EP4739352A1 - Human therapy utilizing novel prokaryotic voltage gated sodium channels - Google Patents

Human therapy utilizing novel prokaryotic voltage gated sodium channels

Info

Publication number
EP4739352A1
EP4739352A1 EP24836630.4A EP24836630A EP4739352A1 EP 4739352 A1 EP4739352 A1 EP 4739352A1 EP 24836630 A EP24836630 A EP 24836630A EP 4739352 A1 EP4739352 A1 EP 4739352A1
Authority
EP
European Patent Office
Prior art keywords
subject
promoter
heart failure
vector
bacnav
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24836630.4A
Other languages
German (de)
French (fr)
Inventor
Nenad Bursac
Tianyau WU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Duke University
Original Assignee
Duke University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Duke University filed Critical Duke University
Publication of EP4739352A1 publication Critical patent/EP4739352A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/06Antiarrhythmics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/21Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Public Health (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

A gene therapy approach is described whereby augmentation of both peak sodium current and calcium transient amplitude in cardiomyocytes effectively alleviates pathologies of heart failure. Prokaryotic sodium channel gene delivery is described as a new therapy for reduced ejection fraction-associated heart failure.

Description

Atty Docket No.: 1449507-DU8236PCT HUMAN THERAPY UTILIZING NOVEL PROKARYOTIC VOLTAGE GATED SODIUM CHANNELS CROSS-REFERENCES TO RELATED APPLICATIONS [0001] The present application claims priority to U.S. Provisional Application No.63/512,038 filed July 5, 2023, the full disclosure of which is incorporated by reference in its entirety for all purposes. STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT [0002] This invention was made with government support under Grant No. RO1EB032726 awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING [0003] The contents of the electronic sequence listing (1449507-DU8236PCT-SL; Size: 56.0 kilobytes; and Date of Creation: July 5, 2024) is herein incorporated by reference in its entirety. BACKGROUND [0004] In cardiac muscle cells sodium channels are primarily responsible for generating the rapid upstroke of the action potential (AP). In this manner sodium channels are essential to the initiation and conduction of electrical signals, and the proper function of sodium channels is therefore necessary for normal function of the heart. Reduced sodium current density and slow action potential conduction can arise from altered extracellular environment, cell morphology, or channel regulation that occur in conditions such as myocardial infarction, heart failure, and cardiac ischemia. In particular, these conditions lead to damage of cardiac tissue and the development of fibrosis, characterized by excessive fibroblast proliferation. Increased amounts of fibroblasts can separate cardiac muscle cells causing slow or discontinuous conduction. Further, genetic mutations that result in loss of function in voltage-gated sodium channels (VGSCs) can cause reduced tissue excitability, leading to various cardiac disorders. 1 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [0005] Heart failure (HF) is a condition or a collection of symptoms that weaken or stiffen the heart. HF constitutes a tremendous health and socioeconomic burden (Tsao, 2023), affecting ~2% of the adult population worldwide and over 6 million people in the United States (Tsao, 2023; Metra, 2017). Both acute and chronic ischemic insults to the heart cause irreversible cardiomyocyte (CM) loss and fibrotic remodeling that impair not only cardiac contraction but also action potential (AP) conduction, often leading to sudden cardiac death (SCD) (Tsao, 2023). Despite considerable progress, current therapies for HF and SCD are limited, with a 5-year patient mortality rate surpassing 50% (Tsao, 2023; Marijon, 2022; Cleland, 1998). Congestive heart failure (CHF is a chronic progressive condition that affects the pumping power of the heart muscle. CHF specifically refers to the stage in which fluid builds up in the heart and causes it to pump inefficiently. Without sufficient blood flow, all major body functions are disrupted. [0006] The growing understanding of the complex molecular mechanisms underlying cardiac contractile and electrical dysfunction makes gene therapy a promising strategy to mitigate the high mortality of HF patients (Kieserman, 2019; Argiro, 2024; Mundisugih, 2024). Several gene therapy approaches have been proposed to rescue electrical abnormalities (Sasano, 2006; Greener, 2012) or restore Ca2+-handling deficits (Greenberg, 2016; Fish, 2013; Tilemann, 2013) associated with HF. Recently, these efforts have been expanded by using precise genome editing tools to prevent the development of acquired or genetic cardiomyopathies (Lebek, 2023; Chai, 2023; Reichart, 2023). However, there are currently no approaches that directly and stably increase both peak Na+ current and Ca2+ transient amplitude in CMs, which could simultaneously provide antiarrhythmic (via faster AP conduction) and inotropic (via stronger contraction) benefits to the failing heart. therapies for cardiac conditions could greatly benefit from approaches that enhance electrical excitability and AP conduction in the heart via delivery of functional VGSCs. However, gene-based therapies involving VGSCs are largely hampered by the inability to stably express mammalian channels using viral delivery methods as the genes encoding the VGSCs are too large (>6 kb) to be efficiently incorporated into viral vectors. SUMMARY [0007] The Summary is provided to introduce a selection of concepts that are further described below in the Detailed Description. This Summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used as an aid in limiting the scope of the claimed subject matter. 2 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [0008] The present disclosure is based, in part, on the discovery by the inventors that expression of prokaryotic voltage-gated sodium channels (BacNav) in mammalian CMs can simultaneously target sodium and calcium dysregulation in failing CMs and provide robust inotropic and anti- arrhythmic effects in the setting of HF with reduced ejection fraction (HFrEF). [0009] An aspect of the present disclosure relates to a method for treating reduced ejection fraction in a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00010] Another aspect of the present disclosure relates to a method for improving both contractile and electrical dysfunction in a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00011] Another aspect of the present disclosure relates to a method for increasing subsarcolemmal Ca2+ levels in cardiomyocytes of a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00012] Another aspect of the present disclosure relates to a method for inhibiting the Na+/Ca2+ exchanger (NCX) in cardiomyocytes of a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00013] Another aspect of the present disclosure relates to a method for reducing the incidence of arrythmia in a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic 3 30155659V.1 Atty Docket No.: 1449507-DU8236PCT sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00014] Another aspect of the present disclosure relates to a method for reversing reduced ejection fraction in a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00015] Another aspect of the present disclosure relates to a method for augmenting peak Na+ current and Ca2+ transient amplitude in cardiomyocytes of a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00016] Another aspect of the present disclosure relates to a recombinant vector comprising a first polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNaV) polypeptide and a second polynucleotide sequence encoding SERCA2a, I-1C, SUMO-1, or BAG3, wherein the first and the second polynucleotides are operably linked to a promoter. [00017] Another aspect of the present disclosure relates to a method for treating reduced ejection fraction in a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a first polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNaV) polypeptide and a second polynucleotide sequence encoding SERCA2a, I-1C, SUMO-1, or BAG3, wherein the first and the second polynucleotides are operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00018] Another aspect of the present disclosure relates to a method for improving both contractile and electrical dysfunction in a subject with heart failure, increasing subsarcolemmal Ca2+ levels in cardiomyocytes of a subject with heart failure, inhibiting the Na+/Ca2+ exchanger (NCX) in cardiomyocytes of a subject with heart failure, reducing the incidence of arrythmia in a subject with heart failure, reversing reduced ejection fraction in a subject with heart failure, or augmenting peak Na+ current and Ca2+ transient amplitude in cardiomyocytes of a subject with heart failure. The method comprises administering to the subject a recombinant vector 4 30155659V.1 Atty Docket No.: 1449507-DU8236PCT comprising a first polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNaV) polypeptide and a second polynucleotide sequence encoding SERCA2a, I-1C, SUMO-1, or BAG3, wherein the first and the second polynucleotides are operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. BRIEF DESCRIPTION OF THE DRAWINGS [00019] The accompanying Figures and Examples are provided by way of illustration and not by way of limitation. The foregoing aspects and other features of the disclosure are explained in the following description, taken in connection with the accompanying example figures (also “FIG.”) relating to one or more embodiments, in which: [00020] FIGS.1A-1I show the effect of BacNav expression on cardiomyocyte calcium handling and force kinetics in vitro. FIG.1A) Experimental design for studies of BacNav expression in NRVM monolayers in vitro. rtTA: reverse tetracycline-controlled transactivator, TRE: tet response element. FIG.1B) Representative immunostaining images of NRVM monolayers transduced with Doxycycline (Dox)-inducible lentivirus and treated with vehicle (- Dox) or Dox (+Dox). FIG.1C) Representative optically recorded Ca2+ transient traces from NRVM monolayer stained with Cal-520 dye and paced at 1Hz and corresponding quantifications of Ca2+ transient amplitude (N=7 NRVM isolations, n=29 coverslips). FIG.1D) Quantifications of Ca2+ transient amplitude of NRVM monolayers before and after treatment with NCX inhibitor ORM-10962 (N=3, n=10). Note that drug treatment eliminated the difference in Ca2+ transient amplitude between BacNav-expressing (+Dox) and control (-Dox) cells. FIG.1E) Representative longitudinal sections of NRVM bundles transduced with Doxycycline (Dox)-inducible lentivirus and treated with vehicle (-Dox) or Dox (+Dox). SAA: sarcomeric α-actinin. FIGS.1F- 1I) Passive tension-length relationship of NRVM bundles (FIG.1F, N=3, n=12) and quantifications of time to peak (FIG.1G), relaxation time (FIG.1H), and total twitch duration (FIG.1I, N=3, n=12). FIG.1J) Representative traces of caffeine-induced Ca2+ transients from NRVM monolayers and corresponding quantifications of Ca2+ transient amplitude (N=6, n=25) and NCX Ca2+ extrusion rate (kNCX) (N=4, -Dox: n=13; +Dox: n=16). Data are presented as mean values ± s.e.m. Significance was evaluated by unpaired two-tailed t-test in FIGS.1C, 1J, 1G-1I and by two-way ANOVA with Holm-Šídák's multiple comparison test in FIG.1D and 1F. 5 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [00021] FIGS.2A-2H show BacNav expression augments CM Ca2+ transients and contractility in vitro, in silico, and ex vivo. FIG.2A) Experimental design for studies of BacNav expression in tissue-engineered NRVM bundles. FIG.2B) Representative cross-sections of NRVM bundles transduced with Doxycycline (Dox)-inducible lentivirus and treated with vehicle (-Dox) or Dox (+Dox). FIG.2C) Representative Ca2+ transient traces of NRVM bundles at 2Hz pacing before and after treatment with NCX inhibitor ORM-10962 and corresponding quantifications of Ca2+ transient amplitude (N=4 NRVM isolations, n=16 bundles per group). Note that drug treatment eliminated the difference in Ca2+ transient amplitude between BacNav- expressing (+Dox) and control (-Dox) bundles. FIG.2D) Representative twitch force traces at 2Hz stimulation and corresponding quantifications of maximum active force (N=3, n=12). FIG. 2E) Experiment design for studies of BacNav expression in healthy adult mouse CMs. FIG.2F) Representative image of isolated mouse CMs containing transduced BacNav-expressing (mScarlet+) and non-transduced (mScarlet-) cells. FIG.2G) Representative optically recorded Ca2+ transient traces from isolated adult mouse CMs stained with Cal-520 dye and paced at 0.5Hz and corresponding quantifications of Ca2+ transient amplitude (N=3 mice, n=36 CMs per group). NT: non-transduced. FIG.2H) Representative traces of caffeine-induced Ca2+ transients from isolated adult mouse CMs and corresponding quantifications of Ca2+ transient amplitude, NCX Ca2+ extrusion rate (kNCX), and SERCA Ca2+ uptake rate (kSERCA) (N=3 mice, n=24 CMs per group). FIG.2I) Representative adult mouse CM shortening traces at 0.5Hz pacing and corresponding quantifications of peak shortening, time to peak shortening, time to 50% relaxation (RT50), and total contraction time (N=3 mice, n=37 CMs per group). Note that BacNav expression augmented CM contraction without affecting contractile kinetics. FIG.2J) Simulated adult rabbit ventricular myocyte Ca2+ transients during 1Hz pacing and caffeine addition for different relative levels of BacNav expression (0X-1X) and corresponding quantifications of Ca2+ transient amplitudes, NCX Ca2+ extrusion rate (kNCX), and SERCA Ca2+ uptake rate (kSERCA).1X BacNav expression level produces the same peak Na+ current as endogenous Nav1.5 during voltage-clamp simulation. Data are presented as mean values ± s.e.m. Significance was evaluated by repeated measures two-way ANOVA with Holm-Šídák's multiple comparison test in FIG. 2C, by unpaired two-tailed t-test in FIGS.2D and 2G, by unpaired two-tailed t-test with Welch’s correction in FIG.2H (ΔF/F0 and kNCX) and FIG.2I, and by Mann-Whitney test in FIG.2H (kSERCA). 6 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [00022] FIGS.3A-3G show Dose-dependent effects of BacNav expression on Ca2+ handling in adult mouse CMs ex vivo and rabbit ventricular CMs in silico. FIGS.3A-3D) Regression plots for mScarlet intensity (corresponding to BacNav expression level) vs. electrically-induced Ca2+ transient amplitude (FIG.3A, n=57 CMs), caffeine-induced Ca2+ transient amplitude (FIG.3B, n=36 CMs), NCX forward mode activity (FIG.3C, n=38 CMs), and SERCA Ca2+ uptake rate (FIG.3D, n=34 CMs) in isolated adult mouse CMs. Plots are made using data from FIGS.2G and 2H for mScarlet levels larger than threshold of 1.05. FIGS.3E- 3G) Simulated effects of different levels of BacNav expression (0X-1X) on steady-state end- diastolic cytosolic Ca2+ concentration (FIG.3E), integrated Ca2+ flux from the cytosol through different Ca2+ transport systems (FIG.3F), and end-diastolic SR Ca2+ content (FIG.3G) in adult rabbit ventricular myocytes paced at 1 Hz.1X BacNav expression level produces the same peak Na+ current as endogenous Nav1.5 during voltage-clamp simulation. Significance in FIGS.3A- 3D was evaluated by two-tailed Pearson correlation analysis. [00023] FIGS.4A-4H show BacNav gene therapy rescues established cardiac contractile dysfunction and prevents fibrosis in TAC-induced HF murine model. FIG.4A) Experimental design for studying BacNav gene therapy in TAC mice. Baseline measurements were performed 1 week before the sham/TAC surgery and AAV was injected retro-orbitally 4 weeks post- surgery. cTnT: cardiac troponin T promoter; HA, hemagglutinin tag. FIG.4B) Representative photographs of sham and TAC mouse hearts 12 weeks post-surgery. FIG.4C) Representative mouse ventricular sections stained for wheat germ agglutinin (WGA) and corresponding quantification of CM cross-sectional area (N=10 mice per group). FIG.4D) Representative Masson-trichrome-stained ventricular sections and corresponding quantification of collagen area (blue, Sham-NT and TAC-BacNav: N=11; TAC-mScarlet and Sham-mScarlet: N=10) . FIGS. 4E-4G) mRNA levels of fibrotic and hypertrophic markers periostin (Postn, FIG.4E), b-myosin heavy chain (Myh7, FIG.4F) and natriuretic peptide A (Nppa, FIG.4G), shown normalized to expression of a housekeeping gene B2m (N=4). FIG.4H, Quantification of echocardiographically recorded left ventricular ejection fraction (LVEF) and LVEF change relative to pre-surgery level (DLVEF), shown during the time course of the study (Sham-NT and TAC-BacNav: N=11; TAC-mScarlet and Sham-mScarlet: N=10). Data are presented as mean values ± s.e.m. Significance was evaluated by Brown-Forsythe and Welch ANOVA test with Dunnett’s T3 multiple comparison test in FIG.4C, by one-way ANOVA in FIG.4D-4G, by 7 30155659V.1 Atty Docket No.: 1449507-DU8236PCT repeated measures two-way ANOVA with Holm-Šídák’s multiple comparison test in FIG.4H (left), and by repeated measures one-way ANOVA in FIG.4H (right, with overall group differences specified by two-colored P values). [00024] FIGS.5A-5G show the effects of AAV-BacNav therapy on morphology and gene expression in TAC mice. FIG.5A) Representative immunostaining images of serial (apex to base) TAC mouse ventricular sections 8 weeks after systemic AAV injection, showing strong BacNav (mScarlet) expression throughout the heart. FIG.5B) Representative mouse serial ventricular sections stained with Masson-trichrome. FIG.5C and 5D) Quantifications of heart weight per body weight ratio (FIG.5C, left), heart weight per tibia length ratio (FIG.5C, right) (N=11, 10, 10, and 9 for Sham-NT, Sham-mScarlet, TAC-mScarlet, and TAC-BacNav, respectively) and CM cross-sectional area determined from WGA stains in FIG.4C (FIG.5D, N=10 mice, n=81 CMs per group). FIG.5E) mRNA levels of fibrotic and hypertrophic markers: regulator of calcineurin 1 (Rcan1), collagen type 3 alpha 1 (Col3a1), and cellular communication network factor 2 (Ccn2), shown normalized to expression of a housekeeping gene B2m (N=4) at 8 weeks post-AAV injection. FIG.5F) Representative CD31 immunohistochemistry images of mouse ventricular sections and corresponding quantification of capillary density (N=7). FIG. 5G) Quantification of echocardiographically recorded LV end-systolic anterior wall thickness (LVAW,s), LV end-diastolic anterior wall thickness (LVAW,d), LV end-systolic posterior wall thickness (LVPW,s), and LV end-diastolic posterior wall thickness (LVPW,d) during the time course of the study (Sham-NT and TAC-BacNav: N=11; TAC-mScarlet and Sham-mScarlet: N=10). Data are presented as mean values ± s.e.m. Significance was evaluated by one-way ANOVA in FIGS.5C-5F and by repeated measures one-way ANOVA with Holm-Šídák's multiple comparison test in FIG.5G (with overall group differences specified by two-colored P values). [00025] FIGS.6A-6J show BacNav gene therapy prevents arrhythmias in TAC-induced HF murine model. FIG.6A) Protocol for arrhythmia studies in sham/TAC mice. Intracardiac and surface ECG signals were continuously recorded, and arrhythmia induction was attempted by applying multiple episodes of pacing at progressively higher rates from atria (A) or ventricle (V), both before and after injection of isoproterenol (ISO) and caffeine. FIG.6B) Representative surface ECG traces during sinus rhythm at baseline or 2 min after ISO/Caff injection (denoted by red lines in A) and corresponding quantifications (FIGS.6C-6F) of PR interval (FIG.6C), QRS 8 30155659V.1 Atty Docket No.: 1449507-DU8236PCT interval (FIG.6D), QTc interval (FIG.6E), and RR interval (FIG.6F) (N=11, 10, 9, and 11 for Sham-NT, Sham-mScarlet, TAC-mScarlet, and TAC-BacNav, respectively). FIGS.6G-6J, Representative surface ECG traces following ISO/Caffeine administration in mScarlet-TAC mice showing spontaneous sustained ventricular tachycardia (VT) (FIG.6G), spontaneous non- sustained ventricular tachycardia (FIG.6H), and second-degree atrio-ventricular (AV) conduction block (J) and corresponding quantifications of sustained VT incidence (FIG.6G), total (sustained+non-sustained) spontaneous VT episodes (FIG.6I), and AV block incidence (FIG.6J). PVC: premature ventricular contraction. Sinus: sinus rhythm. Data are presented as mean values ± s.e.m. Significance was evaluated by repeated measures two-way ANOVA with Holm-Šídák's multiple comparison test in FIGS.6C-6F, by Fisher’s exact test in FIGS.6G and 6J, and by Kruskal-Wallis test with Dunn's multiple comparison test in FIG.6I. [00026] FIGS.7A-7G show the Electrophysiological and echocardiographic parameters in control and TAC mice. FIG.7A) Quantifications of P wave duration at 12 weeks post sham/TAC surgery (8 weeks post AAV injection) during baseline and following Isoproterenol/Caffeine (ISO/Caff) administration (N=11, 10, 9, and 11 for Sham-NT, Sham- mScarlet, TAC-mScarlet, and TAC-BacNav, respectively). FIGS.7B-7D) Representative intracardiac ECG traces following ISO/Caff administration in mScarlet-TAC mice showing examples of spontaneous sustained ventricular tachycardia (VT) (FIG.7B), spontaneous non- sustained ventricular tachycardia (FIG.7C), and second-degree atrio-ventricular (AV) conduction block (FIG.7D). PVC: premature ventricular contraction. Sinus, sinus rhythm. FIGS.7E-7G) Correlation plots between changes in baseline left ventricular ejection fraction at 12 weeks post-surgery vs. pre-surgery (DLVEF) and PR interval (FIG.7E), QRS duration (FIG. 7F) and QTc interval (FIG.7G) at baseline and after ISO/Caff injection. Data in FIG.7A are presented as mean values ± s.e.m and lack of significant differences was established by repeated measures two-way ANOVA with Holm-Šídák's multiple comparison test. Significance in FIG. 7E-7G was evaluated by two-tailed Pearson correlation analysis. [00027] FIGS.8A-8G show systemic AAV9-BacNav delivery results in sustained and specific expression in mouse hearts. FIG.8A) Experimental design for assessing BacNav gene therapy biodistribution and safety 4 weeks and 3 months after AAV delivery in mice. cTnT, cardiac troponin T promoter; HA, hemagglutinin tag. FIGS.8B-8C) Representative immunostaining images at different post-AAV injection timepoints showing robust and sustained 9 30155659V.1 Atty Docket No.: 1449507-DU8236PCT BacNav-HA expression in the mouse ventricles. FIG.8D) High-magnification (top) and super- resolution (bottom) images of mouse ventricular sections 3 months post-AAV injection showing channel targeting to CM sarcolemma and T-tubules. FIGS.8E-8G) Representative immunostaining images of different organs (FIG.8E) and corresponding quantifications of viral genome (vg) (FIG.8F) and BacNav (h2SheP) mRNA levels (FIG.8G, P-value denotes significance for Heart vs. other groups) (4 weeks: N=3; 3 months: N=2). Data are presented as mean values ± s.e.m. Significance in FIGS.8F and 8G was evaluated by two-way ANOVA with Holm-Šídák's multiple comparison test. [00028] FIGS.9A-9C show the assessment of immune and apoptotic responses to AAV9- BacNav delivery in mice. FIGS.9A-9C) Representative low- and high-magnification histological images of mouse ventricle sections stained for CD3 (FIG.9A), H&E (FIG.9B), and cleaved-caspase 3 (CC3, FIG.9C). Insets in (FIGS.9A and 9B): spleen sections as positive control. Inset in (FIG.9C): human tonsil section as positive control. [00029] FIGS.10A-10F show the effects of pre-existing BacNav expression on in vitro ischemia/reperfusion (I/R) injury in tissue-engineered human cardiopatches. FIG. 10A) Experimental design for studying potential protective roles of BacNav expression in human cardiopatches upon I/R injury in vitro. BacNav expression was induced by Dox supplementation 48 hours prior to injury. FIGS.10B-10F) Representative immunostaining (FIG.10B, left and middle) and live-fluorescence (FIG.10B, right) images of cardiopatches (uninjured: -Dox; uninjured, BacNav-expressing: +Dox; injured: I/R-Dox; and injured, BacNav-expressing: I/R+Dox) and corresponding quantifications of cleaved-caspase 3 (CC3) positive area (FIG. 10C, N=3 hiPSC-CM differentiations, n=6 tissues per group), reactive oxygen species (ROS) intensity (FIG.10D, N=3, n=6), percent dead cells (FIG.10E, N=3, n=6), and lactate dehydrogenase (FIG.10F, -Dox: N=4, n=18; +Dox: N=3, n=8; I/R-Dox: N=5, n=43; I/R+Dox: N=4, n=12). Insets: tissues treated for 24h with 800µM H202 as positive injury control. Data are presented as mean values ± s.e.m. Significance was evaluated by Brown- Forsythe and Welch ANOVA with Dunnett’s T3 multiple comparison test in FIG.10C and 10E, by one-way ANOVA with Holm-Šídák's multiple comparison test in FIG.10D, and by Kruskal- Wallis with Dunn's multiple comparison test in FIG.10F. [00030] FIGS.11A-11D show the effects of pre-existing BacNav expression on human cardiopatch function after I/R injury in in vitro. FIG.11A) Representative twitch force traces at 10 30155659V.1 Atty Docket No.: 1449507-DU8236PCT 2Hz stimulation and corresponding quantifications of maximum active force for cardiopatch groups described in FIG.10A (-Dox: N=6 hiPSC-CM differentiations, n=12 tissues; +Dox: N=4, n=9; I/R-Dox: N=6, n=18; I/R+Dox: N=5, n=14). Force normalized to -Dox group. FIG.11B) Passive tension-length relationships in cardiopatches (N=3, n=8). %Stretch values are shown relative to the initial culture length. FIG.11C) Quantifications of time-to-peak twitch, twitch relaxation time, and total twitch duration (N=3, -Dox: n=12; +Dox: n=9; I/R-Dox: n=12; I/R+Dox: n=8) in cardiopatches paced at 2Hz. FIG.11D) Representative isochrone activation maps during 2Hz pacing and corresponding quantifications of conduction velocity and action potential duration (N=3, -Dox: n=8; +Dox: n=6; I/R-Dox: n=10; I/R+Dox: n=10). Pulse signs indicate location of pacing electrode. Data are presented as mean values ± s.e.m. Significance was assessed by unpaired Student t-test (2-tailed) in FIG.11A, and by one-way ANOVA with Holm-Šídák's multiple comparison test in FIG.11D. Lack of significant differences was established by repeated measures two-way ANOVA with Holm-Šídák's multiple comparison test in FIG.11B and by one-way ANOVA with Holm-Šídák's multiple comparison test in FIG.11C. [00031] FIGS.12A-12J show BacNav expression attenuates contractile and Ca2+-handling deficits in I/R-injured human cardiopatches in vitro. FIG.12A) Experimental design for studying BacNav therapy in I/R-injured cardiopatches. BacNav expression was induced by Dox supplementation 16 hours post I/R injury. FIG.12B) Representative twitch force traces at 2Hz stimulation and corresponding quantifications of maximum active force (middle) and active force-length relationship (right) in uninjured (-Dox), injured, vehicle-treated (I/R-Dox), and injured, BacNav-treated (I/R+Dox) cardiopatches (N=5 hiPSC-CM differentiations, n=18 tissues per group). %Stretch values are shown relative to the initial culture length. Note that BacNav expression improved force generation at all tissue lengths. FIG.12C) Representative optically recorded Ca2+ transient traces in cardiopatches paced at 1Hz and corresponding quantification of Ca2+ transient amplitude (N=6, n=18). FIGS.12D-12F) Representative traces of caffeine- induced Ca2+ transients (FIG.12D) and corresponding quantifications of Ca2+ transient amplitude (D), NCX Ca2+ extrusion rate (kNCX, FIG.12E), and SERCA Ca2+ uptake rate (kSERCA, FIG.12F) (N=3, n=9). FIG.12G) Quantification of Ca2+ transient amplitudes before (vehicle) and after treatment of cardiopatches with NCX inhibitor ORM-10962 (left) and relative change in Ca2+ transient amplitude induced by the drug (right) (N=3, -Dox: n=10; I/R-Dox: n=6; I/R+Dox: n=12). Note that NCX inhibition significantly diminished group differences. FIGS. 11 30155659V.1 Atty Docket No.: 1449507-DU8236PCT 12H and 12I) Quantified NCX mRNA (normalized to HPRT1 mRNA, N=3, FIG.12H) and protein (normalized to Cyclophilin B, N=5, FIG.12I) expression in control (non-transduced, NT), NCX shRNA lentivirus-transduced (shNCX), and scrambled shRNA lentivirus-transduced (shScr) cardiopatches. shRNA viruses were applied at the time of cardiopatch making. FIG.12J, Ca2+ transient amplitudes in shNCX cardiopatches. Note that with NCX knockdown BacNav expression did not increase Ca2+ transient amplitude in injured tissues (N=3, n=10). Data are presented as mean values ± s.e.m. Significance was assessed by one-way ANOVA with Holm- Šídák‘s multiple comparison test in FIG.12B (middle), FIGS.12D,12E,12F,12H, and 12J, by repeated measures one-way ANOVA with Holm-Šídák’s multiple comparison test in FIG.12B (right), by repeated measured two-way ANOVA with Holm-Šídák‘s multiple comparison test in FIG.12G (left), by Brown-Forsythe and Welch ANOVA test with Dunnett’s T3 multiple comparison test in FIGS.12C and 12G (right), and by Kruskal-Wallis test with Dunn's multiple comparison test in FIG.12I. [00032] FIGS.13A-13G show the effects of BacNav therapy on structure and function of I/R-injured human cardiopatches in vitro. FIGS.13A and 13B) Representative live-fluorescence (FIG.13A) and immunostaining (FIG.13B) images of cardiopatches and corresponding quantifications of percent dead cells (FIG.13A, N=3 hiPSC-CM differentiations, n=6 tissues per group) and % cleaved-caspase 3 (CC3) positive area (FIG.13B, N=3, n=8). FIG.13C) Representative isochrone activation maps during 2 Hz pacing and corresponding quantifications of conduction velocity and action potential duration (N=4, n=10). Pulse signs indicate location of pacing electrode. D) Quantifications of lactate dehydrogenase (LDH) release in culture media at different post-I/R injury timepoints (N=4, n=17). FIG.13E) Passive tension-length relationships in cardiopatches (N=5, n=18). %Stretch values are shown relative to the initial culture length. FIG.13F) Quantifications of time-to-peak twitch, twitch relaxation time, and total twitch duration (N=5, n=18) in cardiopatches paced at 2 Hz. FIG.13G) Effect of Dox administration in non-transduced (NT) tissues showing no benefits in I/R-injured cardiopatches (N=2, n=6). Data are presented as mean values ± s.e.m. Significance was assessed by one-way ANOVA with Holm-Šídák's multiple comparison test in FIGS.13A, 13B, and 13G and by repeated measures two-way ANOVA with Holm-Šídák's multiple comparison test in FIG.13D. Lack of significant differences was established by one-way ANOVA with Holm-Šídák's multiple comparison test in 12 30155659V.1 Atty Docket No.: 1449507-DU8236PCT FIG.13C and 13F and by repeated measures two-way ANOVA with Holm-Šídák's multiple comparison test in FIG.13E. [00033] FIGS.14A-14H show that BacNav gene therapy improves contractile deficit and prevents arrhythmias in a non-human primate model of myocardial infarction. FIG.14A) Experimental design for studying BacNav therapy in NHP MI model. IM: intramuscular. FIG. 14B) Representative NHP ventricular sections stained 4 weeks post-MI showing expression of BacNav (tagged with hemagglutinin, HA) at CM sarcolemma and T-tubules. FIGS.14C and 14D) Quantifications of echocardiographically recorded LVEF and LVEF change relative to pre- MI level (DLVEF) (FIG.14C), and LV end-systolic volume (LVESV) and LVESV change relative to pre-MI level (DLVESV) (FIG.14D), shown during the time course of the study (Sham: N=4; I/R+GFP: N=6; I/R+BacNav: N=6). FIGS.14E-14H) Representative ECG traces from conscious animals with examples of spontaneous arrhythmic events including idioventricular rhythm (IVR, FIG.14E), atrioventricular block (AVB, FIG.14F), and supraventricular tachycardia (FIG.14G) and corresponding quantification of the % animals with spontaneous arrhythmias (FIG.14H). Data are presented as mean values ± s.e.m. Significance was evaluated by repeated measures two-way ANOVA in FIGS.14C and 14D, and by Fisher’s exact test in FIG.14H. [00034] FIGS.15A-15G show AAV-mediated transgene expression and biodistribution in non-human primates (NHPs) following intramyocardial injection. FIG.15A) Representative images of immunostained GFP (top) and BacNav-HA (bottom) around the injection sites in infarcted NHP ventricles 4 weeks after intramyocardial AAV injection. FIG.15B) Representative high-magnification images showing t-tubular BacNav expression in CMs bordering the Vimentin+ infarct region. FIG.15C) Quantification (by qPCR from isolated gDNA) of AAV tissue biodistribution showing localized AAV transduction around injections sites at the infarct region and minimum cardiac and extracardiac off-target expression (N=6 animals; P-values denote significance for Heart border zone vs. other groups). vg: vector genome. FIG.15D) Quantifications of echocardiographically recorded LV end-diastolic volume (LVEDV) and LVEDV change relative to pre-MI level (DLVEDV) (Sham: N=4; I/R+GFP: N=6; I/R+BacNav: N=6). FIGs.15E-15G) Quantifications of % animals with incidence of idioventricular rhythm (IVR, FIG.15E), atrioventricular block (AVB, FIG.15F), and supraventricular tachycardias (SVT, FIG.15G). Data are presented as mean values ± s.e.m. Significance in FIG.15C was 13 30155659V.1 Atty Docket No.: 1449507-DU8236PCT evaluated by one-way ANOVA with Holm-Šídák's multiple comparison test. Lack of significant differences was established by repeated measures two-way ANOVA with Holm-Šídák's multiple comparison test in FIG.15D and by Fisher’s exact test in FIGS.15E-15G. DETAILED DESCRIPTION [00035] The following detailed description is presented to enable any person skilled in the art to make and use the aspects of the present application. For purposes of explanation, specific nomenclature is set forth to provide a thorough understanding of the present application. However, it will be apparent to one skilled in the art that these specific details are not required to practice the aspects of the present application. Descriptions of specific embodiments are provided only as representative examples. The present application is not intended to be limited to the embodiments shown but is to be accorded the widest possible scope consistent with the principles and features disclosed herein. With respect to the teachings in the present application, any issued patent, pending patent application, patent application publication, or non-patent literature described in this application is expressly incorporated by reference herein. [00036] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed methods and compositions belong. The phrase “as used herein” and variants thereof refer to the entire disclosure of this application, as well as to the appended claims. [00037] Articles “a” and “an” as used herein refer to one or to more than one (i.e. at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element. [00038] “About” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result. [00039] The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of” and “consisting of” those certain elements. As used herein, “and/or” refers to and encompasses any and all possible 14 30155659V.1 Atty Docket No.: 1449507-DU8236PCT combinations of one or more of the associated listed items, as well as the lack of combinations where interpreted in the alternative (“or”). [00040] As used herein, the transitional phrase “consisting essentially of” (and grammatical variants) is to be interpreted as encompassing the recited materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention. See, In re Herz, 537 F.2d 549, 551-52, 190 U.S.P.Q.461, 463 (CCPA 1976) (emphasis in the original); see also MPEP §2111.03. Thus, the term “consisting essentially of” as used herein should not be interpreted as equivalent to “comprising.” [00041] As used throughout, the term “nucleic acid” or “nucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. A nucleic acid sequence can comprise combinations of deoxyribonucleic acids and ribonucleic acids. Such deoxyribonucleic acids and ribonucleic acids include both naturally occurring molecules and synthetic analogues. The polynucleotides of the invention also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like. [00042] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.19:5081 (1991); Ohtsuka et al., J. Biol. Chem.260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). A nucleic acid of the present disclosure may also be codon-optimized for expression in a cell type different from the cell type that the nucleic acid sequence originated from, such as a prokaryotic sequence that is codon-optimized for expression in eukaryotic cells. [00043] “Polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. As used herein, the terms encompass amino acid chains of 15 30155659V.1 Atty Docket No.: 1449507-DU8236PCT any length, including full-length proteins, wherein the amino acid residues are linked by covalent peptide bonds. [00044] As used herein, "treatment,” “therapy,” “therapeutic,” and/or “therapy regimen” refer to the clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes the alleviation or prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition. [00045] Moreover, the present disclosure also contemplates that in some embodiments, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination. [00046] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. [00047] The present disclosure provides a novel therapeutic method for the treatment of heart failure that can also result in the reversal of symptoms, restore the pumping function of the heart, and extend the life of a patient. One of the challenges of treating heart failure patients is that the native sodium channels in the heart muscle have become defective and fail to deliver sufficient Na+ ions into cardiomyocytes (CMs). However, CM sodium channels are too large to fit in a therapeutically acceptable vector for delivery to, and transduction of, CMs. The inventors have found that transducing CMs with a prokaryotic sodium channel (BacNav), which is small enough to package into the capsid of an rAAV vector, under the control of a CM-specific promoter is capable of restoring Na+ uptake. Additionally, the inventors have surprisingly found here that transduction of CMs with BacNav polypeptides also restored Na+/Ca2+ ionic balance 16 30155659V.1 Atty Docket No.: 1449507-DU8236PCT within CMs via suppressing Ca2+ efflux (forward mode) through the Na+/Ca2+ exchanger (NCX), which in turn enhances Ca2+ uptake into the sarcoplasmic reticulum (SR) to increase amplitude of ca2+ transients. This resulted in increased contractile strength of the heart muscle, thus improving pumping force of the heart and restored ejection fraction. [00048] The present disclosure describes multi-species exemplification showing significant inotropic and antiarrhythmic benefits of CM-specific BacNav expression in a variety of healthy and pathological settings in vitro, in silico, and in vivo. Specifically, the inventors have surprisingly found that BacNav expression augments Ca2+ transient amplitude in healthy 2D and 3D cultures of neonatal rat CMs, adult CMs freshly isolated from AAV9-BacNav-transduced mice, and a computational model of rabbit ventricular myocyte. Furthermore, BacNav expression improved contractile strength of healthy 3D neonatal rat CM cultures, isolated mouse CMs, and I/R-injured engineered human heart tissues. [00049] In vivo, in a mouse chronic pressure-overload model, a one-time administration of AAV9-BacNav surprisingly fully restored contractile (LVEF) deficit, attenuated fibrosis and CM hypertrophy, and prevented conduction slowing and ventricular arrhythmias under pacing and adrenergic (ISO/Caff) challenges in sedated animals. In NHPs, in an I/R-induced MI model, AAV-BacNav therapy improved LVEF and prevented spontaneous arrhythmias in conscious animals. Regardless of species, HF etiology, or delivery route tested, the AAV9-BacNav expression was strong, sustained, CM-specific and properly targeted to sarcolemma, and did not elicit immune response or cell apoptosis. Robustness of the approach was further evident from successful use of both pre-clinically (cTnT) (Liu, 2021; Abouleisa, 2022) and clinically (MHCK7) (Mendell, 2020) utilized gene promoters. [00050] Mechanistically, during an AP, additional Na+ influx through BacNav channels acted to suppress NCX forward mode resulting in increased subsarcolemmal Ca2+ levels. In response, Ca2+ reuptake into the SR by SERCA was enhanced, which in turn increased SR Ca2+ content, eventually resulting in larger Ca2+ transient amplitude and stronger contraction. As revealed through drug inhibition and genetic knockdown experiments, NCX was a requisite mediator of the BacNav-induced inotropic effects. In HF patients (Studer, 1994) and animal models (Hobai, 2000; Pogwizd, 1999), increased protein level and activity of NCX underlie enhanced Ca2+ extrusion and reduced cytosolic Ca2+ levels and contractile strength of CMs. Consequently, partial pharmacological inhibition of NCX forward mode has been shown to 17 30155659V.1 Atty Docket No.: 1449507-DU8236PCT augment SR Ca2+ load, Ca2+ transient amplitude, and contractility (Ozdemir, 2008; Hobai, 2004; Acsai, 2007), while also suppressing Ca2+-dependent arrhythmogenic events including early and delayed after depolarizations (Jost, 2013; Nagy, 2004). [00051] As described in the Examples, predominant arrhythmic events post-drug challenge in the TAC mice manifested as bidirectional VTs, which are often initiated by triggered activity due to elevated intracellular Ca2+ (Cerrone, 2005; Leenhardt, 2012). BacNav expression was found to suppress these events and as an added benefit, improved AP conduction slowing (evident from shortening of QRS and PR intervals), which underlies reentrant arrhythmias in ischemic or fibrotic myocardium (Tse, 2016). Without being bound to any particular theory, this suppression may have been a result of inhibiting forward mode NCX activity (Jost, 2013; Nagy, 2004). It is thought that employing engineered BacNav variants with different activation and inactivation kinetics (Nguyen, 2016; Nguyen, 2018) may allow precise modulation of NCX activity (enhancing reverse and suppressing forward mode) to target diverse cardiac pathologies ( Hobai, 2004; Voigt, 2012; Maddaford, 2010; Hegner, 2022; Nagy, 2022), while obviating potential off-target effects associated with pharmacotherapy. Moreover, given their small size, BacNav genes may be co-packaged within a single AAV vector with other candidate genes targeting HF (e.g. SERCA2a (Greenberg, 2016), I-1c (Fish, 2013), SUMO-1 (Tilemann, 2013), BAG3 (Knezevic, 2016)), to test for possible synergistic effects. [00052] The inventors have notably found that therapeutic action of AAV-BacNav was initiated in TAC mice after disease was already established and the resulting functional rescue was accompanied by ameliorated histopathological remodeling with normalized expression levels of key fibrotic and hypertrophy-associated genes. Without being bound to any particular theory, this effect may be at least in part attributed to the improved Ca2+ handling and suppressed calcineurin activation (evident by restored Rcan1 expression), a major driver of cardiac hypertrophic remodeling (Molkentin, 1998; Sussman, 1998; Berry, 2011). Therefore, despite continued pressure overload, BacNav expression in TAC mice may arrest some of the important aspects of maladaptive cardiac remodeling by preventing the sustained Ca2+-dependent pathological signaling. In the I/R MI model in NHPs (distinct HF etiology from TAC), BacNav expression also improved LVEF and prevented arrhythmias, and although effects on Ca2+ handling were not studied, they likely mirrored the mechanism that was consistently found in mouse, rat, human, and rabbit (in silico) CMs. 18 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [00053] An inherent concern in gene therapy revolves around the choice of vector and its delivery route. In this study, although a substantial number of AAV viral genomes were still detectable in liver and kidney three months after systemic delivery in mice, the inventors found no evidence of off-target expression, tissue toxicity, or immunogenicity resulting from the AAV vector or transgene expression. Similarly, using a different delivery route (intramyocardial injections targeting infarct border zone) and a more efficient self-complementary AAV vector, no off-target expression, side effects, significant alterations in ECG, animal behavior, appetite, weight, or fatalities were observed in NHPs during the one-month study. Considering that BacNav effects on Ca2+ handling were dose-dependent, further optimizations of the vector dosage and potential use of alternative cardiotropic AAV capsids (Tabebordbar, 2021; Gonzalez, 2022) based upon the present disclosure can be made to further enhance therapeutic benefits. For ultimate translation to clinics, long-term studies in large animal models of HF (e.g. porcine, canine, or ovine) (Silva, 2020) can further demonstrate the safety and efficacy of BacNav therapy, especially in more advanced stages of the disease. Methods [00054] An aspect of the present disclosure relates to a method for treating reduced ejection fraction in a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00055] Another aspect of the present disclosure relates to a method for improving both contractile and electrical dysfunction in a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00056] Another aspect of the present disclosure relates to a method for increasing subsarcolemmal Ca2+ levels in cardiomyocytes of a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a 19 30155659V.1 Atty Docket No.: 1449507-DU8236PCT promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00057] Another aspect of the present disclosure relates to a method for inhibiting the Na+/Ca2+ exchanger (NCX) in cardiomyocytes of a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00058] Another aspect of the present disclosure relates to a method for reducing the incidence of arrythmia in a subject with heart failure, the method failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00059] Another aspect of the present disclosure relates to a method for reversing reduced ejection fraction in a subject with heart failure, the method failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00060] Another aspect of the present disclosure relates to a method for augmenting peak Na+ current and Ca2+ transient amplitude in cardiomyocytes of a subject with heart failure. The method comprises administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. [00061] Any polynucleotide sequence encoding a BacNav polypeptide (i.e. BacNav coding sequence, also referred to as transgene) is suitable for use in the present disclosure. In some embodiments, the BacNav coding sequence is codon-optimized for expression in eukaryotic cells. In some embodiments, codon choice in the BacNav coding sequence are optimized for expression in human cells. Examples of codon-optimized BacNav coding sequences include, but 20 30155659V.1 Atty Docket No.: 1449507-DU8236PCT are not limited to BacNav variants, NavSheP D60A h2SheP (SEQ ID NO: 1) (Nguyen, 2022), NavRhi V1 (SEQ ID NO: 40), NavRhi V2 (SEQ ID NO: 41), NavRhi V3 (SEQ ID NO: 42), and h3SheP, as well as any of the BacNav coding sequences disclosed in US 20240108754 and U.S. Patent No.11,980,671, which are incorporated in this disclosure in their entirety with respect to the BacNav coding sequences disclosed therein. “Variants” applies to both amino acid and nucleic acid sequences. As to non-coding nucleotide sequences (e.g., sequences of regulatory elements such as promoters, enhancers, polyadenylation signals and the like) it is well known that a sequence variation is tolerated without a diminution of function (e.g., without loss of promoter function). A variant sequence is typically at last 80% identical to the reference sequence, sometimes at least about 85% identical, sometimes at least about 90% identical, at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical and retains the function of the reference sequence. In some embodiments of the aspects of this disclosure, the BacNav polypeptide is h2SheP. [00062] In some embodiments, a BacNav coding sequence may have an epitope tag coding sequence appended to the 3’ end. Exemplary epitope tags include, but are not limited to, a polyhistidine tag, an HA tag (e.g., SEQ ID NO:43), albumin-binding protein, alkaline phosphatase, an AU1 epitope, an AU5 epitope, a biotin-carboxy carrier protein (BCCP), a FLAG epitope (e.g., SEQ ID NO:51), or a MYC epitope (e.g., SEQ ID NO:52). In some embodiments, the epitope tag is a hemagglutinin (HA) tag (SEQ ID NO: 43). [00063] In some embodiments, a BacNav coding sequence may have a trafficking motif appended to the 3’ end of the BacNav coding sequence or, if present, at the 3’ end of the tag sequence. In some embodiments, the trafficking motif is an AnkG motif (SEQ ID NO: 44), CAAX motif (SEQ ID NO: 45), SIV motif (TCCATCGTG), or MOG1 motif (SEQ ID NO: 46). [00064] The polynucleotide sequence encoding a BacNav polypeptide can be introduced into a host cell or organism of interest (i.e. subject) via a vector comprising an expression cassette. The cassette will include 5’ and 3’ regulatory sequences operably linked to a recombinant nucleic acid provided herein that allows for expression of the BacNav polypeptide. The expression cassette will include in the 5’ to 3’ direction of transcription: a transcriptional and translational initiation region (i.e., a promoter), a polynucleotide disclosed herein, and a transcriptional and translational termination region (i.e., termination region) functional in the cell or organism of interest. The promoters described herein are capable of directing or driving 21 30155659V.1 Atty Docket No.: 1449507-DU8236PCT expression of a coding sequence in a host cell. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) may be endogenous or heterologous to the host cell or to each other. As used herein, “heterologous” in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. Promoters, enhancers and other regulatory sequences are “operably linked” to a coding sequence when they affect to the expression or stability of the coding sequence or a polypeptide product (e.g., mRNA or protein). [00065] Regulatory sequences for transgene expression include nucleotide sequences located upstream (5’ non-coding sequences), within, or downstream (3’ non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, enhancers, translation leader sequences, introns, splicing and polyadenylation signals and transcription termination sequences; sequences that enhance translation efficiency (e.g., Kozak consensus sequence) and sequences that enhance protein stability. [00066] In some embodiments of the aspects of this disclosure, the promoter is a cardiomyocyte-specific promoter. In some embodiments of the above aspects, the cardiomyocyte-specific promoter is, α-myosin heavy chain (α-MHC) promoter (SEQ ID NO: 27), myosin light chain (MLC2v) promoter (SEQ ID NO: 28), cardiac troponin T (cTnT) promoter (SEQ ID NO: 29), or atrial natriuretic factor (ANF, atrial-specific) promoter (SEQ ID NO: 30). In some embodiments of the aspects of this disclosure, the promoter is a chimeric muscle-specific promoter. In some embodiments of the above aspects, the chimeric muscle- specific promoter is MHCK7 (SEQ ID NO: 31), CK8 (SEQ ID NO: 32), or SPc5-12 (SEQ ID NO: 33). [00067] Transgenes delivered by AAV vectors are flanked by ITRs (inverted terminal repeats) required for genome replication and packaging. In some embodiments, the Right ITR is the identical reverse complement of the Left ITR (so that a single 5’-3’ nucleotide sequence can define both ITRs). A certain degree of mismatch between the left and right ITRs is tolerated. Various ITRs are known and are suitable for use with AAV2. In one embodiment the ITR is SEQ ID NO: 38 (and its reverse complement). Exemplary ITRs for use in AAV vectors as described herein are those of AAV serotype 1 (ITR1; single strand AAV (SEQ ID NO: 36), self- 22 30155659V.1 Atty Docket No.: 1449507-DU8236PCT complementary AAV (SEQ ID NO: 37), AAV serotype 2 (ITR2; single strand AAV (SEQ ID NO: 38), and self-complementary AAV (SEQ ID NO: 39). [00068] In some embodiments, a AAV vector of the present disclosure comprises a BacNav coding sequence operably linked to a cardiomyocyte/muscle-specific promoter and further comprising two inverted terminal repeats (ITRs) (e.g., AAV serotype 1 (ITR1; single strand AAV (SEQ ID NO: 36), self-complementary AAV (SEQ ID NO: 37) or AAV serotype 2 (ITR2; single strand AAV (SEQ ID NO: 38), self-complementary AAV (SEQ ID NO: 39)). Other possible components of the vector can include enhancers or transcript stabilizing elements, cardiac-specific cis-acting regulatory modules (including, but not limited to, CS-CRM4 (SEQ ID NO: 34) and CS-CRM7 (SEQ ID NO: 35)), an intron, a polyadenylation sequence and a second gene or coding sequence of interest under the control of the same or a different promoter. [00069] In some embodiments, viral vectors (such as AAV vectors) of this disclosure may also comprise at least one stuffer sequence. Due to the requirement for maintaining the vector size within the limits for efficient DNA packaging (approximately 75 to 105% of the wild-type genome length), AAV vectors of this disclosure can also contain stuffer sequences to account for deletion of portions of the viral genome. The total genome size of the AAV vector, including the stuffer sequence, must be within the optimal packaging capacity of the AAV capsid, which is approximately 4.7 kilobases. The length of the stuffer sequence must be selected to ensure the overall genome size remains within this threshold, especially when the therapeutic gene is short and requires additional stuffer DNA to reach the minimum size for stable packaging. The stuffer sequence should be designed to avoid cryptic splice sites, polyadenylation signals, and promoter elements that could interfere with the expression of the transgene or the overall stability of the vector genome. Bioinformatics tools can be used to scan for such elements in proposed stuffer sequences. Using sequences with known safety profiles and minimal immunogenicity is advisable to reduce the potential for adverse immune responses in the subject. Synthetic stuffer sequences or sequences derived from non-coding regions of the human genome are often employed for this purpose. Stuffer sequences can include sequences that facilitate the molecular cloning and manipulation of the AAV vector, such as multiple cloning sites or loxP sites for Cre- lox recombination, which can enhance the utility and flexibility of the vector for various applications. However, these elements must be carefully positioned to avoid disrupting the overall packaging efficiency or the expression of the therapeutic transgene. In some 23 30155659V.1 Atty Docket No.: 1449507-DU8236PCT embodiments, a stuffer sequence is located downstream of the BacNav coding sequence or, if present, downstream of a 3’ end epitope tag coding sequence. In some embodiments, a stuffer sequence can be present between a 3’ end epitope tag sequence and a trafficking motif, such as TGCAAG. [00070] In certain embodiments, exemplary expression cassettes useful for the methods provided in this disclosure include NavRhi-HA-AnkG (SEQ ID NO: 47), NavRhi-HA-CAAX (SEQ ID NO: 48), NavRhi-HA-SIV (SEQ ID NO: 49), and NavRhi-HA-MOG1 (SEQ ID NO: 50). [00071] Expression cassettes may also contain at least one additional coding sequence or genetic element to be cotransformed into the cell or organism of interest. Where additional genes or elements are included, the components are operably linked. Alternatively, the additional coding sequence(s) or element(s) can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of the polynucleotides to be under the transcriptional regulation of the regulatory regions. In some embodiments of the methods provided in this disclosure, the expression cassette or vector comprises a first polynucleotide encoding a BacNav polypeptide and a second polynucleotide sequence encoding a second polypeptide of interest. In some embodiments, the second polypeptide is one whose dysregulation in cardiomyocytes is also associated with abberant Ca2+ regulation in heart failure. In some embodiments, the second polypeptide is SERCA2a, I-1C, SUMO-1, or BAG3. Additional description of such vectors are described below in this disclosure. [00072] Any pharmaceutically acceptable means for the introduction of a BacNav coding sequence into a cell of organism of interest is suitable for use in the present invention including, but not limited to, BacNav gene knock-in using recombinant adeno-associated virus (rAAV) vectors. AAV is a non-enveloped, single-stranded DNA virus having a small icosahedral capsid. A defining characteristic of AAV is its dependence upon a helper virus for productive replication, i.e., AAV is replication defective. In rAAV vectors, all viral open reading frames from the viral genome have been eliminated and replaced with heterologous genetic information, allowing rAAV to be assembled and packaged to high vector yields for gene transfer. There are a number of AAV serotypes, with each serotype being most effective in transducing particular cell types or organs. For example, AAV1, AAV6, AAV8 and AAV9 are considered the most 24 30155659V.1 Atty Docket No.: 1449507-DU8236PCT favorable candidates for specific cardiac transduction with AAV9 considered the best for transducing CMs. Some AAV vectors isolated from other species are also suitable for use in humans due to low immunogenicity, such as, but not limited to, AAVrh74, which was originally isolated from rhesus monkeys. Additionally, modified rAAV capsids have been engineered to enhance their tissue specificity. For example, cc47 (US 2023-0151389 A1), myoAAV2A, myoAAV4A, myoAAV4E, AAV2i8, rAAV.KK04, Anc80L65, rAAVM41, AAV2-THGTPAD, or AAV2-NLPGSGD is a non-limiting list of rAAV capsid serotypes suitable for targeting CMs. Additionally, some chimeric muscle-specific rAAV vectors such as, but not limited to, MHCK7 and CK8 are also suitable for transducing CMs. [00073] In some embodiments of the aspects of this disclosure, the vector is a recombinant adeno-associated virus (AAV) vector. In some embodiments of the above aspects, the recombinant AAV vector serotype is rAAV6, rAAV9, rAAVrh74, cc47, myoAAV2A, myoAAV4A, myoAAV4E, AAV2i8, rAAV.KK04, Anc80L65, rAAVM41, AAV2-THGTPAD, or AAV2-NLPGSGD. [00074] In addition to AAV vectors, other viral vectors that may be used include, but are not limited to, retroviruses, adenoviruses (AdV), lentiviruses, pox viruses, alphaviruses, and herpes viruses. See e.g., Keeler et al., 2017, “Gene Therapy 2017: Progress and Future Directions,” Clin Transl Sci (2017) 10, 242–248, incorporated by reference. [00075] Vectors containing an expression cassette with a BacNav coding sequence may be produced, collected and purified using art-known methods (including methods described in publications cited herein). For AAV methods see, e.g., Zolotukin et al., 2002, Methods 28:158- 167; Aponte-Ubillus et al., 2018, Appl Microbiol Biotechnol.102(3):1045-1054, doi: 10.1007/s00253-017-8670-1; Naso et al., 2017, BioDrugs 31(4):317-334, doi: 10.1007/s40259- 017-0234-5; and Penaud-Budloo et al., 2018, Mol Ther Methods Clin Dev.8:166-180, doi: 10.1016/j.omtm.2018.01.002; all incorporated by reference and cited above. [00076] The BacNav coding sequence is incorporated into the genome of cardiac muscle cells using a pharmaceutically acceptable transduction method. As used herein, the terms “introduce” or “introduced” in the context of gene therapy refers to administering a composition comprising a polynucleotide sequence encoding a BacNav polypeptide to a cell, tissue or organ of a subject under conditions in which polynucleotide enters cells and is expressed in the cells to 25 30155659V.1 Atty Docket No.: 1449507-DU8236PCT produce proteins. Polynucleotides may be introduced as naked DNA, using a viral (e.g., AAV9) vector, using a non-viral vector system, or by other methods. [00077] In some embodiments of the aspects of this disclosure, administering to the subject is by intracoronary injection or direct cardiac muscle wall injection. In some embodiments, the direct injections are into and/or around the margins of a damaged region of the heart. In other embodiments of the above aspects, administering to the subject is by intravenous injection. [00078] As used herein, the term “subject” refers to both human and nonhuman animals. The term "nonhuman animals" of the disclosure includes all vertebrates, e.g., mammals and non- mammals, such as nonhuman primates, sheep, dog, cat, horse, cow, birds, amphibians, reptiles, and the like, as well as animal models, such as transgenic animals, and the like. The methods and compositions disclosed herein can be used on a sample either in vitro (for example, on isolated cells or tissues) or in vivo in a subject (i.e., living organism, such as a patient or animal model. In some embodiments of the aspects of this disclosure, the subject is a mammal. In some embodiments of the above aspects, the mammal is a human. [00079] In some embodiments of the aspects of this disclosure, the subject does not have a voltage gated ion channel-related condition. [00080] In some embodiments of the aspects of this disclosure, the subject has heart disease. The most commonly used classification system in the United States is the New York Heart Association (NYHA) Functional Classification, which places patients in one of four categories based on limitations of physical activity. The NYHA Functional Classification is adapted from Dolgin M, Association NYH, Fox AC, Gorlin R, Levin RI, New York Heart Association. Criteria Committee. Nomenclature and criteria for diagnosis of diseases of the heart and great vessels.9th ed. Boston, MA: Lippincott Williams and Wilkins; March 1, 1994. In some embodiments of the aspects of this disclosure, the subject is in stage I heart failure, stage II heart failure, stage III heart failure, or stage IV heart failure. [00081] Stage I is considered “pre-heart failure.” High-risk individuals include patients with high blood pressure, diabetes, hypertension, metabolic syndrome, and coronary artery disease. In some instances, the subject has a family history of alcohol abuse, rheumatic fever, cardiotoxic drug therapy, or cardiomyopathy. 26 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [00082] Stage II carries some noticeable symptoms. Most commonly, they appear after physical activity. After exercise or other moderate physical exertion, patients may experience some symptoms. Stage II symptoms may include, but are not limited to: heart palpitations, shortness of breath, and fatigue. In some instances, subjects with Stage II heart failure have been treated with a coronary artery bypass, valve repair, or valve replacement. [00083] Stage III marks the beginning of advanced heart failure. Patients have a known diagnosis of systolic heart failure. Like Stage II, Stage III can be exacerbated by physical activity. However, symptoms are often much more severe. Shortness of breath, leg weakness, swelling of the lower body, fatigue, and reduced ability to exercise are all notable signs of this advanced stage. In some instances, subjects with Stage III heart failure have been treated with biventricular pacing or an implantable defibrillator. [00084] Stage IV is the most advanced stage of heart failure. Subjects have known systolic heart failure and advanced symptoms, even with drastic lifestyle changes and the highest level of care. While at rest, subjects still experience symptoms of breathlessness and fatigue, and physical activity is likely not possible. They may also experience weight gain, swelling of the lower extremities, a dry cough, and/or a bloated stomach. In some instances, subjects with Stage IV heart failure are also being treated with medications such as enzyme inhibitors and/or beta- blockers. In some instances, subjects with Stage IV heart failure have been treated with a ventricular assist device, surgical intervention, and/or an intravenous heart pump drug. [00085] In some embodiments of the aspects of this disclosure, anti-AAV antibodies have been reduced in the subject’s blood prior to administering the vector. Some subjects have pre- existing neutralizing anti-AAV antibodies in their blood, which can adversely affect transduction efficiency. Anti-AAV antibodies can be reduced in the subject’s blood by any known therapeutically accepted method including, but not limited to, plasmapheresis, immunoadsorption, or administering empty AAV capsids before or at the same time as the rAAV vectors comprising the BacNav coding sequence. [00086] In some embodiments of the aspects of this disclosure, the subject is administered a therapeutically effective amount of the recombinant vector encoding a prokaryotic sodium ion channel (BacNaV) polypeptide, The term “effective amount” or “therapeutically effective amount” refers to an amount sufficient to effect beneficial or desirable biological and/or clinical results. 27 30155659V.1 Atty Docket No.: 1449507-DU8236PCT Compositions [00087] Dysregulation of SERCA2a, I-1C, SUMO-1, and BAG3 in cardiomyocytes are each also associated with aberrant Ca2+ regulation in heart failure. Accordingly, vectors carrying both a BacNav coding sequence and a coding sequence for SERCA2a, I-1C, SUMO-1, or BAG3 may be beneficial for the treatment of multi-factorial deficiencies in Ca2+ regulation resulting in heart failure. [00088] Another aspect of the present disclosure relates to a vector (e.g., a rAAV vector) comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide and a polynucleotide sequence encoding SERCA2a, I-1C, SUMO-1, or BAG3. Any of the BacNav coding sequences and any of the regulatory sequences described above in this disclosure may be used in the provided vector. The first polynucleotide sequence and the second polynucleotide sequence can be in either orientation in an expression cassette in the vector. In some embodiments, the first polynucleotide sequence is upstream of the second polynucleotide sequence. In some embodiments, the second polynucleotide sequence is upstream of the first polynucleotide sequence. In some embodiments, the first polynucleotide sequence and the second polynucleotide sequence can be operably linked to a single promoter or can each be linked to separate promoters. In some embodiments, the first polynucleotide sequence and the second polynucleotide sequence are operably linked to the same promoter. In some embodiments, the first polynucleotide sequence and the second polynucleotide sequence are each operably linked to a different promoter. [00089] The following Examples are provided by way of illustration and not by way of limitation. EXAMPLES [00090] The following examples are offered to illustrate, but not to limit the claimed invention. Example 1 describes the methods used both in the initial and the updated investigations unless otherwise specified. EXAMPLE 1: Materials and Methods [00091] Mouse husbandry and AAV administration: Male C57Bl/6J mice (10-12 weeks old) from Jackson Laboratory (Bar Harbor, ME) were housed in pathogen-free animal facility using 12h light/dark cycle, ambient temperature of 20–26°C, humidity of 30-70%, and access to 28 30155659V.1 Atty Docket No.: 1449507-DU8236PCT food and water ad libitum. Retro-orbital administration of viral vectors to adult mice was performed as previously described (Yardini, 2011). Briefly, mice were anesthetized with 4% isoflurane and placed in lateral recumbency. A single bolus of AAV or vehicle solution (100µl) was injected via a 30-gauge needle into the medial canthus at an angle of approximately 30 degrees. For the TAC study, mice were administered ~3.5x1012vg (1x1014vg/kg) of pAAV9- cTnT-BacNav-HA-T2A-mScarlet or pAAV9-cTnT-mScarlet vector and for the biodistribution and contractility study, mice were administered 8.75x1011vg (2.5x1013vg/kg) of pscAAV9- cTnT-BacNav-HA or pAAV9-MHCK7-BacNav-HA-T2A-mScarlet vector, respectively. Investigators performing the injections were blinded to the identity of viral vectors or vehicle. For all studies, a previously described BacNav variant, h2SheP (Nguyen, 2022) was utilized. All rodents were treated ethically in accordance with protocols approved by the Duke University Institutional Animal Care and Use Committee (IACUC). [00092] Non-human primate (NHP) husbandry: Both female and male Macaca fascicularis monkeys with body weights between 2-6kg were used in the study. Animals were pre-screened with echocardiogram to exclude those with abnormal cardiac structure and function. Pre-existing AAV9 antibodies in healthy animals were tested using collected serum and the animals with low antibody counts were selected for viral injection, while the remaining animals were used as sham control. [00093] All NHP studies were approved by the Institutional Animal Care and Use Committee and all experimental procedures were performed in accordance with the Animal Use Guidelines of the Singapore Health Services Pte Ltd and the USA National Research Council, the US Department of Agriculture (Animal Welfare Act; Public Law 99–198). Animals were regularly monitored by staff of the National Large Animal Research Facility, Singapore. Post- infarct animals were monitored daily with particular attention paid to signs of distress, which may indicate post-procedure pain or symptoms of heart failure. Surgical wounds were carefully examined for signs of infection. In the event of possible infection, wound swabs were obtained and sent for microbiology with the commencement of empirical antibiotics in consultation with veterinary staff. If there were any severe complications noted in the animal, the veterinary staff were consulted and treated as clinically appropriate. Euthanasia at the end of the study was induced under deep anesthesia by i.v. injection of 100 mg/ml/kg KCl. 29 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [00094] Plasmid construction: The doxycycline-inducible lentiviral transfer plasmid was constructed from the pCW57-MCS1-2A-MCS2 vector (a gift from Adam Karpf, Addgene plasmid #71782). Single-stranded and self-complementary (sc) AAV transfer plasmids were constructed from the pAAV-CAG-eYFP (a gift from Viviana Gradinaru, Addgene plasmid #104055) and pscAAV-CAG-GFP (a gift from Mark Kay, Addgene plasmid #83279), respectively. The NCX-shRNA (Vector ID: VB230411-1261jxj) and scramble (Vector ID: VB010000-0009mxc) lentiviral vectors were constructed and packaged by VectorBuilder. NCX shRNA predesigned target sequence (CCTGAGATTCTCCTTTCAGTA; SEQ ID NO: 2) was used (Sigma). Human-codon-optimized bacterial NavSheP D60A (Irie, 2010) (h2SheP) cDNA was synthesized by ATUM. [00095] Lentivirus production: High-titer lentiviruses were prepared using second- generation lentiviral packaging system as described previously (Nguyen, 2018). Briefly, 293T cells (ATCC) were co-transfected with lentiviral transfer plasmid, packaging plasmid psPAX2, and envelope plasmid pMD2.G (6:3:1 mass ratios) using JetPRIME transfection reagent (Polyplus). Seventy-two hours after transfection, supernatant containing lentiviral particles was collected and combined with 40% polyethylene glycol (PEG) solution at 3:1 volume ratio and incubated overnight at 4°C. Concentrated lentiviral particles were harvested following 45min centrifugation (1,500xg, 4°C) and resuspended in DPBS. Plasmids psPAX2 and pMD2.G were obtained from Didier Trono (Addgene plasmids #12260 and #12259). [00096] AAV production and titration: All recombinant AAV viruses were generated using the standard triple transfection method. Briefly, 293T cells were co-transfected with the adenoviral helper plasmid pALD-X80 (Aldevron), the packaging plasmid AAV2/9 (gift from James M. Wilson, Addgene plasmid #112865), and the transfer ITR plasmid (1:1:1 molar ratios) using polyethylenimine (PEI) 40K Max transfection reagent (Polysciences). Supernatant containing virus particles was collected 72h and 144h after transfection and combined with 40% PEG solution at 4:1 volume ratio for overnight incubation at 4°C. Concentrated AAV particles were harvested following 30min centrifugation (3000 g, 4°C) and resuspended in DPBS with 0.001% Pluronic F-68 (Thermo Fisher Scientific, 24040-032). Benzonase (Millipore Sigma) was added to the virus-containing solution at a final concentration of 50U/ml with subsequent incubation at 37°C for 30 min. Viral particles were purified via iodixanol density gradient ultracentrifugation at 30,000 rpm and 17°C for 15-17 hours (WX Ultra 80, Thermo Fisher 30 30155659V.1 Atty Docket No.: 1449507-DU8236PCT Scientific). Fractions containing AAV9 were collected and subjected to subsequent desalting and concentrated using protein concentrator columns (Thermo Fisher Scientific, 88533). Viral titers of purified viruses were determined by qPCR with primers that specifically amplify the AAV2 ITR regions (forward primer, 5’-AACATGCTACGCAGAGAGGGAGTGG-3’ (SEQ ID NO: 3); reverse primer, 5’-CATGAGACAAGGAACCCCTAGTGATGGAG-3’ (SEQ ID NO: 4); Integrated DNA Technologies). [00097] Neonatal rat ventricular myocyte (NRVM) isolation and culture: Ventricles of 2- day-old Sprague-Dawley rats (Charles River) were excised, minced, and incubated with 0.1% trypsin overnight and dissociated in four sequential steps using 0.1% collagenase (Nguyen, 2022). Isolated cardiomyocytes were seeded onto Aclar coverslips (21 mm diameter, Electron Microscopy Sciences) coated with 30 µg/ml fibronectin (Sigma) at 1.6 x 105 cells/cm2 in DMEM/F-12 medium (Gibco, 11320-033) supplemented with 10% fetal bovine serum (FBS), 0.2% penicillin, and 0.2% B12. The following day (day 1), cells were treated with 10 µg/ml mitomycin-C (Sigma) for 2 hours followed by culture in fresh media. At day 2, media was changed to serum-free maintenance media (DMEM/F12 + 0.2% penicillin + 0.2% B12 + 2.5 µg/ml L-ascorbic acid + 5 nM Triiodo-L-Thyronine + 1X Insulin-Transferrin-Selenium supplement) and lentivirus was added into the cultures for 24 hours. Following viral incubation, cells were switched to maintenance media (DMEM/F12, 0.2% penicillin, 0.2% B12, and 5% FBS), which was refreshed 100% every two days. Cultures were studied at D7. Doxycycline (Sigma, 2µg/mL) or vehicle solution was added from D5-D7. [00098] NRVM bundle fabrication and culture: Tissue-engineered NRVM bundles were fabricated as previously described ( Jackman, 2016). Briefly, 6.5 × 105 freshly isolated NRVMs were mixed with a fibrin-based hydrogel (2.5 mg/ml bovine fibrinogen (Sigma), 1 U/ml thrombin (Sigma), 10% v/v Matrigel (Corning)) and lentivirus. The hydrogel-cell mixture was cast in PDMS tissue molds with two 2 mm x 7 mm troughs and a porous nylon frame. Resulting NRVM bundles were cultured on a dynamic platform in 3D maintenance medium (low Glucose DMEM, 10% horse serum, 0.5% chick embryo extract, aminocaproic acid (1 mg/ml), ascorbic acid 2- phosphate sesquimagnesium salt hydrate (50 µg/ml), penicillin (5 U/ml), vitamin B12 (2 µg/ml)) with full media change every other day for the duration of the experiment. Doxycycline (2µg/mL) or vehicle solution was added from D12-D14. 31 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [00099] Computational modeling: The formulation for the BacNav (h2SheP variant) model current and its gating parameters has been previously described6. The BacNav model was incorporated into a rabbit ventricular myocyte model described by Shannon and Bers7. This model was chosen due to its highly detailed description of Ca2+ dynamics during the action potential (AP). Different levels of BacNav expression were simulated by changing the maximum conductance, with 1X representing BacNav level that produces the same peak current as endogenous Nav1.5 during voltage-clamp simulation (Nguyen, 2022; Needs, 2023). Ryanodine receptor (RyR) opening due to caffeine administration was simulated by changing the three RyR gating variables to 1. The integrated Ca2+ flux over time was calculated as previously described (Shannon, 2004). Steady-state parameters were reached by simulating the single-cell model for 1000 beats at 1Hz pacing rate and the final state was reported. [000100] hiPSC-CM differentiation and culture: DU11 human induced pluripotent stem cells (hiPSCs, derived and validated at Duke University iPSC Core Facility (Shadrin, 2017)) were maintained on hESC-Matrigel (Corning, 354277) in mTeSR Plus medium (Stemcell Technologies) and colony-passaged as small (10–20 cells) clusters every 3 days using 0.5 mM EDTA (1:10 split ratio). hiPSCs were differentiated into cardiomyocytes (hiPSC-CMs) using small-molecule modulation of the Wnt signaling pathway and purified via metabolic selection between day 10 and 14 post induction, as previously described8. Purified hiPSC-CMs were then maintained in 3D RB+ culture media consisting of RPMI-1640 (Sigma, R8758), 2% B-27 supplement (Gibco, 17504044), 2 mg/mL aminocaproic acid (Sigma, A2504), 50 µg/mL ascorbic acid 2-phosphate (Sigma, A8960), 1% penicillin-streptomycin (Thermo Fisher Scientific,15140), 1% non-essential amino acids (Thermo Fisher Scientific, 11140), and 1% sodium pyruvate (Thermo Fisher Scientific, 11360), 0.45 µM 1-thioglycerol (Sigma, M6145), with full media change every other day. [000101] Human cardiopatch fabrication and culture: Human engineered cardiac tissues (Cardiopatches, 7 × 7 mm) were fabricated from human induced pluripotent stem cell-derived CMs (hiPSC-CMs) after 21–23 days of differentiation, as previously described (Shadrin, 2017). Briefly, 0.5×106 cells were mixed with lentivirus in a fibrin-based hydrogel and cast inside a PDMS mold containing a Cerex® frame. Cardiopatches were cultured on a rocking platform (GeneMate Rocker, BioExpress) with 2/3 of the media change every 2 days. Cardiopatches were cultured in 3D RB+ media for the first 7 days and in 5% FBS media (low-glucose DMEM, 5% 32 30155659V.1 Atty Docket No.: 1449507-DU8236PCT fetal bovine serum (FBS), 2 mg/mL aminocaproic acid, 50 µg/mL ascorbic acid 2-phosphate, 1% penicillin-streptomycin, 1% non-essential amino acid, 0.45 µM 1-thioglycerol) for the remainder of culture. [000102] In vitro ischemia/reperfusion injury: The inventors developed an in vitro model of ischemia-reperfusion injury in the engineered cardiopatches. The in vitro ischemia-reperfusion (I/R) injury model was established by modifying a previously published procedure9. Specifically, hiPSC-CM cardiopatches were washed in PBS, placed in a PDMS tissue mold, and incubated in 120 μL of ischemic solution (119 mM NaCl, 12 mM KCl, 1.2 mM NaH2PO4, 1.3 MgSO4, 0.5 MgCl2, 0.9 CaCl2, 20 mM sodium lactate, and 5 mM HEPES, pH = 6.4). Tissues were incubated inside a hypoxic chamber perfused by anoxic gas (95% N2, 5% CO2) at 37°C for 6 h. Reperfusion was modeled by subsequent cardiopatch culture in standard 5% FBS culture media on rocking platform in normoxic conditions at 37°C. Control (uninjured) tissues were cultured under the reperfusion conditions for the entire duration of the experiment. Doxycycline (2µg/mL) or vehicle solution was added as indicated in corresponding experiments. [000103] In vitro I/R injury characterization: Cell death was assessed by measuring lactate dehydrogenase from culture media using CytoTox 96® non-radioactive cytotoxicity assay (Promega, G1780) and staining dead cells using NucGreen Dead (Thermo Fisher Scientific; R37109). Reactive oxygen species (ROS) levels were measured using CellROX™ Green Reagent (Thermo Fisher Scientific; C10444). All assays were performed according to manufacturer's instructions. [000104] Optical mapping of action potential propagation in cardiopatches: Human cardiopatches were optically mapped with a 20-mm diameter hexagonal array of 504 optical fibers (Redshirt Imaging). Briefly, tissues were stained with 10 μM Di-4-ANEPPS (Biotium) for 10 min at room temperature before being transferred to a temperature-controlled (37°C) recording chamber filled with Tyrode’s solution. Illumination via a solid-state excitation light source (Lumencor, SOLA SM) was passed through a 520 ± 30 nm bandpass filter to excite the dye and emitted red fluorescence signals (λ > 590 nm) were collected by the optical fiber array, converted to voltage signals by photodiodes, and recorded at a 2.4-kHz sampling rate with a 750- μm spatial resolution. Action potential propagation was initiated by 10-ms, 1.2 x threshold, 2-Hz stimuli from a bipolar point electrode connected to a Grass Stimulator (Grass Technologies). 33 30155659V.1 Atty Docket No.: 1449507-DU8236PCT Generation of isochrone maps and calculation of conduction velocity (CV) and APD80 were performed for 2Hz pacing using custom MATLAB software, as previously described. [000105] Assessment of contractile force in engineered cardiac tissues: Force generation in engineered cardiac tissues (NRVM bundles or human cardiopatches) was measured using a custom-made isometric force measurement setup containing a force transducer and a computer- controlled linear actuator (Thorlabs), as previously described (Shadrin, 2017). Briefly, in 37°C Tyrode’s solution, tissues were stimulated at 2 Hz using field electrodes and progressively stretched in increments of 4% of culture length to a maximum length (16% for bundles, 20% for cardiopatches). At each length, active force generation and passive tension were recorded after 45s of equilibration. Maximum twitch amplitude, active and passive force-length curves, and parameters of twitch kinetics were derived as previously described using custom MATLAB software (Shadrin, 2017). [000106] Isolation of adult mouse ventricular CMs: Adult mouse ventricular CMs were isolated according to a previously published Langendorff-free procedure (Ackers-Johnson, 2016). Briefly, the heart was excised and enzymatically digested by perfusion of pre-warmed enzyme solution (0.5 mg/mL collagenase II (Worthington), 0.5 mg/mL collagenase IV (Worthington), 0.05 mg/mL protease XIV (Sigma), Blebbistatin 15 μmol/L (Stemcell Technologies)). The collagenase activity was inhibited with fetal bovine serum (FBS) to a final concentration of 10% and the cell suspensions were passed through a 200 μm filter (BD Biosciences). Ca2+ concentration in the bath was gradually restored using 4 intermediate Ca2+ reintroduction buffers (0.06 mM, 0.24 mM, 0.6 mM and 1.2 mM final concentration) during which the cells were allowed to settle by gravity for 10 minutes. Final cell pellet was resuspended in extracellular buffer (137 mM NaCl, 4 mM KCl, 1 mM MgCl2, 10 mM HEPES, 0.33 mM NaH2PO4, 1.2 mM CaCl2, 5.5 mM D-(+)-Glucose, 1 mg/mL BSA, pH 7.4) for subsequent measurements. Only quiescent CMs with clear striations were used for measurements. [000107] .Contractility of isolated adult mouse CMs: Contractility in freshly isolated adult CMs was measured after 1.2 mM Ca2+ reintroduction. Cardiomyocytes were electrically stimulated at 0.5 Hz using a field stimulator at room temperature and contraction video was recorded using a CMOS camera (Thorlabs, CS135MU). Five to ten consecutive contractions from each cell during steady state were analyzed using edge detection software ContHeart, as 34 30155659V.1 Atty Docket No.: 1449507-DU8236PCT previously described (Fagundes, 2020), and contraction amplitude (% cell shortening) and the parameters of contraction kinetics were derived using custom MATLAB software. [000108] Intracellular Ca2+ measurements: Cell monolayers and engineered cardiac tissues were incubated with 10 μM Cal-520 (AAT Bioquest) at 37°C for 60 min followed by 30 min incubation in Tyrode's solution at room temperature. Adult mouse CMs were loaded with 10μM Cal-520 at room temperature for 30 minutes. Subsequently, cells were placed in a 37°C live-imaging chamber in Tyrode's solution and paced with field stimulator at rate specified in corresponding experiments. For NRVM bundle and human cardiopatch recordings, 10 μM Blebbistatin (Stemcell Technologies) was supplemented to prevent motion artifacts. Ca2+ transient videos were acquired using an EMCCD camera (iXon Ultra 897, Andor) attached to a Nikon Eclipse TE2000 microscope, and analyzed using Andor Solis software. Background fluorescence was first subtracted from the fluorescence signal, then the baseline fluorescence F0 was measured as the average fluorescence during 100ms window before stimulation and max fluorescence Fmax was determined in response to stimulation. Ca2+ transient amplitude (ΔF/F0) was defined as (Fmax-Fo)/Fo. For NCX inhibition experiments, 5μM or 10μM ORM-10962 (MedChemExpress) was added before recording as indicated. For correlation studies, 5% mScarlet intensity was used as cutoff for identifying transduced cardiomyocytes. [000109] To measure NCX and SERCA activity rates, cells/tissues were first paced for 20- 30 consecutive pulses using field stimulation. Stimulation was then stopped, and caffeine bolus (40mM for monolayers and engineered tissues, 20mM for adult CMs) was rapidly applied. The decays of electrically stimulated ( ^) and caffeine-induced ( ^caffeine) Ca2+ transients were fitted with mono-exponential equations. NCX forward mode activity and SERCA reuptake activity were estimated based on the respective rate constants of decay (Altamirano, 2019), kNCX=1/ ^caffeine and kSERCA=1/ ^ - 1/ ^caffeine. [000110] Murine model of pressure-overload induced heart failure (HF): Baseline echocardiography parameters were measured in ten-week-old C57BL/6J mice before the surgery. Mice were then randomized to receive transverse aortic constriction (TAC) or sham surgery, carried out at the Duke Cardiovascular Physiology Core Facility as previously described (Li, 2020). Four weeks after surgery, the TAC mice that had <5% decrease in LVEF compared to baseline were excluded. The other animals were randomized for AAV (control mScarlet, or 35 30155659V.1 Atty Docket No.: 1449507-DU8236PCT BacNav) injections. Male mice were used in these studies based on their increased vulnerability to TAC-induced HF compared to females (Fleigner, 2010; Skavdahl, 2005). [000111] NHP model of cardiac ischemia/reperfusion (I/R) and AAV administration: Macaques were sedated by a mixture of ketamine (10 mg/kg) and medetomidine (0.1 mg/kg). After intubation, anesthesia was maintained using 2-2.5% isoflurane. Buprenorphine was administered to provide perioperative and postoperative pain relief. After disinfecting the chest, an incision was performed in the intercostal muscle between ribs 4 and 5 to expose the heart via thoracotomy. Before myocardial infarction (MI) or sham injury, an i.v. lidocaine bolus of 1mg/kg and an infusion of 20 μg/kg/min were used to prevent ventricular arrhythmias. The I/R model was generated by a transient, 60-min occlusion of the mid left anterior descending (LAD) coronary artery using a non-absorbable suture, followed by 10-min reperfusion, mimicking a clinical setting. Following reperfusion, animals were randomly assigned to 2 groups: 1) I/R + intramyocardial injection of scAAV9-MHCK7-GFP vector, and 2) I/R + intramyocardial injection of scAAV9-MHCK7-BacNav-HA vector. For vector injection, 5x1012 vg of AAV in 0.5 ml solution (~1x1012 vg/kg) was intramyocardially injected by placing three 0.1 mL injections in the peri-infarct border zone and two 0.1 ml injections into the central ischemic region. Sham animals did not undergo I/R injury. Subsequently, the chest was closed in layers using 4-0 absorbable sutures. Myocardial ischemia was confirmed by ST-segment elevation in electrocardiograms. After surgery, all animals received analgesia (Ketoprofen: 5 mg/kg/day) and antibiotics (Enrofloxacin: 15mg/kg). [000112] Transthoracic echocardiography in mice and NHPs: For mouse echocardiography, animals were anesthetized by 1.5-2% isoflurane inhalation and imaged in both long axis (B-mode) and short axis (M-mode) using a Vevo3100LT instrument with a 25–55 MHz transducer (MX550D, VisualSonics). For B-mode measurements, the heart was transected longitudinally, ensuring visualization of an open aorta. For M-mode, the heart was transected transversely at the mid-ventricular level where the papillary muscles of the LV were clearly visible. Echocardiographic images were analyzed with VevoLab 5.7.1 software’s AutoLV analysis tool and individually verified for accuracy. Calculations for echocardiographic parameters were performed as per the VevoLab software default settings. Data from at least 3 cardiac cycles were collected and replicate measurements from each heart were averaged. All 36 30155659V.1 Atty Docket No.: 1449507-DU8236PCT measurements and quantifications were performed by an experienced operator in a blinded fashion. [000113] Echocardiography to assess NHP heart function before and after I/R was performed as previously described (Zhen, 2021). All monkeys were sedated by mixture of Ketamine (10 mg/kg)/Medetomidine (0.1 mg/kg) and anesthesia was maintained using 2-2.5% isoflurane. Transthoracic echocardiography was performed using an echocardiographic system composed of a Vivid E95 and a 6S-D Phased Array Transducer with frequency spectrum of 2.4 - 8.0 MHz (GE Venged Ultrasound AS, Horten Norway). The monkeys were placed in a supine position with their chest shaved and a layer of acoustic coupling gel applied to the thorax. An average of 10 cardiac cycles of 2 dimensional images at all standard echocardiographic views (parasternal long and short axis, 4, 2 and 3 chambers) were acquired and stored for subsequent offline analysis. Left ventricular ejection fraction (LVEF) was calculated according to the American Society of Echocardiography-corrected cube formula (Lang, 2015). All quantifications were performed by a qualified cardiologist in a blinded fashion. [000114] Mouse surface ECG and intracardiac electrophysiology: Mice were anesthetized using a volatile anesthetic system with induction chamber (R5835, RWD Life Science, Dover, Delaware, United States) with 2% isoflurane mixed with 2L/min 100% O2. Subdermal leads were placed for surface electrocardiographic (ECG) analysis which includes two total leads: I and II. Baseline ECGs were recorded at 5000 samples/second when mice reached an internal temperature of 37°C and at 1000 samples/second during the remainder of study. For intracardiac electrophysiology, jugular venous cutdown was performed using a dissection microscope (A60, Leica, Buffalo Grove, Illinois, United States) and an 8-lead 1.1F, 8E, 1.0mm octapolar electrophysiology catheter (iWire-BIO8, ADInstruments, Colorado Springs, Colorado, United States) was placed in the internal jugular vein, positioned in the right ventricle and right atrium, and ECG parameters, such as RR, PR, QRS, QT, and corrected QT (Bazett’s QT correction) were measured. Intracardiac pacing from atria and ventricle was performed using customized electrical stimulator to elicit ectopy and arrhythmias with progressive electrical challenge, as previously described (Clasen, 2018). Specifically, for atrial pacing, 200-pulse pacing episodes with pacing interval stepping from 55ms to 15ms with 2ms decrement were applied with a 10-15 sec inter-episode break; for ventricular pacing, 30-pulse pacing episodes with pacing interval of 75ms were applied followed by 10 pulses with pacing interval stepping from 55ms to 15ms with 37 30155659V.1 Atty Docket No.: 1449507-DU8236PCT 2ms decrement with a 10-15 sec inter-episode break. ECG measurements and arrhythmias induction protocols were performed both at baseline and two minutes following adrenergic stimulation and ryanodine receptor sensitization with 200 μg/g caffeine and 1 μg/g isoproterenol IP injection. Rhythm detection was captured by an iWorx-RA-834 Eight Channel 16 bit Data Acquisition System (iWorx, Dover New Hampshire, United States). Data were viewed using a custom-built ECG Analysis Module software program for LabScribe v4. Non-sustained ventricular tachycardia (NSVT) was defined as 3-10 sequential ventricular ectopic beats and sustained VT was defined as greater than 10 beats. All measurements were conducted and analyzed in a blinded fashion. [000115] Real-time electrocardiogram monitoring in NHPs: The implantation of loop recorders (Medtronic-Reveal, USA) was performed as described previously (Zhen, 2021). Briefly, loop recorders were subcutaneously placed in the left paraspinal area inferior to the angle of the scapula in monkeys after MI surgery. An ECG episode was recorded when a ventricular tachycardia was detected by the software or when the heart rate was higher than 120 beats/minute or lower than 60 beats/minute. Every two days, a maximum of 30 ECG episodes were recorded from the loop recorder and transmitted to a server. All ECG recordings were analyzed by an experienced cardiologist in a blinded fashion. [000116] Tissue collection: For NHP studies, after terminal echo measurements, monkey hearts were arrested under anesthesia (2-2.5% isoflurane) by injecting 100 mg/ml/kg KCl and explanted. Cardiac tissue (containing infarct and remote myocardium) was either fixed for immunostaining or snap-frozen in liquid nitrogen for gDNA extraction. Lung, liver, muscle and kidney samples were harvested and frozen for biodistribution analysis. For mouse studies, hearts from heparinized mice (200U i.p.) were arrested under anesthesia (2-2.5% isoflurane) by injecting 150 mM KCl. Hearts were then explanted and were either fixed in 4% PFA for 15 minutes for immunostaining and histology or snap-frozen (part of apex) in liquid nitrogen for RNA extraction. Fixed hearts were immersed in 30% (w/v) sucrose overnight and then embedded and frozen in OCT compound (VWR) using a dry ice/isopropanol bath, cut into 10 µm sections using a cryostat (Leica), and immunostained as described below. For the biodistribution study, lung, liver, muscle, spleen and kidney samples were harvested and frozen for downstream analysis. 38 30155659V.1 Atty Docket No.: 1449507-DU8236PCT [000117] Immunostaining and imaging: Cell monolayers and engineered cardiac tissues were fixed in 4% paraformaldehyde (PFA) for 15 min at room temperature. Animal tissues were fixed in 4% PFA for 30 minutes at room temperature and immersed in 30% (w/v) sucrose at 4°C overnight. The tissues were then embedded and frozen in OCT compound (VWR) using dry ice/isopropanol bath and cut into 5 µm sections using cryostat (Leica). Fixed monolayers, engineered tissues, or tissue sections were permeabilized and blocked in blocking solution (5% donkey serum + 0.1% Triton-X, 30 min) at 4°C overnight, following by overnight incubation with primary and then secondary antibodies at 4°C. Samples were mounted with hard-set mounting medium (Antifade Glass) and imaged using confocal microscope (Leica SP5, Andor Dragonfly). Image analysis was performed using ImageJ software. All antibodies and their respective dilutions are specified in Table 1. Table 1. List of antibodies used. Antibody Source Catalog# Dilution 39 30155659V.1 Atty Docket No.: 1449507-DU8236PCT Donkey anti-Mouse Secondary Antibody, Thermo Fisher A32744 IF (1:200) Alexa Fluor™ Plus 594 Scientific ) ) gy , , y g e performed by BioRepository and Precision Pathology Center at Duke University, and images were acquired using an Axio Imager upright microscope. Images were analyzed using ImageJ software. Cleaved-caspase 3 positive staining area was measured using ImageJ IHC Toolbox plugin. Vascular density (number of vessels/mm2) was determined from CD31-stained ventricular sections by drawing a defined-area grid on the image and counting vascular profiles within a region of interest. Collagen area in mouse ventricular sections was quantified from whole-slide images of Masson’s Trichrome stained tissue sections using the ImageJ color deconvolution function and expressed as % area normalized to total myocardium area. For each animal, at least three sections from three different cross-sectional planes (apex, mid-ventricle, base) were analyzed and the average value was reported. All measurements were conducted and analyzed in a blinded fashion. [000119] AAV neutralizing antibody assay: NHP sera was analyzed for the presence of AAV9 neutralizing antibodies. Specifically, antiserum was heat inactivated at 55°C for 30 mins. The sera samples were prediluted (1:5) in serum-free DMEM media (Gibco), mixed with an equal volume (25µl) of recombinant AAV9-CMV-Luciferase vector (UNC Vector Core, MOI: 1x109vg/well), and incubated at room temperature for 30 min in glass-bottom 96-well plate (Corning). Then, 20,000 HEK293 cells/well were seeded in 50µl of 10% FBS DMEM and incubated in 5% CO2 at 37°C for 24 hours. Cells were lysed with 25 μl of 1X luciferase cell culture lysis reagent (Promega, E1531) and luciferase activity was measured on a VICTOR X4 40 30155659V.1 Atty Docket No.: 1449507-DU8236PCT multilabel plate reader (PerkinElmer) immediately after the addition of 100 μL of luciferase assay reagent (Promega, E1483). All measurements were normalized to no-serum controls. [000120] Quantitative PCR: Total RNA was extracted using an RNeasy Plus Mini Kit according to the manufacturer’s instructions (Qiagen) and the concentration was measured using a NanoDrop One (Thermo Fisher Scientific). Reverse transcription was run on equal amounts of RNA using iScript cDNA Synthesis Kit (Bio-Rad). Genomic DNA was isolated from animal tissues using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s instructions. Standard quantitative PCR was performed using an iTaq Universal SYBR Green Supermix kit (Bio-Rad). The relative expression of indicated genes was quantified by the ΔCT method. For the biodistribution study, vector expression was represented as the ratio of vector genomes per microgram of DNA extracted. The primers used are listed in Table 2. Table 2. List of qPCR primers used. Gene Description Species Forward Primer Reverse Primer (SEQ ID NO:) (SEQ ID NO:) T ) A ) T G T ) G T T C G 41 30155659V.1 Atty Docket No.: 1449507-DU8236PCT h2SheP Human codon --------- CCTGATGGCTCAAT GTACGCATAGATC optimized BacNav ACGGCA (25) CGCAGCA (26) A G [000121] Western blot: Protein was isolated from cardiopatches in radioimmunoprecipitation assay lysis and extraction buffer containing 1X protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, 78440). Protein concentration was measured using a BCA assay (Thermo Fisher Scientific). Western blots were performed by loading 40 µg protein on 4 to 12% Bolt™ Bis-Tris plus mini protein gel (Thermo Fisher Scientific) and running at 100V for 2 hours. Proteins were transferred to 0.45µm PVDF membranes at 250mA for 2 hours. The membrane was blocked with 5% BSA at 4°C overnight, followed by overnight incubation in primary antibodies at 4°C and horseradish peroxidase– conjugated secondary antibody for 2 hours at room temperature. The membrane was incubated in SuperSignal West Pico PLUS Chemiluminescent Substrate for 30 seconds, imaged using a Bio- Rad ChemiDoc imaging system, and quantified using ImageJ. All antibody information and dilutions are listed in Table 1. [000122] Statistical analysis: All statistical analyses and data plotting were performed using Prism (GraphPad Software Inc.). Data are presented as mean ± s.e.m. and represent a minimum of 3 independent experiments with at least 3 biological and technical replicates unless otherwise stated. Outliers were identified and excluded using ROUT method. For comparisons of two experimental groups, statistical significance was evaluated with a standard unpaired Student t-test (2-tailed). Categorial data were tested by Fisher’s exact test (2-sided). Correlations were tested by linear regression analysis and significance was assessed by two-tailed Pearson correlation analysis. Anderson-Darling and F tests were used to confirm normality and compare variances, respectively. Mann-Whitney test was used to evaluate statistical significance for non- normally distributed data. For multiple-comparison analyses, statistical significance was determined by one-way or two-way ANOVA (repeated measure when appropriate), followed by Holm-Šídák’s post-hoc test to calculate P values. Anderson-Darling test and Bartlett’s test were used to confirm normality and compare variances, respectively. For ANOVA tests, log transformation was performed if residuals were not normally distributed. For one-way ANOVA, 42 30155659V.1 Atty Docket No.: 1449507-DU8236PCT Kruskal-Wallis test was used if residuals were not normally distributed; Brown-Forsythe and Welch ANOVA test was used if the variances were significantly different across groups. For all results, the exact P value, number of biological replicates, and statistical test used are reported in figures and figure legends.2-sided P values of <0.05 were considered as statistically significant. EXAMPLE 2: Effects of BacNav expression on CM Ca2+ handling and contractility in vitro, ex vivo, and in silico [000123] To assess the effects of BacNav expression on CM contraction and Ca2+ handling, cultures of neonatal rat ventricular myocytes (NRVMs) were first transduced with a lentivirus encoding doxycycline (Dox)-inducible expression of BacNav (h2SheP variant) (Nguyen, 2016) under a muscle-specific MHCK7 promoter (Salva, 2007; Strash, 2024) (FIG.1A). Upon applying Dox for 48h to induce BacNav expression (FIG.1B), the inventors found that Ca2+ transient amplitude in NRVMs was significantly increased (FIG.1C). While not intending to be bound by theory, the inventors hypothesized that this increase was attributable to a BacNav- mediated decrease of Ca2+ efflux through Na+/Ca2+ exchanger (NCX). In support of this hypothesis, acute inhibition of NCX by 10mM ORM-10962 (Kohajda, 2016) effectively annulled the difference in Ca2+ transient amplitudes between BacNav-expressing (Dox+) and control (Dox-) NRVMs (FIG.1D). These findings were replicated by expressing BacNav in NRVM “bundles”, an in vitro three-dimensional (3D) tissue-engineered culture system that promotes CM maturation and permits measurements of CM contractile force (Jackman, 2016) (FIG.2A-C). Moreover, increased Ca2+ transient amplitude in BacNav-expressing NRVM bundles induced positive inotropy, evident from an increase in tissue contractile force (FIG.2D), which occurred without a change in bundle morphology, passive tension, or twitch kinetics (FIG.1E-I). To further explore the effect of BacNav expression on Ca2+ handling, NRVM monolayers were exposed to a bolus of 40 mM caffeine, a ryanodine receptor (RyR) agonist, and recorded larger Ca2+ transients in BacNav-expressing than control CMs (FIG.1J), indicative of increased SR Ca2+ content. From the decay constant of caffeine-induced transients, the extrusion rate of Ca2+ through NCX (forward mode) (Altamirano, 2019) was calculated and it was found to be reduced with BacNav expression (FIG.1J). This suppression of NCX forward mode in BacNav-expressing NRVMs likely explains their insensitivity to ORM-10962 (FIG.1D and 43 30155659V.1 Atty Docket No.: 1449507-DU8236PCT FIG.2C), given that positive inotropic effect of this drug is largely attributed to its blockage of the forward NCX mode (Kohajda, 2016; Ozdemir, 2008). [000124] Since NRVMs have relatively immature Ca2+ handling (Guo, 2020; Karbassi, 2020), the inventors next assessed the effects of BacNav expression on adult CMs. Ten-week-old C57BL/6 mice were injected with 2.5x1013 vector genomes (vg)/kg of AAV9-MHCK7-BacNav- 2A-mScarlet virus and 8 weeks post-injection (FIG.2E) Ca2+ transients in mScarlet+ (BacNav- expressing) and mScarlet- (non-transduced) ventricular CMs isolated from the same hearts were compared (FIG.2F). Compared to non-transduced CMs, BacNav-expressing CMs showed significantly increased electrically (FIG.2G) and caffeine (FIG.2H) induced Ca2+ transient amplitudes, slower Ca2+ extrusion rate through NCX, and faster Ca2+ uptake into SR via sarcoplasmic/endoplasmic reticulum Ca2+ ATPase (SERCA, FIG.2H). These effects on Ca2+ handling were dependent on BacNav expression level as evident from strong correlations between measured parameters and mScarlet fluorescence intensity in transduced individual CMs (FIG.3A-D). No abnormal activity was observed in any transduced CMs in recorded calcium traces. Furthermore, video edge detection measurements in isolated CMs showed that BacNav expression also increased CM contractile strength (% shortening) without affecting contractile kinetics (FIG.2I). [000125] The inventors previously showed that stable expression of BacNav in NRVMs does not alter expression of major endogenous cardiac ion channel and transporter genes (Nguyen, 2022). To assess the isolated impact of BacNav expression on Ca2+ handling in adult CMs, a detailed model of h2SheP BacNav (Needs; 2023) was next incorporated into a computational model of rabbit ventricular myocyte AP (Shannon, 2004). Consistent with the inventors’ experimental findings, simulated BacNav expression induced dose-dependent increase in Ca2+ transient amplitude during 1 Hz pacing or addition of caffeine (FIG.2J), as well as suppressed NCX forward mode and upregulated SERCA activity (FIG.2J), without a notable change in cytosolic Ca2+ concentration (FIG.3E). In addition, by calculating the integrated Ca2+ flux from the cytosol via different Ca2+ transport mechanisms, it was found that BacNav expression decreased relative NCX Ca2+ efflux during AP repolarization and increased relative SERCA Ca2+ uptake into the SR (FIG.3F), which in turn enhanced SR Ca2+ content (FIG.3G), yielding a larger amplitude of Ca2+ transients. Collectively, these in vitro, ex vivo, and in silico 44 30155659V.1 Atty Docket No.: 1449507-DU8236PCT studies strongly supported the inventors’ hypothesized mechanism of BacNav-induced positive inotropy. EXAMPLE 3: Effects of AAV-BacNav gene therapy in a murine model of pressure-overload HF [000126] Based on the described studies in healthy CMs, it was reasoned that BacNav expression could induce therapeutic effects in hearts with comprised contractile and electrical function. The inventors first tested this possibility in a mouse model of chronic pressure-overload HF induced by transverse aortic constriction (TAC) (FIG.4A). Male C57BL/6 mice at 10 weeks of age were subjected to either TAC surgery or control sham-surgery. At 4 weeks post TAC/sham surgery, the sham animals were randomly divided into two groups and injected with: 1) saline (Sham-NT) or 2) 1x1014 vg/kg of AAV9-cTnT-mScarlet (Sham-mScarlet), and the TAC animals with more than a 5% left ventricular ejection fraction (LVEF) drop compared to pre-surgery (assessed via transthoracic echocardiography) were randomly divided into additional two groups and injected with: 3) 1x1014 vg/kg of AAV9-cTnT-mScarlet (TAC-mScarlet), or 4) 1x1014 vg/kg of AAV9-cTnT-BacNav-HA-2A-mScarlet (TAC-BacNav). Twelve weeks post- surgery (8 weeks after AAV injection), immunostaining revealed robust transgene expression throughout the heart (FIG.5A). As expected, compared to sham mice, TAC mice displayed cardiac hypertrophy (FIG.4B, FIG.5B) accompanied by significant increases in heart/body weight and heart weight/tibia length ratio (FIG.5C) and CM cross-sectional area (FIG.4c, FIG. 5D). Interestingly, compared to TAC-mScarlet hearts, TAC-BacNav hearts showed reduced CM hypertrophy (FIG.4C, FIG.5D) and tissue fibrosis (based on Masson-trichrome staining, FIG. 4D). Moreover, compared to sham groups, classical markers of hypertrophy and fibrosis, such as Postn, Myh7, Nppa, Rcan1, Col3a1 and Ccn2 were upregulated in TAC-mScarlet hearts but not TAC-BacNav hearts (FIG.4E-G, FIG.5E). [000127] Echocardiographic assessment of LVEF further showed that prior to AAV injection at 4 weeks post-surgery, TAC animals displayed a significantly decreased LVEF compared to sham animals (31.3±0.75% vs.41.4±1.32%), indicating an established disease phenotype. Upon sham-treatment, contractile function of TAC-mScarlet mice continued to deteriorate (FIG.4H), with one mouse succumbing at 11 weeks. In contrast, in TAC-BacNav mice, contractile deficit was rescued within 2 weeks of treatment, after which the LVEF 45 30155659V.1 Atty Docket No.: 1449507-DU8236PCT remained comparable with sham groups until the end of the study (FIG.4H). While the BacNav therapy improved several features of TAC-induced pathology, it did not revert reduced capillary density (FIG.5F) or increased LV wall thickness (FIG.5G). Notably, at the dose used, the mScarlet control AAV did not impact cardiac structure, function, or gene expression across any of the measured parameters in sham animals. [000128] To investigate whether BacNav treatment provided anti-arrhythmic benefits to TAC mice, intracardiac electrophysiological (EP) studies were conducted at the 12-week endpoint (FIG.6A). Surface electrocardiograms (ECGs) were recorded at baseline and after isoproterenol and caffeine (ISO/Caff) injection (FIG.6B). At baseline, compared to sham mice, TAC-mScarlet mice showed expected (Boulaksil, 2010) deficits in AP conduction as evident from prolongation of PR, QRS and Qtc intervals (FIG.6C-E). TAC-BacNav mice, on the other hand, displayed QTc and QRS but not PR interval prolongation compared to sham mice (FIG. 6C-E) and had significantly shorter QRS interval than TAC-mScarlet mice, suggesting improved AP conduction due to BacNav expression (FIG.6D). Heart rates (RR interval, FIG.6F) were similar in all four groups. [000129] ISO/Caff injection expectedly increased heart rate in all groups (FIG.6F), and in sham groups prolonged Qtc interval (FIG.6E) but no other EP parameters (FIG.6C,D). In TAC-mScarlet mice, the abnormal conduction worsened with ISO/Caff treatment, as evident from further QRS and Qtc prolongation (FIG.6D,E). In contrast, TAC-BacNav mice showed no EP changes in response to ISO/Caff, ultimately exhibiting significantly shorter PR, QRS, and Qtc intervals compared to TAC-mScarlet mice post-drug treatment. Thus, BacNav expression in TAC mice not only improved baseline AP conduction, but also attenuated adverse EP effects induced by ISO/Caff application. P wave durations (FIG.7A) were found to be similar in all groups, both at baseline and with ISO/Caff injection. [000130] To test the propensity for arrhythmias at baseline and with ISO/Caff treatment, multiple episodes of progressively faster pacing in atria and ventricles were applied through an intracardiac EP catheter and simultaneously recorded surface ECG and intracardiac electrograms (FIG.7B-D). The inventors found no spontaneous or pacing-induced arrhythmias in any of the groups at baseline. With ISO/Caff administration, one Sham-NT mouse displayed a non- sustained ventricular tachycardia (NSVT) that spontaneously occurred between two pacing episodes. All other arrhythmias were observed only in TAC-mScarlet animals, including 5/9 46 30155659V.1 Atty Docket No.: 1449507-DU8236PCT mice that developed spontaneous sustained VTs (FIG.6G) and NSVTs (FIGS.6H and 6I), and 3/9 mice that exhibited atrioventricular (AV) conduction block and ceased breathing, requiring early study termination (FIG.6J). Importantly, none of the 9 TAC-BacNav mice exhibited any arrhythmic events. [000131] Together, correlation plots of EP parameters vs. baseline contractile deficit revelated that TAC mice with more contractile dysfunction also exhibited more abnormal EP parameters (FIGS.7E-7G). Unlike sham (mScarlet) therapy, BacNav therapy significantly improved both mechanical and electrical function of the pressure-overloaded murine hearts (FIGS.7E-7G) and protected them from arrhythmias induced by acute ISO/Caff (adrenergic) stress. EXAMPLE 4: Biodistribution and safety of AAV-BacNav delivery in mice [000132] With the prospect for eventual clinical translation, short-term (4-week) and long- term (3-month) biodistribution and safety profile of systemic delivery of self-complementary (sc)AAV9-cTnT-BacNav-HA vector in adult mice were next examined (FIG.8A). Immunostaining analysis revealed robust and sustained BacNav expression in the ventricles with proper channel targeting to the CM sarcolemma, including T-tubules (Nguyen, 2022) (FIGS. 8B-8D), while no significant expression was detected in off-target organs (FIG.8E). Vector genome biodistribution analysis showed highest transduction in kidney, liver, and spleen at 4 weeks, and in kidney and liver at 3 months post-injection (FIG.8F). As expected, the use of cTnT promoter resulted in CM-specific BacNav expression with significantly higher expression in heart compared to all other examined tissues (FIG.8G). The inventors also assessed potential adverse responses to long-term expression of bacterial BacNav protein in mice. Histological analysis showed no apparent differences in infiltration of CD3+ T lymphocytes or monocytes (FIGS.9A and 9B), or the presence of apoptotic (cleaved caspase-3+) cells (FIG.9C) between BacNav-transduced and control (non-transduced) ventricular sections from age-matched animals. Overall, systemic AAV9 delivery of BacNav under the cTnT promoter in mice yielded stable and specific CM expression without apparent apoptotic or immune response. 47 30155659V.1 Atty Docket No.: 1449507-DU8236PCT EXAMPLE 5: Therapeutic effects of BacNav expression in an in vitro ischemia/reperfusion injury model in 3D human engineered cardiac tissues [000133] Considering the inherent differences in cardiac electrophysiology and Ca2+ handling between rodents and humans, the therapeutic potential of BacNav expression (via a Dox-inducible lentivirus) was next examined in an in vitro model of ischemia-reperfusion (I/R) injury in 3D engineered cardiac tissues (“cardiopatches”) made from hiPSC-CMs (Shadrin, 2017) (FIG.10A). I/R injury was induced by exposing the cardiopatches to anoxic and ischemic (low-pH, lactate-rich) media for 6 hours, followed by 3 hours of incubation in normoxic conditions. When Dox was applied for 48h before I/R injury, the resulting BacNav expression did not protect cardiopatches from acute I/R-induced tissue damage manifested in cell death, generation of reactive oxygen species (ROS), apoptosis (CC3+ area), release of lactate dehydrogenase (LDH), and sarcomere disassembly (FIGS.10B-10F). While the pre-existing BacNav expression increased contractile force in healthy tissues, it did not prevent acute I/R- induced loss of contractile strength (FIGS.11A-11C), likely because the NCX mainly operated in reverse rather than forward mode due to elevation of [Na]I resulting from I/R injury (Wang, 2007). On the other hand, the pre-injury BacNav expression partially rescued the acute I/R- induced AP conduction slowing (FIG.11D) that likely resulted from endogenous Na+ channel inactivation (Kleber, 1986) and closure of gap junctions (Macia, 2011). Action potential duration (APD) was not affected by I/R injury or BacNav expression (FIG.11D). [000134] To assess the effects of BacNav expression in already injured tissues, Dox or vehicle control (-Dox) were applied starting at 16h after the I/R injury (FIG.12A). At 72h post I/R, it was found that injured human cardiopatches continued to exhibit contractile deficit (FIG. 12B) accompanied by evidence of cell death and apoptosis (FIGS.13A and 13B), while AP conduction parameters and LDH release returned to control levels (FIGS.13C and 13D). Importantly, Dox-induced BacNav expression enhanced contractile strength of injured cardiopatches (FIG.12B), without affecting their passive tension or twitch kinetics (FIGS.13E and 13F). This could not be attributed to Dox alone, which did not improve I/R-induced contractile deficit in non-transduced tissues (FIG.13G). [000135] BacNav expression in injured cardiopatches also rescued deficits in Ca2+ transient amplitude (FIG.12C) and caffeine-induced Ca2+ release (reflective of decreased SR Ca2+ stores, FIG.12D) by reducing Ca2+ efflux through NCX (FIG.12E) and upregulating SERCA activity 48 30155659V.1 Atty Docket No.: 1449507-DU8236PCT (FIG.12F), which suggested a similar mechanism of action to that observed in healthy CMs (Fig.1). NCX inhibition by ORM-10962 eliminated the difference in Ca2+ transients between BacNav- and vehicle-treated I/R tissues, primarily through a stronger effect on the vehicle-treated group (FIG.12G). To further confirm specific role of NCX in the BacNav-induced therapeutic effect, a lentivirus expressing a small hairpin RNA (shRNA) targeting NCX (shNCX) was applied, which significantly downregulated NCX gene and protein expression compared to non- transduced or scramble shRNA (shScr)-transduced tissues (FIGS.12H and 12I). With the NCX knockdown, BacNav expression was no longer able to rescue Ca2+ transient deficit in injured cardiopatches (FIG.12J), further indicating that NCX plays an important role in BacNav- mediated improvement of I/R-induced contractile dysfunction in human CMs. EXAMPLE 6: Effects of AAV-BacNav therapy in an I/R myocardial infarction model in non- human primates [000136] To further test BacNav therapy in a preclinical setting, a non-human primate (NHP) Macaca fascicularis model of myocardial infarction (MI) was utilized (FIG.14A) where 60-min occlusion of left anterior descending (LAD) coronary artery was followed by 10-min reperfusion. After the I/R injury, 1x1012 vg/kg self-complementary (sc)AAV9-MHCK7-BacNav- HA or scAAV9-MHCK7-GFP virus was injected intramyocardially (IM) into the infarct area and its border zone. Sham-surgery animals served as control. Staining of the ventricular tissue sections four weeks post-AAV injection showed robust expression of transgene around the infarction site (FIGS.15A and 15B), with successful targeting of BacNav channels to the T- tubular membrane of CMs (FIG.14B). In addition, vector genome biodistribution was quantified in different organs, showing localized scAAV transduction around the infarct region with no significant off-target expression (FIG.15C). [000137] To monitor cardiac contractile function, transthoracic echocardiography was applied and at one-week post-MI found a similar LVEF decrease in BacNav-treated and GFP- treated animals compared to sham-injury control (FIG.14C), indicating similar tissue damage due to the MI and no immediate protective effect of BacNav. By 4 weeks post-MI, GFP-treated but not BacNav-treated animals showed further decrease in LVEF, such that %LVEF loss relative to baseline was significantly larger in GFP group than in other two groups, while not different between BacNav-treated and sham animals (FIG.14C, right). Similarly, by 4 weeks post-MI, the 49 30155659V.1 Atty Docket No.: 1449507-DU8236PCT GFP group but not BacNav group showed increased LV end-systolic volume (LVESV) compared baseline (FIG.14D). The fact that LV end-diastolic volume (LVEDV) did not differ across groups or time points (FIG.15D) suggested that AAV-mediated, CM-specific BacNav expression in NHP hearts specifically counteracted a decline in contractile function induced by MI. [000138] To monitor changes in cardiac electrical activity in conscious animals, loop recorders were also implanted at the time of surgery and analyzed occurrences of spontaneous arrhythmias from recorded ECG traces during the 4-week study. The inventors identified multiple arrhythmic events including idioventricular rhythms (IVRs), atrioventricular blocks (AVBs), and supraventricular tachycardias (SVTs). All six animals in the GFP group developed arrhythmias, while only one animal in the BacNav group and two in the sham group exhibited arrhythmic events (FIGS.14E-14H, FIGS.15E-15G). Importantly, BacNav-treated animals showed significant improvement compared to the GFP group and no difference in any of the measured parameters compared to the sham group, demonstrating anti-arrhythmic, in addition to contractile, benefits of BacNav therapy in the setting of MI. [000139] One skilled in the art will readily appreciate that the present disclosure is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present disclosure described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the present disclosure. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the present disclosure as defined by the scope of the claims. [000140] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference, unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and/or description found in the cited references. 50 30155659V.1 Atty Docket No.: 1449507-DU8236PCT REFERENCES 1. Abouleisa, R.R.E., et al. Transient Cell Cycle Induction in Cardiomyocytes to Treat Subacute Ischemic Heart Failure. Circulation 145, 1339-1355 (2022). 2. Ackers-Johnson, M., et al. A Simplified, Langendorff-Free Method for Concomitant Isolation of Viable Cardiac Myocytes and Nonmyocytes From the Adult Mouse Heart. Circ Res 119, 909-920 (2016). 3. Acsai, K., et al. Effect of partial blockade of the Na(+)/Ca(2+)-exchanger on Ca(2+) handling in isolated rat ventricular myocytes. European journal of pharmacology 576, 1- 6 (2007). 4. Altamirano, F., et al. Polycystin-1 Assembles With Kv Channels to Govern Cardiomyocyte Repolarization and Contractility. Circulation 140, 921-936 (2019). 5. Argiro, A., et al. Applications of Gene Therapy in Cardiomyopathies. JACC Heart Fail 12, 248-260 (2024). 6. Berry, J.M., et al. Reversibility of adverse, calcineurin-dependent cardiac remodeling. Circ Res 109, 407-417 (2011). 7. Boulaksil, M., et al. Longitudinal arrhythmogenic remodelling in a mouse model of longstanding pressure overload. Neth Heart J 18, 509-515 (2010). 8. Cerrone, M., et al. Bidirectional ventricular tachycardia and fibrillation elicited in a knock-in mouse model carrier of a mutation in the cardiac ryanodine receptor. Circ Res 96, e77-82 (2005). 9. Chai, A.C., et al. Base editing correction of hypertrophic cardiomyopathy in human cardiomyocytes and humanized mice. Nat Med 29, 401-411 (2023). 10. Chen, T., et al. Human Tissue-Engineered Model of Myocardial Ischemia-Reperfusion Injury. Tissue Eng Part A 25, 711-724 (2019). 11. Cleland, J.G., et al. Successes and failures of current treatment of heart failure. Lancet 352 Suppl 1, SI19-28 (1998). 12. Fagundes, D.L., et al. ContHeart: Software for monitoring isolated cardiomyocyte shortening. Softwarex 12(2020). 13. Fish, K.M., et al. AAV9.I-1c delivered via direct coronary infusion in a porcine model of heart failure improves contractility and mitigates adverse remodeling. Circ Heart Fail 6, 310-317 (2013). 14. Fliegner, D., et al. Female sex and estrogen receptor-beta attenuate cardiac remodeling and apoptosis in pressure overload. Am J Physiol Regul Integr Comp Physiol 298, R1597-1606 (2010). 15. Gonzalez, T.J., et al. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Nat Commun 13, 5947 (2022). 16. Greenberg, B., et al. Calcium upregulation by percutaneous administration of gene therapy in patients with cardiac disease (CUPID 2): a randomised, multinational, double- blind, placebo-controlled, phase 2b trial. Lancet 387, 1178-1186 (2016). 51 30155659V.1 Atty Docket No.: 1449507-DU8236PCT Greener, I.D., et al. Connexin43 gene transfer reduces ventricular tachycardia susceptibility after myocardial infarction. J Am Coll Cardiol 60, 1103-1110 (2012). Guo, Y. & Pu, W.T. Cardiomyocyte Maturation: New Phase in Development. Circ Res 126, 1086-1106 (2020). Hobai, I.A. & O'Rourke, B. Enhanced Ca(2+)-activated Na(+)-Ca(2+) exchange activity in canine pacing-induced heart failure. Circ Res 87, 690-698 (2000). Hobai, I.A., et al. Partial inhibition of sodium/calcium exchange restores cellular calcium handling in canine heart failure. Circ Res 95, 292-299 (2004). Irie, K., et al. Comparative study of the gating motif and C-type inactivation in prokaryotic voltage-gated sodium channels. J Biol Chem 285, 3685-3694 (2010).Hegner, P., et al. SAR296968, a Novel Selective Na(+)/Ca(2+) Exchanger Inhibitor, Improves Ca(2+) Handling and Contractile Function in Human Atrial Cardiomyocytes. Biomedicines 10(2022). Jackman, C.P. et al. Dynamic culture yields engineered myocardium with near-adult functional output. Biomaterials 111, 66-79 (2016). Jost, N., et al. ORM-10103, a novel specific inhibitor of the Na+/Ca2+ exchanger, decreases early and delayed afterdepolarizations in the canine heart. Br J Pharmacol 170, 768-778 (2013). Karbassi, E., et al. Cardiomyocyte maturation: advances in knowledge and implications for regenerative medicine. Nat Rev Cardiol 17, 341-359 (2020). Kieserman, J.M., et al. Current Landscape of Heart Failure Gene Therapy. J Am Heart Assoc 8, e012239 (2019). Kleber, A.G., et al. Changes in conduction velocity during acute ischemia in ventricular myocardium of the isolated porcine heart. Circulation 73, 189-198 (1986). Knezevic, T., et al. Adeno-associated Virus Serotype 9 - Driven Expression of BAG3 Improves Left Ventricular Function in Murine Hearts with Left Ventricular Dysfunction Secondary to a Myocardial Infarction. JACC Basic Transl Sci 1, 647-656 (2016). Kohajda, Z., et al. The Effect of a Novel Highly Selective Inhibitor of the Sodium/Calcium Exchanger (NCX) on Cardiac Arrhythmias in In Vitro and In Vivo Experiments. PLoS One 11, e0166041 (2016). Lang, R.M., et al. Recommendations for cardiac chamber quantification by echocardiography in adults: an update from the American Society of Echocardiography and the European Association of Cardiovascular Imaging. J Am Soc Echocardiogr 28, 1- 39 e14 (2015). Lebek, S., et al. Ablation of CaMKIIdelta oxidation by CRISPR-Cas9 base editing as a therapy for cardiac disease. Science 379, 179-185 (2023). Leenhardt, A., et al. Catecholaminergic polymorphic ventricular tachycardia. Circ Arrhythm Electrophysiol 5, 1044-1052 (2012). Li, Y., et al. Lack of Thy1 defines a pathogenic fraction of cardiac fibroblasts in heart failure. Biomaterials 236, 119824 (2020). 52 30155659V.1 Atty Docket No.: 1449507-DU8236PCT Liu, S., et al. Gene therapy knockdown of Hippo signaling induces cardiomyocyte renewal in pigs after myocardial infarction. Sci Transl Med 13(2021). Macia, E., et al. Characterization of gap junction remodeling in epicardial border zone of healing canine infarcts and electrophysiological effects of partial reversal by rotigaptide. Circ Arrhythm Electrophysiol 4, 344-351 (2011). Maddaford, T.G., et al. Reduced expression of the Na+/Ca2+ exchanger in adult cardiomyocytes via adenovirally delivered shRNA results in resistance to simulated ischemic injury. Am J Physiol Heart Circ Physiol 298, H360-366 (2010). Marijon, E., et al. Fighting against sudden cardiac death: need for a paradigm shift- Adding near-term prevention and pre-emptive action to long-term prevention. Eur Heart J 43, 1457-1464 (2022). Mendell, J.R., et al. Assessment of Systemic Delivery of rAAVrh74.MHCK7.micro- dystrophin in Children With Duchenne Muscular Dystrophy: A Nonrandomized Controlled Trial. JAMA Neurol 77, 1122-1131 (2020). Metra, M. & Teerlink, J.R. Heart failure. Lancet 390, 1981-1995 (2017). Molkentin, J.D., et al. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93, 215-228 (1998). Mundisugih, J., et al. Adeno-Associated Virus-mediated Gene Therapy for Cardiac Tachyarrhythmia: A Systematic Review and Meta-analysis. Heart Rhythm (2024). Nagy, Z.A., et al. Selective inhibition of sodium-calcium exchanger by SEA-0400 decreases early and delayed after depolarization in canine heart. Br J Pharmacol 143, 827-831 (2004). Nagy, N., et al. Antiarrhythmic and Inotropic Effects of Selective Na(+)/Ca(2+) Exchanger Inhibition: What Can We Learn from the Pharmacological Studies? Int J Mol Sci 23(2022). Needs, D., et al. Prokaryotic voltage-gated sodium channels are more effective than endogenous Na(v)1.5 channels in rescuing cardiac action potential conduction: an in silico study. Am J Physiol Heart Circ Physiol 325, H1178-H1192 (2023). Nguyen, H.X., et al. Engineering prokaryotic channels for control of mammalian tissue excitability. Nat Commun 7, 13132 (2016). Nguyen, H.X., et al. Generation and customization of biosynthetic excitable tissues for electrophysiological studies and cell-based therapies. Nature protocols 13, 927-945 (2018). Nguyen, H.X., et al. Engineered bacterial voltage-gated sodium channel platform for cardiac gene therapy. Nat Commun 13, 620 (2022). Ozdemir, S., et al. Pharmacological inhibition of na/ca exchange results in increased cellular Ca2+ load attributable to the predominance of forward mode block. Circ Res 102, 1398-1405 (2008). Pogwizd, S.M., et al. Upregulation of Na(+)/Ca(2+) exchanger expression and function in an arrhythmogenic rabbit model of heart failure. Circ Res 85, 1009-1019 (1999). 53 30155659V.1 Atty Docket No.: 1449507-DU8236PCT Reichart, D., et al. Efficient in vivo genome editing prevents hypertrophic cardiomyopathy in mice. Nat Med 29, 412-421 (2023). Salva, M.Z., et al. Design of tissue-specific regulatory cassettes for high-level rAAV- mediated expression in skeletal and cardiac muscle. Mol Ther 15, 320-329 (2007). Sasano, T., et al. Molecular ablation of ventricular tachycardia after myocardial infarction. Nat Med 12, 1256-1258 (2006). Shadrin, I.Y., et al. Cardiopatch platform enables maturation and scale-up of human pluripotent stem cell-derived engineered heart tissues. Nat Commun 8, 1825 (2017). Shannon, T.R., et al. A mathematical treatment of integrated Ca dynamics within the ventricular myocyte. Biophys J 87, 3351-3371 (2004). Silva, K.A.S. & Emter, C.A. Large Animal Models of Heart Failure: A Translational Bridge to Clinical Success. JACC Basic Transl Sci 5, 840-856 (2020). Skavdahl, M., et al. Estrogen receptor-beta mediates male-female differences in the development of pressure overload hypertrophy. Am J Physiol Heart Circ Physiol 288, H469-476 (2005). Strash, N., et al. Time-dependent effects of BRAF-V600E on cell cycling, metabolism, and function in engineered myocardium. Sci Adv 10, eadh2598 (2024). Studer, R., et al. Gene expression of the cardiac Na(+)-Ca2+ exchanger in end-stage human heart failure. Circ Res 75, 443-453 (1994). Sussman, M.A., et al. Prevention of cardiac hypertrophy in mice by calcineurin inhibition. Science 281, 1690-1693 (1998). Tabebordbar, M., et al. Directed evolution of a family of AAV capsid variants enabling potent muscle-directed gene delivery across species. Cell 184, 4919-4938 e4922 (2021). Tilemann, L., et al. SUMO-1 gene transfer improves cardiac function in a large-animal model of heart failure. Sci Transl Med 5, 211ra159 (2013). Tsao, C.W., et al. Heart Disease and Stroke Statistics-2023 Update: A Report From the American Heart Association. Circulation 147, e93-e621 (2023). Tse, G. Mechanisms of cardiac arrhythmias. J Arrhythm 32, 75-81 (2016). Voigt, N., et al. Enhanced sarcoplasmic reticulum Ca2+ leak and increased Na+-Ca2+ exchanger function underlie delayed afterdepolarizations in patients with chronic atrial fibrillation. Circulation 125, 2059-2070 (2012). Wang, J., et al. SEA0400, a novel Na+/Ca2+ exchanger inhibitor, reduces calcium overload induced by ischemia and reperfusion in mouse ventricular myocytes. Physiol Res 56, 17-23 (2007). Yardeni, T., et al. Retro-orbital injections in mice. Lab Anim (NY) 40, 155-160 (2011). Zhen, N., et al. A diastolic dysfunction model in non-human primates with transverse aortic constriction. Exp Anim 70, 498-507 (2021). 54 30155659V.1

Claims

Atty Docket No.: 1449507-DU8236PCT WHAT IS CLAIMED IS: 1. A method for treating reduced ejection fraction in a subject with heart failure, the method comprising: administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 2. The method of claim 1, wherein the BacNav polypeptide is h2SheP. 3. The method of claim 1 or 2, wherein the vector is a recombinant adeno-associated virus (AAV) vector. 4. The method of claim 3, wherein the recombinant AAV vector serotype is rAAV6, rAAV9, rAAVrh74, cc47, myoAAV2A, myoAAV4A, myoAAV4E, AAV2i8, rAAV.KK04, Anc80L65, rAAVM41, AAV2-THGTPAD, or AAV2-NLPGSGD. 5. The method of any one of claims 1-4, wherein the promoter is a cardiomyocyte-specific promoter. 6. The method of claim 5, wherein the cardiomyocyte-specific promoter is α-myosin heavy chain (α-MHC) promoter, myosin light chain (MLC2v) promoter, cardiac troponin T (cTnT) promoter, or atrial natriuretic factor (ANF, atrial-specific) promoter. 7. The method of any one of claims 1-4, wherein the promoter is a chimeric muscle-specific promoter. 8. The method of claim 7, wherein the chimeric muscle-specific promoter is MHCK7, CK8, or SPc5-12. 55 30155659V.1 Atty Docket No.: 1449507-DU8236PCT 9. The method of any one of claims 1-8, wherein the administering to the subject is by intracoronary injection or direct injection into cardiac muscle walls. 10. The method of any one of claims 1-8, wherein the administering to the subject is by intravenous injection. 11. The method of any one of claims 3-10, wherein anti-AAV antibodies have been reduced in the subject’s blood prior to administering the vector. 12. The method of any one of claims 1-11, wherein the subject does not have a voltage gated ion channel-related condition. 13. The method of any one of claims 1-12, wherein the subject is a mammal. 14. The method of claim 13, wherein the mammal is a human. 15. The method of any one of claims 1-14, wherein the subject is in stage I heart failure, stage II heart failure, stage III heart failure, or stage IV heart failure. 16. A method for improving both contractile and electrical dysfunction in a subject with heart failure, the method comprising: administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 17. A method for increasing subsarcolemmal Ca2+ levels in cardiomyocytes of a subject with heart failure, the method comprising: administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably 56 30155659V.1 Atty Docket No.: 1449507-DU8236PCT linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 18. A method for inhibiting the Na+/Ca2+ exchanger (NCX) in cardiomyocytes of a subject with heart failure, the method comprising: administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 19. A method for reducing the incidence of arrythmia in a subject with heart failure, the method comprising: administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 20. A method for reversing reduced ejection fraction in a subject with heart failure, the method comprising: administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 21. A method for augmenting peak Na+ current and Ca2+ transient amplitude in cardiomyocytes of a subject with heart failure, the method comprising: administering to the subject a recombinant vector comprising a polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNav) polypeptide operably linked to a promoter, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 57 30155659V.1 Atty Docket No.: 1449507-DU8236PCT 22. The method of any one of claims 16-21, wherein the BacNav polypeptide is h2SheP. 23. The method of claim 22, wherein the vector is a recombinant adeno-associated virus (AAV) vector. 24. The method of claim 23, wherein the recombinant AAV vector serotype is rAAV6, rAAV9, rAAVrh74, cc47, myoAAV2A, myoAAV4A, myoAAV4E, AAV2i8, rAAV.KK04, Anc80L65, rAAVM41, AAV2-THGTPAD, or AAV2-NLPGSGD. 25. The method of any one of claims 16-24, wherein the promoter is a cardiomyocyte- specific promoter. 26. The method of claim 25, wherein the cardiomyocyte-specific promoter is α-myosin heavy chain (α-MHC) promoter, myosin light chain (MLC2v) promoter, cardiac troponin T (cTnT) promoter, or atrial natriuretic factor (ANF, atrial-specific) promoter. 27. The method of any one of claims 16-24, wherein the promoter is a chimeric muscle- specific promoter. 28. The method of claim 27, wherein the chimeric muscle-specific promoter is MHCK7, CK8, or SPc5-12. 29. The method of any one of claims 16-28, wherein the administering to the subject is by intracoronary injection or direct injection into cardiac muscle walls. 30. The method of any one of claims 16-28, wherein the administering to the subject is by intravenous injection. 31. The method of any one of claims 23-30, wherein anti-AAV antibodies have been reduced in the subject’s blood prior to administering the vector. 58 30155659V.1 Atty Docket No.: 1449507-DU8236PCT 32. The method of any one of claims 16-31, wherein the subject does not have a voltage gated ion channel-related condition. 33. The method of any one of claims 16-32, wherein the subject is a mammal. 34. The method of claim 33, wherein the mammal is a human. 35. The method of any one of claims 16-34, wherein the subject is in stage I heart failure, stage II heart failure, stage III heart failure, or stage IV heart failure. 36. A recombinant vector comprising a first polynucleotide sequence encoding a prokaryotic sodium ion channel (BacNaV) polypeptide and a second polynucleotide sequence encoding SERCA2a, I-1C, SUMO-1, or BAG3, wherein the first and the second polynucleotides are operably linked to a promoter. 37. The recombinant vector of claim 36, wherein the vector is a recombinant adeno- associated virus (AAV) vector. 38. The recombinant AAV vector of claim 37, wherein the vector serotype is rAAV6, rAAV9, rAAVrh74, cc47, myoAAV2A, myoAAV4A, myoAAV4E, AAV2i8, rAAV.KK04, Anc80L65, rAAVM41, AAV2-THGTPAD, or AAV2-NLPGSGD. 39. The vector of any one of claims 36-38, wherein the first polynucleotide sequence is upstream of the second polynucleotide sequence. 40. The vector of any one of claims 36-38, wherein the second polynucleotide sequence is upstream of the first polynucleotide sequence. 41. The vector of any one of claims 36-40, wherein the first polynucleotide sequence and the second polynucleotide sequence are operably linked to the same promoter. 59 30155659V.1 Atty Docket No.: 1449507-DU8236PCT 42. The vector of any one of claims 36-40, wherein the first polynucleotide sequence and the second polynucleotide sequence are each operably linked to a different promoter. 43. A method for treating reduced ejection fraction in a subject with heart failure, the method comprising: administering to the subject a recombinant vector of any one of claims 36-42, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 44. A method for improving both contractile and electrical dysfunction in a subject with heart failure, increasing subsarcolemmal Ca2+ levels in cardiomyocytes of a subject with heart failure, inhibiting the Na+/Ca2+ exchanger (NCX) in cardiomyocytes of a subject with heart failure, reducing the incidence of arrythmia in a subject with heart failure, reversing reduced ejection fraction in a subject with heart failure, or augmenting peak Na+ current and Ca2+ transient amplitude in cardiomyocytes of a subject with heart failure, the method comprising: administering to the subject a recombinant vector of any one of claims 36-42, wherein the promoter directs expression of the BacNav polypeptide in cardiomyocytes of the subject. 45. The method of claim 43 or 44, wherein the administering to the subject is by intracoronary injection or direct injection into cardiac muscle walls. 46. The method of any one of claims 43-45, wherein the administering to the subject is by intravenous injection. 47. The method of any one of claims 43-46, wherein anti-AAV antibodies have been reduced in the subject’s blood prior to administering the vector. 48. The method of any one of claims 43-47, wherein the subject does not have a voltage gated ion channel-related condition. 60 30155659V.1 Atty Docket No.: 1449507-DU8236PCT 49. The method of any one of claims 43-48, wherein the subject is a mammal. 50. The method of claim 49, wherein the mammal is a human. 51. The method of any one of claims 43-50, wherein the subject is in stage I heart failure, stage II heart failure, stage III heart failure, or stage IV heart failure. 61 30155659V.1
EP24836630.4A 2023-07-05 2024-07-05 Human therapy utilizing novel prokaryotic voltage gated sodium channels Pending EP4739352A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363512038P 2023-07-05 2023-07-05
PCT/US2024/036948 WO2025010423A1 (en) 2023-07-05 2024-07-05 Human therapy utilizing novel prokaryotic voltage gated sodium channels

Publications (1)

Publication Number Publication Date
EP4739352A1 true EP4739352A1 (en) 2026-05-13

Family

ID=94172297

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24836630.4A Pending EP4739352A1 (en) 2023-07-05 2024-07-05 Human therapy utilizing novel prokaryotic voltage gated sodium channels

Country Status (2)

Country Link
EP (1) EP4739352A1 (en)
WO (1) WO2025010423A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2975645A1 (en) * 2016-08-05 2018-02-05 The Governors Of The University Of Alberta Systems and methods of selecting compounds with reduced risk of cardiotoxicity using cardiac sodium ion channel models
EP4045093A4 (en) * 2019-10-14 2024-02-07 Duke University COMPOSITIONS CONTAINING NOVEL PROKARYOTIC SODIUM CHANNELS AND ASSOCIATED METHODS

Also Published As

Publication number Publication date
WO2025010423A1 (en) 2025-01-09

Similar Documents

Publication Publication Date Title
Biggar et al. Duchenne muscular dystrophy: current knowledge, treatment, and future prospects
JP2010516252A (en) Synthetic mini / micro-dystrophin gene that restores nNOS in the muscle sheath
CN116406297A (en) Methods of treating cardiac disorders and congestive heart failure and administering AAV vectors
ES2320975T3 (en) PLANT NEGATIVE PLB PLB FOR USE IN THE TREATMENT OF CARDIAC DISEASES.
HK1222884A1 (en) Cycle adenosine monophosphate-incompetent adenylyl cyclase and compositions and methods for treating heart failure and increasing cardiac function
CN101977632A (en) Compositions for enhancing uptake of viral vectors in myocardium
US20170252462A1 (en) Extended antegrade epicardial coronary infusion of adeno-associated viral vectors for gene therapy
WO2025010423A1 (en) Human therapy utilizing novel prokaryotic voltage gated sodium channels
US8445454B2 (en) Use on minicircle vectors for cardiac gene therapy
US20230024301A1 (en) Treatment of diseases caused by frame shift mutations
JP2025523953A (en) AUF1 gene therapy for limb-girdle muscular dystrophy
KR20190050277A (en) Pharmaceutical composition for treating or preventing ischemic cardiovascular disease
JP7541003B2 (en) Relaxin receptor 1 for use in the treatment and prevention of heart failure
Sun et al. Prolonged hypotensive effect of human tissue kallikrein gene delivery and recombinant enzyme administration in spontaneous hypertension rats
CN111138549A (en) Fusion protein mUp113 for resisting amyotrophy
Wu Optimization and Evaluation of Engineered Prokaryotic Sodium Channel Gene Therapy for Heart Failure and Cardiac Arrhythmias
US20240058475A1 (en) Methods and compositions for treating muscular dystrophy
AU2021417194A1 (en) Methods and compositions for treating muscular dystrophy
Betts Exon skipping peptide-pmos for correction of dystrophin in mouse models of duchenne muscular dystrophy
Bish Myostatin regulation and function in the heart
TW202227628A (en) Methods and compositions for treating muscular dystrophy
Pacak Gene delivery strategies for the treatment of cardiac and skeletal muscle in murine models of muscular dystrophy
HK1056316B (en) Dominant negative plb mutant for use in treating cardiac disease

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20260128

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR