EP4720296A2 - Antisense oligonucleotides for rett syndrome - Google Patents
Antisense oligonucleotides for rett syndromeInfo
- Publication number
- EP4720296A2 EP4720296A2 EP24816609.2A EP24816609A EP4720296A2 EP 4720296 A2 EP4720296 A2 EP 4720296A2 EP 24816609 A EP24816609 A EP 24816609A EP 4720296 A2 EP4720296 A2 EP 4720296A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- aso
- mecp2
- mrna
- protein
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3233—Morpholino-type ring
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/33—Alteration of splicing
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Public Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Aspects of the disclosure relate to the discovery that exon skipping in the MeCP2 gene can lead to a therapeutically relevant increase in MeCP2 protein, including an increase in the E1 isoform of MeCP2. Exon skipping can be achieved through antisense oligonucleotides that may be chemically modified.
Description
Docket No. BAYM.P0393WO ANTISENSE OLIGONUCLEOTIDES FOR RETT SYNDROME [0001] This application claims priority of U.S. Provisional Application No. 63/505667 filed June 1, 2023, which is hereby incorporated by reference in its entirety. BACKGROUND I. Field of the Invention [0002] This disclosure relates at least to the fields of neurology, molecular biology, and medicine. II. Background [0003] Rett syndrome (RTT) is an X-linked postnatal neurological disorder that affects ~1 in 10,000 female births. Mutations in the MECP2 gene account for 95% of RTT cases.1 MECP2 encodes methyl-CpG binding protein 2 (MeCP2), a transcriptional regulator that binds to methylated cytosines and is essential for postnatal neuronal function. Research on mouse models showed that either a decrease or an increase in MeCP2 protein level leads to neurological deficits similar to those seen in RTT and MECP2-duplication syndrome (MDS) patients, respectively. This suggests that maintaining wild-type level of MeCP2 is critical for normal neurological function. While there is currently no effective treatment for RTT, restoring MeCP2 protein level by reactivating endogenous Mecp2 expression rescues the RTT-like phenotypes observed in a Mecp2-conditionally null mouse model.2 Similarly, increasing mutant MeCP2 level by introduction of a Mecp2 transgene carrying a hypomorphic missense mutation, T158M (recurrent in RTT patients) in T158M-knock-in mice was able to rescue the RTT-like phenotypes observed in these mice.3 MECP2 encodes two alternatively spliced isoforms: MECP2-e1 (e1) which includes exons 1,3 and 4 and MECP2-e2 (e2) which includes all four exons of the gene. These two mRNA isoforms are translated into E1 and E2 proteins respectively. [0004] mRNA and protein expression studies in mice revealed that e1 and e2 mRNA levels are comparably expressed in the brain, but the level of MeCP2-E1 (E1) protein is significantly higher than MeCP2-E2 (E2) protein, indicating that in the brain, e1 is more efficiently translated than e2.4 So far there have been no mutations identified in exon 2 (unique to e2) in RTT patients, and mouse studies have shown that deletion of
caused placental defects 201638021.3 - 1 -
Docket No. BAYM.P0393WO decreasing the viability of e2-null embryos but did not cause RTT-like phenotypes or other neurological deficits in mice. This indicates that E2 is dispensable for postnatal neuronal function of MeCP2.5 [0005] Thus there is a need to explore and develop strategies, including through isoform switching, to increase MeCP2 protein level in RTT patients as a treatment approach. BRIEF SUMMARY [0006] In general, the current disclosure relates to the discovery that skipping exon 2 of the MECP2 gene leads to a therapeutically relevant increase of protein produced from mature MECP2 mRNA, including in cells that harbor MECP2 mutations. In particular, the inventors have determined that exon skipping can produce an amount of the MeCP2-E1 isoform needed to ameliorate electrophysiological and molecular defects resulting from mutations in the MECP2 gene. The desired increase in protein can alleviate issues related to Rett syndrome. [0007] Certain aspects relate to antisense oligonucleotides (ASOs) complementary to an MECP2 gene and/or gene product. The ASOs can be complementary to at least one region of an MECP2 pre-mRNA. The region may be a binding site for one or more proteins involved in splicing. The region may comprise a motif for one or more proteins involved in splicing. In some aspects, the binding occurs at a splice site on the MECP2 pre-mRNA. The splice site may be a splice site between exon 1 and intron 1, intron 1 and exon 2, exon 2 and intron 2 and/or intron 2 and exon 3 of the MECP2 pre-mRNA. [0008] In some aspects, the ASO has 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 (or any range derivable therein) nucleotides. In some aspects, the ASO has at least 88%, 92%, 94%, 96%, or 100% sequence identity to AAGGAAGGTTACTTACCTGAGCCCT (SEQ ID NO: 1). In some aspects, the ASO has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more (or any range derivable therein) nucleotides inserted, contiguously or separately, into the sequence of SEQ ID NO: 1. The insertions may be on the 5’ and/or 3’ end of the sequence, and/or be inserted within the sequence. In some aspects, the ASO has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more (or any range derivable therein) mutations to the SEQ ID NO: 1 sequence. In some aspects, the ASO has 1, 2,34, 5, 6, 7, 8, 910, or more (or any range derivable therein) deletions to the SEQ ID NO: 1 sequence. In some aspects, the ASO comprises non-natural nucleotides. In some aspects, the ASO comprises non-natural nucleotides linkages. The ASO may comprise at least one methylenemorpholine moiety. In certain aspects, the ASO comprises at least one phosphorodiamidate moiety. In certain aspects, the ASO comprises at least one morpholino 201638021.3 - 2 -
Docket No. BAYM.P0393WO linkage. In some aspects, the ASO comprises at least one 2’O methyl RNA base and/or at least one phosphorothioate moiety. In some aspects, the ASO comprises at least one or more combinations of the above mentioned modifications. In certain aspects, the ASO contains a modified sugar, modified sugar linkage, 2’ substitution, modified base, and/or conjugate. The modified sugar and/or sugar linkage may be non-natural. Examples of modifications to the ASO can be found in Crooke, et al., Nature Reviews | Drug Discovery vol.20 p.427-453, which is incorporated by reference herein in its entirety. In certain aspects, the modified nucleotide is a 2′-deoxyribonucleotide. In certain aspects, the 2′-deoxyribonucleotide is 2′-deoxyadenosine or 2′-deoxyguanosine. In some aspects the modified nucleotide is a 2′-O-methyl (e.g., 2′-O- methylcytidine, 2′-O-methylpseudouridine, 2′-O-methylguanosine, 2′-O-methyluridine, 2′-O- methyladenosine, 2′-O-methyl) ribonucleotide. In certain aspects, the modified nucleotide is selected from the group consisting of a 2′-fluoro, 2′-amino and 2′-thio modified ribonucleotide. In some aspects, the modified nucleotide is selected from the group consisting of 2′-fluoro- cytidine, 2′-fluoro-uridine, 2′-fluoro-adenosine, 2′-fluoro-guanosine, 2′-amino-cytidine, 2′- amino-uridine, 2′-amino-adenosine, 2′-amino-guanosine and 2′-amino-butyryl-pyrene-uridine. In some aspects, the modified nucleotide is selected from the group consisting of 5-bromo- uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 5-fluoro-cytidine, and 5-fluoro-uridine, 2,6-diaminopurine, 4-thio-uridine, and 5-amino-allyl-uridine. In some aspects, the modified nucleotide is a backbone-modified nucleotide. In some aspects, the backbone-modified nucleotide contains a phosphorothioate group. In another embodiment, the modified nucleotide is a locked nucleic acid (LNA). [0009] The ASO may comprise one or more delivery moieties. A delivery moiety may increase the ability of the ASO to survive in vivo conditions. A delivery moiety may increase the ability of the ASO to cross the blood-brain barrier. A delivery moiety may increase the ability of the ASO to penetrate a cell membrane. In some aspects, the delivery moiety comprises an octa-guanidine dendrimer. [0010] Certain aspects relate to pharmaceutical compositions comprising any of the ASOs described herein. The pharmaceutical composition may also comprise an excipient. [0011] Certain aspects relate to methods including treating a neurological disorder in an individual, reducing the severity of a neurological disorder in an individual, preventing a neurological disorder in an individual, or improving the quality of life in an individual diagnosed with or suspected of having a neurological disorder. In some aspects, the method comprises 1, 2, 3, 4, or more of any of the following steps: administering an effective amount of an ASO, including any ASO described herein to the individual, administering an effective 201638021.3 - 3 -
Docket No. BAYM.P0393WO amount of a pharmaceutical composition, including any pharmaceutical composition described herein, to the individual, administering an additional therapeutic composition to the individual, monitoring the individual for disease progression, and/or measuring neurological changes in the individual. In certain aspects, the neurological disorder is Rett syndrome. In some aspects, the individual has a genetic defect. In some aspects, the individual has a genetic defect associated with Rett syndrome. In some aspects, the individual has a mutation in the MECP2 gene, which may be a hypomorphic missense mutation such as T158M, R113C, R306C, A140V, or any other hypomorphic missense or nonsense mutation, as well as mutations that might decrease the level of MeCP2 whether in the coding sequence of the protein or outside the coding sequence, in the 5’ or 3’ untranslated regions flanking the protein coding sequence. In some aspects, the effective amount is an amount sufficient to increase MeCP2-E1 protein in a cell, such as a neuron, in the individual. The increase in MeCP2-E1 protein may be an increase sufficient to treat the individual and/or reverse deleterious effects of a genetic defect in the individual. The increase in MeCP2-E1 protein may be an increase of approximately or at least 50%, 60%, 70%, 80%, 90%, 100%, 110%, or 120% increase compared to a reference level. The reference level may be a level in the cell before administering the ASO. The reference level may be a level in a cell, such as a neuron, in an individual diagnosed with Rett syndrome or neurological disease due to partial loss of MeCP2 function. [0012] In some aspects, an ASO is administered to an individual. In some aspects, one or more of the ASOs described herein are administered to an individual. The ASO may be administered in any suitable manner, including by spinal tap. The ASO may be administered to the cisterna magna of the individual. The ASO may be administered to the spinal canal of the individual. The ASO may be administered to the cerebrospinal fluid of the individual. The ASO may be administered by epidural administration. [0013] Certain aspects relate to methods including increasing skipping of exon 2 in an MECP2 pre-mRNA, increasing MeCP2 protein levels in a cell, increasing MeCP2-E1 isoform in a cell, decreasing MeCP2-E2 isoform in a cell, blocking the inclusion of exon 2 in an MECP2 pre-mRNA, and/or increasing the ratio of MeCP2-E1 to MeCP2-E2 isoform in a cell. The method may comprise 1, 2, 3, 4, or more of any of the following steps: contacting the MECP2 pre-mRNA with an effective amount of an ASO, including one or more ASOs described herein, introducing an effective amount of an ASO, including one or more ASOs described herein, to a cell, including any cell described herein, and/or modifying an MECP2 gene or MECP2 gene product in a cell. In some aspects, the cell is a neuron. The effective amount may be an amount sufficient to increase MeCP2-E1 protein in the cell. In some aspects, the increase in MeCP2- 201638021.3 - 4 -
Docket No. BAYM.P0393WO E1 protein is an approximately 50%, 60%, 70%, 80%, 90%, 100%, 110%, or 120% increase compared to a reference level, which may be a level in the cell before administering the ASO and/or modifying the gene. [0014] The modifying of the MECP2 gene or MECP2 gene product in the cell can comprise DNA-editing and/or RNA editing. The DNA editing can comprise CRISPR-based editing, including PRIME editing. In some aspects, the CRISPR-based editing comprises the use of, Cas9, Cas12, Cas13, and/or analogs, enzymatically inactive forms, and/or derivatives thereof. Examples of the use of CRISPR-based editing can be found in U.S. Pat. No. 11,649,444 and Anzalone et al., Nature Biotechnology vol.38 pp.824–844, both of which are incorporated by reference herein in its entirety. In some aspects, the modifying comprises DNA editing and/or RNA editing to remove a splice site in the MECP2 gene. The splice site may be a splice site between exon 1 and intron 1,intron 1 and exon 2, exon 2 and intron 2 and/or intron 2 and exon 3 of the MECP2 gene. The modifying can comprise any gene-editing techniques capable of removing the splice site. In some aspects, the splice site is removed by deletion, mutation, or any other modification capable of changing the splicing characteristics of the pre-mRNA of MECP2. In some aspects, the modifying comprises the use of nucleases. In some aspects, the modifying comprises the use of transposases. In some aspects, the modifying comprises the use of recombinases. In some aspects, the modifying comprises the use of base editors. [0015] The term “one contiguous region,” as used herein, refers to a contiguous, unique region in a nucleic acid sequence, including a pre-mRNA. In other aspects, there are contiguous regions in the pre-mRNA that are repeated, including those that are complementary to binding sites of previously known ASOs. [0016] Throughout this application, the term “about” is used according to its plain and ordinary meaning in the area of cell and molecular biology to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value. [0017] As used herein, “isolated” means altered or removed from the natural state through human intervention. For example, an ASO, naturally present in a living animal is not “isolated,” but a synthetic ASO, or an ASO partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated ASO can exist in substantially purified form, or can exist in a non-native environment such as, for example, a cell into which the ASO has been delivered. [0018] As used herein, the terms “therapeutic composition,” “pharmaceutical composition,” “therapeutic agent” and “pharmaceutical agent” may be used interchangeably and refer to a composition that is used therapeutically to affect a response in a patient. 201638021.3 - 5 -
Docket No. BAYM.P0393WO [0019] The use of the word “a” or “an” when used in conjunction with the term “comprising” may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” Any term used in singular form also comprises plural forms and vice versa. [0020] As used herein, the terms “or” and “and/or” are utilized to describe multiple components in combination or exclusive of one another. For example, “x, y, and/or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.” It is specifically contemplated that x, y, or z may be specifically excluded from an aspect or aspect. [0021] The words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”), “characterized by” (and any form of including, such as “characterized as”), or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. [0022] The compositions and methods for their use can “comprise,” “consist essentially of,” or “consist of” any of the ingredients or steps disclosed throughout the specification. The phrase “consisting of” excludes any element, step, or ingredient not specified. The phrase “consisting essentially of” limits the scope of described subject matter to the specified materials or steps and those that do not materially affect its basic and novel characteristics. It is contemplated that embodiments and aspects described in the context of the term “comprising” may also be implemented in the context of the term “consisting of” or “consisting essentially of.” [0023] It is contemplated that any aspect discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention. [0024] Any method in the context of a therapeutic, diagnostic, or physiologic purpose or effect may also be described in “use” claim language such as “Use of” any compound, composition, or agent discussed herein for achieving or implementing a described therapeutic, diagnostic, or physiologic purpose or effect. [0025] Use of the one or more sequences or compositions may be employed based on any of the methods described herein. Other aspects and embodiments are discussed throughout this application. Any embodiment or aspect discussed with respect to one aspect of the disclosure applies to other aspects of the disclosure as well and vice versa. 201638021.3 - 6 -
Docket No. BAYM.P0393WO [0026] It is specifically contemplated that any limitation discussed with respect to one embodiment or aspect of the invention may apply to any other embodiment or aspect of the invention. Furthermore, any composition of the invention may be used in any method of the invention, and any method of the invention may be used to produce or to utilize any composition of the invention. Aspects of an embodiment set forth in the Examples are also aspects that may be implemented in the context of aspects discussed elsewhere in a different Example or elsewhere in the application, such as in the Brief Summary, Brief Description of the Drawings, Detailed Description, and Claims. [0027] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific aspects of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS [0028] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific aspects presented herein. [0029] FIGs. 1A-1G show the alternatively spliced isoforms of MECP2-e1 and -e2 have different translational efficiencies in the (mouse and human) brain and deletion of exon 2 upregulates MeCP2 protein level in the mouse brain. (A) The MECP2 DNA contains 4 exons that are alternatively spliced into e1 (in purple - exons 1, 3 and 4) and e2 (in orange – exons 1, 2, 3 and 4). These two isoforms are translated into E1 and E2 proteins that have 498 and 486 amino acids respectively and differ only in their N-terminal sequence (B) e1 and e2 mRNA isoforms are expressed at comparabl levels in the mouse cortex (n=3) as measured by qRT- PCR (left) and the E2 protein level is significantly lower than the E1 protein as measured by Western blot (right) (C) In the human prefrontal cortex of males and females, the level of e1 mRNA is ~60% of the total MECP2 mRNA and the e2 is ~40% based on the absolute concentrations of these mRNAs quantified by standard curve qRT-PCR (left), the level of E2 protein is significantly lower than the E1 protein as measured by Western blot (middle) and the protein to mRNA ratio of MeCP2-E1 is significantly higher than that of MeCP2-E2 indicating 201638021.3 - 7 -
Docket No. BAYM.P0393WO higher translational efficiency of E1 compared to E2 (right) (D) CRISPR/Cas9 using gRNAs flanking exon 2 of Mecp2 to delete exon 2 in mouse; all analyses of the exon2 knockout (E2KO) were performed in male mice at 10-11 weeks of age (E) The level of e1 and e2 mRNA in wild-type (WT) (n=4) and E2KO (n=6) mice cortex show abolishing of the e2 isoform in the E2KO mice and a concomitant upregulation of the e1 mRNA level as measured by standard curve qRT-PCR (left) and the total MeCP2 protein level is increased by ~50-60% in the E2KO mice cortex relative to WT mice as measured by Western blot (right) (F) The E2KO mice display less number of entries into open arms (left) and increased time spent in the closed arms (right) compared to the WT mice in an elevated plus maze indicating an increased anxiety phenotype (G) The E2KO mice also display reduced rearing episodes in the open field assay compared to WT mice. For both behavior assays (F&G), WT mice n= 12, E2KO mice n=19. [0030] FIGs. 2A-2D show isoform switching in RTT iPSC-derived neurons (iNeurons) upregulates mutant MeCP2 protein to a level comparable to that of isogenic control iNeurons. (A) A representation of the G118E missense mutation location on the MECP2 gene (top) and the MeCP2 protein (bottom) (B) A representation of the generation of isogenic control and G118E-E2KO iPSCs from patient fibroblasts and the process of deriving iNeurons from these iPSCs through NGN2-driven induction (C) MeCP2 and GAPDH protein level in Isogenic control, G118E and G118E-E2KO iNeurons (n= 2 clones per genotype, 4 replicates per clone) on Western blot (D) Quantification of the MeCP2 protein level in Isogenic control, G118E and G118E-E2KO iNeurons normalized to GAPDH shows reduction in MeCP2 level in the G118E iNeurons relative to the isogenic control iNeurons and a significant upregulation of this in the G118E-E2KO iNeurons relative to the G118E iNeurons. [0031] FIGs. 3A-3C show upregulation of mutant MeCP2 by isoform switching significantly improves electrophysiologic deficits in the Rett iNeurons. (A) An overview of the culturing, patching and recording of electrophysiological properties of the iNeurons (B) Charge (a measure of spontaneous activity) of the G118E iNeurons is significantly lower than the isogenic control iNeurons and this deficit is partially rescued in the G118E-E2KO iNeurons (C) Left – Representative traces of action potentials from the G118E (left- top), Isogenic control (left-middle) and G118E-E2KO (left-bottom) iNeurons in response to current injection, Right – cumulative action potentials fired by G118E, Isogenic control and G118E-E2KO iNeurons over increasing current injections (significance - *G118E vs Isogenic control and/or G118E-E2KO iNeurons). [0032] FIGs.4A-4C show bulk RNA-sequencing reveals significant correction in disease gene signature of the RTT iNeurons using the E2KO strategy. (A) Numbers of significant 201638021.3 - 8 -
Docket No. BAYM.P0393WO (p<0.01) differentially expressed gens (DEGs) between G118E and isogenic control (top), G118E and G118E- E2KO (middle) and between G118E-E2KO and isogenic control (bottom) iNeurons (B) A dot plot of disease gene expression with the Log10Normalized average gene expression on Y-axis and the individual genes arranged in ascending order (based expression level in isogenic control iNeurons) on the X-axis with each individual dot corresponding to one gene and the colors corresponding to the genotype – isogenic control in black, G118E in red and G118E-E2KO in green (C) A plot of the ‘corrected’ genes (genes whose expression in the G118E-E2KO iNeurons lies somewhere between G118E and isogenic control iNeurons) with number of genes on the Y-axis and percent of ‘rescue’ (with 100% being the expression level of a gene in G118-E2KO equal to its expression in isogenic control iNeurons and 0% being the expression level of a gene in G118E-E2KO equal to its expression in G118E iNeurons). [0033] FIGs. 5A-5D show E2Skip Morpholino promotes exon-skipping in MECP2 and upregulates MeCP2 protein level in SHSY5Y cells. (A) Overview of the experiment in undifferentiated SHSY5Y cells (B) The E2_LNA and E2_no LNA ASOs did not induce exon 2 skipping as shown by no change in the proportion of e1 and e2 mRNA in the E2 ASO-treated cells compared to the Scrambled ASO (Scr ASO)-treated cells by standard curve qRT-PCR, left purple bars shows e1 isoform levels while the right orange bars shows e2 isoform levels (C) The MeCP2 protein level (normalized to GAPDH) in the E2_ASO-treated cells (LNA and no LNA) is not upregulated compared to the Scr ASO-treated cells, the MeCP2 ASO-treated cells (positive control ASO that targets MECP2 for degradation) show a reduction in MeCP2 protein level (D) MeCP2 protein level is significantly upregulated by ~80% in SHSY5Y cells treated with E2Skip Morpholino compared to the untreated cells. [0034] FIGs.6A-6D show E2Skip_Vivo Morpholino induces exon 2 skipping of MECP2 in a RTT model. (A) Overview of the experiment in iNeurons to test the E2Skip Morpholinos (B) E2Skip MO (E2 MO) results in a small switch in the proportion of e2 to e1 mRNA isoforms in the isogenic control and G118E iNeurons as measured by standard curve qRT-PCR (C) There is no upregulation of MeCP2 protein level (normalized to GAPDH) in the E2 MO-treated isogenic control or G118E iNeurons compared to the Control MO (D) Treating the iNeurons with E2Skip_Vivo Morpholino (Mo) results in a significant downregulation of the e2 mRNA isoform concomitantly upregulating the e1 mRNA isoform in both isogenic control and G118E iNeurons. [0035] FIGs. 7A-7B show E2Skip_Vivo Mo upregulates MeCP2 protein level in the mouse brain. (A) Treatment paradigm of Control/E2Skip_Vivo Mo in P0 FVB wild-type mouse cortices (B) Left - Western blot bands showing MeCP2 protein and GAPDH internal 201638021.3 - 9 -
Docket No. BAYM.P0393WO control protein in wild-type FVB male mice cortices injected at P0 with Control or E2Skip_Vivo Mo (n=3 each) and harvested 2-weeks post-injection, right - quantification of MeCP2 protein level normalized to GAPDH in these tissues. [0036] FIGs. 8A-8D show Stoke ASOs do not upregulate e1 mRNA or change MeCP2 protein level in HEK293T cells. (A) Fold change in MECP2-e1 mRNA levels in Stoke ASO (ST44, 45, 46) treated HEK293T cells relative to Scrambled ASO (Scr)-treated cells (B) Fold change in MECP2-e2 mRNA levels in Stoke ASO (ST44, 45, 46) treated HEK293T cells relative to Scr ASO-treated cells (C) Fold change in total MECP2 mRNA levels in Stoke ASO (ST44, 45, 46) treated HEK293T cells relative to Scr ASO-treated cells (D) MeCP2 protein level in Stoke ASO (ST44, 45, 46) treated HEK293T cells relative to Scr ASO-treated cells. mRNA levels were measured by RT-qPCR with GAPDH as internal control and protein level was measured by Western blot with GAPDH as internal control. [0037] FIGs.9A-9C show Stoke ASOs do not upregulate e1 mRNA in SHSY5Y cells. (A) Fold change in MECP2-e1 mRNA levels in Stoke ASO (ST44, 45, 46) treated SHSY5Y cells relative to Scrambled ASO (Scr)-treated cells (B) Fold change in MECP2-e2 mRNA levels in Stoke ASO (ST44, 45, 46) treated SHSY5Y cells relative to Scr ASO-treated cells (C) Fold change in total MECP2 mRNA levels in Stoke ASO (ST44, 45, 46) treated SHSY5Y cells relative to Scr ASO-treated cells. mRNA levels were measured by RT-qPCR with GAPDH as internal control. DETAILED DESCRIPTION [0038] Aspects herein relate to characterizations of MeCP2 in neurological disorders. Certain aspects relate to intronic sequences related to isoform switching, which may be genetically deleted or blocked with at least one antisense oligonucleotide (ASO). The ASO may be a splice-switching oligonucleotide (SSO). Such deletions or blocking may result in skipping of exon 2 in the MeCP2 pre-mRNA and enrichment of the E1 protein isoform of MeCP2 in a cell, such as a neuron. In certain aspects, the enrichment is tuned to a therapeutically effective level, which may be an amount that is less than other overexpression methods. I. Antisense Oligonucleotides [0039] In some aspects, the disclosure relates to antisense oligonucleotides (ASOs) that inhibit the binding of certain splicing machinery, which can affect the amount of a protein, 201638021.3 - 10 -
Docket No. BAYM.P0393WO including specific isoforms of the protein, in a cell. In some embodiments, the ASO is a splice- switching oligonucleotide (SSO). In some aspects, the protein comprises MeCP2, including the E1 isoform of MeCP2. In some aspects, the disclosure relates to expression systems capable of expressing the ASO. An ASO may increase the translation of a gene transcript in a cell. An ASO may be from 16 to 1000 nucleotides long, and in certain aspects from 15 to 100 nucleotides long. The ASO may have at least or may have at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 50, 60, 70, 80, or 90 (or any range derivable therein) nucleotides. The ASO may comprise any nucleic acid form such as DNA, RNA, LNA, PNA, or BNA. The ASO may comprise synthetic or non-natural nucleotides. The ASO may be synthetic and/or isolated. In some aspects, the ASO is single-stranded. In some aspects, the ASO is double-stranded. In some aspects, the ASO comprises single-stranded DNA. In some aspects, the ASO comprises single-stranded RNA. In some aspects, the ASO comprises double-stranded DNA. In some aspects, the ASO comprises double-stranded RNA. In some aspects, the ASO comprises an antisense strand. [0040] In some aspects, the ASO comprises AAGGAAGGTTACTTACCTGAGCCCT (SEQ ID NO: 1) [0041] In some aspects, the ASO is capable of increasing protein levels of a protein of interest, such as the E1 isoform of MeCP2, by modulating the splicing of a pre-mRNA transcript encoding the protein. The ASO may be partially or fully complementary to a sequence in the pre-mRNA that is involved in splicing, such as an alternative splicing site or a splicing factor-binding site. [0042] In some aspects, the ASO is, or comprises, an oligonucleotide analog and may include modifications, particularly modifications that increase nuclease resistance, improve binding affinity, and/or improve binding specificity. For example, when the sugar portion of a nucleoside or nucleotide is replaced by a carbocyclic moiety, it is no longer a sugar. Moreover, when other substitutions, such a substitution for the inter-sugar phosphodiester linkage are made, the resulting material is no longer a true species. All such compounds are considered to be analogs. In some aspects, the compound comprises a morpholino. Throughout this specification, reference to the sugar portion of a nucleic acid species shall be understood to refer to either a true sugar or to a species taking the structural place of the sugar of wild type nucleic acids. Moreover, reference to inter-sugar linkages shall be taken to include moieties serving to join the sugar or sugar analog portions in the fashion of wild type nucleic acids. In some aspects, the sugar analog comprises a 2’ deoxy analog. In some aspects, the sugar analog 201638021.3 - 11 -
Docket No. BAYM.P0393WO comprises a 2’-O-methoxyethyl analog. The sugar analog comprising ASO may comprise a phosphorodiamidate morpholino oligomer. In some aspects, the 2′ OH-group may be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, COOR, or OR, wherein R is substituted or unsubstituted C1-C6 alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications include those described in U.S. Pat. Nos.5,858,988, and 6,291,438. [0043] The phosphate group of the nucleotide may also be modified, e.g., by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioates), or by making other substitutions which allow the nucleotide to perform its intended function such as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev.2000 April 10(2): 117- 21, Rusckowski et al. Antisense Nucleic Acid Drug Dev.2000 October 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev.2001 October 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev.2001 April 11(2):77-85, and U.S. Pat. No.5,684,143, all of which are incorporated by reference in their entirety herein. Certain of the above-referenced modifications (e.g., phosphate group modifications) may decrease the rate of hydrolysis of, for example, polynucleotides comprising said analogs in vivo or in vitro. [0044] The present disclosure concerns modified oligonucleotides, i.e., oligonucleotide analogs or oligonucleosides, and methods for effecting the modifications. These modified oligonucleotides and oligonucleotide analogs may exhibit increased chemical and/or enzymatic stability relative to their naturally occurring counterparts. Extracellular and intracellular nucleases generally do not recognize and therefore do not bind to the backbone-modified compounds. When present as the protonated acid form, the lack of a negatively charged backbone may facilitate cellular penetration. [0045] The modified internucleoside linkages may replace naturally-occurring phosphodiester-5’-methylene linkages with four atom linking groups to confer nuclease resistance and enhanced cellular uptake to the resulting compound. [0046] Modifications may be achieved using solid supports which may be manually manipulated or used in conjunction with a DNA synthesizer using methodology commonly known to those skilled in DNA synthesizer art. Generally, the procedure involves functionalizing the sugar moieties of two nucleosides which will be adjacent to one another in the selected sequence. In a 5’ to 3’ sense, an “upstream” synthon such as structure H is modified at its terminal 3’ site, while a “downstream” synthon such as structure H1 is modified at its terminal 5’ site. [0047] Oligonucleosides linked by hydrazines, hydroxylarnines, and other linking groups, are contemplated herein for use in the ASOs, and can be protected by a dimethoxytrityl group 201638021.3 - 12 -
Docket No. BAYM.P0393WO at the 5’-hydroxyl and activated for coupling at the 3’-hydroxyl with cyanoethyldiisopropyl- phosphite moieties. These compounds can be inserted into any desired sequence by standard, solid phase, automated DNA synthesis techniques. One of the most popular processes is the phosphoramidite technique. Oligonucleotides containing a uniform backbone linkage can be synthesized by use of CPG-solid support and standard nucleic acid synthesizing machines such as Applied Biosystems Inc.® 380B and 394 and Milligen/Biosearch® 7500 and 8800s. The initial nucleotide (number 1 at the 3’-terminus) is attached to a solid support such as controlled pore glass. In sequence specific order, each new nucleotide is attached either by manual manipulation or by the automated synthesizer system. [0048] Free amino groups can be alkylated with, for example, acetone and sodium cyanoboro hydride in acetic acid. The alkylation step can be used to introduce other, useful, functional molecules on the macromolecule. Such useful functional molecules include but are not limited to reporter molecules, RNA cleaving groups, groups for improving the pharmacokinetic properties of an oligonucleotide, and groups for improving the pharmacodynamic properties of an oligonucleotide. Such molecules can be attached to or conjugated to the macromolecule via attachment to the nitrogen atom in the backbone linkage. Alternatively, such molecules can be attached to pendent groups extending from a hydroxyl group of the sugar moiety of one or more of the nucleotides. Examples of such other useful functional groups are provided by WO1993007883, which is herein incorporated by reference, and in other of the above-referenced patent applications. [0049] Solid supports may include any of those known in the art for polynucleotide synthesis, including controlled pore glass (CPG), oxalyl controlled pore glass, TentaGel® Support—an aminopolyethyleneglycol derivatized support or Poros—a copolymer of polystyrene/divinylbenzene. Attachment and cleavage of nucleotides and oligonucleotides can be effected via standard procedures. As used herein, the term solid support further includes any linkers (e.g., long chain alkyl amines and succinyl residues) used to bind a growing oligonucleotide to a stationary phase such as CPG. In some aspects, the oligonucleotide may be further defined as having one or more locked nucleotides, ethylene bridged nucleotides, peptide nucleic acids, or a 5’(E)-vinyl-phosphonate (VP) modification. In some aspects, the oligonucleotides has one or more phosphorothioated DNA or RNA bases. II. Obtaining Nucleotides A. Synthesis 201638021.3 - 13 -
Docket No. BAYM.P0393WO [0050] The nucleic acid molecules, including an ASO described herein, may be generated by nucleic acid synthesis. The ASOs may be synthesized using any method known in the art, such as phosphoramidite synthesis and/or solid-phase synthesis. The ASO analogs may be synthesized. B. Expression [0051] The nucleic acid molecules, including any ASO described herein, may be generated by expression vectors. The expression vectors used herein may contain sequences for plasmid or virus maintenance and for cloning and expression of exogenous nucleotide sequences. Such sequences, collectively referred to as “flanking sequences” typically include one or more of the following operatively linked nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcriptional termination sequence, and a selectable marker element. Such sequences and methods of using the same are well known in the art. 1. Expression Systems [0052] Numerous expression systems exist that comprise at least a part or all of the expression vectors discussed above. Prokaryote- and/or eukaryote-based systems can be employed for use with an aspect to produce nucleic acid sequences. Commercially and widely available systems include but are not limited to bacterial, mammalian, yeast, and insect cell systems. Those skilled in the art are able to express a vector to produce a nucleic acid sequence using an appropriate expression system. 2. Methods of Gene Transfer [0053] Suitable methods for nucleic acid delivery to effect expression of compositions are anticipated to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S. Patents 5,994,624,5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; U.S. Patent 5,789,215, incorporated herein by reference); by electroporation (U.S. Patent No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE dextran 201638021.3 - 14 -
Docket No. BAYM.P0393WO followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Patents 5,610,042; 5,322,783, 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Patents 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium mediated transformation (U.S. Patents 5,591,616 and 5,563,055, each incorporated herein by reference); or by PEG mediated transformation of protoplasts (Omirulleh et al., 1993; U.S. Patents 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition mediated DNA uptake (Potrykus et al., 1985). Other methods include viral transduction, such as gene transfer by lentiviral or retroviral transduction. 3. Host Cells [0054] In another aspect, contemplated are the use of host cells into which a recombinant expression vector has been introduced. Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells. One of skill in the art would understand the conditions under which to incubate host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors. [0055] For stable transfection of mammalian cells, it is known, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a selectable marker (e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die), among other methods known in the arts. III. Administration of Therapeutic Compositions [0056] The therapy provided herein may comprise the administration of one or a combination of therapeutic agents, such as one or a combination of unique antisense 201638021.3 - 15 -
Docket No. BAYM.P0393WO oligonucleotides (ASOs) and/or a combination of ASOs and other therapeutic compositions, including those useful for treating disorders disclosed herein, such as any neurological disorder, to a patient. In some aspects, the therapy is a cocktail of ASOs. In some aspects, the other therapeutic compositions are useful for reducing symptoms of the neurological disorder and/or reducing side effects of the other therapeutic agents administered. The therapies may be administered in any suitable manner known in the art. In some aspects, a first therapeutic composition (such as an ASO) and a second composition (such as another ASO or another therapeutic composition) may be administered sequentially (at different times) or concurrently (at the same time). In some aspects, the first and second therapeutic compositions are administered in a separate composition. In some aspects, the first and second therapeutic compositions are in the same composition. [0057] In some aspects, the first therapeutic composition and the second therapeutic composition are administered substantially simultaneously. In some aspects, the first therapeutic composition and the second therapeutic composition are administered sequentially. In some aspects, the first therapeutic composition, the second therapeutic composition, and a third therapeutic composition are administered sequentially. In some aspects, the first therapeutic composition is administered before administering the second therapeutic composition. In some aspects, the first therapeutic composition is administered after administering the second therapeutic composition. [0058] Aspects of the disclosure relate to compositions and methods comprising therapeutic compositions. The different therapies may be administered in one composition or in more than one composition, such as 2 compositions, 3 compositions, or 4 compositions. Various combinations of the agents may be employed. [0059] The therapeutic agents of the disclosure, which may be one or more of any of the ASOs disclosed herein, may be administered before or after onset of symptoms. In certain aspects, the therapeutic agents are administered to an individual that has been determined to have a genetic defect, including any of the genetic defects disclosed herein. In some aspects, the therapeutic agents are administered to an individual identified as having a hypomorphic missense mutation, including any hypomorphic missense mutation disclosed herein. In certain aspects, the therapeutic agents are administered to a newborn. In certain aspects, the therapeutic agents are administered to an individual under two years old. [0060] The therapeutic agents of the disclosure may be administered by the same route of administration or by different routes of administration. In some aspects, the therapy is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, 201638021.3 - 16 -
Docket No. BAYM.P0393WO intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. In certain aspects, the therapeutic agents are administered by intrathecal injection, which may be an intrathecal bolus injection. In some aspects, the therapeutic agents are administered as an aerosol. The appropriate dosage may be determined based on the type of disease to be treated, severity and course of the disease, the clinical condition of the individual, the individual's clinical history and response to the treatment, and the discretion of the attending physician. [0061] The treatments may include various “unit doses.” Unit dose is defined as containing a predetermined-quantity of the therapeutic composition. The quantity to be administered, and the particular route and formulation, is within the skill of determination of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. In some aspects, a unit dose comprises a single administrable dose. [0062] In some aspects, a single dose of the ASO or other therapeutic composition is administered. In some aspects, multiple doses of the ASO or other therapeutic composition are administered. In some aspects, the ASO or other therapeutic composition is administered as a single bolus injection of between 50 µg and 1000 µg. In some aspects, the ASO or other therapeutic composition is administered as a single bolus injection at a dose of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 201638021.3 - 17 -
Docket No. BAYM.P0393WO 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 600, 700, 800, 900, 1000 µg, or any range derivable therein. In some aspects, the ASO or other therapeutic composition is administered as a series of two or more bolus injection each between 50 µg and 1000 µg. In some aspects, the ASO or other therapeutic composition is administered at a dose of between 1 µg/kg and 5000 mg/kg. In some aspects, the ASO or other therapeutic composition is administered at a dose of at least, at most, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 201638021.3 - 18 -
Docket No. BAYM.P0393WO 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, or 5000 µg/kg or mg/kg. [0063] The quantity to be administered, both according to number of treatments and unit dose, depends on the treatment effect desired. An effective dose is understood to refer to an amount necessary to achieve a particular effect. In the practice in certain aspects, it is contemplated that doses in the range from 10 mg/kg to 200 mg/kg can affect the protective capability of these agents. Thus, it is contemplated that doses include doses of about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195,200, 300, 400, 500, 1000 µg/kg, mg/kg, µg/day, or mg/day or any range derivable therein. Furthermore, such doses can be administered at multiple times during a day, and/or on multiple days, weeks, or months. [0064] In certain aspects, the effective dose of the pharmaceutical composition is one which can provide a blood level of about 1 µM to 150 µM. In another aspect, the effective dose provides a blood level of about 4 µM to 100 µM.; or about 1 µM to 100 µM; or about 1 µM to 50 µM; or about 1 µM to 40 µM; or about 1 µM to 30 µM; or about 1 µM to 20 µM; or about 1 µM to 10 µM; or about 10 µM to 150 µM; or about 10 µM to 100 µM; or about 10 µM to 50 µM; or about 25 µM to 150 µM; or about 25 µM to 100 µM; or about 25 µM to 50 µM; or about 50 µM to 150 µM; or about 50 µM to 100 µM (or any range derivable therein). In other aspects, the dose can provide the following blood level of the agent that results from a therapeutic agent being administered to a subject: about, at least about, or at most about 1, 2, 201638021.3 - 19 -
Docket No. BAYM.P0393WO 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 μM or any range derivable therein. In certain aspects, the therapeutic agent that is administered to a subject is metabolized in the body to a metabolized therapeutic agent, in which case the blood levels may refer to the amount of that agent. Alternatively, to the extent the therapeutic agent is not metabolized by a subject, the blood levels discussed herein may refer to the unmetabolized therapeutic agent. [0065] Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the patient, the route of administration, the intended goal of treatment (alleviation of symptoms versus cure) and the potency, stability and toxicity of the particular therapeutic substance or other therapies a subject may be undergoing. [0066] It will be understood by those skilled in the art and made aware that dosage units of µg/kg or mg/kg of body weight can be converted and expressed in comparable concentration units of µg/ml or mM (blood levels). It is also understood that uptake is species and organ/tissue dependent. The applicable conversion factors and physiological assumptions to be made concerning uptake and concentration measurement are well-known and would permit those of skill in the art to convert one concentration measurement to another and make reasonable comparisons and conclusions regarding the doses, efficacies and results described herein. [0067] In certain instances, it will be desirable to have multiple administrations of the composition, e.g., 2, 3, 4, 5, 6 or more administrations. The administrations can be at 1, 2, 3, 4, 5, 6, 7, 8, to 5, 6, 7, 8, 9, 10, 11, or 12 day, week, month, or year intervals, including all ranges there between. [0068] The phrases “pharmaceutically acceptable” or “pharmacologically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal or human. As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, anti-bacterial and anti-fungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients, its use in immunogenic and therapeutic compositions is contemplated. 201638021.3 - 20 -
Docket No. BAYM.P0393WO Supplementary active ingredients, such as other anti-infective agents and vaccines, can also be incorporated into the compositions. [0069] The active compounds can be formulated for parenteral administration, e.g., formulated for injection via epidural, intravenous, intramuscular, subcutaneous, or intraperitoneal routes. Typically, such compositions can be prepared as either liquid solutions or suspensions; solid forms suitable for use to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and, the preparations can also be emulsified. [0070] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including, for example, aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that it may be easily injected. It also should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. [0071] A pharmaceutical composition can include a solvent or dispersion medium containing, for example, water, phosphate buffered saline (PBS), ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion, and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various anti-bacterial and anti-fungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. [0072] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization or an equivalent procedure. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying 201638021.3 - 21 -
Docket No. BAYM.P0393WO techniques, which yield a powder of the active ingredient, plus any additional desired ingredient from a previously sterile-filtered solution thereof. [0073] Administration of the compositions will typically be via any common route. This includes, but is not limited to epidural, oral, or intravenous administration. Alternatively, administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal, or intranasal administration. Such compositions would normally be administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients. [0074] Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above. A. Pharmaceutical Compositions [0075] In certain aspects, the compositions or agents, including those for use in the methods disclosed herein, such as one or more antisense oligonucleotides (ASOs), are suitably contained in a pharmaceutically acceptable carrier. The carrier can be non-toxic, biocompatible, and selected so as not to detrimentally affect the biological activity of the agent. The agents in some aspects of the disclosure may be formulated into preparations for local delivery (i.e. to a specific location of the body, such as the brain, nervous tissue, or other tissue) or systemic delivery, in solid, semi-solid, gel, liquid or gaseous forms such as tablets, capsules, powders, granules, ointments, solutions, depositories, inhalants and injections allowing for oral, parenteral or surgical administration. Certain aspects of the disclosure also contemplate local administration of the compositions by coating medical devices and the like. [0076] Suitable carriers for parenteral delivery via injectable, infusion or irrigation and topical delivery include distilled water, physiological phosphate-buffered saline, normal or lactated Ringer's solutions, dextrose solution, Hank's solution, or propanediol. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any biocompatible oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. The carrier and agent may be compounded as a liquid, suspension, polymerizable or non-polymerizable gel, paste or salve. 201638021.3 - 22 -
Docket No. BAYM.P0393WO [0077] The carrier may also comprise a delivery vehicle to sustain (i.e., extend, delay or regulate) the delivery of the agent(s) or to enhance the delivery, uptake, stability or pharmacokinetics of the therapeutic agent(s). Such a delivery vehicle may include, by way of non-limiting examples, microparticles, microspheres, nanospheres or nanoparticles composed of proteins, liposomes, carbohydrates, synthetic organic compounds, inorganic compounds, polymeric or copolymeric hydrogels and polymeric micelles. [0078] In certain aspects, the actual dosage amount of a composition administered to a patient or subject can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject. [0079] Solutions of pharmaceutical compositions can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions also can be prepared in glycerol, liquid polyethylene glycols, mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. [0080] In certain aspects, the pharmaceutical compositions are advantageously administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable or solution in, or suspension in, liquid prior to injection may also be prepared. These preparations also may be emulsified. A typical composition for such purpose comprises a pharmaceutically acceptable carrier. For instance, the composition may contain 10 mg or less, 25 mg, 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline. Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like. [0081] Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters such as ethyloleate. Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antimicrobial agents, antifungal agents, anti-oxidants, chelating agents and inert gases. The pH and exact concentration of the various components the pharmaceutical composition are adjusted according to well-known parameters. [0082] Additional formulations are suitable for oral administration. Oral formulations include such typical excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. 201638021.3 - 23 -
Docket No. BAYM.P0393WO The compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders. [0083] In further aspects, the pharmaceutical compositions may include classic pharmaceutical preparations. Administration of pharmaceutical compositions according to certain aspects may be via any common route so long as the target tissue is available via that route. This may include oral, nasal, buccal, rectal, vaginal or topical. Alternatively, administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal, intrathecal, or intravenous injection. Such compositions would normally be administered as pharmaceutically acceptable compositions that include physiologically acceptable carriers, buffers or other excipients. For treatment of conditions of the lungs, aerosol delivery can be used. Volume of the aerosol may be between about 0.01 ml and 0.5 ml, for example. [0084] An effective amount of the pharmaceutical composition is determined based on the intended goal. The term “unit dose” or “dosage” refers to physically discrete units suitable for use in a subject, each unit containing a predetermined-quantity of the pharmaceutical composition calculated to produce the desired responses discussed above in association with its administration, i.e., the appropriate route and treatment regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the protection or effect desired. [0085] Precise amounts of the pharmaceutical composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting the dose include the physical and clinical state of the patient, the route of administration, the intended goal of treatment (e.g., alleviation of symptoms versus cure) and the potency, stability and toxicity of the particular therapeutic substance. IV. Proteins [0086] The nucleotides as well as the protein, polypeptide, and peptide sequences for various genes have been previously disclosed and may be found in the recognized computerized databases. Two commonly used databases are the National Center for Biotechnology Information’s Genbank and GenPept databases (on the World Wide Web at ncbi.nlm.nih.gov/) and The Universal Protein Resource (UniProt; on the World Wide Web at uniprot.org). The coding regions for these genes may be amplified and/or expressed using the techniques disclosed herein or as would be known to those of ordinary skill in the art. 201638021.3 - 24 -
Docket No. BAYM.P0393WO V. Other Agents [0087] It is contemplated that other agents may be used in combination with certain aspects of the present aspects to improve the therapeutic efficacy of treatment. These additional agents include agents that act in combination and/or synergistically with the ASOs described herein. The additional agents may comprise agents that reduce symptoms of the disorders disclosed herein, or may comprise agents that reduce side effects associated with the therapeutic compositions disclosed herein. Examples [0088] The following examples are included to demonstrate certain aspects of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific aspects which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure. Example 1: Upregulating MeCP2 Levels By Isoform Switching as a Novel Therapeutic Strategy For Rett Syndrome [0089] Considering that 1) E2 is dispensable for the function of MeCP2 in the brain, 2) isoform e1 is more efficiently translated into MeCP2 protein than e2, and 3) increasing even mutant MeCP2 levels rescues RTT-like phenotypes, experiments were set up to block the splicing of the less efficiently translated e2 mRNA. It was predicted that this would boost production of the more efficiently translated e1 and increase MeCP2 levels, and thus be useful as a potential therapeutic approach for RTT patients with partially functioning alleles. [0090] MECP2 encodes two alternatively spliced isoforms: MECP2-e1 which includes exons 1,3 and 4 and MECP2-e2 which includes all four exons of the gene. The two isoforms also differ by their translational start site (TSS) with the TSS of e1 located in exon 1 and the TSS of e2 in exon 2. This results in a 498 amino acid and a 486 amino acid protein respectively (FIG.1A). The E1 protein has a unique N- terminus that differs from E2 by 21 amino acids.6 A study showed that e1 mRNA is more abundant in the mouse brain compared to e2 by semi- quantitative polymerase chain reaction (qRT-PCR). This study also estimated that the E1 protein is at least ~10-fold higher in mouse brain nuclear lysate compared to E2, based on western blot analysis.4 Similar experiments were performed to look at the mRNA (by semi- 201638021.3 - 25 -
Docket No. BAYM.P0393WO quantitative end-point PCR) and protein level of e1/E1 and e2/E2 in different mouse brain regions. It was found that while the levels of e1 and e2 mRNA are comparable in the mouse cortex, the E1 protein is significantly higher than E2 protein (FIG.1B). The expression of these isoforms was also analyzed at the mRNA and protein level in human prefrontal cortex of male and female postmortem tissue. Here, the e1 and e2 mRNA levels are ~60% and 40% respectively, the protein level of E1 is significantly higher than E2, and the ratio of protein to mRNA for E1 is significantly higher compared to E2 (FIG. 1C). It was hypothesized that by excluding exon 2 in the mRNA transcript, one will be able to increase the more efficiently translated e1 transcripts with the goal of increasing MeCP2 protein level in the brain. [0091] A mouse model was generated in which exon 2 of Mecp2 was deleted by CRISPR/Cas9 in a wild-type (C57B6) background (FIG. 1D). The gRNAs were designed according to the guidelines outlined by Wang et al,7 and CRISPR/Cas9 editing was performed as previously described.8 Male and female founder mice carrying the exon 2 deletion were obtained, as confirmed by PCR followed by sequencing. The founders were backcrossed to wild-type C57B6 mice and performed RNA and protein analyses on the F5 (fifth generation) male mice at 10 weeks of age (young adults). Observed were a complete loss of e2 mRNA, an increase in the amount of e1 mRNA (FIG.1E), and a 50-60% increase in total MeCP2 protein (FIG. 1E) in the cortex of exon 2 knockout (E2KO) mice compared to wild-type mice. Behavioral assays were performed on these mice and they displayed a mild phenotype of increased anxiety in the elevated plus maze (FIG.1F) and in the open field assay (FIG. 1G). Considering that a ~100% increase in MeCP2 in a MeCP2 duplication mouse model results in significantly heightened anxiety,9 the mild phenotype in our E2KO mouse model with a 50- 60% increase in MeCP2 is expected and evidence of a functional protein. [0092] Next, to test the consequence of isoform switching in a RTT model, exon 2 of MECP2 was deleted in a patient-derived induced pluripotent stem cell (iPSC) model of RTT. This model carries a novel missense mutation, G118E, in the methyl-CpG binding domain of MeCP2 (FIG.2A) that reduces MeCP2 protein level by 30-40% and impairs the DNA-binding of ability of MeCP2.10 This mutation is in exon 3 and hence is seen in both isoforms (FIG.2A). Using CRISPR/Cas9- mediated genome editing, we deleted exon 2 in G118E iPSCs and differentiated these into glutamatergic neurons by NGN2-based induction11 (FIG. 2B) generating G118E-E2KO iPSC- derived neurons (iNeurons). The protein levels of G118E and G118E-E2KO iNeurons were compared to isogenic control iNeurons in which the G118E mutation was edited back to the wild- type genomic sequence. As shown in FIG.2C, while the 201638021.3 - 26 -
Docket No. BAYM.P0393WO G118E iNeurons showed reduced MeCP2 protein level, in the G118E-E2KO iNeurons the MeCP2 protein level was increased to a level comparable to that of isogenic control iNeurons. [0093] To assess the functional impact of upregulating mutant MeCP2 protein level in a RTT context, electrophysiology studies were performed on these iNeurons by whole cell patch clamp recording (FIG. 3A). The G118E iNeurons displayed deficits in spontaneous activity; this phenotype was partially rescued by E2KO (FIG. 3B). The G118E neurons also showed hyperexcitability at increasing inputs of current, and this was significantly corrected in the G118E-E2KO neurons (FIG. 3C). This was a strong piece of evidence to indicate that upregulating even mutant MeCP2 protein carrying the G118E mutation by a modest amount (to wild-type level) improves neurological deficits in the RTT context. [0094] MeCP2 is a transcriptional regulator whose loss has been shown to alter the expression of thousands of genes12,13,14. Therefore, we used bulk RNA-sequencing to determine the global gene expression pattern in G118E iNeurons compared to the isogenic controls, and to assess whether E2KO in the G118E iNeurons modifies the disease gene signature. As expected, the G118E iNeurons displayed a significant number of differentially expressed genes (DEGs) compared to the isogenic control iNeurons (FIG. 4A – Top panel). The G118E-E2KO iNeurons also had a large number of significant DEGs relative to both the G118E and isogenic control iNeurons (FIG.4A – bottom 2 panels). The ‘disease genes’ were first defined as the DEGs found in G118E vs isogenic control, then examined these genes in the G118E-E2KO iNeurons to determine whether any gene expression changes were rescued. The E2KO strategy at least partially rescues the gene expression of ~60% of the genes (FIG. 4B) and almost fully rescues (>75% of isogenic control level) the expression of ~20% of the disease genes altered in G118E (FIG.4C – genes that are in the 75%-100% rescue bins). Taken altogether, the electrophysiology and molecular studies suggest that the exon-skipping strategy is a feasible therapeutic approach for RTT. Example 2: Antisense Oligonucleotides for Isoform Switching in MeCP2 [0095] To accomplish this exon skipping with a therapeutic agent, exon-skipping antisense oligonucleotide (ASO) were tested for clinical translation. Four ASOs with different chemistries (Table 1) were obtained, then tested ASOs in both wild-type undifferentiated SHSY5Y cells (derived from SK-N-SH, a human neuroblastoma cell line) and subsequently G118E iNeurons. The effect of ASO treatment were tested on exon 2 skipping and MeCP2 protein level. 201638021.3 - 27 -
Docket No. BAYM.P0393WO
[0096] The two ASOs (E2Skip_ASO_noLNA and E2Skip_ASO_LNA) were tested in undifferentiated SHSY5Y cells by nucleofection (FIG. 5A). In these conditions, they did not switch e2 to e1 mRNA (FIG. 5B) and did not upregulate MeCP2 protein level (FIG. 5C). However, the E2Skip _MO was effective in significantly downregulating the E2 isoform (FIG. 5D top panel - faint bottom band in the MeCP2 protein western blot) while upregulating the E1 isoform (dark upper MeCP2 band), thereby increasing MeCP2 protein level by ~80% in undifferentiated SHSY5Y cells (FIG.5D bottom panel). [0097] The E2Skip_MO was next tested in G118E and isogenic control iNeurons by incubating 7-week-old, mature iNeurons with the E2Skip_MO (along with the delivery agent EndoPorter) for 1 week (FIG.6A) and, in these conditions, found that it did not induce isoform switching of MECP2 mRNA (FIG.6B) and did not change the proteins levels of MeCP2 (FIG. 6C). On the other hand E2Skip_VivoMO, when tested in the 7-week-old iNeurons for 1 week (without the EndoPorter), significantly upregulated the e1 mRNA while concomitantly reducing e2 mRNA levels in both G118E and isogenic control iNeurons (FIG.6D). Next, the effect of E2Skip_VivoMO on MeCP2 protein levels in the G118E iNeurons will be measured. Exon 2 skipping is a promising therapeutic strategy and the E2Skip_VivoMO is an excellent candidate ASO for clinical application of this strategy to help RTT patients with partially functioning alleles of MeCP2. 201638021.3 - 28 -
Docket No. BAYM.P0393WO [0098] Example 3: E2Skip Morpholino upregulates MeCP2 protein level in the mouse brain We injected the E2Skip Mo into wild-type postnatal day 0 (P0) mouse brains (Fig.7A) and 2 weeks post-injection, saw a significant upregulation of MeCP2 protein level in the cortices of these mice upon E2Skip Mo treatment relative to Control Mo treated mice (Fig.7B). [0099] The Examples show a novel method to effectively increase mutant MeCP2 to a therapeutically effective level without leading to MeCP2 over expression. The data show, for the first time, that modestly upregulating mutant MeCP2 protein (to levels comparable to the wild-type protein level) can result in significant improvement of disease phenotypes. Previous studies in the field have shown that reintroduction of the wild-type MeCP2 protein level in a MeCP2-null mouse model (with no MeCP2 protein) can rescue majority of the RTT phenotypes.2 Previous work by Lamonica et al3 using a RTT mouse model expressing the hypomorphic missense mutation T158M showed that transgenic over-expression of T158M Mecp2 (resulting in MeCP2 protein levels 1.5-fold higher than wild-type) ameliorated a majority of the RTT phenotypes in these mice. Both of these previous studies support the rationale for the current project but are limited by relying on either expression of wild-type MeCP2 or extreme overexpression of a mutant MeCP2 protein to improve the phenotypes in the RTT mouse models. This is an important limitation because the brain is very sensitive to the level of MeCP2 protein, and overcorrecting MeCP2 levels may lead to another severe neurological disorder, MeCP2 duplication syndrome (MDS). Therefore, modestly increasing MeCP2 levels in RTT models—like the increase observed in the described isoform switching strategy—is important to maximize the therapeutic benefits while minimizing the risk of overcorrection. Also shown is that this modest upregulation of mutant MeCP2 protein is sufficient to improve RTT phenotypes in an iPSC-derived neuron model, which has not yet been demonstrated in the RTT field, and provides critical preclinical evidence for the therapeutic strategy. [0100] Additionally, the studies identified that modifications of the ribose sugars to a morpholino base, and phosphoroamidate linkage of the ASO, but in some aspects not by a 2’O- methyl RNA base - phosphorothioate bond, of the same sequences, can produce successful exon 2 skipping of MECP2. Using a Morpholino ASO, upregulation of the MeCP2 protein level was significantly achieved in multiple cell types as well as in the mouse cortex, and the Morpholino induced isoform switching at the mRNA level in RTT iNeurons. This is the first ASO- based therapeutic approach for RTT and can help the >75% of RTT patients with partial loss-of-function mutations in MECP2, similar to G118E. 201638021.3 - 29 -
Docket No. BAYM.P0393WO Example 4: Previously developed ASOs tested in HEK293T cells and SHSY5Y Cells [0101] Three ASO sequences previously disclosed in U.S. Patent Application No. 17/518,209 (the Stoke ASOs, SEQ ID NOs:2-4) were tested by treating the HEK293T cells at a dose of 80nM for 72 hours and examined the levels of e1, e2 and total MECP2 mRNA as well as MeCP2 protein level in these cells. There were no significant differences detected in the levels of e1 (Fig.8A), e2 (Fig.8B) or total MECP2 mRNA (Fig.8C). There were also no significant differences detected in MeCP2 protein level (Fig. 8D) in any of the Stoke ASO- treated cells compared to the Scrambled ASO treated cells. [0102] The three Stoke ASO sequences were also tested in undifferentiated SHSY5Y cells by nucleofection at a dose of 10µM and cells were harvested 72 hours post-nucleofection. mRNA levels of MECP2-e1, e2 and total MECP2 were measured and found no significant differences in the mRNA expression of e1 (Fig. 9A), e2 (Fig. 9B) or total MECP2 (Fig. 9C) were found in any of the ST ASO-treated cells relative to Scrambled (Scr) ASO-treated cells. TTACTTACCTGAGCCCTA (ST44, SEQ ID NO:2) GAAGGTTACTTACCTGAG (ST45, SEQ ID NO:3) AAAAGGAAGGTTACTTAC (ST46, , SEQ ID NO:4) * * * [0103] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred aspects, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims. REFERENCES The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. 1. Samaco RC, Neul JL. Complexities of Rett Syndrome and MeCP2. J Neurosci. 2011;31(22):7951 LP - 7959. doi:10.1523/JNEUROSCI.0169-11.2011 201638021.3 - 30 -
Docket No. BAYM.P0393WO 2. Guy J, Gan J, Selfridge J, Cobb S, Bird A. Reversal of Neurological Defects in a Mouse Model of Rett Syndrome. Science (80- ). 2007;315(5815):1143 LP - 1147. doi:10.1126/science.1138389 3. Lamonica JM, Kwon DY, Goffin D, et al. Elevating expression of MeCP2 T158M rescues DNA binding and Rett syndrome-like phenotypes. J Clin Invest. 2017;127(5):1889-1904. doi:10.1172/JCI90967 4. Kriaucionis S, Bird A. The major form of MeCP2 has a novel N-terminus generated by alternative splicing. Nucleic Acids Res. 2004 Mar 19;32(5):1818-23. doi: 10.1093/nar/gkh349. PMID: 15034150; PMCID: PMC390342. 5. Itoh M, Tahimic CG, Ide S, Otsuki A, Sasaoka T, Noguchi S, Oshimura M, Goto Y, Kurimasa A. Methyl CpG-binding protein isoform MeCP2_e2 is dispensable for Rett syndrome phenotypes but essential for embryo viability and placenta development. J Biol Chem. 2012 Apr 20;287(17):13859-67. doi: 10.1074/jbc.M111.309864. Epub 2012 Feb 28. PMID: 22375006; PMCID: PMC3340147. 6. Mnatzakanian GN, Lohi H, Munteanu I, et al. A previously unidentified MECP2 open reading frame defines a new protein isoform relevant to Rett syndrome. Nat Genet. 2004;36(4):339-341. doi:10.1038/ng1327 7. Wang T, Lander ES, Sabatini DM. Single Guide RNA Library Design and Construction. Cold Spring Harb Protoc. 2016;2016(3):pdb.prot090803- pdb.prot090803. doi:10.1101/pdb.prot090803 8. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8:2281. https://doi.org/10.1038/nprot.2013.143. 9. Samaco RC, Mandel-Brehm C, McGraw CM, Shaw CA, McGill BE, Zoghbi HY. Crh and Oprm1 mediate anxiety-related behavior and social approach in a mouse model of MECP2 duplication syndrome. Nat Genet. 2012 Jan 8;44(2):206-11. doi: 10.1038/ng.1066. PMID: 22231481; PMCID: PMC3267865. 10. Zhou J*, Cattoglio C*; Shao Y*, Tirumala HP, Vetralla C, Bajikar SS, Wang Q, Wu Z, Bin Tang B, Bajic A, Meng X, LaGrone A, Zhang P, Kim JJ, Tang J, Darzacq X, Tjian R, Zoghbi HY. A novel pathogenic mutation of MeCP2 impairs its association with DNA without affecting its residence time on chromatin. [Submitted] 201638021.3 - 31 -
Docket No. BAYM.P0393WO 11. Zhang Y, Pak C, Han Y, et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 2013;78(5):785-798. doi:10.1016/J.NEURON.2013.05.029 12. Chahrour M, Jung SY, Shaw C, Zhou X, Wong ST, Qin J, Zoghbi HY. MeCP2, a key contributor to neurological disease, activates and represses transcription. Science. 2008 May 30;320(5880):1224-9. doi: 10.1126/science.1153252. PMID: 18511691; PMCID: PMC2443785. 13. Johnson BS, Zhao YT, Fasolino M, Lamonica JM, Kim YJ, Georgakilas G, Wood KH, Bu D, Cui Y, Goffin D, Vahedi G, Kim TH, Zhou Z. Biotin tagging of MeCP2 in mice reveals contextual insights into the Rett syndrome transcriptome. Nat Med. 2017 Oct;23(10):1203-1214. doi: 10.1038/nm.4406. Epub 2017 Sep 18. PMID: 28920956; PMCID: PMC5630512. 14. Pacheco, N.L., Heaven, M.R., Holt, L.M. et al. RNA sequencing and proteomics approaches reveal novel deficits in the cortex of Mecp2-deficient mice, a model for Rett syndrome. Molecular Autism 8, 56 (2017). https://doi.org/10.1186/s13229-017- 0174-4 201638021.3 - 32 -
Claims
Docket No. BAYM.P0393WO WHAT IS CLAIMED IS: 1. An antisense oligonucleotide (ASO) comprising a sequence complementary to at least one region of an MeCP2 pre-mRNA, wherein the ASO is capable of binding to the MeCP2 pre-mRNA in a manner that promotes alternative splicing of the MeCP2 pre-mRNA that leads to skipping of exon 2 of the MeCP2 pre-mRNA in a neuron. 2. The ASO of claim 1, wherein the binding to MeCP2 pre-mRNA occurs at a splice site on the MeCP2 pre-mRNA. 3. The ASO of claim 2, wherein the splice site is between exon 1 and exon 2 of the MeCP2 pre-mRNA. 4. The ASO of any one of claims 1-3, wherein the ASO comprises 19 to 27 nucleotides. 5. The ASO of any one of claims 1-4, wherein the ASO comprises non-natural nucleotides. 6. The ASO of any one of claims 1-5, wherein the ASO comprises at least one methylenemorpholine moiety. 7. The ASO of any one of claims 1-6, wherein the ASO comprises at least one phosphorodiamidate moiety. 8. The ASO of any one of claims 1-7, wherein the ASO comprises at least one morpholino linkage. 9. The ASO of any one of claims 1-8, wherein the ASO comprises a delivery moiety. 10. The ASO of claim 9, wherein the delivery moiety comprises an octa-guanidine dendrimer. 11. The ASO of any one of claims 1-5, wherein the ASO comprises at least one 2’O methyl RNA base and/or at least one phosphorothioate moiety. 12. The ASO of any one of claims 1-11, wherein the ASO has a nucleotide sequence comprising SEQ ID NO:1. 13. The ASO of any one of claims 1-12, wherein the ASO is isolated. 14. An antisense oligonucleotide (ASO) comprising a morpholino oligonucleotide having a sequence comprising SEQ ID NO:1. 15. The ASO of claim 14, wherein the morpholino oligonucleotide comprises an octa- guanidine dendrimer. 16. A pharmaceutical composition comprising the ASO of any one of claims 1-15. 201638021.3 - 33 -
Docket No. BAYM.P0393WO 17. The pharmaceutical composition of claim 16, further comprising an excipient. 18. A method for treating a neurological disorder in an individual, the method comprising administering an effective amount of the ASO of any one of claims 1-15 or an effective amount of any one of the pharmaceutical compositions of claims 16 or 17 to the individual. 19. The method of claim 18, wherein the neurological disorder is Rett syndrome. 20. The method of claim 18 or 19, wherein the individual has a mutation in a MeCP2 gene. 21. The method of claim 20, wherein the mutation in the MeCP2 gene comprises a hyopmorphic missense mutation. 22. The method of claim 20 or 21, wherein the mutation in the MeCP2 gene comprises a T158M mutation. 23. The method of any one of claims 18-22, wherein the effective amount is an amount sufficient to increase MeCP2-e1 protein in a cell in the individual. 24. The method of claim 23, wherein the cell is a neuron. 25. The method of claim 23 or 24, wherein the increase in MeCP2-E1 protein is an approximately 50%, 60%, 70%, 80%, 90%, 100%, 110%, or 120% increase compared to a level in the cell before administering the ASO. 26. The method of any one of claims 18-25, wherein the ASO is administered by spinal tap. 27. The method of any one of claims 18-25, wherein the ASO is administered to the cisterna magna. 28. The method of any one of claims 18-25, wherein the administration comprises epidural administration. 29. A method of increasing skipping of exon 2 in an MeCP2 pre-mRNA, the method comprising contacting the MeCP2 pre-mRNA with an effective amount of the ASO of any one of claims 1-15. 30. A method of increasing MeCP2 protein levels in a cell, the method comprising introducing an effective amount of the ASO of any one of claims 1-15 to the cell. 31. The method of claim 30, wherein the cell is a neuron. 32. The method of claim 30 or 31, wherein the effective amount is an amount sufficient to increase MeCP2-e1 protein in the cell. 201638021.3 - 34 -
Docket No. BAYM.P0393WO 33. The method of claim 32, wherein the increase in MeCP2-E1 protein is an approximately 50%, 60%, 70%, 80%, 90%, 100%, 110%, or 120% increase compared to a level in the cell before administering the ASO. 34. A method of increasing MeCP2 protein in a cell, the method comprising modifying an MeCP2 gene or MeCP2 gene product in the cell. 35. The method of claim 34, wherein the cell is a neuron. 36. The method of claim 34 or 35, wherein the increase in MeCP2-E1 protein is an approximately 50%, 60%, 70%, 80%, 90%, 100%, 110%, or 120% increase compared to a level in the cell before modifying the MeCP2 gene. 37. The method of any one of claims 34-36, wherein the modifying comprises DNA editing and/or RNA editing to remove a splice site in the MeCP2 gene. 38. The method of claim 37, wherein the splice site is between exon 1 and intron 1, intron 1 and exon 2, exon 2 and intron 2 and/or intron 2 and exon 3 of a pre-mRNA from the MeCP2 gene. 39. The method of claims 37 or 38, wherein the DNA editing comprises CRISPR-based DNA editing. 201638021.3 - 35 -
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363505667P | 2023-06-01 | 2023-06-01 | |
| PCT/US2024/032080 WO2024249916A2 (en) | 2023-06-01 | 2024-05-31 | Antisense oligonucleotides for rett syndrome |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4720296A2 true EP4720296A2 (en) | 2026-04-08 |
Family
ID=93658558
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24816609.2A Pending EP4720296A2 (en) | 2023-06-01 | 2024-05-31 | Antisense oligonucleotides for rett syndrome |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4720296A2 (en) |
| WO (1) | WO2024249916A2 (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TW202106877A (en) * | 2019-04-24 | 2021-02-16 | 美商斯托克治療公司 | Methods and compositions for modulating splicing and translation |
| US11331333B2 (en) * | 2019-11-08 | 2022-05-17 | Georg-August-Universität Göttingen Stiftung Öffentichen Rechts, Universitätsmadizin | Treatment of aberrant fibroblast proliferation |
-
2024
- 2024-05-31 WO PCT/US2024/032080 patent/WO2024249916A2/en not_active Ceased
- 2024-05-31 EP EP24816609.2A patent/EP4720296A2/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024249916A3 (en) | 2025-02-06 |
| WO2024249916A2 (en) | 2024-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240417706A1 (en) | Systems and methods for the treatment of hemoglobinopathies | |
| US12139711B2 (en) | Antisense oligonucleotides for the treatment of Leber congenital amaurosis | |
| US11963982B2 (en) | CRISPR/RNA-guided nuclease systems and methods | |
| JP7420679B2 (en) | Antisense oligomers for the treatment of conditions and diseases | |
| AU2019204974B2 (en) | Restoration of the CFTR function by splicing modulation | |
| US11549112B1 (en) | RNAi agents for inhibiting expression of xanthine dehydrogenase (XDH), pharmaceutical compositions thereof, and methods of use | |
| JP5922721B2 (en) | Identification of microRNAs involved in the maintenance and regeneration of neuromuscular synapses | |
| US12612629B2 (en) | Duchenne muscular dystrophy-related exonic splicing enhancer, sgRNA and gene editing tool, and applications | |
| US20220047637A1 (en) | Systems and methods for the treatment of hemoglobinopathies | |
| US20220073951A1 (en) | Systems and methods for the treatment of hemoglobinopathies | |
| CN102171342A (en) | Effective exon (44) skipping method and related means in Duchenne muscular dystrophy | |
| TW202444921A (en) | Compositions and methods for the targeting of lpa | |
| WO2024249916A2 (en) | Antisense oligonucleotides for rett syndrome | |
| US9611304B2 (en) | TNNT1 mini-promoters | |
| US20150166635A1 (en) | Gpr88 mini-promoters | |
| WO2025217494A1 (en) | Splice-switching oligonucleotides for treating cacna1a-associated disorders | |
| US12630826B2 (en) | RNAi agents for inhibiting expression of xanthine dehydrogenase (XDH), pharmaceutical compositions thereof, and methods of use | |
| WO2024145496A2 (en) | Splice-switching oligonucleotides for treating syngap1-associated disorders | |
| US20250283086A1 (en) | Compositions and methods for treatment of kidney disease | |
| WO2022020806A2 (en) | Utrophin genome editing for treating duchenne muscular dystrophy (dmd) | |
| EA046920B1 (en) | ANTISENSE OLIGONUCLEOTIDES RESTORING ABERRANT SPLICING OF ABCA4 | |
| EP4097235A1 (en) | Antisense oligomers and methods for treating parkin-related pathologies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20251218 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |