EP4739780A1 - Engineered aav capsid proteins - Google Patents
Engineered aav capsid proteinsInfo
- Publication number
- EP4739780A1 EP4739780A1 EP24739463.8A EP24739463A EP4739780A1 EP 4739780 A1 EP4739780 A1 EP 4739780A1 EP 24739463 A EP24739463 A EP 24739463A EP 4739780 A1 EP4739780 A1 EP 4739780A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- antibody fragment
- capsid protein
- aav
- engineered
- amino acids
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2318/00—Antibody mimetics or scaffolds
- C07K2318/20—Antigen-binding scaffold molecules wherein the scaffold is not an immunoglobulin variable region or antibody mimetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present disclosure relates to an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR-H3, or a portion thereof. The present disclosure also relates to an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of an ultralong CDR-H3, or a portion thereof. The disclosure further relates to a capsid comprising an engineered capsid protein, and to recombinant AAVs comprising said engineered capsid protein or capsid, and their use in therapy. The present disclosure also extends to methods of preparing said engineered capsid proteins, capsids and AAVs.
Description
ENGINEERED AAV CAPSID PROTEINS
Field of the Invention
The present disclosure relates to an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR-H3, or a portion thereof. The present disclosure also relates to an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of an ultralong CDR-H3, or a portion thereof. The disclosure further relates to a capsid comprising an engineered capsid protein, and to recombinant AAVs comprising said engineered capsid protein or capsid, and their use in therapy. The present disclosure also extends to methods of preparing said engineered capsid proteins, capsids and AAVs.
Background
Viral vector-mediated gene delivery has shown great promise for gene therapy applications, including approved treatments for inherited blindness, spinal muscular atrophy, and rare diseases. Among the viral vectors that are suitable for use in gene therapy, adeno-associated virus (AAV) has a number of advantageous features for clinical applications as compared to other gene therapy vectors such as adenovirus or lentivirus. AAV is non-pathogenic and is smaller in size than lentivirus, resulting in higher diffusion rates in tissues and greater potential for transducing large areas of tissue upon local injection. In addition, the AAV genome has minimal requirements for replication and packaging, enabling much of AAV to be replaced by a gene of interest and its regulatory elements. Genes delivered by AAV do not integrate into the host chromosome, which mitigates risk of undesired effects, and the genes nonetheless remain stable over long periods in host cells (Li & Samulski, Nature Reviews Genetics 21 (4): 255-272 (2020)). Finally, many naturally-occurring AAVs and AAV serotypes have been identified in nature, which may differ in their tissue tropism and in their transduction efficiency (Srivastava, Current Opinion in Virology 21 : 75-80 (2016)). This variety is an advantage in gene therapy, as certain AAVs may be preferred to transduce specific cells or tissues.
The advantage of diversity has been further exploited by protein engineering to create artificial AAVs. The identity of the AAV is determined by the sequences of proteins that make up the protein shell, or capsid, of AAV. Among different variants, most sequence diversity is found in variable or hypervariable regions (VRs or HVRs) of the capsid proteins. By modifying amino
acids in the variable regions or in other parts of the capsid proteins, it has been shown that it was possible to create AAVs with new or improved properties, such as improved transduction efficiency or altered tissue tropism. One approach to capsid engineering is a random mutagenesis, in which entirely new capsids with random mutations are created and screened for desired properties. In another approach, targeted changes are made to a capsid by substituting amino acid residues from the capsid of a first AAV serotype with corresponding residues from the capsid of a second AAV serotype and/or modifying specific amino acid residues in areas of the capsid that interact with binding partners on target cells.
Alternative approaches also include engineering a capsid by inserting heterologous binding moieties, such as peptides, for example to try to enhance recognition of a binding partner on a target cell, thereby improving the ability of AAV to bind and transduce said target cell. For example, in one study, a 14-mer peptide (LI 4) derived from the laminin fragment Pl was inserted into the common VP3 region of AAV2, as L14 is a target of several cellular integrin receptors and can serve as a viral receptor (Girod et al., Nature Medicine 5: 1052-1056 (1999)). In other studies, insertions of peptides into capsid proteins increased infectivity of rAAVs for retinal cells (e.g. US Patent Application No. US2020121746), cardiac tissues (e.g. PCT Publication No. WO20205889 Al), hepatic tissues (e.g. PCT Publication No. WO2020193799), muscle cells (e.g. PCT Publication No. WO19207132 Al), and GPL anchored blood-brain barrier ligands (e.g. US Patent Application No. US2020325456). Peptides have also been inserted into capsid proteins to facilitate evasion of neutralizing antibodies (e.g. US Patent No. US10745447).
In another example, a designed ankyrin repeat protein (DARPin), specific for the target HER2///CZ/, a receptor tyrosine kinase overexpressed on human cancer cells, was inserted into the N-terminus of VP2 capsid proteins in AAV2, and the resulting rAAV showed increased transduction efficiency of cells expressing Her2, as well as targeting of Her2-expressing tumors (Munch et al., Mol Therapy 21 (1): 109-118 (2013)). In another example, VHH antibodies selective for cell surface markers (CD38, ARTC2.2, or CD38) were inserted into a VP1 capsid protein to confer binding and transduce cells expressing the cell-specific markers with high selectivity (e.g. US Patent Application No. US20210139563).
Nevertheless, while linear peptides are small, the extent of their binding and interaction with targets may be limited by their structure and properties. DARPins are small and can be engineered to bind targets with high affinity, but a disadvantage of DARPins is their concave
binding surface, rigidity, and incomplete randomization of amino acid residues in variable sites. These features limit the range of possible binding targets and require the use of additional engineering to compensate (Shilova & Deyev, Acta Naturae 11 (4): 42-53 (2019)).
Also, antibodies and antibody fragments may be relatively large (e.g., a Fab fragment may be around 50 kDa, while a VHH antibody may be around 15 kDa), and their structures and functions may be constrained by requirements for folding and post-translational modifications. The distance between the N- and C- termini in antibody molecules indicates that these molecules would be severely constrained if assembled within an AAV capsid. As an example, the distance between the N- and C- termini can be greater than 30 A in some antibody fragments (e.g., about 37 A in a scFv fragment and about 47 A in a VHH fragment), while the AAV capsid is only about 250 A in diameter. Finally, an early study indicated that manufacturing of AAV was adversely affected when a single chain antibody was inserted into the N- terminus of VP2 (Yang et al., Human Gene Therapy 9 (13) (2008)).
Therefore, there remains a need for new AAV capsid proteins, notably useful in therapy, having improved properties, for example, improved binding, cell and/or tissue specificity, transduction, and/or improved capsid assembly or manufacturability, while retaining a low immunogenicity.
Summary of Invention
The present inventors show for the first time that a AAV capsid protein may be engineered successfully that comprise a bovine ultralong CDR-H3 or a portion thereof, or a knob domain or portion thereof, conferring new binding properties to a capsid comprising said engineered capsid protein.
Surprisingly, the inventors demonstrate that an antibody fragment that comprises a bovine ultralong CDR-H3 or a portion thereof, or a knob domain of a bovine ultralong CDR-H3 or portion thereof may be inserted within a capsid protein, without disrupting either the folding of the antibody fragment, or the capsid assembly and virus production. This was particularly surprising as the knob domain is a disulphide-rich domain, with complex folding properties in particular in the reducing environment inside a cell.
In addition, the antibody fragment retains binding and specificity to its target, conferring new binding properties to the AAV capsids.
Advantageously, knob domains are small, highly specific and may be raised against a high diversity of antigens, and their ability to be incorporated into an AAV capsid and confer new binding properties to capsids provide engineered capsids and AAVs that may be useful in multiple applications, notably in therapeutic applications.
Thus, in one aspect, there is provided an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR-H3, or a portion thereof. There is also provided an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of an ultralong CDR-H3, or a portion thereof. In some embodiments, the antibody fragment does not comprise a stalk of an ultralong CDR-H3. In some embodiments, the antibody fragment binds an antigen.
In some embodiments, the antibody fragment is 5 amino acids in length or more, 10 amino acids in length or more, 15 amino acids in length or more, 20 amino acids in length or more, 25 amino acids in length or more, 30 amino acids in length or more, 35 amino acids in length or more, 40 amino acids in length or more, 45 amino acids in length or more, 50 amino acids in length or more, 55 amino acids in length or more, or 60 amino acids in length or more. In some embodiments, the antibody fragment is up to 69 amino acids in length. In some embodiments the antibody fragment is between 5 and 55, or between 15 and 50, or between 20 and 45 or between 25 and 40 amino acids in length.
In some embodiments, the antibody fragment comprises a (Zi) Xi C X2 motif at its N-terminal extremity, wherein:
Zi is present or absent, and when Zi is present, Zi represents 1 amino acid or 2, 3, 4, or 5 independently selected amino acids;
Xi is any amino acid residue, preferably selected from the list consisting of Serine, Threonine, Asparagine, Alanine, Glycine, Proline, Histidine, Lysine, Valine, Arginine, Isoleucine, Leucine, Phenylalanine and Aspartic acid; and,
C is cysteine; and,
X2 is an amino acid selected from the list consisting of Proline, Arginine, Histidine, Lysine, Glycine and Serine.
In some embodiments, the antibody fragment comprises a sequence which is a variant of a naturally occurring sequence. In some embodiments, the antibody fragment further comprises at least one bridging moiety between two amino acids, optionally wherein the bridging moiety is a disulphide bond. In some embodiments, the antibody fragment is fully bovine. In alternative embodiments, the antibody fragment is chimeric.
In some embodiments, the AAV capsid protein comprises a naturally occurring, or a variant or an artificial AAV sequence or a combination thereof. In some embodiments, the AAV capsid protein comprises a sequence of an AAV selected from the group consisting of AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof.
In some embodiments, the antibody fragment is inserted within the AAV capsid protein, optionally via a linker. In some embodiments, the antibody fragment is inserted within the AAV capsid protein via one linker, wherein optionally the linker is genetically fused to the antibody fragment, optionally at its C-terminal end. In alternative embodiments, the antibody fragment is inserted within the AAV capsid protein, via at least two linkers. In some embodiments, at least one linker is fused, optionally genetically, to the N-terminal of the antibody fragment, and at least one linker is fused, optionally genetically, to the C-terminal end of the antibody fragment. In some embodiments, the AAV capsid protein is a VP1, a VP2, or VP3.
In some embodiments, the antibody fragment is inserted within the common VP3 region of the AAV capsid protein, optionally, within the GH loop of the common VP3 region. In some embodiments, the antibody fragment is inserted within the variable region VR-IV of the AAV capsid protein. In some embodiments, the antibody fragment is inserted within the AAV capsid protein after amino acid residue Gly455 of AAV9 with reference to SEQ ID NO: 40 (or a corresponding amino acid residue of another AAV). In some embodiments, the antibody fragment is inserted within the variable region VR-V of the AAV capsid protein. In some embodiments, the antibody fragment is inserted within the AAV capsid protein after amino acid residue Asn498 of AAV9 with reference to SEQ ID NO:40, or a corresponding amino acid residue of another AAV. In some embodiments, the antibody fragment is inserted within the variable region VR-VIII of the AAV capsid protein. In some embodiments, the antibody fragment is inserted within the AAV capsid protein after amino acid residue Gln588 of AAV9 with reference to SEQ ID NO:40, or a corresponding amino acid residue of another AAV. In
some embodiments, the AAV capsid protein is VP1 or VP2 and the antibody fragment is inserted within the VP1/VP2 common region of the capsid protein. In some embodiments, the antibody fragment is inserted within the N-terminus of the VP2 capsid protein. In some embodiments, the antibody fragment is inserted within the N-terminus of the VP2 capsid protein of AAV9 before amino acid residue Thrl with reference to SEQ ID NO:41, or a corresponding amino acid in another AAV.
In another aspect, there is provided an AAV capsid comprising an engineered capsid protein according to the invention. In some embodiments, there is provided an AAV capsid comprising two engineered capsid proteins according to the invention, wherein the first and second engineered capsid proteins are respectively VP1 and VP2, or VP1 and VP3, or VP2 and VP3. In some embodiments, there is provided an AAV capsid comprising three engineered capsid proteins according to the invention, wherein the first, second and third engineered capsid proteins are respectively VP1, VP2 and VP3.
In another aspect, there is provided a nucleic acid encoding an engineered capsid protein or a capsid according to the invention. In another aspect, there is provided a vector comprising said nucleic acid.
In another aspect, there is provided a recombinant adeno-associated virus (rAAV) particle comprising the engineered capsid protein or capsid or nucleic acid or vector according to the invention, and a transgene. In some embodiments, the transgene encodes a peptide, a polypeptide or a nucleic acid molecule, optionally wherein the nucleic acid molecule is a small interfering RNA (siRNA), small or short hairpin RNA (shRNA), microRNA (miRNA).
In another aspect, there is provided a host cell comprising said nucleic acid or said vector and/or which produces a rAAV particle comprising the engineered capsid protein or capsid according to the invention, and a transgene.
In another aspect, there is provided a method for producing an AAV particle comprising an engineered capsid protein according to the invention, and a transgene, said method comprising: a) providing a first vector comprising a first nucleotide sequence encoding an AAV capsid protein, and a second nucleotide sequence encoding the antibody fragment; wherein the first nucleotide sequence and the second nucleotide sequence are genetically fused optionally via a nucleotide sequence coding for a linker; b) providing a second vector comprising the transgene, c) providing a third, Helper vector, d) transfecting a host cell with the first, second and third vector; and e) recovering the AAV from the host cell.
In another aspect, there is provided a vector or an AAV particle according to the invention, for use as a medicament.
Detailed Description of the Invention
As used in this disclosure, the singular forms “a”, “an”, and “the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to “a nucleic acid” includes “nucleic acids”, and the like.
The term “comprises” (comprise, comprising) should be understood to have its normal meaning in the art, i.e. that the stated feature or group of features is included, but that the term does not exclude any other stated feature or group of features from also being present. The term “consists of’ should also be understood to have its normal meaning in the art, i.e. that the stated feature or group of features is included, to the exclusion of further features. For every embodiment in which “comprises” or “comprising” is used, we anticipate a further embodiment in which “consists of’ or “consisting of’ is used. Thus, every disclosure of “comprises” should be considered to be a disclosure of “consists of’.
Antibody fragments
In one aspect, the present disclosure provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR-H3, or a portion thereof. In some embodiments, the present disclosure provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of a bovine ultralong CDR-H3, or a portion thereof.
Antibody fragments for use in the context of the present disclosure encompass whole bovine ultralong CDR-H3 and any portion thereof, preferably any functionally active portion thereof (e.g. which binds to a target or an antigen of interest). Therefore, in some embodiments, the present disclosure provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR- H3, or a portion thereof which bind an antigen. In some embodiments, the present disclosure provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of a bovine ultralong CDR- H3, or a portion thereof which bind an antigen.
Whole antibodies also known as “immunoglobulins (Ig)” generally relate to intact or full- length antibodies i.e. comprising the elements of two heavy chains and two light chains, interconnected by disulphide bonds, which assemble to define a characteristic Y-shaped three- dimensional structure. Classical natural whole antibodies are monospecific in that they bind one antigen type, and bivalent in that they have two independent antigen binding domains. The terms “intact antibody”, “full-length antibody” and “whole antibody” are used interchangeably to refer to a monospecific bivalent antibody having a structure similar to a native antibody structure, including an Fc region as defined herein.
Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region (CL). Each heavy chain is comprised of a heavy variable region (abbreviated herein as VH) and a heavy chain constant region (CH) constituted of three constant domains Cm, Cm and CH3, or four constant domains Cm, Cm, CH3 and CH4, depending on the Ig class. The “class” of an Ig or antibody refers to the type of constant region and includes IgA, IgD, IgE, IgG and IgM and several of them can be further divided into subclasses, e.g. IgGl, IgG2, IgG3, IgG4. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
The term “constant domain(s)”, “constant region”, as used herein are used interchangeably to refer to the domain(s) of an antibody which is outside the variable regions. The constant domains are identical in all antibodies of the same isotype but are different from one isotype to another. Typically, the constant region of a heavy chain is formed, from N to C terminal, by CHI -hinge -CH2-CH3-optionnaly CH4, comprising three or four constant domains.
“Fc”, “Fc fragment”, “Fc region” are used interchangeably to refer to the C-terminal region of an antibody comprising the constant region of an antibody excluding the first constant region domain. Thus, Fc refers to the last two constant domains, Cm and CH3, of IgA, IgD, and IgG, or the last three constant domains of IgE and IgM, and the flexible hinge N-terminal to these domains.
The VH and VL regions of a whole antibody can be further subdivided into regions of hypervariability (or “hypervariable regions”) determining the recognition of the antigen, termed complementarity determining regions (CDR), interspersed with regions that are more
structurally conserved, termed framework regions (FR). Each VH and Vris composed of three CDRs and four FRs, arranged from amino-terminus to carboxy -terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The CDRs and the FR together form a variable region. By convention, the CDRs in the heavy chain variable region of an antibody or antigenbinding fragment thereof are referred as CDR-H1, CDR-H2 and CDR-H3 and in the light chain variable region as CDR-L1, CDR-L2 and CDR-L3. They are numbered sequentially in the direction from the N-terminus to the C-terminus of each chain.
CDRs are conventionally numbered according to a system devised by Kabat et al. This system is set forth in Kabat et al., 1991, in Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NTH, USA (hereafter “Kabat et al. (supra)”). This numbering system is used in the present specification except where otherwise indicated. The Kabat residue designations do not always correspond directly with the linear numbering of the amino acid residues. The actual linear amino acid sequence may contain fewer or additional amino acids than in the strict Kabat numbering corresponding to a shortening of, or insertion into, a structural component, whether framework or complementarity determining region (CDR), of the basic variable domain structure. The correct Kabat numbering of residues may be determined for a given antibody by alignment of residues of homology in the sequence of the antibody with a “standard” Kabat numbered sequence.
The CDRs of the heavy chain variable domain are located at residues 31-35 (CDR-H1), residues 50-65 (CDR-H2) and residues 93-102 (CDR-H3) according to the Kabat numbering system. However, according to Chothia (Chothia, C. and Lesk, A.M. J. Mol. Biol., 196, 901- 917 (1987)), the loop equivalent to CDR-H1 extends from residue 26 to residue 32. Thus, unless indicated otherwise ‘CDR-H1’ as employed herein is intended to refer to residues 26 to 35, as described by a combination of the Kabat numbering system and Chothia’ s topological loop definition. The CDRs of the light chain variable domain are located at residues 24-34 (CDR-L1), residues 50-56 (CDR-L2) and residues 89-97 (CDR-L3) according to the Kabat numbering system. Based on the alignment of sequences of different members of the immunoglobulin family, numbering schemes have been proposed and are for example described in Kabat et al., 1991, and Dondelinger et al., Frontiers in Immunology, Vol 9, article 2278 (2018).
Different species exhibit a diversity of CDR-H3 lengths. Some bovine antibodies have been characterized by unusually long CDR-H3 (so called “bovine ultralong CDR-H3”) with lengths
of up to 69 residues, representing 1-15 % of the bovine repertoire, whereas more conventional bovine antibodies have CDR-H3 of around 23 residues. Camelid single chain antibodies have up to 24 residues and shark IgNAR antibodies have up to 27 residues. The CDR-H3 are too long to be accommodated by any of these numbering schemes, but alternative systems have been used, as the one discussed in Stanfield et al. (Stanfield, R. L., Wilson, I. A. & Smider, V. V. Conservation and diversity in the ultralong third heavy-chain complementarity-determining region of bovine antibodies. Sci Immunol 1, (2016) (hereinafter “Stanfield et al. (supra)”)).
“Bovine CDR-H3” as used herein encompasses all CDR-H3 found in bovines, including bovine regular CDR-H3 and bovine ultralong CDR-H3.
The term “Bovine ultralong CDR-H3” refers to the subset of CDR-H3 which has the features of characterized ultralong CDR-H3 as defined hereinafter, notably comprising a duplication of the IGHVI-7 gene segment. The ultralong CDR-H3 has been found in bovine IgG of all classes.
Bovine ultralong CDR-H3 have been characterized by a very unusual tridimensional structure comprising a “stalk domain” and a “knob domain”. The stalk domain is composed of two antiparallel P strands (each strand generally corresponding to about 12 residues). The knob domain is a disulfide rich domain which comprises a loop motif and sits atop of the stalk, which serves as a bridge to link the knob domain with the main bovine antibody scaffold. The CDR- H3 is derived from DNA rearrangement of variable (V), diversity (D), and joining (J) gene segments. The ultralong CDR-H3 are encoded by the VHBUL (Bovine Ultra Long), DH2, and JHI gene segments, and their length is due to an unusually long DH2 segment. Ultralong CDR- H3 have been characterized by a duplication of the IGHVI-7 gene segment.
The “stalk domain” of bovine ultralong CDR-H3 has been characterised by its structure notably. The skilled person will appreciate that the definition of a “stalk domain” may rely on crystal structure analysis and/or sequencing information, notably as he will understand that the stalk domain position and structure may vary slightly from one ultralong CDR-H3 to another, e.g. in terms of size. The term “stalk domain” will be generally appreciated by the skilled person to correspond to the antiparallel P strands that bridge the knob domain with the main bovine antibody scaffold. The length of the stalk p strands can differ, notably from long p strands (12 or more residues) to shorter P strands.
The skilled person will appreciate that the definition of a knob domain may rely on crystal structure analysis and/or sequencing information, notably as he will understand that the knob
domain position and structure may vary slightly from one ultralong CDR-H3 to another, e.g. in terms of size, cysteine content, disulphide bond content. In particular, the sequence of ultralong CDR-H3 can be determined by well-known sequencing methods, and the skilled person will be able to identify the minimal sequence which define a knob domain, based for example on a comparative analysis, with well characterised ultralong CDR-H3 as well as stalk and knob domains thereof, e.g. by alignment with well-known and/or standard nucleic and/or amino acid sequences, and/or based on crystal structure analysis.
As mentioned above, the ultralong CDR-H3 are too long to be accommodated by any of existing numbering scheme, but alternative systems have been used, as the one discussed in Stanfield et al. (supra). Structural analysis has also been provided for example by Wang et al. (Wang, F. et al. Reshaping antibody diversity. Cell 153, 1379-1393 (2013)).
The conserved Cysteine at position 92(Kabat) and the conserved Tryptophan at position 103(Kabat) respectively defines the start and the end of the CDR-H3. The germline encoded VHBUL DH2 JHI has the following sequence:
CTTVHQSCPDGYSYGYGCGYGYGCSGYDCYGYGGYGGYGGYGYSSYSYSYTYEYYVDA WGQGLLVTVSS
(VHBUL; followed by DH2 gene region in bold; followed by JHI gene region underlined; The sequence coding the CDR-H3 is in italic, between positions 92 and 103 according to Kabat)
Kabat numbering system may be used for heavy-chain residues 1 to 100 and 101 to 228 but residues between 100 and 101 (corresponding to residues encoded by DH2 and JHI genes) do not accommodate to the Kabat numbering system and may be numbered differently, for example sequentially with a D identifier, as described in Stanfield et al. (supra), with the conserved Cysteine residue at the start of DH2 being “D2”, followed by D3, D4 etc. . .).
Following Cys H92, the common motif TTVHQ (positions 93-97 in the germline VHBUL, according to Kabat) starts the ascending strand of the P-stalk region of the CDR-H3. The length between the end of the VHBUL and the “CPD” conserved motif in DH2 is variable due to differences in junctional diversity formed through V-D recombination. In Stanfield, those junctional residues are referred as “a,b,c” following Hl 00 residue, depending on the length.
The DH2 region has been characterised to encode the knob domain and part of the descending strand of the stalk region. DH2 begins with a conserved Cysteine which is part of a conserved “CPD” motif in the germline sequence, which characterises the beginning of the knob domain.
The knob domain terminates at the beginning of the descending strand of the P-stalk region. The descending strand of the P-stalk region has been characterised by alternating aromaticaliphatic residues in some ultralong CDR-H3. The descending strand of the P-stalk region ends with the residues encoded by the genetic J region, followed by residue Hl 01, Hl 02 according to Kabat.
In the context of the present disclosure, the minimal sequence that may define a knob domain corresponds to the portion of the ultralong CDR-H3 encapsulated by disulphide bonds, more particularly the minimal knob domain sequence starts from the first cysteine residue of an ultralong CDR-H3 and ends with the last cysteine residue of the ultralong CDR-H3. Therefore, a minimal knob domain typically comprises at least two cysteines. In one embodiment, the knob domain sequence starts from one residue preceding the first cysteine residue of an ultralong CDR-H3 and ends after the residue subsequent to the last cysteine residue of the ultralong CDR-H3. Additional amino acids may be present in the N-terminal extremity and/or in the C-terminal extremity of the knob domain sequence, preferably up to 5 additional amino acids may be present in the N-terminal and/or in the C-terminal extremity.
In one aspect, there is provided an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of an ultralong CDR-H3, or a portion thereof. In one embodiment, the antibody fragment consists of the knob domain of a bovine ultralong CDR-H3, i.e. is a full-length knob domain, notably comprised between the ascending stalk and the descending stalk of the ultralong CDR-H3. In one embodiment, the antibody fragment comprises or consists of a portion of the knob domain of a bovine ultralong CDR-H3. In some embodiments, the antibody fragment binds to an antigen.
In some embodiments, the antibody fragment does not comprise a stalk of an ultralong CDR- H3, notably of a bovine ultralong CDR-H3. In some embodiments, the engineered capsid protein comprising an AAV capsid protein and an antibody fragment does not comprise a stalk of an ultralong CDR-H3 notably of a bovine ultralong CDR-H3.
In one embodiment, the antibody fragment comprises at least two, or at least four, or at least six, or at least eight, or at least ten cysteine residues. In one embodiment, the antibody fragment comprises two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen or fourteen cysteine residues. In one embodiment, the antibody fragment comprises between two cysteine
residues and ten cysteine residues. In one embodiment, the antibody fragment comprises between four cysteine residues and eight cysteine residues.
Two cysteine residues may bridge together to form a disulphide bond within the antibody fragment, for example within the knob domain.
In one embodiment, the antibody fragment comprises at least one, or at least two, or at least three, or at least four, or a at least five disulphide bonds. In one embodiment, the antibody fragment comprises one, two, three, four, five, six, or seven disulphide bonds. In one embodiment, the antibody fragment comprises between one disulphide bond and five disulphide bonds. In one embodiment, the antibody fragment comprises between two disulphide bonds and four disulphide bonds.
It will be appreciated that an increased content in cysteine residues will increase the possibility to form disulphide bonds within the antibody fragment. Such disulphide bonds contribute to form a loop motif within the antibody fragment, which may be advantageous to increase the stability, and/or rigidity and/or binding specificity and/or binding affinity of the antibody fragment for a target or antigen of interest.
In one embodiment, the antibody fragment is 5 amino acids in length or more, 10 amino acids in length or more, 15 amino acids in length or more, 20 amino acids in length or more, 25 amino acids in length or more, 30 amino acids in length or more, 35 amino acids in length or more, 40 amino acids in length or more, 45 amino acids in length or more. In one embodiment, the antibody fragment is up to 50 amino acids in length or up to 55 amino acids in length. In one embodiment, the antibody fragment is 5 amino acids in length or more, 10 amino acids in length or more, 15 amino acids in length or more, 20 amino acids in length or more, 25 amino acids in length or more, 30 amino acids in length or more, 35 amino acids in length or more, 40 amino acids in length or more, 45 amino acids in length or more, and is up to 55 amino acids in length. In one embodiment, the antibody fragment is a portion of a bovine ultralong CDR- H3 which is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52,
53, 54, or 55 amino acids in length. In one embodiment, the antibody fragment is a portion of a knob domain of a bovine ultralong CDR-H3 which is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 amino acids in length. In one embodiment, the antibody fragment is between 5 and 55, or between 15 and 50, or between 20
and 45, or between 25 and 40 amino acids in length. In one embodiment, the antibody fragment is a knob domain of a bovine ultralong CDR-H3 which is between 5 and 55, or between 15 and 50, or between 20 and 45, or between 25 and 40 amino acids in length.
In one embodiment, the antibody fragment comprises a (Zi) Xi C X2 motif at its N-terminal extremity, wherein: a. Zi is present or absent, and when Zi is present, Zi represents 1 amino acid or
2, 3, 4, or 5 independently selected amino acids; and, b. Xi is any amino acid residue; and, c. C is cysteine; and, d. X2 is an amino acid selected from the list consisting of Proline, Arginine, Histidine, Lysine, Glycine and Serine.
In one embodiment, the antibody fragment comprises a knob domain or any portion thereof which comprises a (Zi) Xi C X2 motif at its N-terminal extremity, as defined above. Zi as defined in the present invention represents any amino acid or any sequence of 2, 3, 4, or 5 independently selected amino acids that may be the same or different. In one embodiment, Zi is 1 amino acid. In another embodiment, Zi is 2 amino acids, which may be the same or different. In another embodiment, Zi is 3 amino acids, which may be the same or different. In another embodiment, Zi is 4 amino acids, which may be the same or different. In another embodiment, Zi is 5 amino acids, which may be the same or different.
In one embodiment, Xi is selected from the list consisting of Serine, Threonine, Asparagine, Alanine, Glycine, Proline, Histidine, Lysine, Valine, Arginine, Isoleucine, Leucine, Phenylalanine and Aspartic acid. Thus, in one aspect, the invention provides an antibody fragment, which comprises a (Zi) Xi C X2 motif at its N-terminal extremity, wherein: a. Zi is present or absent, and when Zi is present, Zi represents 1 amino acid or 2,
3, 4, or 5 independently selected amino acids; and, b. Xi is any amino acid residue, preferably selected from the list consisting of Serine, Threonine, Asparagine, Alanine, Glycine, Proline, Histidine, Lysine, Valine, Arginine, Isoleucine, Leucine, Phenylalanine and Aspartic acid; and, c. C is cysteine; and, d. X2 is an amino acid selected from the list consisting of Proline, Arginine, Histidine, Lysine, Glycine and Serine.
In one embodiment, the antibody fragment comprises a knob domain or any portion thereof which comprises a (Zi) Xi C X2 motif at its N-terminal extremity, as defined above. In one embodiment, the antibody fragment comprises a (Zi)Xi C X2 motif at its N-terminal extremity, wherein C is cysteine; and Xi is selected in the list consisting of Serine (S), Threonine (T), Asparagine (N), Alanine (A), Glycine (G), Proline (P), Histidine (H), Lysine (K), Valine (V), Arginine (R), Isoleucine (I), Leucine (L), Phenylalanine (F) and Aspartic acid (D), and X2 is selected from the list consisting of Proline (P), Arginine (R), Histidine (H), Lysine (K), Glycine (G) and Serine (S), and wherein Zi is present or absent, and when Zi is present, Zi represents 1 amino acid or 2, 3, 4, or 5 independently selected amino acids.
In one embodiment, the N-terminal extremity of the antibody fragment comprises a motif which comprises 3 amino acid residues, corresponding to a XiC X2 motif, selected in the list consisting of SCP, TCP, NCP, ACP, GCP, PCR, HCP, SCR, KCP, VCP, TCH, RCP, ICP, ICR, HCR, LCR, SCK, SCG, NCP, TCS, DCP and FCR.
In one embodiment, the N-terminal extremity of the antibody fragment is initiated by a motif selected in the list consisting of (Zi)SCP, (Zi)TCP, (Zi)NCP, (Zi)ACP, (Zi)GCP, (Zi)HCP, (Zi)KCP, (Zi)VCP, (Zi)RCP, (Zi)ICP, (Zi)DCP, wherein Zi is present or absent, and when Zi is present, Zi represents 1 amino acid or 2, 3, 4, or 5 independently selected amino acids.
In one embodiment, the antibody fragment comprises a (AB)n and/or (BA)n motif, wherein A is any amino acid residue, B is an aromatic amino acid selected from the group consisting of: tyrosine (Y), phenylalanine (F), tryptophan (W), and histidine (H), and wherein n is 1, 2, 3 or 4.
In one embodiment, A is an aliphatic amino acid residue. An aliphatic amino acid is an amino acid containing an aliphatic side chain functional group. Aliphatic amino acid residues include Alanine, isoleucine, leucine, proline, and valine.
In one embodiment, the antibody fragment comprises a motif of 2-8 amino acids which is rich in aromatic and/or aliphatic amino acids. In one embodiment, the antibody fragment comprises a motif of 2-8 amino acids which comprises at least 2, or at least 3 or at least 4, or at least 5 amino acids selected from the group consisting of: tyrosine (Y), phenylalanine (F), tryptophan (W), and histidine (H).
In some embodiments, the antibody fragment comprises or consists of the sequence of formula (I):
(Zl) (Xl) C X2 (Y)nl (C)n2 (Y)n3 (C)n4 (Y)n5 (C)n6 (Y)n7 (C)n8 (Y)n9 (C)nlO (Y)nll (C)nl2 (Y)nl3 (C)nl4 (Y)nl5 (C)nl6 (Y)nl7 C (X3) (Z2) (I) wherein:
C represents one cysteine residue; and,
Zi is present or absent, and when Zi is present, Zi represents 1 amino acid or 2, 3, 4, or 5 independently selected amino acids; and,
Xi is present or absent, and when Xi is present, Xi is any amino acid residue, preferably selected from the list consisting of Serine, Threonine, Asparagine, Alanine, Glycine, Proline, Histidine, Lysine, Valine, Arginine, Isoleucine, Leucine, Phenylalanine and Aspartic acid; and,
X2 is selected from the list consisting of Proline, Arginine, Histidine, Lysine, Glycine and Serine; and,
Z2 is present or absent, and when Z2 is present, Z2 represents 1 amino acid or 2, 3, 4, or 5 independently selected amino acids; and, n2, n4, n6, n8, nlO, nl2, nl4 and nl6 are independently 0 or 1; and,
Y represents any amino acid or any sequence of amino acids that may be the same or different; and, nl, n3, n5, n7, n9, ni l, nl3, nl5 and nl7 represent the number of amino acids in Y, and are independently selected from 0 to 22, preferably from 1 to 15; and, at least one of nl, n3, n5, n7, n9, ni l, nl3, nl5 and nl7 is not equal to 0; and,
X3 is present or absent, and when X3 is present, X3 represents any amino acid, preferably selected from the list consisting of Leucine, Serine, Glycine, Threonine, Tryptophan, Asparagine, Tyrosine, Arginine, Isoleucine, aspartic acid, Histidine, Glutamic acid, Valine, Lysine, Proline; and, wherein the peptide is up to 55 amino acids in length.
Zi represents any amino acid or any sequence of 2, 3, 4, or 5 independently selected amino acids that may be the same or different. In one embodiment, Zi is 1 amino acid. In another embodiment, Zi is 2 amino acids, which may be the same or different. In another embodiment,
Zi is 3 amino acids, which may be the same or different. In another embodiment, Zi is 4 amino acids, which may be the same or different. In another embodiment, Zi is 5 amino acids, which may be the same or different.
Z2 represents any amino acid or any sequence of 2, 3, 4, or 5 independently selected amino acids that may be the same or different. In one embodiment, Z2 is 1 amino acid. In another embodiment, Z2 is 2 amino acids, which may be the same or different. In another embodiment, Z2 is 3 amino acids, which may be the same or different. In another embodiment, Z2 is 4 amino acids, which may be the same or different. In another embodiment, Z2 is 5 amino acids, which may be the same or different.
Zi and Z2 may comprise any amino acid as long as the properties of the antibody fragment otherwise defined is retained, e.g. binding capability to an antigen of interest.
Brackets are generally used for optional residues or sequences. For example, (C) generally indicates an optional Cysteine residue, in the context of the present disclosure. In some embodiments, the antibody fragment comprises a knob domain of an ultralong CDR-H3 or any portion thereof and comprises or consists of the sequence of formula (I) as described above.
In some embodiments, the antibody fragment of the present invention specifically binds to an antigen of interest, i.e. comprises a specific binding domain to an antigen of interest. “Specifically,” as employed herein is intended to refer to a binding domain that only recognises the antigen to which it is specific or a binding domain that has significantly higher binding affinity to the antigen to which is specific compared to affinity to antigens to which it is nonspecific, for example 5, 6, 7, 8, 9, 10 times higher binding affinity.
Preferably, the antibody fragment of the present invention has a specific binding affinity (as measured by its dissociation constant KD) for its cognate antigen of 10'5 M or less, 10'6 M or less, 10'7 M or less, 10'8 M or less, 10'9 M or less, 10'10 M or less, or 10'11 M or less. In one embodiment, the antibody fragment of the present invention has a specific binding affinity (as measured by its dissociation constant KD) for its cognate antigen between 1. 10'7 M and 1. 10" 8 M, or between 1. 10'8 M and 1. 10'9 M, or between 1. 10'9 M and 1. IO'10 M.
Affinity can be measured by known techniques such as surface plasmon resonance techniques including Biacore™. Affinity may be measured at room temperature, 25°C or 37°C. Affinity
may be measured at physiological pH, i.e. at about pH 7.4. In one embodiment, the affinity values as described above are measured using Biacore, notably Biacore 8K, at pH 7.4.
It will be appreciated that the affinity of antibodies fragments provided by the present invention may be altered using any suitable method known in the art.
Antibody fragment variants
In some aspects, the antibody fragment comprises a sequence which is a variant of a naturally occurring sequence of a bovine antibody, i.e. of a bovine ultralong CDR-H3 or portion thereof. In other words, the present disclosure provides variants of antibody fragments as described above, which comprise non-naturally occurring sequences, i.e. which have been further engineered, for example to improve at least one pharmacokinetic and/or biological function. In such aspects, the antibody fragment comprising a naturally occurring sequence may be referred as “parent”.
The present invention also includes antibody fragments, i.e. bovine ultralong CDR-H3 or portions thereof, which comprise sequences which are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% similar or identical to a sequence given herein. “Identity", as used herein, indicates that at any particular position in the aligned sequences, the amino acid residue is identical between the sequences. "Similarity", as used herein, indicates that, at any particular position in the aligned sequences, the amino acid residue is of a similar type between the sequences. For example, leucine may be substituted for isoleucine or valine. Other amino acids which can often be substituted for one another include but are not limited to:
- phenylalanine, tyrosine and tryptophan (amino acids having aromatic side chains);
- lysine, arginine and histidine (amino acids having basic side chains);
- aspartate and glutamate (amino acids having acidic side chains);
- asparagine and glutamine (amino acids having amide side chains); and
- cysteine and methionine (amino acids having sulphur-containing side chains).
Degrees of identity and similarity can be readily calculated by methods well known, for example the BLAST™ software available from NCBI.
In one embodiment, antibody fragments of the present disclosure are processed to provide improved affinity for a target or antigen. Such variants can be obtained by a number of affinity maturation protocols including mutating the CDR, chain shuffling, use of mutator strains of E. coli, DNA shuffling, phage display and sexual PCR. Vaughan etal (Nature Biotechnology, 16,
535-539, 1998) discusses these methods of affinity maturation. Another method useful in the context of the present disclosure to improve binding of the antibody fragment at a binding site on the target or antigen of interest is a method as described in WO2014/198951. Improved affinity as employed herein in this context refers to an improvement over the starting antibody fragment. Affinity can be measured as described above.
In one embodiment, the antibody fragment is a variant of a parent bovine antibody fragment which has an affinity which is at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% higher than the affinity of the parent bovine antibody fragment, as measured for example by Biacore.
“Truncated variants" when referring to antibody fragments are those with one or more amino acids in the native or starting amino acid sequence removed from either terminus of the polypeptide.
In some embodiments, the antibody fragment is a variant which has been engineered to comprise a disulfide bond which is in a non-naturally occurring position. This may be engineered into the molecule by introducing cysteine(s) into the amino acid chain at the position or positions required. This non-natural disulfide bond is in addition to or as an alternative to the natural disulfide bond(s) which may be present in the parent antibody fragment. The cysteine(s) in natural positions can be replaced by an amino acid such as serine which is incapable on forming a disulfide bridge. Introduction of engineered cysteines can be performed using any method known in the art. These methods include, but are not limited to, PCR extension overlap mutagenesis, site-directed mutagenesis or cassette mutagenesis (see, generally, Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY, 1989; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing & Wiley-Interscience, NY, 1993). Site-directed mutagenesis kits are commercially available, e.g. QuikChange® Site-Directed Mutagenesis kit (e.g. Stratagene, La Jolla, CA). Cassette mutagenesis can be performed based on Wells et al., 1985, Gene, 34:315-323. Alternatively, mutants can be made by total gene synthesis by annealing, ligation and PCR amplification and cloning of overlapping oligonucleotides.
In one aspect, it may be useful to decrease or remove the cysteine residues and/or disulfide bonds in an antibody fragment of the disclosure, e.g. to lower the risk of immunogenicity, i.e. of side reactions occurring during or after the administration to a patient. In such aspect, one
or all of the cysteine(s) in natural positions can be replaced by an amino acid such as serine which is incapable on forming a disulfide bridge. It will be appreciated that alternative bridging moieties may be used to stabilise and/or form a cyclised antibody fragment in the absence of cysteine residues. In one embodiment, the antibody fragment is a variant which has been engineered to remove the cysteine residues and which comprises at least one bridging moiety as defined in the present disclosure. In one embodiment, the antibody fragment is a variant which has been engineered to contain only one, or only two, or only three, or only four, cysteine residues, and/or to contain only one or only two disulphide bonds and which optionally further comprises at least one bridging moiety as defined in the present disclosure.
Additional modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of tyrosinyl, seryl or threonyl residues, methylation of the alpha-amino groups of lysine, arginine, and histidine side chains (Creighton, T. E., Proteins: Structure and Molecular Properties, W.H. Freeman and Co., San Francisco, 1983, pp. 79-86).
The antibody fragment of the invention may be cyclised. Cyclisation may be advantageous to confer more resistance to proteolysis, resulting notably in an improved stability. Therefore, in one embodiment, the antibody fragment of the present disclosure further comprises a bridging moiety between two amino acids. Cyclised antibody fragments include any antibody fragments that have as part of their structure one or more cyclic features such as a loop, bridging moiety, and/or an internal linkage. As used herein, the term "bridging moiety" refers to one or more components of a bridge formed between two adjacent or non-adjacent amino acids, unnatural amino acids or non-amino acids in an antibody fragment. Bridging moieties may be of any size or composition.
In one embodiment, a bridging moiety may be between the amino acid residue in N-terminal position and the amino acid residue in C-terminal position such as to create a head-to-tail cyclisation. In one embodiment, a bridging moiety may be between amino acids which are not in terminal position. In one embodiment, the antibody fragment comprises only one bridging moiety between two amino acids. In another embodiment, the antibody fragment comprises more than one bridging moiety between two amino acids, e.g. two, or three, or five bridging moieties, each one being between two amino acids. In one embodiment, the bridging moiety comprises a disulphide bond. In one embodiment, the disulphide bond is formed between two naturally occurring cysteine residues. In another embodiment, the disulphide bond is formed
between cysteine residues, with at least one cysteine residue being engineered, as described above.
In one embodiment, the antibody fragment of the invention is fully bovine. In such embodiment, each and every residue is derived from a bovine germline sequence. In some embodiments, each and every residue is derived from a bovine germline sequence which has undergone affinity maturation for an antigen.
In one embodiment, the antibody fragment of the invention is chimeric. The term "chimeric" refers to an antibody fragment comprising at least two portions, one being derived from a particular source or species, such as bovine, while the other portion is derived from a different source or species, such as human. In one embodiment, the antibody fragment is human/bovine chimeric. In one embodiment, the antibody fragment comprises at least one residue derived from a human sequence. In one embodiment, the antibody fragment comprises one, two, three, four, five, or more residues derived from a human sequence. In one embodiment, the antibody fragment comprises at least two residues derived from a human sequence wherein the at least two residues are contiguous.
In one embodiment, the antibody fragment of the invention is synthetic. The term “synthetic” refers to an antibody fragment that has been produced de novo by synthesis, notably by chemical synthesis. Chemical synthesis approaches have been described, such as solid phase polypeptide synthesis (see e.g., Coin, I et al. (2007); Nature Protocols 2(12):3247-56).
In one embodiment, the antibody fragment comprises a sequence selected from the group consisting of SEQ ID NO:2, 4, 6, 8, 10, 12, 26, 27, 30, 31, 34 or 35, or any variant thereof as described herein. In one embodiment, the antibody fragment comprises a bovine ultralong CDR-H3 and comprises a sequence selected from the group consisting of SEQ ID NON, 8, 12, 27, 31 or 35 or any variant thereof as described herein. In one embodiment, the antibody fragment comprises a knob domain of a bovine ultralong CDR-H3 and comprises a sequence selected from the group consisting of SEQ ID NO: 2, 6, 10, 26, 30, or 34, or any variant thereof as described herein.
AA V capsid proteins
The term “adeno-associated virus or AAV” encompasses any AAV, for example, any serotype or subtype of AAV, any forms of AAV such as a naturally-occurring AAV or any variant or
any derivative thereof, and/or any engineered (i.e. artificial), or recombinant forms of AAV, or any combination of these.
The AAV single-stranded DNA genome comprises two inverted terminal repeats (ITRs) and two open reading frames, containing structural (cap) and packaging (rep) genes (Hermonat et al., 1984). The AAV genome typically comprises packaging genes, such as rep and/or cap genes which encode packaging functions for an AAV particle. The rep gene encodes one or more of the proteins Rep78, Rep68, Rep52 and Rep40 or variants thereof. The cap gene encodes one or more capsid proteins such as VP1, VP2 and VP3 or variants thereof. These proteins make up the capsid of a viral particle such as an AAV particle. In some embodiments, the AAV capsid protein is a virion protein (VP).
VP1, VP2, and VP3 refer to three distinct proteins found in the capsid (or protein shell) of an AAV. The terms “VP” encompasses any AAV VP, for example, from any AAV serotype or subtype of AAV, any forms of AAV such as a naturally-occurring AAV or any variant or any derivative thereof, and/or any engineered (i.e. artificial), or recombinant forms of AAV, or any combination of these.
The VPs are encoded by a single capsid gene cap and are produced by alternative mRNA splicing of the transcript and alternative start codon usage. VP1, VP2, and VP3 differ from one another only in their N-terminus.
“VP1” refers to the VP1 capsid protein, which is about 79-82 kDa in size and comprises about 713-738 amino acids. VP1 comprises the entire sequence of VP2 and VP3, and in addition, at its N-terminal, an amino acid sequence which is unique to VP1 and may be referred to as “the VP1 unique region.”
“VP2” refers to the VP2 capsid protein, which is about 64-67 kDa in size and comprises about 580-601 amino acids. VP2 comprises the entire sequence of VP3, and in addition, at its N- terminal, a VP2 amino acid sequence that is not present in VP3 but is shared by VP1 and VP2 and may be referred to as “the VP1/VP2 common region.”
“VP3” refers to the VP3 capsid protein, which is about 59-61 kDa in size and which comprises about 524-544 amino acids. The VP3 amino acid sequence is shared among all the VPs and may be referred to as “the common VP3 region.”
In some embodiments, the AAV capsid protein comprises a naturally occurring, or a variant or derivative, or an artificial AAV sequence or a combination thereof.
As described herein, “naturally-occurring” refers to a form of a biomolecule such as an AAV capsid protein or an AAV capsid gene that may be found in nature and/or may be isolated from a biological source such as a human, a non-human primate, or cells isolated from the biological source. Variants, and/or derivatives of a naturally-occurring AAV may also be found in nature and/or isolated from a biological source. An example of a naturally-occurring AAV protein is an AAV capsid protein of AAV2, which is a serotype of AAV first isolated from human cells. An example of a naturally-occurring capsid gene is an AAV2 cap gene that encodes the AAV2 capsid protein. A naturally-occurring biomolecule may also be called a “wild-type” biomolecule. Naturally-occurring AAVs include, but are not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, or a combination thereof.
These AAVs may classified according to their similarity, for example, according to genetic sequences which indicate a common ancestor and its lineal descendants. AAV clades comprise clades A, B, C, D, E, and F (Gao et al., J Virology, 78(12): 6381-6388 (2004)).
In contrast to naturally-occurring, “engineered” or “artificial” refers to a form of a molecule such as an AAV capsid protein or an AAV capsid gene that has been generated by an experimental method (for example, produced by de novo synthesis) and/or is not known to occur in nature. As an example, an engineered AAV capsid protein may differ from a naturally- occurring AAV capsid protein (or a variant or derivative) by the addition, substitution, and/or deletion of one or more amino acids as compared to the protein sequence of the naturally- occurring capsid protein. An engineered AAV capsid gene may differ from a naturally- occurring AAV capsid gene by the addition, substitution, and/or deletion of one or more nucleotides as compared to the nucleotide sequence of the naturally-occurring capsid gene. Engineered AAV capsid genes and engineered AAV capsid proteins may be created using molecular techniques such as capsid shuffling, directed evolution, random peptide library insertions, generation of chimeric capsids, site-directed mutagenesis, and more. An example of an engineered AAV capsid protein is an AAV capsid protein that comprises the insertion of a heterologous peptide, as described e.g. in US Patent Application No. US2020121746, or the chimera AAV X-Vivo (AAV-XV) derived from chimeras of AAV12 VP1/2 sequences and the VP3 sequence of AAV6 (Viney et al., Journal of Virology 95 (7) (2021)).
In some embodiments, the AAV capsid protein (e.g., VP1, VP2, or VP3) comprises a sequence of an AAV selected from the group consisting of AAV1, AAV2, AAV true type (AAV-TT),
AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof. In one embodiment, the AAV capsid protein is VP1 of an AAV selected from the group consisting of AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof. In one embodiment, the AAV capsid protein is VP2 of an AAV selected from the group consisting of AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof. In one embodiment, the AAV capsid protein is VP3 of an AAV selected from the group consisting of AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof.
In one embodiment, the AAV capsid protein (e.g., VP1, VP2, or VP3) comprises a sequence of an AAV-TT wherein the AAV-TT comprises the sequence SEQ ID NO: 69. In one embodiment, the AAV capsid protein is AAV-TT VP1. In one embodiment, the AAV capsid protein is AAV-TT VP2. In one embodiment, the AAV capsid protein is AAV-TT VP3.
In one embodiment, the AAV capsid protein (e.g., VP1, VP2, or VP3) comprises a sequence of an AAV9. In one embodiment, the AAV capsid protein is AAV9 VP1 and comprises the amino acid sequence given in SEQ ID NO:40. In one embodiment, the AAV capsid protein is AAV9 VP2 and comprises the amino acid sequence given in SEQ ID NO:41. In one embodiment, the AAV capsid protein is AAV9 VP3 and comprises the amino acid sequence given in SEQ ID NO:42. The sequences given in SEQ ID NOS: 40, 41, and 42 are aligned in Figure 2 (top, middle and bottom lines respectively).
Engineered capsid proteins
In one aspect, the present disclosure provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR-H3, or a portion thereof. In another aspect, the present disclosure provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of a bovine ultralong CDR-H3, or a portion thereof. In some embodiments, the antibody fragment does not comprise a stalk domain of a bovine ultralong CDR-H3, or any portion thereof, i.e., the engineered capsid protein does not comprise a stalk domain of a bovine ultralong CDR-H3, or any portion thereof. In some embodiments, the antibody fragment binds to an antigen.
In the context of the present disclosure, the terms “Fused to”, “inserted into”, and “conjugated to” may be used interchangeably. Thus, antibody fragment fusion proteins encompass molecules comprising an antibody fragment of the invention fused to, or conjugated to, or inserted into/within an AAV capsid protein.
In one embodiment, the antibody fragment is inserted within the AAV capsid protein, directly, i.e. without any linker between the capsid protein and the antibody fragment. In such case, it will be appreciated that an amino acid of the antibody fragment forms a bond (e.g., a peptide bond) with an amino acid of the AAV capsid protein. The antibody fragment and the capsid protein therefore form a fusion protein wherein a first nucleotide sequence encoding the capsid protein is directly genetically fused to a second nucleotide sequence encoding the antibody fragment. Both the capsid protein and the antibody fragment may be translated from the same open reading frame (ORF) or from two ORFs that are aligned.
In another embodiment, the antibody fragment of the invention is inserted within the AAV capsid protein, via a linker, i.e. via one or more linkers.
In one embodiment, the antibody fragment comprises a sequence selected from the group consisting of SEQ ID NO:2, 4, 6, 8, 10, 12, 26, 27, 30, 31, 34 or 35, or any variant thereof as described herein.
In one embodiment, the antibody fragment is inserted within the AAV capsid protein via one linker (i.e. a single linker). In one embodiment, the antibody fragment is inserted within the AAV capsid protein via one linker wherein the linker is genetically fused to the antibody fragment. In one embodiment, the linker is positioned at the N-terminus of the antibody fragment. In one embodiment, the linker is positioned at the C-terminus of the antibody fragment. In one embodiment, the sequence of an antibody fragment and linker positioned at its C-terminus comprises any sequence from SEQ ID NO: 19 to 21, SEQ ID NO: 23 to 25, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36.
In another embodiment, the antibody fragment is inserted within the AAV capsid protein via at least two linkers. The at least two linkers may be the same or different. In some embodiments, at least one linker is fused, optionally genetically, to the N-terminal end of the antibody fragment, and at least one linker is fused, optionally genetically, to the C-terminal end of the antibody fragment. In some embodiments, the antibody fragment is inserted within the AAV capsid protein via two linkers, wherein one linker is positioned at the N-terminal end of the
antibody fragment and the second linker is positioned at the C-terminal end of the antibody fragment, as illustrated below:
- AAV capsid protein - Linker - Antibody fragment - Linker- AAV capsid potein -
In some embodiments, the first and second linkers are the same, i.e. comprise the same amino acid sequence. In one embodiment, the sequence of Linker - Antibody fragment - Linker comprises any sequence from SEQ ID NO: 13 to 18, SEQ ID NO:22, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 37.
In some embodiments, the first and second linkers are different, i.e. comprise different amino acid sequences.
In one embodiment, the linker(s) is/are a peptide linker. The term “peptide linker” as used herein refers to a peptide comprised of amino acids. A range of suitable peptide linkers will be known to the person of skill in the art. In one embodiment, the linker is a flexible linker. In one embodiment, the linker is selected from a sequence comprised in the list consisting of SEQ ID NO: 103 to SEQ ID NO: 145, as represented in Table 13.
Table 13. Linkers
(S) is optional in sequences 103 and 107 to 112.
In some embodiments, the antibody fragment is inserted within the AAV capsid protein via one linker comprising the sequence SEQ ID NO:95 (GGGGG) (i.e. SEQ ID NO: 108 without the optional Serine). In some embodiments, the antibody fragment is inserted within the AAV capsid protein via one linker comprising the sequence GGGGSGGGGS (SEQ ID NO: 97) (i.e. SEQ ID NO: 109 without the optional Serine). In some embodiments, the linker is positioned at the C-terminal end of the antibody fragment. In some embodiments, the linker comprising SEQ ID NO:95 is encoded by a nucleotide acid sequence comprising ggtggaggcgggggt (SEQ ID NO: 96). In some embodiments, the linker comprising SEQ ID NO:97 is encoded by a nucleotide acid sequence comprising ggt gga ggc ggg agt gga ggt ggc ggg agt (SEQ ID NO: 98). In some embodiments, the linker comprising SEQ ID NO:97 is encoded by a nucleotide acid sequence comprising ggc ggg ggt gga agt ggc gga ggt gga agt (SEQ ID NO: 99).
In some embodiments, the antibody fragment is inserted within the AAV capsid protein via two linkers, wherein one linker is positioned at the N-terminal end of the antibody fragment and the second linker is positioned at the C-terminal end of the antibody fragment, and wherein both linkers comprise the sequence SEQ ID NO: 95. In some embodiments, the antibody fragment is inserted within the AAV capsid protein via two linkers, wherein one linker is positioned at the N-terminal end of the antibody fragment and the second linker is positioned at the C-terminal end of the antibody fragment, and wherein both linkers comprise the sequence SEQ ID NO: 97. In some embodiments, one of the two linkers is encoded by sequence SEQ ID NO: 98 and the other linker is encoded by sequence SEQ ID NO: 98 or SEQ ID NO: 99. Figure 1 shows an illustration of engineered viruses comprising capsid proteins inserted with an antibody fragment, such as a knob domain (Fig. lA, 1C), or a bovine ultralong CDR-H3 (Fig. IB, ID), optionally via a linker (Fig. IE- IF respectively).
In some embodiments, the antibody fragment may be conjugated to the capsid protein, e.g. by chemical conjugation. The antibody fragment may be attached via bioconjugation, for example, via covalent bonds formed directly with the capsid protein, or formed indirectly via an adaptor or linker. In some embodiments, the antibody fragment conjugated to the capsid protein forms a cyclic peptide.
Methods for chemical conjugation may comprise direct conjugation of the antibody fragment to lysine residues or cysteine residues on the capsid, for example via NHS-ester chemistry (to primary amines in lysine residues or the N-terminus of polypeptide chains) or maleimide chemistry (to thiol groups in cysteine residues). Further techniques for bioconjugation may
include click chemistry, biotin-based attachment, incorporation of unnatural amino acids on the capsid, polymers, atom-transfer radical polymerization, and more (Chen et al., Wiley Interdiscip Rev Nanomed Nanobiotechnol. 11 (3): el545 (2019)). A further exemplary method for conjugating a ligand to an AAV capsid is described in WO 2017212019, wherein the ligand is covalently linked to a primary amino group of a capsid polypeptide via a -CSNH- bond. Alternatively, bispecific antibodies may be used to bind an AAV capsid and cell-specific receptor (Bartlett et al., Nat. Biotechnol. 17 (2): 181-186 (1999)). In some embodiments, functionalized peptides can be conjugated to the AAV capsid via an isothiocyanate moiety that readily reacts with a primary amine. For example, an antibody fragment may be linked to an isothiocyanate via a PEG linker, and the isothiocyanate may react with a lysine residue on the AAV capsid.
In some embodiments, amino acid residues in a capsid protein may be mutated to lysine or cysteine residues in order to facilitate the chemical conjugation at locations in the capsid protein which do not have lysine or cysteine residues. For example, if specific amino acid residues in loop regions of the capsid protein are exposed and/or available for binding, these residues may be changed to a lysine or cysteine residue.
In some embodiments, the present invention provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment as described herein, wherein the antibody fragment is inserted within a AAV capsid protein VP1 (optionally via a linker). In some embodiments, the present invention provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment as described herein, wherein the antibody fragment is inserted within a AAV capsid protein VP2 (optionally via a linker). In some embodiments, the present invention provides an engineered capsid protein comprising an AAV capsid protein and an antibody fragment as described herein, wherein the antibody fragment is inserted within a AAV capsid protein VP3 (optionally via a linker).
In certain embodiments, the antibody fragment may be comprised within a region of the AAV capsid protein that mediates binding to heparan sulfate proteoglycan (HSPG), a cell surface molecule that acts as a receptor for AAV(Biining & Srivastava, Molecular Therapy - Methods & Clinical Development 12 (15): 248-265 (2019)).
In some embodiments, the antibody fragment is inserted within a capsid protein without deleting any amino acid of the capsid protein, i.e., all amino acids of the AAV capsid protein before insertion are present in the capsid protein when inserted with the antibody fragment.
Accordingly, the antibody fragment may be inserted before, after an amino acid residue of the AAV capsid protein, or in between two amino acid residues of the AAV capsid protein.
The antibody fragment may be comprised within a structural or topological element in the AAV capsid protein. Structurally, AAV capsid proteins have a conserved core structure, consisting of an eight-stranded, P-barrel motif, aA helix, and loops connecting the P strands. The loops may form features in the surface topology of the AAV capsid, for example, in AAV9 the DE loop (connect PD and PE strands) protrusions form the central channel at each five-fold axis and the HI loops (connect pH and pi strands) lie on the floor of the depression around each five-fold axis (DiMattia et al., Journal of Virology 86 (12): 6947-6958 (2012)). Accordingly, the antibody fragment may be comprised within a loop in the AAV capsid protein, such as a surface-exposed loop of the AAV capsid. The antibody fragment may be comprised at any site along the loops and in particular may be comprised within the outermost portion of a loop, as it may maximize exposure to a binding target.
The antibody fragment may be comprised within regions of the AAV capsid protein where amino acids residues show the greatest diversity across AAVs, e.g., in a variable region. The term “variable region” (also “VR”) or “hypervariable region” (also “HVR”) refers to regions on an AAV capsid protein (e.g., VP1, VP2, and/or VP3) which show variation when AAV capsid proteins from different AAVs are compared. In general, the variable regions comprise amino acids that are believed to mediate certain functions of the AAV capsid proteins, such as cell and/or tissue tropism, specificity, and/or efficiency of transduction, recognition of AAV by neutralizing antibodies in the host, the innate immune response of the host, and downstream processing or processability of the AAV (Vandenberghe et al., Gene Therapy 16: 311-319 (2009)). For example, VP3 contains nine variable regions in VP3 (numbered VR-I to VR-IX) whose sequence diversity across AAV serotypes has been reported to contribute to functional differences observed between the serotypes (Tseng & Agbandje-McKenna, Frontiers in Immunology 5 (9) (2014)).
Variable regions may be found in between P strands in AAV capsid proteins. VR-I may be found in between PB and PC strands; VR-II may be found in between the PD and PE strands; VR-III may be found in between the PE and PF strands; VR-IV, VR-V, VR-VI, VR-VII, and VR-VIII may be found in between the PG and pH strands; and VR-IX may be found after the pi strand. The length of the VRs varies depending on the AAV, but ranges from about 4 to 18 amino acid residues (DiMattia et al., Journal of Virology 86 (12): 6947-6958 (2012)) and
(Govindasamy et al., Journal of Virology 80 (23) (2020)). VRs may be found in the loops connecting the P strands. For example, VR-IV, VR-V, and VR-VIII are located in loops at the top of the protrusions (Tseng & Agbandje-McKenna, Frontiers in Immunology 5 (9) (2014)). VR-IV, VR-V, VR-VI, VR-VII, and VR-VIII connecting the PG and PH strands are comprised in a loop referred to as “GH loop”.
In some embodiments, the antibody fragment is inserted within the common VP3 region of the AAV capsid protein. The capsid protein may be VP1, VP2, or VP3. In some embodiments, the antibody fragment is inserted within the common VP3 region of VP1. In some embodiments, the antibody fragment is inserted within the common VP3 region of VP2. In some embodiments, the antibody fragment is inserted within the common VP3 region of VP3.
In some embodiments, the antibody fragment is inserted within the GH loop comprised in the common VP3 region. In one embodiment, the antibody fragment is inserted within the GH loop of VP1. In one embodiment, the antibody fragment is inserted within the GH loop of VP2. In one embodiment, the antibody fragment is inserted within the GH loop of VP3.
In some embodiments, the antibody fragment is inserted within the variable region VR-IV of the AAV capsid protein (within the GH loop comprised in the common VP 3 region). In some embodiments, the antibody fragment is inserted within the variable region VR-IV of an AAV9 capsid protein. In some embodiments, the antibody fragment is inserted within the AAV capsid protein after amino acid residue Gly455 of AAV9 with reference to SEQ ID NO: 40 (or a corresponding amino acid residue of another AAV).
In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP1 after amino acid residue Gly455 of AAV9 with reference to SEQ ID NO: 40 (or a corresponding amino acid residue of another AAV). In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP2 after amino acid residue Gly318 of AAV9 with reference to SEQ ID NO: 41 (or a corresponding amino acid residue of another AAV). In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP3 after amino acid residue Gly253 of AAV9 with reference to SEQ ID NO: 42 (or a corresponding amino acid residue of another AAV).
In some embodiments, the antibody fragment is inserted within the variable region VR-V of the AAV capsid protein. In some embodiments, the antibody fragment is inserted within the variable region VR-V of an AAV9 capsid protein. In some embodiments, the antibody
fragment is inserted within the AAV capsid protein after amino acid residue Asn498 of AAV9 with reference to SEQ ID NO:40, or a corresponding amino acid residue of another AAV.
In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP1 after amino acid residue Asn498 of AAV9 with reference to SEQ ID NO: 40 (or a corresponding amino acid residue of another AAV). In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP2 after amino acid residue Asn361 of AAV9 with reference to SEQ ID NO: 41 (or a corresponding amino acid residue of another AAV). In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP3 after amino acid residue Asn296 of AAV9 with reference to SEQ ID NO: 42 (or a corresponding amino acid residue of another AAV).
In some embodiments, the antibody fragment is inserted within the variable region VR-VIII of the AAV capsid protein. In some embodiments, the antibody fragment is inserted within the variable region VR-VIII of an AAV9 capsid protein. In some embodiments, the antibody fragment is inserted within the AAV capsid protein after amino acid residue Gln588 of AAV9 with reference to SEQ ID NO:40, or a corresponding amino acid residue of another AAV.
In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP1 after amino acid residue Gln588 of AAV9 with reference to SEQ ID NO: 40 (or a corresponding amino acid residue of another AAV). In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP2 after amino acid residue Gln451 of AAV9 with reference to SEQ ID NO: 41 (or a corresponding amino acid residue of another AAV). In some embodiments, the antibody fragment is inserted within the AAV capsid protein VP3 after amino acid residue Gln386 of AAV9 with reference to SEQ ID NO: 42 (or a corresponding amino acid residue of another AAV).
In some embodiments, the antibody fragment is inserted within the VP1/VP2 common region of the AAV capsid protein. In some embodiments, the antibody fragment is inserted within the VP1/VP2 common region of VP1. In some embodiments, the antibody fragment is inserted within the VP1/VP2 common region of the VP2 capsid protein.
In some embodiments, the antibody fragment is inserted within the N-terminus of the VP2 capsid protein. In some embodiments, the antibody fragment is inserted within the N-terminus of the VP2 capsid protein of AAV9 before amino acid residue Thrl with reference to SEQ ID NO:41, or a corresponding amino acid in another AAV. As represented for example in SEQ ID NO: 47, it will be understood that when inserted before the amino acid residue Thrl of
AAV9 VP2 with reference to SEQ ID N0:41 (amino acid sequence), an additional codon is present at the N-terminal end of the sequence encoding the antibody fragment, said codon being a start codon (e.g. ATG as in SEQ ID NO: 47), to allow the recombinant expression of a VP2 protein wherein the antibody fragment is inserted within (and directly fused to) the N-terminus of a VP2.
In some embodiments, the antibody fragment is inserted within the VP1 unique region of a VP1 capsid protein.
In some embodiments, the capsid protein is from any AAV serotype or subtype of AAV, any forms of AAV such as a naturally-occurring AAV or any variant or any derivative thereof, and/or any engineered (i.e. artificial), or recombinant forms of AAV, or any combination of these. In some embodiments, the capsid protein is VP1 and/or VP2 and/or VP3 from AAV comprising AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination of these.
Among AAVs, the composition and numbering of amino acids in an AAV capsid protein may vary. For example, VP1 from AAV9 may comprise a Gly residue at position 455 of the amino acid sequence given in SEQ ID NO:40. In contrast, VP1 from another AAV may not have a Gly residue at position 455, either because the equivalent Gly residue has a differently numbered position, or because the VP1 in the AAV does not have an equivalent Gly residue. Alignments of capsid proteins from different AAVs may be used to identify corresponding amino acid residues or regions in each variant. For example, sequences of VPs from different AAVs may be aligned using the ClustalW algorithm, or crystal structures of VPs from AAVs may be compared by structural alignment with the Secondary Structure Matching Program (SSM) (DiMattia et al., Journal of Virology 86 (12): 6947-6958 (2012)). Figure 3 shows an alignment of VP1 from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, and AAV-TT.
As an example, the amino acid residues in VP1 from exemplary AAVs which correspond to Gly455, Asn498, and Gln588 in VP1 from AA9 (amino acid sequence given in SEQ ID NO: 40) are as follows: Gly454, Asn498, Ser588 of the amino acid sequence given in SEQ ID NO:60 (AAV1); Gly454, Asn498, Ser588 of the amino acid sequence given in SEQ ID NO:65 (AAV6); Gly456, Asn500, Asn590 of the amino acid sequence given in SEQ ID NO:67 (AAV8); Gly453, Asn497, Asn587 of the amino acid sequence given in SEQ ID NO:69 (AAV AAV-TT).
Where an amino acid residue in an AAV capsid protein from a first AAV does not have a corresponding amino acid residue in an AAV capsid protein from a second AAV, a modification according to the present disclosure may be made at or near to an adjacent or nearby amino acid residue. The alternative amino acid in the second AAV may have a comparable location, function, and/or topology to the amino acid residue in the first AAV. For example, where an insertion is disclosed herein at Gly455 (according to VP1 numbering) in an AAV capsid protein from AAV9, the insertion may be made at a Gly residue located in the VR-IV of the GH loop of another AAV, or at an alternative amino acid residue in the VR-IV. The alternative amino acid may have a comparable location, function, and/or topology to Gly455 in AAV9.
In one embodiment, the invention provides an engineered capsid protein comprising an AAV capsid protein and at least two antibody fragments as described in the present disclosure, i.e. the capsid protein (e.g. VP1, VP2, or VP3) is inserted with more than one (two or more) antibody fragments. In some embodiments, the engineered capsid protein is an engineered VP1 comprising an AAV capsid protein VP1 and at least two antibody fragments as described in the present disclosure. In some embodiments, the engineered capsid protein is an engineered VP2 comprising an AAV capsid protein VP2 and at least two antibody fragments as described in the present disclosure. In some embodiments, the engineered capsid protein is an engineered VP3 comprising an AAV capsid protein VP3 and at least two antibody fragments as described in the present disclosure. In some embodiments, the engineered capsid protein comprises an AAV capsid protein and two, three, four, five and up to ten antibody fragments. In some embodiments, the antibody fragments are inserted in more than one site in the AAV capsid protein. In some embodiments, each of the antibody fragments is inserted at a different site in the AAV capsid protein. In some embodiments, two, or three, or four, or five antibody fragments are inserted within the capsid protein, at different sites of insertion, as described above. In some embodiments, the engineered capsid protein is VP1, VP2 or VP3.
In some embodiments, the at least two antibody fragments are identical. In some embodiments, the at least two antibody fragments are different. In some embodiments, at least three antibody fragments are inserted and the at least three antibody fragments are identical, different or are a mixture of antibody fragments that are identical and antibody fragments that are different.
AA V capsids comprising engineered capsid proteins
In one aspect, there is provided an AAV capsid comprising an engineered capsid protein according to the present disclosure. Therefore, in one aspect, the invention provides, an AAV capsid comprising an engineered capsid protein, wherein the engineered capsid protein comprises an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR-H3, or a portion thereof, optionally wherein the antibody fragment binds an antigen. In another aspect, the invention provides, an AAV capsid comprising an engineered capsid protein, wherein the engineered capsid protein comprises an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of a bovine ultralong CDR-H3, or a portion thereof, optionally wherein the antibody fragment binds an antigen.
In some embodiments, the antibody fragment does not comprise a stalk of an ultralong CDR- H3. In some embodiments, the AAV capsid protein does not comprise a stalk of an ultralong CDR-H3. In some embodiments, the AAV capsid does not comprise a stalk of an ultralong CDR-H3. In some embodiments, the antibody fragment does not comprise a stalk of a bovine ultralong CDR-H3. In some embodiments, the AAV capsid protein does not comprise a stalk of a bovine ultralong CDR-H3. In some embodiments, the AAV capsid does not comprise a stalk of a bovine ultralong CDR-H3.
In an AAV capsid, the three VPs assemble to form a 60-subunit icosahedral-shaped capsid. The VPs are present in an average ratio of about 5:5:50 (VP1 :VP2:VP3), although the assembly process is stochastic and the actual ratio may vary slightly (Wbrner et al., Nat Commun 12 (1): 1642 (2021)). As described herein, the number of antibody fragments comprised within an AAV capsid may depend on which VP is inserted with the antibody fragment and on the cloning strategy, as described in the Examples, in particular Example 5.
Figure 10 illustrates possible configurations of capsid proteins. Knob domains are described for illustrative purposes, as an example of the antibody fragments of the present disclosure.
In some embodiments, only AAV capsid VP1 is inserted with an antibody fragment, i.e., the AAV capsid comprises an engineered capsid protein VP1 according to the present disclosure, while VP2 and VP3 have not been engineered, i.e. do not comprise an antibody fragment. It will be understood that such an AAV capsid comprises about 5 copies of an engineered capsid protein according to the present disclosure (i.e. 5 copies of an engineered capsid protein VP1; in addition to 5 copies of VP2 and 50 copies of VP3).
Figure 10A illustrates the configuration of a capsid comprising 5 antibody fragments, such as knob domains, wherein the antibody fragments are comprised within only VP1 of the AAV capsid. Methods for producing such a capsid may comprise providing two different cap genes: 1) a first cap gene deleted in a start codon for VP1 (represented in Figure 10A with an asterisk over the start codon, in black), so that no VP1 is produced, while VP2 and VP3 are produced from this first cap gene); and 2) a second cap nucleic sequence encoding only VP1, comprising the antibody fragment (represented in Figure 10A as a diagonal pattern), and co-expressing both cap genes. When the capsid assembles, only VP1 comprises the antibody fragment and about 5 copies of the antibody fragment are comprised within the engineered capsid.
In some embodiments, the first cap gene deleted in a start codon for VP1 is from AAV9 and comprises SEQ ID NO: 73 (AAV9 VP1 del”). The second cap nucleic sequence encoding VP1 only may be a cap gene where VP1 has a deletion in the splice acceptor site for VP2 and VP3 (e.g. “VP1 sa del”, SEQ ID NO:70). Therefore, the second cap nucleic sequence may comprise the sequence of a cap gene deleted in the splice acceptor site for VP2 and VP3 and the sequence of an antibody fragment inserted therein. An example of such a sequence of the invention is provided in SEQ ID NO: 74. It will be understood that the antibody fragment within that sequence may be replaced by any other sequence coding for an antibody fragment according to the invention, and that the antibody fragment may be inserted in another insertion site as described in the present disclosure. In some embodiments, the antibody fragment is inserted within the common VP3 region of VP1 as described herein. In some embodiments, the antibody fragment is inserted within the VP1/VP2 common region. In some embodiments, the antibody fragment is inserted within the VP1 unique region.
In some embodiments, only AAV capsid VP2 is inserted with an antibody fragment, i.e., the AAV capsid comprises an engineered capsid protein VP2 according to the present disclosure, while VP1 and VP3 have not been engineered, i.e. do not comprise an antibody fragment. It will be understood that such an AAV capsid comprises about 5 copies of an engineered capsid protein according to the present disclosure (i.e. 5 copies of an engineered capsid protein VP2; in addition to 5 copies of VP1 and 50 copies of VP3).
Figure 10B illustrates the configuration of a capsid comprising 5 antibody fragments, such as knob domains, wherein the antibody fragments are comprised within only VP2 of the AAV capsid. Methods for producing such a capsid may comprise providing two different cap genes: 1) a first cap gene deleted in a start codon for VP2 (represented in Figure 10B with an asterisk
over the start codon, in black), so that no VP2 is produced, while VP1 and VP3 are produced from this first cap gene; and 2) a second cap genetic sequence encoding VP2 only comprising the antibody fragment (represented in Figure 1 OB as a diagonal pattern), and co-expressing both cap genes. When the capsid assembles, only VP2 comprises the antibody fragment and about 5 copies of the antibody fragment are comprised within the engineered capsid.
In some embodiments, the first cap gene deleted in a start codon for VP2 is from AAV9 and comprises SEQ ID NO: 39 (AAV9 del VP2”). The second cap genetic sequence encoding VP2 comprising the antibody fragment may be generated by inserting antibody fragments within VP2 as described in the present disclosure.
For example, the second cap genetic sequence encoding VP2 comprising the antibody fragment inserted within the N-terminus of AAV9 VP2 may comprise SEQ ID NO: 72. As another example, the second cap genetic sequence encoding VP2 comprising the antibody fragment inserted within the common VP3 region of AAV9 VP2 may comprise SEQ ID NO: 71. It will be understood that the antibody fragment within those sequences may be replaced by any other sequence coding for an antibody fragment according to the invention, and that the antibody fragment may be inserted in another insertion site as described in the present disclosure. In some embodiments, the antibody fragment is inserted within the common VP3 region of VP2 as described herein. In some embodiments, the antibody fragment is inserted within the VP1/VP2 common region. In some embodiments, the antibody fragment is inserted within the N-terminus of VP2.
In some embodiments, only AAV capsid VP3 is inserted with an antibody fragment, i.e., the AAV capsid comprises an engineered capsid protein VP3 according to the present disclosure, while VP1 and VP2 have not been engineered, i.e. do not comprise an antibody fragment. It will be understood that such an AAV capsid comprises about 50 copies of an engineered capsid protein according to the present disclosure (i.e. 50 copies of an engineered capsid protein VP3; in addition to 5 copies of VP1 and 5 copies of VP2). Figure 10C illustrates the configuration of a capsid comprising 50 antibody fragments, such as knob domains, wherein the antibody fragments are comprised within only VP3 of the AAV capsid. Methods for producing such a capsid may comprise providing different cap genes: 1) a first cap gene comprising a deletion in a splice acceptor for VP2 and VP3 in the cap gene (indicated in Figure 10C with an asterisk over the splice acceptor, in white), so that neither VP2 nor VP3 is produced, while VP1 is produced from this cap gene, and 2) additional cap genetic sequences encoding VP2 and VP3
(either on the same plasmid or on separate plasmids) comprising the antibody fragment (represented in Figure IOC as a diagonal pattern), and co-expressing all cap genes.
In some embodiments, the AAV capsid comprises more than one engineered capsid protein according to the present disclosure.
In some embodiments, the AAV capsid comprises two engineered capsid proteins according to the present disclosure. In some embodiments, the first and second engineered capsid proteins are respectively VP1 and VP2, or VP1 and VP3, or VP2 and VP3.
In some embodiments, the first and second engineered capsid proteins are respectively VP1 and VP2. In such embodiments, the AAV capsid may comprise about 10 copies of an antibody fragment. Figure 10D illustrates the configuration of a capsid comprising 10 antibody fragments, such as knob domains, wherein about 5 antibody fragments are comprised within VP1 and about 5 antibody fragments are comprised within VP2 of the AAV capsid. Methods for producing such a capsid may comprise providing different cap genes: 1) a first cap gene comprising a deletion in a start codon for VP1 and VP2 in the cap gene (indicated in Figure 10D with an asterisk over the start codon, in black), so that neither VP1 nor VP2 is produced, while VP3 is produced from this cap gene, and 2) additional cap genetic sequences encoding VP1 and VP2 (either on the same plasmid or on separate plasmids) comprising the antibody fragment (represented in Figure 10D as a diagonal pattern), and co-expressing all cap genes.
In some embodiments, the first and second engineered capsid proteins are respectively VP1 and VP3. In such embodiments, the AAV capsid may comprise about 55 copies of an antibody fragment. Figure 10E illustrates the configuration of a capsid comprising 55 antibody fragments, such as knob domains, wherein about 5 antibody fragments are comprised within VP1 and about 50 antibody fragments are comprised within VP3 of the AAV capsid. Methods for producing such a capsid may comprise providing two cap genes: 1) a first cap gene comprising a deletion in a start codon for VP2 in the cap gene (indicated in Figure 10E with an asterisk over the start codon, in black), so that VP2 is not produced, and inserting an antibody fragment in the cap gene so that engineered VP1 and VP3 are produced from this cap gene, and 2) additional cap gene encoding VP2 (represented in Figure 10E as a diagonal pattern), and co-expressing both cap genes.
In some embodiments, the first and second engineered capsid proteins are respectively VP2 and VP3. In such embodiments, the AAV capsid may comprise about 55 copies of an antibody fragment. Figure 10F illustrates the configuration of a capsid comprising 55 antibody
fragments, such as knob domains, wherein about 5 antibody fragments are comprised within VP2 and about 50 antibody fragments are comprised within VP3 of the AAV capsid. Methods for producing such a capsid may comprise providing different cap genes: 1) a first cap gene comprising a deletion in a start codon for VP1 and VP2 in the cap gene (indicated in Figure 10F with an asterisk over the start codon, in black), so that neither VP1 nor VP2 are produced, and inserting an antibody fragment in the cap gene so that engineered VP3 is produced from this cap gene, and 2) additional cap gene encoding VP1 and VP2 (either on the same plasmid or on separate plasmids), VP1 that does not contain an antibody fragment and VP2 inserted with an antibody fragment (represented in Figure 1 OF as a diagonal pattern), and co-expressing all cap genes.
Alternative methods for producing such a capsid may comprise providing: 1) a first cap gene comprising a deletion in a splice acceptor for VP2/VP3 in the cap gene (indicated in Figure 10H with an asterisk over the splice acceptor, in white, e.g. “VP1 sa del” as described herein), so that only VP1 is produced from this cap gene, and 2) additional cap gene encoding VP2 and VP3 (either on the same plasmid or on separate plasmids), both containing an antibody fragment (e.g. a knob domain as represented in Figure 1 OH as a diagonal pattern), and coexpressing all cap genes.
An example of this capsid may be produced using a first nucleotide sequence comprising “AAV9 VP1 sa del” (SEQ ID NO:70) encoding a first AAV9 cap gene in which a VP2/VP3 splice acceptor site is deleted, and a second nucleotide sequence comprising a second AAV9 cap gene in which an antibody fragment is comprised and in which the VP1 start codon is deleted. The second nucleotide may comprise SEQ ID NO:75. It will be understood that nucleotide sequences encoding other antibody fragments as described in the present disclosure may be substituted for the nucleotide sequence encoding the antibody fragment used as an example in SEQ ID NO:75, and that the antibody fragment may be inserted in another insertion site as described in the present disclosure, e.g. at different positions within the common VP3 region.
In some embodiments, the AAV capsid comprises three engineered capsid proteins according to the present disclosure. In some embodiments, the first, second and third engineered capsid proteins are respectively VP1, VP2 and VP3.
Figure 10G illustrates the configuration of a capsid comprising 60 antibody fragments (such as knob domains, wherein the antibody fragments are comprised within each of VP1, VP2, and
VP3 of the AAV capsid. Methods for producing such a capsid may comprise a step of providing a cap gene comprising a nucleic sequence comprising a sequence encoding an antibody fragment, such as a knob domain (represented as in Figure 10G as a diagonal pattern), so that each of VP1, VP2, and VP3 comprising an antibody fragment are produced.
An exemplary AAV capsid comprising about 60 copies of an antibody fragment may be produced using nucleotide sequences encompassed by the invention such as AAV9 Gly455 Bl (SEQ ID NO:43), AAV9 Asn498 Bl (SEQ ID NO:44), or AAV9 Gln588 B 1 (SEQ ID NO:45). It will be understood that other nucleotide sequences encoding other antibody fragments as described in the present disclosure may be used, and that the antibody fragment may be inserted in another insertion site as described in the present disclosure, to generate engineered capsids according to the invention. In some embodiments, the antibody fragment is inserted within the common VP3 region of VP1, VP2 and VP3 as described herein. It will be understood that the number of antibody fragments comprised within the AAV capsid may reflect not only whether the antibody fragment is comprised within VP1, VP2, and/or VP3, but also the number of antibody fragments comprised within the VP. For example, 2 antibody fragments may be comprised within VP1, but not within VP2 or VP3, with the resulting capsid comprising 10 antibody fragments in total, all comprised within VP1.
Accordingly, a plurality of antibody fragments may be comprised within VP1, but not VP2 or VP3. In certain embodiments, a plurality of antibody fragments may be comprised only within VP2 but not within VP1 or VP3, or comprised only within VP3 but not within VP1 or VP2, or comprised within VP1 and VP2 but not VP3, or comprised within VP1 and VP3 but not VP2, or comprised within VP2 and VP3 but not VP1, or comprised within each of VP1, VP2, and VP3. A plurality of antibody fragments may be comprised within the same site in an AAV capsid protein, or the plurality of antibody fragments may be comprised within different sites in the AAV capsid protein.
In certain embodiments, each of the antibody fragments in the plurality of antibody fragments is the same antibody fragment. In some embodiments, at least 2 of the antibody fragments in the plurality of antibody fragments are different, e.g., comprising a different sequence and/or different binding properties. An AAV capsid may comprise 2 or more different antibody fragments. It will be understood that in such embodiments wherein the antibody fragments bind to different antigens or targets, there is provided multi-specific engineered capsids, capable of binding more than one antigen or target. In some embodiments, the invention provides a AAV
capsid which comprise two antibody fragments which bind to a different target or antigen of interest (i.e., there is provided bi-specific engineered capsids). It will be understood that in such embodiments, each antibody fragment may be a bovine ultralong CDR-H3, or a portion thereof which binds to an antigen, a knob domain of a bovine ultralong CDR-H3, or a portion thereof which binds to an antigen, and that the number of copies of each antibody fragment and insertion site may differ and the AAV capsid may be generated according to the present disclosure.
Figure 11 shows an illustration of antibody fragments inserted within AAV capsids, wherein two exemplary knob domains have different sequences. The total number of knob domains may be varied.
In some embodiments, 2 different antibody fragments are comprised within VP1 and VP2 respectively but not VP3, or comprised within VP1 and VP3 but not VP2, or comprised within VP2 and VP3 but not VP1.
In some embodiments, a first antibody fragment is comprised within VP1 and a second antibody fragment is comprised within VP2. The resulting AAV capsid may comprise 5 copies of the first antibody fragment and 5 copies of the second antibody fragment, such as knob domains (as illustrated in Fig. 11 A). Methods for producing this capsid may comprise a step of providing 1) a cap gene deleted in start codons for VP1 and VP2 (indicated in Figure 11 A with an asterisk over the start codons, in black), so that no VP1 or VP2 are produced from the cap gene, while VP3 is produced 2) a sequence encoding VP1 comprising a first antibody fragment (represented in Figure 11A as a diagonal pattern) and a second sequence encoding VP2 comprising a second antibody fragment (represented in Figure 11A as a stippled pattern) on the same plasmid or on separate plasmids.
In some embodiments, a first antibody fragment is comprised within VP2 and a second antibody fragment is comprised within VP3. The resulting AAV capsid may comprise 5 copies of the first antibody fragment and 50 copies of the second antibody fragment, such as knob domains (as illustrated in Fig. 1 IB). Methods for producing this capsid may comprise a step of providing 1) a cap gene deleted in start codons for VP1 and VP2 (indicated in Figure 1 IB with an asterisk over the start codons, in black) and inserted with a first antibody fragment, so that no VP1 or VP2 are produced from the cap gene, while an engineered VP3 is produced 2) a sequence encoding VP1 and a second sequence encoding VP2 comprising a second antibody
fragment (represented in Figure 1 IB as a diagonal pattern) on the same plasmid or on separate plasmids.
In some embodiments, a first antibody fragment is comprised within VP1 and a second antibody fragment is comprised within VP3. The resulting AAV capsid may comprise 5 copies of the first antibody fragment and 50 copies of the second antibody fragment, such as knob domains (as illustrated in Fig. 11C). Methods for producing this capsid may comprise a step of providing 1) a cap gene deleted in the splice acceptor for VP2 and VP3 (indicated in Figure 11C with an asterisk over the splice acceptor, in white) and inserted with a first antibody fragment, so that no VP2 or VP3 are produced from the cap gene, while an engineered VP1 is produced, 2) a sequence encoding VP2 and a second sequence encoding VP1 comprising a second antibody fragment (represented in Figure 11C as a stippled pattern) on the same plasmid or on separate plasmids.
Alternative methods for producing such a capsid may comprise providing: 1) a first cap gene comprising a deletion in the start codon for VP1 and VP2 (indicated in Figure 11D with an asterisk over the start codon, in black), and an antibody fragment inserted within VP3 so that only engineered VP3 is produced from this cap gene, and 2) a sequence encoding VP2, and a sequence encoding VP1 comprising an antibody fragment, (either on the same plasmid or on separate plasmids), and co-expressing all genes. When the capsid assembles, it comprises 50 copies of the first antibody fragment and 5 copies of the second antibody fragment.
The AAV capsid may comprise AAV capsid proteins from one or more AAVs. In some embodiments, the AAV capsid may comprise capsid proteins from AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV1 1, AAV12, or AAV13, or a combination thereof. VP1 and/or VP2 and/or VP3 may each be selected from AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof. VP1, VP2, and VP3 may be selected from the same AAV, or may be selected from different AAVs. In some embodiments, VP1 comprises a sequence from a first AAV and is inserted within an antibody fragment, while VP2 and VP3 do not comprise an antibody fragment, and may be from another AAV. In other embodiments, each of VP1, VP2, and VP3 may comprise an antibody fragment, and VP 1 is from a first AAV, VP2 is from a second AAV, and VP3 is from a third AAV.
Standard methods may be used for analyzing the configuration of the capsids such as x-ray crystallography, NMR spectroscopy, or cryogenic electron microscopy (cryo EM). Such methods may be useful in the context of the disclosure to assess the assembly and three- dimensional structure of the capsid and the antibody fragment, which may be visualized with high-resolution using advanced software.
Nucleic acids, vectors, rAA Vs particles and host cells
In one aspect, the invention provides a nucleic acid encoding an engineered capsid protein or a capsid according to the present invention.
In some embodiments, the nucleic acid encoding an engineered capsid protein or a capsid comprises a first nucleotide sequence encoding a capsid protein and a second nucleotide sequence, wherein the second nucleotide sequence encodes an antibody fragment. The first nucleotide sequence may be contiguous with the second nucleotide sequence, e.g., attached via linkage by phosphodiester bonds. In some embodiments, the nucleic acid comprises at least a third nucleotide sequence encoding a linker, wherein at least one linker is position between a capsid protein and an antibody fragment as disclosed in the present disclosure.
In some embodiments, the first nucleotide sequence and the second nucleotide sequence and optionally at least the third nucleotide sequence, are in reading frame with each other. This configuration may facilitate transcription and translation of a gene product (e.g., a protein) comprising the capsid protein and the antibody fragment.
In some embodiments, the first nucleotide sequence comprises an AAV cap gene that encodes at least one AAV capsid protein selected from VP1, VP2, and VP3.
The first nucleotide sequence (e.g., the AAV cap gene) may comprise a mutation in any one of VP1, VP2, and/or VP3, as compared to the nucleotide sequence of a reference AAV cap gene. For example, the start codon of the nucleotide encoding any one of VP1, VP2, or VP3 may comprise a mutation. In some embodiments, the start codon from which synthesis of VP1 starts comprises a mutation that eliminates translation of VP1. In some embodiments, the start codon from which synthesis of VP2 starts comprises a mutation that eliminates translation of VP2. In some embodiments, the start codon from which synthesis of VP3 starts comprises a mutation that eliminates translation of VP3. An exemplary nucleotide sequence is given in SEQ ID NO:39, in which the nucleotide sequence encoding VP2 of AAV9 comprises a mutation in the
start codon. A mutation may comprise a deletion in a start codon or a deletion in a splice acceptor site for any one of VP1, VP2, or VP3.
In some embodiments, the first nucleotide sequence encodes at least one AAV capsid protein comprising VP1, VP2, or VP3, wherein each of VP1 and/or VP2 and/or VP3 are from AAV comprising AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof.
In some embodiments, the nucleic acid encoding an engineered capsid protein or a capsid comprises a nucleotide sequence which encodes an antibody fragment as described in the present disclosure. Examples of suitable sequences are provided in Table 1 (SEQ ID NO: 1, 3, 5, 7, 9, 11). In some embodiments, the nucleic acid encoding an engineered capsid protein or a capsid comprises a nucleotide sequence which encodes an antibody fragment which comprises the sequence SEQ ID NO:2, 4, 6, 8, 10, 12, 26, 27, 30, 31, 34 or 35, or any variant thereof as described herein.
A nucleotide sequence for the AAV9 Rep/Cap is given in SEQ ID NO:38. The VP2 start codon beginning at nucleotide 2424 is indicated in bold, underlined text.
A nucleotide sequence for the AAV9 Rep/Cap comprising a mutation in the VP2 start codon is given in SEQ ID NO: 39. The VP2 start codon beginning at nucleotide 2424 is indicated in underlined text. In this sequence, a G to C mutation removed the start codon in VP2.
Amino acid sequences for AAV9 VP1 (SEQ ID NO: 40), AAV9 VP2 (SEQ ID NO: 41), and AAV9 VP3 (SEQ ID NO: 42) are provided. In each sequence, a Gly (G), an Asn (N), and a Gin (Q) residue are indicated in bold, underlined text. According to the numbering in SEQ ID NO: 40, the residues are Gly455, Asn498, and Gln588. According to the numbering in SEQ ID NO: 41, the residues are Gly318, Asn361, and Gln451. According to the numbering in SEQ ID NO:42, the residues are Gly253, Asn296, and Gln386. Corresponding acid nucleic sequences are provided in SEQ ID NO: 48, 49, 50 respectively.
Nucleotide sequences comprising a sequence encoding a capsid protein inserted with an antibody fragment include sequences presented in Table 2. In some embodiments, the nucleic acid encoding an engineered capsid protein or a capsid comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 43-59 and SEQ ID NO: 70-94.
In another aspect, the invention provides a vector comprising the nucleic acid encoding an engineered capsid protein according to the present invention. The vector may be a plasmid or
a viral vector (i.e. an AAV vector). Therefore, there is provided an AAV vector comprising a nucleic acid encoding an engineered capsid protein, wherein the engineered capsid protein comprises an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR-H3, or a portion thereof. There is also provided an AAV vector comprising a nucleic acid encoding an engineered capsid protein, wherein the engineered capsid protein comprises an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a knob domain of a bovine ultralong CDR-H3, or a portion thereof. In some embodiments, the antibody fragment binds to an antigen.
Another aspect of the present disclosure relates to a recombinant AAV (rAAV) particle comprising an engineered capsid protein and/or an engineered capsid and/or a nucleic acid and/or a vector, as described herein. Therefore, there is provided a recombinant AAV (rAAV) particle comprising an engineered capsid protein or an engineered capsid comprising an engineered capsid protein, wherein the engineered capsid protein comprises an AAV capsid protein and an antibody fragment which is a bovine ultralong CDR-H3 or a portion thereof. There is also provided a rAAV particle comprising an engineered capsid protein or an engineered capsid comprising an engineered capsid protein, wherein the engineered capsid protein comprises an AAV capsid protein and an antibody fragment which is a knob domain of a bovine ultralong CDR-H3 or a portion thereof. In some embodiments, the engineered capsid protein, or engineered capsid, or rAAV, particle does not comprise a stalk of a bovine ultralong CDR-H3. In some embodiments, the antibody fragment binds to an antigen.
In some embodiments, the rAAV particle comprises a nucleic acid sequence that is not of AAV origin (e.g., a nucleic acid heterologous to AAV). The heterologous nucleic acid may be a nucleic acid sequence of interest. In some embodiments, the heterologous nucleic acid is a single stranded DNA. In some embodiments, the heterologous nucleic acid is a transgene. In some embodiments, the recombinant AAV (rAAV) particle comprises a transgene. In some embodiments, the transgene is encapsulated within the rAAV particle. In some embodiments, the transgene is comprised in a rAAV vector inside the rAAV particle. It will be understood that the rAAV may provide a vector to deliver a transgene into a host cell, wherein the transgene is delivered and expressed in the host cell.
In some embodiments, the transgene encodes a peptide, a polypeptide or a nucleic acid molecule. In some embodiments, the nucleic acid molecule is a small interfering RNA (siRNA), small or short hairpin RNA (shRNA), microRNA (miRNA).
The nucleic acid constructs, AAV vectors and viral particles described herein may be prepared by standard means known in the art. Thus, well established methods of production (including transfection, packaging and purification methods) can be used to prepare a suitable vector preparation.
In certain embodiments, the rAAV vectors and particles further comprise at least one genetic element, such as an additional nucleic acid encoding a promoter, an intron, an inverted terminal repeats (ITR), a poly A, or a stuffer sequence. A nucleic acid construct of the invention and further comprising at least one ITR flanking said nucleic acid construct in 5’ and/or 3’, preferably at least two ITRs (one at each end of the nucleic acid construct of the invention, i.e. a 5TTR and a 3’ITR). An ITR sequence acts in cis to provide a functional origin of replication and allows for integration and excision of the nucleic acids construct from the genome of a cell. One or more of the ITRs may be obtained from viral genomes, such as AAV genomes, having different serotypes or may be a chimeric or mutant ITR. An example of a mutant ITR is one having a deletion of a trs (terminal resolution site). This deletion allows for continued replication of the genome to generate a single- stranded genome which contains both coding and complementary sequences i.e., a self-complementary viral genome (e.g. self-complementary AAV genome). This allows for bypass of DNA replication in the target cell, and so enables accelerated transgene expression. Preferred ITR sequences are those of from AAV genomes, such as AAV2, AAV9 and variants thereof.
In another aspect, the present disclosure provides a host cell comprising a nucleic acid construct of the invention or a vector of the invention.
The present invention also provides a host cell which produces an AAV viral particle as disclosed herein. Any suitable host cell may comprise a nucleic acid construct of the invention or a vector of the invention. Further, any suitable host cell can be used to produce a viral particle of the invention. In the context of the present invention as a whole, the host cell is preferably an insect cell or a mammalian cell. Non-limiting examples of such cells are sf9, HEK293 (including e.g., HEK293F, HEK293S or HEK293T), BHK or CHO cells. In a non-limiting example, the host cell may comprise a nucleic acid construct or a vector of the invention, and further comprise an additional nucleic acid construct or a vector providing the minimal additional genome sequences needed for packaging of the nucleic acid construct in the viral particle (such as in the form of an AAV helper plasmid providing other essential genes).
In one aspect, the disclosure provides a method for producing an AAV particle comprising an engineered capsid protein and a transgene, said method comprising: a) providing a first vector comprising a nucleotide sequence encoding an AAV capsid protein, a second nucleotide sequence encoding the antibody fragment; wherein the first nucleotide sequence and the second nucleotide sequence are genetically fused optionally via a nucleotide sequence coding for a linker; b) providing a second vector comprising the transgene c) providing a third, Helper vector d) transfecting a host cell with the first, second and third vector; e) recovering the AAV particle from the host cell.
Optionally, the method comprises providing at least an additional vector encoding an AAV capsid. It will be understood that the number of nucleotide sequences will vary depending on the cloning strategy as described in the present disclosure. Different cloning strategies are described herein as examples and may be used to control which of VP1, VP2, and/or VP3 comprise the antibody fragment in the rAAV. For example, when the antibody fragment is comprised within the common VP3 region, each of VP1, VP2, and VP3 as translated from the AAV cap gene will comprise the antibody fragment.
In contrast, if the AAV cap gene comprises a mutation resulting in that VP 1 and/or VP2 and/or VP3 is not produced then, providing an additional nucleotide sequence (either in a same or different vector) encoding said VP(s) is necessary to produce all VPs (VP1, VP2 and VP3) in the rAAV. Therefore, the cloning/ transfection strategy may require transfection of multiple nucleotide sequences encoding all the AAV capsid proteins (engineered, i.e. comprising an antibody fragment, or non-engineered). Also, the transfection of 2, 3, 4, or 5 nucleotide sequences may be used, for example, to maintain a high production efficiency.
Accordingly, the method may comprise providing n nucleotide sequences, each encoding an AAV capsid protein (engineered or not), wherein n is an integer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; and transfecting the cell line with the n nucleotide sequences. When n is 2 or higher, the nucleotide sequences may be provided together, e.g., combined into one nucleotide sequence or together on one plasmid. Alternatively, the 2 or more nucleotide sequences may be provided separately from one another, e.g., on separate plasmids.
Amino acid sequences and nucleic acid sequences coding for antibody fragments for use in the present invention can be obtained by methods previously described, for example in WO2021191424. The method may comprise the following steps: a) immunising a bovine with an immunogenic composition, and; b) isolating total RNA from PBMC or secondary lymphoid organ, or antigen-specific memory B-cells, and; c) amplifying the cDNA of the ultralong CDR-H3, and; d) sequencing an ultralong CDR-H3 or portion thereof; wherein the immunogenic composition comprises an antigen of interest or immunogenic portions thereof, or DNA encoding the same.
Methods for immunizing a bovine according to step a) and isolating total RNA according to step b) are well known in the art.
Methods for amplifying the cDNA of the ultralong CDR-H3 are also well known in the art. Advantageously, at step c) a method for amplifying directly the cDNA of ultralong CDR-H3 and discriminate from standard CDR-H3 may be used. The method may comprise a primary polymerase chain reaction (PCR) with primers flanking CDR-H3, annealing to the conserved framework 3 and framework 4 of the VH, to amplify all CDR-H3 sequences, irrespective of their length or amino acid sequence. The method may additionally comprise a second round of PCR with stalk primers to specifically amplify ultralong sequences from the primary PCR.
In one embodiment, the method for amplifying the cDNA of CDR-H3 comprises:
1) a primary PCR using primers flanking CDR-H3, annealing to the conserved framework 3 and framework 4 of the VH, to amplify all CDR-H3 sequences, and
2) a second round of PCR using stalk primers to specifically amplify ultralong sequences from the primary PCR.
Step d) may be performed according to methods well known in the art such as direct nucleotide sequencing. The antibody fragment and portion thereof, for example the knob domain, may be defined as described in the present disclosure and its sequence isolated.
Additionally, sequences coding antibody fragments for use in the present invention may be derived from libraries, as described for example in WO2021191424.
Following assembly of a rAAV comprising a capsid protein that comprises an antibody fragment, the rAAV may be screened for functional properties and/or for manufacturability (e.g., viral production). For example, the rAAV may be screened to determine if the antibody fragment retains its binding affinity for its target, or to an antigen of interest, if the capsid protein has assembled, titers of rAAV produced, and/or transduction efficiency. In some embodiments, functional properties and/or manufacturability may be determined for a plurality of rAAVs, wherein each rAAV comprises a capsid protein that comprises an antibody fragment or combination of antibody fragments, so that an rAAV with desired properties may be selected.
In certain embodiments, screening may be performed by introducing antibody fragments into one or more sites on a rAAV. Diverse antibody fragments may be inserted into the site(s) on rAAV to generate an rAAV library, for example, by inserting nucleic acids, each encoding a different antibody fragment into an AAV cap gene and generating a library plasmid pool. The insertion may be at specific sites in the cap gene, or may be at random sites in the cap gene. In some embodiments, all 60 subunits of the capsid gene express an antibody fragment, for example, each of the 60 subunits may be engineered to express a copy of the same antibody fragment. In some embodiments, fewer than 60 subunits of the capsid gene express an antibody fragment. The library plasmid pool may be used to transfect a producer cell line, such as HEK293 cells, in order to produce the rAAV display library. The rAAV library may be screened for binding to a target and/or transduction efficiency of target cells in order to select a rAAV with desired properties resulting from the insertion of antibody fragment(s) according to the present disclosure.
In some embodiments, there is provided methods for purifying a rAAV particle as described in the present disclosure, said method comprising the steps of a) providing a composition of rAAVs comprising an antibody fragment e.g. obtained according to methods described in the present disclosure, wherein the composition comprises rAAVs and other components such as impurities, b) loading the composition obtained in step a) onto a binding substrate to the antibody fragment such that the rAAVs comprising the antibody fragment are retained on the substrate, c) recovering the rAAVs, comprising the antibody fragment thereby isolating the rAAV from other components in the AAV preparation. The binding substrate may be a column or one or more magnetic beads on which a target of the antibody fragment has been immobilized. The rAAV preparation may be a crude lysate or may be a purified or partially purified, for example, after filtration or chromatography steps.
A further aspect of the present disclosure relates to a method for improving transduction of a target cell by a rAAV, wherein the rAAV comprises a capsid protein comprising an antibody fragment. The antibody fragment may bind to at least one specific molecule on a target cell (e.g., an antigen or a target molecule), and the rAAV may transduces the target cell specifically, selectively, or preferentially as compared to the control rAAV (i.e. the corresponding AAV which does not comprise the engineered capsid protein, i.e. which does not comprise an antibody fragment). The AAV capsid protein may comprise VP1, VP2, or VP3. Each of VP1 and/or VP2 and/or VP3 may be from an AAV, wherein the AAV comprises AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof.
The nucleic acid constructs, vectors and/or AAV viral particles herein described can be formulated into pharmaceutical compositions. Therefore, herein provided is a pharmaceutical composition comprising a nucleic acid construct of the invention, a vector of the invention and/or an AAV viral particle of the invention together with a pharmaceutically acceptable carrier, excipient, and/or diluent.
The pharmaceutical composition of the invention may comprise a pharmaceutically acceptable excipient, carrier, buffer, stabilizer, and/or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may be determined by the skilled person according to the route of administration.
The pharmaceutical composition may be provided in liquid form. Liquid pharmaceutical compositions generally include a liquid carrier such as water, or physiological saline solution. For injection at the site of affliction, the active ingredient will be in the form of an aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer’s Injection, Lactated Ringer’s Injection, Hartmann’s solution. Preservatives, stabilizers, buffers, antioxidants and/or other additives may be included, as required.
Dosages and dosage regimes can be determined within the normal skill of the medical practitioner responsible for administration of the composition.
In one aspect, there is provided an AAV vector or AAV particle or pharmaceutical compositions as described herein, for use as a medicament.
In another embodiment, the present invention also encompasses the use of the nucleic acid constructs, vectors, viral particles and/or pharmaceutical compositions described herein for the treatment or the prevention of a disease or condition in a patient.
Herein provided is a nucleic acid construct of the invention, a vector of the invention, an AAV viral particle of the invention, and/or a pharmaceutical composition of the invention for use in a method of treating or preventing a disease or a condition in a patient in need thereof. The present invention further provides a method of treating or preventing a disease or condition in a patient in need thereof, said method comprising administering to the patient a therapeutically effective amount of a nucleic acid construct, a vector, a viral particle, and/or a pharmaceutical composition of the invention. The present invention also provides the use of a nucleic acid construct, a vector, a viral particle, and/or a pharmaceutical composition of the invention for the manufacture of a medicament for the treatment or prevention of a disease or condition in a patient in need thereof.
Brief Description of the Figures
Figure 1 shows an illustration of engineered viruses comprising capsid proteins inserted with an antibody fragment, such as a knob domain (Fig. lA, 1C), or a bovine ultralong CDR-H3 (Fig. IB, ID), optionally via a linker (Fig. IE- IF respectively).
Figure 2 shows an alignment of VP1, VP2, and VP3 amino acid sequences from AAV9 (top, middle and bottom line respectively).
Figure 3 shows an alignment of an AAV capsid protein from representative AAVs.
Figure 4 shows a diagram for the design of AAVs Cap constructs for the production of capsid proteins inserted with antibody fragments within the N-terminus of VP2. (AAV9 Del VP2: AAV9 Cap construct with a VP2 start codon mutation, as indicated with AAV9 VP2 N- term antibody fragment construct. The antibody fragment is shown as white rectangle).
Figure 5 shows a diagram for the design of AAVs Cap constructs for the production of capsid proteins inserted with antibody fragments within the common VP3 region. The antibody fragment is shown as white rectangle.
Figure 6 shows silver staining of VP2-N-term antibody fragments engineered rAAV that were purified from AAV9 affinity column. 2 pl of Precision Plus Protein Unstained Protein
Standards (Bio-rad Laboratories) were used in the first lane. 5 pl (about 5E10 viral particles) of purified rAAV were loaded on to each lane.
Figure 7 shows a Western blot of VP2-N-term antibody fragment engineered rAAV that were purified from AAV9 affinity column. 10 pl of Chameleon Duo pre-stained protein ladder (Li- Cor Biosciences) were used in the first and last lane. In Figure 7A, 2pl (about 2E10 viral particles) of purified rAAV were loaded on to each lane. In Figure 7B, 10 pl of rAAV elution from C5 protein immobilized on Pierce NHS-activated magnetic beads were loaded on to each lane. In Figure 7C, 10 pl of rAAV elution from uncoated magnetic beads that capped with ethanolamine as control were loaded on to each lane.
Figure 8 shows transduction of VP2-N-term antibody fragments engineered rAAV in Ad-293 HEK GPLC5 cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 8A shows rAAV with MOI=5E4 vg/cell, p<0.0001 for one-way ANOVA test, p<0.0001 for multiple comparisons between engineered rAAV and AAV9; Figure 8B: rAAV with MOI=1E5 vg/cel, p<0.0001 for one-way ANOVA test, p<0.0001 for multiple comparisons between engineered rAAV and AAV9; Figure 8C: rAAV with MOI=2E5 vg/cell, p<0.0001 for one-way ANOVA test, p<0.0001 for multiple comparisons between engineered rAAV.
Figure 9 shows binding to human C5 (Fig.9A). No binding was detected in wild-type AAV9 or to human homologue C3b (Fig.9B).
Figure 10 illustrates engineering strategies of antibody fragments inserted within AAV capsids, showing that the number of antibody fragments inserted within AAV capsids such as knob domains as illustrated, may be varied.
Figure 11 illustrates engineering strategies where two antibody fragments are inserted within AAV capsids, wherein two exemplary knob domains have different sequences (i.e. bispecific AAV capsids). The number of combined knob domains may be varied.
Figure 12 shows transduction of various configurations of engineered rAAV9 in HEK293 cells expressing the target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 12A shows transduction of rAAV9 comprising the antibody fragment B3.2 at a loop insertion site in VP2 and VP3. Figure 12A showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of
1E4 vg/cell and 1E5 vg/cell respectively, and p=0.0154 at dose of 1E3 vg/cell. Figure 12B shows transduction of rAAV9s comprising the antibody fragment B3.2 at a loop insertion site in VP2, and Figure 12C shows transduction of rAAV9 comprising the antibody fragment B3.2 at a loop insertion site on VP1. Figure 12B showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK GPI-C5 cells and Ad-293 HEK WT cells at dose of lE3vg/cell, 1E4 vg/cell and 1E5 vg/cell respectively. Figure 12C showed p<0.0001 for two-way ANOVAtest, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E4 vg/cell and 1E5 vg/cell respectively. Figure 12D shows the transduction of wild-type AAV9. Figure 12D showed p=0.0029 for two- way ANOVA test, p=0.0019 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E3 vg/cell and p=0.004 at lE4vg/cell. Solid circle: Ad-293 HEK GPI-C5 cells; empty circle: Ad-293 HEK WT cells. Figure 12E shows a Western blot for VP proteins.
Figure 13 shows transduction of an engineered rAAV9s in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 13 A shows transduction of rAAV9 comprising the antibody fragment D3.1 at the N-terminus of VP2. Figure 13 A showed p<0.0001 for two-way ANOVAtest, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell. Figure 13B shows transduction of rAAV9 comprising the antibody fragment D3.2 at a loop insertion site. Figure 13B showed p<0.0001 for two-way ANOVAtest, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E4 vg/cell and 1E5 vg/cell respectively. Figure 13C shows transduction of wild-type AAV9. Figure 13C showed p=0.01 for two-way ANOVA test, p=0.0005 for multiple comparisons between Ad-293 HEK target cells and Ad- 293 HEK WT cells at dose of 1E5 vg/cell.
Figure 14 shows transduction of an engineered rAAV9s in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 14A shows transduction of rAAV9 comprising the antibody fragment E3.1 at the N-terminus of VP2. Figure 14A showed p<0.0001 for two-way ANOVAtest, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell, 0.0085 for lE4vg/cell, and 0.0176 for lE3vg/cell. Figure 14B shows transduction of rAAV9 comprising the antibody fragment E3.2 at a loop insertion site. Figure 14B showed p<0.0001 for two-way ANOVA test,
pO.OOOl for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell and 0.0097 for lE4vg/cell. Figure 14C shows transduction of wildtype AAV9. Figure 14C showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell.
Figure 15 shows transduction of an engineered rAAV9s in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 15A shows transduction of rAAV9 comprising the antibody fragment G3.1 at the N-terminus of VP2. Figure 15A showed p<0.0001 for two-way ANOVAtest, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell, 0.0070 for lE4vg/cell, and 0.0202 for lE3vg/cell. Figure 15B shows transduction of rAAV9 comprising the antibody fragment G3.2 at a loop insertion site. Figure 15B showed p=0.001 for two-way ANOVA test, p=0.0003 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell. Figure 15C shows transduction of wild-type AAV9. Figure 17C showed p=0.001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad- 293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell.
Figure 16 shows transduction of an engineered rAAVl in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 16A shows transduction of rAAVl comprising the antibody fragment B3.1 at the N-terminus of VP2. Figure 16A showed p=0.1315 for two-way ANOVA test. Figure 16B shows transduction of wild-type AAV1. Figure 16B showed p=0.0003 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E4 vg/cell and 0.04 at 1E5 vg/cell.
Figure 17 shows transduction of an engineered rAAV6 variant (“AAV6var”) in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 17A shows transduction of rAAV6var comprising the antibody fragment B3.1 at the N-terminus of VP2. Figure 17A showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell and lE4vg/cell. Figure 17B shows transduction of AAV6var that does not comprise an
antibody fragment. Figure 17B showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell.
Figure 18 shows transduction of an engineered rAAV8s in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 18A shows transduction of rAAV8 comprising the antibody fragment B3.1 at the N-terminus of VP2. Figure 18A showed p<0.0001 for two-way ANOVAtest, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell and lE4vg/cell. Figure 18B shows transduction of rAAV8 comprising the antibody fragment B3.2 at a loop insertion site. Figure 18B showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell, lE4vg/cell and lE3vg/cell. Figure 18C shows transduction of AAV8 wild-type (i.e. not inserted with an antibody fragment). Figure 18C showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E5 vg/cell. Figure 18D shows a Western blot for VP proteins.
Figure 19 shows transduction of an engineered rAAV8 in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 19A shows transduction of rAAV8 comprising the antibody fragment E3.1 at the N-terminus of VP2. Figure 19A showed p<0.0001 for two-way ANOVAtest, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E6 vg/cell and 0.0017 at lE5vg/cell. Figure 19B shows transduction of AAV8 wild-type. Figure 19B showed p=0.0002 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad- 293 HEK WT cells at dose of 1E6 vg/cell.
Figure 20 shows transduction of an engineered rAAVTT in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 20A shows transduction of rAAVTT comprising the antibody fragment B3.1 at the N-terminus of VP2. Figure 20A showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad- 293 HEK target cells and Ad-293 HEK WT cells at dose of 1E6 vg/cell and 1E5 vg/cell. Figure 20B shows transduction of AAVTT that does no comprise an antibody fragment. Figure 20B
showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad- 293 HEK target cells and Ad-293 HEK WT cells at dose of 1E6 vg/cell.
Figure 21 shows transduction of an engineered rAAVTT in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 21A shows transduction of rAAVTT comprising the antibody fragment G3.1 at the N-terminus of VP2. Figure 21A showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad- 293 HEK target cells and Ad-293 HEK WT cells at dose of 1E6 vg/cell and 0.0012 at lE5vg/cell. Figure 21B shows transduction of AAVTT, not engineered. Figure 21B showed p<0.0001 for two-way ANOVAtest, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 1E6 vg/cell and 0.0082 at lE5vg/cell.
Figure 22 shows transduction of an engineered rAAV6 variant (“AAV6var”) in HEK293 cells expressing a target of an antibody fragment, as compared to HEK293 WT control cells. Four replicates were tested for each dose. Error bars show the SD of four replicates. Figure 22A shows transduction of rAAV6var comprising the antibody fragment D3.1 at the N-terminus of VP2. Figure 22A showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 5E5 vg/cell. Figure 22B shows transduction of AAV6var that has not been inserted with an antibody fragment. Figure 22B showed p<0.0001 for two-way ANOVA test, p<0.0001 for multiple comparisons between Ad-293 HEK target cells and Ad-293 HEK WT cells at dose of 5E5 vg/cell and 0.0002 at 1E5 vg/cell.
Figure 23 shows a Western blot of various engineered rAAV9s
Figure 24 shows a Western blot of engineered rAAVs from different serotypes.
Example 1: Engineering of recombinant AAV (rAAV)
AAV capsid proteins were engineered to generate capsid proteins, and rAAVs, comprising an antibody fragment, wherein the antibody fragment comprised a bovine ultralong CDR-H3, or a knob domain of a bovine ultralong CDR-H3.
Sequences of bovine ultralong CDR-H3 and portions thereof, for example knob domains, were obtained according to methods previously described in WO2021191424. Cows were
immunized using various (7) immunogens, to generate antibody fragments described herein, that bind to 7 different targets. In the following example, letters A to G respectively refer to antibody fragments that bind to each one of the 7 targets. For one same target, e.g. “A”, number 1 (i.e. “Al”) refers to a knob domain of a bovine ultralong CDR-H3, number 2 (i.e. “A2”) refers to the whole bovine ultralong CDR-H3. Number 3 and variants (e.g. 3.1, 3.2) each refer to an antibody fragment which is a knob domain, fused to at least one linker. Number 4 and variants (e.g. 4.1, 4.2) each refer to an antibody fragment which is a bovine ultralong CDR-H3, fused to at least one linker. Sequences of antibody fragments including as exemplified herein are represented in Table 1. Linkers are indicated in italics.
The antibody fragments were inserted within capsid proteins of an AAV according to the present disclosure. In one approach, capsid protein VP2 of AAV9 was engineered by inserting an antibody fragment within the N-terminus of VP2. In this approach, firstly, a deletion in VP2 was made in a first cap gene of AAV (“AAV9 del VP2”), so that VP2 was not produced from this cap gene, while VP1 and VP3 were produced. Then, a second cap gene was provided, where VP2 comprised an antibody fragment. When expressed together, the two cap genes produced VP1 and VP3 that did not comprise an antibody fragment (e.g. a knob domain) whereas VP2 did. The corresponding design of Rep/Cap constructs is illustrated in Figure 4.
In another approach, antibody fragments were inserted within the common VP3 region of a cap gene of AAV9, resulting in engineered rAAV9 comprising VP1, VP2 and VP3 proteins that all comprise an antibody fragment. The corresponding design of Rep/Cap constructs is shown in Figure 5.
Table 2 provides sequences for AAV9 VP1 (SEQ ID NO: 40), AAV9 VP2 (SEQ ID NO: 41), and AAV9 VP3 (SEQ ID NO: 42). Corresponding nucleic acid sequences are provided in SEQ ID NO: 48-50. Insertion sites Gly455, Asn498, Gln588 in the common VP3 region are according to the numbering in SEQ ID NO: 40 (VP1) and are indicated in bold, underlined text. Corresponding Gly (G), Asn (N), and Gin (Q) residues in VP2 are Gly318, Asn361, and Gln451 according to the numbering in SEQ ID NO: 41, and Gly253, Asn296, and Gln386 in VP3 according to the numbering in SEQ ID NO:42. Unless otherwise specified, in the context of the present disclosure, insertion sites Gly455, Asn498, Gln588 in the common VP3 region will refer to those residues at those exact positions in VP1 with reference to SEQ ID NO:40 or any corresponding position in VP2 or VP3 as described herein.
DNA sequences encoding engineered capsid proteins inserted with antibody fragments were synthesized de-novo and cloned in backbone plasmids according to standard cloning methods allowing the production of recombinant expression vector.
Sequences of Rep/Cap of AAV9, and engineered capsid proteins, are represented in Table 2. In SEQ ID NO:38 (Wild-type Rep/Cap), the VP2 start codon beginning at nucleotide 2424 is indicated in bold, underlined text. A nucleotide sequence for the AAV9 Rep/Cap comprising a mutation in the VP2 start codon is given in SEQ ID NO: 39. The VP2 start codon beginning at nucleotide 2424 is indicated in bold, underlined text. In this sequence, a G to C mutation (ACG>ACC) removed the start codon in VP2. This mutant will be referred to as “AAV9 del VP2”.
Representative sequences of AAV9 (Rep/Cap) comprising an antibody fragment inserted at the N-terminal of VP2 is provided in SEQ ID NO: 47. Representative sequences of AAV9 (Rep/Cap) comprising an antibody fragment inserted after Gly455, Asn498, Gln588 in the common VP3 region are provided respectively in SEQ ID NO: 43, 44 and 45. Isolated sequences of VP1, VP2 and VP3 inserted as those positions in the common VP3 region are represented in SEQ ID NO: 51-53 (respectively VP1, VP2, VP3 Gly455), SEQ ID NO: 54-56 (respectively VP1, VP2, VP3 Asn498), SEQ ID NO: 57-59 (respectively VP1, VP2, VP3 Gln588). In those sequences, the antibody fragment Al or Bl (knob domain) was represented. It will be understood that the engineered capsid proteins comprising alternative antibody fragments have been generated using similar methods of insertions and sequences can be readily obtained by replacing the Al or Bl sequence with any other sequence coding for an antibody fragment, including as exemplified herein and/or as provided in Table 1.
Rep/cap were expressed under the control of a CMV promoter. SEQ ID NO: 46 provides an example of a nucleotide sequence including a CMV promoter indicated in lower case text, an antibody fragment indicated in bold, underlined text; AAV9 VP2 indicated in double underlined text; and SV40 polyA is in italic lowercase text.
The AAV helper plasmid pALD-X80 was purchased from Aldevron, LLC. The cis payload plasmid is ssAAV ITR-CMV-eGFP-SV40-ITR.
Linkers used in the following examples include a linker comprising the sequence GGGGG (SEQ ID NO: 95) (the corresponding nucleotide sequence used in the example comprises ggtggaggcgggggt (SEQ ID NO:96), or a linker comprising the sequence GGGGSGGGGS (or “GGGGSX2” or “G4Sx2” (SEQ ID NO: 97). Corresponding nucleotide sequences used in the
example comprise the sequence ggt gga ggc ggg agt gga ggt ggc ggg agt (SEQ ID NO: 98) and ggc ggg ggt gga agt ggc gga ggt gga agt (SEQ ID NO: 99). For example, when two linkers are used, each GGGGSX2 linker located at each N-or C-terminal end of the antibody fragment, one linker may be encoded by sequence SEQ ID NO: 98 and the other linker may be encoded by sequence SEQ ID NO: 98 or SEQ ID NO: 99. Alternatively, when two linkers are used, each GGGGSX2 linker located at each N-or C-terminal end of the antibody fragment, one linker may be encoded by sequence SEQ ID NO: 99 and the other linker may be encoded by sequence SEQ ID NO: 99.
As described above, antibody fragments exemplified are represented in Table 1, including sequences of antibody fragments genetically fused to at least one linker as described herein (represented in italic).
Recombinant AAV (rAAV) vectors comprising engineered capsid proteins according to the present disclosure were produced by standard transfection methods suitable for producing rAAV, for example as described below.
Expi293 cells (Thermo Fisher) were passaged using Expi293 Expression Media (Thermo Fisher) in shake flasks. The Expi293 cells were cultured on an orbital shaker in an Eppendorf incubator. To set up the production flasks, a shake flask was inoculated the day before transfection. Viable cell density was calculated using a Vi-Cell Blu (Beckman Coulter).
A transfection complex was created for each flask as follows for the production flask with a 30 mL working volume. Separately, the Cis plasmid, the engineered Rep/Cap plasmid (AAVs), and the helper plasmid (pALD-X80) (for AAVs inserted with antibody fragments in the common VP3 region); or , the Cis plasmid, the helper plasmid (pALD-X80), and the engineered Rep/Cap plasmids (AAVs), including the AAV9 Del VP2 containing plasmid (for AAVs inserted with antibody fragments in the VP2 N-terminal region only) were diluted in Opti-PRO serum free media, then added Polyethylenimine (PEI) MAX (Polysciences Inc), vortexed and incubated for at room temperature. Transfection complexes were then added to shake flasks containing cells. Cells were cultured with the transfection mixture with constant agitation.
After growth, flasks were spiked with the concentrated AAV lysis buffer and Benzonase (MilliporeSigma). This mixture was incubated with constant agitation. The mixture was clarified by centrifugation. Samples were stored at -80°C until further analysis. rAA V genome copies titer determination
The rAAV sample was thawed at room temperature, then briefly vortexed and centrifuged for one minute. After this, each sample was added to an individual well of a 96-well PCR plate. The plate was then transferred to a Bio-Rad thermal cycler and was heated for, followed by heat inactivation, then cooled.
The rAAV sample was mixed with a ddPCR master mix composed of Supermix for Probes (No dUTP; Bio-Rad Laboratories), forward primer GAACCGCATCGAGCTGAA (SEQ ID NO: 100), reverse primer TGCTTGTCGGCCATGATATAG (SEQ ID NO: 101), Probe 6- Fam/Zen/3’IBFQ: ATCGACTTCAAGGAGGACGGCAAC (SEQ ID NO: 102), and DNase- free water. This primer set targets eGFP transgene region. Each sample was run in duplicate in a 96-well PCR plate.
The plate was placed into the Bio-Rad QX-200 droplet generator and droplets were generated per the manufacturer’s instructions. After droplet generation, the plate was heat-sealed with a foil covering and placed into a Bio-Rad thermocycler programmed to run one step of 95°C for 10 minutes, followed by 40 cycles of 95°C for 30 seconds and 56°C for 1 minute, then one step of 98°C of 10 minutes, final hold at 4°C. For PCR amplification steps, the ramping was set at 2.5°C/seconds.
Once complete, the plate was placed into a Bio-Rad QX200 droplet for droplet reading per the manufacturer’s instruction. The concentration of vector genomes (VG/mL) was quantified using the following formula:
VG/ML: X = [(aY)(1000/b)], where:
X is VG/mL; a is volume of the ddPCR reaction (25 pl);
Y is the ddPCR readout in copies per microliter; b is the volume of vector in the ddPCR (5 pL);
Assay acceptance criteria were defined as follows: The %CV between the replicates must be <15%; each reaction well must have >1,000 accepted droplets.
Viral particle quantification by ELISA
The viral particle titer was determined by AAV9 titration ELISA kit (PROGEN) according to the manufacturer’s instructions and mouse monoclonal ADK9 antibody was used for both the
capture and detection steps. Washes in the provided IX Assay Buffer (AS SB) were performed between each step using a AquaMax 4000 microplate washer (Molecular Devices). Samples were detected with a SpectraMax M5e plate reader (Molecular Devices). Capsid titers were then interpolated from the standard curve based on reading results. Results
VG and VP titers obtained for rAAV9 engineered- VP2 N-term inserted antibody fragments are represented in Table 3. Wild-type AAV9 and AAV9 del VP2 (VP2 deleted) were used as controls.
VG and VP titers obtained for rAAV9 engineered with antibody fragments inserted within the common VP3 region (Gly455, Asn498) are represented in Table 4. Wild-type AAV9 was used as control. In this experiment, the productivity of AAV9 Gln588 inserted antibody fragment was lower (data not shown).
The results indicate that rAAV9 with engineered capsid proteins (comprising a viral vector with a CMV promoter driven eGFP transgene) could be successfully produced without significant impact on capsid assembly.
Table 3: Productivity of rAAV9 engineered- VP2 N-term inserted antibody fragments
Table 4: Productivity of rAAV9 engineered-common VP3 region inserted antibody fragments
Example 2: Assessment of the productivity of purified rAAV particles
Some rAAV samples obtained as described in the previous example were further purified as follows. The rAAV samples were purified with POROS CaptureSelect AAV9 Affinity Resin (ThermoFisher) packed onto Tricorn 10/50 column. The chromatography system was run with AKTA Avant 150 (Cytiva). The column was first equilibrated. The clarified upstream sample was loaded on to the column. The column was washed with equilibration buffer. The column was then eluted with elution buffer. The pH was adjusted. The column can be reused after stripping, cleaning, and equilibration. The loaded materials, flow through, and eluates were collected for further analysis. rAAV genome copies titer and viral particle quantification were determined using the methods described in the previous example. Recovery rates were also calculated according to standard methods.
In addition, silver staining of VP protein gel was performed; about 5.0E10 purified virus particles for each sample was heated at 95°C in the presence of loading buffer and separated on a NuPAGE Novex Bis-Tris 4-12% protein mini-gel (Invitrogen). The gel was stained based on the chemical reduction of silver ions to metallic silver on a protein band using SilverQuest silver staining kit (Invitrogen) according manufacturer’s protocol. Once the gel was stained, it was imaged using Chemidoc Imager (Bio-Rad Laboratories) with Imaging Lab software (BioRad Laboratories). The results are presented in Table 5 and 6.
Table 5: Productivity of various purified rAAV9 engineered- VP2 N-term antibody fragments
Table 6: Recovery rates of rAAV9 engineer ed-VP2 N-term antibody fragments
The results show that engineered rAAV9 viral particles having a nucleic acid comprising a CMV promoter driving expression of eGFP transgene could be successfully produced and purified with AAV9 affinity column.
The recovery rates for engineered rAAV9 were close to rAAV9 with high titer yield. In addition, figure 6 shows the expected sizes for the antibody fragment N-term fused VP2 and the wild-type AAV9 VP2, in addition to intact VP1 and VP3.
Example 3: Assessment of antigen binding of the engineered rAAVs
In this example, the binding properties of the antibody fragments when inserted within rAAV were assessed. One of the target C5 was used as an illustration.
Purified C5 protein was immobilized on Pierce NHS-activated magnetic beads (ThermoFisher). Uncoated magnetic beads that were capped with ethanolamine were used as control for immunoprecipitation. 10 pL beads were incubated with 10 pL rAAV (21 °C, 30 min). Then the beads were washed 5 times with 200pl PBS+ 0.05%Tween20, one time with 200 pL PBS, and eluted in 50 pL SDS-PAGE loading buffer (Li-Cor Biosciences) at 95°C.
AAV capsid proteins were screened in binding ELISAs according to the following method: 96- well ELISA plates (Nunc Maxisorp) were coated with a 2 pg/mL solution of either human C5 (purified in house) or human C3b (Complement Technologies, Inc), in carbonate-bicarbonate buffer (Sigma). All washing steps comprised four wash cycles with PBS, 0.05% Tween 20. Blocking Buffer was PBS, 10% Sea Block (Thermo Fisher [v/v]). Two-fold, eleven-point serial dilutions of AAV capsid were prepared in Assay Buffer (PBS, 0.05% Tween 20 (v/v), 10 % Sea Block [v/v]), to give a final assay range of 10 nM - 10 pM. For detection, a 1/20 dilution of a biotinylated anti-AAV9 antibody (Progen ADK9) secondary antibody was used with a 1/1000 dilution of Streptavidin HRP (Thermo). Finally, ‘One-Step’ 3, 3', 5, 5' Tetramethylbenzidine (Thermo Scientific) was used to reveal. The reaction was stopped with the addition of a 2% (w/v) NaF solution and the OD was measured at 630 nm. Data were fitted using a 4-parameter logistic fit (GraphPad Prism 8.1.1) to derive apparent equilibrium dissociation constants (KD app).
The rAAV purified with AAV9 affinity column were denatured with SDS-PAGE loading buffer (Li-Cor Biosciences) at 95°C, size fractionated by 4-15% SDS-PAGE Bio-Rad mini- Protean TGX precast Gels, transferred to 0.2 pm PVDF membrane with Trans-Blot Turbo semi-dry transfer system (Bio-Rad Laboratories) and detected with the Bl antibody fragment that recognizes a common epitope at the C terminus of AAV VP proteins. The magnetic beads pull-down eluted proteins were separated on an SDS-PAGE gel and observed by Western blotting in same condition. The membrane was first blocked with Intercept blocking buffer TBS (Li-Cor Biosciences) for 1 hour at room temperature, then stained with primary antibody
(Anti -AAV VP1/VP2/VP3 mouse monoclonal Bl, Progen, 1 :250) with Intercept antibody diluent T20 TBS (Li-Cor Biosciences) over night at 4°C. Then the membrane was washed with TBS-Tween20 for 3 times with 10 min each, then stained with Secondary Antibody (IRDye 800CW Donkey anti-Mouse IgG, Li-Cor Biosciences, 1 :2000) in Intercept antibody diluent T20 TBS (Li-Cor Biosciences) for Ih at RT, then washed with TBS-Tween20 for 3 times with 10 min each. Proteins were visualized using a Li-Cor Odyssey CLx far red imager (Li-Cor Biosciences).
The total signal for each VP band was measured by Image Studio software (Li-Cor Biosciences), and VP2 components for rAAV were quantified as percentage of VP2 signal density compared to total VP1/VP2/VP3 signal density as shown in Table 7.
Table 7: VP2 components of various VP2-N-term antibody fragments engineered rAAV9
Engineered rAAVs were capable of binding its target as confirmed by its successful pull-down with C5 protein immobilized magnetic beads (Figure 7B) but not with uncoated control magnetic beads (Figure 7C). The engineered rAAVs all bound to human C5 but not human C3 (Figure 9). No binding to either C5 or C3 was detected for the wild type AAV9 capsid. For binding to C5, KD app values, derived from n=2 experiments, were as follows: Bl = 386 pM (range 233-640 pM), B2 = 720 pM (range 360 pM - 1.44 nM), B3.1 = 958 pM (range 700 pM - 1.311 nM), B4.1 = 1.37 nM (range 859 pM - 2.183 nM). Binding to human C5 as measured by OD at 630 nm is shown in Figure 9A.
Finally, the results indicate that an exemplary antibody fragment (i.e. a knob domain) may be selected due to its binding properties to a target of interest, that would not be expected to normally interact with a AAV that does not comprise the antibody fragment, therefore conferring new binding properties to the engineered rAAV.
Example 4 - Assessment of the ability of the engineered rAAVs to transduce cells
The human-derived Ad-293 HEK (Agilent Technologies) were passaged in DMEM + 10% FBS + 1% Penicillin/Streptomycin (all from Thermo Fisher Scientific). The plasmid with CMV promoter driven expression of C5 protein fused to C-terminal of glycosyl phosphatidylinositol (GPI) as anchor membrane protein were used for transient transfection. Ad-293 HEK GPI-C5 cells were prepared as cells were transfected using X-tremeGene 360 Transfection reagent (Roche) according to the manufacturer’s protocol. For a 75 cm2 plate, 12 pg of GPI-C5 plasmid and 24 pl X-tremeGene transfection reagent (Roche) were added and mixed in 1200pl of Opti- MEM medium (Thermo fisher). The transfection reagent/DNA complex were incubated for 15 minutes at room temperature, then added to cells by dropwise.
The cells were cultured in DMEM + 10% FBS + 1% Penicillin/Streptomycin (all from Thermo Fisher Scientific). After 48 hours of transfection, the cells were seeded into 96-well plates in lOOpl volume with density of 5E5 cells per ml and rAAV with serial dilution of multiplicity of infection (MOIs, vg/cell) were added to each well. Four replicates were tested for each dose. After 48h of transduction, cells were washed with PBS, then resuspend with FACS buffer (PBS+3%FBS). Cells were run with Guava easyCyte HT flow cytometer (Illuminex) and eGFP expression were analyzed with Guavasoft 4.0 (Illuminex). For cell gating, forward and side scatter density plots (FSC vs SSC) were used based on size and granularity. Forward scatter height versus forward scatter area density plots (FSC-H vs FSC- A) were further used to exclude doublets.
All statistical analyses were performed, and graph were generated with GraphPad Prism 8 software (GraphPad Prism software, Inc.). A p value <0.05 was considered to be statistically significant. In the case of one group variable, one-way ANOVA was used. In the case of two group variables, two-way ANOVA was used. A post hoc analysis with a Bonferroni’s test for multiple comparisons was tested.
Engineered AAVs specifically bind HEK cells enriched with GPI-C5 membrane anchor protein. The engineered rAAV showed enhanced transduction in Ad-293 HEK GPI-C5 cells as compared with rAAV9 (Figure 8).
Example 5: Engineered AAVs with variable number of copies of an antibody fragment
In the preceding examples, the engineered rAAVs comprised either 60 insertions wherein each of VP1, VP2, and VP3 comprised the insertion of an antibody fragment within the common VP3 region, or 5 insertions wherein the VP2 protein only comprised an insertion of an antibody fragment at its N-terminus.
Alternatively, the engineered capsid proteins were configured to produce rAAVs comprising either 5 copies or 55 copies of an antibody fragment. To produce various configurations of VP1, VP2, and VP3 insertions in the following experiments, the cloning strategies included:
Cloning strategy 1 : Insertion of an antibody fragment within VP2 and VP3, but not in VP1 as illustrated in Figure 10F or 10H. This strategy was designed to result in about 55 insertions on the resulting engineered rAAV. Firstly, a deletion in the splice acceptor site for VP2 and VP3 was made in a first cap gene of AAV (called “VP1 sa del”, SEQ ID NO:70), so that neither VP2 nor VP3 were produced from this cap gene, while VP1 was produced. Then, a second cap gene was provided, where VP1 was deleted (“VP1 del”) and which comprised an antibody fragment. Together, the two cap genes produced VP1 that did not comprise an antibody fragment, VP2 and VP3 both comprising an antibody fragment.
Cloning strategy 2: Insertion of an antibody fragment to VP2, but not VP 1 or VP3 as illustrated in FigurelOB. The antibody fragment was fused to/or inserted within the N-terminus of VP2. This strategy results in about 5 insertions of the antibody fragment in the rAAV vector. Firstly, a deletion in VP2 was made in a first cap gene of AAV (AAV9 del VP2), so that VP2 was not produced from this cap gene, while VP1 and VP3 were produced. Then, a second cap gene was provided, where VP2 comprised an antibody fragment. Together, the two cap genes produced VP1 and VP3 that did not comprise a knob domain whereas VP2 did.
Cloning strategy 3 : Insertion of an antibody fragment within VP1, but not VP2 or VP3 (Figure 10A). This strategy was designed to result in about 5 insertions on the resulting rAAV. Firstly, a deletion in VP1 was made in a first cap gene of AAV (e.g., by deleting the start codon for VP1, as in a construct called “VP1 del”, e.g., SEQ ID NO:73), so that VP1 was not produced from this cap gene, while VP2 and VP3 were produced. Then, a second cap gene was provided, where VP1 had a deletion in the splice acceptor site for VP2 and VP3 (“VP1 sa del”, SEQ ID NO:70) and where VP1 comprised an antibody fragment. Together, the two cap genes produced VP2 and VP3 that did not comprise a knob domain whereas VP1 did.
Table 8 summarizes the productivity data for decorated AAV9s produced according to each of the cloning strategies 1, 2, and 3. The antibody fragment used in this example was B3.2, which comprises the knob domain Bl plus a linker GGGGSGGGGS at its C-terminal end and at its N-terminal end, that was added to the insertion site Gly455 in AAV9 VPs within the common VP3 region (of either VP2/VP3, or only VP2 or only VP1).
Results of the transduction assay in HEK293 cells are summarized in Figure 12A-D. Figure 12E shows a Western blot for VP proteins, illustrating a change in size of VPs following addition of the antibody fragment B3.2, as compared to a wild-type, i.e. not engineered, AAV9 control. Consistent with properties of engineered rAAV9 with 60 copies of antibody fragments, the results demonstrate that engineered rAAV capsids with different numbers of antibody fragments could be successfully produced at high titers, and insertions could be added to VP1 alone, to VP2 alone, or to VP2 and VP3. All of the engineered AAV9s were capable of transducing HEK cells expressing the target of knob domain at higher percentages than a control AAV9 showing that the engineered AAV9s gained specificity to the target of the knob domain.
Table 8: Productivity of engineered AAVs
Example 6: Engineering of recombinant AAV9s using other antibody fragments
In this example, additional antibody fragments were tested (D, E, F, and G derived antibody fragments). Engineered rAAV9s were produced and purified as described in the previous examples 1 and 2. Cloning strategy corresponding to cloning strategy 2 of example 5 was used to produce engineered rAAV9 either at the N-terminus of VP2, or at Gly455 in the loop insertion site of VP2 only. Transduction assays were conducted in HEK293.
Viral genome titers, capsid titers, and percentage of full capsids are summarized in Table 9. Results of the transduction assay are shown in Figures 13-15.
The results demonstrate that the engineered rAAV9s comprising antibody fragments could be successfully produced at high titers. Overall, the engineered rAAV9s transduced HEK293 cells expressing the target of the knob domains to a greater extent when compared to transduction of control WT HEK293 cells. Table 9: Productivity of the engineered rAAVs
Example 7: Engineered AAVs from different AAV serotypes
A selection of exemplary AAV variants was evaluated for their ability to be inserted with antibody fragments. Variants AAV1, an exemplary AAV6 variant (called “AAV6var”), AAV8, AAV9, and AAV true type (AAV-TT) were tested. These variants are representatives of the AAV clades A, B, E, and F.
Production of engineered AAVs, purification, titer determination, and transduction assays were carried out as described herein. AAV8 titration ELISA kit (PROGEN), AAV1 titration ELISA kit (PROGEN), AAV6 titration ELISA kit (PROGEN) and AAV2 titration ELISA kit (PROGEN) were used for AAV8, AAV1, AAV6var and AAVTT respectively for their viral particle quantification. Antibody fragments comprising either 1 copy of linker GGGGG (SEQ
ID NO: 95) or 2 copies of linker GGGGSGGGGS (SEQ ID NO: 97) were cloned into the exemplary AAV variants using cloning strategy as described herein to insert an antibody fragment within VP2 only. Representative sequences of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh.10, AAV-TT capsid proteins are provided in SEQ ID NO: 60- 69 respectively.
Results
Viral genome titers, capsid titers, and percentage of full capsids are summarized in Tables 10- 12. Results of the transduction assays are shown in Figures 16-22. Western blots in Figure 23 and Figure 24 show the change in size of VP fragments in various rAAVs following the addition of the antibody fragments comprising knob domains that bind to the targets.
Transduction results from experiments with engineered AAV variants were consistent with results from experiments with engineered AAV9. Overall, for all the AAV serotypes tested, the engineered AAVs transduced HEK293 cells expressing the target of the antibody fragments to a greater extent when compared to transduction of control WT HEK293 cells. Table 10. Productivity of engineered AAV8s
Table 11. Productivity of engineered AAVs from different serotypes
Table 12. Productivity of engineered AAVs from different serotypes
Taken together, these data show that the capsid proteins described herein may be engineered to comprise knob domains and antibody fragments comprising knob domains which vary in size, sequence, specificity, and in number. The knob domains or antibody fragments comprising knob domains may be inserted at different sites in the AAV capsid protein, may be
inserted in different VP proteins, and may be inserted into different AAV (e.g., AAVs from different clades).
Sequences of antibody fragments and capsid proteins useful in the context of the present disclosure are represented in Table 1 and Table 2 respectively (Amino acid sequences (aa.) and nucleotide sequences (nt.)).
Table 1: Antibody fragments (Linkers are indicated in italic)
Table 2: Rep/Cap sequences
Ill
Claims
1. An engineered capsid protein comprising an AAV capsid protein and an antibody fragment, wherein the antibody fragment comprises a bovine ultralong CDR-H3, or a portion thereof.
2. An engineered capsid protein comprising an AAV capsid protein and an antibody fragment, optionally according to claim 1, wherein the antibody fragment comprises a knob domain of an ultralong CDR-H3, or a portion thereof.
3. The engineered capsid protein according to claim 2, wherein the antibody fragment does not comprise a stalk of an ultralong CDR-H3.
4. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment binds an antigen.
5. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment is 5 amino acids in length or more, 10 amino acids in length or more, 15 amino acids in length or more, 20 amino acids in length or more, 25 amino acids in length or more, 30 amino acids in length or more, 35 amino acids in length or more, 40 amino acids in length or more, 45 amino acids in length or more, 50 amino acids in length or more, 55 amino acids in length or more, or 60 amino acids in length or more.
6. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment is up to 69 amino acids in length.
7. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment is between 5 and 55, or between 15 and 50, or between 20 and 45 or between 25 and 40 amino acids in length.
8. The capsid protein according to any one of the preceding claims, wherein the antibody fragment comprises a (Zi) Xi C X2 motif at its N-terminal extremity, wherein:
Zi is present or absent, and when Zi is present, Zi represents 1 amino acid or 2, 3, 4, or 5 independently selected amino acids;
Xi is any amino acid residue, preferably selected from the list consisting of Serine, Threonine, Asparagine, Alanine, Glycine, Proline, Histidine, Lysine, Valine, Arginine, Isoleucine, Leucine, Phenylalanine and Aspartic acid; and,
C is cysteine; and,
X2 is an amino acid selected from the list consisting of Proline, Arginine, Histidine, Lysine, Glycine and Serine.
9. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment comprises a sequence which is a variant of a naturally occurring sequence.
10. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment further comprises at least one bridging moiety between two amino acids, optionally wherein the bridging moiety is a disulphide bond.
11. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment is fully bovine.
12. The engineered capsid protein according to any one of claims 1 to 10, wherein the antibody fragment is chimeric.
13. The engineered capsid protein according to any one of the preceding claims, wherein the AAV capsid protein comprises a naturally occurring, or a variant or an artificial AAV sequence or a combination thereof.
14. The engineered capsid protein according to any one of the preceding claims, wherein the AAV capsid protein comprises a sequence of an AAV selected from the group consisting of AAV1, AAV2, AAV true type (AAV-TT), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, or AAV13, or a combination thereof.
15. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment is inserted within the AAV capsid protein, optionally via a linker.
16. The engineered capsid protein according to claim 15, wherein the antibody fragment is inserted within the AAV capsid protein via one linker, wherein optionally the linker is genetically fused to the antibody fragment, optionally at its C-terminal end.
17. The engineered capsid protein according to claim 15, wherein the antibody fragment is inserted within the AAV capsid protein, via at least two linkers.
18. The engineered capsid protein according to claim 17, wherein at least one linker is fused, optionally genetically, to the N-terminal end of the antibody fragment, and at least one linker is fused, optionally genetically, to the C-terminal end of the antibody fragment.
19. The engineered capsid protein according to any one of the preceding claims, wherein the AAV capsid protein is a VP1, a VP2, or a VP3.
20. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment is inserted within the common VP3 region of the AAV capsid protein, optionally, within the GH loop of the common VP3 region.
21. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment is inserted within the variable region VR-IV of the AAV capsid protein.
22. The engineered capsid protein according to any one of the preceding claims, wherein the antibody fragment is inserted within the AAV capsid protein after amino acid residue Gly455 of AAV9 with reference to SEQ ID NO: 40 (or a corresponding amino acid residue of another AAV).
23. The engineered capsid protein according to any one of claims 1-20, wherein the antibody fragment is inserted within the variable region VR-V of the AAV capsid protein.
24. The engineered capsid protein according to claim 23, wherein the antibody fragment is inserted within the AAV capsid protein after amino acid residue Asn498 of AAV9 with reference to SEQ ID NO:40, or a corresponding amino acid residue of another AAV.
25. The engineered capsid protein according to any one of claims 1-20, wherein the antibody fragment is inserted within the variable region VR-VIII of the AAV capsid protein.
26. The engineered capsid protein according to claim 25, wherein the antibody fragment is inserted within the AAV capsid protein after amino acid residue Gln588 of AAV9 with reference to SEQ ID NO:40, or a corresponding amino acid residue of another AAV.
27. The engineered capsid protein according to any one of claims 1-19, wherein the AAV capsid protein is VP1 or VP2 and wherein the antibody fragment is inserted within the VP1/VP2 common region of the capsid protein.
28. The engineered capsid protein according to any one of claims 1-19 or 27, wherein the antibody fragment is inserted within the N-terminus of the VP2 capsid protein.
29. The engineered capsid protein according to claim 28, wherein the antibody fragment is inserted within the N-terminus of the VP2 capsid protein of AAV9 before amino
acid residue Thrl with reference to SEQ ID NO:41, or a corresponding amino acid in another AAV.
30. An AAV capsid comprising an engineered capsid protein according to any one of the preceding claims.
31. An AAV capsid comprising two engineered capsid proteins according to any one of the preceding claims, wherein the first and second engineered capsid proteins are respectively VP1 and VP2, or VP1 and VP3, or VP2 and VP3.
32. An AAV capsid comprising three engineered capsid proteins according to any one of the preceding claims, wherein the first, second and third engineered capsid proteins are respectively VP1, VP2 and VP3.
33. A nucleic acid encoding an engineered capsid protein according to any one of claims 1 to 29, or a capsid according to any one of claims 30 to 32.
34. A vector comprising the nucleic acid according to claim 33.
35. A recombinant adeno-associated virus (rAAV) particle comprising the engineered capsid protein according to any one of claims 1 to 29, or the capsid according to any one of claims 30 to 32, or the nucleic acid according to claim 33 or the vector according to claim 34, and a transgene.
36. The rAAV particle according to claim 35, wherein the transgene encodes a peptide, a polypeptide or a nucleic acid molecule, optionally wherein the nucleic acid molecule is a small interfering RNA (siRNA), small or short hairpin RNA (shRNA), micro RNA (miRNA).
37. A host cell comprising the nucleic acid according to claim 33 or a vector according to claim 34 and/or which produces a viral particle according to claim 35 or 36.
38. A method for producing an AAV particle comprising an engineered capsid protein according to any one of claims 1 to 29, and a transgene, said method comprising: a) providing a first vector comprising a first nucleotide sequence encoding an AAV capsid protein, and a second nucleotide sequence encoding the antibody fragment; wherein the first nucleotide sequence and the second nucleotide sequence are genetically fused, optionally via a nucleotide sequence coding for a linker; b) providing a second vector comprising the transgene; c) providing a third, Helper vector; d) transfecting a host cell with the first, second and third vector; e) recovering the AAV particle from the host cell.
39. A vector according to claim 34, or an AAV particle according to claim 35 or 36 or obtained according to claim 38, for use as a medicament.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363511793P | 2023-07-03 | 2023-07-03 | |
| PCT/EP2024/068552 WO2025008323A1 (en) | 2023-07-03 | 2024-07-02 | Engineered aav capsid proteins |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4739780A1 true EP4739780A1 (en) | 2026-05-13 |
Family
ID=91853417
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24739463.8A Pending EP4739780A1 (en) | 2023-07-03 | 2024-07-02 | Engineered aav capsid proteins |
Country Status (8)
| Country | Link |
|---|---|
| EP (1) | EP4739780A1 (en) |
| KR (1) | KR20260034663A (en) |
| CN (1) | CN121712809A (en) |
| AR (1) | AR133153A1 (en) |
| AU (1) | AU2024290842A1 (en) |
| IL (1) | IL325384A (en) |
| TW (1) | TW202507010A (en) |
| WO (1) | WO2025008323A1 (en) |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201310544D0 (en) | 2013-06-13 | 2013-07-31 | Ucb Pharma Sa | Obtaining an improved therapeutic ligand |
| IL314171A (en) | 2015-09-28 | 2024-09-01 | Univ Florida | Methods and compositions for stealth virus antibody vectors |
| EP3469073B1 (en) | 2016-06-09 | 2024-01-10 | Centre National de la Recherche Scientifique (CNRS) | Raav with chemically modified capsid |
| EP3645052A4 (en) | 2017-06-30 | 2021-07-28 | Regents of the University of California | ADENO-ASSOCIATED VIRUS VIRIONS WITH CAPSID VARIANTS AND METHOD OF USING THEREOF |
| CN111727243A (en) | 2017-12-19 | 2020-09-29 | 北卡罗来纳-查佩尔山大学 | Methods and compositions for delivering viral vectors across the blood-brain barrier |
| CA3097375A1 (en) | 2018-04-27 | 2019-10-31 | Universitat Heidelberg | Modified aav capsid polypeptides for treatment of muscular diseases |
| EP3564263A1 (en) | 2018-05-03 | 2019-11-06 | Universitätsklinikum Hamburg-Eppendorf | Fusion proteins comprising a cell surface marker specific vhh |
| WO2020005889A1 (en) | 2018-06-25 | 2020-01-02 | Leading Edge V-Twin LLC | Methods and apparatus for an actively cooled cylinder |
| EP3715358A1 (en) | 2019-03-28 | 2020-09-30 | Universität zu Köln | Mutated adeno-associated virus capsid proteins, aav particle comprising the same and liver directed aav vector gene therapy |
| EP4126936A1 (en) | 2020-03-27 | 2023-02-08 | UCB Biopharma SRL | Autonomous knob domain peptides |
| WO2022103766A2 (en) * | 2020-11-10 | 2022-05-19 | Avirmax, Inc. | Engineered viral capsids and methods of use |
-
2024
- 2024-07-02 KR KR1020267002907A patent/KR20260034663A/en active Pending
- 2024-07-02 AU AU2024290842A patent/AU2024290842A1/en active Pending
- 2024-07-02 CN CN202480049950.5A patent/CN121712809A/en active Pending
- 2024-07-02 AR ARP240101720A patent/AR133153A1/en unknown
- 2024-07-02 EP EP24739463.8A patent/EP4739780A1/en active Pending
- 2024-07-02 WO PCT/EP2024/068552 patent/WO2025008323A1/en not_active Ceased
- 2024-07-03 TW TW113124943A patent/TW202507010A/en unknown
-
2025
- 2025-12-16 IL IL325384A patent/IL325384A/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| IL325384A (en) | 2026-02-01 |
| AU2024290842A1 (en) | 2026-01-15 |
| KR20260034663A (en) | 2026-03-11 |
| WO2025008323A1 (en) | 2025-01-09 |
| AR133153A1 (en) | 2025-09-03 |
| CN121712809A (en) | 2026-03-20 |
| TW202507010A (en) | 2025-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7410522B2 (en) | Adeno-associated virus (AAV) transmission of anti-FAM19A5 antibodies | |
| KR20220011664A (en) | Modified viral particles and uses thereof | |
| WO2022166949A1 (en) | Anti-aav2 monoclonal antibody, and preparation method therefor and use thereof | |
| JP2025517628A (en) | Novel recombinant AAV VP2 fusion polypeptides | |
| EP4705484A1 (en) | Compositions and methods for the treatment of tau-related disorders | |
| US20250333528A1 (en) | Transferrin receptor-binding domains and proteins comprising the same | |
| IL303758A (en) | Antibody transport | |
| AU2024290842A1 (en) | Engineered aav capsid proteins | |
| CN113912715B (en) | Anti-alpha-synuclein antibody and related product and application thereof | |
| CN118085066B (en) | A monoclonal antibody against AAV and its use | |
| WO2025015060A1 (en) | Engineered vectorized antibodies with reduced stability in systemic circulation and uses thereof | |
| EA052874B1 (en) | Delivery of antibodies to FAM19A5 using adeno-associated virus (AAV) | |
| CN120249394A (en) | A recombinant adeno-associated virus vector for delivering human C3b single-domain antibody and its fusion protein | |
| EA047634B1 (en) | DELIVERY OF ANTIBODIES TO FAM19A5 USING ADENO-ASSOCIATED VIRUS (AAV) | |
| EP4630457A1 (en) | Bispecific antigen-binding molecules and uses thereof | |
| CN120082564A (en) | Her2 antibodies can be expressed by adeno-associated virus | |
| WO2023178171A2 (en) | Cassettes of anti-complement component 3 antibody, vectorization and theraputic application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20260203 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |