EP4720261A1 - Novel culture conditions for clonal expansion of nephron progenitor cells, generation of nephron organoids, and rapid and scalable modeling of polycystic kidney disease - Google Patents
Novel culture conditions for clonal expansion of nephron progenitor cells, generation of nephron organoids, and rapid and scalable modeling of polycystic kidney diseaseInfo
- Publication number
- EP4720261A1 EP4720261A1 EP24812019.8A EP24812019A EP4720261A1 EP 4720261 A1 EP4720261 A1 EP 4720261A1 EP 24812019 A EP24812019 A EP 24812019A EP 4720261 A1 EP4720261 A1 EP 4720261A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- inhibitor
- composition
- culture medium
- cell
- cell culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0684—Cells of the urinary tract or kidneys
- C12N5/0687—Renal stem cells; Renal progenitors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
- G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/05—Inorganic components
- C12N2500/10—Metals; Metal chelators
- C12N2500/20—Transition metals
- C12N2500/24—Iron; Fe chelators; Transferrin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/05—Inorganic components
- C12N2500/10—Metals; Metal chelators
- C12N2500/20—Transition metals
- C12N2500/24—Iron; Fe chelators; Transferrin
- C12N2500/25—Insulin-transferrin; Insulin-transferrin-selenium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/117—Keratinocyte growth factors (KGF-1, i.e. FGF-7; KGF-2, i.e. FGF-12)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/15—Transforming growth factor beta (TGF-β)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/235—Leukemia inhibitory factor [LIF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/40—Regulators of development
- C12N2501/415—Wnt; Frizzeled
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/72—Transferases [EC 2.]
- C12N2501/727—Kinases (EC 2.7.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2513/00—3D culture
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Pathology (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Disclosed herein are compositions, culture system, and methods for the stable clonal expansion of nephron progenitor cells (NPCs) and for the generation of nephron organoids. The compositions and culture systems allow for highly pure and clonally expandable NPC population that enables genome wide screens and rapid, efficient, and scalable organoid models of kidney disease.
Description
Attorney Docket No: 065715-000150WOPT NOVEL CULTURE CONDITIONS FOR CLONAL EXPANSION OF NEPHRON PROGENITOR CELLS, GENERATION OF NEPHRON ORGANOIDS, AND RAPID AND SCALABLE MODELING OF POLYCYSTIC KIDNEY DISEASE CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application includes a claim of priority under 35 U.S.C.119(e) to U.S. provisional patent application No.63/468,963, filed May 25, 2023, and to U.S. provisional patent application No. 63/563,055, filed March 08, 2024, the entirety of both of which is hereby incorporated by reference. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT [0002] This invention was made with government support under DK135739 and DK054364 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING [0003] The Sequence Listing submitted May 24, 2024 as a xml file named “065715- 000150WOPT_SL” created on May 23, 2024 and having a size of 112,181 bytes, is hereby incorporated by reference. FIELD [0004] The technology described herein relates to a culture system for the stable clonal expansion of nephron progenitor cells (NPCs), reprogramming differentiated nephrons, generation of nephron organoids, and rapid and scalable modeling of kidney diseases. BACKGROUND [0005] SIX2+ nephron progenitor cells (NPCs) play a central role in kidney organogenesis. In the developing kidney, niche signals coordinate two different NPC fates: some NPCs are induced to form nephrons, the functional units of the kidney, while others self-renew to repopulate the progenitor pool. NPCs are then exhausted shortly after birth in the mice and before birth in humans, leaving limited regenerative potential in adult mammalian kidneys. Dysregulation of NPC fates underlies a number of congenital kidney diseases while uncontrolled proliferation of NPCs in Wilms tumor is the most prevalent pediatric kidney cancer. Thus, a deeper insight into NPC biology is central to improving an understanding of kidney development, congenital disease and cancer, and to applying developmental insight to regenerating kidney functions. 1 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0006] Over the past few years, systems have been developed to either generate NPCs de novo from pluripotent stem cells or expand NPCs from primary NPCs isolated from embryonic/fetal kidneys such that: 1) mouse and human NPC-like cells can now be generated transiently using step-wise directed differentiation protocols from mouse and human pluripotent stem cells (hPSCs); 2) primary mouse and human NPCs can be isolated and expanded for a short period of time in two-dimensional (2D) culture format or expanded long term over a few months in our previously reported three-dimensional (3D) culture format. These systems have advanced the current understanding of NPC biology, and NPC- derived nephron organoids have been shown to be powerful tools in modeling kidney development and diseases. [0007] While acknowledging progress, significant limitations remain. First, current hPSC-derived nephron organoids fail to generate mature and functional kidney cell types and lack a diversity of critical cell types characteristic of distal nephron segments, likely reflecting the quality of hPSC-derived NPC- like cells. Second, compared to 2D culture, the currently available NPC 3D culture system is tedious and less compatible with functional genomics tools, such as CRISPR screens, hindering genomic scale study of NPC biology. Third, it has not been possible to expand NPCs derived from hPSCs, the desired cell source for kidney regeneration and disease modeling, over the long term. [0008] Therefore it is an objective of the present invention to provide a chemically-defined 2D culture system supporting the stable clonal expansion of primary mouse and human nephron progenitor cells, and hPSC-derived induced NPCs (iNPCs), and utilize human iNPC-derived kidney culture to aid in exploring cellular plasticity by screening drugs and small molecule, by screening genome-wide genetics, and by modeling diseases. BRIEF DESCRIPTION OF THE DRAWINGS [0009] The drawings are of illustrative embodiments. They do not illustrate all embodiments. Other embodiments may be used in addition or instead. Details that may be apparent or unnecessary may be omitted to save space or for more effective illustration. Some embodiments may be practiced with additional components or steps and/or without all of the components or steps that are illustrated. When the same numeral appears in different drawings, it refers to the same or like components or steps. [0010] Figs.1A-1P depict^p38 inhibition allowing the derivation of clonal expandable NPC lines from any mouse strain. (1A) Schematic of mNPC line derivation and the applications. 2 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (1B) Quantification of SIX2+/PAX2+ cell percentages in mNPCs after 4 days of culture in mNPSR containing different small molecules as indicated (left panel). Typical bright field images of self- renewing or differentiating mNPCs are shown on the right panels. Scale bars, 50 μm. (1C) Immunostaining of E13.5 mouse kidney section for phosphorylated p38 (p-p38), NPC marker SIX2, and ureteric epithelium marker KRT8. Scale bar, 50 μm. (1D) Morphology of mNPCs cultured in mNPSR-v2 medium for 28 days (D28). Scale bar, 50 μm. (1E) Growth curve of mNPCs cultured in mNPSR-v2 starting from 5,000 cells. (1F and 1G) Immunofluorescence staining (1F) and quantification (1G) of mNPCs cultured in mNPSR-v2 medium for 28 days. Scale bars, 100 μm. (1H) Bright-field image showing 7 days after co-culturing E12.5 spinal cord (SP) with aggregated mNPCs on Transwell filter. Red dashed lines indicate the boundaries between spinal cords and differentiated mNPCs. Scale bar, 200 μm. (1I) Whole-mount immunofluorescence analysis of mNPC-derived nephron structures in (1H). Scale bar, 100 μm. (1J) Time-course bright-field images showing mNPC clonal expansion from one single cell. Scale bars, 50 μm. (1K) Bright-field (BF) and immunofluorescence images of a representative single cell mNPC clone. Scale bars, 50 μm. (1L) Growth curve of a single mNPC cultured in mNPSR-v2 medium over 11 days. (1M) Single cell cloning efficiency of mNPCs derived in 2D culture format (2D NPC), or transitioned from existing 3D-cultured mNPCs to 2D culture (3D-to-2D NPC). (1N) Whole-mount immunofluorescence analyses of nephron organoids generated from a clonal NPC line. Scale bars, 100 μm. (1O) Principal component analysis (PCA) of bulk RNA-seq data of primary NPCs, NPCs cultured in mNPSR-v2 medium, and a negative control Six2-negative population from E12.5 kidney. (1P) Heatmap showing selected marker gene expression in primary and cultured NPCs, based on bulk RNA-seq datasets. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). See also Figure 8, 9 and Tables 1-3. [0011] Figs.2A-2J depict the plasticity of developing nephron cells with mNPSR-v2 medium. 3 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (2A and 2B) Immunofluorescence images (2A) and quantification (2B) of the expression of SIX2 and SALL1, in Six2-GFP- cells isolated from E12.5, E14.5, E16.5, and P0 kidneys and cultured in mNPSR-v2 medium for 4 days. Scale bars, 100 μm. (2C and 2D) Immunofluorescence images (2C) and quantification (2D) of the expression of SIX2 and SALL1 in P3, P4, P5, and P7 whole kidney cells cultured in mNPSR-v2 medium for 4 days. Note that only fluorescence signals in the nucleus were true SIX2 signals. Membrane-bound signals were from the non-specific binding of the SIX2 primary antibody. Scale bars, 100 μm. (2E) Schematic showing the genetic labeling and FACS isolation of the induced Six2-tdT+ cells from P3 kidney cells. (2F) qRT-PCR analysis of primary mNPC, Six2-tdT+ cells cultured for 4 days and 8 days, adult kidney, and E12.5 kidney, for various marker genes . (2G) Schematic showing the genetic labeling, FACS isolation, and culturing of Wnt4-tdT+ cells from P3 kidneys. (2H) Flow cytometry gating plot showing the purification of Wnt4-tdT+ cells from P3 kidneys. (2I and 2J) Immunofluorescence images (2I) and quantification (2J) of the expression of SIX2 and SALL1 in Wnt4-tdT+ kidney cells isolated from P3 kidney, and in whole P3 kidney cells, cultured in mNPSR-v2 medium for 4 days. Scale bars, 100 μm. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. See also Figure 10. [0012] Figs.3A-3M depict genome-wide CRISPR screen in the NPC lines to offer new resources for studying kidney development and disease. (3A) Schematic illustrates the workflow of genome-wide CRISPR knockout screen in mNPC lines. (3B) Box plot showing the distribution of beta scores of all genes or essential genes in two CRISPR screen replicates. Boxes, 25th to 75th percentiles; whiskers, 1st to 99th percentiles. (3C) MAGeCKFlute scatterplots of beta scores showing common positively and negatively selected genes from two CRISPR screen replicates. (3D) Top 11 enriched ingenuity pathway analysis (IPA) Canonical Pathways from CRISPR screen replicate #1. (3E–3I) MAGeCKFlute scatterplots of beta scores from two CRISPR screen replicates showing FGF signaling related genes (3E), NPC signature genes that encode nucleus-localizing proteins (3F), 4 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Wilms tumor-related genes (3G), CAKUT-related genes (3H), and genes that regulate epigenetic mechanisms (3I). (3J and 3K) Normalized read counts of 4 individual sgRNAs targeting Kmt2a (3J) and Kat6a (3K) at the start and the end of the CIRPSR screen. (3L and 3M) Immunofluorescence images (3L) and quantification (3M) of the expression of SIX2, PAX2, SALL1, and WT1 in mNPCs after treated with KMT2A inhibitor MLL1 (inh), or KAT6A inhibitor WM-1119, for 8 days. Scale bars, 50 μm. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. See also Figure 11 and Tables 9-11. [0013] Fig.4A-4U depict YAP activation derives long-term expandable human NPC lines. (4A) Schematic showing the derivation of iNPC lines from hPSCs and applications. (4B–4D) Immunofluorescence images of 11.3-week human fetal kidney sections for SXI2, p-p38 (4B), p-SMAD2/3 (4C), and p-SMAD1/5/8 (4D). Scale bars, 50 μm. (4E and 4F) Immunofluorescence images (4E) and quantification (4F) of YAP expression in iNPCs cultured in hNPSR-v1 medium supplemented with 0, 2, or 4 µM TRULI for 6 days. Scale bars, 50 μm. (4G) Bright-field image of iNPCs cultured in hNPSR-v2 medium for 87 days. Scale bar, 100 μm. (4H) Growth curve of iNPCs cultured in hNPSR-v2 starting from 5,000 cells. (4I and 4J) Immunofluorescence images (4I) and quantification (4J) of iNPCs cultured in hNPSR- v2 medium for 21 days for various NPC marker genes. Scale bars, 50 μm. (4K) Time-course bright-field images showing clonal expansion of iNPCs. Scale bars, 50 μm. (4L) Immunofluorescence analysis of a single cell iNPC clone for SIX2 and PAX2. Scale bars, 50 μm. (4M and 4N) 3D (4M) and 2D (4N) PCA plots of bulk RNA-seq data. (4O) Heatmap showing gene expression of selected marker genes. “D0-iNPC-SIX2” and “D0- iNPC-SIX2/PAX2” are FACS-purified SIX+/PAX2+ iNPCs without further culture;non-NPCs “Pri-SIX2- Neg” are primary SIX2-negative non-NPCs from human fetal kidneys.. (4P and 4Q) Bright field (BF) and fluorescence images (4P) and quantification (4Q) of mCherry expression in iNPCs upon lentiviral overexpression of mCherry (lentiviral OE), or knock-in of mCherry- expressing cassette into AAVS1 allele (CRISPR KI). Scale bars, 50 μm. 5 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (4R-4U) Whole-mount immunofluorescence analyses of human nephron organoids generated from iNPCs cultured in hNPSR-v2 medium for 42 days for various nephron marker genes as indicated. Scale bars, 50 μm. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. See also Figures 12, 13, and Table 2. [0014] Fig.5A-5N depict single cell multiome analysis of iNPC-derived nephron organoids (5A) Schematic of the experimental design of multimodal analyses, and the major conclusions. (5B) PCA plot of bulk RNA-seq data. (5C) Heatmap showing expression of selected markers for human nephrogenesis. (5D) UMAP projection of iNPC-derived nephron organoid snRNA-seq dataset. (5E) UMAP projection of signature gene expression (5F) Dot plot of cluster-enriched gene expression. (5G) UMAP projection of integrated single-cell datasets of iNPC-derived organoids and other published hPSC-derived kidney organoids. (5H) Proportions of cell types identified in (5G) in different kidney organoids. (5I and 5J) NPHS1 expression in the integrated dataset (5G) is shown through a feature plot (5I), and a violin plot (5J). (5K-5M) Dot plots of marker gene expression of proximal tubule population (5K), distal tubule population (5L), and podocyte population (5M) from the integrated dataset (5G). (5N) Genome browser views of snATAC-seq open chromatin regions of selected genes in iNPC- derived podocyte (COL4A3, COL4A4, and NPHS1) and distal tubule (SLC12A1), as compared to adult kidney’s podocyte and distal tubule. See also Figure 14. [0015] Fig.6A-6T depict reprogramming from podocyte to NPC by hNPSR-v2 reveals human podocyte plasticity. (6A) Schematic of the reprogramming process. (6B) Flow cytometry gating plots showing isolation of SIX2-GFP- cells from day 7 nephron organoids (left) and purification of SIX2-GFP+ rNPCs from SIX2-GFP- cells upon culture in hNPSR-v2 (right). 6 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (6C) Bright field image of rNPCs from (6B), cultured in hNPSR-v2 for 13 days. Scale bar, 50 µm. (6D) PCA of bulk RNA-seq data. (6E) Flow cytometry gating plots showing isolation of SIX2-GFP-/PODXL+ podocytes from day 7 nephron organoids (left) and purification of SIX2-GFP+ rNPCs from SIX2-GFP-/PODXL+ cells upon culture in hNPSR-v2 (right). (6F) Bright field images of SIX2-GFP-/PODXL+ podocytes from (6E) and the derivative rNPCs. Scale bars, 50 µm. (6G-6J) Immunofluorescence images and quantification of SIX2-GFP-/PODXL+ podocytes (6G and 6I) and the derivative rNPCs (6H and 6J). Scale bars, 50 µm. (6K) Bright-field (BF) and immunofluorescence images of day 8 nephron organoid (derived from MAFB-GFP iNPC line). Scale bars, left, 200 µm; right, 100 µm. (6L) Flow cytometry gating plot showing the enrichment of rNPCs based on ITGA8 expression. (6M) Bright-field image of rNPC line derived from MAFB-GFP+ podocytes. Scale bar, 50 µm. (6N and 6O) Whole-mount immunofluorescence images of rNPC line (from MAFB-GFP+ podocytes) derived organoids. Scale bars, left, 200 µm; right, 50 µm. (6P) Flow cytometry gating plots showing isolation of PODXL+ primary podocytes from 17.4 week human fetal kidney (left) and enrichment of ITGA8+ rNPCs upon culture in hNPSR-v2 (right). (6Q) Immunofluorescence images of primary podocyte-derived rNPC line cultured in hNPSR-v2 for 31 days. Scale bars, 50 µm. (6R) Whole-mount immunofluorescence images of rNPC (from primary podocyte)-derived nephron organoid. Scale bars, left, 200 µm; right, 50 µm. (6S) Heatmap showing expression of selected marker gene expression during podocyte-to-NPC reprogramming process. (6T) Schematic of the model of podocyte-to-NPC reprogramming. See also Figure 15, 16. [0016] Fig.7A-7N depict rapid, efficient, and scalable PKD modeling and small molecule screening from genome-edited mouse NPCs. (7A-7B) Schematic of the experimental protocol for generating scalable mouse (7A) and human (7B) PKD organoid models from genome-edited NPC lines. (7C) Bright-field and GFP images showing GFP-/- (control) or PKD2-/- mini mNPC aggregates (from Cas9-GFP genetic background) in Aggrewell. Scale bars, 500 µm. 7 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (7D) Quantification of the numbers of pHH3+ nuclei in LTL+/CDH+ cells from Pkd2-/- or GFP-/- mini nephron organoids. (7E) Heatmap of selected gene expression as determined by qRT-PCR. (7F) Metabolic analyses of OCR and ECAR in Pkd2-/- or GFP-/- mini nephron organoids using Sea- horse assays. Blank boxes indicate baseline levels and filled boxes indicate stressed levels upon oligo/FCCP treatment. (7G) Heatmaps showing the quantification of small molecule screening results in terms of cyst formation efficiency (left) and cyst diameter (right). Identified HDAC inhibitor hits are shown in green, and BRD4 inhibitors are shown in blue. (7H) Venn diagram showing the common small molecule candidates identified in (7G). (7I) Western blot analysis of PC2 expression in candidate PKD2-/- single cell hPSC clones. (7J) Schematic of CRISPR/Cas9-mediated random insertions or deletions (indels) on the first exon of PKD2 gene and the outcome on PKD2 expression in #10 and #11 PKD2-/- clones. (7K) Bright field images showing rapid cyst formation in the mini PKD organoids. Right panels show enlarged pictures of the boxed areas from the left panels. Scale bars, 500µm and 200 µm (enlarged pictures). (7L) Bright-field images showing cyst formation in PKD2-/- iNPC-derived nephron organoids treated with DMSO, 10 µM Tolvaptan, 0.1 µM staurosporine (STS), and PTC-209 at 10 nM, 100 nM, or 1 µM. Scale bars, 200 µm. (7M) Quantification of the percentages of cystic organoids in samples shown in (L). (7N) Immunofluorescence images of PKD2-/- iNPC-derived nephron organoids in (L) for TUNEL assay. Scale bars, 50μm. Data are presented as mean ± SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01. See also Figures 17-23 [0017] Fig.8A-8M depict development of mNPSR-v2 medium and characterization of mNPCs cultured in mNPSR-v2 medium. Related to Figure 1. (8A) Schematic of the experimental procedure for the development of mNPSR-v2 medium. (8B) Bright-field (BF) and immunofluorescence images of primary mNPCs after 4 days of culture in media containing different concentrations of CHIR99021, LDN193189, and SB202190 as indicated, on top of mNPSR medium. Scale bars, 50 μm (bright field) and 100 μm (fluorescence). 8 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (8C) Bright-field images of primary mNPCs cultured in mNPSR-v2 medium with or without DAPT for 4 days. Lower panels show enlarged pictures of the boxed areas in the upper panels, highlighting the differentiated morphology from the condition without DAPT. Scale bars, 100 μm (upper panels), 50 μm (lower panels). (8D) qRT-PCR analysis of mNPCs cultured for 4 days in mNPSR-v2 medium with or without DAPT for NPC marker genes as indicated. (8E) qRT-PCR analysis of two long-term cultured mNPC lines, derived from NPCs at two developmental stages (E12.5 and E16.5), for NPC marker gene expression as indicated. Primary E12.5 mNPC sample was used as control. (8F) Bright-field images of established mNPC line upon withdrawal of each individual mNPSR- v2 medium component as indicated for 2 days. mNPCs cultured in complete mNPSR-v2 medium were used as control. Scale bars, 50 μm. (8G) qRT-PCR of mNPCs cultured in different media as shown in (8F), for Lhx1 and Pax8, two marker genes representing early nephron induction. (8H) Whole-mount immunofluorescence analyses of nephron organoids derived from E13.5 NPC line (Day 28 of culture) for various marker genes representing glomerulus (PODXL and WT1), proximal tubule (LTL, PAX2, PAX8), loop of Henle (AQP1, PAX2, PAX8), and distal tubule (DBA, PAX2 and PAX8). The nephron organoids were generated using chemically-defined medium protocol. Scale bars, 100 μm. (8I) Time-course bright-field (BF) and Hoxb7-Venus fluorescence images of an engineered kidney, reconstructed from cultured mNPCs and cultured mouse UB (labeled with Hoxb7-Venus) and cultured on Transwell air-liquid interface, from day 2 (D2) through day 7 (D7). Scale bars, 200 μm. (8J) Whole-mount immunofluorescence analysis of the D7 engineered kidney in (I) for various nephron marker genes as indicated. UB-derived structures were labeled with KRT8. Scale bar, 200 μm. (8K) Chick chorioallantoic membrane (CAM) assay showing host chicken vasculature invasion into cultured mNPCs, 5 days after transplantation. Scale bars, 1 cm. (8L) Bright-field (BF) and GFP images of the mNPC transplant in CAM assay, showing the gradual formation of vasculature around the Cas9-GFP mNPCs from 3 days (D3) to 5 days (D5) upon transplantation. Scale bars, 200 μm. (8M) Whole-mount immunofluorescence images showing the formation of nephron structures 5 days after mNPCs were transplanted to CAM. Scale bar, 100 μm. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. 9 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0018] Figs.9A-9K depict derivation of mNPC Lines from E11.5 MM and whole embryonic kidneys. Related to Figure 1. (9A and 9B) Immunofluorescence images (9A) and quantification (9B) of a representative clonal mNPC line derived from parental mNPCs cultured for 44 days in mNPSR-v2, for various NPC marker gene expression as indicated. Scale bars, 100 μm. (9C and 9D) Two-dimensional presentation of principal component analysis (PCA) of bulk RNA- seq data of various primary NPCs isolated from different developmental stages, NPCs cultured in mNPSR-v2 medium, and a negative control Six2-negative population from E12.5 kidney. (9E) qRT-PCR analyses of long-term cultured E11.5 MM-derived mNPC lines (on day 37 and day 54) for NPC marker genes Six2, Pax2, Hoxd11, Eya1, and IPC marker gene Foxd1. Primary E12.5 mNPCs, and primary Foxd1+ mIPCs (freshly FACS purified from E13.5 kidneys of Foxd1-GFP reporter mice) were used as controls. Note the lack of Foxd1 expression in the MM-derived mNPC lines, suggesting the selective expansion of NPCs, but not IPCs, from the mNPSR-v2 medium. (9F) Whole-mount immunofluorescence analyses of nephron organoids derived from E11.5 MM- derived NPC line (Day 54 of culture) for various marker genes representing glomerulus (PODXL and WT1), proximal tubule (LTL, PAX2, PAX8), loop of Henle (AQP1, PAX2, PAX8), and distal tubule (DBA, PAX2, and PAX8). The nephron organoids were generated using chemically-defined medium protocol. Scale bars, 50 μm. (9G and 9H) Immunofluorescence analyses (9G) and quantification (9H) of E13.5 whole kidney cells cultured in mNPSR-v2 medium for the first three passages for various NPC marker genes as indicated. Scale bars, 100 μm. (9I and 9J) Immunofluorescence analyses (9I) and quantification (9J) of E13.5 whole kidney cell- derived mNPC line, after 30 days of culture in mNPSR-v2 medium, for NPC marker genes as indicated. Scale bars, 100 μm. (9K) Whole-mount immunofluorescence analyses of nephron organoids derived from E13.5 whole kidney-derived NPC line (Day 30 of culture) for various nephron marker genes as indicated. The nephron organoids were generated using chemically-defined medium protocol. Scale bars, 100 μm. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0019] Figs.10A-10G depict plasticity of developing kidney cell types in vitro. Related to Figure 2. 10 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (10A) Immunofluorescence images of E14.5, P3, P4, and P5 kidney sections for NPC (SIX2) and UB (KRT8) markers. Note that only E14.5 kidney section showed SIX2+ cells (nucleus localization) surrounding the KRT8+ UB tips. Membrane-bound SIX2 signals from P3, P4 and P5 kidney sections were from the non-specific binding of the SIX2 primary antibody to some renal tubules. Scale bars, 100 μm. (10B and 10C) Immunofluorescence images (10B) and quantification (10C) of P4 whole kidney cells cultured in mNPSR-v2 medium for overnight or 4 days, for NPC marker genes SIX2 and SALL1. Note that only fluorescence signals in the nucleus were true SIX2 signals. Membrane-bound signals were from the non-specific binding of the SIX2 primary antibody. Scale bars, 100 μm. (10D and 10E) Immunofluorescence staining (10D) and quantification (10E) of P3 whole kidney cells cultured in mNPSR-v2, mNPSR, and 10% FBS media for 4 days, for various NPC marker genes as indicated. Note that only fluorescence signals in the nucleus were true SIX2 signals. Membrane-bound signals were from the non-specific binding of the SIX2 primary antibody. Scale bars, 100 μm. (10F) Bright-field and Six2-tdTomato fluorescence images of P3 whole kidney cells cultured in mNPSR-v2 for 4 days following experimental procedures described in Fig.2E. Scale bars, 100 μm. (10G) Flow cytometry analysis of P3 whole kidney cells cultured in mNPSR-v2 for 4 days following experimental procedures described in Fig.2E. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0020] Figs.11A-11I depict genome-wide CRISPR screen in mouse NPC lines. Related to Figure 3. (11A) MAGeCKFlute scatterplot of beta scores from two biological replicates of mNPC lines on all genes. Grey line means y=x, and red line is the fitted line. (11B) Distribution of normalized sgRNA read counts in the plasmid library, and in two CRISPR screen samples. (11C) Box plot showing the distribution of normalized sgRNA read counts in the CRISPR screen plasmid library, and in two CRISPR screen samples. Boxes, 25th to 75th percentiles; whiskers, 1st to 99th percentiles. (11D) Top 18 enriched ingenuity pathway analysis (IPA) canonical pathways from CRISPR screen replicate #2. Pathways shown in green color are well-established pathways in NPC self-renewal. (11E) Common enriched IPA canonical pathways identified from CRISPR screen #1 and #2. (11F and 11G) MAGeCKFlute scatterplots of beta scores from two CRISPR screen replicates showing Wnt (11F) and LIF (11G) signaling related genes. 11 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (11H) Immunofluorescence analyses of the expression of NPC marker genes SIX2, PAX2, SALL1, and WT1 in mNPCs after treated with KMT2A inhibitor WDR5 degrader, or KAT6A inhibitor MOZ-IN-3, for 8 days. Scale bars, 50 μm. (11I) Quantification of images in (11H). Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0021] Figs.12A-12R depict characterization of long-term expandable iNPCs derived from hPSCs. Related to Figure 4. (12A) Immunofluorescence analyses of 11.3-week human fetal kidney sections for SIX2 and p- p38. Scale bars, 50 μm. Related to Figure 4. (12B) Schematic of the directed differentiation protocol to generate iNPCs from SIX2-GFP; PAX2-mCherry dual-reporter hPSC line. The protocol was adapted from Morizane et al., 2015, with minor modification to add ROCK inhibitor Y27632 on Step 2 to enhance cell survival. After 10 days of differentiation, SIX2-GFP+/PAX2-mCherry+ iNPCs were isolated by fluorescence-activated cell sorting (FACS) then cultured in hNPSR-v2 medium. (12C) Representative flow cytometry plot showing the percentages of SIX2-GFP+/PAX2- mCherry+ population and SIX2-GFP+/PAX2-mCherry- population upon 10 days of differentiation from the dual-reporter hPSC line following the protocol described in (12B). (12D and 12E) Immunofluorescence images (12D) and quantification (12E) of iNPCs cultured in hNPSR-v2 medium for 87 days, for the expression of YAP and various human NPC marker genes. Scale bars, 50 μm. (12F) qRT-PCR analyses of iNPCs cultured in hNPSR-v2 medium for 30 days, 55 days, and 80 days for expression of various NPC marker genes as indicated. (12G) Bright-field and live-cell fluorescence images showing the expression of SIX2-GFP and PAX2-mCherry in two representative iNPC clones derived from single cells. Scale bars, 50 μm. (12H) Summary of iNPC cloning efficiency from three independent experiments. (12I) Bright-field image of unpurified hPSC-derived iNPCs (all the cells after 10 days of hPSC differentiation following protocol described in (12B), without FACS sorting for SIX2-GFP+/PAX2- mCherry+ population), upon culture in hNPSR-v2 medium for 21 days. Note that all the cells show highly uniform morphology that is indistinguishable from the cultured FACS-purified iNPCs shown in Figure 4G. Scale bar, 100 μm. 12 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (12J) Immunofluorescence images of unpurified iNPCs cultured in hNPSR-v2 medium for 21 days, for various NPC marker genes as indicated. Scale bars, 50 μm. (12K) Quantification of immunofluorescence staining results of unpurified iNPCs cultured in hNPSR-v2 medium for 7 days, 14 days, and 21 days, for various NPC marker genes as indicated. (12L) Two-dimensional PCA plot of bulk RNA-seq data. Different colors represent different primary NPCs, primary non-NPCs, iNPCs without culture, human NPCs cultured in hNPSR-v1 medium for 15 days, or human NPCs cultured in hNPSR-v2 medium for around 15 days, 30 days, 50 days, or 80 days. (12M) Time-course bright-field and live-cell fluorescence images showing the morphological changes and PAX2-mCherry reporter expression during the 14-day nephron organoid formation process starting from cultured iNPCs. Note the dramatic morphological changes from day 1 (D1) to day 3 (D3) when numerous tubule-like structures start to form, reflecting mesenchymal-to-epithelial transition, a key early step towards nephron formation. Scale bars, 100 μm. (12N) Bright-field and PAX2-mCherry images of iNPC-derived organoids on Day 8. Scale bars, 200 μm. (12O) Whole-mount immunofluorescence images of D8 iNPC-derived organoids. Scale bars, left, 200 μm; right, 50 μm. (12P-12R) Whole-mount immunofluorescence images of end-point iNPC-derived organoids for proximal tubule-associated transporters SLC27A1 (12P) and SLC34A1 (12Q), and neuronal marker genes MAP2 and NeuN (12R). WT1 and PODXL are glomerulus markers which serve as controls for immunostaining in (12R) Scale bars, 100 μm. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0022] Figs.13A-13N depict derivation of hNPC lines from human fetal kidney tissue. Related to Figure 4. (13A) Schematic showing the experimental procedures for derivation of long-term expandable hNPC lines from human fetal kidney tissue with hNPSR-v2 medium. (13B) Immunofluorescence images of 11.3-week human fetal kidney sections co-stained for NPC marker genes SIX2 and ITGA8. Scale bars, 50 μm. (13C) Flow cytometry plots showing percentages of ITGA8+ populations (circled) from 11.4- week or 12-week fetal kidneys as two representative examples. 13 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (13D and 13E) Immunofluorescence images (13D) and quantification (13E) of FACS-enriched primary ITGA8+ hNPCs, after overnight culture in hNPSR-v2 medium, for NPC marker genes SIX2 and PAX2. Scale bars, 50 μm. (13F) Time-course bright-field images of the morphology and growth of representative human fetal kidney-derived hNPCs cultured in hNPSR-v2 medium in a typical passage cycle from day 1 (D1) to day 4 (D4). Scale bars, 100 μm. (13G) Bright-field image of human fetal kidney-derived hNPC line cultured in hNPSR-v2 medium for 63 days. Scale bar, 100 μm. (13H) Growth curve of human fetal kidney-derived hNPC line cultured in hNPSR-v2 medium in a typical 4-day passage cycle starting from 5,000 cells. (13I) Immunofluorescence images of human fetal kidney-derived hNPC line cultured in hNPSR- v2 medium for 87 days for the expression of YAP and various human NPC marker genes. Scale bars, 100 μm. (13J) Quantification of immunostaining results from (13I). (13K) Schematic showing the chemically-defined stepwise human nephron organoid induction protocol starting from cultured hNPCs or iNPCs. (13L) Time-course bright-field images showing the induction of human nephron organoid from cultured hNPCs following the stepwise 14-day differentiation protocol as described in (13K). Scale bars, 100 μm. (13M) Whole-mount immunofluorescence analyses of human nephron organoids generated from hNPCs cultured in hNPSR-v2 medium for 45 days. Different segments of the nephron were formed, including glomerulus (PODXL, WT1), proximal tubule (HNF4A, LTL), loop of Henle (AQP1, SLC12A1), and distal tubule (CDH1). Note that no neuronal cells positive for NeuN were observed, suggesting limited off-target cell population in the cultured NPC-derived nephron organoid. Scale bars, 100 μm. (13N) Bright-field image of human nephron organoid generated from hNPCs cultured in hNPSR- v2 medium for 104 days. Scale bar, 200 μm. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0023] Figs.14A-14F depict single-cell multiome analysis of D21 iNPC-derived nephron organoids. Related to Figure 5. 14 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (14A and 14B) Dataset as violin plots of clusters demonstrating cluster levels for nCount_RNA, nFeature_RNA, percent.mt (14A), and nCount_ATAC, nFeature_ATAC, TSS.enrichment (14B). (14C) UMAP projection of 21 cell clusters within iNPC-derived nephron organoids. (14D) UMAP projection of signature gene expression for proximal tubule (HNF4A and LRP2), distal tubule (POU3F3 and IRX1), and interstitium (COL1A1) in iNPC-derived nephron organoids. (14E) Violin plots of selected marker gene expression in the integrated single-cell dataset. (14F) UMAP plot revealing 18 cell clusters within the integrated single-cell dataset of iNPC- derived organoids and other published kidney organoids. [0024] Figs.15A-15P depict Reprogramming with hNPSR-v2. Related to Figure 6. (15A and 15B) Immunofluorescence image (A) and quantification (B) of purified rNPCs (OG- D7) cultured in hNPSR-v2 medium for 22 days. Scale bars, 50 μm. (15C) Bright-field, SIX2-GFP, and PAX2-mCherry images of aggregated rNPCs (OG-D7) cultured in hNPSR-v2 medium for 13 days or 19 days (left). And their derivative nephron organoids (right). Scale bars, left, 100 μm; right, 200 μm. (15D) Whole-mount immunofluorescence analysis of rNPC (OG-D7)-derived organoids. Scale bars, whole-mount, 200 μm; enlarged, 50 μm. (15E) Schematic demonstration of the method for the generation of iNPC-derived nephron organoids and characterization at different timepoints to assess human nephron plasticity. (15F) Morphology of cultured iNPCs, rNPCs (OG-D3), rNPCs (OG-D5), and rNPCs (OG-D8). Scale bars, 50 μm. (15G-15I) Whole-mount immunofluorescence analysis of organoids derived from rNPCs (OG- D3), rNPCs (OG-D5), and rNPCs (OG-D8). Scale bars, whole-mount, 200 μm; enlarged, 50 μm. (15J) Two-dimensional principal component analysis (PCA) of bulk RNA-seq data of primary hNPCs, primary non-hNPCs, hNPCs cultured in hNPSR-v2 medium, OG-D7 SIX2- cells, and rNPCs (OG-D3, OG-D5, OG-D7). (15K) Heatmap showing expression of selected undifferentiated NPC and differentiated kidney cell type marker genes in primary hNPCs, primary non-hNPCs, hNPCs cultured in hNPSR-v2 medium, OG-D7 SIX2- cells, and rNPCs (OG-D3, OG-D5, OG-D7). (15L) Time-course bright-field images of OG-D7 SIX2-/PODXL+ podocytes cultured in hNPSR- v2 for the first 7 days. Scale bars, 50 μm. (15M) Whole-mount immunofluorescence analysis of rNPCs (OG-D7-pod)-derived organoids. Scale bars, whole-mount, 200 μm; enlarged, 50 μm. (15N) Flow cytometry gating plot showing the purification of OG-D8 MAFB-GFP cells. 15 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (15O and 15P) Immunofluorescence image (15O) and quantification (15P) of purified rNPCs (OG-D8-MAFB-pod) cultured in hNPSR-v2 medium for 17 days. Scale bars, 50 μm. [0025] Figs.16A-16N depict transcriptome profiling of podocyte-to-NPC reprogramming in hNPSR-v2. Related to Figure 6. (16A) Flow cytometry gating plot showing the purification of 11.4-wk hFK PODXL+ cells. (16B and 16C) Immunofluorescence image (16B) and quantification (16C) of isolated 11.4-wk hFK PODXL+ cells cultured in hNPSR-v2 medium overnight and for 22 days. Scale bars, 50 μm. (16D and 16E) Immunofluorescence image (16D) and quantification (16E) of isolated 17.4-wk hFK PODXL+ cells cultured in hNPSR-v2 medium overnight and for 22 days. Scale bars, 50 μm. (16F) Morphology of rNPCs(17.4-wk hFK-pod) cultured in hNPSR-v2 medium for 31 days. Scale bar, 50 μm. (16G) Quantification of immunofluorescence image shown in Fig.6Q. (16H) Bright-field (BF) and whole-mount immunofluorescence images of rNPC (17.4-wk hFK- pod)-derived organoids. Scale bars, BF and whole-mount, 200 μm; enlarged, 50 μm. (16I) 3D PCA plot of bulk RNA-seq data of FACS-purified SIX2-/PODXL+ podocytes (D0), and upon culture in hNPSR-v2 medium for 2, 4, 6, 9, 16, and 24 days. Note that on D7, SIX2+ cells emerged from podocyte culture were purified by FACS based on SIX2-GFP, before continuous culture till D24 (see also Methods). (16J) Unsupervised clustering based on Pearson correlation of bulk RNA-Seq datasets for samples described in (16I). (16K and 16L) Volcano plots showing differentially expressed genes between D4 and D0 samples, and between D24 and D4 samples as described in (16I). (16M and 16N) Gene ontology (GO) analysis on differentially expressed genes between D4 and D0 samples, and between D24 and D4 samples as described in (16I). Data are presented as mean ± SD. Each column represents counts from three biological replicates (n=3). [0026] Figs.17A-17J depict Generation of Pkd1"/" or Pkd2"/" mNPC lines through one-step multiplexed CRISPR-Cas9 knockout (KO) system. Related to Figure 7. (17A) Schematic showing the lentiviral vector design for one-step multiplexed CRISPR-Cas9 knockout (KO). 16 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (17B) Bright-field and EGFP images of aggregated Cas9-GFP mNPCs 7 days upon infection of lentivirus targeting EGFP gene and puromycin selection. Empty lentiviral vector without sgRNA was used as control. Scale bars, 200 μm. (17C) Flow cytometry analysis of EGFP expression in control (left) or EGFP KO (right) Cas9- GFP mNPCs. (17D) qRT-PCR analysis for various NPC marker genes as indicated in bulk EGFP-/-, Pkd1-/-, and Pkd2-/- NPC lines 28 days after lentiviral infection and puromycin selection. Primary NPC sample was used as control . (17E) Western blot analysis of bulk EGFP-/-, Pkd1-/-, and Pkd2-/- mNPC lines (day 28 of culture after lentiviral infection) for PC2, PAX2, and SIX2, and beta-actin (ACTB) expression. (17F) Cloning efficiency of deriving Pkd1-/- or Pkd2-/- clonal mNPC lines from bulk Pkd1-/- or Pkd2-/- mNPCs. (17G) qRT-PCR analyses of long-term cultured (26 days) Pkd1-/- and Pkd2-/- clonal mNPC lines for various NPC marker genes as indicated. Primary NPC sample was used as control. (17H) PCR-based genotyping for Pkd1-/- or Pkd2-/- clonal mNPC lines. Wild-type (WT) mNPC line without genome editing was used as control. (17I) Schematic showing the multiplexed CRISPR/Cas9-mediated deletions on the first exon of Pkd2 gene, leading to double allele premature termination of Pkd2 transcription and thus successful gene knockout of Pkd2, in Pkd2-/- clonal mNPC lines #4 and #5. (17J) Western blot analysis of Pkd2-/- clonal mNPC lines for PC2, PAX2, and SIX2, and beta- actin (ACTB) expression. Wild-type (WT) mNPC line without genome-editing, cultured for a similar time period, was used as control. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0027] Figs.18A-18M depict rapid, efficient, and scalable PKD modeling from genome-edited mouse NPCs. Related to Figure 7. (18A) Schematic of the experimental protocol for deriving cystic nephron organoid model from Pkd1-/- or Pkd2-/-clonal mNPC lines. (18B) Bright-field images showing cyst formation in nephron organoids derived from Pkd1-/- or Pkd2-/- clonal mNPC lines. mNPC line with EGFP KO in bulk was used as control. Scale bars, 200 μm. (18C) Quantification of the percentages of cystic organoids in samples shown in (18B). 17 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (18D) Bright-field images of PKD organoids derived from fresh Pkd2-/- nephron organoids, or Pkd2-/- nephron organoids after freeze-thaw process, following experimental procedure as described in (18A). Scale bars, 200 μm. (18E and 18F) Quantification of cystic organoid percentages (18E) and cyst diameters (18F) for samples shown in (18D). (18G) Bright-field images of Pkd2-/- clonal mNPC line #4 -derived nephron organoids treated with DMSO (control), or various previously reported PKD drugs: CFTRinh172, metformin, tolvaptan, and AZ505. Scale bars, 200 pm. (18H and 18I) Quantification of the cyst diameters (18H) and percentages of cystic organoids (18I) in samples shown in (18G). (18J) Time-course bright-field images showing the development of cystic mini nephron organoids from the Pkd2-/-mNPC clonal line, following experimental procedures described in Figure 7A. Enlarged pictures of the boxed areas in the upper panels are shown in the lower panels. Scale bars, 500 pm (upper panels) and 200 pm (lower panels). (18K) Bright-field images showing cyst growth at 5 days and 9 days after shaking culture using protocol described in Figure 7A. Scale bars under each timepoint, 500 pm (left panels) and 200 pm (right panels). (18L and 18M) Quantification of cystic organoid percentages (18L) and cyst diameters (18M) for samples from (18K). Data are presented as mean ± SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001 [0028] Figs.19A-19F depict optimization of clonal Pkd2-/- mNPC-derived mini PKD organoid model. Related to Figure 7. (19A) Schematic of the chemically-defined differentiation protocol to generate nephron organoid from cultured mNPCs on Transwell air-liquid-interface. (19B and 19C) Upper panel shows the schematic of the experimental design for optimizing cystic PKD organoid generation via manipulation of basal medium and different doses of CHIR99021. Green color indicates the variables tested (19B). Lower panel shows the results of the experiments, in which bright-field images of mini nephron organoids derived from two clonal GFP-/- mNPC lines (#1 and #2) or two Pkd2-/- mNPC lines (#4 and #5) after 5 days of differentiation in shaking culture are shown. Two different basal media, hBI or KR5 (see also Methods for the detailed medium components), were tested. Under each basal medium, different concentrations of CHIR99021 (3 pM, 4.5 pM, 6 pM) were added 18 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT together with 200 ng/ml FGF2, for 2 days, followed by continuous culture in the same basal medium for another 3 days. Note that the results indicated that KR5 is superior to hBI in supporting cyst development while different concentrations of CHIR99021 did not have dramatic differences in KR5 basal medium (19C). Scale bars 200 μm. (19D and 19E) Upper panel shows the schematic of the experimental design for further optimizing cystic PKD organoid generation, based on the selected best culture condition identified in (19C), in which KR5 medium with 200 ng/ml FGF2 and 4.5 µM CHIR99021 was added for the first 2 days, followed by KR5 medium only for another 3 days. Pkd2-/- mini nephron organoids were generated in this culture condition with or without the addition of 1% Matrigel (MTG), and under shaking culture (120 rpm) or static suspension culture (19D). Lower panel shows the results of the experiments. Note that shaking culture without 1% MTG generated the best cystic organoids with limited organoid fusion and was selected as the finalized protocol (19E). Scale bars, 200 μm. (19F) Summary of observations in (19C), upper panel, and (19E), lower panel, in terms of cyst formation, organoid fusion, and health status of the GFP-/- or Pkd2-/- mini nephron organoids generated in different conditions tested. [0029] Figs.20A-20P depict Pkd2-/- mini PKD organoids recapitulate molecular, cellular, and metabolic features of PKD. Related to Figure 7. (20A) Immunofluorescence analysis of Pkd2-/- or GFP-/- mini nephron organoids for pHH3, LTL and CDH1. C, cystic portion; M, mesenchymal portion; T, tubule portion. Scale bars, 100 μm. (20B) Genomic DNA concentrations from single mini nephron organoids derived from EGFP-/- or Pkd2-/- mNPCs. The same number of EGFP-/- or Pkd2-/- mNPCs were seeded to form organoids. Note the significantly higher genomic DNA concentrations from the Pkd2-/- organoids, suggesting higher cell proliferation in the cystic organoids. (20C) Bright-field images showing the separation of cystic and non-cystic parts from the Pkd2-/- organoids through microdissection. Scale bars, 200 μm. (20D) Heat map presentation of cell cycle, mTOR signaling, and MYC activity associated gene expression levels as determined by qRT-PCR, in cystic parts and non-cystic parts of Pkd2-/- mini PKD organoids. (20E) Metabolic analyses of OCR and ECAR in Pkd2-/- or EGFP-/- NPCs using Seahorse assays. Blank boxes indicate baseline levels and filled boxes indicate stressed levels upon oligo/FCCP treatment. (20F–20I) Measurement of oxygen consumption rate (OCR, 20F and 20G) and extracellular acidification rate (ECAR, 20H and 20I) in GFP-/- or Pkd2-/- mini nephron organoids under baseline or 19 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT oligo/FCCP treatment-induced stressed state using Seahorse XFp assays.20F and 20H show experimental tracings, and 20G and 20I show summary data. (20J–20M) Measurement of OCR (20J and 20K) and ECAR (20L and 20M) in GFP-/- or Pkd2-/- NPCs under baseline or oligo/FCCP treatment-induced stressed state using Seahorse XFp assays.20J and 20L show experimental tracings, and 20K and 20M show summary data. (20N and 20O) Quantification of metabolic potential of GFP-/- or Pkd2-/- mini nephron organoids (20N), or GFP-/- or Pkd2-/- NPCs (20O), under baseline or oligo/FCCP treatment-induced stressed state. (20P) Quantification of baseline OCR/ECAR ratios in GFP-/- or Pkd2-/- mini nephron organoids, and in GFP-/- or Pkd2-/- NPCs. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0030] Figs.21A-21E depict validation of identified small molecule candidate PTC-209. Related to Figure 7. (21A) Pie chart showing the categories of 148 small molecules in the small molecule screen library targeting major epigenetic regulatory pathways . (21B) Bright-field images of Pkd2-/- clonal NPC line #5-derived mini nephron organoids upon treatment with representative PKD small molecule candidates identified during the small molecule screening. Treatment with DMSO, and different doses of metformin and tolvaptan, were used as controls. Scale bars, 500 μm. (21C) Bright-field images of Pkd2-/- mini nephron organoids treated with different concentrations of PTC-209 (small molecule candidate), SB939 (representative HDAC inhibitor, positive control) and AZD5153 (representative BRD4 inhibitor, positive control). Scale bars, 200 μm (>30 mini nephron organoids/group). (21D and 21E) Quantification of cystic organoid percentages (21D) and cyst diameters (21E) for samples in (21C). Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0031] Figs.22A-22J depict validation of PTC-209 in PKD2-/- iNPC-derived mini organoids. Related to Figure 7. 20 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT (22A) Bright-field and GFP images of mini PKD2-/- SIX2-GFP iNPC aggregates upon seeding onto Aggrewell plate overnight. Scale bars, 500 μm. (22B) Bright-field (BF) and immunofluorescence images of a cystic nephron organoid derived from PKD2-/- iNPCs. Right panels show enlarged images of the boxed cystic area from the left panel. Scale bars, 500 μm (left panel) and 100 μm (right panels). (22C and 22D) Quantification of cystic organoid percentages (22C) and cyst diameters (22D) for samples shown in Figure 7K. (22E) Bright-field images of PKD2-/- iNPC-derived mini cystic PKD organoids treated with various known drugs for PKD. Scale bars, 500 μm. (22F and 22G) Quantification of cystic organoid percentages (22F) and cyst diameters (22G) for samples shown in (22E). (22H-22J) Quantification of TUNEL+ cells/organoid (22H), TUNEL+ cells in PODXL+ cells/organoid (22I), and TUNEL+ cells in CDH1+ cells/organoid (22J) in PKD2-/- iNPC-derived nephron organoids with different treatments as shown in Fig.7N. Data are presented as mean ^ SD. Each column represents counts from three biological replicates (n=3). The significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. [0032] Figs.23A-23D depict full gel electrophoresis and immunoblotting images. Related to Figure27, 17 and 21. (23A) Full immunoblotting images for data shown in Figure 7I. (23B) Full immunoblotting images for data shown in Figure 17E (23C) Full gel electrophoresis images for data shown in Figure 17H (23D) Full immunoblotting images for data shown in Figure 17J DETAILED DESCRIPTION [0033] All references cited herein are incorporated by reference in their entirety as though fully set forth. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 3rd ed., Revised, J. Wiley & Sons (New York, NY 2006); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 7th ed., J. Wiley & Sons (New York, NY 2013); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 4th ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, NY 2012), provide one skilled in the art 21 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT with a general guide to many of the terms used in the present application. For references on how to prepare antibodies, see D. Lane, Antibodies: A Laboratory Manual 2nd ed. (Cold Spring Harbor Press, Cold Spring Harbor NY, 2013); Kohler and Milstein, (1976) Eur. J. Immunol.6: 511; Queen et al. U. S. Patent No.5,585,089; and Riechmann et al., Nature 332: 323 (1988); U.S. Pat. No.4,946,778; Bird, Science 242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988); Ward et al., Nature 334:544-54 (1989); Tomlinson I. and Holliger P. (2000) Methods Enzymol, 326, 461-479; Holliger P. (2005) Nat. Biotechnol. Sep;23(9):1126-36). [0034] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, several terms are defined below. [0035] Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. [0036] As utilized herein, “and/or” means any one or more of the items in the list joined by “and/or”. As an example, “x and/or y” means any element of the three-element set {(x), (y), (x, y)}. As another example, “x, y, and/or z” means any element of the seven-element set {(x), (y), (z), (x, y), (x, z), (y, z), (x, y, z)}. As utilized herein, the term “exemplary” means serving as a non-limiting example, instance, or illustration. As utilized herein, the terms “e.g.” and “for example” set off lists of one or more non- limiting examples, instances, or illustrations. [0037] Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that the 22 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. [0038] The components, steps, features, objects, benefits and advantages which have been discussed are merely illustrative. None of them, nor the discussions relating to them, are intended to limit the scope of protection in any way. Numerous other embodiments are also contemplated. These include embodiments which have fewer, additional, and/or different components, steps, features, objects, benefits and advantages. These also include embodiments in which the components and/or steps are arranged and/or ordered differently. [0039] Unless otherwise stated, all measurements, values, ratings, positions, magnitudes, sizes, and other specifications that are set forth in this specification, including in the claims that follow, are approximate, not exact. They are intended to have a reasonable range that is consistent with the functions to which they relate and with what is customary in the art to which they pertain. [0040] “Comprising” is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. “Consisting essentially of” when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. “Consisting of” shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and/or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure. [0041] All articles, patents, patent applications, and other publications that have been cited in this disclosure are incorporated herein by reference. [0042] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non- human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician. Relational terms such as “first” and “second” and the like may be used solely to distinguish one entity or action from another, without necessarily requiring or implying any actual relationship or order between them. 23 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0043] In one aspect, described herein is a method of producing, enriching, maintaining, or expanding nephron progenitor cells (NPCs), the method comprising contacting at least one NPC, metanephric mesenchyme (MM) cell, or kidney cell with a composition or culture media from Table 2. [0044] As used herein, the term “expanded population” of NPCs refers to a population of cells comprising at least one more NPC, such that the quantity of NPCs in the population is greater (e.g., at least 10% greater, at least 20% greater, at least 30% greater) than the number of NPCs prior to contacting with the composition described herein, e.g., the medium in Table 2. [0045] As used herein, “contacting” one or more cells with the composition or culture mediumcan be achieved in a variety of ways. For instance, a population of cells may be contacted with the composition or culture medium by culturing the cells in the presence of the composition or medium for a period of time, such as for two or more days. [0046] As used herein, a “cell culture” refers to an in vitro population of cells having a population of metabolically active cells. The number of these cells can be roughly stable over a period of at least 3 days or can grow. As used herein, “culturing” refers to continuing the viability of a cell or population of cells. In some embodiments of any of the aspects, the phenotype, morphology, number, or differentiation status of the cultured cells can change over time. In some embodiments of any of the aspects, the phenotype, morphology, or differentiation status of the cultured cells does not change over time. Conditions suitable for cell culture for different cell types are well known in the art and cell culture media for various cell types is readily available. Exemplary media and conditions are provided elsewhere herein. Culturing refers to maintaining a cell culture over time and can comprise contacting the culture with appropriate media and/or providing appropriate environmental conditions (such as temperature and humidity). The appropriate conditions and media will vary depending on cell type selected and selection of the appropriate conditions and media is well within the ordinary skill in the art, e.g., utilizing a commercially available media advertised for that cell type. Culturing can be performed in static or flowing media and can comprise changing the media at intervals or continuously. The terms “cells” and “population of cells” are used interchangeably and refer to a plurality of cells, i.e., more than one cell. The population may be a pure population comprising one cell type. Alternatively, the population may comprise more than one cell type. [0047] Unless otherwise specified, in each step of the methods, the cells may be cultured at a temperature of about 30-40° C., preferably about 37° C. under a CO2-containing air atmos- phere, but not limited to such conditions. The concentration of CO2 in the air may preferably be about 2-5%. Unless otherwise specified, the medium for cell culturing can be prepared by appropriately adding factors (or “supplements”) necessary for each stage to a basal medium used for culturing animal cells. Examples of the basal media include Dulbecco’s modified Ea- gle’s Medium (DMEM) Medium, DMEM/F12 24 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Medium, MEM Zinc Option Medium, IMEM Zinc Option Medium, IMDM Medium, Medium 199 Medium, Eagle’s Minimum Essential Medium (EMEM) Medium, a-MEM Medium, Ham’s F12 Medium, RPMI 1640 Medium, Fischer’s Medium, and mixtures of these media. The basal medium may contain serum (for example, fetal bovine serum (FBS)) or the basal medium may be a serum-free medium. As required, the basal medium may contain, for example, one or more alternatives to sera such as KnockOut Serum Replacement (KSR) (Thermo Fisher Scientific), which is an alternative to serum used for culturing ES cells, albumin, transferrin, N2 Supplement (Thermo Fisher Scien- tific), B-27 Supplement (Thermo Fisher Scientific), a fatty acid, insulin, a collagen precursor, a trace element, 2-mercaptoethanol, and 3’- Thioglycerol, and the basal medium may also con- tain one or more substances such as a lipid, an amino acid, L-glutamine, GlutaMAX (Thermo Fisher Scientific), a nonessential amino acid (NEAA), a vitamin, a growth factor, an antibiotic, an antioxidant, pyruvic acid, a buffer agent, an inorganic salt, and equivalents thereof as well as one or more other substances. [0048] The term “candidate compound/drug” or “a compound/drug of interest” refers to an agent to be screened. Candidate compounds may include, for example, small molecules such as small organic compounds (e.g., organic molecules having a molecular weight between about 50 and about 2,500 Da), peptides or mimetics thereof, ligands including peptide and non-pep- tide ligands, polypeptides, nucleic acid molecules such as aptamers, peptide nucleic acid molecules, and components, combinations, and derivatives thereof. [0049] The phrase “pluripotent stem cell(s)” refers to stem cells which have pluripotency, that is the ability of cells to differentiate into all types of the cells in the living body, as well as proliferative capacity. Examples of the pluripotent stem cells include embryonic stem (ES) cells, embryonic stem cells derived from cloned embryo obtained by nuclear transfer, germline stem cells, embryonic germ cells, induced pluripotent stem (iPS) cells, pluripotent cells derived from cultured fibroblasts and bone marrow stem cells. Mouse or human pluripotent stem cells, particularly ES cells and iPS cells are preferably used. [0050] As used herein, the terms “induced pluripotent stem cell”and “iPSC,” refer to a pluripotent cell artificially derived from a differentiated somatic cell. iPSCs are capable of self-renewal and differentiation into cell fate-committed stem cells as well as various types of mature cells. [0051] The term “organoid” generally refers to an agglomeration of cells that recapitulates aspects of cellular self-organization, architecture and signaling interactions present in a native organ. The term “organoid” includes spheroids or cell clusters formed from suspension cell cultures. In some embodiments, an organoid comprises a number in the order of 104, 105, or 103 cells. [0052] As used herein, the phrases “preserve” or “maintain” multi-potency or pluripotency refer to a process by which the degree of multi-potency or pluripotency of a population of cells is preserved over a period of time. The degree of multi-potency or pluripotency of a population of cells describes the number 25 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT and identity of differentiated cell types into which a population of cells can differentiate. For example, a population of cells exhibiting multi-potency that has been maintained over a period of two days ex vivo (e.g., in culture) is capable of differentiating into at least the same number of different cell types as the population was capable of differentiating into at the beginning of the cell culture period. [0053] The “lineage” of a cell defines the heredity of the cell, i.e., which cells it came from and what cells it can give rise to. The lineage of a cell places the cell within a hereditary scheme of development and differentiation. [0054] A cell that is referred to as being “positive” for a given marker may express a level of that marker depending on the degree to which the marker is present on the cell surface. In some embodiments, the term relates to intensity of fluorescence or other marker used in the sorting process of the cells. In some embodiments, a cell may express a low level or a bright level of a marker, and the distinction of low and bright will be understood in the context of the marker used on a particular cell population being sorted. A cell that is referred to as being “negative” for a given marker can mean that that given marker is absent from that cell, or can also mean that the marker is expressed at a relatively low or very low level by that cell or population, and that it generates a very low signal when detectably labelled or is undetectable above background levels. [0055] In some embodiments, expression levels can be measured using techniques such as polymerase chain reaction comprising appropriate primers for markers of interest. For example, total RNA can be extracted from cells or organoids before being reverse transcribed and subject to PCR and analysis. [0056] In various embodiments, a positive marker refers to an expression of the corresponding gene and/or a level of the corresponding protein above a reference, control or background level. Generally, standard gene names and symbols can be found in community databases specific to particular organisms (e.g., human: www.genenames.org; rat: rgd.mcw.edu; mouse: www.informatics.jax.org; zebrafish: zfm.org; flies: flybase.org; worms: www.worm- base.org). In general, symbols for genes are italicized (e.g., SLC12A3 ), whereas symbols for proteins are not italicized (e.g., SLC12A3); and gene names that are written out in full are not italicized (e.g., solute carrier family 12 member 3). For humans, non-human primates, chickens, and domestic species, gene symbols contain three to six italicized characters that are all in uppercase (e.g., PKD1). For mice and rats, gene symbols are italicized, with only the first letter in uppercase (e.g., Pkd1). Gene symbol PKD1 refers to Polycystin 1, transient receptor potential channel interacting; gene symbol PKD2 refers to Polycystin 2, transient receptor potential cation channel; gene symbol NPHS1 refers to NPHS1 Adhesion Molecule, Nephrin; gene symbol PODXL refers to Podocalyxin Like; gene symbol PLA2R1 refers to Phospholipase A2 Receptor 1; gene symbol COL4A3 26 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT refers to collagen type IV alpha 3 chain; gene symbol COL4A4 refers to collagen type IV alpha 4 chain; gene symbol SLC12A3 refers to solute carrier family 12 member 3. [0057] As used herein, the term "inhibitor" refers to any compound, natural or synthetic, which can reduce the activity of a target protein or signaling pathway. An inhibitor can be, for example, a peptide, a protein, an antibody, a peptidomimetic, an amino acid, an amino acid analog, a polynucleotide, a polynucleotide analog, an aptamer, a nucleotide, a nucleotide analog, an organic or inorganic compound. An inhibitor may attenuate or prevent the activity of a target protein either directly or indirectly. Direct inhibition can be obtained, for instance, by binding to a protein and preventing the protein from interacting with an endogenous molecule, such as an enzyme, a substrate, or other binding partner, thereby diminishing the activity of the protein. For instance, an inhibitor may bind an enzyme active site and sterically preclude binding of an endogenous substrate at this location, thus decreasing the enzymatic activity of the protein. Alternatively, indirect inhibition can be obtained, for instance, by binding to a protein that promotes the activity of a target protein by inducing a conformational change or catalyzing a chemical modification of the target protein. For instance, indirect inhibition of a target protein may be achieved by binding and inactivating a kinase that catalyzes the phosphorylation of, and thus activates, the target protein. [0058] In some embodiments of any of the aspects, “activating agent” or “agonist” refers to an agent which increases the expression and/or activity of the target by at least 10% or more, e.g. by 10% or more, 50% or more, 100% or more, 200% or more, 500% or more, or 1000 % or more. The efficacy of an agonist of can be determined, e.g. by measuring the level of an expression product or the activity. Methods for measuring the level of a given mRNA and/or polypeptide are known to one of skill in the art, e.g. RT-PCR with primers can be used to determine the level of RNA, and Western blotting with an antibody can be used to determine the level of a polypeptide. [0059] The term "gene" or "gene sequence" refers to the coding sequence or control sequence, or fragments thereof. A gene may include any combination of coding sequence and control sequence, or fragments thereof. Thus, a "gene" as referred to herein may be all or part of a native gene. A polynucleotide sequence as referred to herein may be used interchangeably with the term "gene”, or may include any coding sequence, non-coding sequence or control sequence, fragments thereof, and combinations thereof. The term "gene" or "gene sequence" includes, for example, control sequences upstream of the coding sequence (for example, the ribosome binding site). [0060] The term "nucleic acid" as used herein means a polymer composed of nucleotides, e.g. deoxyribonucleotides (DNA) or ribonucleotides (RNA). The terms "ribonucleic acid" and "RNA" as used herein mean a polymer composed of ribonucleotides. The terms "deoxyribonucleic acid" and "DNA" as 27 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT used herein mean a polymer composed of deoxyribonucleotides. (Used together with “polynucleotide” and “polypeptide”.) [0061] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s). [0062] As used herein, the terms “protein" and “polypeptide" are used interchangeably herein to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha- amino and carboxy groups of adjacent residues. The terms "protein", and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. "Protein" and “polypeptide” are often used in reference to relatively large polypeptides, whereas the term "peptide" is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms "protein" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing. [0063] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978- 0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, 28 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties. [0064] Other terms are defined herein within the description of the various aspects of the invention. [0065] The Applicants’ discoveries can be used for the regenerative/stem cell biology field towards the establishment of hepatocyte transplantation therapy. Furthermore, the invention also provides a substantial degree of benefit for the basic research of liver biology and pathophysiology in general. [0066] In some aspects of the application, the inventors describe compositions, culture systems, and methods that improve long-term clonal expansion of nephron progenitor cells (NPCs) and induced NPCs (iNPCs) from pluripotent stem cells. In addition, the compositions, culture systems, and methods described herein improve reprogramming differentiated nephron cells to the NPC state. In some aspects of the application, the inventors describe compositions, culture systems, and methods that improve the generation of nephron organoids. The compositions, culture systems, and methods allow for genome wide screens and rapid, efficient, and scalable organoid models of kidney disease. [0067] In some aspects of the application, the composition or cell culture medium is a composition or cell culture medium as shown in Table 2 or Table 4. In some embodiments, the composition or cell culture medium comprises, consists essentially of, or consists of an inhibitor of p38 MAPK, an inhibitor of Notch signaling, an inhibitor of TGF-B signaling, an inhibitor of BMP signaling, and an inhibitor of GSK3. In some embodiments, the composition or cell culture medium further comprises a YAP agonist. [0068] In some embodiments, the composition or cell culture medium described herein further comprises a basal cell culture medium and supplements. In some embodiments, the basal cell culture medium comprises, consists essentially or, or consists of one or more of, or all of DMEM/F12, L-alanyl- L-glutamine (GlutaMAX-1), MEM non-essential amino acids solution, 2-mercaptoethanol, penicillin streptocycin solution, B-27 supplement devoid of vitamin A, and insulin-transferrin-sodium selenite (ITS) liquid media supplement. In some embodiments, the supplements of the basal cell culture comprise, consists essentially of, or consists of one or more of, or all of, a fibroblast growth factor (FGF), BMP7, heparin, leukocyte inhibitors (LIF), and a ROCK inhibitor. [0069] Exemplary fibroblast growth factors include but are not limited to, FGF1, FGF2, FGF7, FGF8, FGF9, FGF10, and FGF20. In preferred embodiments, the FGF is FGF2. 29 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0070] In some embodiments, the composition or cell culture medium comprises an FGF, e.g., FGF2, at 100-300 ng/mL. In some embodiments the composition or cell culture medium comprises an FGF, e.g., FGF2, at 200 ng/mL. [0071] In some embodiments, composition or cell culture medium comprises a mouse LIF. In some embodiments, composition or cell culture medium comprises a human LIF. [0072] Exemplary ROCK inhibitors include but are not limited to, Y-27632, Rasudil, Y39983, Wf- 536, SLx-2119, Azabenzimidazole-aminofurazans, DE-104, H-1152P, ROKα inhibitor, XD-4000, HMN- 1152, Rhostatin, BA-210, Ki-23095, VAS-102, and Quinazoline. In preferred embodiments, the ROCK inhibitor is Y-27632. [0073] In some embodiments, the composition or cell culture medium comprises a ROCK inhibitor, e.g., Y-27632, at 1-20 µM. In some embodiments the composition or cell culture medium comprises a ROCK inhibitor, e.g., Y-27632, at 10 µM. [0074] As used herein, the term “inhibitor of p38 MAPK” or “p38 MAPK inhibitor” means any material that interferes or inhibits the activity of p38 MAPK or blocks signaling through the p38 MAP kinase pathway. Without limitations, a p38 MAPK inhibitor can function by reducing the amount of p38 MAPK, inhibiting or blocking p38 MAPK activation, or inhibiting other molecules in the signaling pathway. [0075] Exemplary inhibitors of p38 MAPK include, but are not limited to, SB203580 (Adezmapimod), BIRB 796 (Doramapimod), SB202190 (FHPI), LY2228820 (Ralimetinib dimesylate), VX-701, PH-797804, VX-745 (Neflamapimod), TAK-715, p38-αMAPK-IN-1, R1487, SB242235, TA- 01, PD169316, TA-02, SD 0006, Pamapimod, BMS-582949, SB239063, GW856553X (Losmapimod), DBM 1285, and Skepinone-L. [0076] In preferred embodiments, the inhibitor of p38 MAPK is SB202190. [0077] In some embodiments, the composition or cell culture medium comprises an inhibitor of p38 MAPK, e.g., SB202190, at 1-10 µM. In some embodiments the composition or cell culture medium comprises an inhibitor of p38 MAPK, e.g., SB202190, at 5 µM. [0078] As used herein, the term “inhibitor of Notch signaling” or “Notch signaling inhibitor” means any material that interferes or inhibits the activity of Notch or blocks signaling through the Notch pathway. Without limitations, a Notch signaling inhibitor can function by reducing the amount of Notch, inhibiting or blocking Notch activation, or inhibiting other molecules in the signaling pathway. [0079] Exemplary inhibitors of Notch signaling include, but are not limited to, DAPT, Valproic acid (VPA), LY-411575, RO4929097, Demcizumad, Navicixizumab, Brontictuzumab, YO-01027, CB-103, 30 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Tangeretin, Crenigacestat, Carvacrol, RBPJ Inhibitor-1, IMR-1, Psoralidin, Semagacestat, BMS-906024, FLI-06, Bruceine D, and Avagacestat. [0080] In preferred embodiments, the inhibitor of Notch signaling is DAPT. [0081] In some embodiments, the composition or cell culture medium comprises an inhibitor of Notch signaling, e.g., DAPT, at 1-10 µM. In some embodiments the composition or cell culture medium comprises an inhibitor of Notch signaling, e.g., DAPT, at 5 µM. [0082] As used herein, the term “inhibitor of TGF-B signaling” or “TGF-B signaling inhibitor” means any material that interferes or inhibits the activity of TGF-B or blocks signaling through the TGF- B pathway. Without limitations, a TGF-B signaling inhibitor can function by reducing the amount of TGF-B, inhibiting or blocking TGF-B activation, or inhibiting other molecules in the signaling pathway. [0083] Exemplary inhibitors of TGF-B signaling include, but are not limited to, A83-01, A77-01, AZ 12799734, D4476, Disitertide, Galunisertib, GW 788388, IN 1130, LY 364947, R 268712, RepSox, SB 431542, SB 505124, SB 525334, SB208, and SM 16. [0084] In preferred embodiments, the inhibitor of TGF-B signaling is A83-01. [0085] In some embodiments, the composition or cell culture medium comprises an inhibitor of TGF-B signaling, e.g., A83-01, at 1-100 nM. In some embodiments the composition or cell culture medium comprises an inhibitor of TGF-B signaling, e.g., A83-01, at 50 nM. [0086] As used herein, the term “inhibitor of BMP signaling” or “BMP signaling inhibitor” means any material that interferes or inhibits the activity of BMP or blocks signaling through the BMP pathway. Without limitations, a BMP signaling inhibitor can function by reducing the amount of BMP, inhibiting or blocking BMP activation, or inhibiting other molecules in the signaling pathway. [0087] Exemplary inhibitors of BMP signaling include, but are not limited to, LDN193189, DMH-1, DMH2, Dorsomorphin dihydrochloride, K0228, M4K2163, ML347, and SB505124. [0088] In preferred embodiments, the inhibitor of BMP signaling is LDN193189. [0089] In some embodiments, the composition or cell culture medium comprises an inhibitor of BMP signaling, e.g., LDN193189, at 100-300 nM. In some embodiments the composition or cell culture medium comprises an inhibitor of BMP signaling, e.g., LDN193189, at 200 nM. [0090] As used herein, the term “inhibitor of GSK3” or “GSK3 inhibitor” means any material that interferes or inhibits the activity of GSK3 or blocks signaling through the GSK3 pathway. Without limitations, a GSK3 signaling inhibitor can function by reducing the amount of GSK3, inhibiting or blocking GSK3 activation, or inhibiting other molecules in the signaling pathway. [0091] Exemplary inhibitors of GSK3 include, but are not limited to, CHIR99021, 3F8, A1070722, Alsterpaullone, AR-A 014418, AZD 2858, BIO, Bio-acetoxime, CHIR98014, Indirubin-3’-oxime, 31 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Kenpaullone, Lithium carbonate, MeBIO, R-Spondin 1, SB216763, SB415286, TC-G 24, TCS 2002, TCS 21311, TDZD 8, and TWS 119. [0092] In preferred embodiments, the inhibitor of GSK3 is CHIR99021. [0093] In some embodiments, the composition or cell culture medium comprises an inhibitor of GSK3, e.g., CHIR99021, at 1-5 µM. In some embodiments the composition or cell culture medium comprises an inhibitor of GSK3, e.g., CHIR99021, at 1.5 µM. [0094] As used herein, the term “YAP agonist” means any material that activates or enhances the activity of YAP or activates or enhances the signaling through the YAP pathway. Without limitations, a YAP agonist can function by increasing the amount of YAP, allowing or enhancing YAP activation, or increasing activity of other molecules in the signaling pathway. Further, YAP agonists can function by inhibiting molecules that block or inhibit YAP. [0095] Exemplary agonists of YAP include, but are not limited to, TRULI, Lat kinase inhibitors, and PY-60. In preferred embodiments, the YAP agonist is TRULI. [0096] In some embodiments, the composition or cell culture medium comprises an agonist of YAP, e.g., TRULI, at 1-5 µM. In some embodiments the composition or cell culture medium comprises an agonist of YAP, e.g., TRULI, at 2 µM. [0097] Various embodiments provide methods for deriving, maintaining, or expanding nephron progenitor cells (NPCs) or nephron progenitor cell lines. In some embodiments, methods for deriving, maintaining, or expanding NPCs comprise contacting nephron progenitor cells, metanephric mesenchyme (MM) cells, or kidney cells with a composition or cell culture medium described herein. In some embodiments, the NPC, MM cells, or kidney cells are mammalian cells. In some embodiments, the NPC, MM cells, or kidney cells are human cells. In some embodiments, the NPC, MM cells, or kidney are mouse cells. [0098] In some embodiments, methods for deriving, maintaining, or expanding nephron progenitor cell lines comprise contacting a pluripotent stem cell (PSC) with a composition or cell culture medium described herein. In some embodiments, the pluripotent stem cells are human pluripotent stem cell (hPSC). In some embodiments, the pluripotent stem cells are mouse pluripotent stem cell (mPSC). In some embodiments, methods for deriving, maintaining, or expanding nephron progenitor cell lines comprise contacting a PSC-derived induced NPC (iNPC) with a composition or cell culture medium described herein. In some embodiments, the cells contacted are human pluripotent stem cell (hPSC)- derived iNPCs. In some embodiments, the cells contacted are mouse pluripotent stem cell (mPSC)- derived iNPCs. [0099] In some embodiments, methods for deriving, maintaining, or expanding nephron progenitor cell lines comprise contacting a cell isolated from a kidney with a composition or cell culture medium 32 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT described herein. In some embodiments the cell isolated from a kidney is a cell isolated from a mammalian kidney. In some embodiments the cell isolated from a kidney is a cell isolated from a mouse kidney. In some embodiments the cell isolated from a kidney is a cell isolated from a human kidney. In some embodiments the cell isolated from a kidney is a cell isolated from a human fetal kidney. Methods for isolating cells from a kidney are known to those skilled in the art. [0100] Various embodiments provide methods for reprogramming differentiated nephron cells to the NPC state. In some embodiments, methods for reprogramming differentiated nephron cells comprise contacting differentiated nephron cells with a composition or cell culture medium described herein. In some embodiments, the differentiated nephron cell is an adult kidney cell. In some embodiments, the differentiated nephron cell is a Six2-negative cell. In some embodiments, the differentiated nephron cell is a Wnt4+ cell. In some embodiments, the differentiated nephron cell is a podocyte. In some embodiments, the differentiated nephron cell is isolated from kidneys. [0101] In some embodiments, the cells contacted with the composition or cell culture medium described herein, maintain a expression of NPC marker genes. NPC marker genes include, but are not limited to, SIX2, PAX2, WT1, SALL1, and ITGA8. [0102] A further aspect of the invention provides a method of generating mouse nephron organoids. In some embodiments, the method comprises contacting a population of NPCs or iNPCs derived from pluripotent stem cells, for a first period of time with a first composition or cell culture medium and contacting the cells for a second period of time with a second composition or cell culture medium. [0103] In some embodiments, the first composition or cell culture medium is a composition or cell culture medium described herein. In some embodiments, the first composition or cell culture medium is a composition or cell culture medium described in Table 2 or Table 4. In some embodiments, the first period of time is about 1 day, or 0.5-2 days. [0104] In some embodiments, the second composition or cell culture medium is KR5-CF medium. KR5-CF medium is KR5 medium supplemented with both CHIR99021 and FGF2. In some embodiments the KR5-CF medium is supplemented with CHIR99021 at a final concentration between 1-10 uM or about 4.5 uM. In some embodiments the KR5-CF medium is supplemented with FGF2 at a final concentration between 100-300 ng/mL or about 200 ng/mL. In some embodiments, the second period of time is about 7 days, or about 3-14 days. [0105] A further aspect of the invention provides a method of generating human nephron organoids. In some embodiments, the method comprises contacting a population of NPCs or iNPCs derived from pluripotent stem cells, for a first period of time with a first composition or cell culture medium, contacting the cells for a second period of time with a second composition or cell culture medium, contacting the cells for a third period of time with a third composition or cell culture medium, and contacting the cells 33 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT for a fourth period of time with a fourth composition or cell culture medium. In some embodiments, the NPCs or iNPCs derived from pluripotent stem cells are human NPCs or iNPC derived from human pluripotent stem cells. [0106] In some embodiments, the first composition or cell culture medium is a composition or cell culture medium described herein. In some embodiments, the first composition or cell culture medium is a composition or cell culture medium described in Table 2 or Table 4. In some embodiments, the first period of time is about 1 day, or 0.5-2 days. [0107] In some embodiments, the second composition or cell culture medium is STEMdiff™ APEL™ 2 medium supplemented with CHIR99021. In some embodiments the second composition or medium is supplemented with CHIR99021 at a final concentration between 1-10 uM or about 6 uM. In some embodiments, the second period of time is about 1 hour, or about 0.5 hours-5 hours. [0108] In some embodiments, the third composition or cell culture medium is STEMdiff™ APEL™ 2 medium supplemented with both FGF9 and heparin. In some embodiments the third composition or medium is supplemented with FGF9 at a final concentration between 1-100 ng/mL or about 50 ng/mL. In some embodiments the third composition or medium is supplemented with herapin at a final concentration between 0.5-5 ug/mL or about 1 ug/mL. In some embodiments, the third composition or cell culture medium is not supplemented with CHIR99021. In some embodiments, the third period of time is about 5 days, or about 3-6 days. [0109] In some embodiments, the fourth composition or cell culture medium is STEMdiff™ APEL™ 2 medium without any other factors. In some embodiments, the fourth period of time is about 10 days, or about 5-15 days. [0110] In another embodiment, the fourth composition or cell culture medium is Advanced RPMI 1640 Medium supplemented with B27 and A83-01. In some embodiments the fourth composition or medium is supplemented with 1X B27. In some embodiments the fourth composition or medium is supplemented with A83-01 at a final concentration between 100-300nM, or about 200nM. In some embodiments, the fourth period of time is about 10 days, or about 5-21 days. [0111] In some embodiments, the nephron organoid is characterized by the development of distal convoluted tubule structures and/or the elevated expressions of one or more markers for distal tubule segments. The one or more markers for distal tubule segments includes, but is not limited to, SLC12A3. [0112] In some embodiments, the nephron organoid is characterized by the development of podocyte structures, proximal tubule structures, and distal tubule structures, and/or the elevated expressions of one or more markers for podocyte structures, proximal tubule structures, and distal tubule structures. The one or more markers for mature podocytes include, but is not limited to NPHS1, PODXL, PLA2R1, COL4A3, 34 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT or COL4A4. The one or more markers for proximal tubule structures include, but is not limited to LTL, HNF4A, SLC34A1, and SLC27A2. [0113] In some embodiments, the NPCs, iNPCs, reprogrammed NPCs, or nephron organoids described herein, can be passaged for a plurality of times, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 times, each passage maintaining the positive expression of the one or more markers for NPCs, one or more NPC regulators, and/or one or more NPC lineage markers. [0114] Various embodiments provide a composition or cell culture medium, described herein, that can be used for generating an engineered kidney, or generating an engineered kidney model in vitro or ex vivo or de novo. Methods to generate an engineered kidney include combining UB tip cells (or UPC cells, or a tip portion of cells from a branch of an UB organoid) with nephron progenitor cells (NPCs) in one culture, and cultivating the combination in a kidney reconstruction medium, to generate a tubular network with connected nephron-like cell types and a collecting duct. NPCs first contacted with a composition or culture medium described herein improve the engineered kidney generation. [0115] Various embodiments of the invention provide a method for generating nephron organoids for modeling of a kidney disease. In some embodiments of the invention, the method comprises generating nephron organoids for ex vivo modeling of a kidney disease, in which at least a fraction of the cells in the organoid comprises at least one edited gene. In some embodiments, the edited gene comprises a mutation, an overexpression, a down regulation, a knock out or a combination thereof. [0116] In some embodiments, the nephron organoids or engineered kidneys (kidney organoids) encompassed by the present disclosure can be used in various screening applications. In some embodiments the nephron organoids or kidney organoids can be used to screen a candidate compound for therapeutic efficacy in treating kidney disease or disorder. In other examples, nephron organoids or kidney organoids can be used to screen for toxicity. For example, kidney organoids can be used to screen for nephrotoxicity. [0117] In some embodiments, provided herein is a method of screening for a candidate drug for treating a kidney disease, reducing the incidence or severity of a kidney disease, and/or promoting kidney regeneration, which includes contacting a molecule of interest with an NPC or nephron organoid generated; and measuring a level of a biomarker transcribed or expressed in the NPC or nephron organoid before with contact of the molecule of interest, and measuring a level of the biomarker transcribed or expressed in the NPC or nephron organoid in the presence of the molecule of interest. [0118] Further embodiments provide a method of screening for a candidate drug for treating, reducing the incidence or severity of a kidney disease, and/or for promoting kidney regeneration, comprising contacting a molecule of interest with an engineered kidney generated; and measuring a level of a biomarker transcribed or expressed in the engineered kidney before contact of the molecule of 35 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT interest, and measuring a level of the biomarker transcribed or expressed in the engineered kidney in the presence of the molecule of interest. [0119] In some embodiments, the biomarker is associated with a disease or condition in the renal system, e.g., having an elevated expression level or transcription level in a subject with a disease or condition in the renal system, compared to a reference from a subject who does not have the disease or condition in the renal system. In some embodiments of the screening methods, a level of the biomarker in the presence of the molecule of interest below that before the contact with the molecule of interest is indicative that the molecule of interest is a candidate agent or is likely to inhibit, reduce the severity, or treat the disease or condition in the renal system. In some embodiments, a level of the biomarker in the presence of the molecule of interest above that before the contact with the molecule of interest is indicative that the molecule of interest is not a candidate agent or is not likely to inhibit, reduce the severity, or treat the disease or condition in the renal system. [0120] In some embodiments, nephron organoids or kidney organoids disclosed herein are representative of a kidney disease, which can be assessed to screen for therapeutic efficacy. For example, the kidney disease can be selected from the group consisting of congenital nephrotic syndrome (CNS) including steroid resistant nephrotic syndrome and Finnish nephropathy, focal segmental glomerulonephritis (FSGS), Alport syndrome and Pierson syndrome. In another example, the kidney disease is polycystic kidney disease. [0121] In some embodiments, provided herein is a method of generating a scalable organoid model of polycystic kidney disease (PKD) comprising knocking our the PKD1 or PKD2 gene in a cell, and contacting the cell with the composition or cell medium described herein for a first period of time to form mini aggregates, then transferring the mini aggregates into KR5-CF medium and shaking for a second period of time, then contacting the mini aggregates with KR5 medium without additional supplements for a third period of time. In some embodiments, the KR5-CF medium comprises GlutaMax-1, MEM NEAA, 2-Mercaptoethanol, Pen Strep, Serum Replacement, CHIR99021, and FGF7. In some embodiments, the first period of time is about 1 day, the second period of time is about 2-3 days, and the third period of time is about 4-8 days. In some embodiments, the PKD organoid model is generated starting from hNPCs, iNPCs, or mNPCs. [0122] In various embodiments, the PKD organoid model is generated using CRISPR/Cas9 based genome editing. [0123] In various embodiments, [0124] In various embodiments, the PKD organoid model disclosed herein is used to screen for therapeutic efficacy. In some embodiments, the PKD organoid model is used to screen small molecules 36 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT that can treat PKD. In some embodiments, the PKD organoid model is used to test molecules for treatments of PKD. [0125] In some embodiments, described herein is a method of treating PKD comprising administering a BMI-1 inhibitor. In some embodiments, the BMI-1 inhibitor is PTC0-209. [0126] A kit comprising the composition or cell culture medium described herein is also provided. [0127] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents. [0128] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims. [0129] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure. 37 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0130] Some embodiments of the technology described herein can be defined according to any of the following numbered embodiments: 1. A composition comprising at least: a. An inhibitor of p38 MAPK; b. An inhibitor of Notch signaling; c. An inhibitor of TGF-B signaling; d. An inhibitor of BMP signaling; and e. An inhibitor of GSK3. 2. The composition of embodiment 1, wherein the inhibitor of p38 MAPK is selected from the group consisting of: SB203580 (Adezmapimod), BIRB 796 (Doramapimod), SB202190 (FHPI), LY2228820 (Ralimetinib dimesylate), VX-701, PH-797804, VX-745 (Neflamapimod), TAK-715, p38- αMAPK-IN-1, R1487, SB242235, TA-01, PD169316, TA-02, SD 0006, Pamapimod, BMS-582949, SB239063, GW856553X (Losmapimod), DBM 1285, and Skepinone-L. 3. The composition of any one of the preceding embodiments, wherein the inhibitor of p38 MAPK is SB202190. 4. The composition of any one of the preceding embodiments, wherein the inhibitor of Notch signaling is selected from the group consisting of: DAPT, Valproic acid (VPA), LY-411575, RO4929097, Demcizumad, Navicixizumab, Brontictuzumab, YO-01027, CB-103, Tangeretin, Crenigacestat, Carvacrol, RBPJ Inhibitor-1, IMR-1, Psoralidin, Semagacestat, BMS-906024, FLI-06, Bruceine D, and Avagacestat. 5. The composition of any one of the preceding embodiments, wherein the inhibitor of Notch signaling is DAPT. 6. The composition of any one of the preceding embodiments, wherein the inhibitor of TGF-B signaling is selected from the group consisting of: A83-01, A77-01, AZ 12799734, D4476, Disitertide, Galunisertib, GW 788388, IN 1130, LY 364947, R 268712, RepSox, SB 431542, SB 505124, SB 525334, SB208, and SM 16. 7. The composition of any one of the preceding embodiments, wherein the inhibitor of TGF-B signaling is A83-01. 8. The composition of any one of the preceding embodiments, wherein the inhibitor of BMP signaling is selected from the group consisting of: LDN193189, DMH-1, DMH2, Dorsomorphin dihydrochloride, K0228, M4K2163, ML347, and SB505124. 38 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 9. The composition of any one of the preceding embodiments, wherein the inhibitor of BMP signaling is LDN193189. 10. The composition of any one of the preceding embodiments, wherein the inhibitor of GSK3 is selected from the group consisting of: CHIR99021, 3F8, A1070722, Alsterpaullone, AR-A 014418, AZD 2858, BIO, Bio- acetoxime, CHIR98014, Indirubin-3’-oxime, Kenpaullone, Lithium carbonate, MeBIO, SB216763, SB415286, TC-G 24, TCS 2002, TCS 21311, TDZD 8, and TWS 119. 11. The composition of any one of the preceding embodiments, wherein the inhibitor of GSK3 is CHIR99021. 12. The composition of any one of the preceding embodiments, further comprising a basal cell culture medium and supplements. 13. The composition of any one of the preceding embodiments, wherein the basal cell culture medium comprises DMEM/F12, L-alanyl-L-glutamine (GlutaMAX-I), MEM non-essential amino acids solution, 2-mercaptoethanol, penicillin streptocycin solution, B-27 supplement devoid of vitamin A, and insulin-transferrin-sodium selenite (ITS) liquid media supplement. 14. The composition of any one of the preceding embodiments, wherein the supplements comprise a fibroblast growth factor (FGF), BMP7, heparin, leukocyte inhibitors (LIF), and a ROCK inhibitor. 15. The composition of any one of the preceding embodiments, wherein the FGF is selected from the group consisting of: FGF1, FGF2, FGF7, FGF8, FGF9, FGF10, and FGF20. 16. The composition of any one of the preceding embodiments, wherein the FGF is FGF2. 17. The composition of any one of the preceding embodiments, wherein the ROCK inhibitor is selected from the group consisting of: Y-27632, Rasudil, Y39983, Wf-536, SLx-2119, Azabenzimidazole-aminofurazans, DE- 104, H-1152P, ROKα inhibitor, XD-4000, HMN-1152, Rhostatin, BA-210, Ki-23095, VAS-102, and Quinazoline. 18. The composition of any one of the preceding embodiments, wherein the ROCK inhibitor is Y- 27632. 19. The composition of any one of the preceding embodiments, wherein the LIF is mouse LIF or human LIF. 20. The composition of any one of the preceding embodiments wherein the ingredients comprise or consist of the ingredients listed in Table 2. 21. The composition of any one of the preceding embodiments, further comprising a YAP agonist. 22. The composition of any one of the preceding embodiments, wherein the YAP agonist is TRULI. 39 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 23. The composition of any one of the preceding embodiments, wherein the ingredients comprise or consist of the ingredients in Table 4. 24. A cell culture medium, wherein the medium comprises at least: a. An inhibitor of p38 MAPK; b. An inhibitor of Notch signaling; c. An inhibitor of TGF-B signaling; d. An inhibitor of BMP signaling; e. An inhibitor of GSK3. 25. The cell culture medium of embodiment 24, wherein the inhibitor of p38 MAPK is selected from the group consisting of: SB203580 (Adezmapimod), BIRB 796 (Doramapimod), SB202190 (FHPI), LY2228820 (Ralimetinib dimesylate), VX-701, PH-797804, VX-745 (Neflamapimod), TAK-715, p38- αMAPK-IN-1, R1487, SB242235, TA-01, PD169316, TA-02, SD 0006, Pamapimod, BMS-582949, SB239063, GW856553X (Losmapimod), DBM 1285, and Skepinone-L. 26. The cell culture medium of any one of embodiments 24-25, wherein the inhibitor of p38 MAPK is SB202190. 27. The cell culture medium of any one of embodiments 24-26, wherein the inhibitor of Notch signaling is selected from the group consisting of: DAPT, Valproic acid (VPA), LY-411575, RO4929097, Demcizumad, Navicixizumab, Brontictuzumab, YO-01027, CB-103, Tangeretin, Crenigacestat, Carvacrol, RBPJ Inhibitor-1, IMR 28. The cell culture medium of any one of embodiments 24-27, wherein the inhibitor of Notch signaling is DAPT. 29. The cell culture medium of any one of embodiments 24-28, wherein the inhibitor of TGF-B signaling is selected from the group consisting of: A83-01, A77-01, AZ 12799734, D4476, Disitertide, Galunisertib, GW 788388, IN 1130, LY 364947, R 268712, RepSox, SB 431542, SB 505124, SB 525334, SB208, and SM 16. 30. The cell culture medium of any one of embodiments 24-29, wherein the inhibitor of TGF-B signaling is A83-01. 31. The cell culture medium of any one of embodiments 24-30, wherein the inhibitor of BMP signaling is selected from the group consisting of: LDN193189, DMH-1, DMH2, Dorsomorphin dihydrochloride, K0228, M4K2163, ML347, and SB505124. 40 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 32. The cell culture medium of any one of embodiments 24-31, wherein the inhibitor of BMP signaling is LDN193189. 33. The cell culture medium of any one of embodiments 24-32, wherein the inhibitor of GSK3 is selected from the group consisting of: CHIR99021, 3F8, A1070722, Alsterpaullone, AR-A 014418, AZD 2858, BIO, Bio- acetoxime, CHIR98014, Indirubin-3’-oxime, Kenpaullone, Lithium carbonate, MeBIO, SB216763, SB415286, TC-G 24, TCS 2002, TCS 21311, TDZD 8, and TWS 119. 34. The cell culture medium of any one of embodiments 24-33, wherein the inhibitor of GSK3 is CHIR99021. 35. The cell culture medium of any one of embodiments 24-34, further comprising a basal cell culture medium and supplements. 36. The cell culture medium of any one of embodiments 24-35, wherein the basal cell culture medium comprises DMEM/F12, L-alanyl-L-glutamine (Gluta- MAX-I), MEM non-essential amino acids solution, 2-mercaptoethanol, penicillin streptomycin solution, B-27 devoid of vitamin A, and insulin-transferrin-sodium selenite (ITS) solution. 37. The cell culture medium of any one of embodiments 24-36, wherein the supplements comprise a fibroblast growth factor (FGF), BMP7, heparin, leukocyte inhibitors (LIF), and a ROCK inhibitor. 38. The cell culture medium of any one of embodiments 24-37, wherein the FGF is selected from the group consisting of: FGF1, FGF2, FGF7, FGF8, FGF9, FGF10, and FGF20. 39. The cell culture medium of any one of embodiments 24-38, wherein the FGF is FGF2. 40. The composition of any one of embodiments 24-39, wherein the ROCK inhibitor is selected from the group consisting of: Y-27632, Rasudil, Y39983, Wf-536, SLx-2119, Azabenzimidazole-aminofurazans, DE- 104, H-1152P, ROKα inhibitor, XD-4000, HMN-1152, Rhostatin, BA-210, Ki-23095, VAS-102, and Quinazoline. 41. The cell culture medium of any one of embodiments 24-40, wherein the ROCK inhibitor is Y- 27632. 42. The cell culture medium of any one of embodiments 24-41, wherein the ingredients comprise or consist of the ingredients in Table 2. 43. The cell culture medium of any one of embodiments 24-42, further comprising a YAP agonist. 44. The cell culture medium of any one of embodiments 24-43, wherein the YAP agonist is TRULI. 45. The cell culture medium of any one of embodiments 24-44, wherein the ingredients comprise or consist of the ingredients in Table 4. 41 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 46. A kit comprising the composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45 47. A method of deriving, maintaining, or expanding nephron progenitor cell lines from any mouse strain, the method comprising: contacting at least one mouse NPC, mouse MM, or mouse kidney cell, with the composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45. 48. The method of embodiment 47, wherein the cell is isolated from a mouse kidney. 49. A method of reprogramming differentiated nephron cells to the NPC state, the method comprising: contacting the cells with the composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45. 50. A method of reprogramming differentiated nephron cells to the NPC state, the method comprising: contacting the cells with a composition or culture medium consisting essentially of the ingredients in Table 2 or Table 4. 51. The method of any one of embodiments 49-50, wherein the cell, or population thereof, is a Wnt4+ cell. 52. The method of any one of embodiments 49-51, wherein the cell, or population thereof, is isolated from kidneys. 53. A method of deriving, maintaining, or expanding human nephron progenitor cells, the method comprising: contacting at least one primary hNPC or one human pluripotent stem cell (hPSC)- derived induced NPC, with the composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45. 54. The method of embodiment 53, wherein the cell is isolated from human fetal kidneys. 55. A method of deriving, maintaining, or expanding primary mammalian nephron progenitor cells, the method comprising: contacting at least one mammalian NPC, with the composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45. 56. The method of embodiment 55, wherein the mammalian NPC is derived from mice, rats, rabbits, dogs, cats, pigs, or non-human primates. 57. A method of generating nephron organoids, comprising: contacting a population of iNPCs or hNPCs for a first period of time with the composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45; and for a second period of time with a composition comprising CHIR99021; and for a third period of time with a composition comprising FGF9 and heparin; and for a fourth period of time with a culture medium without additional factors. 42 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 58. The method of embodiment 57, wherein the contacting a population of iNPCs or hNPCs is in a sequential order: the first period of time of about 1 day in the presence of a composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45, then the second period of time of about 1 hour in the presence of CHIR99021 and the absence of a composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45, then the third period of time of about 4 days in the presence of FGF9 and heparin and the absence of CHIR99021, then the fourth period of time of about 9 days in the presence of a culture medium with no additional factors and the absence of FGF9 and heparin. 59. The method of embodiments 57 or 58, wherein the organoids develop distal convoluted tubule structures. 60. The method of embodiment 59, wherein the organoids are positive in one or more markers for distal tubule segments, wherein the markers for distal tubule segments comprise SLC12A3. 61. A method of screening for a candidate drug for treating a kidney disease, reducing the incidence or severity of a kidney disease, and/or for promoting kidney regeneration, comprising: contacting a molecule of interest with an NPC generated by the method of any one of embodiments 46-56, or an organoid generated by the method of any one of embodiments 57-60; and measuring a level of a biomarker transcribed or expressed in the NPC before contact of the molecule of interest, and measuring a level of the biomarker transcribed or expressed in the NPC in the presence of the molecule of interest. 62. A method of generating a scalable organoid model of polycystic kidney disease (PKD), comprising: knocking out the PKD1 or PKD2 gene in a cell; and contacting that cell with the composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45 for a first period of time to form mini aggregates; and transferring the mini aggregates into a KR5-CF medium and shaking for a second period of time; and contacting the mini aggregates with KR5 medium for a third period of time, wherein KR5 medium comprises GlutaMax-1, MEM NEAA, 2-Mercaptoethanol, Pen Strep, and Serum Replacement, and the KR5-CF medium comprises the ingredients of KR5 and CHIR99021 and FGF7. 63. The method of claim 62, wherein the contacting PKD1 or PKD2 knockout cell is in a sequential order: the first period of time of about 1 day in the presence of a composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45, then the second 43 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT period of time of about 2-3 days in the presence of KR5-CF medium, then the third period of time of about 4-8 days in the presence of KR5 medium. 64. The method of embodiment 62 or 63, wherein the cell is a hNPC, iNPC, or mNPC. 65. The method of embodiment 62 or 63, wherein PKD1 or PKD2 is knocked out using CRISPR/Cas9 based genome editing. 66. A method of treating PKD, comprising administering a BMI-1 inhibitor. 67. The method of embodiment 66, wherein the BMI-1 inhibitor is PTC-209. 68. The method of embodiments 57 or 58, wherein the organoids develop podocyte structures, proximal tubule structures, and distal tubule structures. 69. The method of embodiment 59, wherein the organoids are positive for one or more markers of mature podocytes organoids, wherein the markers for distal tubule segments comprise NPHS1, PODXL, PLA2R1, COL4A3, or COL4A4. 70. A method of generating nephron organoids, comprising: contacting a population of iNPCs or hNPCs for a first period of time with the composition of any one of embodiment 1-23 or the cell culture medium of any one of embodiment 24-45; and for a second period of time with a composition comprising CHIR99021; and for a third period of time with a composition comprising FGF9 and heparin; and for a fourth period of time with a culture medium with B27 and A83-01. 71. The method of embodiment 70, wherein the contacting a population of iNPCs or hNPCs is in a sequential order: the first period of time of about 1 day in the presence of a composition of any one of embodiments 1-23 or the cell culture medium of any one of claims 24-45, then the second period of time of about 1 hour in the presence of CHIR99021 and the absence of a composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45, then the third period of time of about 4 days in the presence of FGF9 and heparin and the absence of CHIR99021, then the fourth period of time of about 9 days in the presence of a culture medium with B27 and A83-01 and the absence of FGF9 and heparin. 72. The method of embodiments 70 or 71, wherein the organoids develop podocyte structures, proximal tubule structures, and distal tubule structures. 73. The method of embodiment 72, wherein the organoids are positive for one or more markers of mature podocytes. 74. The method of embodiment 73, wherein the one or more markers of mature podocytes comprise NPHS1, PODXL, PLA2R1, COL4A3, or COL4A4. 44 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 75. A method of reprogramming differentiated nephron cells to the NPC state, the method comprising: contacting the cells with the composition of any one of embodiments 1-23 or the cell culture medium of any one of embodiments 24-45. 76. The method of any one of embodiments 49-50, wherein the cell, or population thereof, is a podocyte. 77. The method of any one of embodiments 75, wherein the cell, or population thereof, is isolated from kidneys. 78. A nephron organoid generated by the method of any one of claims 70-74. [0131] Illustrative embodiments are now described. Other embodiments may be used in addition or instead. Details that may be apparent to a person of ordinary skill in the art may have been omitted. Some embodiments may be practiced with additional components or steps and/or without all of the components or steps that are described. EXAMPLES EXAMPLE 1: Nephron progenitor cell-directed modeling of human kidney development, disease, and cellular plasticity SUMMARY: [0132] Nephron progenitor cells (NPCs) self-renew and differentiate into nephrons, the functional units of the kidney. Here, manipulation of p38 and YAP activity allowed for long-term clonal expansion of primary mouse and human NPCs, and induced NPCs (iNPCs) from human pluripotent stem cells. Molecular analyses demonstrated cultured iNPCs resemble closely primary human NPCs. iNPCs generated nephron organoids with minimal off-target cell types and enhanced maturation of podocytes relative to published human kidney organoid protocols. Surprisingly, NPC culture medium uncovered plasticity in human podocyte programs, enabling podocyte reprogramming to an NPC-like state. Scalability and ease of genome-editing facilitated genome-wide CRISPR screening in NPC culture, uncovering novel genes associated with kidney development and disease. Further, NPC-directed modeling of autosomal-dominant polycystic kidney disease (ADPKD) identified a small molecule inhibitor of cystogenesis. These findings highlight a broad application for the reported iNPC platform in the study of kidney development, disease, plasticity, and regeneration. RESULTS p38 inhibition allows the derivation of clonal expandable NPC lines from any mouse strain. 45 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0133] We previously developed a 3D culture system that can expand mouse NPCs (mNPCs) as clusters of cells in a chemically-defined culture medium, mNPSR12. However, mNPSR did not support mNPC expansion in a regular monolayer (2D) culture setting. To solve this problem, we have systematically screened the addition of a variety of small molecules and growth factors to mNPSR medium, resulting in mNPSR-v2: a chemically-defined medium that supports the derivation and long- term clonal expansion of mNPC lines from multiple mouse strains (Fig.1A , Fig.8A and Tables 1 and 2). [0134] Compared to mNPSR, mNPSR-v2 has four additional small molecules: SB202190 (inhibitor of p38 MAPK), DAPT (inhibitor of Notch signaling), A83-01 (inhibitor of TGF-β signaling) and LDN193189 (inhibitor of BMP signaling), and required a different concentration (1.5 µM) of CHIR99021 (inhibitor of GSK3). Of these additional components, we have previously found that adding A83-01 and LDN193189 to mNPSR can enable the expansion of mNPCs at lower seeding mNPC numbers in a 3D culture setting21. LDN19318910 and DAPT11 have also been used in supporting short-term expansion of mNPCs. Consistently, we noticed addition of DAPT prevented spontaneous differentiation of 2D cultured mNPCs (Fig.8C and D). The p38 MAPK inhibitor SB202190 has not been previously reported to support mNPC self-renewal, but appears to have the most significant effect in sustaining the percentage of SIX2+/PAX2+ mNPCs in culture (Fig.1B and 8B). In addition, intrinsic p38 MAPK activity was found to be low in the self-renewing mNPCs in vivo (Fig.1C). mNPCs expanded in mNPSR-v2 stably proliferate with highly homogeneous morphology (Fig.1D and E), show uniform NPC marker gene expression (Fig.1F and 1G), at similar levels to those observed in primary NPCs (Fig.8E). Upon withdrawing each individual medium component from mNPSR-v2, we confirmed that all components are essential to maintain the proper growth rate and undifferentiated state of the mNPCs (Fig.8F and G). [0135] To examine the nephrogenic potential of the cultured mNPCs in vitro and in vivo, we examined first the inductive response in the classic spinal cord induction assay6,12. We observed the formation of numerous tubule-like structures after 7 days (Fig.1H), with PODXL+ glomeruli, LTL+ proximal tubule, and CDH1+ distal tubule structures (Fig.1I). Nephron organoids were also formed from cultured mNPCs using our chemically-defined media 12, generating multiple segments of the nephron (Fig.8H). When we reconstructed an engineered kidney from cultured mNPCs and cultured ureteric bud (UB)22, mNPCs induced dramatic branching morphogenesis from the UB (Fig.8I), while the UB induced nephron formation from the mNPCs (Fig.8J). When mNPCs were transplanted onto the chicken chorioallantoic membrane (CAM) in vivo23, mNPCs differentiated into nephrons and chick vasculature infiltrated the transplant (Fig.8K-8M). 46 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0136] Importantly, 2D-cultured mNPCs were efficiently expanded from single cells with a high cloning efficiency of 60–70% (Fig.1J-N, 9A and 9B). To compare the global gene expression of cultured and primary mNPCs12,24, we performed bulk RNA-seq. Based on principal component analysis (PCA), cultured NPCs were clustered tightly together (Fig.1O and 9C), largely overlapped with primary E11.5, E12.5, and E13.5 mNPCs in PC1 and PC3 axes (Fig.9D) as well as in the heatmap, using a selective group of typical NPC and nephron marker genes (Fig.1P). Comparative analysis indicates cultured mNPCs resemble early-stage (E11.5 to E13.5) mNPCs. The robustness of mNPSR- v2 allowed us to derive mNPC lines from isolated E11.5 metanephric mesenchyme (Fig.9E and 9F) or from whole kidney cells of an early embryonic kidney (Fig.9G-9K), enabling the derivation of mNPC lines from all mouse strains tested (Fig.1A and Table 3). Plasticity of developing nephron cells with mNPSR-v2 medium. [0137] While developing the mNPSR-v2 medium, we noticed a significant portion (10–20%) of Six2-GFP negative (Six2-GFP-) cells isolated from dissociated kidneys at all stages (E12.5, E14.5, E16.5 and P0 kidneys) adopted a SIX2+/SALL1+ phenotype within 4 days of culture (Fig.2A and 2B). This finding suggests the possibility of phenotypic plasticity on the part of non-NPC type(s) in mNPSR-v2 medium. To exclude the possibility of potential contamination of a small number of Six2- GFP+ mNPCs during FACS, we cultured cells from kidneys at postnatal day 3 (P3), P4, P5 and P7, stages that do not have Six2-GFP+ cells (Fig.10A), in mNPSR-v2 for 4 days. Approximately 17% of the P3 kidney cells and 7% of the P4 kidney cells were scored as SIX2+/SALL1+, rare SIX2+/SALL1+ cells were observed also within P5 and P7 cultures (Fig.2C and 2D, and 10B and 10C). This happens most efficiently in mNPSR-v2 (18%), less efficiently in mNPSR (6%), and does not happen in basal medium with 10% FBS (0%) (Fig.10D and 10E). To further characterize the induced Six2+ cells, we developed an assay to purify these cells using an NPC lineage tracing reporter system3 (Fig.2E). Similar to immunostaining results, after 4 days of culture, around 20% of the cultured P3 kidney cells became Six2-tdTomato (Six2-tdT)+ as shown by FACS (Fig.10F and 10G). On culture day 8, Six2- tdT+ cells showed a more complete NPC profile expressing Six2, Pax2, Sall1, Wt1, Gdnf, Hoxd11, and Eya1, coinciding with loss of expression of nephron marker genes Slc12a1, Slc12a3, and Aqp1 (Fig. 2F). [0138] Wnt4+ cells, the immediate differentiated progenies of the NPCs, can migrate back to the cap mesenchyme niche, where NPCs reside, and reverse back to the NPC state in vivo25. To investigate whether Wnt4+ cells contribute to the plasticity we observed in vitro, we injected tamoxifen into P2 Wnt4-GFP-Cre-ERT2; Rosa26-tdTomato (Wnt4-tdT for short) mice to permanently label Wnt4+ cells and their progeny. Kidneys were isolated 24hrs later on P3, and tdTomato+ cells FACS purified and 47 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT cultured in mNPSR-v2 (Fig.2G and 2H). After 4 days of culture, more than 70% of the cultured Wnt4-tdT+ cells stained positive for SIX2/SALL1, as compared to 20% starting from P3 whole kidneys (Fig.2I and 2J). These results suggest that, like in vivo, the Wnt4+ cells represent a highly plastic cell population that can be efficiently reprogrammed to an NPC state in vitro in the presence of mNPSR-v2 mirroring niche maintenance conditions.. Genome-wide CRISPR screen in the NPC lines identify functional genes for kidney development and disease. [0139] Considering the central roles NPCs play in kidney organogenesis, Wilms tumor, and congenital kidney diseases such as congenital anomalies of the kidney and urinary tract (CAKUT), the use of CRISPR screen tools17-19,26,27 to understand NPC biology from the genome-wide perspective could provide valuable molecular and genetic insight into these areas. Thus, as a proof-of-concept, we introduced a genome-wide CRISPR knockout library28 into cultured NPCs to screen for genes essential for NPC fitness (Fig.3A), comparing the relative abundance of sgRNAs in the cultured NPCs by next- generation sequencing 3 weeks after introduction of the CRISPR library. With the MAGeCK-VISPR tool29, sgRNA abundance changes from 4 different sgRNAs targeting the same gene in the library are statistically integrated as beta scores. Positively selected (i.e. increased sgRNA abundance) genes with more dramatic sgRNA abundance increase will have higher positive beta scores; while negatively- selected genes with more dramatic sgRNA abundance decrease appear as lower negative beta scores [0140] After performing quality control analyses for the similarity of biological replicates (Fig. 11A), global changes of sgRNA abundance in the screen (Fig.11B and 11C), and negative selection for “pan-essential genes”30 (Fig.3B), we identified 410 positively-selected genes (beta scores >1.5) and 696 negatively-selected genes (beta scores <-1.5) shared between replicates (Fig.3C). Using Ingenuity Pathway Analysis (IPA) to analyze the identified gene sets confirmed the enrichment of fundamental cellular pathways necessary for cell survival, and identified mTOR signaling, microRNA biogenesis, and oxidative phosphorylation pathways, which play critical roles in NPC self-renewal in in vivo studies31-35, among the top enriched pathways (Fig.3D, 11D and 11E). Consistent with an essential role for FGF, WNT, and LIF signaling in NPC self-renewal in vitro (Fig.11F and 11G), genes encoding critical receptor, signaling mediator, and effector proteins of these pathways, were identified in the screen (Fig.3E, 11F and 11G). For example, Fgfr1, Grb2, Mapk1, and Myc, were among the top negatively selected genes. On the contrary, Dusp6, which inhibits FGF signaling, was a top positively- selected gene (Fig.3E). These results further validated the high quality of our CRISPR screen results. [0141] To identify potential NPC self-renewal genes in the whole genome, we removed from the CRISPR screen hits essential genes and genes with low gene expression levels in primary NPCs12,24. 48 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT We then overlapped the gene list with two NPC-enriched gene lists—E12.5 Six2+ NPC vs. Six2- non- NPC12 and E16.5 NPC vs. IPC (interstitial progenitor cell)24. With this stringent data filtration method, a short-list of 64 genes were obtained. Interestingly, 25 out of the 64 genes encode proteins that localize to the nucleus (Fig.3F), including genes linked to NPC programs: Sall136-38, Wt139, Foxc140, and Myc41,42. Amongst genes with no previous NPC association we identified Sobp, a co-factor for Six1, which encodes a key transcriptional determinant of the NPC state43. SOBP is known to interfere in the transcriptional activation of SIX1/EYA1 target genes during craniofacial development, likely leading to Branchio-oto-renal syndrome (BOR)44. These observations, together with our CRISPR screen result, support a potential role for Sobp in the regulation of NPC fates. [0142] Wilms tumor is associated with the retention and expansion of cells that have overlapping signatures between NPCs and their early nephron-committed descendants. Currently, around 30 Wilms tumor-related genes have been well established5. Of note, 11 out of the 30 genes (36.7%) were identified by our CRISPR screen. The tumor suppressor genes Trp53 and Bcor were among the top positively selected genes, while oncogenes such Mycn and Max were amongst the negatively selected gene set (Fig.3G). Dysregulation of normal kidney development process can also lead to congenital kidney diseases, such as CAKUT, for which around 330 genes might be related4. Out of the 330 genes, 25 (7.6%), were identified in our CRISPR screen, consistent with the notion that dysregulation of NPC fates represents a significant source for kidney malformation (Fig.3H). Confirmation of the large numbers of known Wilms tumor and CAKUT related genes suggests that our CRISPR screen datasets might identify other genes with previously unknown functions in these diseases. [0143] Epigenetic mechanisms have been found to play critical roles in NPC self-renewal in vivo45. Our CRISPR screen has identified the majority of these reported epigenetic factors, including Hdac146, Chd447, Ezh248, and Smarca449. In addition, two other epigenetic regulators whose function has not been examined in NPCs, Kmt2a (Mll1) and Kat6a, were found to be among the top negatively- selected genes (Fig.3I-3K). After confirming the expression of Kmt2a and Kat6a in the cultured NPCs and primary NPCs, we employed two small molecule inhibitors to KMT2A, MLL1 (inh), and WDR5 degrader50, and two small molecule inhibitors to KAT6A, WM-1119, and MOZ-IN-3, and experimentally validated KMT2A and KAT6A activities are essential for NPC self-renewal (Fig.3L and 3M, and 11H and 11I). Considering recent whole-exome sequencing in families with CAKUT identified dominant monogenic point mutations in human KMT2D and KAT6B genes associated with syndromic CAKUT51, these findings suggest mutations in KMT2D and KAT6B might dysregulate NPC programs in human CAKUT . [0144] Taken together, our CRISPR screen datasets provide valuable genome-scale resources for future studies of kidney development, Wilms tumor, and CAKUT. 49 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT YAP activation derives long-term expandable human NPC lines. [0145] To derive long-term expandable human NPC lines in 2D, we first performed immunostaining in human fetal kidney sections and verified that p38 MAPK activity (Fig.4B and 12A), TGF-β signaling (Fig.4C) and BMP signaling (Fig.4D), are intrinsically low in the primary hNPCs in vivo. Thus, we included p38, TGF-β, and BMP inhibitors in the culture medium to expand human NPC as we did in mNPSR-v2. By replacing mouse LIF with human LIF in the mNPSR-v2 medium, we prepared a culture medium, designated as hNPSR-v1. Relying on our engineered H1 human embryonic stem cells (hESCs) with dual reporter system for SIX2-GFP and PAX2-mCherry, following a well-established 10-day hPSC-to-NPC differentiation protocol8 (Fig.12B), we purified the SIX2+/PAX2+ hPSC-induced NPC (iNPC) population by FACS (Fig.12C) and cultured them in hNPSR-v1. However, after 2 weeks iNPC cell proliferation slowed, NPC marker gene expression was down-regulated and iNPCs lost YAP expression in the nucleus (Fig.4E). Considering the reported role of YAP activity in the self-renewal of NPCs52, we supplemented our recently reported, highly specific small molecule YAP agonist TRULI53 to the medium to make an hNPSR-v2 formulation (Table 2). [0146] iNPCs cultured in hNPSR-v2 grew quickly with a typical passaging ratio of 1:10 every 3–4 days (Fig.4G and 4H). After 3 weeks of culture, more than 95% of cells maintained expression of SIX2/PAX2/WT1/SALL1/ITGA8 (Fig.4I and 4J). After long-term culture of more than 3 months, all examined NPC marker genes were still retained, except for a gradual decrease of PAX2 starting after 1 month of culture (Fig.12D-12F). iNPCs showed a clonal efficiency of 58-70% in reseeding experiments (Figs.4K and 4L, 12G and 12H). Importantly, the robustness of hNPSR-v2 enabled the direct derivation of iNPC lines without prior FACS enrichment of SIX2+/PAX2+ iNPCs (Fig.4A, 12I- 12K and Methods). Primary human NPCs were stably expanded in hNPSR-v2 for 100 days while retaining NPC gene expression (Fig.13A-13J). Bulk RNA-seq analysis was performed to compare iNPCs without further culture in hNPSR-v2 (day 0), cultured human NPCs (day 15 to day 80) from different sources (iNPC or primary NPCs) and primary human NPCs from human fetal kidneys24. PCA analysis showed, compared to iNPCs without further culture, or cultured in the v1 medium, NPCs cultured in the v2 medium were clustered in PCA closer to the primary NPC state, which largely overlapped with the primary NPCs in both PC1 and PC3 axes (Fig.4M, 4N, and 12L). Heatmap of NPC marker genes and nephron segment anchor genes also clustered the cultured NPCs closer to the primary NPCs than iNPCs without any culture (Fig.4O). Of note, compared to primary NPCs and cultured NPCs, iNPCs without further culture (iNPC D0) showed significantly lower expression of SIX2, HOXA11, and HOXD11 genes (Fig.4O), suggesting that after further culture, iNPCs transition to a state much similar to the primary NPCs. Furthermore, we showed that genetic manipulations, 50 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT including lentiviral gene overexpression and CRISPR-Cas9 based gene knock-in, can be efficiently conducted in the cultured iNPCs, opening new avenues of applications for this system (Fig.4P and 4Q). [0147] We next applied a pulse of Wnt activation to generate nephron organoids from cultured NPCs, a standard approach in protocols driving hPSC kidney organoid development that mirrors Wnt induction of the mesenchymal-to-epithelial transition of NPCs in vivo (Fig.13K, and Methods). We observed a clear mesenchymal-to-epithelial transition in the first 3 days after Wnt activation, with numerous PAX2-mCherry reporter positive renal tubule-like structures formed over a course of 14 days of culture (Fig.12M and 12N). Immunostaining further confirmed the formaton of renal vesicle (RV) or S-shaped body (SSB) stage early nephrons 8 days after differentiation (Fig.12O), and the formation of various nephron segments after 2 weeks of differentiation, including PODXL+/NPHS1+ glomeruli, LTL+/HNF4A+/SLC34A1+/SLC27A2+ proximal tubule, and PAX2+/SLC12A1+ loop of Henle, with primary cilia observed exclusively on the apical side of the renal tubules (Fig.4R-4U, 12P and 12Q). Current kidney organoids generate a significant amount of off-target cell populations such as neurons and myocytes14,15,54,55. In contrast, in the cultured iNPC-derived nephron organoids, MAP2 and NeuN, two neuron genes frequently expressed in current kidney organoids, were not detected (Fig.12R). Similar results were observed in the nephron organoids that were derived from long-term cultured primary human NPCs (Fig.13L-13N). Transcriptome analyses reveal in vivo-like nephrogenesis, mature podocyte formation, and minimal off-target cells from iNPC-derived nephron organoid. [0148] To examine progressive transcriptional changes during in vitro differentiation in our organoid model, we performed time-course bulk RNA-seq at 2, 4, 7, 10, 14, and 21 days post induction with two replicates (Fig.5A). Unsupervised clustering by principal component analysis (PCA) grouped the samples in a temporal order, suggesting gradual transcriptional changes from undifferentiated NPCs (D0) to differentiated nephron organoid (D21) (Fig.5B). Comparing these data with human marker genes for the nephrogenesis shows nephron organoid differentiation recapitulates in vivo-like staged nephrogenesis. Transcriptional signatures sequentially progress from NPC (D0) to PTA/RV/SSB stage (D2-D7), and then exhibit profiles resembling maturing nephrons containing podocytes and renal tubules (D10-D21) (Fig.5C). For example, the time-course gene expression profile includes the in vivo podocyte development trajectory: podocytes at the early period of the development (“early podocyte”, E-Pod) genes (e.g., SLC16A1, OLFM3, and PCDH9) at D7 and D10; mature podocytes (“late podocyte”, L-Pod) genes (e.g., NPHS1, PODXL, and PLA2R1) detected at D10 and gradually increased until D21 (Fig.5C). Importantly, the late podocyte genes COL4A3 and COL4A4, encoding essential 51 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT glomerulus basement membrane components associated with Alport syndrome56, were expressed abundantly in the iNPC-derived nephron organoids, in contrast to the previous reports of other hPSC- derived kidney organoid models8,9,57. [0149] To evaluate cellular heterogeneity and differentiation outcome in our organoid model in an unbiased manner, we employed single-nuclear multiome analysis on D21 nephron organoids with the 10X Chromium Single Cell Multiome ATAC + Gene Expression platform. After applying quality- control metrics and eliminating potential sequencing artifacts through the Seurat V4 R package58 (Fig. 14A and 14B), we obtained 21,404 nuclei from two biological replicates of organoid samples, with a median of 2,888 genes per nucleus from the snRNA-seq dataset, and 8,711 fragments per nucleus from the snATAC-seq dataset. Consistent with our bulk RNA-seq and immunostaining results, unsupervised UMAP clustering of the snRNA-seq dataset identified major compartments of the nephron including podocyte, proximal tubule and distal tubule. In addition, a COL1A1+ interstitium population and a minor population of off-target cells (0.67%) were also identified (Fig.5D-5F, 14C and 14D). [0150] To directly compare our iNPC-derived organoids with existing kidney organoids generated from hPSCs, we integrated our snRNA-seq data (day 21) with two published datasets (days 26 and 28) representing two prevailing kidney organoid protocols from hPSCs: 1) our previously published kidney organoid dataset following the Morizane protocol57 (samples TT.r1 and TT.r2); and 2) a recent publication following the Takasato protocol from the Humphreys lab generated using the same single- nuclear multiome approach59 (samples AN1.1, BJFF.6, and H9) (Fig.5G, 14E and 14F). The relative proportions of cell-types generated in each kidney organoid model was quantified. Compared to hPSC- derived kidney organoids, iNPC-derived kidney organoids have three unique features: 1) higher proportion of podocytes (Fig.5H-5J), 2) few off-target cells (Fig.5H), and 3) no residual undifferentiated SIX2+ or EYA1+ NPCs (Fig.5H). The observation of fewer off-target cells is consistent with our immunostaining results (Fig.12R) and is in line with expectations considering the high purity of the iNPCs and their restricted developmental potential to generate nephrons. [0151] For the renal tubule compartment, the proximal tubule cells in iNPC-derived organoid showed high expression levels of CUBN and LRP2 (Fig.5K). The majority of distal tubule cells showed high expression levels of SLC12A1 (Fig.5L), consistent with their strong expression and apical localization shown by immunostaining (Fig.4S and 4T). Consistent with our bulk RNA-seq results (Fig.5C), the multiome analysis confirmed that the most mature podocytes in the iNPC-derived organoid showed lower expression of early podocyte genes and higher expression of late podocyte genes compared to those forming in hPSC-derived organoids, suggesting improved podocyte differentiation in our model (Fig.5M). Supporting this, in the snATAC-seq dataset, the open chromatin 52 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT accessibility of COL4A3, COL4A4, and NPHS1 from iNPC-derived podocytes mimic the podocytes from adult kidneys60 (Fig.5N). Reprogramming from podocyte to NPC by hNPSR-v2 reveals human podocyte plasticity. [0152] To examine the potential for cell plasticity in human nephron development (Fig.2), we differentiated SIX2-GFP; PAX2-mCherry dual-reporter iNPCs to nephron organoids.7 days after nephron induction, we FACS-isolated SIX2-GFP- non-NPCs and cultured cells in hNPSR-v2 (Fig.6B). After 9 days in hNPSR-v2, 27.7% of cells in the SIX2-GFP- seeded cultures were SIX2-GFP+. SIX2- GFP+ cells were FACS-purified (using GFP) and stably expanded in hNPSR-v2 assuming a morphology indistinguishable from iNPCs (Fig.6C) while maintaining consistent expression of NPC marker genes (Fig.15A and 15B). Further, these SIX2-GFP- descendant cells underwent similar organoid differention to primary SIX2-GFP+ iNPCs (Fig.15C and 15D). We next isolated SIX2-GFP- cells from organoids 3, 5, and 8 days after nephron induction (OG-D3, OG-D5, and OG-D8 for short, respectively) (Fig.15E). Following culture in hNPSR-v2, SIX2-GFP+ NPC lines were also successfully derived from SIX2-GFP- cells at each of these time points (Fig.15F-15I). Transcriptome analyses clearly showed the transition from SIX2-GFP- non-NPCs to SIX2-GFP+ NPCs, inseparatable from iNPCs on the basis of PCA of mRNA profiles (Fig.6D, and 15J) and expression of NPC marker genes (Fig.15K). Given the emergence of SIX2-GFP+ NPC-like cells from a SIX2-GFP- population we termed this cell type “reprogrammed” NPCs (rNPCs). [0153] Compared to other specialized cell types to emerge in the epithelial anlage of the nephron, podocyte progenitors are recruited late in renal vesicle formation but specified early developing podocytes share molecular features on NPCs2,61. We thus investigated whether specified podocytes can be reprogrammed to rNPCs. For that, we performed FACS upon immunolabelling podocyte surface marker PODXL and sorted out PODXL+/SIX2-GFP- podocyte population (32.2%) from nephron organoids, which were futher verified to be SIX2-/SALL1-/MAFB+/NPHS1+/WT1+/PODXL+ (Fig.6G and 6I). After 7 days of culture in hNPSR-v2, podocytes underwent a mesenchymal transition (Fig.6F and 15L). Remarkably, by day 8 of culture, 44.6% of original PODXL+/SIX2-GFP- cells were SIX2- GFP+ (Fig.6E). Stable rNPC lines derived after this timepoint showed uniform NPC marker gene expression (Fig.6H and 6J) and a nephrogenic potential similar to that of other rNPC and iNPC lines (Fig.15M). As a secondary validation, we employed our previously described MAFB-GFP knockin reporter hPSC line derived from the H9 hESC background62. iNPC lines were generated from MAFB- GFP hPSC line. MAFB-GFP+ podocytes were isolated by FACS from day 8 iNPC-derived nephron organoids and cultured in hNPSR-v2 (Fig.6K and 15N). rNPC cells were isolated from these cultures by FACS sorting on surface marker ITGA8+, which is highly enriched in NPCs, and continued culture 53 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT in hNPSR-v2 (Fig.6L and 6M). Analysis of NPC gene expression (Fig.15O and 15P) and nephrogenic potential (Fig.6N and 6O) supported a reprogramming of MAFB-GFP+ podocytes to NPCs. To exclude the possibility that the plasticity can only be observed from organoid-derived podocytes, PODXL+ podocytes were purified from 17.4 week (17.4wk) human fetal kidney (hFK) and cultured in hNPSR-v2 (Fig.6P). After 22 days of culture, more than half of the cultured cells were positive for SIX2 and SALL1 (Fig.16D and 16E). After 30 days of culture, ITGA8+ cells (68.5%) were isolated by FACS and cultured (Fig.6P); cultured cells displayed a typical NPC morphology (Fig.16F), consistent expression of NPC marker genes (Fig.6Q and 16G) and nephrogenic potential on differentiation (Fig.6R and 16H), consistent with reprogramming. An rNPC line was also derived from primary podocytes isolated from a 11.4wk hFK sample (Fig.16A-16C), confirming plasticity of primary human podocytes. [0154] To examine progressive transcriptional changes during podocyte-to-NPC reprogramming, we performed time-course bulk RNA-seq of this process (Methods). PCA and Pearson correlation heatmap clearly segregated D0 (podocytes) samples from samples of all other time points, with D4/D6 samples and D9/D16/D24 samples forming two clusters (Fig.16I and 16J). By examining marker genes for human nephrogenesis, podocyte genes were found to be highly expressed in the D0 samples but nearly completely depleted from D2 (Fig.13S). On the contrary, expression of genes representing PTA/RV stage (e.g. PAX8, WNT4, CRYM) was induced from D2, reached the peak on D4, and decreased on D6. From D9 to D24, the samples no longer express any podocyte or PTA/RV signature genes, but show strong NPC signature gene expression. Between day 0 and 4 of culture, podocyte signature gene significantly down-regulated while PTA/RV genes were significantly up-regulated (Fig. 16K). Comparing D24 to D4 showed a marked increase in expression of NPC signature genes (Fig. 16L). Gene ontology (GO) analyses were consistent with the observed changes in gene expression (Fig.16M and 16N). These data, support a model in which podocytes cultured in hNPSR-v2 undergo a reversal of the differentiation program through a PTA/RV intermediate before stabilizing as rNPCs (Fig.6T). Rapid, efficient, and scalable PKD modeling and small molecule sreening from genome-edited NPCs . [0155] Autosomal-dominant polycystic kidney disease (ADPKD) is the most prevalent inherited kidney disease occurring at a frequency of approximately 1 in 500 live births63. Studies from several groups62,64-67 have successfully modeled ADPKD through the genetic removal of PKD1 or PKD2 in human pluripotent stem cells (hPSCs), and PSC differentiation to cyst-forming kidney organoids, under a variety of conditions. Starting from genome-edited mouse and human NPC lines, we have developed 54 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT rapid, efficient, and scalable ADPKD modeling and small molecule sreening platforms (Fig.7A and 7B). [0156] We employed a modified one-vector multiplexed CRISPR-Cas9 system68 for highly efficient one-step gene knockout directly in Cas9-expressing mouse NPCs (Fig.17A-17C, and Table 3). We then generated Pkd1 and Pkd2 knockout NPCs using this system (Fig.17D and 17E). We next isolated single cell clones from both Pkd1 and Pkd2 bulk knockout mNPCs (Fig.17F) and validated successful knockout of each allele (Pkd2-/- clones #2, 4 and 5) and (Pkd1-/- clone #1; Fig.17G-17J). To examine cyst formation, we used our published protocol to make nephron organoids at the air-liquid- interface in Transwells12, then manually dissected organoids into smaller pieces which were transferred to shaking culture64 (Fig.18A). Almost all Pkd1-/- and Pkd2-/- NPC-derived nephron organoids formed cysts of different sizes, whereas no cysts were formed in EGFP-/- control organoids (Fig.18B and 18C). Cysts were formed at a similar efficiency following a freeze-and-thaw cycle, opening up opportunities for easy transportation and distribution of PKD organoids (Fig.18D-18F). Treatment with CFTRinh17269, metformin70,71, and AZ50572,73, previously reported to have cyst growth suppressing activities, decreased the percentage of organoids undergoing cyst formation and cyst diameter within the organoids (Fig.18G-18I). As expected, these AVPR2 negative organoids did not respond to the only current FDA approved treatment for ADPKD, the AVPR2 inhibitor tolvaptan 74,75. To establish a scalable PKD organoid model, we used commercially available AggreWell plates to mass produce mini 3D NPC aggregates. After aggregation, the mini NPC aggregates were transferred into shaking culture, the setting for nephron induction and cyst formation (Fig.7A and 7C). Under the optimized culture condition (Fig.19A-19F, and Methods), Pkd1-/- or Pkd2-/- NPC aggregates differentiated into cystic nephron organoids under shaking culture in a synchronized manner with the budding of cysts as early as 4 days after shaking culture (Fig.18J-18M). [0157] We further determined whether the NPC-derived PKD organoids recapitulates key features of PKD. Whole-mount immunostaining of Pkd2-/- cystic organoids clearly showed the co-expression of LTL and CDH1 in the majority of the cyst-lining cells (Fig.20A). Analysis of phosphorylated histone H3 (pHH3) staining and quantification of total genomic DNA indicated an increased cellular proliferation in cystic organoids (Fig.7D, 20A and 20B). Gene expression analysis showed enhanced expression of a group of cell cycle genes, and increased activity of the mTOR pathway76,77 and MYC78,79 (Fig.7E and 20C and 20D). To examine the metabolic status of Pkd2-/- organoids and control GFP-/- organoids, we performed a SeahorseXFpTM analysis. Both the oxygen consumption rate (OCR, indicator of oxidative phosphorylation) and the extracellular acidification rate (ECAR, indicator of glycolysis) were elevated in Pkd2-/- organoids (Fig.7F, 20F-20I, 20N, and 20P). In PKD, cyst- lining cells use significantly more energy from glycolysis to support the high metabolic needs for cyst 55 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT growth80,81. Importantly, comparing undifferentiated PKD mutant NPCs with organoid derivatives demonstrated the metabolic phenotypes following Pkd2 removal were specific to differentiated epithelium-containing organoids (Fig.20E, 20J-20M, 20O, and 20P). Taken together, the cultured NPC-derived PKD organoid models recapitulate key molecular, cellular, and metabolic features of ADPKD pathogenesis. [0158] As a proof-of-concept for small molecule screening using this PKD organoid model (Fig. 7A), we tested a commercially available small molecule library comprising 148 compounds targeting major pathways regulating the epigenome (Fig.7G, 21A and Methods). Fourteen compounds showed significant inhibititory effects on cyst formation in at least one biological replicate (Fig.7G and 7H), while metfomin dose-dependently inhibited cyst formation and tolvaptan had no effect (Fig.21B). Of the 14 hits, 12 replicated in a second screen (Fig.7H). Of these, 8 were annotated as HDAC inhibitors and 3 as BRD4 inhibitors, both previously identified at targets for ADPKD82,83. The final hit, PTC-209, a specific inhibitor of BMI-1, has not previously been linked to cysts suppression in ADPKD but showed a dose-dependent inhibition in our assay (Fig.21C-21E). [0159] To replicate screening in human PKD2 mutant organoids (Fig.7B), biallelic frame-shift mutations were generated in PKD2 in the SIX2-GFP hPSC line (clones #10 and 11; Fig.7I and 7J). Mini NPC aggregates were generated from these followed by shaking culture and nephron induction (Fig.7B, 22A, and Methods). After 8 days of shaking culture, cysts were observed in PKD2-/- NPC- derived nephron organoids, but not in wild-type control organoids. These cysts continued to grow larger with the majority of the cyst-lining cells expressing LTL and CDH1 (Fig.7K, 22B-22D). These cystic organoids respond to CFTRinh172, metformin, AZ505, and tubacin84, but not tolvaptan (Fig. 22E-22G). Incubating with PTC-209 resulted in a dose-dependent cyst inhibitory effect without obvious cellular toxicity at the inhibitory threshold (1 µM), as determined by TUNEL assay using staurosporine induction of cell death as a positive control (Fig.7L-7N). DISCUSSION [0160] In this study, we identify culture conditions that enable the long-term expansion of mouse and human NPCs retaining nephrogenic potential. Inhibition of p38 MAPK activity and activation of YAP were critical to success. The in vitro NPC culture system will facilitate future mechanistic studies on the specific actions of these pathways. Surprisingly, hNPSR-v2 supported the dedifferention of committed nephron progenitors (WNT4+) and cells undergoing podocyte development (MAFB+ and NPHS1+) to NPC-like cells as determined by gene expression profiling and assaying nephrogenic potential through organoid development. These observations support in vivo studies of the developing mouse kidney that highlight a developmental plasticity within induced Wnt4+ NPCs25. Analysis of 56 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT hNPSR-v2-dependent reprogramming of podocytes supports a reversal of the podocyte differentiation program. How this operates at the molecular level and to which point in the podocye developmental program cells retain plasticity are interesting questions for future study that are facilitated by the reported culture model. [0161] Our observation that hPSC-derived iNPCs, without further culture in hNPSR-v2, are not fully programmed to the NPC stage, agrees with a recent report where an improvement in NPC specification led to improved proximal tubule specification16. We observed iNPCs, with transcriptome much closer to primary NPCs, generate nephron organoids with more mature podocytes expressing COL4A3+/COL4A4+ hitherto only reported in human kidney organoids following implantation into the mouse kidney57,85,86. Given that podocytes are the kidney cell type most associated with recessive genetic disease87, including deficiencies in COL4A3/4/5 associated with Al-port syndrome, the culture system offers new opportunities for disease modeling. A disease modeling potential was further highlighted by effective modeling of ADPKD: removing PKD1 and PKD2 and demonstrating robust cystogenesis in iNPC derived kidney organoid cultures; and further, identifying a BMI-1 inhibitor, PTC-209, as a cyst suppressor in a screen of small molecule modifers of epigenetic programming. Additionally, at the genome level, CRISPR/CAS9 technologies demonstrated the utility of iNPC culture for genetic screening, confirming existing and identifying novel gene regulators of NPC states. Table 1. Chemicals and growth factors used in the optimization of mNPSR-v2 medium Targeted signaling pathways Chemicals and growth factors CHIR99021 (0.5pM, 1pM, 1.25pM, 1.5pM, Wnt signaling pathway 1.75pM, 2pM, 2.5pM, 3pM), R-Spondin 1 (50ng/mL, 100ng/mL), IWR-1 (0.5pM, 2.5pM, 5pM) XMU-MP-1 (0.1pM, 0.3pM, 0.5pM, 1pM), Verteporfin (0.1pM, 1pM), Lysophosphatidic acid (LPA) Hippo signaling pathway (1pM), Sphingosine-1-phosphate (S1P) (1pM), TRULI (1pM, 1.5pM, 2pM, 2.5pM 4pM, 10pM) Notch signaling pathway DAPT (2pM, 5pM, 10pM) Activin A (5ng/mL, 20ng/mL, 100ng/mL), SB431542 TGF-β signaling pathway (2pM, 10pM), A83-01 (0.05 to 0.5pM), LDN-193189 (10 to 200 nM), BMP4 (5ng/mL, 20ng/mL, 100ng/mL), BMP7 (10ng/mL, 57 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 50ng/mL, 100ng/mL) FGF1 (100ng/mL), FGF2 (10ng/mL, 50ng/mL, 200ng/mL), FGF7 (100ng/mL), FGF8 (100ng/mL), FGF family signaling pathways FGF9 (10ng/mL, 50ng/mL, 100ng/mL), FGF10 (100ng/mL), FGF20 (100ng/mL), PD0325901 (1pM), SB202190 (5pM), SP600125 (10pM), All trans-Retinoic Acid (0.1pM, 1pM), Retinoic acid signaling pathway TTNPB (0.1pM, 1pM) LIF signaling pathway LIF (1ng/mL, 5ng/mL, 10ng/mL), JAKI (100nM) VEGF signaling pathway VEGF (50ng/mL, 100ng/mL) NF-κB signaling pathway TNF-alpha (50ng/mL, 100ng/mL) EGF signaling pathway EGF (50ng/mL, 100ng/mL) Insulin signaling pathway IGF-1 (100ng/mL), IGF-2 (10ng/mL) HGF signaling pathway HGF (50ng/mL, 100ng/mL) SCF/c-KIT signaling pathway SCF (100ng/mL) PDGF signaling pathway PDGF-BB (100ng/mL) GDNF/RET signaling pathway GDNF (100ng/mL) Forskolin (10pM), AICAR (0.1mM, 0.5mM), Others Y-27632 (10pM) Table 2 Medium Recipe of mNPSR-v2 medium Basal medium: DMEM/F12 (1:1) (1X), Invitrogen, Cat. No.11330-032. Supplements: Reagent Name Company Cat. No. Final Concentration GlutaMAX-I (100X) Invitrogen 35050-079 1X MEM NEAA (100X) Invitrogen 11140-050 1X 2-Mercaptoethanol Invitrogen 21985-023 0.11 μM (55mM) Pen Strep (100X) Invitrogen 15140-122 1X B-27 Supplement (50X), minus vitamin Invitrogen 12587-010 1X A 58 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT ITS Liquid Media Sigma I3146-5ML 1X Supplement (100×) BMP7 R&D 354-BP-010 50 ng/ml FGF2 Peprotech 100-18B 200 ng/ml Heparin Sigma H3149-100KU 1 µg/ml Y-27632 Enzo ALX-270-333-M025 10 µM Mouse LIF Millipore ESG1107 1000 units/ml LDN193189 Reagents Direct 36-F52 200 nM A83-01 STEMGENT 04-0014 50 nM SB202190 Axon Medchem 1364 5 µM DAPT Sigma D5942-5MG 5 µM CHIR99021 Reagents Direct 27-H76 1.5 μM Notes on ITS component: The commercially available ITS Liquid Media Supplement (100 X) (Sigma, Cat# I3146-5ML) was used to make mNPSR-v2/hNPSR-v2 media based on the tables listed above. Commercial ITS Liquid Media Supplement (100 X) was originally used to make mNPSR-v2/hNPSR-v2 media, and generated data shown 59 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT in Figures 1-4 and 7, and Figures 8-13 and 17-22. Figures 5 and 6, and Figures 14-16 were generated using NPCs cultured with individual ITS components prepared as below. Reagent Name Source Cat. No. Final Concentration Human insulin Sigma 91077C-100MG 10 pg/mL Transferrin, Apo-, Human Plasma Sigma 616395-100MG 5.5 pg/mL Sodium selenite Sigma S5261-10G 5 ng/mL To prepare 100 mL m/hNPSR-v2 medium using individual ITS components, add: 100 pL Human insulin (Human insulin Stock: 10 mg/mL) 100 pL Transferrin, Apo-, Human Plasma (Transferrin, Apo-, Human Plasma Stock: 5.5mg/mL) 10 pL Sodium selenite (Sodium selenite Stock: 50 pg/mL Table 3 Summary of different mNPC lines derived with mNPSR-v2 medium E12.5, E14.5, E16.5 Six2- GFP clonal E12.5 wild-type mNPC lines E11.5 MM wild whole kidney E11.5 MM E13.5, E14.5, type mNPC lines mNPC lines Cas9-GFP E15.5, E16.5, E11.5 MM E13.5, E15.5 Six2- clonal mNPC mNPC cell lines E18.5 Six2- Cas9-GFP tdT whole kidney lines GFP mNPC mNPC lines mNPC lines E11.5 MM lines E11.5 MM Six2- E12.5 Wnt4-tdT Cas9-GFP tdT mNPC lines whole kidney Pkd1-/- clonal mNPC lines mNPC lines E11.5 MM Cas9-GFP Pkd2-/- clonal mNPC lines Six Metanephric Sources 2-GFP mouse strain Mesenchyme Whole kidney Single mNPC (MM) Cell Purification Manual Enzymatic FACS sorting, method FACS sorting dissection dissociation manual dissection Derived cell lines number >12 >40 >15 >45 Passage # P10-P15 P10-P31 P11-P13 P8-P10 In vitro cultured time (Days) 30-45 30-93 33-39 24-30 Fold of NPC 11-1020 1 14 46 14 17 9 11 expansion 10 0 -10 10 -10 10 -10 60 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Average passage cycle (Days) 3 3 3 3 Doublings per day 0.6542- 0.6666 0.6291-0.6417 0.6711-0.7031 0.5838-0.5937 # of successful differentiation (nephron >60 >200 >75 >250 organoids induction) Differentiation competency 100% 100% 100% 100% Table 4. Medium Recipe of hNPSR-v2 medium Basal medium: DMEM/F12 (1:1) (1X), Invitrogen, Cat. No.11330-032. Supplements: Reagent Name Source Cat. No. Final Concentration GlutaMAX-I (100X) Invitrogen 35050-079 1X MEM NEAA (100X) Invitrogen 11140-050 1X 2-Mercaptoethanol Invitrogen 21985-023 0.1 μM (55mM) Pen Strep (100X) Invitrogen 15140-122 1X B-27 Supplement (50X), minus vitamin Invitrogen 12587-010 1X A ITS Liquid Media Sigma I3146-5ML 1X Supplement (100×) BMP7 R&D 354-BP-010 50 ng/ml FGF2 Peprotech 100-18B 200 ng/ml Heparin Sigma H3149-100KU 1 µg/ml Y-27632 Enzo ALX-270-333-M025 10 µM Human LIF Millipore LIF1050 10 ng/ml LDN193189 Reagents Direct 36-F52 200 nM A83-01 STEMGENT 04-0014 50 nM SB202190 Axon Medchem 1364 5 µM 61 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT DAPT Sigma D5942-5MG 5 µM CHIR99021 Reagents Direct 27-H76 1.5 μM Donated from Prof. TRULI Gnedeva, Ksenia lab 10mM-Stock 2 µM in USC Table 5 Growth factors and small molecules tested in this study Growth factors /Chemicals Concentrations tested Source Cat. No. Growth factors and chemicals tested in optimizing mNPSR-v2, hNPSR-v2, and hNPSR-v3 media Activin A 5ng/ml, 20ng/ml, 100ng/ml Stemgent 03-0001 SB431542 2μM, 10μM Reagents Direct 21-A94 A83-01 0.05 to 0.5μM Stemgent 04-0014 BMP4 5ng/ml, 20ng/ml, 100ng/ml Stemgent 03-0007 BMP7 10ng/ml, 50ng/ml, 100ng/ml R&D Systems 354-BP-010 LDN-193189 10 to 200 nM Reagents Direct 36-F52 0.5μM, 1μM, 1.25μM, CHIR99021 1.5μM, 1.75μM, 2μM, Reagents Direct 27-H76 2.5μM, 3μM, IWR-1 2.5μM, 5μM, 50μM Sigma 10161-5MG Y-27632 10μM Enzo ALX-270-333- M025 PD0325901 1μM Reagents Direct 39-C68 FGF1 100ng/ml Peprotech AF-100-17A FGF2 200ng/ml Peprotech AF-450-33 FGF7 100ng/ml Peprotech 450-60 FGF8 100ng/ml Peprotech AF-100-25 FGF9 200ng/ml Peprotech 100-23 FGF10 100ng/ml Peprotech AF-100-26 FGF20 100ng/ml Peprotech 100-41 TNF-alpha 50ng/ml, 100ng/ml R&D Systems 210-TA-020 VEGF 50ng/ml, 100ng/ml R&D Systems 293-VE-010 HGF 50ng/ml, 100ng/ml Peprotech 315-23 EGF 50ng/ml, 100ng/ml R&D Systems 236-EG-200 JAK Inhibitor I 500nM STEMCELL Technologies 74022 62 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Sphingosine-1- phosphate (S1P) Lysophosphatidic acid (LPA) SCF 100ng/ml R&D Systems 255-SC-010 IGF-1 100ng/ml Sigma I1271-.1MG IGF-2 10ng/ml Peprotech AF-100-12 ESG1107 LIF 1ng/ml, 5ng/ml, 10ng/ml Millipore (mLIF) LIF1050 (hLIF) All trans-Retinoic Acid 0.1μM, 1μM Santa Cruz sc-200898 TTNPB 0.1μM, 1μM TOCRIS 0761 SP600125 10μM TOCRIS 1496 SB202190 5μM Axon Medchem 1364 DAPT 2μM, 5μM, 10μM Sigma D5942-5MG XMU-MP-1 0.1μM, 0.3μM, 0.5μM, 1μM, Selleck Chemicals S8334 Verteporfin 0.1μM, 1μM Selleck Chemicals S1786 RG108 10μM Cayman Chemical 13302-5mg Tranylcypromine 5μM Cayman Chemical 10010494- 100mg Valproic Acid 0.5mM STEMCELL Technologies 72292 Forskolin 10μM Sigma F3917-10MG GDNF 100ng/ml PeproTech 450-10-50ug PDGF-BB 100ng/ml R&D Systems 220-BB-010 R-Spondin 1 50ng/ml, 100ng/ml R&D Systems 4645-RS-100 AICAR 0.1mM, 0.5mM Sigma A9978 TRULI 1μM, 2μM, 4μM, 10μM Ksenia Gnedeva lab, USC 10mM-Stock Chemicals tested in validating the effects of Kmt2a and Kat6a on mNPC self-renewal MOZ-IN-3 5μM and 10μM Cayman Chemical 27402-1mg WM-1119 1μM and 2.5μM Cayman Chemical 30509-5mg WDR5 degrader 50nM and 100nM Yali Dou lab, USC 10mM-Stock MLL1 inhibitor 0.5μM and 1μM Yali Dou lab, USC 10mM-Stock Table 6 RT-qPCR primers sequences RT-qPCR Primers (Mouse) Gene Name Forward Primer Reverse Primer Gapdh CATGGCCTTCCGTGTTCCTA (SEQ CCTGCTTCACCACCTTCTTGAT ID: 1) (SEQ ID: 2) mNPC marker genes Six2 AGGAAAGGGAGAACAGCGAGAA GGACTGGACGACGAGTGGT (SEQ (SEQ ID: 3) ID: 4) 63 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Wt1 CCACACCCCTACTGACAGTT (SEQ TCACTCTCATACCCTGTGCC (SEQ ID: 5) ID: 6) Osr1 CTGCCCAACCTGTATGGTTT (SEQ TGGCACTTTAGAAAAAGAGG (SEQ ID: 7) ID: 8) Eya1 GGACAGGCACCGTACAGCTACC GTGTGCTGGATACGGCGAGCTG (SEQ ID: 9) (SEQ ID: 10) Hoxd11 TGGAACGCGAGTTTTTCTTT (SEQ TTGCAGACGGTCCCTGTTCA (SEQ ID: 11) ID: 12) Pax2 AAGCCCGGAGTGATTGGTG (SEQ CAGGCGAACATAGTCGGGTT (SEQ ID: 13) ID: 14) Sall1 CTCAACATTTCCAATCCGACCC GGCATCCTTGCTCTTAGTGGG (SEQ (SEQ ID: 15) ID: 16) Gdnf TCCAACTGGGGGTCTACGG (SEQ GCCACGACATCCCATAACTTCAT ID: 17) (SEQ ID: 18) Mouse pretubular aggregates (PTA) and renal vesicles (RV) marker genes Pax8 GGCTCTACCTACTCTATCAA (SEQ CTGCTGCTGCTCTGTGAGTC (SEQ ID: 19) ID: 20) Lhx1 CTTCTTCCGATGTTTCGGTA (SEQ TCATGCAGGTGAAGCAGTTG (SEQ ID: 21) ID: 22) Mouse interstitial progenitor cell marker gene Foxd1 TGAGCACGGAGATGTCCGATG CACCACGTCGATGTCTGTCTC (SEQ (SEQ ID: 23) ID: 24) Mature mouse nephron marker genes Slc12a1 TCATTGGCCTGAGGCGTAGTTG TTTGTGCAAATAGCCGACATAGA (SEQ ID: 25) (SEQ ID: 26) Slc12a3 ACACGGCAGCACCTTATACAT GAGGAATGAATGCAGGTCAGC (SEQ ID: 27) (SEQ ID: 28) Aqp1 AGGCTTCAATTACCCACTGGA CTTTGGGCCAGAGTAGCGAT (SEQ (SEQ ID: 29) ID: 30) Genes associated with cell cycle progression, mTOR signaling, and MYC activity Cdc25a ACAGCAGTCTACAGAGAATGGG GATGAGGTGAAAGGTGTCTTGG (SEQ ID: 31) (SEQ ID: 32) Pcna TTTGAGGCACGCCTGATCC (SEQ GGAGACGTGAGACGAGTCCAT ID: 33) (SEQ ID: 34) Rrm2 TGGCTGACAAGGAGAACACG AGGCGCTTTACTTTCCAGCTC (SEQ (SEQ ID: 35) ID: 36) Mcm4 GAGGAAAGCAGGTCGTCACC AGGGCTGGAAAACAAGGCATT (SEQ ID: 37) (SEQ ID: 38) Tra2b AATCCCGTTCTGCTTCCCG (SEQ TCGTGACCTTGTATAATGCCTTC ID: 39) (SEQ ID: 40) Mcm5 CAGAGGCGATTCAAGGAGTTC CGATCCAGTATTCACCCAGGT (SEQ (SEQ ID: 41) ID: 42) Mcm6 GCTGTTCCTAGACTTCCTGGA CAACCAGCGTGTTTCTCTCAG (SEQ (SEQ ID: 43) ID: 44) Bub1 AGAATGCTCTGTCAGCTCATCT TGTCTTCACTAACCCACTGCT (SEQ (SEQ ID: 45) ID: 46) 64 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Actr3 ACTGTGGCACGGGATATACAA GTCACCCACTTTTGCAGACTC (SEQ (SEQ ID: 47) ID: 48) Brca1 CTGCCGTCCAAATTCAAGAAGT CTTGTGCTTCCCTGTAGGCT (SEQ (SEQ ID: 49) ID: 50) Chek1 GTTAAGCCACGAGAATGTAGTGA GATACTGGATATGGCCTTCCCT (SEQ ID: 51) (SEQ ID: 52) Rrm2 TGGCTGACAAGGAGAACACG AGGCGCTTTACTTTCCAGCTC (SEQ (SEQ ID: 53) ID: 54) Brca2 ATGCCCGTTGAATACAAAAGGA ACCGTGGGGCTTATACTCAGA (SEQ ID: 55) (SEQ ID: 56) Hells TGAGGATGAAAGCTCTTCCACT ACATTTCCGAACTGGGTCAAAA (SEQ ID: 57) (SEQ ID: 58) Hmgb3 AGGTGACCCCAAGAAACCAAA GCAAAATTGACGGGAACCTCTG (SEQ ID: 59) (SEQ ID: 60) Srsf3 GCGCAGATCCCCAAGAAGG (SEQ ATCGGCTACGAGACCTAGAGA ID: 61) (SEQ ID: 62) Dhcr24 CTCTGGGTGCGAGTGAAGG (SEQ TTCCCGGACCTGTTTCTGGAT (SEQ ID: 63) ID: 64) Cyb5b GAGCCCTCCGTCACCTACTA (SEQ AGCTTTCAGTTGCATCAGCAC (SEQ ID: 65) ID: 66) Dhfr CGCTCAGGAACGAGTTCAAGT TGCCAATTCCGGTTGTTCAATA (SEQ ID: 67) (SEQ ID: 68) Psma7 AGGAGGCGGTCAAAAAGGG (SEQ CATACAGACGTTATCGTCCAAGG ID: 69) (SEQ ID: 70) Wee1 GTCGCCCGTCAAATCACCTT (SEQ GAGCCGGAATCAATAACTCGC ID: 71) (SEQ ID: 72) Ezh2 TGCCTCCTGAATGTACTCCAA AGGGATGTAGGAAGCAGTCATAC (SEQ ID: 73) (SEQ ID: 74) Cdkn1a CCTGGTGATGTCCGACCTG (SEQ CCATGAGCGCATCGCAATC (SEQ ID: 75) ID: 76) RT-qPCR Primers (Human) hNPC marker genes GAPDH GTGGACCTGACCTGCCGTCT (SEQ GGAGGAGTGGGTGTCGCTGT (SEQ ID: 77) ID: 78) SIX2 AGGAAAGGGAGAACAACGAGAA GGGCTGGA TGA TGAGTGGT (SEQ (SEQ ID: 79) ID: 80) PAX2 CCCAAAGTGGTGGACAAGAT GAAAGGCTGCTGAACTTTGG (SEQ (SEQ ID: 81) ID: 82) EYA1 GGACAGGCACCATACAGCTACC ATGTGCTGGATACGGTGAGCTG (SEQ ID: 83) (SEQ ID: 84) HOXD11 TGGAACGCGAGTTTTTCTTT (SEQ CTGCAGACGGTCTCTGTTCA (SEQ ID: 85) ID: 86) OSR1 CTGCCCAACCTGTATGGTTT (SEQ CGGCACTTTGGAGAAAGAAG (SEQ ID: 87) ID: 88) SALL1 CCCCGGTTGCTAACAAAAGC (SEQ GAGGTTGTGATCGCTGAGGTA ID: 89) (SEQ ID: 90) 65 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT WT1 GTGACTTCAAGGACTGTGAACG CGGGAGAACTTTCGCTGACAA (SEQ ID: 91) (SEQ ID: 92) GDNF GGCAGTGCTTCCTAGAAGAGA AAGACACAACCCCGGTTTTTG (SEQ ID: 93) (SEQ ID: 94) Mature human nephron marker genes SLC22A8 CCAGAGTCCATACGCTGGTTG TCACTTGCGGTGTACTTGGC (SEQ (SEQ ID: 95) ID: 96) SPTSSB GCTGTGCTGTTTTAGAGCCCT CCAGGCGAATGTGGATTGG (SEQ (SEQ ID: 97) ID: 98) UMOD CGGCGGCTACTACGTCTAC (SEQ TGCCATCTGCCATTATTCGATTT ID: 99) (SEQ ID: 100) Table 7 Antibodies used in this study Antibodies Source Cat. No. Dilution Ratio SIX1 Cell Signaling Technology 12891 1:500 SIX2 Proteintech 11562-1-AP 1:500 SIX2 Abnova H00010736-M01 1:300 SALL1 R&D Systems PP-K9814-00 1:500 WT1 Abcam ab89901 1:500 PAX2 BioLegend 901001 1:500 PAX8 Proteintech 10336-1-AP 1:500 FOXD1 Abcam ab129324 1:500 MEIS1/2/3 Active Motif 39795 1:500 PODXL (mouse) R&D Systems MAB1556 1:400 PODXL (human) R&D Systems AF1658 1:400 LTL Vector laboratories B-1325 1:400 LRP2 MyBioSource MBS690201 1:400 DBA Vector laboratories B-1035 1:400 CDH1 Cell Signaling Technology 3195 1:400 CDH1 BD Trans-duction Laboratories 610182 1:400 AQP1 (mouse) Santa Cruz Biotechnology sc-25287 1:400 AQP1 (human) Abcam ab168387 1:400 HNF4 R&D Systems MAB4605 1:400 SLC12A1 Abcam ab240542 1:400 SLC12A3 Sigma-Aldrich HPA028748-100UL 1:400 SLC27A2 Novus Biologicals Cat# NBP2-37738 1:400 SLC34A1 Novus Biologicals Cat# NBP2-13328 1:400 ITGA8 R&D Systems AF4076 1:200 p-p38 Cell Signaling Technology 4511 1:8000 p-SMAD2 Cell Signaling Technology 18338 1:4000 p-Smad1/5/9 Cell Signaling Technology 13820 1:4000 KRT8 DSHB TROMA-I 1:50 MAP2 Abcam ab5392 1:200 NeuN GeneTex GTX16208 1:200 66 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Phospho-Histone H3 (Ser10) pHH3 Cell Signaling Technology 9706 1:400 YAP Santa Cruz Biotechnology sc-101199 1:100 PC2 Baltimore PKD Core Rabbit mAB 3374 CT- 14/4 1:500 β-Actin Cell Signaling Technology 3700 1:1000 β-Tubulin Cell Signaling Technology 2146 1:1000 JAG-1 R&D Systems AF599 1:500 POU3F3 Thermo Fisher Scientific PA5-64311 1:500 Nephrin R&D Systems AF4269 1:500 NPHS2 Abcam Ab50339 1:500 Acetyl-alpha tubulin Sigma-Aldrich MABT868 1:500 MAFB R&D Systems MAD3810 1:500 DAPI Thermo Fisher Scientific D1306 1:500 Table 8 Molecules used in drug screening with expandable NPC-derived Pkd2-/- or PKD2-/- ADPKD model Molecules Concentrations Tested Source Cat. No. Epigenetics Screening Library (96-Well) (148 1µM Cayman Chemical 11076 Compounds) Tolvaptan 10µM SAMSCA®, JINARC®, JYNARQUE® Metformin 300µM TOCRIS 2864 CFTRinh172 100µM Cayman Chemical 15545-5mg AZ-505 10µM Cayman Chemical 16875-1mg Tubacin 10µM Cayman Chemical 13691-1mg UNC0646 5µM Cayman Chemical 11085-5mg PTC-209 1µM Cayman Chemical 16277-5mg SGC0946 10µM Cayman Chemical 13967-5mg Cyproheptadine 10µM Cayman Chemical 19551-250mg Wedelolactone 10µM Cayman Chemical 11796-1mg Table 9 Highly confident NPC self-renewal related genes identified Gene ID Entrez Gene Name Beta Scores p-value FDR Location Type(s) Uqcrfs1 ubiquinol-cytochrome c -4.824 0.00117 0.176 Cytoplasm enzyme reductase, Rieske iron- sulfur polypeptide 1 Hspe1 heat shock protein family -4.641 0.00112 0.124 Cytoplasm enzyme E (Hsp10) member 1 Rnaseh2a ribonuclease H2 subunit A -3.815 0.00219 0.16 Nucleus enzyme 67 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Eef1e1 eukaryotic translation -3.356 0.00315 0.174 Cytoplasm translati elongation factor 1 epsilon on 1 regulato r Myc MYC proto-oncogene, -3.237 0.00335 0.174 Nucleus transcri bHLH transcription factor ption regulato r Rad21 RAD21 cohesin complex -3.209 0.00335 0.174 Nucleus transcri component ption regulato r Paics phosphoribosylaminoimid -2.68 0.018 0.377 Cytoplasm enzyme azole carboxylase and phosphoribosylaminoimid azolesuccinocarboxamide synthase Bcl9l BCL9 like -2.532 0.0092 0.269 Cytoplasm other Wt1 WT1 transcription factor -2.519 0.0093 0.27 Nucleus transcri ption regulato r Wars2 tryptophanyl tRNA -2.437 0.0251 0.437 Cytoplasm enzyme synthetase 2, mitochondrial E2f3 E2F transcription factor 3 -2.311 0.0129 0.3 Nucleus transcri ption regulato r Foxc1 forkhead box C1 -2.116 0.0177 0.342 Nucleus transcri ption regulato r Zdhhc2 zinc finger DHHC-type -2.094 0.0188 0.354 Nucleus enzyme palmitoyltransferase 2 Lmx1b LIM homeobox -2.082 0.0189 0.354 Nucleus transcri transcription factor 1 beta ption regulato r Sall1 spalt like transcription -1.864 0.0273 0.404 Nucleus transcri factor 1 ption regulato r Sobp sine oculis binding protein -1.802 0.0305 0.421 Nucleus other homolog Tbc1d9b TBC1 domain family 1.787 0.0498 0.492 Other other member 9B Srgap3 SLIT-ROBO Rho GTPase 1.807 0.0461 0.475 Cytoplasm other activating protein 3 68 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Ttc21b tetratricopeptide repeat 1.823 0.0437 0.47 Extracellul other domain 21B ar Space Kazald1 Kazal type serine 1.827 0.0462 0.53 Extracellul other peptidase inhibitor domain ar Space 1 Dach1 dachshund family 1.838 0.0443 0.526 Nucleus transcri transcription factor 1 ption regulato r Csrp2 cysteine and glycine rich 1.843 0.0438 0.526 Nucleus other protein 2 Ybx3 Y-box binding protein 3 1.847 0.0403 0.462 Nucleus transcri ption regulato r Scn8a sodium voltage-gated 1.851 0.0399 0.461 Plasma ion channel alpha subunit 8 Membrane channel Adam11 ADAM metallopeptidase 1.864 0.0405 0.509 Plasma peptidas domain 11 Membrane e Ctnnal1 catenin alpha like 1 1.872 0.0397 0.505 Plasma other Membrane Atoh8 atonal bHLH transcription 1.876 0.0371 0.453 Nucleus transcri factor 8 ption regulato r Lima1 LIM domain and actin 1.879 0.0363 0.447 Cytoplasm other binding 1 Crat carnitine O- 1.882 0.0383 0.499 Cytoplasm enzyme acetyltransferase Lbx2 ladybird homeobox 2 1.884 0.0354 0.444 Nucleus transcri ption regulato r Celsr1 cadherin EGF LAG seven- 1.884 0.0382 0.499 Plasma G- pass G-type receptor 1 Membrane protein coupled receptor Ntn3 netrin 3 1.891 0.0343 0.437 Extracellul other ar Space Tspan11 tetraspanin 11 1.9 0.0334 0.433 Other other Ralgapa2 Ral GTPase activating 1.91 0.0324 0.428 Cytoplasm other protein catalytic subunit alpha 2 Sardh sarcosine dehydrogenase 1.91 0.0323 0.428 Cytoplasm enzyme Lrrc8b leucine rich repeat 1.949 0.0308 0.461 Plasma transpor containing 8 VRAC Membrane ter subunit B Aldh2 aldehyde dehydrogenase 2 1.984 0.0273 0.449 Cytoplasm enzyme family member 69 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Frem2 FRAS1 related 1.991 0.0254 0.395 Extracellul other extracellular matrix 2 ar Space Ppfia4 protein tyrosine 2.014 0.0239 0.429 Plasma other phosphatase, receptor Membrane type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4 Dyrk3 dual specificity tyrosine 2.025 0.022 0.374 Nucleus kinase phosphorylation regulated kinase 3 Dock9 dedicator of cytokinesis 9 2.032 0.0213 0.37 Cytoplasm other Nfic nuclear factor I C 2.034 0.0213 0.37 Nucleus transcri ption regulato r Klhdc2 kelch domain containing 2 2.041 0.0213 0.41 Cytoplasm other Erbb2 erb-b2 receptor tyrosine 2.099 0.0165 0.331 Plasma kinase kinase 2 Membrane Zfhx2 zinc finger homeobox 2 2.106 0.0161 0.368 Nucleus transcri ption regulato r Cecr2 CECR2 histone acetyl- 2.115 0.0157 0.364 Nucleus other lysine reader Tfeb transcription factor EB 2.129 0.0149 0.361 Nucleus transcri ption regulato r Tyro3 TYRO3 protein tyrosine 2.138 0.0139 0.308 Plasma kinase kinase Membrane Arhgef25 Rho guanine nucleotide 2.171 0.0123 0.296 Cytoplasm other exchange factor 25 Smurf1 SMAD specific E3 2.198 0.0113 0.324 Cytoplasm enzyme ubiquitin protein ligase 1 Jmjd1c jumonji domain containing 2.206 0.0104 0.273 Nucleus enzyme 1C Otub2 OTU deubiquitinase, 2.212 0.0101 0.272 Nucleus enzyme ubiquitin aldehyde binding 2 Slc9a3r2 SLC9A3 regulator 2 2.212 0.0101 0.272 Plasma transpor Membrane ter Mcc MCC regulator of WNT 2.254 0.00818 0.256 Cytoplasm other signaling pathway Nup210 nucleoporin 210 2.26 0.00823 0.283 Nucleus transpor ter Ephb3 EPH receptor B3 2.309 0.006 0.217 Plasma kinase Membrane Rhod ras homolog family 2.326 0.00518 0.211 Cytoplasm enzyme member D 70 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Chst14 carbohydrate 2.339 0.00544 0.248 Cytoplasm enzyme sulfotransferase 14 Sema3f semaphorin 3F 2.37 0.00412 0.191 Extracellul other ar Space Pou6f1 POU class 6 homeobox 1 2.548 0.00188 0.2 Nucleus transcri ption regulato r Cd24a CD24a antigen 2.672 0.000966 0.176 Plasma other Membrane Hspg2 heparan sulfate 2.684 0.000966 0.176 Extracellul enzyme proteoglycan 2 ar Space Rab11fip1 RAB11 family interacting 2.748 0.000712 0.102 Cytoplasm other protein 1 Pax2 paired box 2 3.552 0 0 Nucleus transcri ption regulato r Table 10 Genes identified for FGF, Wnt, and LIF signaling pathways FGF Wnt LIF Signaling Signaling Signaling MAPK1 SRCAP SOCS3 GRB2 SMARCE1 MYC FGFR1 BCL9 GRB2 PLAUR GSK3B CRLF2 STAT3 INO80 PRLR MAPK14 HDAC1 IL13 CAMK2A AXIN1 JAK3 DUSP6 GNB1 MYC SMARCC1 RAC1 PPP2R5D MAX GNG12 MKNK1 CSNK2A2 CREB1 HDAC3 PPP3CA CTNNAL1 CELSR1 TLE6 71 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Table 11 Genes identified that are known to be involved in Wilms tumor or CAKUT development Known Wilms tumor genes Known CAKUT genes identified identified CHD4 EXOC5 MLLT1 WT1 WT1 ITGB1 MYCN YAP1 FGFR1 FOXC1 BCOR SOX11 TP53 MYCN DICER1 FGFR1 DGCR8 NR2F2 HDAC4 ID2 MAX TBX3 TJP2 RARB LGR4 GDF11 DUSP6 KDR MDM4 ALDH1A2 RSPO3 FGF1 NR4A2 POU3F3 DSTN DCN Table 12 Chemicals, peptides, and recombinant proteins Molecules Source Cat. No. Activin A Stemgent Cat# 03-0001 SB431542 Reagents Direct Cat# 21-A94 A83-01 Stemgent Cat# 04-0014 BMP4 Stemgent Cat# 03-0007 BMP7 R&D Systems Cat# 354-BP-010 LDN-193189 Reagents Direct Cat# 36-F52 CHIR99021 Reagents Direct Cat# 27-H76 72 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT IWR-1 Sigma-Aldrich Cat# 10161-5MG Y-27632 Selleck Chemicals Cat# S1049 PD0325901 Reagents Direct Cat# 39-C68 FGF1 Peprotech Cat# AF-100-17A FGF2 Peprotech Cat# AF-450-33 FGF7 Peprotech Cat# 450-60 FGF8 Peprotech Cat# AF-100-25 FGF9 Peprotech Cat# 100-23 FGF10 Peprotech Cat# AF-100-26 FGF20 Peprotech Cat# 100-41 TNF-alpha R&D Systems Cat# 210-TA-020 VEGF R&D Systems Cat# 293-VE-010 HGF Peprotech Cat# 315-23 EGF R&D Systems Cat# 236-EG-200 JAK Inhibitor 1 STEMCELL Technologies Cat# 74022 Sphingosine-1-phosphate (S1P) Sigma-Aldrich Cat# S9666-1MG Lysophosphatidic acid (LPA) Sigma-Aldrich Cat# L7260-1MG SCF R&D Systems Cat# 255-SC-010 IGF-1 Sigma-Aldrich Cat# I1271-.1MG IGF-2 Peprotech Cat# AF-100-12 Mouse LIF Millipore Cat# ESG1107 Human LIF Millipore Cat# LIF1050 All trans-Retinoic Acid Santa Cruz Biotechnology Cat# sc-200898 TTNPB TOCRIS Cat# 0761 SP600125 TOCRIS Cat# 1496 SB202190 Axon Medchem Cat# 1364 DAPT Sigma-Aldrich Cat# D5942-5MG XMU-MP-1 Selleck Chemicals Cat# S8334 Verteporfin Selleck Chemicals Cat# S1786 Forskolin Sigma-Aldrich Cat# F3917-10MG GDNF PeproTech Cat# 450-10-50ug PDGF-BB R&D Systems Cat# 220-BB-010 R-Spondin 1 R&D Systems Cat# 4645-RS-100 AICAR Sigma-Aldrich Cat# A9978 TRULI Cayman Chemical Cat# 36623 MOZ-IN-3 Cayman Chemical Cat# 27402-1mg WM-1119 Cayman Chemical Cat# 30509-5mg WDR5 degrader Yali Dou lab, USC 10mM-Stock MLL1 inhibitor Yali Dou lab, USC 20mM-Stock Epigenetics Screeening Library (96- Cayman Chemical Cat# 11076 Well) (148 Compounds) Tolvaptan Selleck Chemicals Cat# S2593 Metformin TOCRIS Cat# 2864 CFTRinh172 Cayman Chemical Cat# 15545-5mg AZ-505 Cayman Chemical Cat# 16875-1mg 73 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Tubacin Cayman Chemical Cat# 13691-1mg PTC-209 Cayman Chemical Cat# 16277-5mg Staurosporine (STS) Selleck Chemicals Cat# S1421 I. Experimental model and subject details Human tissues [0162] All human fetal kidney samples were collected under Institutional Review Board approval (USC-HS-13-0399 and CHLA-14-2211). Following the patient decision for pregnancy termination, the patient was offered the option of donation of the products of conception for research purposes, and those that agreed signed an informed consent. This did not alter the choice of termination procedure, and the products of conception from those that declined participation were disposed of in a standard fashion. The only information collected was gestational age and whether there were any known genetic or structural abnormalities. Resource Source Identifier Human fetal kidney tissues (9-13 weeks) USC and CHLA N/A Mice [0163] All animal work was performed under Institutional Animal Care and Use Committee approval (USC IACUC Protocol # 20829). Swiss Webster mice were purchased from Taconic Biosciences (Model # SW-F, MPF 4 weeks). Six2tm3(EGFP/cre/ERT2)Amc mice (Six2GCE, JAX # 009600), Wnt4tm2(EGFP/cre/ERT2)Amc/tm1(CAG-tdTomato) mice (Wnt4GCE, JAX # 032489), Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh mice (JAX #026179), Tg(Hoxb7-Venus*)17Cos mice (JAX # 016252) were kindly shared from Dr. Andrew McMahon. Gt(ROSA)26Sortm14(CAG-tdTomato)Hze mice (tdTomato reporter mice, JAX # 007908) were kindly shared from Dr. Kenneth Hallows. Six2tdTomato mice were generated through crossing Six2GCE mice and tdTomato reporter mice. Wnt4tdTomato mice were generated through crossing Wnt4GCE mice and tdTomato reporter mice. Six2tdTomato/Hoxb7Venus mice were generated through crossing Six2tdTomato mice and Hoxb7Venus mice. hPSC lines [0164] Experiments using hPSCs were approved by the Stem Cell Oversight Committee (SCRO) of University of Southern California under protocol # 2018-2. Human pluripotent stem cells are routinely cultured in mTeSR1 (STEMCELL Technologies #85850) or mTeSR1 Plus (STEMCELL Technologies 74 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT #100-0276) medium in monolayer culture format coated with Matrigel and passaged using dispase as previously described 88, or using Versene Solution (Thermo Fisher # 15040066) following manufacturer’s protocols. Resource Source Identifier SIX2-GFP H1 line hESC This study N/A SIX2-GFP/PAX2-mCherry H1 line hESC This study N/A SIX2-GFP PKD2-/- H1 line hESC This study N/A MAFB-P2A-eGFP H9 hESC Tran et al., 2019 N/A Critical Commercial Assays Reagent Source Cat. No. TRIzol Reagent Thermo Fisher Scientific 15596026 Direct-zol RNA MicroPrep Kit Zymo Research R2062 DNA/RNA Shield Zymo Research R1100-50 Quick-RNA Microprep Kit Zymo Research R1051 iScript Reverse Transcription Supermix Bio-Rad 1708841 Ssoadvanced™ Universal SYBR Bio-Rad 1725274 PowerUp SYBR Green Master Mix Thermo Fisher Scientific A25777 AzuraView GreenFast qPCR Blue Mix LR Azura Genomics AZ-2320 TSA Plus Cyanine 3 Evaluation Kit PerkinElmer NEL744E001KT KAPA Stranded mRNA-Seq Kit KAPA Biosystems KK8420 CyQUANT® Cell Proliferation Assay Kit Invitrogen C7026 XF24 extracellular analyzer Seahorse Bioscience AggreWell™8006-well Starter Kit STEMCELL Technologies 34860 AggreWell™80024-well Plate Starter Kit STEMCELL Technologies 34850 Click-iT Plus TUNEL Assay Invitrogen C10618 10x Chromium Next GEM Chip J 10X Genomics 2000264 10x Chromium Next GEM Single Cll Reagent Kit A 10X Genomics 1000282 SPRI-select Beads Beckman Coulter B23318 METHOD DETAILS Deriving clonal expandable NPC lines from any mouse strain with mNPSR-v2 medium Deriving NPC lines from Six2-GFP mice 75 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0165] Timed pregnant E12.5-E18.5 kidneys were isolated from Six2-GFP (Six2GCE, JAX # 009600) mouse embryos, and then the kidneys were minced into small pieces. The minced kidney pieces were transferred into 1.5mL Eppendorf tubes and spun down at 300 g for 3 minutes. (Note that we aliquoted the kidney pieces into multiple tubes to ensure the volume of the tissue pellet after centrifugation was less than 100 µl per tube to ensure best dissociation). The dissection medium was then carefully aspirated. The kidney pieces were then washed once with sterile PBS.500 µL of pre-warmed Accumax Cell Dissociation Solution (Innovative Cell Technologies, Cat. No. AM-105) was added to the tube to resuspend the kidney pieces. The tube was incubated in 37°C incubator for 20~22 minutes.500 µL 10% FBS medium (10% FBS in DMEM) was added to the tube, and then GENTLY pipetted up and down 20 to 25 times to further dissociate the kidney pieces. The tube was spun down and the supernatant was then removed. FACS medium (cold PBS with 2% FBS) was added to resuspend the cell pellet and the cell suspension was filtered through 40 µm cell strainer (Greiner bio-one, Cat. No.542040) to remove cell clumps before FACS to sort out Six2-GFP+ NPCs. Purified Six2-GFP+ NPCs were counted with TC20™ Automated Cell Counter (Bio-Rad, Cat. No.1450102), and then cultured in mNPSR-v2 medium (Table 2) to establish NPC lines. Take 96-well plate for example, we counted and seeded 5,000 FACS-purified NPCs into one Matrigel-coated well with 100 µl mNPSR-v2 medium. The medium was refreshed 2 days after cell seeding. When NPCs grew to 80-90% confluent (on day 3 or day 4), the culture medium was removed, and the cells were washed once with 100 µl PBS, and then dissociated with 50 µl pre-warmed Accumax. The cells were incubated with Accumax for 8 mins, and then 150 µl 10% FBS medium was added to neutralize Accumax. The medium was pipetted up and down GENTLY for 5-7 times to make single cell suspension, which was then seeded at 1:20-1:30 passage ratio to a new well in 96-well plate. Change medium 2 days after seeding. On day 3 or day 4, the cells grew to 80-90% confluent and can be passaged again using the same protocol described above. (Note, for coating with Matrigel (R&D Systems, # 3433-010-01) in one well of 96-well plate, dissolve 1 mg Matrigel into 25 ml cold DMEM/F12, and then aliquot 100 µl medium into each well. The plate is then incubated in 37°C for at least 1-2 hours before the coating medium is aspirated followed by cell seeding.) Deriving NPC lines from E11.5 metanephric mesenchyme (MM) [0166] E11.5 kidneys were isolated and MM was manually dissected out from the E11.5 kidneys following our previously described protocol to isolate E11.5 UB and MM (Zeng et al., 2021).20 isolated MM were pooled together and dissociated in 500 µl Accumax for 8-10 minutes (scale it down if less MM were isolated) before 500 µl 10% FBS medium was added to neutralize Accumax. The medium was then pipetted up and down GENTLY for 7-10 times to dissociate the MM into single cells.5,000 cells were then seeded into one well in a Matrigel-coated 96-well plate (scale up or down based on the surface area, 76 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT if different culture format was used) in mNPSR-v2 medium to derive NPC line, using similar protocols described above starting from Six2-GFP+ NPCs. Deriving NPC lines from whole kidneys [0167] E12.5-E15.5 kidneys were isolated, minced into small pieces, and dissociated in Accumax as described above for dissociating E12.5-E18.5 Six2-GFP kidneys.5,000 cells were then seeded into one well in a Matrigel-coated 96-well plate (scale up or down if different culture format was used) in mNPSR-v2 medium to derive NPC line, using similar protocols described above starting from Six2-GFP+ NPCs. Note that, different from NPC line derivation from Six2-GFP+ NPCs, or from isolated E11.5 MM, whole kidney cells need to go through 2-3 passages to enrich the NPC population in the culture before a stable NPC line can be established with 90-95% purity. Deriving single cell clonal mouse NPC lines [0168] NPC lines can be derived from FACS-purified Six2-GFP+ NPCs, isolated E11.5 MM, or whole kidney cells as described above. When NPC lines are stably established, single cell clonal NPC lines can be generated. For that, when the NPC lines grew to around 80% confluency, the cells were dissociated into single cells following the protocol described above for passaging NPCs. The cells were counted and seeded into Matrigel-coated 96-wells at the density 0.5 cell per well with 100 µl mNPSR-v2 medium so that most wells would have either one single cell or no cell (day 0). On day 3, 50 µl used medium was removed, and 100 µl fresh medium was added. On day 6, the used medium was completely removed and 100 µl fresh medium was added. On day 9, NPC clones were clearly observed under the microscope in about 30% of the wells seeded. Cells in these wells were dissociated following our protocol described above, and all the cells were seeded into another 96-well. On day 11, the cells reached around 80-90% confluency and were passaged routinely thereafter every 3 days as described above. To determine cloning efficiency, 60 wells of a 96-well plate were seeded with single cell NPC following the method mentioned above (D0). On day 3, the wells containing clusters of cells from a single cell were labeled and counted, and the wells without any cell were discontinued. On day 9, the number of wells grown at least 50% confluency was counted. Cloning efficiency was calculated by using the number of wells recorded on day 9 divided by the number of wells recorded on day3, from three independent experiments. Generation of mouse nephron organoids from mouse NPC lines [0169] mNPCs cultured in mNPSR-v2 medium were dissociated into single cells using Accumax as described above.30,000 cells were seeded into one well of a U-bottom 96-well plate (Thermo Fisher Scientific, # 174929) and cultured with 100 μl mNPSR-v2 medium overnight for cells to aggregate. 77 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Nephron organoids were formed thereafter following the protocol we described previously1. Briefly, on the next day (Day 0), 3D NPC aggregates were transferred onto 6-well format transwell membrane (Corning, # 3450) with 1.2 mL KR5-CF medium at the bottom chamber and cultured for 2 days. On Day 2, change medium to 1.2 mL KR5 medium and change medium every other day. Samples were harvested on Day 7 for various assays. KR5 medium Basal medium: DMEM/F12 (1:1) (1X), Invitrogen, Cat. No.11330-032. Supplements: Reagent Name Company Cat. No. Final Concentration GlutaMAX-I (100X) Invitrogen 35050-079 1X MEM NEAA (100X) Invitrogen 11140-050 1X 2-Mercaptoethanol (55mM) Invitrogen 21985-023 0.1 μM Pen Strep (100X) Invitrogen 15140-122 1X KSR (KnockOut™ Serum Replacement) Invitrogen 10828-028 5 % KR5-CF medium KR5 medium with 4.5 μM CHIR99021 (C) and 200 ng/mL FGF2 (F). Spinal cord induction assay [0170] After mNPSR-v2 cultured mNPCs reached 80-90% confluency in 2D culture, cells were dissociated into single cells using Accumax Cell Dissociation Solution.30,000 cells were seeded into each well of U-bottom 96-well plate with 100 μl mNPSR-v2 medium and cultured overnight for re- aggregation. On the next day (Day 0), spinal cord was isolated from E12.5 embryo, and 3D mNPC aggregates were transferred to 6-well format transwell membrane tightly close to spinal cord dorsal part with 1.2mL KR5 in bottom well. Medium was changed every other day with fresh KR5 medium, and the samples were harvested for various assays on day 7. Mouse engineered kidney generation from cultured NPCs and UB [0171] Mouse UB (mUB) was cultured as we previously described4. The day before mouse kidney reconstruction, mNPCs were dissociated and 50,000 cells were seeded into one well of U-bottom 96-well low-attachment plate with 100µL mNPSR-v2 medium and cultured overnight in 37 ^C incubator to generate 3D mNPC aggregate. A small piece (with 6-10 branching tips) of day 5-10 cultured mUB 78 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT organoid was manually dissected out using sterile needles and inserted into a microdissected hole in a 3D mNPC aggregate (sterile needle was used to pierce a hole in the center of mNPC aggregate sphere). This structure was then transferred into a well of a U-bottom 96-well low-attachment plate with 100 µl kidney reconstruction medium (APEL2 + 0.1 µM TTNPB) plus 10 µM Y27632, using a P200 pipette with the top 0.5-1 cm of the tip cut to widen the tip, and cultured in 37 ^C incubator (day 0). After 24 h (day 1), the reconstructed UB/NPC structure was then transferred onto a 12-well transwell insert membrane (Corning, Cat. No.3460).300 µl kidney reconstruction medium was added to the lower chamber of the transwell. Medium was changed every two days for a total of 7 days while the reconstructed kidney branching and maturation progressed. Chicken chorioallantoic membrane (CAM) assay [0172] CAM assay was conducted as a cost-effective method to evaluate the nephrogenic potential of cultured NPCs in vivo. Briefly, Cas9-GFP mNPC lines were dissociated into single cells, and then 30,000 cells were seeded into 96-well U-bottom low-attachment plate (Thermo Fisher Scientific, # 174929) in mNPSR-v2 medium to generate 3D NPC aggregate. On the next day (D0), change medium with 100ul KR5-CF medium and follow by continuous two days culture (D0-D2). On day 2, transfer 3D NPC aggregates into chicken chorioallantoic membrane. On day 5 and day 7, use microscope to take videos to record the vasculature system in implants. On day 7, harvest the samples for various assays. Dissociation of postnatal P3-P7 mouse kidneys and further culture in mNPSR-v2 [0173] P3-P7 pups were euthanized, and the kidneys were dissected. Mince one kidney into small pieces using blade (Cincinnati Surgical, # 75870-580). Collect small amount of kidney pieces into an Eppendorf tube (after spinning down, the pellet volume should be less than 30 µl). Spin down at 300g for 5min, remove the supernatant and resuspend the pellet with 500 µl warmed-up FRESH 1X Collagenase IV (Thermo Fisher Scientific, # 17104019). Put the Eppendorf tube into rotating shaker (Eppendorf ThermoMixer® F2.0) set at 37C with 800rpm shaking speed. Every 10min, take out the tube and pipet up and down the samples for 10 times. Dissociation in Col IV for a total of 30min. After 30min and the 3rd pipetting, spin the cells down at 300g for 1min to collect the kidney tubules and glomerulus as the pellet. Resuspend the pellet with warmed-up 500ul Accumax. Put the Eppendorf tube into rotating shaker set at 37C with 800rpm shaking speed. Every 10min, take out the tube and pipet up and down the samples for 10 times. Dissociation in Accumax a total of 30min. After 30min, add 500 µl 10% FBS to neutralize the dissociation. Then start the 3rd pipetting for 20 times. Spin down the cells at 300g for 5min, remove supernatant, and resuspend the pellet with 200 µl ACK lysing buffer (Thermo Fisher Scientific, # A1049201), to remove the blood cells (room temperature for 3min). Add 1ml 10% FBS and spin the cells 79 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT down at 300g for 5min. Remove the 1.2ml supernatant and resuspend the cells into 100 µl 10% FBS medium for cell counting (use Trypan Blue to determine the live cell percentage). Usually, the live cell percentage of dissociated cells was 50-75%. Dissociated whole kidney cells were further cultured with mNPSR-v2 medium to induce Six2+ NPC-like cells. Note that for this culture, iMatrix-511 (Nacalai USA, # 892021), but not Matrigel, was used for coating plates, to enhance the attachment of the postnatal kidney cells to the plate. Generation of SIX2-GFP/PAX2-mCherry knock-in dual reporter hPSC line [0174] CRISPR-Cas9 based genome editing was used to insert 2A-EGFP-FRT-PGK-Neo-FRT or 2A-mCherry-loxP-PGK-Neo-loxP cassette downstream of the stop codon (removed) of endogenous SIX2 or PAX2 gene, respectively. DNA sequences ~1 kb upstream and ~1 kb downstream of the stop codon for endogenous SIX2 (upstream F: CCGGAATTCTGCCCAGTTTGGAGCTACAG (SEQ ID: 101); upstream R: TACGAGCTCGGAGCCCAGGTCCACGAGGTT (SEQ ID: 102); downstream F: CGCGTCGACAACCCATTTGCCTTGATGAG (SEQ ID: 103); downstream R: CCCAAGCTTCCCGAAGAACATTCACATGAGG (SEQ ID: 104)) or PAX2 (upstream F: GAAGTCGACTTTCCACCCATTAGGGGCCA (SEQ ID: 105); up-stream R: TATGCTAGCGTGGCGGTCATAGGCAGCGG (SEQ ID: 106); downstream F: TATAC- GCGTTTACCGCGGGGACCACATCA (SEQ ID: 107); downstream R: GACGGTACCAGTAACTGCTGGAG-GAAGAC (SEQ ID: 108)) were cloned as homology arms upstream and downstream of 2A-EGFP-FRT-PGK-Neo-FRT (for SIX2-GFP) or 2A-mCherry-loxP-PGK- Neo-loxP cassette (for PAX2-mCherry), respectively, to facilitate homologous recombination.2A-EGFP fragment was cloned from pCAS9_GFP (Addgene # 44719) and the FRT-PGK-Neo-FRT cassette was cloned from pZero-FRT-Neo3R (kindly provided by Dr. Keiichiro Suzuki).2A-mCherry-loxP-Neo-loxP fragment was cloned from Nanog-2A-mCherry plasmid (Addgene # 59995). The different fragments were then cloned to a modified pUC19 plasmid with additional restriction sites inserted, to make the complete donor plasmids for both knock-in experiments. Oligos for making sgRNA-expressing plasmid for SIX2 knockin (F: CACCGGGGCTCCTAGAACCCATTTG (SEQ ID: 109); R: AAAC CAAATGGGTTCTAGGAGCCCC (SEQ ID: 110)) or PAX2 knockin (F: CACCGATGACCGCCACTAGTTACCG (SEQ ID: 111); R: AAACCGGTAACTAGTGGCGGTCATC (SEQ ID: 112)) were synthesized, annealed, and cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene # 62988). Both donor and sgRNA plasmids for SIX2 reporter knockin were transfected into the H1 hESCs using the Lipofectamine 3000 Transfection Reagent (Invitrogen, Cat. No. L3000015). Neomycin-resistant single cell colonies were picked up manually and genotyping was performed based on PCR. Clones with biallelic knock-in of SIX2-GFP were chosen for second round screen where plasmid 80 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT encoding flippase was delivered via transfection to allow the transient expression of flippase, whose activities excise the FRT-flanked PGK-Neo cassette from the SIX2-GFP knock-in alleles. PCR was performed to identify single cell clones in which PGK-Neo cassettes were excised from both alleles. Then the same strategy was used to knock in PAX2 reporter based on the successful biallelic SIX2-GFP knock- in clones. PKD2 knock-out in SIX2-GFP knock-in reporter hPSC line [0175] SIX2-GFP knock-in reporter hPSC line was generated using the method described above. We further knocked out PKD2 gene in the reporter hPSC line using CRISPR/Cas9 based genome editing. For that, sgRNA was designed to target the first exon of human PKD2 gene with sgRNA targeting sequence: CCGCGATAACCCCGGCTTCG (SEQ ID: 113). sgRNA was inserted into lentiCRISPR v2 plasmid (Addgene # 52961) and lentivirus was produced and then infected into SIX2-GFP hPSC line. After puromycin selection followed by clonal expansion of hPSCs, 11 single cell clones were picked up and expanded. Proteins were extracted from the 11 single cell clones and Western blot was performed to identify the candidate PKD2-/- clones #10 and #11. PCR-based genotyping from the genomic DNA, following by Sanger sequencing, further confirmed the generation of frame-shift mutations in both alleles of PKD2 gene from #10 and #11 clones. Deriving iNPC lines from human pluripotent stem cells Deriving iNPC lines from FACS-purified SIX2-EGFP/PAX2-mCherry iNPCs [0176] Directed differentiation from SIX2-GFP/PAX2-mCherry knock-in dual reporter hPSCs into iNPCs was performed following a previously published protocol5, with minor modifications. Briefly, hPSCs were dissociated into single cells with Accumax and 40,000 cells were seeded into one well in a 12-well plate with 1ml mTeSR medium plus 10 µM Y27632. Medium was changed daily with fresh 1ml mTeSR medium without Y27632 for another 2 days. At this time (day 0), hPSCs formed small colonies and were ready for directed differentiation. Phase 1, day 0 to day 4 (D0-D4), hPSCs were cultured with 1 ml Advanced RPMI 1640 Medium (Thermo Fisher Scientific, # 12633-012) supplemented with 8 µM CHIR99021 and 10nM LDN193189; medium was refreshed on D2 and D3. Phase 2 (D4-D7), medium was changed to Advanced RPMI 1640 Medium supplemented with 10 µM Y27632 and 10 ng/ml activin A; medium was refreshed daily. Phase 3 (D7-D10), medium was changed to Advanced RPMI 1640 Medium supplemented with 50 ng/ml FGF9; medium was changed daily till D10. On D10, cells were dissociated into single cells with pre-warmed Accumax, and SIX2-GFP/PAX2-mCherry iNPCs were sorted out through BD FACSAria™ III Cell Sorter. Sorted iNPCs were counted and 10,000 cells were seeded into one well in a 96-well plated coated with Matrigel and cultured with 100 µl hNPSR-v2 81 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT medium (Table 2). The medium was refreshed 2 days after cell seeding. When iNPCs grew to 80-90% confluent (on day 3 or day 4), the culture medium was removed, and the cells were washed once with 100 µl PBS, and then dissociated with 50 µl pre-warmed Accumax. The cells were incubated with Accumax for 8 mins, and then 150 µl 10% FBS medium was added to neutralize Accumax. The medium was pipetted up and down GENTLY for 5-7 times to make single cell suspension, which was then seeded at 1:10 passage ratio to a new well in 96-well plate. Change medium 2 days after seeding. On day 3 or day 4, the cells grew to 80-90% confluent and can be passaged again using the same protocol described above. (Note, Matrigel coating protocol for iNPC culture is the same as the one described for mNPC culture.) Deriving iNPC lines without prior FACS-based purification of iNPCs [0177] hPSCs were differentiated following the same protocol described above to generate iNPCs. On D10 of differentiation, instead of using FACS to purify the iNPCs based on SIX2-GFP; PAX2- mCherry dual reporter system, the dissociated whole cells were counted and then 10,000 cells were seeded into one well of 96-well coated with Matrigel and cultured with 100 µl hNPSR-v2 medium. Thereafter, after 2 weeks of continuous culture and passage in hNPSR-v2 medium following protocol described above, stable iNPC line was established with 90-95% purity of iNPCs. Deriving single cell clonal iNPC lines [0178] When iNPC lines are stably established, single cell clonal iNPC lines can be generated. For that, when the iNPC lines grew to around 80% confluency, the cells were dissociated into single cells following the protocol described above for passaging iNPCs. The cells were counted and seeded into Matrigel-coated 96-wells at the density 0.5 cell per well with 100 µl hNPSR-v2 medium so that most wells would have either one single cell or no cell (day 0). On day 3, 50 µl used medium was removed, and 100 µl fresh medium was added. On day 6, the used medium was completely removed and 100 µl fresh medium was added. On day 9, NPC clones were clearly observed under the microscope in about 30% of the wells seeded. Cells in these wells were dissociated following our protocol described above, and all the cells were seeded into another 96-well. On day 12-14, the cells reached around 80-90% confluency and were passaged routinely every 3 or 4 days at the ratio of 1:10 as described above for bulk iNPC culture. To determine cloning efficiency, 60 wells of a 96-well plate were seeded with single cell NPC following the method mentioned above (D0). On day 3, the wells containing clusters of cells from a single cell were labeled and counted, and the wells without any cell were discontinued. On day 9, the number of wells grown at least 40% confluency was counted. Cloning efficiency was calculated by using 82 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT the number of wells recorded on day 9 divided by the number of wells recorded on day3, from three independent experiments. Deriving hNPC lines from human fetal kidneys [0179] Tweezers were utilized to dissect nephrogenic zones from 9 to 12 week-old human fetal kidneys. Nephrogenic zones were minced into small pieces, and transferred into 1.5 mL Eppendorf tubes, and spun down at 300 g for 3 minutes. (Note that we aliquoted the kidney pieces into multiple tubes to ensure the volume of the tissue pellet after centrifugation was less than 100 µl per tube to ensure best dissociation). The dissection medium was then carefully aspirated. The kidney pieces were then washed once with sterile PBS.500 µL of pre-warmed Accumax was added to the tube to resuspend the kidney pieces. The tube was incubated in 37°C incubator for 20~22 minutes.500 µL 10% FBS medium (10% FBS in DMEM) was added to the tube, and then GENTLY pipetted up and down 20 to 25 times to further dissociate the kidney pieces. The tube was spun down and the supernatant was then removed. FACS medium (cold PBS with 2% FBS) was added to resuspend the cell pellet and the cell suspension was filtered through 40 µm cell strainer (Greiner bio-one, Cat. No.542040) to remove cell clumps. Cells were counted and diluted to 1 million cells per 100 µl in FACS medium, and ITGA8 antibody (R&D Systems, # AF4076) was added at the ratio of 1:200 for live cell staining. The incubation with ITGA8 antibody was performed on ice for 1 hour, followed by wash with 1 ml FACS medium and incubation for 1 hour with fluorescence protein-conjugated secondary antibody (Donkey anti-Goat IgG (H+L) Highly Cross- Adsorbed Secondary Antibody, Alexa Fluor Plus 488 or 568, Thermo Scientific, # A11055 or A11057) protected from light. After that, another wash with 1 ml FACS medium was performed and the cell suspension was then subjected to FACS to sort out ITGA8+ hNPC through BD FACSAria™ III Cell Sorter. Purified ITGA8+ hNPCs (70-90% SIX2+/PAX2+) were cultured with the same protocol as described for purified SIX2-GFP; PAX2-mCherry iNPCs. After 2 to 3 passages in hNPSR-v2 medium, stable hNPC line with 90-95% hNPCs were established. Lentiviral expression of mCherry in iNPCs [0180] 30,000 SIX2-GFP+/PAX2-mCherry+ iNPCs were seeded into one well in 24-well plate.24 hours later, iNPCs were infected with lentivirus expressing mCherry driven by EF1α promoter (EF1a_mCherry_P2A_Hygro, Addgene, # 135003) using spinfection method described above.24 hours after infection, 150 μg/ml Hygromycin B (Thermo Scientific, Cat. No.10687010) was added to the medium to select for iNPCs that have been successfully infected. More than 95% of the iNPCs showed bright mCherry expression after 1 week of Hygromycin B selection. (Note that exogenous mCherry is 83 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT much brighter than endogenous mCherry from the PAX2-mCherry reporter, allowing the separation of these two mCherry signals.) Targeted genome editing at the AAVS1 loci in iNPCs [0181] 30,000 SIX2-GFP+/PAX2-mCherry+ iNPCs were seeded into one well in 24-well plate.24 hours later, iNPCs were transfected with a mixture of two plasmids that provide donor DNA for targeted knockin of CAG promoter-driven mCherry expression cassette at the AAVS1 loci (pAAVS1-P-CAG- mCherry, Addgene, # 80492), and that express Cas9 and sgRNA (pXAT2, Addgene, # 80494), at the ratio of 3:1, using Lipofectamine 3000 transfection reagent.24 hours after transfection, 0.3 μg/ml puromycin was added to the medium to select for iNPCs that have been successfully gene edited. More than 97% of iNPCs showed bright mCherry expression after 1 week of puromycin selection. (Note that exogenous mCherry is much brighter than endogenous mCherry from the PAX2-mCherry reporter, allowing the separation of these two mCherry signals.) Generation of human nephron organoids from human NPC lines Nephron organoid protocol -v1: [0182] iNPCs or hNPCs cultured in hNPSR-v2 medium were dissociated into single cells using Accumax as described above.30,000 cells were seeded into one well of a U-bottom 96-well plate (Thermo Fisher Scientific, # 174929) and cultured with 100 μl hNPSR-v2 medium overnight for cells to aggregate. On the next day (Day 0), 3D NPC aggregates were transferred onto 6-well format transwell membrane (Corning, # 3450) with 6 μM CHIR99021 in 1.2 mL STEMdiff™ APEL™2 medium (STEMCELL Technologies, # 05270) at the bottom of the chamber for 1-hour. Then medium on the bottom chamber was removed as much as possible, and 1.2mL STEMdiff™ APEL™2 medium with 50 ng/mL FGF9 and 1 μg/mL heparin was added for continuous culture. This medium was refreshed every other day. On Day 5, medium was changed to 1.2mL STEMdiff™ APEL™2 medium without any other factors. The medium was refreshed every other day till Day 14, when the samples were harvested for various assays. Nephron organoid protocol -v2: [0183] When iNPCs or rNPCs reached 80-90% confluency in hNPSR-v2 culture, they were dissociated into single cells with Accumax as detailed above.30,000 dissociated iNPCs or rNPCs were seed into one well of a U-bottom 96-well plate (Thermo Fisher Scientific, # 174929) and cultured with 100 μl hNPSR-v2 medium overnight for cells to aggregate. On the next day (Day 0), 3D NPC aggregates were transferred onto 6-well format Transwell plate (Corning, # 3450) with 6 μM CHIR99021 in 1.2 mL STEMdiffTM APELTM2 medium (STEMCELL Technologies, # 05270) (Stage I) at the bottom of the 84 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT chamber for 1 hour. The medium at the bottom chamber was then completely removed, and 1.2mL STEMdiffTM APELTM2 medium with 50 ng/mL FGF9 and 1 μg/mL heparin (Stage II) was added for continuous culture. This medium was refreshed every other day. On Day 5, medium was changed to 1.2mL Advanced RPMI 1640 Medium (Thermo Fisher Scientific, #12633-012) with 1X B27 and 200 nM A83-01 (Stage III). The medium was refreshed every other day till Day 14 or Day 21, when the samples were harvested for various assays Growth curve analysis of NPCs cultured in mNPSR-v2 or hNPSR-v2 media [0184] For the growth curve analysis, 5,000 mNPCs, iNPCs, or hNPCs were seeded into each well of a 96-well plate coated with Matrigel and cultured in their corresponding mNPSR-v2 or hNPSR-v2 media. For each experiment, 16 wells were prepared for each line tested. Every 24 hours, 4 wells were dissociated, and the cell number was counted till 4 days after initial cell seeding, to determine the cell growth from day 0 to day 4. Three independent experiments were performed for each NPC line, serving as three biological replicates, to calculate the average cell numbers and the error bars at each time point. Bulk RNA sequencing [0185] Cultured mouse and human NPC samples were collected and lysed in TRIzol reagent or DNA/RNA Shield and stored at -80 ^C. Total RNA was extracted using Direct-zol RNA MicroPrep Kit (Zymo) or Quick-RNA Microprep Kit (Zymo). Bulk RNA-Sequencing was then performed through the Molecular Pathology Genomics Core of Children’s Hospital Los Angeles (CHLA), or through Novogene USA Inc. For sequencing through CHLA, cDNA library was prepared using KAPA Stranded mRNA-Seq Kit (KAPA Biosystems) and sequenced using Illumina HiSeq 2500. For sequencing through Novogene, library prep and sequencing were performed using standard Novogene bulk RNA-seq pipeline. Bulk RNA-seq data analysis [0186] RNA sequencing data was analyzed using Partek Flow Genomic Analysis Software. In addition to the new data generated from mouse and human NPC lines described in this study, legendary bulk RNA-seq data of primary mouse and human NPCs were used as positive controls, and primary kidney cells that are not NPCs were used as negative controls. These include E12.5 Six2-negative primary mouse non-NPCs, E11.5, E12.5, E13.5, E16.5 and P0 primary mouse NPCs 1, SIX2-negative primary human non-NPCs, SIX2+ human NPCs, SIX2+/MEIS1+ human NPCs, 6 and ITGA8+ human NPCs 3. FASTQ files were trimmed from both ends based on a minimum read length of 25 bps and an end minimum quality score (Phred) of 20 or higher. For mouse samples, reads were aligned to mm39 using STAR 2.7.8a. For human samples, reads were aligned to hg38 using STAR 2.7.8a. Aligned reads were 85 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT quantified to the Partek E/M annotation model. Gene counts were normalized using DESeq2 Median ratio.972 mouse NPC signature genes were identified by comparing primary Six2+ E12.5 NPCs and primary Six2- E12.5 non-NPCs1, with cutoff of fold change > 1.5 or < -1.5, and p-value < 0.01 using DESeq2.1058 human NPC signature genes were identified by comparing 5 datasets of primary ITGA8+, SIX2+ or SIX2+/MEIS1+ NPCs with 2 datasets of primary SIX2- non-NPCs2,3, with cutoff of fold change > 1.5 or < -1.5, and FDR < 0.05 using DESeq2. Principle component analysis (PCA) for Figure 5B was performed using human nephron lineage signature genes. All other PCA were performed using the mouse or human NPC signature genes identified. Hierarchical clustering of selected genes was produced based on the genes’ DESeq2 Median ratio values, clustering samples and features with average linkage cluster distance and Euclidean point distance. Volcano plots (Figure 16K and 16L) were generated using the DEG (differentially expressed genes) between podocytes (D0) and podocytes cultured with hNPSR-v2 for 4 days (K), and between podocytes cultured with hNPSR-v2 for 4 days and 24 days (L), with cutoff of fold change > 2 or < -2, and FDR < 0.05. Gene ontology (GO) analysis (Figure 16M and 16N) were performed using Metascape based on the DEG (differentially expressed genes) between podocytes (D0) and podocytes cultured with hNPSR-v2 for 4 days (Fig.16M), and between podocytes cultured with hNPSR-v2 for 4 days and 24 days (Fig.16N) with cutoff fold change > 5 or < -5 for D4 vs. D0 (Fig.16M), or > 2 or < -2 for D24 vs. D4 (Fig.16N), and p value < 0.01. Single nuclei isolation from iNPC-derived nephron organoids [0187] Expanded iNPCs (D25-D45) were used to generate nephron organoids following the nephron organoid induction protocol (v2, described above). Total 10 organoids were harvested at the Day 21 time point for 10x Genomics Single Cell Multiome (snRNA/snATAC-seq) sequencing. These organoids were first minced into small pieces, transferred to 1.5mL Eppendorf tubes, and washed with 1x DPBS. These organoid pieces were then dissociated into single cells using 10 mg/mL Bacillus licheniformis cold active protease (Sigma P5380) mixed with 2.5 mg/mL collagenase type 4 (Worthington, #LS004188) and 125 U/mL DNase I (Worthington, #LS002058) in 1x DPBS at 12°C. The digestion mix was agitated twenty times every 5 min with wide bore P-200 pipet tip. The dissociation reaction was terminated by quenching with fetal bovine serum (total end concentration 10%) when there were mostly single cells (after around 45 min). The tube was then centrifuged at 300g for 5 mins, supernatant was removed, and the cell pellets were washed twice with DPBS, centrifuged in between, and resuspended in prechilled nuclear lysis buffer as outlined in 10X protocol (CG000365 RevC). After 5 mins of nuclear lysis, the single cell suspension viability went from 99% to less than 3% as assayed with Trypan Blue staining and visualization with a Countess III Cell Counter. The now nuclear pellet was washed and centrifuged three times to remove 86 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT debris and passed through a 40 µM filter (Pluriselect 43-50040) upon last wash. The final nuclear pellet was resuspended in prechilled 1X Nuclei Buffer (10X Genomics, #2000207). snRNA-seq and snATAC-seq library construction and sequencing [0188] Nuclei concentration was assessed and a target of ~13,000 x 2 nuclei (in two technical replicates) were loaded into two separate Tn5 transposition reactions. Loading onto Chip J, GEM Generation and Library Preparation followed the manufacturer’s protocol (10X Genomics, CG000338) with 7 preAmp, 7 ATAC Library, 8 cDNA, and 14 SI GEX PCR cycles used. All cleanups were performed using suggested SPRI-Select bead ratios. Final library concentration and quality were assessed by BioAnalyzer. Complementary snRNA (GEX) and snATAC libraries were then sequenced on the Illumina-S4 Novaseq 6000 platform at Novogene. Data analysis for snRNA-seq/snATAC-seq datasets [0189] Data for integration. Other organoid transcriptomic scRNA-seq91 at differentiation day 28 and snRNA-seq/snATAC-seq90 at differentiation day 26 datasets were downloaded and loaded into Seurat version 4.3.0.1 and Signac version 1.10.0. Generation of Seurat objects included quality-control metrics for genes per cell (250-12,000), mRNA transcripts per cell (250-75,000), and maximum mitochondrial percentage (35%) to eliminate low quality cells. [0190] Data integration. These objects were then prepped for integration with DietSeurat and integrated into one unified snRNA-seq data object through standard Seurat data integration pipeline (found on the world wide web at satijalab.org/seurat/archive/v4.3/integration_introduction) using the following functions: SplitObject, NormalizeData, FindVariableFeatures, and SelectionIntegrationFeatures, FindIntegrationAnchors, and IntegrateData. Linear dimension reduction was performed on this integrated object with a total number of 75 PCs during principal component analysis. [0191] Identifying gene markers and calculating cell identity proportions. Cluster characterization and kidney cell type labeling was conducted by running differential gene expression analysis with FindAllMarkers on the integrated and labeled object, and the top differentially expressed genes were used to identify cell types. Cell count per sample was calculated by first re-naming clusters to cell identities with levels. The integrated and labeled Seurat object was split into individual organoid datasets using SplitObject by original identity. These individual objects were then converted to a dataframe with dplyr version 1.1.2 function bind_rows and base R function as.data.frame. Finally, cell proportions for each organoid identity were converted to percentages based on each individual dataset – e.g. all percentages of the cell identities are unique to each identity. Specific cell type populations were analyzed by sample by 87 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT subsetting the integrated and labeled Seurat object based on assigned kidney cell type, and gene expression was analyzed with DotPlot grouped by original identity, and/or VlnPlot split by original identity. Genome-wide CRISPR screen [0192] The Brie genome-wide CRISPR knockout library7 (Addgene # 73632) was introduced to cultured NPCs via lentiviral infection in two different NPC lines as two biological replicates. This library contains 4 sgRNAs for each of the 19,674 protein-coding genes of the mouse genome, and 1,000 non- targeting control sgRNAs, totaling 78,637 unique sgRNAs . The infection was carried out at a low multiplicity of infection (MOI) of 0.3, to ensure the majority of the NPCs express only one sgRNA. For each experiment, twenty-five million NPCs were used for the initial infection so that at least 100 cells would carry the same sgRNA to protect against random loss of sgRNA if lower cell number was used.0.3 µg/ml puromycin was added 48 hours after lentiviral infection, to select for the successfully infected cells, which were further cultured continuously for a total of 3 weeks since lentiviral infection. Genomic DNA was extracted after 3 weeks of culture, and targeted PCR was performed to amplify the sgRNA integrated into the genome for next-generation sequencing, following Sequencing Protocol provided by Addgene (“Broad Institute PCR of sgRNAs for Illumina sequencing”). Next-generation sequencing was performed from the Molecular Pathology Genomics Core of Children’s Hospital Los Angeles using Illumina HighSeq 2500. Genome-wide CRISPR screen data analysis [0193] Normalized read counts for each individual sgRNA in the plasmid library, before and after CRISPR screen, CRISPR screen beta scores, and the scatterplots of beta scores, were generated using MAGeCKFlute 8.1798 genes from CRISPR screen replicate #1, and 1627 genes from CRISPR screen replicate #2, with beta scores > 1.5 or < -1.5, and p-values < 0.05, were identified as potential hits for further analyses using Canonical Pathway Analysis tools of the Ingenuity Pathway Analysis (IPA) platform. Full list of reference CAKUT or Wilms tumor-related genes, and the genes identified in the screens, were summarized in Table 11. KMT2A and KAT6A inhibitor treatment experiments [0194] 20,000 mNPCs were seeded into each Matrigel-coated well of 96-well plates, and cultured in (1) mNPSR-v2 + DMSO, (2) mNPSR-v2 + 100 nM WDR5 degrader, (3) mNPSR-v2 + 1 µM MLL1 (inh), (4) mNPSR-v2 + 5 µM MOZ-IN-3, or (5) mNPSR-v2 + 5 µM WM-1119. Medium was changed 88 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT every two days and samples were harvested for immunofluorescence staining and qRT-PCR assay on day 8. Three independent experiments were conducted for each group as biological replicates. Establishment of one-step multiplexed CRISPR/Cas9 knockout lentiviral plasmids [0195] Three different sgRNAs (sgRNA-A, sgRNA-B, and sgRNA-C) were designed to target EGFP coding sequences9, or the first exons of Pkd1, or Pkd2 genes. These sgRNAs were inserted individually into lentiGuide-Puro plasmid (Addgene # 52963) following the cloning protocols provided from the plasmid depositor. Then, for each target gene, the three sgRNA expression cassettes were subcloned one by one from the three lentiGuide-Puro plasmids into a modified pLKO.1-TRC plasmid (additional multiple cloning site BclI-EsrGI-MluI-NheI-PstI-SalI-XbaI-XmaI was inserted between the original PpuMI and EcoRI sites in the pLKO.1-TRC plasmid (Addgene # 10878)) to make tandem sgRNA expression cassettes in the same lentiviral vector. sgRNA targeting sequences: Gene sgRNA-A sgRNA-B sgRNA-C EGFP AAGGGCGAGGAGCTG CTGAAGTTCATCTGCA GGAGCGCACCATCTTC TTCAC (SEQ ID: 114) CCAC (SEQ ID: 115) TTCA (SEQ ID: 116) Pkd1 GCTGCGCTGACGATGC CTGGCCGGAGACCCTG AGCGGCCGGAGCAAT CGCT (SEQ ID: 117) GGCG (SEQ ID: 118) TGACG (SEQ ID: 119) Pkd2 CGAGATGGAGCGCAT TCGCCCGCGCCGCGAG AGTGGCGCCCGGGCA CCGGC (SEQ ID: 120) CGTC (SEQ ID: 121) GTCGG (SEQ ID: 122) One-step gene knockout in mouse NPCs with multiplexed CRISPR/Cas9 KO system [0196] Multiplexed CRISPR/Cas9 KO plasmids targeting EGFP, Pkd1, or Pkd2 were generated as described above. Lentivirus was produced from these plasmids and used to infect mNPCs. For that, lentivirus was first packaged following protocols we described previously1 and was then concentrated 100x using Lenti-X Concentrator kit (Takara, # 631231). Concentrated lentivirus was aliquoted and stored in -80 ^C before use. The lentivirus was used at 1x final concentration together with 10 μg/ml polybrene (Sigma-Aldrich, Cat. No. TR-1003-G) diluted in mNPSR-v2. Lentiviral infection was conducted in mNPC cultured in wells of 96-well plate. (1) For gene editing in Cas9-EGFP mNPC line, used culture medium was removed from each well and 100 µl lentivirus-polybrene-mNPSR-v2 mixture was added to the well. The plate was then centrifuged at 800 g for 15 minutes at room temperature. After 89 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT the spinfection, the lentivirus-polybrene-mNPSR-v2 mixture was removed and the infected mNPCs were washed three times gently with 150-200 µl pre-warmed PBS, then cultured in 100 µl fresh mNPSR-v2 medium.24 hours after infection, 0.3 μg/ml puromycin was added to the medium to select for NPCs that have been successfully infected. (2) For gene editing in Six2-GFP mNPC lines or wildtype mNPC lines cultured in 96-well plate, cells were first infected with lentivirus containing lentiCas9-Blast plasmid (Addgene, # 52962) using similar spinfection protocol described above.24 hours after infection, 2 μg/ml blasticidin was added to the medium to select for NPCs that have been successfully infected.1 week after selection, these Cas9-expressing mNPCs were infected with lentivirus expressing multiplexed CRISPR/Cas9 KO system as described above to generate gene KO starting from the wild-type mNPC line. Once bulk Pkd1-/- or Pkd2-/- mNPC lines were generated, single cell clonal Pkd1-/- or Pkd2-/- mNPC lines were generated following the same protocols we described above for generating clonal mNPC lines from mNPCs. Genotyping of Pkd1-/- or Pkd2-/- single cell clonal mNPC lines [0197] Genomic DNA of Pkd1-/- or Pkd2-/- single cell clonal mNPC lines were extracted using QuickExtractTM DNA Extraction Solution (Lucigen, # QE09050). PCR primers were designed to flank the sgRNA targeting sites of Pkd1 or Pkd2 genes (listed below). PCR were performed and PCR amplicons were used to conduct gel running and purified by DNA Clean & Concentrator kit (Zymo Research, # D4031). A-tailing were then performed on the purified PCR products following the NEB protocol, which can be found on the world wide web at neb.com/protocols/2013/11/01/a-tailing-with-taq-polymerase. A- tailed PCR products were ligated with digested linear pGEM®-T Vector (Promega, Cat. No. A3600), followed by transformation with One Shot™ TOP10 Chemically Competent E. coli (Thermo Fisher Scientific, # C404010). Transformed E. coli were evenly daubed on IPTG/X-gal/Amp agarose plates and incubated at 37 ^C overnight. White bacterial clones were then picked up, inoculated, followed by mini- prep plasmid extraction (Zymo Research, # D4020). Extracted plasmids were sent to for Sanger sequencing. SnapGene software was utilized to analyze sequencing data. Primers for PCR-based Pkd1-/- or Pkd2-/- genotyping: Gene Forward Reverse CCCTCCTGAACTGCGGCT (SEQ GGACCCAGTCATGATGCTCTA Pkd1 ID: 123) (SEQ ID: 124) GCAAGCTACCCCGTAGGAATG GCGCAGGCAGTTGTCAAGC Pkd2 (SEQ ID: 125) (SEQ ID: 126) 90 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Optimization of mini Pkd2-/- cystic organoid generation [0198] Clonal Pkd2-/- mNPC lines and GFP-/- mNPC lines were used to optimize mini organoids model. For the first round of optimization, after mNPSR-v2 cultured NPCs reached 80-90% confluency in 2D culture, cells were dissociated into single cells using Accumax Cell Dissociation Solution.500,000 cells were seeded into each well of AggreWell™80024-well Plate (STEMCELL Technologies, Cat. No. 34850) with 2 mL mNPSR-v2 medium and cultured overnight. On the next day (Day 0), mini 3D NPC aggregates formed, and they were transferred into 12-well plates with around 30 mini aggregates/well in 1mL medium. mini 3D NPC aggregates were treated with different concentrations of CHIR99021 at 3.0 μM, 4.5 μM or 6.0 μM in KR5 or hBI medium under shaking culture at 120 rpm (VWR Orbital Shaker Model 1000) for 2 days (D0-D2), and then followed by culture with KR5 or hBI for 5 days (D2-D7). For the second round of optimization, mini 3D NPC aggregates were transferred into 12-well plates or ultra- low attachment plates under shaking culture or suspension culture, and treated with CHIR99021 at 4.5 μM in KR5 medium with 1% MTG or without MTG for 2 days (D0-D2), and then followed by culture in KR5 with 1% MTG or without MTG for 5 days (D2-D7). Cystic organoid formation efficiency was quantified based on 3-4 independent experiments and cyst diameters were measured by the measure tools of Olympus Cellsens Standard software. See also Figure S6 for more information. hBI medium Basal medium: DMEM/F12 (1:1) (1X), Invitrogen, Cat. No.11330-032. Supplements: Final Reagent Name Company Cat. No. Concentration GlutaMAX-I (100X) Invitrogen 35050-079 1X MEM NEAA (100X) Invitrogen 11140-050 1X 2-Mercaptoethanol (55mM) Invitrogen 21985-023 0.1 μM Pen Strep (100X) Invitrogen 15140-122 1X B-27 Supplement (50X), minus vitamin A Invitrogen 12587-010 1X ITS Liquid Media Supplement (100×) Sigma I3146-5ML 1X Generation of PKD organoid models from mouse and human NPC lines Traditional PKD organoid models: 91 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0199] Clonal Pkd2-/- mNPC lines or PKD2-/- iNPC lines were used to generate corresponding mouse or human ADPKD models. The protocols for generation of mouse and human nephron organoids on transwell plates from NPC lines were described above. On day 7 (mouse) or day 14 (human) of organoid differentiation, each organoid was cut into 6 pieces using needles and subjected to shaking culture at 120 rpm (VWR Orbital Shaker Model 1000) in KR5 medium to develop cysts. Cystic organoid formation efficiency was quantified based on 3-4 independent experiments and cyst diameters were measured by the measure tools of Olympus Cellsens Standard software. For drug testing using this traditional PKD organoid model, for each drug treatment group, 30 small organoid pieces from fully developed mouse or human nephron organoids were pooled together in one well of a 12-well plate, cultured in KR5 medium with shaking, and supplemented with the drug to be tested. Drugs were freshly added to the medium and were refreshed with KR5 medium every two days.4 days after drug treatment, cystic organoids were recorded through imaging and cyst formation efficiency and cyst diameter were quantified. Concentrations of drugs used in this study were determined based on previous publications 10-13. Cystic organoid formation efficiency was quantified based on 3-4 independent experiments and cyst diameters were measured by the measure tools of Olympus Cellsens Standard software. Scalable mini PKD organoid models: [0200] Clonal Pkd2-/- mNPC lines or PKD2-/- iNPC lines were used to generate corresponding mouse or human ADPKD mini organoid models. For that, 500,000 mNPCs or iNPCs were seeded into each well of AggreWell™80024-well Plate (STEMCELL Technologies, # 34850) with 2 mL mNPSR-v2 medium (mouse) or hNPSR-v2 medium (human), and cultured overnight to form mini aggregates (~300 mini aggregates per well, or ~7,200 mini aggregates per plate). On the next day (Day 0), mini 3D NPC aggregates from one well were transferred into 2 wells of 6-well plate with 2.5 mL KR5-CF medium in each well with shaking at 120 rpm. These aggregates were treated with KR5-CF medium for 2 days (mouse) or 3 days (human), then the medium was changed to 2.5 mL KR5 medium with medium refreshed every other day till harvested. Obvious PKD cysts typically emerged 4 days (mouse) or 8 days (human) after shaking culture. Cystic organoid formation efficiency was quantified based on 3-4 independent experiments and cyst diameters were measured by the measure tools of Olympus Cellsens Standard software. Small molecule screening with scalable mini PKD organoid models [0201] Commercially available small molecule library (Cayman, # 11076) targeting major epigenetic processes was used for small molecule screening in the scalable mini PKD organoid models. Following protocols described above, thousands of mini NPC aggregates were generated using a full plate of 92 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT AggreWell™80024-well Plate starting from 12 million Pkd2-/- clonal NPC line #4, or #5, as two biological replicates. These mini NPC aggregates were seeded into 12-well plates with around 30 mini NPC aggregates per well (Day 0). These plates were then subjected to shaking culture with 1 mL KR5-CF medium per well for 2 days. Medium was changed to 1 mL KR5 medium per well after 2 days (Day 2). On Day 3, small molecules from the epigenetic library were added individually into each well at the concentration of 1 µM, with controls that have DMSO, or different concentrations of metformin or tolvaptan. Cystic organoid percentages and cyst diameters were quantified on Day 5 as described above. Similar protocols were used when individual hits were further validated rather than from the initial screen. For small molecule testing in the human mini PKD organoid models, the KR5-CF step was extended to 3 days (Day 0 to Day 3), followed by KR5 step with medium refreshed every two days. Small molecule candidates were added on Day 6, and data were analyzed on Day 8. Cystic organoid formation efficiency was quantified based on 3-4 independent experiments and cyst diameters were measured by the measure tools of Olympus Cellsens Standard software. Seahorse assays on GFP-/- or Pkd2-/- NPCs and GFP-/- or Pkd2-/- nephron organoids [0202] The XFp Extracellular Flux Analyzer (Agilent) was used for extracellular flux measurements. For GFP-/- mNPCs vs Pkd2-/- mNPCs, 20,000 cells per well were seeded in iMatrix-511 (Nacalai USA, # 892021) coated Seahorse miniplates 18-20 hours before the assay. For GFP-/- nephron organoids vs Pkd2- /- nephron organoids, on Day 4 of shaking culture following the mini PKD organoid protocol, one single nephron organoid was seeded into each well of poly-l-lysine coated Seahorse miniplate 1 hour before the assay. The XF sensor cartridges were hydrated overnight at 37°C without carbon dioxide in the Seahorse XF calibrant solution, as recommended by the manufacturer protocol. For the cell energy phenotype test, cell culture medium was replaced with XF assay medium (unbuffered DMEM [pH7.4] with 17.5 mM glucose, 0.5 mM pyruvate, and 4.5 mM glutamine). Microplate with cells was placed in a 37°C incubator without carbon dioxide for one hour. Oligomycin and FCCP were added to the ports at the final concentration of 1 µM. Standard XFp cell energy phenotype test (3 cycles of baseline measurements and 5 cycles of Oligomycin + FCCP with 3 minutes mixing and 3 minutes measuring) were performed for 1hour. Measurements were recorded from three to six independent experiments with three technical replicates per group in each independent experiment. Data were either normalized to cell numbers for NPCs (stained and counted with Hoechst 33342), or normalized to total genomic DNA amounts for organoids (CyQUANT® Cell Proliferation Assay, Invitrogen, C7026). Data were analyzed using Wave software. 93 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Isolation of SIX2-GFP- cells or SIX2-GFP-/PODXL+ cells from SIX2-GFP/PAX2-RFP iNPC-derived nephron organoids [0203] SIX2-GFP/PAX2-RFP iNPC-derived nephron organoids were generated as detailed above. Nephron organoids at Day 3 (D3), Day 5 (D5), Day 7 (D7), or Day 8 (D8) time points were collected into 1.5 mL Eppendorf tubes containing 10% FBS medium. After removing 10% FBS medium as much as possible, 500 μl pre-warmed fresh 1X Collagenase IV (Thermo Fisher Scientific, # 17104019) was added to the tube. The tube was then transferred onto a rotating shaker (Eppendorf ThermoMixer® F2.0) set at 800 rpm shaking speed in 37°C cell culture incubator for a total dissociation time of 30 minutes. Every 10 min, the tube was taken out and the reaction mix was pipetted up and down for 10 times. After 30min and the 3rd pipetting, cells were spun down at 300g for 3min to collect the organoid pieces at the bottom of the tube. The pellet was then resuspended with 500 µl pre-warmed Accumax, incubated at 37°C with 800 rpm shaking speed for 10min. Next, 500 μl 10% FBS was added to the tube to neutralize, and the reaction mix was pipetted up and down for 10 times followed by spinning down the tube at 300g for 5min. After the centrifugation, supernatant was removed and the cell pellet was resuspended with FACS medium (cold PBS with 2% FBS) for FAGS sorting. For the isolation of SIX2-GFP-/PODXL+ cells, after spinning down the cells and removing supernatant, the pellet was resuspended with FACS medium containing PODXL antibody (R&D Systems, MAB1658) at the ratio of 1:200 for live cell staining. Cells were incubated with PODXL antibody for 1 hour on ice, followed by washing with 1 ml FACS medium once and incubating in FACS medium containing fluorescence protein-conjugated secondary antibody (Donkey anti-Mouse IgG (H+L) Highly Gross-Adsorbed Secondary Antibody, Alexa Fluor 647, Thermo Scientific, A-31571) for 1 hour on ice in dark. Then, cells were washed again and resuspended with FACS medium for FAGS to sort out SIX2-GFP-/PODXL+ cells using a BD SORP FACSYMPHONY S6 cell sorter. Cultured SIX2-GFP/PAX2-RFP iNPGs were used as control for gating SIX2-GFP- cells or SIX2-GFP-/PODXL+ cells every time. Isolation of MAFB-GFP+ cells from MAFB-P2A-eGFP iNPC-derived nephron organoids [0204] MAFB-P2A-eGFP (MAFB-GFP) iNPGs were derived from the parental hPSG line following the protocol detailed above. Nephron organoids were generated from MAFB-GFP iNPGs following the protocol described above. D8 nephron organoids were harvested for MAFB-GFP+ cell isolation following the dissociation and FAGS protocol as detailed above. Isolation of PODXL+ primary podocytes from human fetal kidney [0205] Kidney nephrogenic zone pieces were dissected out from 11.4-week or 17.4-week human fetal kidneys using tweezers. These pieces were minced into smaller pieces and transferred into 1.5 mL 94 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Eppendorf tubes. After spun down the tubes at 300 g for 3 minutes, supernatant was carefully aspirated and the pieces were washed once with sterile PBS. Then, 500 μL of pre-warmed Accumax was added to each tube to resuspend the pieces and the tubes was incubated in 37°C incubator for 20~22 minutes. After the incubation, 500 μL 10% FBS medium (10% FBS in DMEM) was added to each tube, and the reaction mix was pipetted up and down very gently 20 to 25 times to further dissociate the pieces into single cells. The tubes were then spun down and the supernatant was removed, and the cells pellet was resuspended with FAGS medium for PODXL staining followed by FAGS for PODXL+ cells as described above. Chemical reprogramming from non-NPCs and podocytes to rNPCs with hNPSR-v2 [0206] Bulk SIX2-GFP- non-NPGs, and SIX2-GFP-; PODXL+ podocytes, from SIX2-GFP; PAX2- mCherry dual-reporter iNPG-derived nephron organoids, MAFB-GFP+ podocytes from MAFB-GFP reporter iNPC-derived nephron organoids, and PODXL+ primary podocytes from human fetal kidneys, were isolated as described above and cultured in hNPSR-v2 medium. The cells were continuously passaged following iNPC culture protocol described above upon grown into confluency. After culture for 7-30 days, rNPCs were purified by FACS based on SIX2-GFP expression (from SIX2-GFP; PAX2- mCherry dual-reporter background), or enriched based on ITGA8 expression (from MAFB-GFP reporter background or from primary podocytes) as described in the manuscript (for ITGA8 staining, follow protocol described in section “Deriving hNPC lines from human fetal kidneys”). The purified/enriched rNPCs were then continuously cultured following iNPC culture protocol. For the described time-course bulk RNA-seq, FACS based on SIX2-GFP expression was performed 7 days after SIX2-GFP-; PODXL+ podocytes were cultured in hNPSR-v2 medium to purify the rNPCs. Toxicity analysis of PTC-209 on mini PKD2-/- organoids [0207] PKD2-/- iNPCs were expanded with hNPSR-v2 following the protocol as described above. iNPCs were dissociated into single cells using Accumax when reached 80-90% confluency in culture. 500,000 cells were seeded into one well of an AggreWellTM80024-well Plate (STEMCELL Technologies, # 34850) with 1.5 mL hNPSR-v2 medium and cultured overnight to form mini aggregates (~300 mini aggregates per well). On the next day (Day 0), after mini aggregates formed, old me dium was gently removed as much as possible, and 1 mL STEMdiffTM APELTM2 medium containing 6 μM CHIR99021 (Stage I) were added to the well for a 1-hour CHIR99021 treatment. After the 1-hour treatment, old medium was removed and mini aggregates were transferred into 1 well of a 6-well plate with 2.5mL STEMdiffTM APELTM2 medium containing 50 ng/mL FGF9 and 1 μg/mL heparin (Stage II) in the well. The plate was placed on a shaker set at 120 rpm for continuous shaking culture until sample harvesting. On day 5, the medium was changed to 2.5 mL Advanced RPMI 1640 Medium (Thermo Fisher 95 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT Scientific, #12633-012) with 1X B27 and 200nM A83-01 (Stage III). On day 7, these PKD2-/- organoids were transferred and evenly divided into 6 groups/wells in a 12-well plate with 1 mL Stage III medium containing DMSO, Tolvaptan_10 µM, PTC-209_10 nM, PTC-209_100 nM, PTC-209_1 μM, or staurosporine_0.1µM in each well (~50X organoids/group), under shaking culture. After 2 days of culture (On Day 9), pictures were taken to record the cyst formation efficiency and cyst growth for each group. Organoids were then harvested for TUNEL assay as described below. Immunofluorescence staining Whole-mount staining: [0208] Samples were fixed in 4% PFA (4% Paraformaldehyde Aqueous Solution, Electron Microscopy Sciences, #157-4) for 15 minutes (kidney organoids, cystic organoids, or engineered kidneys) in Eppendorf tubes or tissue culture plates at room temperature. They were then washed four times in 1X PBS (Corning, Cat. No.21-040-CV) for total 30 minutes. After the washes, samples were blocked in blocking solution (0.3% PBST containing 3% BSA) for 30 minutes at room temperature or 4 ^C overnight followed by primary antibody staining (primary antibodies were diluted in blocking solution) at 4 ^C overnight. On the second day, samples were washed four times with 0.3% PBST for total 60 minutes at room temperature. Secondary antibodies diluted in blocking solution were added and samples were incubated at 4 ^C overnight. On the third day, samples were washed four times with 0.3% PBST for total 60 minutes at room temperature then mounted for imaging. Confocal Microscope Zeiss LSM 800: AxioObserver.M2 was used for imaging recording in this study. Cryo-section staining: [0209] Samples were fixed in 4% PFA for 30 minutes (human fetal kidneys, mouse embryonic kidneys, or mouse postnatal kidneys) in Eppendorf tubes or tissue culture plates at room temperature and then washed four times in 1X PBS for total 30 minutes. Fixed kidneys were transferred and incubated in 30% sucrose overnight at 4 ^C. After these kidneys sunk to the bottom in the sucrose on the next day, they were then transferred into a plastic mold and embedded in OCT Compound (Scigen, Cat. No.4586K1) and froze in -80 ^C for 24 hours to make a cryo-block. The cryo-blocks were sectioned using Leica CM1800 Cryostat. For staining, these sectioned slides were blocked with blocking solution for 30 minutes followed by 2 hours of primary antibodies staining, all at room temperature. After primary staining, wash the slides four times with 0.3% PBST for a total of 15 minutes, then secondary staining for one hour at room temperature. After secondary staining, the slides were washed four times with 0.3% PBST for a total of 15 minutes and mounted with mounting medium (Southern Biotech, Fluoromount-G® Mounting Medium, #0100-01). For the Cryo-section staining of human fetal kidneys and mouse 96 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT embryonic kidneys with p-p38, p-Smad2 or p-Smad1/5/9 antibodies, we used TSA-based immunocytofluorescence staining with TSA Plus Cyanine 3 Evaluation Kit (PerkinElmer, # NEL744E001KT) to enhance the phosphorylation signals. Slides were first incubated with 3% H2O2 reagent at room temperature for 10 minutes, rinsed with PBS, then blocked for 30 mins with blocking buffer. After blocking, these slides were incubated with diluted primary antibody overnight at 4 ^C (p- Smad2 dilution ratio-1:4000, p-Smad1/5/9 dilution ratio-1:4000, p-p38 dilution ratio-1:8000, in blocking buffer). On the second day, slides were rinsed with 0.3% PBST, incubated with anti-rabbit or anti-mouse HRP (1:2,000 in blocking buffer) for 2 hours at room temperature, rinsed again with 0.3% PBST, then incubated with TSA working solution (1:100 dilution) for 15 minutes at room temperature followed by a final rinse with 0.3% PBST. After the completion of TSA-based staining, proceed to standard IF staining. Immunofluorescence staining in 96-well plates: [0210] NPCs cultured in 96-well plates were stained directly in the plates to determine various NPC marker gene expression. For that, the used culture medium was first removed from each well and 50 µl 4% PFA was added to fix the samples in the plates for 10 minutes at room temperature. Fixed samples were then gently washed three times in 1X PBS (Corning, Cat. No.21-040-CV) 3 times for total 15 minutes, blocked in 100 µl blocking solution (0.1% PBST containing 3% BSA) for 30 minutes at room temperature, then followed by primary antibody staining at room temperature for 2 hours. Then, samples were gently washed two times with PBST for 10 minutes and secondary staining was conducted for one hour at room temperature. After the secondary staining, samples were gently washed three times with PBST for 15 minutes, and the PBST from the last wash was kept in the well to prevent samples from drying out. Samples were then ready for observation and recording. Note: NPCs cultured on Matrigel- coated 96-well plates can easily detach from the plate during staining, it is important to add/remove reagents gently in the process of staining. Validated primary antibodies in this study can be found in “Key Resources Table”. Imaging data quantification: [0211] For immunostaining quantification, 3-4 different fields of view were randomly selected to count the number of positively stained cell numbers and total cell numbers (as determined by DAPI signals). At least 500 cells per field of view were included. Error bars represent standard derivation between different fields of views. TUNEL assay 97 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT [0212] Samples Mini PKD2-/- organoids were stained using the Click-iT Plus TUNEL Assay kit (Invitrogen, Cat# C10618) following the manufacturer’s instruction. Briefly, Mini PKD2-/- organoids were incubated with the TdT reaction buffer for 10 min at 37°C in 1.5mL Eppendorf tube. TdT reaction buffer was then removed and replaced by TdT reaction mixture and incubated for 1 hour at 37°C. After the 1-hour incubation, TdT reaction mixture was removed and the organoids were rinsed with PBST (0.3% Triton X-100 in PBS). Next, organoids were incubated with the Click-iT Plus TUNEL reaction cocktail at 37°C for 30 min in dark, followed by PBST washes and immunofluorescent staining as detailed above RNA isolation, reverse transcription, qRT-PCR, and immunoblotting [0213] Samples were dissolved in 100 µl TRIzol (Invitrogen, Cat. No.15596018) or 100 µl DNA/RNA Shield (Zymo Research, Cat. No. R1100-50) and kept in -80 ^C freezer. RNA isolation was performed using the Direct-zol RNA MicroPrep Kit (Zymo Research, Cat. No. R2062) or Quick-RNA Microprep Kit (Zymo Research, Cat. No. R1051) according to the manufacturer’s instructions. Reverse transcription was performed using the iScript Reverse Transcription Supermix (Bio-Rad, Cat. No. 1708841) following the manufacturer’s instructions. qRT-PCR was performed using SsoAdvanced Universal SYBR® Green Supermix (Bio-Rad, Cat. No.1725274) or AzuraView GreenFast qPCR Blue Mix LR (Azura Genomics, Cat. No. AZ-2320) and carried out on an Applied Biosystems Vii 7 RT-PCR system (Thermo Scientific P/N 4453552). Validated gene-specific primers in this study can be found in Table 6. Fold changes were calculated from ΔCt using Gapdh as a housekeeping gene as previously described14. Immunoblotting experiments were performed as described previously14. FACS [0214] Cells were dissociated/prepared as described above. FACS sorting was performed on a BD FACSAria™ III Cell Sorter, operated by experienced core facility staff at USC Stem Cell’s FACS core. Sorted cells were collected in 1.5 ml Eppendorf tubes with 500 µl dissection medium on ice. QUANTIFICATION AND STATISTICAL ANALYSIS [0215] Data are presented as mean ^ SD from at least three biological replicates (n=3). Statistical significance was determined by two-tailed unpaired Student’s t tests; ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001. 98 4888-2877-9200.3
Claims
Attorney Docket No.065715-000150WOPT CLAIMS What is claimed is: 1. A composition comprising at least: a. An inhibitor of p38 MAPK; b. An inhibitor of Notch signaling; c. An inhibitor of TGF-B signaling; d. An inhibitor of BMP signaling; and e. An inhibitor of GSK3. 2. The composition of claim 1, wherein the inhibitor of p38 MAPK is selected from the group consisting of: SB203580 (Adezmapimod), BIRB 796 (Doramapimod), SB202190 (FHPI), LY2228820 (Ralimetinib dimesylate), VX-701, PH-797804, VX-745 (Neflamapimod), TAK-715, p38- αMAPK-IN-1, R1487, SB242235, TA-01, PD169316, TA-02, SD 0006, Pamapimod, BMS-582949, SB239063, GW856553X (Losmapimod), DBM 1285, and Skepinone-L. 3. The composition of any one of the preceding claims, wherein the inhibitor of p38 MAPK is SB202190. 4. The composition of claim 1, wherein the inhibitor of Notch signaling is selected from the group consisting of: DAPT, Valproic acid (VPA), LY-411575, RO4929097, Demcizumad, Navicixizumab, Brontictuzumab, YO-01027, CB-103, Tangeretin, Crenigacestat, Carvacrol, RBPJ Inhibitor-1, IMR-1, Psoralidin, Semagacestat, BMS-906024, FLI-06, Bruceine D, and Avagacestat. 5. The composition of any one of the preceding claims, wherein the inhibitor of Notch signaling is DAPT. 6. The composition of claim 1, wherein the inhibitor of TGF-B signaling is selected from the group consisting of: A83-01, A77-01, AZ 12799734, D4476, Disitertide, Galunisertib, GW 788388, IN 1130, LY 364947, R 268712, RepSox, SB 431542, SB 505124, SB 525334, SB208, and SM 16. 7. The composition of any one of the preceding claims, wherein the inhibitor of TGF-B signaling is A83-01. 8. The composition of claim 1, wherein the inhibitor of BMP signaling is selected from the group consisting of: 99 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT LDN193189, DMH-1, DMH2, Dorsomorphin dihydrochloride, K0228, M4K2163, ML347, and SB505124. 9. The composition of any one of the preceding claims, wherein the inhibitor of BMP signaling is LDN193189. 10. The composition of claim 1, wherein the inhibitor of GSK3 is selected from the group consisting of: CHIR99021, 3F8, A1070722, Alsterpaullone, AR-A 014418, AZD 2858, BIO, Bio- acetoxime, CHIR98014, Indirubin-3’-oxime, Kenpaullone, Lithium carbonate, MeBIO, SB216763, SB415286, TC-G 24, TCS 2002, TCS 21311, TDZD 8, and TWS 119. 11. The composition of any one of the preceding claims, wherein the inhibitor of GSK3 is CHIR99021. 12. The composition of any one of the preceding claims, further comprising a basal cell culture medium and supplements. 13. The composition of any one of the preceding claims, wherein the basal cell culture medium comprises DMEM/F12, L-alanyl-L-glutamine (GlutaMAX-I), MEM non-essential amino acids solution, 2-mercaptoethanol, penicillin streptocycin solution, B-27 supplement devoid of vitamin A, and insulin-transferrin-sodium selenite (ITS) liquid media supplement. 14. The composition of any one of the preceding claims, wherein the supplements comprise a fibroblast growth factor (FGF), BMP7, heparin, leukocyte inhibitors (LIF), and a ROCK inhibitor. 15. The composition of any one of the preceding claims, wherein the FGF is selected from the group consisting of: FGF1, FGF2, FGF7, FGF8, FGF9, FGF10, and FGF20. 16. The composition of any one of the preceding claims, wherein the FGF is FGF2. 17. The composition of any one of the preceding claims, wherein the ROCK inhibitor is selected from the group consisting of: Y-27632, Rasudil, Y39983, Wf-536, SLx-2119, Azabenzimidazole-aminofurazans, DE- 104, H-1152P, ROKα inhibitor, XD-4000, HMN-1152, Rhostatin, BA-210, Ki-23095, VAS-102, and Quinazoline. 18. The composition of any one of the preceding claims, wherein the ROCK inhibitor is Y-27632. 19. The composition of any one of the preceding claims, wherein the LIF is mouse LIF or human LIF. 20. The composition of any one of the preceding claims wherein the ingredients comprises or consist of the ingredients listed in Table 2. 21. The composition of any one of the preceding claims, further comprising a YAP agonist. 22. The composition of any one of the preceding claims , wherein the YAP agonist is TRULI. 100 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 23. The composition of any one of the preceding claims, wherein the ingredients comprises or consist of the ingredients in Table 4. 24. A cell culture medium, wherein the medium comprises at least: a. An inhibitor of p38 MAPK; b. An inhibitor of Notch signaling; c. An inhibitor of TGF-B signaling; d. An inhibitor of BMP signaling; e. An inhibitor of GSK3. 25. The cell culture medium of claim 24, wherein the inhibitor of p38 MAPK is selected from the group consisting of: SB203580 (Adezmapimod), BIRB 796 (Doramapimod), SB202190 (FHPI), LY2228820 (Ralimetinib dimesylate), VX-701, PH-797804, VX-745 (Neflamapimod), TAK-715, p38- αMAPK-IN-1, R1487, SB242235, TA-01, PD169316, TA-02, SD 0006, Pamapimod, BMS-582949, SB239063, GW856553X (Losmapimod), DBM 1285, and Skepinone-L. 26. The cell culture medium of any one of claims 24-25, wherein the inhibitor of p38 MAPK is SB202190. 27. The cell culture medium of claim 24, wherein the inhibitor of Notch signaling is selected from the group consisting of: DAPT, Valproic acid (VPA), LY-411575, RO4929097, Demcizumad, Navicixizumab, Brontictuzumab, YO-01027, CB-103, Tangeretin, Crenigacestat, Carvacrol, RBPJ Inhibitor-1, IMR 28. The cell culture medium of any one of claims 24-27, wherein the inhibitor of Notch signaling is DAPT. 29. The cell culture medium of claim 24, wherein the inhibitor of TGF-B signaling is selected from the group consisting of: A83-01, A77-01, AZ 12799734, D4476, Disitertide, Galunisertib, GW 788388, IN 1130, LY 364947, R 268712, RepSox, SB 431542, SB 505124, SB 525334, SB208, and SM 16. 30. The cell culture medium of any one of claims 24-29, wherein the inhibitor of TGF-B signaling is A83-01. 31. The cell culture medium of claim 24, wherein the inhibitor of BMP signaling is selected from the group consisting of: LDN193189, DMH-1, DMH2, Dorsomorphin dihydrochloride, K0228, M4K2163, ML347, and SB505124. 101 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 32. The cell culture medium of any one of claims 24-31, wherein the inhibitor of BMP signaling is LDN193189. 33. The cell culture medium of claim 24, wherein the inhibitor of GSK3 is selected from the group consisting of: CHIR99021, 3F8, A1070722, Alsterpaullone, AR-A 014418, AZD 2858, BIO, Bio- acetoxime, CHIR98014, Indirubin-3’-oxime, Kenpaullone, Lithium carbonate, MeBIO, SB216763, SB415286, TC-G 24, TCS 2002, TCS 21311, TDZD 8, and TWS 119. 34. The cell culture medium of any one of claims 24-33, wherein the inhibitor of GSK3 is CHIR99021. 35. The cell culture medium of any one of claims 24-34, further comprising a basal cell culture medium and supplements. 36. The cell culture medium of any one of claims 24-35, wherein the basal cell culture medium comprises DMEM/F12, L-alanyl-L-glutamine (Gluta- MAX-I), MEM non-essential amino acids solution, 2-mercaptoethanol, penicillin streptomycin solution, B-27 devoid of vitamin A, and insulin-transferrin-sodium selenite (ITS) solution. 37. The cell culture medium of any one of claims 24-36, wherein the supplements comprise a fibroblast growth factor (FGF), BMP7, heparin, leukocyte inhibitors (LIF), and a ROCK inhibitor. 38. The cell culture medium of any one of claims 24-37, wherein the FGF is selected from the group consisting of: FGF1, FGF2, FGF7, FGF8, FGF9, FGF10, and FGF20. 39. The cell culture medium of any one of claims 24-38, wherein the FGF is FGF2. 40. The composition of any one of claims 24-39, wherein the ROCK inhibitor is selected from the group consisting of: Y-27632, Rasudil, Y39983, Wf-536, SLx-2119, Azabenzimidazole-aminofurazans, DE- 104, H-1152P, ROKα inhibitor, XD-4000, HMN-1152, Rhostatin, BA-210, Ki-23095, VAS-102, and Quinazoline. 41. The cell culture medium of any one of claims 24-40, wherein the ROCK inhibitor is Y-27632. 42. The cell culture medium of any one of claims 24-41, wherein the ingredients comprises or consist of the ingredients in Table 2. 43. The cell culture medium of any one of claims 24-42, further comprising a YAP agonist. 44. The cell culture medium of any one of claims 24-43, wherein the YAP agonist is TRULI. 45. The cell culture medium of any one of claims 24-44, wherein the ingredients comprise or consist of the ingredients in Table 4. 46. A kit comprising the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45 102 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 47. A method of deriving, maintaining, or expanding nephron progenitor cell lines from any mouse strain, the method comprising: contacting at least one mouse NPC, mouse MM, or mouse kidney cell, with the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45. 48. The method of claim 47, wherein the cell is isolated from a mouse kidney. 49. A method of reprogramming differentiated nephron cells to the NPC state, the method comprising: contacting the cells with the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45. 50. A method of reprogramming differentiated nephron cells to the NPC state, the method comprising: contacting the cells with a composition or culture medium consisting essentially of the ingredients in Table 2 or Table 4. 51. The method of any one of claims 49-50, wherein the cell, or population thereof, is a Wnt4+ cell. 52. The method of any one of claims 49-51, wherein the cell, or population thereof, is isolated from kidneys. 53. A method of deriving, maintaining, or expanding human nephron progenitor cells, the method comprising: contacting at least one primary hNPC or one human pluripotent stem cell (hPSC)- derived induced NPC, with the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45. 54. The method of claim 53, wherein the cell is isolated from human fetal kidneys. 55. A method of deriving, maintaining, or expanding primary mammalian nephron progenitor cells, the method comprising: contacting at least one mammalian NPC, with the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45. 56. The method of claim 55, wherein the mammalian NPC is derived from mice, rats, rabbits, dogs, cats, pigs, or non-human primates. 57. A method of generating nephron organoids, comprising: contacting a population of iNPCs or hNPCs for a first period of time with the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45; and for a second period of time with a composition comprising CHIR99021; and for a third period of time with a composition comprising FGF9 and heparin; and for a fourth period of time with a culture medium without additional factors. 58. The method of claim 57, wherein the contacting a population of iNPCs or hNPCs is in a sequential order: the first period of time of about 1 day in the presence of a composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45, then the second period of time of about 103 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 1 hour in the presence of CHIR99021 and the absence of a composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45, then the third period of time of about 4 days in the presence of FGF9 and heparin and the absence of CHIR99021, then the fourth period of time of about 9 days in the presence of a culture medium with no additional factors and the absence of FGF9 and heparin. 59. The method of claims 57 or 58, wherein the organoids develop distal convoluted tubule structures. 60. The method of claim 59, wherein the organoids are positive in one or more markers for distal tubule segments, wherein the markers for distal tubule segments comprise SLC12A3. 61. A method of screening for a candidate drug for treating a kidney disease, reducing the incidence or severity of a kidney disease, and/or for promoting kidney regeneration, comprising: contacting a molecule of interest with an NPC generated by the method of any one of claims 46-56, or an organoid generated by the method of any one of claims 57-60; and measuring a level of a biomarker transcribed or expressed in the NPC before contact of the molecule of interest, and measuring a level of the biomarker transcribed or expressed in the NPC in the presence of the molecule of interest. 62. A method of generating a scalable organoid model of polycystic kidney disease (PKD), comprising: knocking out the PKD1 or PKD2 gene in a cell; and contacting that cell with the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45 for a first period of time to form mini aggregates; and transferring the mini aggregates into a KR5-CF medium and shaking for a second period of time; and contacting the mini aggregates with KR5 medium for a third period of time, wherein KR5 medium comprises GlutaMax-1, MEM NEAA, 2-Mercaptoethanol, Pen Strep, and Serum Replacement, and the KR5-CF medium comprises the ingredients of KR5 and CHIR99021 and FGF7. 63. The method of claim 62, wherein the contacting PKD1 or PKD2 knockout cell is in a sequential order: the first period of time of about 1 day in the presence of a composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45, then the second period of time of about 2-3 days in the presence of KR5-CF medium, then the third period of time of about 4-8 days in the presence of KR5 medium. 64. The method of claim 62 or 63, wherein the cell is a hNPC, iNPC, or mNPC. 65. The method of claim 62 or 63, wherein PKD1 or PKD2 is knocked out using CRISPR/Cas9 based genome editing. 104 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 66. A method of treating PKD, comprising administering a BMI-1 inhibitor. 67. The method of claim 66, wherein the BMI-1 inhibitor is PTC-209. 68. The method of claim 57 or 58, wherein the organoids develop podocyte structures, proximal tubule structures, and distal tubule structures. 69. The method of claim 59, wherein the organoids are positive for one or more markers of mature podocytes organoids, wherein the markers for distal tubule segments comprise NPHS1, PODXL, PLA2R1, COL4A3, or COL4A4. 70. A method of generating nephron organoids, comprising: contacting a population of iNPCs or hNPCs for a first period of time with the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45; and for a second period of time with a composition comprising CHIR99021; and for a third period of time with a composition comprising FGF9 and heparin; and for a fourth period of time with a culture medium with B27 and A83-01. 71. The method of claim 70, wherein the contacting a population of iNPCs or hNPCs is in a sequential order: the first period of time of about 1 day in the presence of a composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45, then the second period of time of about 1 hour in the presence of CHIR99021 and the absence of a composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45, then the third period of time of about 4 days in the presence of FGF9 and heparin and the absence of CHIR99021, then the fourth period of time of about 9 days in the presence of a culture medium with B27 and A83-01 and the absence of FGF9 and heparin. 72. The method of claims 70 or 71, wherein the organoids develop podocyte structures, proximal tubule structures, and distal tubule structures. 73. The method of claim72, wherein the organoids are positive for one or more markers of mature podocytes. 74. The method of claim 73, wherein the one or more markers of mature podocytes comprise NPHS1, PODXL, PLA2R1, COL4A3, or COL4A4. 75. A method of reprogramming differentiated nephron cells to the NPC state, the method comprising: contacting the cells with the composition of any one of claims 1-23 or the cell culture medium of any one of claims 24-45. 76. The method of any one of claims 49-50, wherein the cell, or population thereof, is a podocyte. 77. The method of any one of claims 75, wherein the cell, or population thereof, is isolated from kidneys. 105 4888-2877-9200.3
Attorney Docket No.065715-000150WOPT 78. A nephron organoid generated by the methods of any one of claims 70-74. 106 4888-2877-9200.3
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363468963P | 2023-05-25 | 2023-05-25 | |
| US202463563055P | 2024-03-08 | 2024-03-08 | |
| PCT/US2024/031129 WO2024243567A1 (en) | 2023-05-25 | 2024-05-24 | Novel culture conditions for clonal expansion of nephron progenitor cells, generation of nephron organoids, and rapid and scalable modeling of polycystic kidney disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4720261A1 true EP4720261A1 (en) | 2026-04-08 |
Family
ID=93589877
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24812019.8A Pending EP4720261A1 (en) | 2023-05-25 | 2024-05-24 | Novel culture conditions for clonal expansion of nephron progenitor cells, generation of nephron organoids, and rapid and scalable modeling of polycystic kidney disease |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP4720261A1 (en) |
| CN (1) | CN121969740A (en) |
| WO (1) | WO2024243567A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN120721467B (en) * | 2025-08-29 | 2026-04-03 | 华中科技大学同济医学院附属协和医院 | A multiplex immunofluorescence staining method and kit for localizing and detecting the level of nascent RNA synthesis. |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201111244D0 (en) * | 2011-06-30 | 2011-08-17 | Konink Nl Akademie Van Wetenschappen Knaw | Culture media for stem cells |
| AU2014280843B2 (en) * | 2013-06-14 | 2017-04-20 | The University Of Queensland | Renal progenitor cells |
-
2024
- 2024-05-24 EP EP24812019.8A patent/EP4720261A1/en active Pending
- 2024-05-24 WO PCT/US2024/031129 patent/WO2024243567A1/en not_active Ceased
- 2024-05-24 CN CN202480049279.4A patent/CN121969740A/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| CN121969740A (en) | 2026-05-01 |
| WO2024243567A1 (en) | 2024-11-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Huang et al. | Long-term expandable mouse and human-induced nephron progenitor cells enable kidney organoid maturation and modeling of plasticity and disease | |
| Shan et al. | PRC2 specifies ectoderm lineages and maintains pluripotency in primed but not naïve ESCs | |
| Genuth et al. | A stem cell roadmap of ribosome heterogeneity reveals a function for RPL10A in mesoderm production | |
| Ito et al. | Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification | |
| Quaranta et al. | Revised roles of ISL1 in a hES cell-based model of human heart chamber specification | |
| Zhou et al. | Linc-RNA-RoR acts as a “sponge” against mediation of the differentiation of endometrial cancer stem cells by microRNA-145 | |
| US11377636B2 (en) | Endogenous retrovirus transcription as a marker for primate naive pluripotent stem cells | |
| Román-Trufero et al. | Maintenance of undifferentiated state and self-renewal of embryonic neural stem cells by Polycomb protein Ring1B | |
| Jaber et al. | Comparative parallel multi-omics analysis during the induction of pluripotent and trophectoderm states | |
| WO2024050546A1 (en) | Methods and culture media for generating embryos in vitro from pluripotent stem cells | |
| Li et al. | Single-cell transcriptome analyses reveal critical regulators of spermatogonial stem cell fate transitions | |
| van der Veer et al. | Dual functions of TET1 in germ layer lineage bifurcation distinguished by genomic context and dependence on 5-methylcytosine oxidation | |
| Carvelli et al. | A multifunctional locus controls motor neuron differentiation through short and long noncoding RNAs | |
| WO2024243567A1 (en) | Novel culture conditions for clonal expansion of nephron progenitor cells, generation of nephron organoids, and rapid and scalable modeling of polycystic kidney disease | |
| Aizawa et al. | Epigenetic regulation limits competence of pluripotent stem cell‐derived oocytes | |
| Bisson et al. | GATA6 regulates WNT and BMP programs to pattern precardiac mesoderm during the earliest stages of human cardiogenesis | |
| Cao et al. | Histone arginine methyltransferase CARM1-mediated H3R26me2 is essential for morula-to-blastocyst transition in pigs | |
| Xu et al. | Genome-wide CRISPR screen identifies Menin and SUZ12 as regulators of human developmental timing | |
| Palma et al. | Chromatin activity of IκBα mediates the exit from naïve pluripotency | |
| Militi et al. | SMAD2/3-SMYD2 and developmental transcription factors cooperate with cell-cycle inhibitors to guide tissue formation | |
| Dehghanian et al. | ZFP982 confers mouse embryonic stem cell characteristics by regulating expression of Nanog, Zfp42, and Dppa3 | |
| Khelifi et al. | Determining epigenetic memory in kidney proximal tubule cell derived induced pluripotent stem cells using a quadruple transgenic reprogrammable mouse | |
| EP3500276A1 (en) | Methods of differentiating stem cells into endoderm | |
| Sutcliffe et al. | Epigenetic restoration of differentiation competency via reversal of epiblast regionalisation | |
| Wood | The epigenetic network mediated by Ehmt1 and its role in neurodevelopment disorders |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20251218 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |