNAs of host origin were analyzed at age 37 and 115 days old, respectively, before and during colitis as attested by levels of fecal lipocalin-2, a dynamic marker of intestinal inflammation (data not shown). A total of 752 miRNAs were screened using high-throughput RT-qPCR-based technology. Among the 8 most significantly altered miRNAs, 2 miRNAs were increased and previously related to inflammation^21,22, namely miR- 21a-5p and let-7b-5p. To determine the importance played by these 2 colitis-associated miRNAs in the physiopathology of colitis and their relationship with the microbiota, miR-21a- 5p (miR-21) and let-7b-5p (let-7b) were selected for further analysis in C57B1/6 wild-type (WT) mice.

The exogenous administration of miR-21 and let-7b drives miRNA-specific intestinal inflammation

Having established the association between miR-21 and let-7b with intestinal inflammation in mice, we wanted to determine in vivo the extent to which they are central in driving inflammatory response. C57B1/6 WT 6-week-old mice were treated ad libitum in the drinking water for 4 days with either water, miR-21 [200nM], or let-7b [200nM] (data not shown). The viability of these molecules was evaluated throughout the entire experiment to ensure their stability and to study their pharmacodynamics. Results of RT-qPCR showed that both mimics were stable in water at room temperature for 4 days (data not shown). Moreover, a significant increase of both mimics was found in the feces of treated compared with untreated mice, indicating that these molecules reached the colonic lumen successfully (data not shown). Additionally, the administration of negative-control-mimic ad libitum in the drinking water for 4 days did not induce any sign of inflammation, as confirmed by myeloperoxidase (MPO) measurement, and RT-qPCR analysis of the mRNA expressions levels of Tumor necrosis factor (TNF), interleukin (IL)-6, and IL-10 (data not shown) providing evidence of the specificity of miR-21 and let-7b in triggering inflammation. Consequently, the negative-control -mimic group was no longer included in the subsequent experiments.

Phenotypically, miRNA-treated mice did not display severe inflammation, as observed by histological examination (data not shown) and quantified by H&E scoring (data not shown). Nonetheless, a low-grade inflammation was found by RT-qPCR when quantifying inflammatory cytokines (data not shown). TNF levels were detected to increase after treatment with both miR-21 and let-7b. Interestingly, we observed a miRNA-dependent inflammatory response. The let-7b inflammatory response likely involved macrophages, as previously reported by Xu et al. ²³ , with increased levels of IL-6 and IL-ip. Whereas the administration of miR-21 seemed to trigger an inflammation driven by neutrophils, as shown by the significantly increased levels of the neutrophil marker MPO (data not shown). Altogether, these data demonstrate that the oral administration of mimics is sufficient to create a low-grade inflammation. Moreover, the inflammatory pathway seems to be miRNA specific.

Administration of miR-21 increases colonic permeability and passage of bacteria Impacts on intestinal inflammation usually include epithelial barrier impairment, which increases intestinal permeability. Here, we evaluated ex vivo the colonic permeability of WT mice treated ad libitum through drinking water for 4 days with either water, miR-21, or let-7b. Proximal colonic tissues were mounted in Ussing chambers, and the passage of different sizes of macromolecules throw the sample was measured for 120min at intervals of 30min. Paracellular permeability, assessed by FITC Dextran 4 kDa flux (data not shown), was significantly increased after miR-21 treatment. Only a slight increase in transcellular permeability, assessed by HRP 45 kDa flux (data not shown), was observed after the treatment with either mimic. Interestingly, and corroborating the existence of increased intestinal permeability and the passage of bacterial components, elevated amounts of circulating antilipopolysaccharide (anti-LPS) antibodies were found after miR-21 treatment (data not shown). We sought to investigate the extent of barrier dysfunction by analyzing the expression of the most relevant genes involved in tight junctions. Only the treatment with miR-21 significantly increased the expression of Claudin-1, -2, and -5 (data not shown), as commonly observed in intestinal inflammatory disorders²⁴. These results indicate miR-21 effects upon the intestinal barrier function are remarkably stronger than those of let-7b, and lead to increased permeability and passage of bacterial components.

Administration of let-7b modifies fecal microbiota composition to a greater extent than miR-21

The extent to which the administration of mimics for 4 days could modify the microbiota in vivo was studied by different means. Firstly, we investigated the bioactive fecal levels of LPS as a mean to evaluate the functional features of the microbiota. Mice that received mimics showed a drastic decrease in LPS after 2 days of let-7b treatment and after 4 days of miR-21 treatment (data not shown) The analysis of 16S rRNA sequencing from fecal samples further confirmed microbiota alterations. The principal coordinates analysis (PCoA) of the Unweighted UniFrac index showed significant modifications of the beta diversity after treatment with let- 7b (data not shown), which were confirmed when calculating the matrix relative distance between groups (data not shown). However, such differences were not detected after miR-21 treatment (data not shown). The taxonomic analysis at the class level revealed bacterial differences mostly after let-7b treatment (data not shown). The two most significantly modified bacterial classes were compared per treatment over time. Mice that received mimics had a remarkable increase in the relative abundance of Cyanobacteria 4C0d-2 and Proteobacteria Alphaproteobacteria (data not shown). We conclude that let-7b in vivo modifies gut microbiota to a greater extent than miR-21. miRNAs modify the intestinal mucus composition and promote the production of antibacterial factors

One possible explanation for the observed microbiota modifications is that fecal miRNAs alter the niche where bacteria reside, thus changing the microbiota growth and distribution. One of the factors influencing the presence of specific bacteria and their proximity to the intestinal epithelium is the mucus layer²⁵. To test the hypothesis that the mucus may be altered by miRNAs, we first analyzed markers of mucus composition by RT-qPCR. The administration of miR-21 decreased mRNA levels of Mucin 2 (Muc2), the main component of mucus, while let- 7b increased the expression of Mucl mRNA, which primary function is cell protection, and significantly decreased Muc5b (data not shown).

Increased luminal miRNAs could also induce microbiota to penetrate the mucus and increase microbial encroachment, manifested as a decrease of the epithelium-microbial distance, causing chronic low-grade intestinal inflammation. Hence, we next examined microbiota invasion by measuring the distance between luminal bacteria and the surface of the epithelium using confocal imaging of FISH-stained colonic samples. The average bacteria-epithelium distance was reduced after miR-21 and let-7b treatment (data not shown).

It is also possible that miRNAs impact the commensal bacteria by targeting secreted bactericidal mediators. For example, miR-21 has previously been demonstrated to target CAMP and defensin B4A (DefB4A)²⁶. Here, the study of the expression of several antibacterial factors by RT-qPCR interestingly showed that, unlike let-7b, miR-21 treatment significantly increased genes encoding for LYPD8, known to bind and inhibit the motility of flagellated bacteria²⁷; and ZG16, which aggregates Gram-positive bacteria²⁸ (data not shown). The mRNA levels of genes encoding antimicrobial peptides from the defensin family, cryptidins (Defcr)2 and Defcr5 were also found to increase only after miR-21 treatment (data not shown).

Building upon the previous findings, the impact of miR-21 on the host seems to be more pronounced when compared to let-7b. The inflammatory response elicited by let-7b could potentially be attributed to the direct interactions between miRNA and the microbiota, as suggested by the results of microbiota analyses (data not shown) and the lack of changes in bactericidal mediators (data not shown).

The persistence of microbiota alterations after Let-7b treatment is associated with delayed miRNA-induced inflammation

In order to investigate to what extent, the previously observed microbiota changes (data not shown) persisted and to understand the relationship between these changes and host inflammation, we maintained mice for 17 days after finalizing the earlier described 4-day miRNA treatment (data not shown). Unlike the previous experiments, we found an almost significant increase in the colon weight/length ratio in those mice treated with let-7b (data not shown). Moreover, the above-mentioned proinflammatory effects induced by miR-21 were diminished and no longer detected when euthanizing the mice after 17 days without treatment (data not shown). In contrast, mRNA expression levels of TNF remained significantly increased in mice treated with let-7b, unlike those treated with miR-21 (data not shown). The overexpression of the key tight junction Occludin mRNA suggests that the intestinal barrier function remained altered (data not shown). In this particular case, increased Occludin mRNA levels could be the consequence of an enhanced autophagy, recently described to be protective against inflammation-induced tight junction barrier loss²⁹. Furthermore, Nod2 mRNA, known to promote host defense after the detection of muramyl dipeptide (MDP)³⁰ and to be upregulated by TNF³¹, was found significantly increased in all miRNA-treated mice compared to the water- treated group (data not shown).

Regarding the microbiota, 16S sequencing followed by the PCoA of the Bray Curtis distances (data not shown) revealed that the microbiota remained unmodified for the miR-21 treated group. While the microbiota differences previously described persisted for those mice treated with let-7b (data not shown).

Overall, these data show that the miRNA-induced changes have a prolonged effect on the host inflammatory response. Nonetheless, miR-21 proinflammatory effects seem to decrease when the mimic is removed, supporting the idea that miR-21 inflammatory effects are mostly the consequence of a direct interaction with the host³². Our data also suggest let-7b microbial changes persist and could be the trigger rather than the result of the above-described inflammation. To further explore this new hypothesis, we next studied if the presence of microbiota was an essential requirement to induce miR-dependent host inflammation. Let-7b-induced inflammation is abrogated in the absence of microbiota

To better evaluate whether the inflammatory effects of miR-21 and let-7b in the colon were mediated by the miRNA-host interactions directly or as a consequence of the microbiota modifications by the mimics, colitis was studied in intestinal microbiota-depleted mice. For that, WT mice were treated with a mix of ampicillin [Img/ml] and neomycin [0.5mg/ml] ad libitum in drinking water for 14 days before miRNA-4-day treatment (data not shown). Interestingly, the joint administration of let-7b with antibiotics abolished intestinal inflammation and impaired intestinal permeability (data not shown), showing that microbiota is crucial for these events. Previous miR-21 proinflammatory effects were greatly preempted when jointly administered with antibiotics, but increased colonic MPO (data not shown) was maintained. This result suggests that the recruitment of neutrophils may occur independently of the presence of bacteria.

Selected miRNAs can directly alter human complex microbiota in vitro

In order to elucidate if miR-21 and let-7b might directly interact with bacteria and induce changes in the microbiota composition, we examined their impact on parallel anaerobic human microbiota cultures using the MiniBioReactor Arrays (MBRA) system set as previously reported³³'³⁵. Human fecal samples from 2 healthy donors were used to generate independent complex microbiota cultures treated in triplicate, after a stabilization phase, with two injections at time 0 and 12 h of either PBS, miR-21 [200nM], or let-7b [200nM] mimics for a total of 60h (data not shown). The analysis of the 16s rRNA gene sequences showed a decrease in the a- diversity after treatment in the 2 donors. Both mimics reduced the richness or the total number of bacterial species of the entire population, measured with the Shannon index (data not shown). Interestingly, only miR-21 treatment had a severe effect on the specie distribution of abundance (data not shown), while let-7b treatment drastically diminished the phylogenetic diversity (data not shown). Shannon and Evenness are abundance-based indexes, extremely sensitive to the singleton count, whereas Faith’s PD does not consider species abundances but the presence or absence of a specie. These results indicated that miR-21 seemed to target more abundant bacteria while let-7b affected less abundant species.

The measurement of bioactive LPS and flagellin was assessed to identify the proinflammatory potential of the microbiota modified by miRNAs¹⁸. Both mimics reduced the concentrations of LPS over time, being significant after miR-21 treatment (data not shown). In contrast, in vitro flagellin levels increased after 12h incubation with miR-21 but not let-7b (data not shown). Moreover, the Firmicutes/Bacteroidetes ratio showed slight changes in samples treated with let- 7b (data not shown). These results suggest the alteration in microbiota composition likely has a functional relevance.

The PCoA of the Bray-Curtis distance from all time points was used to assess the impact of each miRNA mimic of the beta diversity. A visualization of the resulting matrices by PCoA analysis showed that the cultures treated with mimics could be well distinguished from those treated with PBS, being significantly different in both donors (miR-21 v . PBS donor 1 q<0.001, donor 2 q<0.05; let-7b vs. PBS donor 1 q<0.001, donor 2 q<0.005, data not shown). The taxonomic display over time from each donor revealed a stable microbiota in those samples treated with PBS, whereas when treated with miRNAs, some classes of bacteria were modified along the experiment (data not shown). More in detail, Bacteroidetes Bacteroidia known to be decreased in CD patients³⁶, was the most abundant bacterial class in our samples. This class was significantly decreased after 2h treatment in both donors after miR-21 (p < 0.05 vs. TO), but not PBS. Let-7b also significantly modified Bacteroidetes Bacteroidia relative abundance in both donors. Contrary to miR-21, let-7b treatment increased this bacterial class after 60h treatment (p < 0.0001 vs. TOh, and p = 0.07 vs PBS T60h). These results indicate that miR-21 and let-7b can directly interact with bacteria and modify the microbiota composition in the absence of a host. In addition, such modifications are different and specific to each miRNA.

Anti-miRNAs treatment has a powerful anti-inflammatory effect, improves intestinal permeability, and prevents dysbiosis

Providing the ability of miR-21 and let-7b to modify both the host and the microbiota, thus triggering inflammation and dysbiosis, we investigated the therapeutic potential of manipulating the microbiota and the host response by inhibiting endogenous miR-21 and let- 7b with anti-miRNAs according to the experimental design presented in Figure 1A. Long-term administration of miRNA inhibitors to IL- 10 mice (from 4 weeks to 15 weeks of age) increased the mice probability of survival from 62.5% for the PBS control group to 88.8% and 100% for the anti -miR-21 and anti-let-7b treated groups, respectively (Figure IB). Furthermore, both anti-miRNA treatments reduced to a great extent the intrinsic inflammation normally present in IL-10 ^z mice. Macroscopic evidence was already observed in the colon weight/length ratio (Figure 1C). The inflammatory marker MPO and the levels of TNF, IL-6, and IL-10 encoding genes in the colon of IL- 10 mice, were significantly decreased after anti -miR-21 treatment (Figure 1D-G). The microscopic examination of colonic samples after H&E staining with a lowered number of lymphoid follicles in anti-mir-21 treated mice further confirmed these results (Figure 1H). While anti-miR-21 effects were remarkable, the anti-inflammatory impact of anti-let-7b was milder (Figure 1C-H). These findings suggest that inhibiting miR-21 and let-7b can provide a protective effect against inflammation-associated mortality.

The extent of the successful anti-inflammatory effects was further investigated by studying intestinal permeability. The measurement of FITC Dx 4kDa and HRP 45kDa indicated a decreased paracellular and transcellular passage of those molecules through the proximal colonic tissue (Figure II) which proved an improvement of the colonic barrier function.

Regarding the microbiota, PCoA analysis showed mice treated with anti-miRNAs presented a significant alteration of beta diversity after treatment compared to that of control mice (Figure 1J). The microbiota composition of mice treated with inhibitors also differed from that of mice that received PBS suggesting the anti-miRNA treatment prevented the development of dysbiosis. (Figure IK). It was characterized by a significant decrease of F. Clostridia and an increase of V. Verrucomicrobiae after anti-let-7b (Figure IL). Together, these results suggest that inhibitors of miR-21 and let-7b could serve as new therapeutic tools to both reduce intestinal inflammation and manipulate the microbiota toward being less harmful to the host.

Figures 2A-2J show the effects and comparisons of a long-term administration of anti-miR-21 and anti-let7b, orally administered single or combined in a the IL10-/- mouse model of chronic inflammation. Markers of inflammation detected by qPCR are drastically lowered with the combined anti-miR treatment. In an effort to analyze the anti-inflammatory potential of each anti-miR we used a second model of colitis, a model of DSS-induced acute colitis. Mice were treated with 1% DSS for 7 days in conjunction with anti-miR (Figures 3A-3N). The short-term administration of anti-miRs during acute inflammation, especially anti -miR-21 induced significant decrease of macro, micro and molecular markers of inflammation (including TNF, IL-6. ILlb...) as well as markers of permeability.

Discussion:

We and others have highlighted the importance of miRNAs in regulating both the host and the gut microbiome, playing a crucial role in maintaining intestinal homeostasis^7,12’¹⁸. Despite the growing interest in this research field and its implications within health and disease, the mechanisms underlying the interactions between miRNAs and the microbiota in IBD remain unresolved. Thus, this study aimed to investigate the significance of miRNA-microbiota interactions, shedding light on their pathogenic relevance. Here, we present strong evidence linking miR-21 and let-7b with colonic inflammation. Originally and unlike previous studies where lacking miRNAs were restored¹², we orally administered free mimics in the drinking water of WT mice, simulating the fecal overexpression found during colitis. Our findings bring novelty by identifying distinct mechanisms of action for miR-21 and let-7b, the former on intestinal epithelium and the latter on the microbiota, both ultimately impacting host inflammatory response. Remarkably, the specific inhibition of these miRNAs drastically improved the overall colitis and dysbiosis of IBD mice models.

The utilization of IL- 10 mice in this study allowed the identification of miRNAs associated with colitis, thereby establishing a link between miR-21 and let-7b and the inflammatory condition observed in these mice. The subsequent investigation involved C57B1/6 WT mice and aimed to elucidate the importance of miR-21 and let-7b in the physiopathology of colitis and their potential interplay with the gut microbiota.

MiR-21 is one of the most overexpressed and well-studied miRNAs in both IBD³⁷ and colorectal cancer³⁸. A recent meta-analysis has revealed a positive association between miR-21 expression in colon tissue and the development of UC and CD. Findings suggest that miR-21 could potentially serve as a disease marker for IBD³⁷’³⁹. In the context of murine colitis, we⁴⁰ and others⁴¹ have observed increased miR-21 levels in IL- 10 mice, known to develop spontaneous intestinal inflammation. Complementary, other studies have reported that the deletion of miR-21 results in the reduction of susceptibility to induced experimental colitis^42,43. In the present study, the administration of miR-21 led to increased colonic permeability and the passage of bacterial components, as well as altered expression of tight junction genes associated with intestinal inflammatory disorders, with the main alteration of claudins. We believe the outcome of the intestinal barrier impairment was low-grade colonic inflammation driven by neutrophils. Supporting our results, the overexpression of miR-21 has previously been described to regulate intestinal epithelial tight junctions through the degradation of RhoB mRNA⁴⁴ and the upregulation of ADP ribosylation factor 4 (ARF4)⁴⁵ in the PTEN/PI3K/Akt signaling pathway³². In our hands, such host events seemed to be primarily a result of direct interaction with the host in a microbiota-independent manner. As a matter of fact, in vivo treatment caused a minor dysbiosis that we believe was mainly associated with the induction and release of antimicrobial peptides. Importantly, Johnston et al. previously reported that the protective effects shown in miR-21 mice are, at least in part, dependent on the presence of the characteristic microbiota⁴⁶. The dissimilarities in our results can be explained by the miR- 21-induced production of defensins, which authors did not account for when using the miR-21 ^/_ mice model. Nonetheless, miR-21 -bacterial direct interactions are also likely. For instance, a recent study reported a direct effect of miR-21 over the single cultivated bacteria Lactobacillus spp., reducing its growth⁴⁷. In line with our in vivo results, and as further discussed below, our experiment of a joint incubation of complex microbiota and miR-21 leads to minor bacterial changes.

On another end, shreds of evidence relating let-7b with IBD are still scarce, and if any, associated with CD⁴⁸'⁵⁰. Noteworthy, its mucosal overexpression has been correlated with C- reactive protein (CRP) levels, a biological marker of inflammation⁵¹. Here, the oral administration of let-7b to WT mice was sufficient to induce low-grade inflammation characterized by the presence of macrophages. Likewise, other studies have reported intestinal macrophages to be the main target of let-7b²³, being recognized as a potential contributor to macrophage activation, polarization, and inflammatory response⁴⁹. To investigate the impact of let-7b on the microbiota, we have conducted various analyses. Mice treated with the mimic exhibited significant microbiota modifications, which included altered bacteria compositions and intense reduction of LPS bioactivity after only 2 days of treatment. Additionally, fecal microbiota changes persisted after stopping the treatment alongside aggravated colitis. Further, and contrary to miR-21, the inflammation induced in WT mice by let-7b oral administration was effectively suppressed with antibiotic treatment, indicating a reliance on the presence of microbiota. We then hypothesize that let-7b-induced microbial changes may act as a trigger rather than a consequence of inflammation Although our study is the first one reporting these facts, previous studies have shown let-7b to play a role in regulating inflammation in relation to bacterial and viral infections⁵²'⁵⁴. In humans, let-7b mucosal overexpression in the colon of CD patients has recently been associated with the bacterial invasion of intestinal epithelial cells⁴⁸. At the same time, this miRNA has been shown to modify the NF-KB activation and the expression of downstream genes involved in the immune responses during Helicobacter pylori infection²². More interestingly, the interkingdom interaction abilities of miRNAs were introduced by Tomkovich et al., who found let-7b and another 8 host miRNAs targeting the microbiota⁵⁵. Although little is known about these interactions, it has been suggested that host secreted let-7b can directly interact with Pseudomonas aeruginosa and reduce the formation of biofilms in lung infections by targeting biofilm formation proteins⁵⁶. Another miRNA from the same family, let-7f has been shown to promote the growth of Ruminococcus gnavus, a Grampositive anaerobic bacterial specie known for its mucus-degrading properties¹⁷. In conclusion, we found that the overexpression of luminal let-7b has a pronounced impact, perhaps directly, on the gut microbiota, with possible proinflammatory outcomes.

In recent studies, the presence of miRNAs in feces has been established and well-characterized. Findings suggest that these molecules could have the ability to enter bacteria and modulate gene expression by binding to specific genes, subsequently affecting bacterial growth and metabolites^12,26’⁵⁷. Given the significance of understanding the influence of miRNAs on the microbiome, we conducted further investigations to assess the direct impact of both miR-21 and let-7b on the microbiota. We used a unique in vitro model, known as MBRA³³'³⁵, that allows the dynamic and stable culture of human-derived microbiota under anaerobic conditions. The innovative and original method of incubating complex microbiota with either let-7b or miR-21 in MBRA systems revealed specific miRNA-bacterial interactions for both treatments that led to a decrease in alpha-diversity and modifications of the beta-diversity. More in detail, miR-21 primarily targeted abundant bacteria, while let-7b had a greater impact on less abundant species. Moreover, both mimics resulted in a reduction in LPS concentrations over time. On the other hand, the levels of flagellin, another proinflammatory molecule dedicated to bacterial motility, increased after 12 hours of incubation with miR-21, indicating that this mimic may have a specific effect on flagellated bacteria. In addition, we observed changes in the Firmicutes/Bacteroidetes ratio in those samples treated with let-7b. The Firmicutes/Bacteroidetes ratio is known to be associated with intestinal health and dysbiosis, indicating a potential alteration in the microbiota composition that was then confirmed with the distance analysis of the beta-diversity. Overall, let-7b seemed to have a stronger impact on the beta-diversity of both donors compared to miR-21. Taken together, these results strongly suggest that the alteration in microbiota composition induced by miR-21 and let-7b has functional relevance, particularly in terms of proinflammatory potential. Although the mechanisms by which miRNAs may be influencing microbial composition have yet to be determined, these results demonstrated for the first time that both mimics could directly modulate complex gut microbiota.

We acknowledge the limitations of the MBRA system, particularly regarding the potential loss of certain bacterial species, such as mucus-dependent bacteria, which could normally be targeted by either let-7b or miR-21 but may be lost upon manipulation. Our results showed a mucus production shift after miRNAs treatment in vivo, accompanied by an increased encroachment of bacteria. To address this, we could introduce mucin beads in the system⁵⁸, thereby promoting the persistence and growth of mucus-degrading bacteria. This would enable us to study the miRNA effects (direct or not) on these types of bacteria, such as Akkermansia muciniphila, which was drastically increased after inhibition of let-7b in vivo. Nevertheless, we still believe that the present MBRA results offer valuable insights into the potential direct impact of fecal miRNA on the intestinal microbiota. Recent findings have indeed shown the intricate interplay between bacterial taxon abundance and fecal miRNAs, which target both host and bacterial genes¹⁹, without, however, providing further insight into how this could participate in IBD pathogenesis. Exploring whether fecal miRNAs can actively shape the microbiota would provide novel and unique opportunities to manipulate this complex community in a way that could benefit the host and, ultimately, IBD patients. Thus, further investigation is required to elucidate the mechanism by which these mimics directly regulate specific bacterial gene expression and affect differential gut microbial growth.

Having demonstrated the pathogenic potential of miR-21 and let-7b, we postulated that their inhibition using antisense oligonucleotides (ASO) with a complementary sequence may have beneficial effects. Recent research has shown the promising therapeutic potential of anti- miRNAs as antagonists that suppress the overexpression of miRNAs at post-transcriptional level⁵⁹, correcting abnormal functions^14,60. Our results showed that the long-term administration of miRNA inhibitors, also known as antagomirs, to IL-10 mice provided a protective effect against inflammation-associated mortality since the inflammatory response in these mice was greatly reduced by both treatments. While the anti-inflammatory effects of anti -miR-21 were remarkable, the impact of anti-let-7b on inflammation was milder Moreover, the inhibition of these endogenous miRNAs helped maintain intestinal barrier integrity and reduced the passage of potentially harmful substances. In terms of the microbiota, anti-miRNA treatment caused a shift in the overall composition of the microbiota, being more drastic for those mice treated with anti-let-7b, preventing the development of dysbiosis. Although the protective effects appear to be specific, it is important to bear in mind that a single miRNA can potentially target and modulate the expression of multiple transcripts Therefore, the regulatory role of miR-21 and let-7b on inflammation might result from the regulation of a combination of several genes. Little is known about the specific inhibition of either let-7b or miR-21 in vivo. To our knowledge, our study provides the very first evidence of the in vivo therapeutic potential inhibiting let-7b and miR-21 in the context of colitis. Ding et al. reported the use of ASO against miR-21 in a xenograft model of colorectal carcinoma that effectively inhibited tumor growth and metastasis⁶¹. However, the different administration method makes comparisons with our study inequitable. Interestingly, clinical studies are being carried out with anti -miR-21 (RG- 012) for the management of Alport syndrome, a rear kidney disease that courses with eye abnormalities and hearing loss⁶². Further work deciphering its anti-inflammatory potential during colitis and its role in modifying human microbiota is required.

Altogether, this study provides evidence of the functional significance of fecal miRNAs in microbiota-host communication and suggests their potential role, multi-faceted, in dysbiosis- related conditions and intestinal inflammation, a new concept that appears particularly relevant in IBD¹⁴. Innovative studies like the present may offer new insights into its pathogenesis and new therapeutic strategies.

REFERENCES:

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

1 Xavier, R. J. & Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature 448, 427-434 (2007). https://doi.org: 10.1038/nature06005

2 Qin, J. et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 464, 59-65 (2010). https://doi.org: 10.1038/nature08821

3 Kang, S. S. et al. An antibiotic-responsive mouse model of fulminant ulcerative colitis. PLoS Med 5, e41 (2008). https://doi.org: 10.1371/joumal.pmed.0050041

4 Nagao-Kitamoto, H. et al. Functional Characterization of Inflammatory Bowel Disease- Associated Gut Dysbiosis in Gnotobiotic Mice. Cell Mol Gastroenterol Hepatol 2, 468-481 (2016). https://doi.org: 10.1016/j.jcmgh.2016.02.003

5 Yau, T. O , Tang, C. M., Harriss, E. K , Dickins, B. & Polytarchou, C. Faecal microRNAs as a non-invasive tool in the diagnosis of colonic adenomas and colorectal cancer: A meta-analysis. Sci Rep 9, 9491 (2019). https://doi.org: 10.1038/s41598-019-45570-9

6 Ji, Y. et al. Faecal microRNA as a biomarker of the activity and prognosis of inflammatory bowel diseases. Biochem Biophys Res Common 503, 2443-2450 (2018). https://doi.org: 10.1016/j.bbrc.2018.06.174 7 Shen, Q. et al. Extracellular vesicle miRNAs promote the intestinal microenvironment by interacting with microbes in colitis. Gut Microbes 14, 2128604 (2022). https://doi.org: 10.1080/19490976.2022.2128604

8 Viennois, E. et al. Serum miRNA signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans. Scientific Reports 7, 2520 (2017). https://doi.org: 10.1038/s41598-017-02782-1

9 Fasseu, M. et al. Identification of restricted subsets of mature microRNA abnormally expressed in inactive colonic mucosa of patients with inflammatory bowel disease. PLoS One 5 (2010). https://doi.org: 10.1371/journal. pone.0013160

10 Iborra, M. et al. Identification of serum and tissue micro-RNA expression profiles in different stages of inflammatory bowel disease. Clin Exp Immunol 173, 250-258 (2013). https://doi.org: 10. I l l 1/cei.12104

11 Schbnauen, K. et al. Circulating and Fecal microRNAs as Biomarkers for Inflammatory Bowel Diseases. Inflamm Bowel Dis 24, 1547-1557 (2018). https://doi.org: 10.1093/ibd/izy046

12 Liu, S. et al. The Host Shapes the Gut Microbiota via Fecal MicroRNA. Cell Host Microbe 19, 32-43 (2016). https://doi.org:10.1016/j.chom.2015.12.005

13 Dalmasso, G. et al. Microbiota modulate host gene expression via microRNAs. PLoS One 6, el9293 (2011). https://doi.org: 10.1371/journal. pone.0019293

14 Casado-Bedmar, M. & Viennois, E. MicroRNA and Gut Microbiota: Tiny but Mighty- Novel Insights into Their Cross-talk in Inflammatory Bowel Disease Pathogenesis and Therapeutics. J Crohns Colitis 16, 992-1005 (2022). https://doi.org: 10.1093/ecco-jcc/jjab223

15 Maudet, C., Mano, M. & Eulalio, A. MicroRNAs in the interaction between host and bacterial pathogens. FEBS Lett 588, 4140-4147 (2014). https://doi.org: 10.1016/j.febslet.2014.08.002

16 Williams, M. R , Stedtfeld, R. D , Tiedje, J. M & Hashsham, S. A. MicroRNAs-Based Inter-Domain Communication between the Host and Members of the Gut Microbiome. Front Microbiol 8, 1896 (2017). https://doi.org: 10.3389/fmicb.2017.01896

17 Rezende, R. M. et al. Gamma-delta T cells modulate the microbiota and fecal microRNAs to maintain mucosal tolerance. Microbiome 11, 32 (2023). https://doi.org: 10.1186/s40168-023-01478-1

18 Viennois, E. et al. Host-derived fecal microRNAs can indicate gut microbiota healthiness and ability to induce inflammation. Theranostics 9, 4542-4557 (2019). https://doi.org: 10.7150/thno.35282 19 Tomkovich, S. et al. Human Colon Mucosal Biofilms and Murine Host Communicate via Altered mRNA and microRNA Expression during Cancer. mSystems 5 (2020). https://doi.org: 10.1128/mSystems.00451-19

20 Kuhn, R., Lohler, J., Rennick, D., Rajewsky, K. & Muller, W. Interleukin- 10-deficient mice develop chronic enterocolitis. Cell 75, 263-274 (1993). https://doi.org: 10.1016/0092- 8674(93)80068-p

21 Lu, X., Yu, Y. & Tan, S. The role of the miR-21-5p-mediated inflammatory pathway in ulcerative colitis. Exp Ther Med 19, 981-989 (2020). https://doi.org: 10.3892/etm.2019.8277

22 Teng, G. G. et al. Let-7b is involved in the inflammation and immune responses associated with Helicobacter pylori infection by targeting Toll-like receptor 4. PLoS One 8, e56709 (2013). https://doi.org: 10.1371/journal.pone.0056709

23 Xu, Y. et al. Crohn's disease-associated AIEC inhibiting intestinal epithelial cell-derived exosomal let-7b expression regulates macrophage polarization to exacerbate intestinal fibrosis. Gut Microbes 15, 2193115 (2023). https://doi.org:10.1080/19490976.2023.2193115

24 Weber, C. R , Nalle, S. C., Tretiakova, M., Rubin, D. T. & Turner, J. R. Claudin-1 and claudin-2 expression is elevated in inflammatory bowel disease and may contribute to early neoplastic transformation. Lab Invest 88, 1110-1120 (2008). https://doi.org: 10.1038/labinvest.2008.78

25 Paone, P. & Cani, P. D. Mucus barrier, mucins and gut microbiota: the expected slimy partners? Gut 69, 2232-2243 (2020). https://doi.org:10.1136/gutjnl-2020-322260

26 Liu, P. T. et al. MicroRNA-21 targets the vitamin D-dependent antimicrobial pathway in leprosy. Nat Med 18, 267-273 (2012). https://doi.org:10.1038/nm.2584

27 Okumura, R. et al. Lypd8 promotes the segregation of flagellated microbiota and colonic epithelia. Nature 532, 117-121 (2016). https://doi.org:10.1038/naturel7406

28 Bergstrom, J. H. et al. Gram-positive bacteria are held at a distance in the colon mucus by the lectin-like protein ZG16. Proc Natl Acad Sci U S A 113, 13833-13838 (2016). https://doi.org: 10.1073/pnas.1611400113

29 Saha, K. et al. Autophagy Increases Occludin Levels to Enhance Intestinal Paracellular

Tight Junction Barrier. bioRxiv, 2022.2004.2011.487876 (2022). https://doi.org: 10.1101/2022.04.11.487876

30 Girardin, S E. et al. Nod2 Is a General Sensor of Peptidoglycan through Muramyl Dipeptide (MDP) Detection*. Journal of Biological Chemistry 278, 8869-8872 (2003). https://doi.org:https://doi.org/10.1074/jbc.C200651200 31 Hisamatsu, T. et al. CARD15/NOD2 functions as an antibacterial factor in human intestinal epithelial cells. Gastroenterology 124, 993-1000 (2003). https://doi.org:https://doi.org/10.1053/gast.2003.50153

32 Zhang, L., Shen, J., Cheng, J. & Fan, X. MicroRNA-21 regulates intestinal epithelial tight junction permeability. Cell Biochem Funct 33, 235-240 (2015). https://doi.org: 10.1002/cbf.3109

33 Auchtung, J. M., Robinson, C. D., Farrell, K. & Britton, R. A. MiniBioReactor Arrays (MBRAs) as a Tool for Studying C. difficile Physiology in the Presence of a Complex Community. Methods Mol Biol 1476, 235-258 (2016). https://doi.org:10.1007/978-l-4939- 6361-4 18

34 Auchtung, J. M., Robinson, C. D. & Britton, R. A. Cultivation of stable, reproducible microbial communities from different fecal donors using minibioreactor arrays (MBRAs). Microbiome 3, 42 (2015). https://doi.org: 10.1186/s40168-015-0106-5

35 Naimi, S., Viennois, E., Gewirtz, A. T. & Chassaing, B. Direct impact of commonly used dietary emulsifiers on human gut microbiota. Microbiome 9, 66 (2021). https://doi.org: 10.1186/s40168-020-00996-6

36 Alam, M. T. et al. Microbial imbalance in inflammatory bowel disease patients at different taxonomic levels. Gut Pathog 12, 1 (2020). https://doi.org:10.1186/sl3099-019-0341 - 6

37 Yan, H., Zhang, X. & Xu, Y. Aberrant expression of miR-21 in patients with inflammatory bowel disease: A protocol for systematic review and meta analysis. Medicine (Baltimore) 99, el9693 (2020). https://doi.org: 10.1097/md.0000000000019693

38 You, C. et al. Expression of miR-21 and miR-138 in colon cancer and its effect on cell proliferation and prognosis. Oncol Lett 17, 2271-2277 (2019). https://doi.org: 10.3892/ol.2018.9864

39 Zhou, R. et al. Identification of microRNA-16-5p and microRNA-21-5p in feces as potential noninvasive biomarkers for inflammatory bowel disease. Aging (Albany NY) 13, 4634-4646 (2021). https://doi.org:10.18632/aging.202428

40 Maite, C. B., Roy, M. & Emilie, V. The Effect of Sex-Specific Differences on IL-10(- /-) Mouse Colitis Phenotype and Microbiota. Int J Mol Sci 24 (2023). https://doi.org: 10.3390/ijms241210364

41 Schaefer, J. S., Montufar-Solis, D , Vigneswaran, N. & Klein, J. R. Selective upregulation of microRNA expression in peripheral blood leukocytes in IL-10-/- mice precedes expression in the colon. J Immunol 187, 5834-5841 (2011). https://doi.org: 10.4049/jimmunol.1100922

42 Shi, C. et al. MicroRNA-21 knockout improve the survival rate in DSS induced fatal colitis through protecting against inflammation and tissue injury. PLoS One 8, e66814 (2013). https://doi.org: 10.1371/joumal.pone.0066814

43 Wu, F. et al. Divergent influence of microRNA-21 deletion on murine colitis phenotypes. Inflamm Bowel Dis 20, 1972-1985 (2014). https://doi.org: 10.1097/mib.0000000000000201

44 Yang, Y. et al. Overexpression of miR-21 in patients with ulcerative colitis impairs intestinal epithelial barrier function through targeting the Rho GTPase RhoB. Biochem Biophys Res Commun 434, 746-752 (2013). https://doi.org:10.1016/j.bbrc.2013.03.122

45 Nakata, K. et al. Commensal microbiota-induced microRNA modulates intestinal epithelial permeability through the small GTPase ARF4. J Biol Chem 292, 15426-15433 (2017). https://doi.org: 10.1074/jbc.Ml 17.788596

46 Johnston, D. G. W. et al. Loss of MicroRNA-21 Influences the Gut Microbiota, Causing Reduced Susceptibility in a Murine Model of Colitis. J Crohns Colitis 12, 835-848 (2018). https://doi.org: 10.1093/ecco-jcc/jjy038

47 Santos, A. A. et al. Host miRNA-21 promotes liver dysfunction by targeting small intestinal Lactobacillus in mice. Gut Microbes 12, 1-18 (2020). https://doi.org: 10.1080/19490976.2020.1840766

48 Fernandez-Ponce, C. et al. MicroRNAs overexpressed in Crohn’s disease and their interactions with mechanisms of epigenetic regulation explain novel aspects of Crohn’s disease pathogenesis. Clinical Epigenetics 13, 39 (2021). https://doi.org: 10.1186/sl3148-021-01022-8

49 Gong, L. et al. Immunomodulatory Effect of Serum Exosomes From Crohn Disease on Macrophages via Let-7b-5p/TLR4 Signaling. Inflammatory Bowel Diseases 28, 96-108 (2021). https://doi.org: 10.1093/ibd/izab 132

50 Zahm, A. M. et al. Circulating microRNA is a biomarker of pediatric Crohn disease. J Pediatr Gastroenterol Nutr 53, 26-33 (2011). https://doi.org:10.1097/MPG.0b013e31822200cc

51 Guo, Z et al. Mucosal MicroRNAs Expression Profiles before and after Exclusive Enteral Nutrition Therapy in Adult Patients with Crohn’s Disease. Nutrients 8, 519 (2016).

52 Aguilar, C., Mano, M. & Eulalio, A. Multifaceted Roles of microRNAs in Host-

Bacterial Pathogen Interaction. Microbiol Spectr 7 (2019). https://doi.org: 10.1128/microbiolspec.BAI-0002-2019

53 Letafati, A. et al. MicroRNA let-7 and viral infections: focus on mechanisms of action. Cell Mol Biol Lett 27, 14 (2022). https://doi.org: 10.1186/sl 1658-022-00317-9 54 Ren, Z. & Ambros, V. R. Caenorhabditis elegans microRNAs of the let-7 family act in innate immune response circuits and confer robust developmental timing against pathogen stress. Proc Natl Acad Sci U S A 112, E2366-2375 (2015). https://doi.org: 10.1073/pnas.1422858112

55 Tomkovich, S. et al. Human Colon Mucosal Biofilms and Murine Host Communicate via Altered mRNA and microRNA Expression during Cancer. mSystems 5, 10.1128/msystems.00451-00419 (2020). https://doi.org:doi: 10.1128/msystems.00451-19

56 Koeppen, K. et al. Let-7b-5p in vesicles secreted by human airway cells reduces biofilm formation and increases antibiotic sensitivity of <i>P. aeruginosa</i>. Proceedings of the National Academy of Sciences 118, e2105370118 (2021). https://doi.org:doi: 10.1073/pnas.2105370118

57 Teng, Y. et al. Plant-Derived Exosomal MicroRNAs Shape the Gut Microbiota. Cell

Host & Microbe 24, 637-652.e638 (2018). https://doi.org:https://doi.org/10.1016/j.chom.2018.10.001

58 Sauvaitre, T. et al. Role of mucus-bacteria interactions in Enterotoxigenic Escherichia coli (ETEC) Hl 0407 virulence and interplay with human microbiome. NPJ Biofilms Microbiomes 8, 86 (2022). https://doi.org:10.1038/s41522-022-00344-6

59 Lima, J. F., Cerqueira, L., Figueiredo, C., Oliveira, C. & Azevedo, N. F. Anti-miRNA oligonucleotides: A comprehensive guide for design. RNA Biol 15, 338-352 (2018). https://doi.org: 10.1080/15476286.2018.1445959

60 Zhu, F. et al. miR-155 antagomir protect against DSS-induced colitis in mice through regulating Thl7/Treg cell balance by Jarid2/Wnt/p-catenin. Biomed Pharmacother 126, 109909 (2020). https ://doi. org: 10.1016/j .biopha.2020.109909

61 Ding, T. et al. Antisense Oligonucleotides against miR-21 Inhibit the Growth and Metastasis of Colorectal Carcinoma via the DUSP8 Pathway. Mol Ther Nucleic Acids 13, 244- 255 (2018). https://doi.org:10.1016/j.omtn.2018.09.004

62 Rubel, D. et al. Anti-microRNA-21 Therapy on Top of ACE Inhibition Delays Renal

Failure in Alport Syndrome Mouse Models. Cells 11 (2022). https://doi.org: 10.3390/cellsl 1040594

63 Snoussi, C. et al. Green tea decoction improves glucose tolerance and reduces weight gain of rats fed normal and high-fat diet. J Nutr Biochem 25, 557-564 (2014). https://doi.org: 10.1016/j .jnutbio.2014.01.006 64 Keita, A. V. et al. Characterization of antigen and bacterial transport in the follicle- associated epithelium of human ileum. Lab Invest 86, 504-516 (2006). https://doi.org: 10.1038/labinvest.3700397

65 Ganda Mall, J. P. et al. A P-Glucan-Based Dietary Fiber Reduces Mast Cell-Induced Hyperpermeability in Ileum From Patients With Crohn's Disease and Control Subjects.

Inflamm Bowel Dis 24, 166-178 (2017). https://doi.org: 10.1093/ibd/izx002

66 Singh, V. et al. Dysregulated Microbial Fermentation of Soluble Fiber Induces

Cholestatic Liver Cancer. Cell 175, 679-694. e622 (2018). https://doi.org: 10.1016/j. cell.2018.09.004 67 Viennois, E. et al. Micheliolide, a new sesquiterpene lactone that inhibits intestinal inflammation and colitis-associated cancer. Lab Invest 94, 950-965 (2014). https://doi. org: 10.1038/labinvest.2014.89

68 Johansson, M. E. & Hansson, G. C. Preservation of mucus in histological sections, immunostaining of mucins in fixed tissue, and localization of bacteria with FISH. Methods Mol Biol 842, 229-235 (2012). https://doi.org: 10.1007/978-l-61779-513-8_13

Claims

CLAIMS:

1. A method of treating an inflammatory bowel disease (IBD) in a patient in need thereof comprising administering to the patient a therapeutically effective amount of at least one miRNA inhibitor selected from the group consisting of let-7b inhibitors and miR- 21 inhibitors.

2. The method of claim 1 wherein the patient suffers from ulcerative colitis or Crohn’s disease.

3. The method according to claim 1 or 2 wherein the miRNA inhibitor is a compound such as nucleic acid that hybridizes with let-7b or miR-21 or having sequence complementarity to that of let-7b or miR-21.

4. The method according to claim 1 or 2 wherein the miRNA inhibitor is selected from the group consisting of double-stranded RNAs (such as short- or small-interfering RNA or "siRNA"), antagomirs, antisense nucleic acids, and enzymatic RNA molecules such as ribozymes.

5. The method according to claim 1 or 2 wherein the miRNA inhibitor is an antisense oligonucleotide.

6. The method according to claim 1 or 2 wherein the miRNA inhibitor is an antagomir.

7. The method according to any one of claims 1 to 6 that includes the local administration to the bowel (i.e. intestine or colon) of the miRNA inhibitor

8. The method according to claim 7 wherein the miRNA inhibitor is orally administered to the patient.

9. The method according to claim 7 wherein the miRNA inhibitor is rectally administered to the patient.

10. The method according to any one of claims 1 to 9 wherein the miRNA inhibitor is administered to the patient in combination with one or more immunosuppressive drugs.

11. The method according to claim 10 wherein the immunosuppressive drug is corticosteroid.

12. The method of claim 10 wherein the immunosuppressive drug in an anti-TNF drug.

13. The method of claim 10 wherein the immunosuppressive drug is cyclosporine.