EP4735610A1

EP4735610A1 - Method for controllable transcription in liver or liver cancer

Info

Publication number: EP4735610A1
Application number: EP24830873.6A
Authority: EP
Inventors: Tak Wah Mak; Chunxing ZHENG; Bryan Edward SNOW
Original assignee: University Health Network; Centre For Oncology And Immunology Ltd; University of Hong Kong HKU
Current assignee: University Health Network; Centre For Oncology And Immunology Ltd; University of Hong Kong HKU
Priority date: 2023-06-29
Filing date: 2024-06-27
Publication date: 2026-05-06
Also published as: CN121420065A; WO2025002240A1

Abstract

Provided is a reliable and convenient approach to achieve precise control of gene expression in the liver in vivo. The methods generally combine a doxycycline-inducible gene expression system with a Sleeping Beauty transposon vector and hydrodynamic injection, enabling efficient integration of a controllable gene expression system into the genome of hepatocytes. The doxycycline-inducible system generally allows for precise and reversible control of gene expression. In some forms, a combination of gene alterations and overexpression of Myc leads to the development of HCC in animals. The method can also use a vector that allows for the inducible expression of a tumor antigen. The method can also induce tumor antigen-specific T-cell immune responses, providing a potent tool for the development of targeted therapies for HCC.

Description

METHOD FOR CONTROLLABLE TRANSCRIPTION IN LIVER OR LIVER CANCER

FIELD OF THE INVENTION

The present invention generally relates to a transcription technology. More specifically, the present invention relates to a controllable transcription in liver or liver cancer.

BACKGROUND OF THE INVENTION

The liver is a vital organ responsible for a range of essential functions, including metabolism, detoxification, and protein synthesis. Hepatocellular carcinoma (HCC) is the most common primary liver malignancy in humans and the third most common cause of cancer-related deaths worldwide. Liver gene delivery has the potential to treat various liver diseases, including liver cancer, hepatitis, and metabolic disorders, by introducing therapeutic genes into the liver cells. There are several methods of gene delivery to the liver, including viral and non-viral vectors, hydrodynamic injection, and electroporation. A significant limitation of many gene delivery approaches is the inability to precisely control gene expression. The liver is a dynamic organ that undergoes constant changes in response to environmental and physiological cues. Gene expression in the liver is highly regulated and controlled by various factors, including hormones, nutrients, and drugs. Therefore, studying gene function in the liver requires a temporal approach to capture the dynamic changes in gene expression and function over time. Temporal analysis of gene function in the liver can provide valuable insights into the molecular mechanisms of liver diseases, such as liver cancer and hepatitis. By precisely controlling the timing and duration of gene expression, gene therapy can be made more effective and safer.
The use of a tetracycline-inducible gene expression is a popular choice for this purpose. The current in vivo applications of tetracycline-inducible gene expression systems are mainly focused on generating transgenic mice, transplanting in vitro modified cells, and viral transduction.
There remains a need for developing convenient, efficient, liver-specific, and non-viral approach that can be applied to both wild-type and gene-modified mice without the need to generate transgenic mice or perform complicated crossbreeding. There is also a need for reliable and convenient approach for achieving precise control of gene expression in the liver in vivo.
Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.
Throughout this specification the word “comprise, ” or variations such as “comprises” or “comprising, ” will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

SUMMARY OF THE INVENTION

Disclosed are methods for achieving precise control of gene expression in liver cancer or liver in vivo, as well as composition resulting therefrom.
The methods include utilizing a combination of a transposon gene delivery vector, a gene deleting tool (such as CRISPR) , and a hydrodynamic injection technique. The methods generally involve incorporation of a doxycycline-inducible gene expression system into the transposon gene delivery vector. The methods generally can be used to induce liver cancer in vivo and to achieve controlled and precise gene expression in liver cancer.
Disclosed are compositions and methods for creating and using non-human models of liver cancer. Disclosed are compositions containing a nucleic acid transposon vector. Generally, the vector includes three or four sequences disposed in one or two expression segments. In some forms, the first expression sequence encodes a reverse tetracycline-controlled transactivator (rtTA) protein. In some forms, the second expression sequence encodes a self-cleaving peptide. In some forms, the third expression sequence encodes an oncogene. In some forms, the fourth expression sequence encodes a test gene.
In some forms, the first expression segment includes a promoter. In some forms, the first expression segment includes the first expression sequence. In some forms, the first expression segment includes the second expression sequence. In some forms, the first expression segment includes the third expression sequence. In some forms, the first expression segment includes a promoter, the first expression sequence, the second expression sequence, and the third expression sequence.
In some forms, the second expression segment includes the fourth expression sequence.
In some forms, the first expression sequence is under the control of the promoter. In some forms, the second expression sequence and the third expression sequence are co-expressed with the first expression sequence. In some forms, the second expression sequence is between the first expression sequence and the third expression sequence. In some forms, the first expression segment and the second expression segment are in reverse trans orientation in the vector. In some forms, expression of the fourth expression sequence is the under the control of a tetracycline-responsive element (TRE) . In some forms, the rtTA protein induces expression of the fourth expression sequence in the presence of an rtTA inducer.
In some forms, the nucleic acid transposon vector is a sleeping beauty transposon vector.
In some forms, the promoter is a constitutive promoter. In some forms, the promoter is an EF1α promoter, SV40 promoter, CMV promoter, UBC promoter, PGK promoter, CAGG promoter, or Alb promoter.
In some forms, the rtTA protein is the rtTA-Advanced protein.
In some forms, the self-cleaving peptide is any one of P2A, E2A, F2A, or T2A.
In some forms, the oncogene is c-Myc, CCND1, c-met, Yap, activated Akt (Akt1) , mutated CTNNB1, TERT, H-Ras^V12, SV40 large T antigen, or Nras (G12V) .
In some forms, the test gene is the chicken ovalbumin (OVA) . In some forms, the test gene is a tumor antigen. In some forms, the test gene encodes one or more sgRNAs, shRNAs, or combinations thereof. In some forms, the expression of the one or more sgRNAs, shRNAs, or combinations thereof is under the control of an H1-202 promoter.
Disclosed are methods creating and using non-human models of liver cancer. Generally, the methods involve administering a disclosed and one or more gene deletion effectors into hepatocytes of a non-human subject via hydrodynamic injection.
In some forms, following administration, the vector is integrated into the genome of the hepatocytes. In some forms, one or more of the gene deletion effectors targets one or more tumor suppressor genes for deletion. In some forms, the tumor suppressor genes include one or more of the Trp53 gene, the AXIN1 gene, the APC gene, the ARID1A gene, the ARID2 gene, the KEAP1 gene, and the Pten gene.
In some forms, the gene deletion effectors include one or more CRISPR systems, one or more TALENs, one or more Zinc Finger Nucleases, or combinations thereof. In some forms, the CRISPR systems include one or more guide RNAs targeting one or more tumor suppressor genes for deletion.
In some forms, the non-human subject is a wild-type mouse or gene-modified mouse.
In some forms, following administration, liver cancer is induced in the non-human subject, thereby forming a tumor model. In some forms, the liver cancer is hepatocellular carcinoma (HCC) .
In some forms, expression of the fourth expression sequence is induced by administering to the non-human subject tetracycline or doxycycline. In some forms, expression of the fourth expression sequence causes an immune response in the non-human subject against the expression product of the test gene.
Disclosed are methods of treating liver cancer in a human subject. In some forms, the methods involve treating the human subject with a therapy to cause in the human subject an immune response caused in the disclosed tumor model by expression of a disclosed test gene.
In some forms, the compositions contains a nucleic acid transposon vector that includes a promoter, a reverse tetracycline-controlled transactivator (rtTA) expression cassette, a coding sequence for a self-cleaving peptide, an oncogene, and an inducible test gene controlled by tetracycline-responsive element (TRE) .
In some forms, the rtTA is under the control of the promoter and co-expressed with the oncogene. In some forms, the self-cleaving peptide is between the coding regions of the oncogene and the rtTA. In some forms, the rtTA expression cassette and the inducible test gene are in reverse trans orientation in the nucleic acid transposon vector, In some forms, the inducible test genes are induced by inducible agents.
In some forms, one or more of the nucleic acid transposon vector is a sleeping beauty transposon vector. In some forms, the promoter is constitutive such as EF1α, SV40, CMV, UBC, PGK, CAGG, or Alb. In some forms, the rtTA is rtTA-Advanced.
In some forms, the self-cleaving peptide is any one of P2A, E2A, F2A, or T2A.
In some forms, the oncogene is c-Myc, CCND1, c-met, Yap, activated Akt (Akt1) , mutated CTNNB1, TERT, H-Ras^V12, SV40 large T antigen, or Nras (G12V) .
In some forms, the inducible test gene is chicken ovalbumin (OVA) . In some forms, the inducible test gene is any gene of interest including any tumor antigen. In some forms, the inducible test gene enables expression of sgRNAs or shRNAs. In some forms, the expression of sgRNAs or shRNAs are controlled by incorporation of H1-202 promoter downstream of TRE and incorporation of terminator sequence (TTTTT) .
In some forms, the method includes administering and of the disclosed compositions along with tools for gene deletion in hepatocytes of a subject via hydrodynamic injection. In some forms, the tools for gene deletion include any one of CRISPR systems, or TALENs, or Zinc Finger Nucleases. In some forms, the transposon vector administered via hydrodynamic injection is integrated into the genome of hepatocytes.
In some forms, the CRISPR systems comprise guide RNAs targeting tumor suppressor genes for gene deletion. In some forms, the tools for gene deletion include deleting one or more of tumor suppressor genes. In some forms, the tumor suppressor genes include one or more of the Trp53 gene, the AXIN1 gene, the APC gene, the ARID1A gene, the ARID2 gene, the KEAP1 gene, and Pten gene.
In some forms, the subject can include both wild-type or gene-modified mice.
In some forms, the hydrodynamic injection of the nucleic acid transposon vectors and gene deleting tools induce liver cancer in vivo to form a tumor model. In some forms, the liver cancer is hepatocellular carcinoma (HCC) .
In some forms, the inducible test gene controlled by tetracycline-responsive element (TRE) , is induced by administering pharmaceutically acceptable amounts of any one of tetracycline or doxycycline in a subject. In some forms, the administration of any one of tetracycline or doxycycline triggers immune responses in a subject against the induced test gene. In some forms, immune responses are identified for treatment of liver cancer or to understand gene functions at different stages of liver cancer.
In some forms, the transposon vector is a Sleeping Beauty transposon vector.
In some forms, the transposon vector is used to induce overexpression of oncogenes such as Myc or Nras (G12V) .
In some forms, a reverse tetracycline-controlled transactivator (rtTA) is co-expressed with the oncogenes.
In some forms, the doxycycline inducible genes are chicken ovalbumin (OVA) , or tumor antigen, or sgRNAs or shRNAs or any gene of interest.
In some forms, the transposon vector administered via hydrodynamic injection is integrated into the genome of hepatocytes.
In some forms, the CRISPR vectors comprise guide RNAs for deleting tumor suppressor genes such as Trp53, AXIN1, APC, ARID1A, ARID2, KEAP1, and Pten.
In some forms, this method offers a convenient, efficient, liver-specific, and non-viral approach that can be applied to both wild-type and gene-modified mice without the need to generate transgenic mice or perform complicated crossbreeding.
In some forms, the administration of any one of tetracycline or doxycycline triggers immune responses in a subject against the induced gene.
In some forms, tumor suppressors are identified for treatment of liver cancer.
Additional advantages of the disclosed method and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or may be learned by practice of the disclosed method and compositions. The advantages of the disclosed method and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed.

BRIEF DESCRIPTION OF THE DRAWINGS

Figs. 1A-1D show CRISPR-and transposon-induced hepatocellular carcinoma in mice. Fig. 1A Schematic diagrams of the plasmids used to induce (top) CRISPR/Cas9-mediated deletion of Trp53 and Pten, and (bottom) transposon-mediated overexpression of Myc in mouse livers. Arrowheads indicate tumor nodules. Fig. 1B shows representative macroscopic views of livers from mice injected with the combination of plasmids shown in panel (Fig. 1A) at the indicated days post-injection. Control received transposase vector only. Fig. 1C shows representative histological sections of tumor-burdened livers immunostained to detect MYC, P53 and PTEN. Fig. 1D shows distribution of immunostained liver tumor nodules from the livers in (Fig. 1C) . Numbers of tumor nodules with the indicated immunostaining patterns are labeled in the pie plot, which is a summary of two independent experiments. Sections were resected from 3 mice/group on day 25 of HCC induction.
Fig. 2 shows schematic diagram of the transposon vector used to induce overexpression of Myc and inducible OVA expression.
Figs. 3A-3E show HCC with inducible OVA expression. Fig. 3A is a schematic diagram of the plasmids used to induce simultaneous CRISPR/Cas9-mediated deletion of Trp53 and Pten plus overexpression of Myc and Tet-On inducible OVA. Fig. 3B is a schematic diagram of the experimental protocol used to induce OVA expression. Doxycycline (Dox) was added to mouse drinking water following palpable HCC onset. Figs. 3C-3E show representative histological sections of normal or tumor-burdened livers that were immunostained to detect OVA. The liver tissues included Dox-treated non-tumor-bearing liver, healthy liver from Act-mOVA mice (transgenic mice that express OVA protein in all of their cells under the control of the β-actin promoter) , and liver from mice subjected to inducible OVA HCC induction and Dox treatment following the protocol shown in (Fig. 3B) .
Figs. 4A-4H show induction of OVA-specific Tregs and PD-1+ effector T cells in HCC with inducible OVA expression. Fig. 4A is schematic diagram of the plasmids used to induce simultaneous CRISPR/Cas9-mediated deletion of Trp53 and Pten plus overexpression of Myc and Tet-On inducible OVA. Fig. 4B is a schematic diagram of the experimental protocol used to induce OVA expression. Doxycycline (Dox) was added to mouse drinking water following palpable HCC onset. Figs. 4C-4H show representative flow cytometry plots showing the expression of Foxp3 and PD-1 in OVA-specific CD4+ T cells in livers of mice that were left untreated or treated with Dox-containing drinking water to induce OVA expression following HCC onset, representing two independent experiments.

DETAILED DESCRIPTION OF THE INVENTION

A. DEFINITIONS
The term “vector” refers to a nucleic acid molecule or polynucleotide, such as a replicating RNA, plasmid, phage, or cosmid, into which another nucleic acid sequence segment may be inserted so as to bring about the replication of the inserted segment. The described vectors can be expression vectors. Vector also refers to a molecule incorporating nucleic acid sequences encoding regulatory elements for transcription, translation, transcript stability, replication, and other functions as are known in the art vector" refers to a molecule incorporating nucleic acid sequences encoding regulatory elements for transcription, translation, transcript stability, replication, and other functions as are known in the art. A vector may be a nucleic acid such as a plasmid or other DNA vector. The vector may comprise one or more genes in a linear or circularized configuration. The vector may also have a “plasmid backbone” that is involved in the production, manufacture, or analysis of a gene product. An "expression vector" is a vector that allows for production of a product encoded for by a nucleic acid sequence contained in the vector. For example, expression of a particular growth factor protein encoded by a particular gene. A "gene product" means products encoded by the nucleic acid sequences of the vector.
The term “gene” or “genes” refers to isolated or modified nucleic acid sequences, including both RNA and DNA, that encode genetic information for the synthesis of a whole RNA, a whole protein, or any portion of such whole RNA or whole protein. Genes that are not naturally part of a particular organism's genome are referred to as “foreign genes” , “heterologous genes” or “exogenous genes” and genes that are naturally a part of a particular organism's genome are referred to as “endogenous genes” . The term “gene” as used with reference to genomic DNA includes intervening, non-coding regions as well as regulatory regions and can include 5’ and 3’ ends.
The term “expressed” or “expression” refers to the transcription from DNA to an RNA nucleic acid molecule at least complementary in part to a region of one of the two nucleic acid strands of the gene. The term “expressed” or “expression” also refers to the translation from said RNA nucleic acid molecule to give a protein or polypeptide or a portion thereof.
The term “coding region” refers to a portion of nucleic acid containing codons which may be translated into amino acids, although "stop codons" (TAG, TGA, or TAA) are not translated into an amino acids, but may also be considered to be part of a coding region. Unless stated otherwise, promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not considered part of a coding region. Coding regions of the present invention can be present in a single polynucleotide construct, e.g., on a single vector, or in separate polynucleotide constructs, e.g., on separate (different) vectors. Furthermore, any vector may contain a single coding region, or may comprise two or more coding regions. In addition, a vector, polynucleotide, or nucleic acid embodiments may encode heterologous coding regions, either fused or unfused to a nucleic acid encoding a different heterologous polypeptide. Heterologous coding regions include without limitation specialized elements or motifs, such as a secretory signal peptide or a heterologous functional domain.
The term "regulatory element" refers to a DNA sequence that controls and regulates the transcription of another DNA sequence.
The term "promoter" refers to a nucleic acid sequence sufficient to direct transcription of a gene. Also included in the invention are those promoter elements which are sufficient to render promoter dependent gene expression controllable for cell type specific, tissue specific or inducible by external signals or agents. Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as "inducible promoters" or "regulatable” promoters.
The terms "nucleic acid, " "nucleic acid sequence, " "nucleic acid fragment, " "oligonucleotide, " and "polynucleotide" are used interchangeably and are intended to include, but not limited to, a polymeric form of nucleotides that may have various lengths, either deoxyribonucleotides (DNA) or ribonucleotides (RNA) , or analogs or modified nucleotides thereof, including, but not limited to locked nucleic acids (LNA) , peptide nucleic acids (PNA) , and morpholinos. An oligonucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A) ; cytosine (C) ; guanine (G) ; and thymine (T) (uracil (U) for thymine (T) when the polynucleotide is RNA) . Thus, the term "oligonucleotide sequence" is the alphabetical representation of a polynucleotide molecule; alternatively, the term may be applied to the polynucleotide molecule itself. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. Oligonucleotides may optionally include one or more non-standard nucleotide (s) , nucleotide analog (s) and/or modified nucleotides. In some cases, nucleotide sequences are provided using character representations recommended by the International Union of Pure and Applied Chemistry (IUPAC) or a subset thereof. IUPAC nucleotide codes used herein include, A = Adenine, C = Cytosine, G = Guanine, T = Thymine, U = Uracil, R = A or G, Y = C or T, S = G or C, W = A or T, K = G or T, M = A or C, B = C or G or T, D = A or G or T, H = A or C or T, V = A or C or G, N =any base, “. ” or “-” = gap. In some forms the set of characters is (A, C, G, T, U) for adenosine, cytidine, guanosine, thymidine, and uridine respectively. In some forms the set of characters is (A, C, G, T, U, I, X) for adenosine, cytidine, guanosine, thymidine, uridine, inosine, xanthosine, respectively. The modified sequences, non-natural sequences, or sequences with modified binding, may be in the genomic, the guide or the tracr sequences.
The term “selection marker” refers to a gene introduced into a cell, especially a bacterium or to cells in culture, which confers a trait suitable for artificial selection. Selection markers may be genes that can be expressed to convey an identifying factor or phenotype that is a readily observable and a distinguishable trait, usually an antibiotic or chemical resistance gene, that is able to be selected for based upon the marker gene's effect, i.e., resistance to an phenotype that makes the organism resistant or susceptible to a specific set of conditions. Selectable markers may be resistance to an antibiotic, resistance to a herbicide, colorimetric markers, enzymes, fluorescent markers, and the like, wherein the effect is used to track the inheritance of a nucleic acid of interest and/or to identify a cell or organism that has inherited the nucleic acid of interest.
The term “antigen” refers to any substance (e.g., peptide, protein, nuclei acid, lipid, small molecule, such as a moiety expressed by or otherwise associated with a pathogen or cancerous or pre-cancerous cell) that serves as a target for the receptors of an adaptive immune response. The antigen may be a structural component of a pathogen, cancerous or pre-cancerous cell.
As used herein, the terms “approximately” or “about” in reference to a number are generally taken to include numbers that fall within a range of 5%, 10%, 15%, or 20%in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0%or exceed 100%of a possible value) .
As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant, and/or microbe) .
As used herein, the term “in vivo” refers to events that occur within an organism (e.g., animal, plant, and/or microbe) .
The terms “immunologic” , “immunological” or “immune” response refer to the development of a beneficial humoral (antibody mediated) and/or a cellular (mediated by antigen-specific T cells or their secretion products) response directed against an immunogen in a recipient patient. Such a response can be an active response induced by administration of immunogen or a passive response induced by administration of antibody or primed T-cells. The relative contributions of humoral and cellular responses to the protective or therapeutic effect of an immunogen can be distinguished by separately isolating antibodies and T-cells from an immunized syngeneic animal and measuring protective or therapeutic effect in a second subject.
As used herein, the term “immunostimulatory agent” refers to an agent that modulates an immune response to an antigen but is not the antigen or derived from the antigen. “Modulate” , as used herein, refers to inducing, enhancing, suppressing, directing, or redirecting an immune response. Such agents include immunostimulatory agents that stimulate (or boost) an immune response to an antigen but, as defined above, is not the antigen or derived from the antigen. Immunostimulatory agents, therefore, include adjuvants. In some forms, the immunostimulatory agent is on the surface of the nanocarrier and/or is encapsulated within the nanocarrier. In some forms, the immunostimulatory agent on the surface of the nanocarrier is different from the immunostimulatory agent encapsulated within the nanocarrier. In some forms, the nanocarrier includes more than one type of immunostimulatory agent. In some forms, the more than one type of immunostimulatory agent act on different pathways. Examples of immunostimulatory agents include those provided elsewhere herein.
As used herein, the term “nucleic acid, ” in its broadest sense, refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain. In some forms, a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. In some forms, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and/or nucleosides) . In some forms, “nucleic acid” refers to an oligonucleotide chain including individual nucleic acid residues. As used herein, the terms “oligonucleotide” and “polynucleotide” can be used interchangeably. In some forms, “nucleic acid” encompasses RNA as well as single and/or double-stranded DNA and/or cDNA, any natural or synthetic linear and sequential arrays of nucleotides and nucleosides, for example, replicating RNA (repRNA) , messenger RNA (mRNA) , small interfering RNA (siRNA) , transfer RNA (tRNA) , microRNA (miRNA) , guide strand RNA (sgRNA) , polynucleotides, oligo-nucleotides, oligo-nucleosides and derivatives thereof. Such nucleic acids may be collectively referred to as “constructs, ” or “plasmids. ” Furthermore, the terms “nucleic acid” , “DNA” , “RNA” , and/or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone. For example, the so-called “peptide nucleic acids, ” which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. The term “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and/or encode the same amino acid sequence. Nucleotide sequences that encode proteins and/or RNA may include introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can include nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. Anucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated. The term “nucleic acid segment” is used herein to refer to a nucleic acid sequence that is a portion of a longer nucleic acid sequence. In many forms, a nucleic acid segment includes at least 3, 4, 5, 6, 7, 8, 9, l 0, or more residues. In some forms, a nucleic acid is or includes natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) ; nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0 (6) -methylguanine, and 2-thiocytidine) ; chemically modified bases; biologically modified bases (e.g., methylated bases) ; intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) ; and/or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages) .
As used herein, the term “T cell antigen” refers to any antigen that is recognized by and triggers an immune response in a T cell (e.g., an antigen that is specifically recognized by a T cell receptor on a T cell via presentation of the antigen or portion thereof bound to a major histocompatibility complex molecule (MHC) . In some forms, an antigen that is a T cell antigen is also a B cell antigen. In other forms, the T cell antigen is not also a B cell antigen. T cells antigens generally are proteins or peptides. T cell antigens may be an antigen that stimulates a CD8+ T cell response, a CD4+ T cell response, or both. The nanocarriers, therefore, in some forms can effectively stimulate both types of responses.
As used herein, the term “target” or “marker” refers to any entity that is capable of specifically binding to a particular targeting moiety. In some forms, targets are specifically associated with one or more particular tissue types. In some forms, targets are specifically associated with one or more particular cell types. For example, a cell type specific marker is typically expressed at levels at least 2 fold greater in that cell type than in a reference population of cells. In some forms, the cell type specific marker is present at levels at least 3 fold, at least 4 fold, at least 5 fold, at least 6 fold, at least 7 fold, at least 8 fold, at least 9 fold, at least 10 fold, at least 50 fold, at least 100 fold, or at least 1000 fold greater than its average expression in a reference population. Detection or measurement of a cell type specific marker may make it possible to distinguish the cell type or types of interest from cells of many, most, or all other types. In some forms, a target can include a protein, a carbohydrate, a lipid, and/or a nucleic acid, as described herein. A substance is considered to be “targeted” for the purposes described herein if it specifically binds to a target. In some forms, a targeting moiety specifically binds to a target under stringent conditions. An inventive nanocarrier, such as a vaccine nanocarrier, including a targeting moiety is considered to be “targeted” if the targeting moiety specifically binds to a target, thereby delivering the entire nanocarrier to a specific organ, tissue, cell, and/or subcellular locale.
As used herein, the term “therapeutic agent” refers to any agent that, when administered to a subject, has a therapeutic, prophylactic, and/or diagnostic effect and/or elicits a desired biological and/or pharmacological effect.
As used herein, the term “treating” refers to partially or completely alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a particular disease, disorder, and/or condition. For example, “treating” a microbial infection may refer to inhibiting survival, growth, and/or spread of the microbe. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some forms, treatment includes delivery of an inventive vaccine nanocarrier to a subject.
As used herein, “subject” includes, but is not limited to, animals, plants, bacteria, viruses, parasites and any other organism or entity. The subject can be a vertebrate, more specifically a mammal (e.g., a human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig or rodent) , a fish, a bird or a reptile or an amphibian. The subject can be an invertebrate, more specifically an arthropod (e.g., insects and crustaceans) . The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. A patient refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary subjects.
As used herein, the terms “effective amount” or “therapeutically effective amount” means a quantity sufficient to alleviate or ameliorate one or more symptoms of a disorder, disease, or condition being treated, or to otherwise provide a desired pharmacologic and/or physiological effect. Such amelioration only requires a reduction or alteration, not necessarily elimination. The precise quantity will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, weight, etc. ) , the disease or disorder being treated, as well as the route of administration, and the pharmacokinetics and pharmacodynamics of the agent being administered.
By “pharmaceutically acceptable” is meant a material that is not biologically or otherwise undesirable, i.e., the material can be administered to a subject along with the selected compound without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
As used herein, the terms “single guide RNA” or “sgRNA” refer to the polynucleotide sequence comprising the guide sequence, tracr sequence and the tracr mate sequence. “Guide sequence” refers to the around 20 base pair (bp) sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or “spacer. ”
The terms “Cas9, ” “Cas9 protein, ” or “Cas9 nuclease” refer to a RNA-guided endonuclease that is a Cas9 protein that catalyzes the site-specific cleavage of double stranded DNA. Also, referred to as “Cas nuclease” or “CRISPR-associated nuclease. ”
The use of the terms “a, ” “an, ” “the, ” and similar referents in the context of describing the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.
Use of the term “about” is intended to describe values either above or below the stated value in a range of approx. +/-10%; in other forms the values may range in value either above or below the stated value in a range of approx. +/-5%; in other forms the values may range in value either above or below the stated value in a range of approx. +/-2%; in other forms the values may range in value either above or below the stated value in a range of approx. +/-1%. The preceding ranges are intended to be made clear by context, and no further limitation is implied. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as" ) provided herein, is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the disclosure.
Every compound disclosed herein is intended to be and should be considered to be specifically disclosed herein. Further, every subgroup that can be identified within this disclosure is intended to be and should be considered to be specifically disclosed herein. As a result, it is specifically contemplated that any compound, or subgroup of compounds can be either specifically included for or excluded from use or included in or excluded from a list of compounds.
Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular polypeptide is disclosed and discussed and a number of modifications that can be made to a number of polypeptides are discussed, specifically contemplated is each and every combination and permutation of polypeptides and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific form or combination of forms of the disclosed methods.
B. COMPOSITION OF VECTORS
1. Nucleic acid transposon vector
The compositions include a nucleic acid transposon vector. The transposon expression vector enables expression of one or more oncogenes in the target liver cells. The transposon expression vector includes one or more nucleic acid sequences encoding one or more oncogenes, a pair of inverted terminal repeat (ITR) sequences (also terminal inverted repeats or TIRs) , and an antibiotic resistance gene for the selection of cells containing the transposon expression vector.
The transposon expression vector exploits transposon technology to enable expression of one or more oncogenes in the target liver cells. Transposons translocate from one DNA site to another in a simple, cut-and-paste manner. Transposition is a precise process in which a defined DNA segment is excised from one DNA molecule and moved to another site in the same or different DNA molecule or genome.
Typically, the transposon includes one or more inverted repeats (ITR ) that mediate integration into the genome of a host cell, and nucleic acid sequences placed between the ITRs that typically include internal repeats (IR) /direct repeats (DR) , a promoter, one or more genes of interest, a Poly A region, and a terminator, internal repeats (IR) /direct repeats (DR) .
Translocation of transposon requires specific binding of transposase to inverted terminal repeats (ITRs) (e.g., about 230 bp) at each end of the transposon, which is followed by a cut-and-paste transfer of the transposon into a target DNA sequence. The ITRs contain two imperfect direct repeats (DRs) of about 32 bp. The outer DRs are at the extreme ends of the transposon whereas the inner DRs are located inside the transposon, 165-166 bp from the outer DRs. Although there is a core transposase-binding sequence common to all of the DRs, additional adjacent sequences are required for transposition and these sequences vary in the different DRs. In some forms, at least two DRs are required in each ITR for transposition. Each DR appears to have a distinctive role in transposition. Therefore, in some forms, the DRs of a transposase are not interchangeable for efficient transposition. In some forms, the spacing and sequence between the DR elements in an ITR affect transposition rates. In some forms, Transposons are flanked by TA dinucleotide base-pairs that are important for excision. Therefore, in some forms, elimination of the TA motif on one side of the transposon significantly reduces transposition while loss of TAs on both flanks of the transposon abolishes transposition. Exemplary transposons include members of the Tcl/mariner superfamily, such as mariner and Sleeping Beauty (SB) transposons. The regulation, including the strategy to enforce a synapsis of the transposon ends, as well as the requirement for such a synapsis, also varies among recombinases. While mariners have short ITRs with one transposon binding site at each transposon end (Rosenzweig B, et al., 1983. Nucleic Acids Res, 11: 4201-9; Tosi LR and Beverley SM, 2000. Nucleic Acids Res., 28: 784-90. ) , Sleeping Beauty (SB) belongs to the indirect repeat/direct repeat (IR/DR) subfamily of transposons, possessing two transposase binding sites (represented by direct repeats) at each transposon ends (Franz G and Savakis C, 1991. Nucleic Acids Res, 19: 6646; Izsvak, et al., 1995. Mol Gen Genet. 247: 312-22; Ivics, et al., 1997. Cell, 91: 501-10; Miskey, et al., 2003. Nucleic Acids Res, 31: 6873-81; Plasterk, et al., 1999. Trends Genet, 15: 326-32) .
i. Sleeping beauty transposon vector
A preferred transposon is the sleeping beauty (SB) transposon. The Sleeping Beauty transposon system is composed of a Sleeping Beauty (SB) transposase and a transposon that was designed in 1997 to insert specific sequences of DNA into genomes of vertebrate animals.
SB transposition is a cut-and-paste process, during which the transposable element is excised from its original location by the transposase and is integrated into a new location. The transposition process can arbitrarily be divided into at least four major steps: (1) binding of the transposase to its sites within the transposon IRs; (2) formation of a synaptic complex in which the two ends of the elements are paired and held together by transposase subunits; (3) excision from the donor site; and (4) reintegration at a target site.
The natural size of SB is 1.6 kb, and the sequences minimally required for transposition are included in the approximately 230-bp-long IRs. Similar to other transposable elements, the efficiency of SB transposition drops with increasing size, with the upper limit of transposon size being around 10 kb. Therefore, in some forms, the cargo nucleic acid within the SB transposon includes one or more genes of interest having a combined size of 10,000 base pairs (bp) , or less than 10,000 bp, such as between about 100 bp and 5,000 bp, inclusive, or between about 500 bp and about 2000 bp.
Different variants of SB transposons are known in the art (see, e.g., WO 98/40510, US 8,227,432 , Cui, et al., 2002. Structure-function analysis of the inverted terminal repeats of the Sleeping Beauty transposon". J. Mol. Biol. 318 (5) : 1221-1235; Izsvák, et al. 2000. Sleeping Beauty, a wide host-range transposon vector for genetic transformation in vertebrates. J. Mol. Biol. 302 (1) : 93-102) . Commercially available plasmids containing Sleeping Beauty transposons are designated:
pT (web page addgene. org/26555/sequences/#depositor-partial) ;
pT2 (web page addgene. org/26557/sequences/#depositor-full) ; or
pT3 (Yant, et al. Mutational analysis of the N terminal DNA binding domain of sleeping beauty transposase: critical residues for DNA binding and hyperactivity in mammalian cells. Mol Cell Biol. 2004 Oct; 24 (20) : 9239 47) .
In some forms, the transposon is a polynucleotide including a SB transposon including a cargo nucleic acid flanked by left and right inverted terminal repeats (ITR ) and left and right inverted repeat/direct repeat (IR/DR) sequences. The left IR contains an additional a motif (HDR) that acts as an enhancer in SB transposition (Izsvak, et al., 2002. J Biol Chem, 277: 34581 8. ) The IR/DR is an absolute requirement of SB transposition (Izsvak, et al., 2000. J Mol Biol, 302: 93 102. ) . Typically, the SB transposon nucleic acid sequence is configured such that the transposon is capable of being mobilized by a Sleeping Beauty transposase protein, i.e., having a left IR/DR including an outer left DR motif and an inner left DR motif, and a right IR/DR including an outer right DR motif and an inner right DR motif, where the IR/DRs each contain binding sites for the SB transposase.
The disclosed transposon expression vector may include nucleic acids encoding a wide variety of genes. In preferred forms, the transposon expression vector includes one or more nucleic acid sequences encoding one or more oncogenes. An oncogene of interest is cellular myelocytomatosis (c-myc) . Other oncogens of interest are CCND1, c- met, Yap, activated Akt (Akt1) , mutated CTNNB1, TERT, H-Ras^V12, and SV40 large T antigen.
2. Reverse tetracycline-controlled trans activator (rtTA)
The nucleic acid transposon vector includes expression of a reverse tetracycline-controlled trans activator (rtTA) -Advanced, which is a modified version of the reverse tetracycline-controlled transactivator (rtTA) protein.
The reverse tetracycline-controlled transactivator (rtTA) protein is an engineered transcription factor used in the tetracycline-controlled gene expression system, commonly referred to as the Tet-On system (Das et al., Curr Gene Ther. 2016, 16 (3) : 156-167) . This system allows for precise, inducible control of gene expression in response to the presence of tetracycline or its analog, doxycycline. When doxycycline is added to the system, it binds to the rtTA-Advanced protein and causes it to undergo a conformational change, allowing it to bind to the tetracycline-responsive promoter and activate transcription of the target gene. When the inducer is removed, the rtTA-Advanced protein reverts back to its original conformation and the target gene expression is turned off.
3. Promoter
In some forms, the nucleic acid transposon vector includes one or more promoter elements, configured to control expression of the one or more genes of interest upon integration within the host cell genome.
In some forms, the promoter is a strong, constitutively active promoter for high-level expression of the gene of interest. Commonly used promoters of this type include the CMV (cytomegalovirus) promoter/enhancer, EF1a (elongation factor 1a) , SV40 (simian virus 40) , Ubiquitin C (UBC) , Albumin (Alb) , chicken β actin, and CAG (CMV, chicken β actin, rabbit β globin) . A preferred promoter is the EF1 alpha, or EFS (its short, intron-less form) promoter. EFS is a cellular-derived enhancer/promoter with decreased cross-activation of nearby promoters, therefore hypothetically decreasing the risk of genotoxicity. In the design multiple transcription units may be arranged in close proximity in a space-limited vector. All of these promoters provide constitutively active, high-level gene expression in most cell types. Some of these promoters are subject to silencing in certain cell types, therefore this consideration should be evaluated for each application.
4. Oncogenes
In some forms, the disclosed nucleic acid transposon vector includes one or more nucleic acid sequences encoding one or more oncogenes that are co-expressed with rtTA-Advanced.
The disclosed transposon expression vector may include nucleic acids encoding a wide variety of genes. In preferred forms, the transposon expression vector includes one or more nucleic acid sequences encoding one or more oncogenes. An exemplary oncogene is cellular myelocytomatosis (c-myc) . Other exemplary oncogenes are CCND1, c-met, Yap, activated Akt (Akt1) , mutated CTNNB1, TERT, H-Ras^V12, and SV40 large T antigen.
In some forms, the disclosed nucleic acid transposon vector expresses oncogenes that include but not limited to transcription factor (MYC) , GTPase (RAS) , receptor tyrosine kinases (e.g., EGFR, HER2, MET, PDGFR, KIT, FGFR3, ALK, VEGFR and RET) , serine/therinine kinase (bRAF and AURORA Kinase) , tyrosine kinase (ABL) , and lipid kinase (PI3K) .
In some forms, the nucleic acid transposon vector encoding the oncogene may include a sequence of bases that is endogenous and/or exogenous to target cells. An exogenous sequence is one that is not present in the target cell, while an endogenous sequence is one that pre-exists in the target cell prior to delivery of the transposon expression vector. Either way, the nucleic acid encoding the oncogene is exogenous to the target cell, since it originates from a source other than the target cell and is introduced into the target cell by the methods described below. In some forms, the exogenous nucleic acid may be an oncogene whose protein product is not well characterized. In such forms, the transposon expression vector is employed to stably introduce the oncogene into the target cell and observe changes in the cell phenotype to characterize the oncogene. In some forms, the exogenous nucleic acid encodes a protein of interest which is to be produced by the cell. The nucleic acid encoding the oncogene may vary in size. The upper and lower limits of the size of the nucleic acid encoding the oncogene may readily be determined empirically by those of skill in the art.
5. Self-cleaving peptides
The nucleic acid transposon vector includes self-cleaving peptides between coding regions of rtTA and oncogene. Self-cleaving peptides, also known as self-processing or self-excising peptides, are short peptide sequences that facilitate the autocatalytic cleavage of a polypeptide chain at a specific site. These peptides are often used in biotechnology and molecular biology to ensure the production of separate, functional protein products from a single polypeptide precursor. These peptides are naturally found in a wide range of viral families. Members of self-cleaving peptides include P2A, E2A, F2A, or T2A. The disclosed nucleic acid transposon vector can include any of the self-cleaving peptides.
In some forms, the transposon vector includes one or more polypeptide sequences encoding a viral 2A region. Therefore, in some forms, the vector can include one or more 2A peptide sequences, typically at the carboxyl (C) terminus of the TCR delta constant domain.
T2A peptides are 18-22 amino-acid (aa) -long viral oligopeptides that mediate “cleavage” of polypeptides during translation in eukaryotic cells. The designation “2A” refers to a specific region of the viral genome and different viral 2As have generally been named after the virus they were derived from. The first discovered 2A was F2A (foot-and-mouth disease virus) , after which E2A (equine rhinitis A virus) , P2A (porcine teschovirus-1 2A) , and T2A (thosea asigna virus 2A) were also identified. The mechanism of 2A-mediated “self-cleavage” was recently discovered to be ribosome skipping the formation of a glycyl-prolyl peptide bond at the C-terminus of the 2A20) . A highly conserved sequence GDVEXNPGP (SEQ ID NO: 13) is shared by different 2As at the C-terminus, and is important for the creation of steric hindrance and ribosome skipping. There are three possibilities for a 2A-mediated skipping event:
1 -Successful skipping and recommencement of translation results in two “cleaved” proteins: the protein upstream of the 2A is attached to the complete 2A peptide except for the C-terminal proline, and the protein downstream of the 2A is attached to one proline at the N-terminus;
2 -Successful skipping but ribosome fall-off and discontinued translation results in only the protein upstream of 2A; and
3 -Unsuccessful skipping and continued translation resulting in a fusion protein.
Overall, 2A peptides lead to relatively high levels of downstream protein expression compared to other strategies for multi-gene co-expression, and they are small in size thus bearing a lower risk of interfering with the function of co-expressed genes. 2A peptides have also been successfully employed by several different groups for polycistronic and bi-cistronic multigene expression. An exemplary amino acid sequence for a T2A sequence is: GSGSGEGRGSLLTCGDVEENPGP (SEQ ID NO: 14) .
6. Agents to induce gene expression
In one embodiment the inducible promoter is a tetracycline-inducible promoter (TIP) , whereby the TIP cassette contains the tetracycline responsive element (TRE) (Gossen, et al., Science 268: 1766-1769 (1995) ) , to allow the doxycycline-dependent manipulation of gene expression. Doxycycline is a member of the tetracycline antibiotics group.
When the inducible promoter is a tetracycline-inducible promoter (TIP) , introduction of ubiquitous or tissue-specific tetracycline-controlled transactivators (tTA) to the animal background enables over-expression of the gene from embryonic stage onward in the absence of doxycycline (ubiquitous or tissue-specific gain of expression) and silence it upon the exposure to doxycycline (conditional loss of expression) .
Furthermore, when the inducible promoter is a tetracycline-inducible promoter (TIP) , introduction of the reverse tetracycline-controlled transactivators (rtTA) to the animal background enables gene expression in the tissue of choice upon an exposure to doxycycline (conditional gain of expression) .
The principle of exploiting tetracycline-inducible system for gene conditional expression or silencing was described more than a decade ago (Gross, et al., Nature, 416: 396-400 (2002) ; Shin, et al., Nature, 402: 496-501 (1999) ; Tanaka, et al., Biol Psychiatry, 67: 770-773 (2010) ) .
i. Inducible test genes
The inducible genes are generally used to test the effect of expression of the inducible gene on the liver cancer model. Thus, these inducible genes are referred to interchangeably as “inducible genes, ” “test genes, ” and “inducible test genes. ”
In some forms, the tetracycline-inducible gene is chicken ovalbumin (OVA) .
In some forms, the tetracycline-inducible gene is any gene of interest including any tumor antigen.
In some forms, the tetracycline-inducible gene enables expression of sgRNAs or shRNAs wherein the expression of sgRNAs or shRNAs are controlled by incorporation of H1-202 promoter downstream of TRE and incorporation of terminator sequence (TTTTT) .
a. Tumor antigens
In some forms, the antigen (s) is or includes a tumor antigen. There are many classes of tumor antigens, including, but not limited to, oncogene expression products, alternatively spliced expression products, mutated gene products, over-expressed gene products, aberrantly expressed gene products, antigens produced by an oncogenic viruses, oncofetal antigens, as well as proteins with altered cell surface glycolipids, and proteins having altered glycosylation profiles.
Exemplary tumor antigens included or encoded by compositions including one or more mRNA antigens and one or more mRNA adjuvants include tumor-associated or tumor-specific antigens, such as, but not limited to, alpha-actinin-4, Alphafetoprotein (AFP) , Bcr-Abl fusion protein, Carcinoembryonic antigen (CEA) , CA-125, Casp-8, beta-catenin, cdc27, cdk4, cdkn2a, coa-1, dek-can fusion protein, epithelial tumor antigen, EF2, ETV6-AML1 fusion protein, LDLR-fucosyltransferaseAS fusion protein, HLA-A2, HLA-A11, hsp70-2, KIAAO205, Mart2, Mum-1, 2, and 3, neo-PAP, myosin class I, OS-9, pml-RARa fusion protein, PTPRK, K-ras, N-ras, Triosephosphate isomeras, Bage-1, Gage 3, 4, 5, 6, 7, GnTV, Herv-K-mel, Lage-1, Melanoma-associated antigen (MAGE) ; Mage-A1, 2, 3, 4, 6, 10, 12, Mage-C2, NA-88, NY-Eso-1/Lage-2, SP17, SSX-2, and TRP2-Int2, MelanA (MART-I) , gp100 (Pmel 17) , tyrosinase, TRP-1, TRP-2, MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15 (58) , CEA, RAGE, NY-ESO (LAGE) , SCP-1, Hom/Mel-40, PRAME, p53, H-Ras, HER-2/neu, BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR, Epstein Barr virus antigens, EBNA, human papillomavirus (HPV) antigens E6 and E7, TSP-180, MAGE-4, MAGE-5, MAGE-6, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72-4, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, b-Catenin, CDK4, Mum-1, p16, TAGE, PSMA, PSCA, CT7, telomerase, 43-9F, 5T4, 791Tgp72, a-fetoprotein, 13HCG, BCA225, BTAA, CA 125, CA 15-3 (CA 27.29\BCAA) , CA 195, CA 242, CA-50, CAM43, CD68\KP1, CO-029, FGF-5, G250, Ga733 (EpCAM) , HTgp-175, M344, MA-50, MG7-Ag, MOV18, MUC-1, NB\70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 (Mac-2 binding protein\cyclophilin C-associated protein) , TAAL6, TAG72, TLP, tyrosinase, and TPS. An exemplary tumor antigen is the model melanoma tumor antigen Trp1.
In certain forms, the tumor antigen is the gene product of a gene that is normally expressed during embryogenesis, and whose expression in normal adult tissues is limited, such as an “oncofetal” protein, or an alternatively-spliced variant of a normal protein. Oncofetal antigens are proteins which are typically present only during fetal development but are found in adults with certain kinds of cancer. These proteins are often measurable in the blood of individuals with cancer and may be used to both diagnose and follow treatment of the tumors. Therefore, in some forms, the compositions including one or more mRNA antigens and one or more mRNA adjuvants include or encode one or more oncofetal proteins. An exemplary oncofetal protein is the Hmga2 protein.
In certain forms, the tumor antigen is the gene product of a gene that is normally expressed or not expressed by cells, but whose sequence has been altered by mutation, genetic recombination, altered splicing or another process leading to a distinct protein coding sequence or post-translational modification of a coding sequence and a consequently distinct peptide-MHC complex presented on the surface of a tumor compared with non-tumor cells of the same tissue of origin, here termed a ‘neoantigen’ . In some forms, a neoantigen is specific to a subject.
b. Other inducible test genes
The compositions of the nucleic acid transposon vector can include one or more ribonucleic acid sequences encoding one or more peptide antigens.
In some forms, the exogenous nucleic acid sequence can encodes a vaccine antigen. An antigen can include any protein or peptide that is foreign to the subject organism. Preferred antigens can be presented at the surface of antigen presenting cells (APC) of a subject for surveillance by immune effector cells, such as leucocytes expressing the CD4 receptor (CD4 T cells) and Natural Killer (NK) cells. Typically, the antigen is of viral, bacterial, protozoan, fungal, or animal origin. In some forms, the antigen is a cancer antigen. Cancer antigens can be antigens expressed only on tumor cells and/or required for tumor cell survival. Certain antigens are recognized by those skilled in the art as immuno-stimulatory (i.e., stimulate effective immune recognition) and provide effective immunity to the organism or molecule from which they derive.
B cell antigens can be peptides, proteins, polysaccharides, saccharides, lipids, nucleic acids, small molecules (alone or with a hapten) or combinations thereof. T cell antigens are proteins or peptides. The antigen can be derived from a virus, bacterium, parasite, plant, protozoan, fungus, tissue or transformed cell such as a cancer or leukemic cell and can be a whole cell or immunogenic component thereof, e.g., cell wall components or molecular components thereof. Suitable antigens are known in the art and are available from commercial government and scientific sources. The antigens may be purified or partially purified polypeptides derived from tumors or viral or bacterial sources. The antigens can be recombinant polypeptides produced by expressing DNA encoding the polypeptide antigen in a heterologous expression system. All or part of an antigenic protein can be encoded by a DNA or RNA molecule for delivery. Antigens may be provided as single antigens or may be provided in combination. Antigens may also be provided as complex mixtures of polypeptides or nucleic acids.
7. Tools for gene deletions
i. CRISPR Technology
In some forms, CRISPR-mediated somatic knockout of tumor suppressor genes has been used to induce Hepatocellular Carcinoma (HCC) in mice.
In some forms, CRISPR-mediated gene knockout includes deletion of one or more of the tumor suppressor genes Trp53, AXIN1, APC, ARID1A, ARID2, KEAP1, and Pten.
The term “CRISPR” (Clustered Regularly Interspaced Short Palindromic Repeats) is an acronym for DNA loci that contain multiple, short, direct repetitions of base sequences. The prokaryotic CRISPR/Cas system has been adapted for use as gene editing (silencing, enhancing or changing specific genes) for use in eukaryotes (see, for example, Cong, Science, 15: 339 (6121) : 819-823 (2013) and Jinek, et al., Science, 337 (6096) : 816-21 (2012) ) . Methods of preparing compositions for use in genome editing using the CRISPR/Cas systems are described in detail in WO 2013/176772 and WO 2014/018423, which are specifically incorporated by reference herein in their entireties.
In general, the term “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ( “Cas” ) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or an active partial tracrRNA) , a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system) , a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system) , or other sequences and transcripts from a CRISPR locus. One or more tracr mate sequences operably linked to a guide sequence (e.g., direct repeat-spacer-direct repeat) can also be referred to as pre-crRNA (pre-CRISPR RNA) before processing or crRNA after processing by a nuclease. Typically, a CRISPR-Cas9 system includes a guide RNA (gRNA) and Cas9 nuclease, which together form a ribonucleoprotein (RNP) complex. The presence of a specific protospacer adjacent motif (PAM) in the genomic DNA is required for the gRNA to bind to the target sequence. The Cas9 nuclease then makes a double-strand break in the DNA. Endogenous repair mechanisms triggered by the double-strand break may result in gene knockout via a frameshift mutation or knock-in of a desired sequence if a DNA template is present.
In some forms, a tracrRNA and crRNA are linked and form a chimeric crRNA-tracrRNA hybrid where a mature crRNA is fused to a partial tracrRNA via a synthetic stem loop to mimic the natural crRNA: tracrRNA duplex as described in Cong, Science, 15: 339 (6121) : 819-823 (2013) and Jinek, et al., Science, 337 (6096) : 816-21 (2012) ) . A single fused crRNA-tracrRNA construct can also be referred to as a guide RNA or gRNA (or single-guide RNA (sgRNA) ) . Within an sgRNA, the crRNA portion can be identified as the ‘target sequence’ and the tracrRNA is often referred to as the ‘scaffold’ .
CRSIPR systems having enhanced editing activity and high genome-wide targeting specificity typically include two components: (1) a single guide RNA configured for enhanced editing activity; and (2) a Cas enzyme.
ii. Transcription Activator-Like Effector Nucleases (TALEN)
In some forms, TALEN-mediated knockout of tumor suppressor genes can be used to induce Hepatocellular Carcinoma (HCC) in mice.
In some forms, the element that induces a single or a double strand break in the target cell’s genome is a nucleic acid construct or constructs encoding a transcription activator-like effector nuclease (TALEN) . TALENs have an overall architecture similar to that of ZFNs, with the main difference that the DNA-binding domain comes from TAL effector proteins, transcription factors from plant pathogenic bacteria. The DNA-binding domain of a TALEN is a tandem array of amino acid repeats, each about 34 residues long. The repeats are very similar to each other; typically they differ principally at two positions (amino acids 12 and 13, called the repeat variable diresidue, or RVD) . Each RVD specifies preferential binding to one of the four possible nucleotides, meaning that each TALEN repeat binds to a single base pair, though the NN RVD is known to bind adenines in addition to guanine. TAL effector DNA binding is mechanistically less well understood than that of zinc-finger proteins, but their seemingly simpler code could prove very beneficial for engineered-nuclease design. TALENs also cleave as dimers, have relatively long target sequences (the shortest reported so far binds 13 nucleotides per monomer) and appear to have less stringent requirements than ZFNs for the length of the spacer between binding sites. Monomeric and dimeric TALENs can include more than 10, more than 14, more than 20, or more than 24 repeats.
Methods of engineering TAL to bind to specific nucleic acids are described in Cermak, et al, Nucl. Acids Res. 1-11 (2011) . US Published Application No. 2011/0145940, which discloses TAL effectors and methods of using them to modify DNA. Miller et al. Nature Biotechnol 29: 143 (2011) reported making TALENs for site-specific nuclease architecture by linking TAL truncation variants to the catalytic domain of Fokl nuclease. The resulting TALENs were shown to induce gene modification in immortalized human cells. General design principles for TALE binding domains can be found in, for example, WO 2011/072246.
iii. Zinc Finger Nucleases (ZFN)
In some forms, ZFN-mediated knockout of tumor suppressor genes can be used to induce Hepatocellular Carcinoma (HCC) in mice.
In some embodiments, the element that induces a single or a double strand break in the target cell’s genome is a nucleic acid construct or constructs encoding a zinc finger nucleases (ZFNs) . ZFNs are typically fusion proteins that include a DNA-binding domain derived from a zinc-finger protein linked to a cleavage domain.
The most common cleavage domain is the Type IIS enzyme Fokl. Fok1 catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, U.S. Pat. Nos. 5,356,802; 5,436,150 and 5,487,994; as well as Li et al. Proc., Natl. Acad. Sci. USA 89 (1992) : 4275-4279; Li et al. Proc. Natl. Acad. Sci. USA, 90: 2764-2768 (1993) ; Kim et al. Proc. Natl. Acad. Sci. USA. 91: 883-887 (1994a) ; Kim et al. J. Biol. Chem. 269: 31 , 978-31, 982 (1994b) . One or more of these enzymes (or enzymatically functional fragments thereof) can be used as a source of cleavage domains.
The DNA-binding domain, which can, in principle, be designed to target any genomic location of interest, can be a tandem array of Cys2His2 zinc fingers, each of which generally recognizes three to four nucleotides in the target DNA sequence. The Cys2His2 domain has a general structure: Phe (sometimes Tyr) -Cys- (2 to 4 amino acids) -Cys- (3 amino acids) -Phe (sometimes Tyr) - (5 amino acids) -Leu- (2 amino acids) -His- (3 amino acids) -His. By linking together multiple fingers (the number varies: three to six fingers have been used per monomer in published studies) , ZFN pairs can be designed to bind to genomic sequences 18-36 nucleotides long.
Engineering methods include, but are not limited to, rational design and various types of empirical selection methods. Rational design includes, for example, using databases including triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; 6,534,261; 6,610,512; 6,746,838; 6,866,997; 7,067,617; U.S. Published Application Nos. 2002/0165356; 2004/0197892; 2007/0154989; 2007/0213269; and International Patent Application Publication Nos. WO 98/53059 and WO 2003/016496.
iv. Other gene altering tools.
In some forms, the genome editing composition optionally includes a donor polynucleotide. The modifications of the target DNA due to NHEJ and/or homology-directed repair can be used to induce gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, gene mutation, etc.
Accordingly, cleavage of DNA by the genome editing composition can be used to delete nucleic acid material from a target DNA sequence by cleaving the target DNA sequence and allowing the cell to repair the sequence in the absence of an exogenously provided donor polynucleotide. Thus, the subject methods can be used to knock out a gene (resulting in complete lack of transcription or altered transcription) or to knock in genetic material into a locus of choice in the target DNA.
Alternatively, if the genome editing composition includes a donor polynucleotide sequence that includes at least a segment with homology to the target DNA sequence, the methods can be used to add, i.e., insert or replace, nucleic acid material to a target DNA sequence (e.g., to “knock in” a nucleic acid that encodes for a protein, an siRNA, an miRNA, etc. ) , to add a tag (e.g., 6xHis, a fluorescent protein (e.g., a green fluorescent protein; a yellow fluorescent protein, etc. ) , hemagglutinin (HA) , FLAG, etc. ) , to add a regulatory sequence to a gene (e.g., promoter, polyadenylation signal, internal ribosome entry sequence (IRES) , 2A peptide, start codon, stop codon, splice signal, localization signal, etc. ) , to modify a nucleic acid sequence (e.g., introduce a mutation) , and the like. As such, the compositions can be used to modify DNA in a site-specific, i.e., “targeted” , way, for example gene knock-out, gene knock-in, gene editing, gene tagging, etc. as used in, for example, gene therapy.
In applications in which it is desirable to insert a polynucleotide sequence into a target DNA sequence, a polynucleotide including a donor sequence to be inserted is also provided to the cell. By a “donor sequence” or “donor polynucleotide” or “donor oligonucleotide” it is meant a nucleic acid sequence to be inserted at the cleavage site. The donor polynucleotide typically contains sufficient homology to a genomic sequence at the cleavage site, e.g., 70%, 80%, 85%, 90%, 95%, or 100%homology with the nucleotide sequences flanking the cleavage site, e.g., within about 50 bases or less of the cleavage site, e.g., within about 30 bases, within about 15 bases, within about 10 bases, within about 5 bases, or immediately flanking the cleavage site, to support homology-directed repair between it and the genomic sequence to which it bears homology. The donor sequence is typically not identical to the genomic sequence that it replaces. Rather, the donor sequence may contain at least one or more single base changes, insertions, deletions, inversions or rearrangements with respect to the genomic sequence, so long as sufficient homology is present to support homology-directed repair. In some embodiments, the donor sequence includes a non-homologous sequence flanked by two regions of homology, such that homology-directed repair between the target DNA region and the two flanking sequences results in insertion of the non-homologous sequence at the target region.
Donor sequences can also include a vector backbone containing sequences that are not homologous to the DNA region of interest and that are not intended for insertion into the DNA region of interest. Generally, the homologous region (s) of a donor sequence will have at least 50%sequence identity to a genomic sequence with which recombination is desired. In certain embodiments, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 99.9%sequence identity is present. Any value between 1%and 100%sequence identity can be present, depending upon the length of the donor polynucleotide.
The donor sequence can include certain sequence differences as compared to the genomic sequence, e.g., restriction sites, nucleotide polymorphisms, selectable markers (e.g., drug resistance genes, fluorescent proteins, enzymes etc. ) , etc., which can be used to assess for successful insertion of the donor sequence at the cleavage site or in some cases may be used for other purposes (e.g., to signify expression at the targeted genomic locus) . In some cases, if located in a coding region, such nucleotide sequence differences will not change the amino acid sequence, or will make silent amino acid changes (i.e., changes which do not affect the structure or function of the protein) . Alternatively, these sequences differences may include flanking recombination sequences such as FLPs, loxP sequences, or the like, that can be activated at a later time for removal of the marker sequence.
The donor sequence can be a single-stranded DNA, single-stranded RNA, double-stranded DNA, or double-stranded RNA. It can be introduced into a cell in linear or circular form. If introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonucleolytic degradation) by methods known to those of skill in the art. For example, one or more dideoxynucleotide residues are added to the 3' terminus of a linear molecule and/or self-complementary oligonucleotides are ligated to one or both ends. See, for example, Chang et al. Proc. Natl. Acad. Sci. USA 84: 4959-4963 (1987) ; Nehls et al. Science 272: 886-889 (1996) . Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group (s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphor amidates, and O-methyl ribose or deoxyribose residues.
As an alternative to protecting the termini of a linear donor sequence, additional lengths of sequence can be included outside of the regions of homology that can be degraded without impacting recombination. A donor sequence can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance.
C. METHODS OF MAKING NUCLEIC ACID TRANSPOSON VECTORS FOR GENERATING CONTROLLABLE GENE EXPRESSION CONSTRUCTS.
In some forms, the disclosed methods and compositions utilize a sleeping beauty transposon expression vector to enable controlled expression of one or more genes in target liver cells. The sleeping beauty transposon is cloned into a pT2/BH plasmid. The resulting plasmid contains the following elements flanked by left and right inverted repeat/direct repeat (IR/DR) sequences in the following order (Fig. 2) :
(a) a human elongation factor 1 alpha (EF1α) promoter;
(b) a reverse tetracycline-controlled transactivator (rtTA) -Advanced protein;
(c) a P2A self-cleaving peptide sequence;
(d) a c-Myc open reading frame;
(e) a Beta Globin 3’ UTR followed by GU rich region; and
(f) an inducible gene of interest in reverse orientation that is under the control of tetracycline-responsive element (TRE) .
The resulting pT2_BH-Sleeping Beauty-EF1a-rtTA-P2A-Myc+TRE-OVA construct gets integrated into genome of hepatocytes after delivering the transposon vector using hydrodynamic injection technique.
D. METHODS OF USE
1. Generating tumor model
The hydrodynamic injection method is utilized to introduce vectors into hepatocytes that can induce tumor formation in mice. These vectors consist of a Sleeping Beauty transposon vector, which continuously expresses a cancer-causing oncogene, and CRISPR vectors with guide RNAs that delete tumor suppressor genes. The combined effect of oncogene expression and the deletion of tumor suppressor genes leads to the development of hepatocellular carcinoma (HCC) in mice. This method offers convenient, efficient, liver-specific, and non-viral approach that can be applied to both wild-type and gene-modified mice without the need to generate transgenic mice or perform complicated crossbreeding.
In some forms, the transposon vector is pT2_BH-Sleeping Beauty-EF1a-rtTA-P2A-Myc+TRE-OVA that can be used to overexpress oncogenes such as c-myc.
In some forms, CRISPR vectors can be used for deletion or mutation of the second exon ofTrp53 and first exon ofPten.
Hepatocellular carcinoma (HCC) is developed due to a combined effect ofMyc expression and Trp53 and Pten ablation. The ablation of Trp53 and Pten, and the overexpression of Myc in mice to develop HCC mimics the multi-stage and multi-hit process of human liver carcinogenesis.
The non-human animal model is suitable for research purposes such as investigating the molecular and genetic mechanisms underlying recurrent HCC tumor development, identifying potential therapeutic targets, and testing potential compounds for the treatment of recurrent HCC.
Thus, the non-human animal model is a genetically modified non-human animal. As used herein, the term “genetically modified non-human animal” refers to a non-human animal having exogenous DNA in at least one chromosome of the animal's genome. In some forms, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically modified non-human animal have the exogenous DNA in its genome. The cell having exogenous DNA, i.e., the target cells, can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, or an endogenous tumor cell. In some forms, genetically modified non-human animals contain a modified endogenous locus that contains an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences. The non-human animals are generally not able to pass the modification to progeny, i.e., through germline transmission.
In some forms, the target cells are liver cells. Exemplary target liver cells include but are not limited to hepatocytes, Kupffer cells, stellate (Ito) cells, sinusoidal endothelial cells (SECs) , cholangiocytes, biliary epithelial cells (BECs) , liver progenitor cells (LPCs) , pit cells or liver-associated natural killer (NK) cells, dendritic cells, and liver sinusoidal endothelial cell (LSEC) fenestrations. In preferred forms, the target liver cells are hepatocytes.
The non-human animal model develops a focal HCC tumor after a period of time following integration of the model generating system. In some forms, the period of time for developing the focal HCC tumor is about 3 weeks to about 5 weeks, more preferably about 4 weeks following integration of the model generating system. Generally, the non-human animal model develops one or more recurrent HCC liver tumors after a period of time following surgical resection of the focal tumors. In some forms, the period of time for development of the recurrent HCC tumors is about six weeks to about 11 weeks following surgical resection of the focal tumors. In some forms, the period of time for development of the recurrent HCC tumors is about six weeks to about seven months following surgical resection of the focal tumors. In some forms, the period of time for development of the recurrent HCC tumors is about six weeks, about two months, about three months, about four months, about 5 months, about six months, about seven months following surgical resection of the focal tumors.
Recurrent HCC tumor cells and tissues are defined structurally and functionally as described herein; using methods and assays similar to those described below. Because recurrent HCC tumor cells and tissues are known to evolve phenotypically and functionally over time as additional genetic mutations occur, the recurrent HCC tumor cells and tissues may change phenotypically and functionally over time in the non-human animal model. Nevertheless, one can use the methods as described herein and employ the markers as disclosed herein, to consistently isolate and/or identify recurrent HCC tumor cells and tissues. In some forms, the HCC tumor cells and tissues express cell surface markers including but not limited to Alpha-fetoprotein and glypican 3.
Generally, the non-human animal model is an immune-competent animal. An “immune-competent” animal, as used herein, is one in which the native or natural innate and adaptive immune system has been retained (i.e., not artificially altered) , such that the animal retains its normal capacity to develop an immune response against a foreign antigen. One advantage is that the animal models have been tolerized specifically to certain xenogenic cells and/or tissues e.g., cells and/or tissues produced by the model generating system, such that they do not recognize such xenogenic cells and/or tissues as foreign cells and/or tissues. Therefore, cells and/or tissues produced by the model-generating system can be achieved without the need to resort to germline genetic modification of the recipient animal's native immune system or the use of immunosuppressive agents to prevent the animal from rejecting the xenogenic cells and/or tissues. A further advantage is that the animal remains capable of mounting a normal immune response against the cells and/or tissues produced by the model generating system. Thus, such immune-competent animals would usually have T, B, and/or NK cells that are normal and/or unaltered (insofar as being not artificially altered or engineered, it being appreciated that a natural mutation may arise, which otherwise does not significantly impair the animal's normal immune response) . The non-human animal model is immunologically tolerant to the HCC tumor cells, while maintaining a competent immune system. The animal models are “tolerogenic” to the HCC tumor cells, which means they are immunologically tolerant such that they maintain a state of tolerance to the HCC tumor cells, instead of mounting an immune response to, or rejection of, the HCC tumor cells. The term “tolerogenic, ” as referred to herein, generally means that the animals tolerate the HCC tumors, without being immunocompromised or immunodeficient, either through the use of germline genetic modifications or immunosuppressive agents. This is in contrast with an immunodeficient or immunocompromised animal where the natural or native immune response is attenuated, weakened, or decreased, such that the animal has an altered immunocompetence to fight a foreign antigen. Such animals usually have atypical T, B, and/or NK cells. In preferred forms, the tumors are derived from the immune competent mice; therefore, the tumors are not rejected by the immune system of the mice.
The target animal for harboring the model-generating system is preferably a mammal. In some forms, the mammal is a rodent such as mice, rats, squirrels, prairie dogs, porcupines, beavers, guinea pigs, and hamsters. In some forms, the target animal is a rabbit. In some forms, the target animal is zebra fish. In preferred forms, target animal is a rodent, preferably mice or rats. The target animal chosen will various uses for modeling and studying human disease and evaluation of treatments. In one or more forms, the target animals are useful as models for recurrent HCC, and/or methods of modeling recurrent HCC using the model-generating system described above. For example, HCC tumors could be established in the recipient animal via the model generating system for testing of pharmaceuticals, cytotherapy, photodynamic therapy, magnetic hyperthermic therapy, gene therapy, and the like. The model generating system can be used to promote the development of the HCC tumor cells and/or tissue specifically in liver. For this reason, it is desirable to restrict movement by the tumor cells to facilitate tumor formation in the liver.
In some forms, the non-human animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola. In some forms, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129/SvEv-and C57BL/6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some forms, the mouse is a mix of the 129 strain and the C57BL/6 strain. In some forms, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains. In some forms, the mouse is a BALB strain, e.g., BALB/c strain. In some forms, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB/c-50%12954/Sv; or 50%C57BL/6-50%129) .
In some forms, the non-human animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some forms, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.
2. Screening for tumor suppressors
i. Using inducing agents to generate immune responses
The sleeping beauty transposon vector described herein contains a doxycycline-inducible gene expression system which gets integrated into genome of hepatocytes following hydrodynamic injection of the transposon vector. By utilizing the Sleeping Beauty transposon vector, this method provides a stable and long-lasting integration of the gene expression system into the genome of hepatocytes. The doxycycline-inducible system allows for precise and reversible control of gene expression, enabling researchers to precisely regulate the timing and magnitude of gene expression in the liver. Moreover, the hydrodynamic injection technique used herein enables efficient and high-level gene expression in hepatocytes, making it an important tool for liver gene therapy.
The reverse tetracycline-controlled Trans-Activator (rtTA) is co-expressed with oncogenes, such as c-Myc, to ensure inducible gene expression occurs in all affected tumorous cells. The rtTA is expressed prior to c-Myc to ensure that the inducible gene expression is activated in all tumorous cells. This approach ensures that the gene expression is precisely targeted, specifically induced, and maximally effective in treating liver cancer.
To prevent the leaky transcription caused by remote promoters, the fragment containing the rtTA expression cassette and the gene driven by tetracycline response element (TRE) are cloned in the reverse "trans" orientation in the vector. This approach prevents the leaky transcription caused by remote promoters, ensuring that the inducible gene expression is precisely controlled.
After the establishment of a tumor model, doxycycline can be administered to induce the expression of genes such as those that encode antigens since these genes are under the control of TRE. A range of doxycycline can be administered for controlling differential levels of gene transcription. In some forms, doxycycline (Dox) can be administered through drinking water. In some forms, expression of antigens can be monitored using immunohistochemistry analysis on liver sections.
In some forms, the expression of antigens due to the administration of Dox generates immune responses such as T cells specific to antigens or increased PD-1 expression or induction of Tregs or antigen specific B cells or antibodies.
ii. Accessing responses to identify tumor suppressors
In some forms, the one or more parameters indicative of cellular response are selected from the group consisting of cell viability, cell proliferation, cell death, metabolic activity, gene expression, protein expression, and any combination thereof.
In some forms, one or more tumor suppressors that is generated in response to tumor antigens include both innate and adaptive responses such as generation of natural killer cells, macrophages, dendritic cells, cytotoxic T lymphocytes, helper T cells, and B cells, and also include production of cytokines and chemokine, immune surveillance, and immune memory.
In some forms, measuring of the one or more cellular responses or tumor suppressors is performed using one or more techniques such as flow cytometry, microscopy, gene expression analysis, quantitative polymerase chain reaction (qPCR) , enzyme-linked immunosorbent assay (ELISA) , mass spectrometry, and any combination thereof. Methods for screening test compounds are known in the art and further include but are not limited to scintillation proximity assays, Direct fluorescence measurement, Fluorescence polarization, Fluorescence resonance energy transfer (FRET) , Time-resolved fluorescence (TRF, HTRF, and TiRF) , AlphaScreen, Highcontent screening (HCS) , Protein fragment complementation assays (PCA) , microfluidics, and label-free technologies (reviewed in Janzen (2014) Chemistry and Biology, 21 (9) , pages 1162-1170) .
The present invention can be further understood by the following non-limiting examples.
3. Other uses
In some forms, the disclosed methods and compositions allow for the controlled expression of desired genes or antigens in liver cancer driven by c-Myc. The expression of desired genes is mediated by the delivery of the transposon vector containing doxycycline-inducible transcription construct via hydrodynamic injection to hepatocytes. With appropriate modifications, this vector can also be adapted for use in other oncogene-driven liver cancers such as expression of GTPase (RAS) , receptor tyrosine kinases (e.g., EGFR, HER2, MET, PDGFR, KIT, FGFR3, ALK, VEGFR and RET) , serine/therinine kinase (bRAF and AURORA Kinase) , tyrosine kinase (ABL) , and lipid kinase (PI3K) . Additionally, this vector can also be adapted for use in other normal hepatocytes, enabling the controllable expression of genes, sgRNAs, or shRNAs. In addition to temporal control of gene expression, gene transcription levels can be also controlled by administering a range of doxycycline in a dose-dependent manner.
E. KITS
The materials described above as well as other materials can be packaged together in any suitable combination as a kit useful for performing, or aiding in the performance of, the disclosed method. It is useful if the kit components in a given kit are designed and adapted for use together in the disclosed method.
Materials and reagents for preparing the model-generating system described above can be packaged together in any suitable combination as a kit useful for performing, or aiding in the performance of, the disclosed method. It is useful if the kit components in a given kit are designed and adapted for use together in the disclosed method.
In some forms, the kit can be cell culture kit containing materials and reagents for use in the generation and/or maintenance of the non-human animals. For example, the kit can contain a CRISPR-Cas expression vector, a transposon expression vector, a transposase expression vector.
In some forms, the kit can further include reagents to aid in the delivery of the vectors to the non-human animals e.g., primers for genotyping target liver cells such as primers for the Trp53 gene, Pten gene and primers for the c-Myc gene.
In some forms, the kits will include reagents for determining the viability and/or function of HCC tumor cells, e.g. in the presence/absence of a candidate agent, e.g. one or more antibodies that are specific for markers expressed by different types of target liver cells, or reagents for detecting particular molecules such as cytokines, etc.
Other reagents may include culture media, culture supplements, matrix compositions, and the like. In some forms, the one or more culture media may be a 1×formulation or a more concentrated formulation, for example, a 2× to 250× concentrated medium formulation. In a 1× formulation each ingredient in the medium is at the concentration intended for cell culture, for example a concentration set out above. In a concentrated formulation one or more of the ingredients is present at a higher concentration than intended for cell culture. Concentrated culture media are well known in the art, such as salt precipitation or selective filtration. A concentrated medium may be diluted for use with water (in certain forms, deionized and distilled) or any appropriate solution, for example, an aqueous saline solution, an aqueous buffer, or a culture medium.
The one or more media in the kit may be contained in hermetically sealed vessels which prevent contamination. Hermetically sealed vessels may be preferred for transport or storage of the culture media. The vessel may be any suitable vessel, such as a flask, a plate, a bottle, a jar, a vial, or a bag.
In addition to the above components, the kits may further include instructions for use. These instructions may be present in the kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc. Yet another means would be a computer readable medium, e.g., diskette, CD, etc., on which the information has been recorded. Yet another means that may be present is a website address which may be used via the internet to access the information at a removed site.
It is to be understood that the disclosed method and compositions are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
Examples
Methods
Mice. OT-II (B6. Cg-Tg (TcraTcrb) 425Cbn/J) , Act-mOVA (C57BL/6-Tg (CAG-OVAL) 916Jen/J) , and control C57BL/6J mice were all purchased from the Jackson Laboratory and bred in the animal facility at the Princess Margaret Cancer Centre. All animal experiments were approved by the University Health Network Animal Care Committee.
CRISPR and transposon vectors. sgRNAs targeting Trp53 and Pten were as previously described. The following guide oligos were designed to express (1) mouse Pten sgRNA: forward primer 5’-CACCGCTAACGATCTCTTTGATGA -3’ (SEQ ID NO: 1) and reverse primer 5’-AAACTCATCAAAGAGATCGTTAGC -3’ (SEQ ID NO: 2) ; and (2) mouse p53 sgRNA: forward primer 5’-CACCGCCTCGAGCTCCCTCTGAGCC -3’ (SEQ ID NO: 3) and reverse primer 5’-AAACGGCTCAGAGGGAGCTCGAGGC -3’ (SEQ ID NO: 4) . The annealed double-stranded guide oligos were cloned into the BbsI cut sites of pX330 vector. The p53 sgRNA cassette in pX330-p53 was amplified by PCR with primers 5’-GCTTCTAGACATGTGAGGGCCTATTTC -3’ (SEQ ID NO: 5) and 5’-TACAGCTAGCGCCATTTGTCTGCAGAATTGG -3’ (SEQ ID NO: 6) . This additional sgRNA cassette was then cut with NheI andXbaI and subcloned into NheI site of pX330-Pten to obtain the duplex CRISPR vector pX330-p53-Pten.
The transposon system with SB100X and pT2/BH was described previously. The mouse c-Myc CDS was cloned into pT2/BH with EcoR1 and NotI restriction enzymes to obtain the pT2-Myc plasmid.
For the pT2-OVA-P2A-Myc plasmid, a 660bp fragment of the cytosolic region (aa173-386, containing both MHC class I-and II-restricted epitopes) of the chicken ovalbumin (OVA) cDNA was amplified by PCR and engineered with a Kozak consensus methionine and EcoRI and NheI cloning sites using the following primers: OVA_ERI_U1 5'-GAATTCGCCGCCATGGTTCTGGTTAATGCCATTGTCTTC -3' (SEQ ID NO: 7) and OVA_Nhe1_L1 5'-GCTAGCAGGGGAAACACATCTGCCAAAGAAGAGAAC -3' (SEQ ID NO: 8) . A P2A self-cleaving 2A peptide cassette, flanked by a flexible GSG linker region, was then added in-frame to the 3' end of the OVA region using NheI and XhoI restriction sites. Finally, the mouse c-Myc cDNA was sublconed in-frame 3’ of the P2A cassette using the following PCR primers: Cmyc_XhoI_LE_U1 5'-CTCGAGCCCCTCAACGTGAACTTCACCAAC -3' (SEQ ID NO: 9) and Cmyc_BstB1_L1 5'-CAATTAGTTCGAAGTTTATGCACCAGAGTTACGAAGCTGTTCGAGTTTGTGTT TC -3' (SEQ ID NO: 10) . This primer set removed the mouse c-Myc start methionine and engineered an additional BstB1 site at the 3’ end of mouse c-Myc that allowed subcloning of the entire Kozak OVA-P2A-Myc cassette into the pT2/BH-CAG-GS-Myc plasmid using EcoRI and BstBI restriction enzyme cloning sites.
For the pT2-EF1a-rtTA-P2A-Myc+TRE-OVA plasmid, the entire ～1700bp CAG-CMV promoter and enhancer region in the pT2-OVA-P2A-Myc plasmid was removed and replaced with the 289bp human elongation factor 1 alpha (EF1α) core promoter to create the pT2-EF1a-OVA-P2A-Myc plasmid. The pT2-EF1a-OVA-P2A-Myc plasmid was then digested with EcoRI and NheI to remove the chicken ovalbumin (OVA) region and replace it with a reverse tetracycline-controlled Trans-Activator (rtTA) coding sequence (rtTA-Advanced) to create the pT2-EF1a-rtTA-P2A-Myc plasmid. TRE tight Promoter from pTRE-Tight caspase-3 (p12) : : nz [TU#817] (agift from Martin Chalfie, Addgene plasmid #16084) was subcloned upstream of the BGH 3’ UTR and PolyA signal of pcDNA3.1-Zeo (Invitrogen) via XhoI and EcoRI restriction sites to generate pcDNA3.1 (-) Zeo-TRE-BGHpA. Next, OVA cDNA was subcloned into pcDNA3.1 (-) Zeo-TRE-BGHpA using EcoRI and HindIII restriction sites to generate pcDNA3.1 (-) Zeo-TRE-OVA-BGHpA. The entire 1256 bp TRE-OVA-BGHpA fragment was PCR amplified using the following primers: BGHpA_IF_Fwd: 5’-CCTGCAGCCCAAGCTTGTTCTTTCCGCCTCAGAAGCC -3’ (SEQ ID NO: 11) and TRE_IF_Rev: 5’-AGCCTTCCACAAGCTTCTCGAGTTTACTCCCTATCAGTG -3’ (SEQ ID NO: 12) . The amplified fragment was then cloned in the reverse “trans” orientation into HindIII linearized pT2-EF1a-rtTA-P2A-Myc plasmid using (Takara Bio USA) , generating the final pT2-EF1a-rtTA-P2A-Myc+TRE-OVA plasmid.
Gene delivery to hepatocytes via hydrodynamic injections. For delivery of transposon and CRISPR vectors, mice (8-20 weeks old) were injected with a volume of 100 ml/kg body weight containing 25 μg pX330-p53-Pten (or its modified form) plus 0.66 μg SB100X and 5 μg pT2-EF1a-rtTA-P2A-Myc+TRE-OVA. The molar ratio of SB100X to pT2-EF1a-rtTA-P2A-Myc+TRE-OVA was 1: 5. Hydrodynamic injection into the lateral tail vein took 5-7 seconds. Blinding was achieved during injection by putting littermates of different genotypes into new cages lacking mouse information.
To evaluate and quantify HCC development, mice were monitored daily for the appearance of palpable tumors, which were defined as a discernable enlargement of the abdomen. To induce the OVA expression in HCC, when mice showed a discernable enlargement of the abdomen, they received doxycycline (Sigma) -containing drinking water (600 mg/L) for 15 days, followed by euthanasia and FACS analysis of liver cells.
Hepatic mononuclear cell isolation. Mice were euthanized by CO₂asphyxiation and immediately subjected to whole-body perfusion with ice cold PBS containing 10 mM EDTA. Liver tissues were collected, disrupted, and passed through 70-μm sieves to obtain single-cell suspensions. Mononuclear cells (MNCs) were enriched by centrifugation through a 40/80%Percoll gradient for 20 min at 2000 rpm.
Flow cytometry. Antibodies and tetramers used to stain hepatic MNCs included anti-mouse CD4 BUV737, anti-mouse CD8 PerCP-Cy5.5, anti-mouse CD45 Alexa Fluor 700, anti-mouse CD19 BUV395, anti-mouse NK1.1 BV605, anti-mouse CD11b BV510, TCRvβ5.1/5.2 PE-Cy7, anti-mouse PD-1 APC (all from BioLegend) ; anti-mouse FOXP3 (clone FJK-16S) PE from Thermo Fisher; and mouse CD1d PBS-57 BV421-labeled tetramer from the NIH Tetramer Facility.
For staining of transcription factors, the eBioscience Foxp3/Transcription Factor Staining Buffer Set was used following the manufacturer’s instructions.
Flow cytometric analyses were carried out using BD LSRFortessa cell analyzers at the Princess Margaret Flow Facility.
Immunohistological analyses. Sections cut from formalin-fixed, paraffin-embedded (FFPE) blocks of mouse livers were used for immunohistochemistry (IHC) . After dewaxing and rehydration, endogenous peroxidase was deactivated in 3%H₂O₂ (20 ml 30%H₂O₂ + 180 ml PBS) for 15 min at RT. Antigen retrieval with 10 mM sodium citrate buffer (pH 6.0) was performed prior to immunostaining.
Primary antibody used for IHC is rabbit anti-Ovalbumin (Rockland (Cedarlane) , 200-401-033S) . Polymer-conjugated secondary antibody is HRP horse anti-rabbit IgG (MP-7405) from Vector Laboratories.
Immunostained histological sections were scanned using a NanoZoomer 2.0-HT slide scanner from Hamamatsu.
Results
Induction of HCC using CRISPR and transposon technology
The inventors sought to model HCC in mice by combining genetic alterations recurrently observed in the human disease. These changes included mutation of the TP53 and PTEN tumor suppressor genes and overexpression of the MYC oncogene. TP53 is commonly altered in human liver cancer, whereas PTEN protein is reduced or absent in about 40%of HCC patients. Hepatocyte-specific deletion ofPten in mice similarly leads to HCC development. Chromosomal amplifications involving MYC are among the most frequent DNA copy number changes in human HCC, and activation of MYC transcription is a central signature associated with the conversion of preneoplastic lesions to HCC.
With respect to the engineering of the above mutations, CRISPR-mediated somatic knockout of tumor suppressor genes, as well as transposon-based expression of oncogenes, have been shown to induce HCC in mice. To mimic the multi-stage and multi-hit process of human liver carcinogenesis, the inventors combined these two approaches by ablating Trp53 and Pten using CRISPR, and over-expressing Myc using a transposon vector. To this end, the inventors generated a duplex CRISPR vector with guide RNAs targeting the second exon of Trp53 and first exon ofPten, and a Sleeping Beauty transposon vector in which the Myc coding sequence was driven by a CAG promoter (Fig. 1A) . A combination of these vectors was delivered to mice via hydrodynamic injection, allowing for specific plasmid delivery to hepatocytes. Due to a synergistic effect between Myc expression and combined Trp53 and Pten ablation, the inventors observed rapid development of HCC in injected mice. Neoplasms were visible on the liver surface by 15 days post-injection, and by day 25, significant tumor nodules were present (Fig. 1B) . Immunostaining confirmed that the majority of these tumor clones were negative for p53 and PTEN and positive for MYC (Figs. 1C-1D) .
Optimizing the design of a transposon vector for simultaneous inducible OVA expression and constitutive Myc expression
In some forms, the disclosed methods and compositions combine a doxycycline-inducible gene expression system with a Sleeping Beauty transposon vector and hydrodynamic injection to enable the integration of a controllable gene expression system into the genome of hepatocytes. In one of the embodiments, the inventors aimed to achieve controllable expression of tumor antigens in hepatocellular carcinoma (HCC) in mice by combining ablating Trp53 and Pten using CRISPR. The inventors used chicken ovalbumin (OVA) to mimic a tumor antigen and devised a Sleeping Beauty transposon vector allowing the inducible expression of cytosolic OVA with constitutive expression of oncogene Myc (Fig. 2) . In this vector design, the inventors used a strong promoter EF1α to drive the expression of rtTA-Advanced, a modified version of the reverse tetracycline-controlled transactivator (rtTA) protein (Fig. 2) . When doxycycline is added to the system, it binds to the rtTA-Advanced protein and causes it to undergo a conformational change, allowing it to bind to the tetracycline-responsive promoter and activate transcription of the target gene. When the inducer is removed, the rtTA-Advanced protein reverts back to its original conformation and the target gene expression is turned off. The inventors co-expressed c-Myc with rtTA-Advanced by placing the P2A self-cleaving peptide sequence between the coding regions of these two proteins. In this same vector, the inventors use TRE (tetracycline-responsive element) tight promoter to control the expression of OVA (Fig. 2) . The TRE promoter is a minimal promoter that contains multiple copies of a tetracycline-responsive element, which is recognized by the tTA protein. When tetracycline or its analogs are absent, the tTA protein is unable to bind to the TRE promoter and gene expression is repressed. However, when tetracycline or its analogs are present, the tTA protein undergoes a conformational change that allows it to bind to the TRE promoter, activating gene expression. By utilizing the reverse "trans" orientation of the tetracycline response element (TRE) and the gene driven by TRE, this method effectively prevents leaky transcription caused by remote promoters, ensuring that the gene expression is tightly controlled (Fig. 2) .
An HCC model with inducible OVA expression
To achieve controllable expression of tumor antigens in HCC in mice, the inventors utilized the transposon vector for simultaneous inducible OVA expression and constitutive Myc expression, along with a CRISPR vector for ablating Trp53 and Pten (Fig. 3A) . This was delivered to hepatocytes via hydrodynamic injection (Fig. 3A) . When HCCs were palpable, doxycycline (Dox) was administered to these mice through their drinking water to induce OVA expression. The inventors then collected the liver tissues from mice treated with Dox but without HCC induction, Act-mOVA transgenic mice (as positive control) , and mice subjected to inducible OVA-HCC with Dox treatment. By immunohistochemistry analysis, OVA expression was revealed on liver section from Act-mOVA transgenic mice and the tumor regions of inducible OVA-HCC with Dox treatment, but not on liver sections from mice receiving Dox without HCC induction (Figs. 3C-3E) . Therefore, this model provides a specific and efficient means of expressing tumor antigens in a controllable manner.
Inducible tumor antigen triggers TCR-specific T cell immune responses in HCC
To determine the role of the tumor antigens in the induction of T cell immune responses in the HCC model described herein, the inventors used transgenic OT-II mice expressing an OVA-specific TCR. The inventors introduced the transposon vector for simultaneous inducible OVA expression and constitutive Myc expression, alongside the CRISPR Trp53/Pten deletion vector into OT-II mice (Fig. 4A) . OT-II mice are a commonly used mouse strain in immunology research. These mice are genetically engineered to express a T cell receptor (TCR) that recognizes an OVA peptide presented on major histocompatibility complex (MHC) class II molecules. This makes them a useful tool for studying CD4 T cell responses to OVA antigens. When HCCs were palpable, doxycycline (Dox) was administered to these mice through their drinking water to induce OVA expression (Fig. 4B) . When the inventors compared CD4⁺ T cells in Dox-treated and untreated mice, the inventors found that about 15%of OVA-specific (TCR Vβ5⁺) CD4⁺ T cells were Foxp3⁺ regulatory T cells upon the induction of OVA expression in HCCs (Fig. 4C-4E) . In the untreated mice, only about 2%of TCR Vβ5⁺CD4⁺ T cells expressed Foxp3, comparable to the percentage in OT-II mice bearing OVA-negative HCC (Fig. 4C) . Interestingly, the inventors also observed an elevation in the percentage of Foxp3⁺ Tregs among CD4⁺ T cells carrying natural TCRs (TCR Vβ5^-) (Fig. 4C-4E) , suggesting that Chat expression in T cells can also be induced through “antigen spreading” .
The inventors then investigated the characteristics of Foxp3^-OVA-specific conventional T cells (Tconvs) in the HCC model with inducible OVA expression. PD-1 expression is induced on T cells following antigen recognition and activation. PD-1 was highly expressed by these OVA-specific Tconvs and about 60%of these cells were PD-1⁺(Fig. 4F-4H) . In contrast, in the untreated mice and OT-II mice bearing OVA-negative HCC, only about 2%of TCR Vβ5⁺CD4⁺ T cells expressed PD-1. Taken together, these data confirm that the induced tumor antigen are capable of inducing Tregs and PD-1⁺Tconvs, and highlight the potential of inducible gene expression approach can be utilized for preclinical investigations into cancer immunotherapy.
Discussion
There are various methods for achieving controllable gene expression in vivo. These include generating transgenic animals that express the inducible promoter and gene of interest either ubiquitously or in a tissue-specific manner. Alternatively, viral vectors like adenovirus or lentivirus can deliver the inducible promoter and gene of interest directly to target tissues or cells in vivo. Non-viral methods like electroporation or lipid-based transfection can also be used to introduce the inducible promoter and gene of interest to target cells or tissues in vivo, albeit with lower efficiency compared to viral vectors.
The delivery of the transposon vector containing doxycycline-inducible transcription construct via hydrodynamic injection to hepatocytes was discovered to provide gene delivery with high efficiency and specificity. As a non-viral method, it offers the advantage of lower immunogenicity and toxicity.
In addition, the design of the controllable transcription system has several advantages. The rtTA is co-expressed with oncogenes, such as c-Myc, to ensure inducible gene expression occurs in all affected tumorous cells. The rtTA is expressed prior to c-Myc to ensure that the inducible gene expression is activated in all tumorous cells. This new approach ensures that the gene expression is precisely targeted, specifically induced, and maximally effective in treating liver cancer. To prevent the leaky transcription caused by remote promoters, the fragment containing the rtTA and the gene driven by TRE were cloned in the reverse "trans" orientation in the vector. This innovative solution prevents the leaky transcription caused by remote promoters, ensuring that the inducible gene expression is precisely controlled.
The disclosed methods and compositions were developed to allow for the controlled expression of desired genes or antigens in liver cancer driven by c-Myc. With appropriate modifications, this vector can also be adapted for use in other oncogene-driven liver cancers or normal hepatocytes, enabling the controllable expression of genes, sgRNAs, or shRNAs. In addition to temporal control of gene expression, it is theoretically possible to control gene transcription levels by administering a range of doxycycline. This is essential for gene dosage-dependent studies and investigating tumor antigen abundance in immunotherapy responsiveness.
Overall, this system offers high delivery efficiency and specificity through the hydrodynamic injection of transposon vectors containing doxycycline-inducible transcription constructs to hepatocytes. It enables the controllable expression of desired genes or antigens, with potential for adaptation to oncogene-driven liver cancers or normal hepatocytes.
It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these can vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
Throughout the description and claims of this specification, the word “comprise” and variations of the word, such as “comprising” and “comprises, ” means “including but not limited to, ” and is not intended to exclude, for example, other additives, components, integers or steps.
“Optional” or “optionally” means that the subsequently described event, circumstance, or material may or may not occur or be present, and that the description includes instances where the event, circumstance, or material occurs or is present and instances where it does not occur or is not present.
Unless the context clearly indicates otherwise, use of the word “can” indicates an option or capability of the object or condition referred to. Generally, use of “can” in this way is meant to positively state the option or capability while also leaving open that the option or capability could be absent in other forms or embodiments of the object or condition referred to. Unless the context clearly indicates otherwise, use of the word “may” indicates an option or capability of the object or condition referred to. Generally, use of “may” in this way is meant to positively state the option or capability while also leaving open that the option or capability could be absent in other forms or embodiments of the object or condition referred to. Unless the context clearly indicates otherwise, use of “may” herein does not refer to an unknown or doubtful feature of an object or condition.
Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range from the one particular value and/or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent “about, ” it will be understood that the particular value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise. It should be understood that all of the individual values and sub-ranges of values contained within an explicitly disclosed range are also specifically contemplated and should be considered disclosed unless the context specifically indicates otherwise. Finally, it should be understood that all ranges refer both to the recited range as a range and as a collection of individual numbers from and including the first endpoint to and including the second endpoint. In the latter case, it should be understood that any of the individual numbers can be selected as one form of the quantity, value, or feature to which the range refers. In this way, a range describes a set of numbers or values from and including the first endpoint to and including the second endpoint from which a single member of the set (i.e. a single number) can be selected as the quantity, value, or feature to which the range refers. The foregoing applies regardless of whether in particular cases some or all of these embodiments are explicitly disclosed.
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed method and compositions belong. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present method and compositions, the particularly useful methods, devices, and materials are as described. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. No admission is made that any reference constitutes prior art. The discussion of references states what their authors assert, and applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of publications are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

A composition comprising a nucleic acid transposon vector, wherein the vector comprises:

(a) a first expression segment, wherein the first expression segment comprises:

(i) a promoter;

(ii) a first expression sequence encoding a reverse tetracycline-controlled transactivator (rtTA) protein;

(iii) a second sequence encoding a self-cleaving peptide;

(iv) a third expression sequence encoding an oncogene; and

(b) a second expression segment, wherein the second expression segment comprises a fourth expression sequence encoding a test gene;

wherein expression of the first expression sequence is under the control of the promoter, wherein the second sequence and the third expression sequence are co-expressed with the first expression sequence, wherein the second sequence is between the first expression sequence and the third expression sequence, wherein the first expression segment and the second expression segment are in reverse trans orientation in the vector, wherein expression of the fourth expression sequence is the under the control of a tetracycline-responsive element (TRE) , and wherein the rtTA protein induces expression of the fourth expression sequence in the presence of an rtTA inducer.
The composition of claim 1, wherein the nucleic acid transposon vector is a sleeping beauty transposon vector.
The composition of claim 1 or 2, wherein the promoter is a constitutive promoter.
The composition of any one of claims 1-3, wherein the promoter is an EF1αpromoter, SV40 promoter, CMV promoter, UBC promoter, PGK promoter, CAGG promoter, or Alb promoter.
The composition of any one of claims 1-4, wherein the rtTA protein is the rtTA-Advanced protein.
The composition of any one of claims 1-5, wherein the self-cleaving peptide is any one of P2A, E2A, F2A, or T2A.
The composition of any one of claims 1-6, wherein the oncogene is c-Myc, CCND1, c-met, Yap, activated Akt (Akt1) , mutated CTNNB1, TERT, H-Ras^V12, SV40 large T antigen, or Nras (G12V) .
The composition of any one of claims 1-7, wherein the test gene is the chicken ovalbumin (OVA) .
The composition of any one of claims 1-7, wherein the test gene is a tumor antigen.
The composition of any one of claims 1-9, wherein the test gene encodes one or more sgRNAs, shRNAs, or combinations thereof.
The composition of claim 10, wherein the expression of the one or more sgRNAs, shRNAs, or combinations thereof is under the control of an H1-202 promoter.
A method comprising administering the composition of any one of claims 1-11 and one or more gene deletion effectors into hepatocytes of a non-human subject via hydrodynamic injection.
The method of claim 12, wherein, following administration, the vector is integrated into the genome of the hepatocytes.
The method of claim 12 or 13, wherein one or more of the gene deletion effectors targets one or more tumor suppressor genes for deletion.
The method of claim 14, wherein the tumor suppressor genes comprise one or more of the Trp53 gene, the AXIN1 gene, the APC gene, the ARID1A gene, the ARID2 gene, the KEAP1 gene, and the Pten gene.
The method of any one of claims 12-15, wherein the gene deletion effectors comprise one or more CRISPR systems, one or more TALENs, one or more Zinc Finger Nucleases, or combinations thereof.
The method of claim 16, wherein the CRISPR systems comprise one or more guide RNAs targeting one or more tumor suppressor genes for deletion.
The method of any one of claims 12-17, wherein the non-human subject is a wild-type mouse or gene-modified mouse.
The method of any one of claims 12-18, wherein, following administration, liver cancer is induced in the non-human subject, thereby forming a tumor model.
The method of claim 19, wherein the liver cancer is hepatocellular carcinoma (HCC) .
The method of any one of claims 12-20, wherein expression of the fourth expression sequence is induced by administering to the non-human subject tetracycline or doxycycline.
The method of any one of claims 12-21, wherein expression of the fourth expression sequence causes an immune response in the non-human subject against the expression product of the test gene.
A method of treating liver cancer in a human subject, the method comprising treating the human subject with a therapy to cause in the human subject the immune response caused in the non-human subject of claim 22.