EP4719493A2 - Cpt1 gene therapy and methods for treating or preventing cardiovascular diseases - Google Patents

Cpt1 gene therapy and methods for treating or preventing cardiovascular diseases

Info

Publication number
EP4719493A2
EP4719493A2 EP24816514.4A EP24816514A EP4719493A2 EP 4719493 A2 EP4719493 A2 EP 4719493A2 EP 24816514 A EP24816514 A EP 24816514A EP 4719493 A2 EP4719493 A2 EP 4719493A2
Authority
EP
European Patent Office
Prior art keywords
cpt1a
aav9
tac
expression
ctnt
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24816514.4A
Other languages
German (de)
French (fr)
Inventor
E. Douglas LEWANDOWSKI
Andrew CARLEY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ohio State Innovation Foundation
Original Assignee
Ohio State Innovation Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ohio State Innovation Foundation filed Critical Ohio State Innovation Foundation
Publication of EP4719493A2 publication Critical patent/EP4719493A2/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y203/00Acyltransferases (2.3)
    • C12Y203/01Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • C12Y203/01021Carnitine O-palmitoyltransferase (2.3.1.21)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present disclosure relates to CPT1 gene therapies and methods of use thereof.

Description

Docket No.103361-521WO1 CPT1 GENE THERAPY AND METHODS FOR TREATING OR PREVENTING CARDIOVASCULAR DISEASES CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 63/505,085, filed May 31, 2023, and U.S. Provisional Patent Application No. 63/520,161, filed August 17, 2023, which are incorporated by reference herein in their entireties. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with Government Support under Grant Nos. HL132525 and HL160646 awarded by the National Institutes of Health. The Government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING The sequence listing submitted on May 31, 2024, as an .XML file entitled “103361- 521WO1_ST26.xml” created on May 29, 2024, and having a file size of 41,440 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). FIELD The present disclosure relates to CPT1 gene therapies and methods of use thereof. BACKGROUND Development of cardiovascular dysfunction in mammals is a common feature that normally precedes most forms of heart failure. This development is contemplated in the art to be an adaptive process that involves molecular changes, including altered expression of several genes encoding proteins essential for contraction, relaxation, and metabolic functions, in the myocardium. The adaptation is associated with a reprogramming of cells in the cardiovascular system to survive under stress and includes changes in enzymes that regulate metabolism and gene expression programs in the heart with beneficial downstream actions of cardioprotection at the onset of stress leading to heart failure. Current cardiovascular treatment strategies are often ineffective leading to continued decline in cardiovascular function and emergence of heart failure. Given the limitations of current cardiovascular treatments, there is need to address the aforementioned problems mentioned above by developing methods of treatment that can promote Docket No.103361-521WO1 cardiovascular functions during stress and dysfunction. The methods disclosed herein address these and other needs. The compositions and methods disclosed herein address these needs and more. SUMMARY The present disclosure provides CPT1 gene therapies and methods of treating, preventing, reversing, and/or ameliorating cardiovascular disease using the CPT1 gene therapies. In one aspect, disclosed herein is a method of treating or preventing a cardiovascular disease in a subject, the method comprising administering a pharmaceutically effective amount of a composition comprising a nucleic acid encoding a carnitine palmitoyltransferase 1 (CPT1) protein (such as, for example CPT1a) and pharmaceutically acceptable carrier, wherein the composition increases expression of the CPT1 protein (such as, for example CPT1a) in the subject relative to an untreated subject. In some embodiments, the nucleic acid delivery vehicle comprises a viral vector selected from an adeno-associated viral (AAV) vector, an adenoviral (AV) vector, a lentiviral vector, and a retroviral vector. In some embodiments, the AAV vector comprises an AAV9 serotype. In some embodiments, the composition further comprises a nucleic acid encoding a cardiac-specific promoter. In some embodiments, the cardiac-specific promoter comprises cardiac troponin T (cTnT). In some embodiments, the pharmaceutically acceptable carrier comprises a nucleic acid delivery vehicle, excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or a combination thereof. In some embodiments, the composition is administered intravenously. In some embodiments, the cardiovascular disease comprises myocardial infarction (heart attack), heart failure, coronary heart disease heart valve complications, high blood pressure, peripheral artery disease, aortic disease, pericardial disease congenital heart disease. In some embodiments, the method prevents or reverses pathological heart symptoms or functions selected from cardiac hypertrophy, cardiac fibrosis, cell death, reduced cardiac output, reduced ejection fraction, enlarged heart chambers, narrowed heart chambers. In some embodiments, the subject is a human or a rodent. BRIEF DESCRIPTION OF FIGURES The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below. Docket No.103361-521WO1 FIGS. 1A, 1B, 1C, 1D, 1E, 1F, 1G, 1H, 1I, 1J, 1K, and 1L show the CPT1 protein and mRNA expression measured in human failing hearts from both males and females. CPT1a and CPT1b protein and mRNA (Cpt1a, Cpt1b) expression measured in male (Figures 1A-1F) and female (Figures 1G-1L) patients with non-ischemic cardiomyopathy (NICM) vs. nonfailing donor hearts (NF) from two different patient cohorts (University of Pennsylvania (UPenn), n=4 NF male and female, n=4 NICM male and female; and University of Utah (Utah), for males n=5 NF and NICM, for females n=4 NF and n=5 NICM). *p<0.05, unpaired 2-tailed t-test. FIGS. 2A, 2B, 2C, 2D, 2E, 2F, 2G, 2H, 2I, and 2J show the loss of CPT1a expression sensitizes the heart to pathological stress while overexpressing CPT1a attenuates the functional decline. Figure 2A shows the experimental protocols outlining the surgical interventions in csCPT1a ko mice and C57Bl/6 mice injected with AAV9.cTnT.Cpt1a, PBS, or empty virus (AAV9.Emp). Western blots (Figure 2B) and mean data showing CPT1a and CPT1b protein content in csCPT1a ko hearts vs. f/f 8 wks after TAC or sham surgery vs. calsequestrin (CASQ) (n=4 f/f sham, n=3 csCPT1a ko sham, n=4 f/f TAC, n=3 csCPT1a ko TAC). Figure 2C shows the left ventricular (LV) mass, and Figure 2D shows the ejection fraction, 8 wks after TAC or sham surgery (n=4 f/f sham, n=4 csCPT1a ko sham, n=10 f/f TAC, n=6 csCPT1a ko TAC). Western blots (Figure 2E) and mean data (Figure 2F) showing CPT1a and CPT1b protein content in hearts 8 wks after TAC or sham surgery. CPT1a overexpression (AAV9.cTnT.Cpt1a) attenuated the reduction in ejection fraction (Figure 2G) and fractional shortening (Figure 2H) compared to PBS controls (n=6 PBS sham, AAV9.cTnT.Cpt1a sham, PBS TAC; n=13 AAV9.cTnT.Cpt1a TAC). Figure 2I shows the increase in left ventricular (LV) mass at 8 wks TAC was unaffected by AAV9.cTnT.Cpt1a vs. PBS (n=6 PBS sham, AAV9.cTnT.Cpt1a sham, PBS TAC; n=13 AAV9.cTnT.Cpt1a TAC). Figure 2J shows the AAV9.cTnT.Cpt1a delivery 10 d before TAC or sham surgery similarly attenuated the decline in systolic function when compared to empty virus treated mice (AAV9.Emp) (n=7 AAV9.Emp sham, n=5 AAV9.cTnT.Cpt1a sham, n=7 AAV9.Emp TAC, n=8 AAV9.cTnT.Cpt1a TAC). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, via 2-way ANOVA with Tukey’s multiple comparisons test; @p<0.05 vs. AAV9.cTnT.Cpt1a sham 4 wks, #p<0.05 vs AAV9.Emp sham 4 wks, @@p<0.05 vs. AAV9.cTnT.Cpt1a sham 8 wks, ##p<0.05 vs. AAV9.Emp sham and AAV9.cTnT.Cpt1a TAC 8 wks, by mixed-effects ANOVA with Tukey's multiple comparisons test. FIGS.3A, 3B, 3C, 3D, 3E, 3F, and 3G show the Relative long chain fatty acid oxidation measured in CPT1a knockout mice (csCPT1a ko) and mice overexpressing CPT1a (AAV9.cTnT.Cpt1a). Figure 3A shows the representative in vitro 13C NMR signals from the 4- carbon of glutamate of f/f TAC vs. csCPT1a KO TAC hearts showing the corresponding Docket No.103361-521WO1 differences in multiplet structure (singlet, glutamate labeled at the 4 carbon; doublet, glutamate labeled at the 4 carbon and the 2 or 3 carbon) of the resonance signals used to calculate the contribution of acetyl CoA derived from β-oxidation (β-OX) of long chain fatty acid (LCFA) to the tricarboxylic acid cycle (TCA) and (Figure 3B) fractional contribution of 13C-labeled palmitate to acetyl CoA production hearts at 8 wks after TAC or Sham surgery (n=4 f/f sham, n=4 csCPT1a ko sham, n=6 f/f TAC, n=7 csCPT1a ko TAC). Figure 3C shows the heart weight to tibia length (HW:TL) measured in sham and TAC-operated f/f and csCPT1a ko mice at the end of perfusion. Figure 3D shows the reduced fractional contribution of 13C palmitate to acetyl CoA production 10 d after AAV9.cTnT.Cpt1a delivery (n=5) vs. PBS (n=5) and cardiac ANP mRNA (Nppa) expression was increased 10 d after AAV9.cTnT.Cpt1a delivery (n=5) vs PBS (n=5). Figure 3E shows the representative NMR signals from the 4-carbon of glutamate from AAV9.cTnT.Cpt1a vs. PBS control hearts used to calculate the contribution of acetyl CoA derived from β-oxidation (β-OX) of long chain fatty acid (LCFA) to the tricarboxylic acid cycle (TCA) and (Figure 3F) contribution of 13C palmitate to acetyl CoA production was reduced with TAC vs Sham in PBS hearts but not in in AAV9.cTnT.Cpt1a hearts (n=6 PBS sham, n=4 AAV9.cTnT.Cpt1a sham, n=7 PBS TAC, n=6 AAV9.cTnT.Cpt1a TAC). Figure 3G shows the heart weight to tibia length (HW:TL) measured in sham and TAC-operated PBS and AAV9.cTnT.Cpt1a mice at the end of perfusion. For Figures 3A and 3C, *p<0.05, by 2-way ANOVA with Tukey's multiple comparisons test. For B, *p<0.05, unpaired 2-tailed t-test. FIGS. 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I show the miRNA370 regulates CPT1a expression in heart failure. Figure 4A shows the miR370 expression in mice 8 wks after transverse aortic constriction (TAC) or sham surgery (n=4). Figure 4B shows the miR370 expression in non- failing (NF) heart tissue and heart tissue from patients with non-ischemic cardiomyopathy (NICM) collected at the University of Pennsylvania (n=4 male and n=4 female combined for both NF and NICM). Figure 4C shows the miR370 expression in non-failing (NF) heart tissue and heart tissue from patients with non-ischemic cardiomyopathy (NICM) collected at the University of Utah (n=5 male and n=4 female NF, n=5 male and female NICM). Figure 4D shows the Cpt1a mRNA expression in the heart following i.v. AAV9.cTnT.miR370 measured at the indicated time points (n=4; one-way ANOVA with Tukey's multiple comparisons test). Figure 4E shows the Cpt1b mRNA expression in the heart following i.v. AAV9.cTnT.miR370 measured at the indicated time points (n=4). Figure 4F shows the depiction of experimental protocol for miR370 delivery followed by TAC. Figure 4G shows the Cpt1a mRNA expression 8 wks after TAC or sham surgery in mice previously injected with PBS or AAV9.cTnT.miR370 (n=5 PBS sham, n=4 AAV9.cTnT.miR370 sham, n=4 PBS TAC, n=4 AAV9.cTnT.miR370 TAC). Ejection fraction Docket No.103361-521WO1 (Figure 4H) (n=7 PBS sham, n=7 AAV9.cTnT.miR370 sham, n=11 PBS TAC, n=12 miR370 TAC) and fractional contribution (n=5 PBS sham, n=5 AAV9.cTnT.miR370 sham, n=7 PBS TAC, n=5 AAV9.cTnT.miR370 TAC) of 13C palmitate to acetyl CoA production (Figure 4I) in PBS or AAV9.cTnT.miR370 mice 8 wks after TAC or sham surgery. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001; via one-way ANOVA with Tukey's multiple comparisons test (Figures 4B & 4C), one-way ANOVA with Tukey’s multiple comparison test (Figures 4D-4F), 2- way ANOVA with Tukey's multiple comparisons test (Figures 4G-4I). FIGS.5A and 5B show the ANP mRNA (Nppa) Expression in Response to TAC in cardiac specific CPT1a knockout mice (csCPT1a ko) and mice overexpressing CPT1a (AAV9.cTnT.Cpt1a). Figure 5A shows the cardiac Nppa expression 10 d after injection of AAV9.cTnT.Cpt1a or AAV9.cTnT.miR370 (n=6 PBS, n=4 AAV9.cTnT.Cpt1a, n=2 AAV9.cTnT.miR370). Figure 5B shows the cardiac Nppa and Myh7 expression measured at the indicated time points after TAC or sham in AAV9.cTnT.Cpt1a mice (0.016 clip) and csCPT1a ko mice (0.018 clip) (8 wks AAV9.cTnT.Cpt1a, n=4 PBS sham, n=3 PBS TAC, n=3 AAV9.cTnT.Cpt1a sham, n=4 AAV9.cTnT.Cpt1a TAC; 8 wks csCPT1a ko, n=5; 5 d AAV9.cTnT.Cpt1a, n=5 PBS sham, all others n=4; 5 d csCPT1a ko, n=3). *p<0.05, **p<0.01, ***p<0.001, unpaired 2-tailed t-test (Figure 5A), 2-way ANOVA with Tukey's multiple comparisons test (Figure 5B). FIGS. 6A, 6B, 6C, 6D, 6E, 6F, 6G, 6H, and 6I show the increasing CPT1a expression exhibits therapeutic potential. Figure 6A shows that the AAV9.cTnT.Cpt1a or AAV9.Emp was administered 4 wks after TAC surgery in C57Bl/6 mice. Figure 6B shows the decline in ejection fraction and (Figure 6C) fractional shortening was partially corrected 2 and 4 wks after AAV9.cTnT.Cpt1a administration (n=3 Sham AAV9.Emp, n=4 sham AAV9.cTnT.Cpt1a, n=5 TAC AAV9.Emp, n=5 TAC AAV9.cTnT.Cpt1a). Figure 6D shows the LV mass measured via echocardiography 8 wks post-TAC in C57Bl/6 mice described in Figure 6A. CPT1a expression (Figure 6E), (Figure 6F) ANP mRNA (Nppa), and (Figure 6G) β myosin heavy chain mRNA (Myh7) measured at the end of the protocol described in Figure 6A. Figure 6H shows the treatment of csCPT1a ko mice post-TAC with AAV9.cTnT.Cpt1a or AAV9.Emp, 1 wk after TAC surgery. Figure 6I shows the ejection fraction measured at the end of the treatment protocol described in Figure 6H (n=5 f/f TAC, n=4 csCPT1a ko+AAV9.cTnT.Cpt1a TAC, n=3 csCPT1a ko+AAV9.Emp TAC). #p<0.05 vs Sham AAV9.Emp at 4 wks, ##p<0.05 vs. Sham AAV9.Emp and TAC AAV9.cTnT.Cpt1a at 6 wks, ###p<0.05 vs. Sham AAV9.Emp and TAC AAV9.cTnT.Cpt1a at 6 wks, @ p<0.05 vs Sham AAV9.cTnT.Cpt1a at 4 wks, @@p<0.05 vs Sham AAV9.cTnT.Cpt1a at 6 wks, @@@p<0.05 vs Sham AAV9.cTnT.Cpt1a at 8 wks; by Docket No.103361-521WO1 mixed-effects ANOVA with Tukey's multiple comparisons test (Figures 6B-6C). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001; by 2-way ANOVA with Tukey's multiple comparisons test (Figures 6D-6H). FIGS.7A, 7B, 7C, 7D, 7E, and 7F show the CPT1a expression changes lead to profound differences in overall gene expression. Figure 7A shows the diagram showing the number of genes altered by cardiac specific CPT1a knockout (csCPT1a ko, n=4) or cardiac specific CPT1a overexpression in sham hearts (AAV9.cTnT.Cpt1a, n=3 PBS sham, n=4 AAV9.cTnT.Cpt1a sham) and heatmap of changes in gene expression that occurred in the 82 overlapping genes that were significantly altered by both the loss of CPT1a and AAV9.cTnT.Cpt1a. Figure 7B shows the mean change in gene expression (log2FC) for the 82 overlapping genes altered in Figure 7A. Figure 7C shows the pathway enrichment for the 82 overlapping genes identified in Figure 7B. The number of genes enriched in each pathway is indicated and related pathways were grouped together. Figure 7D shows the diagram of genes altered by AAV9.cTnT.Cpt1a in either sham or TAC hearts (8 wks post-TAC) and heatmap for the 133 overlapping genes for which the expression was changed by CPT1a overexpression vs. both PBS sham and PBS TAC. Figure 7E shows the mean change in gene expression (log2FC) for those 133 overlapping genes altered in Figure 7C. Figure 7F shows the summary of the changes in gene expression and corresponding changes in LCFA contribution to oxidative metabolism (FAO) revealing independent responses to altered CPT1a expression for the comparisons indicated. ****p<0.0001; by unpaired 2-tailed t-test. FIG. 8 shows the model depicting the relationship between CPT1a expression, contribution of LCFA to oxidative metabolism (FAO), gene expression and contractile function in normal sham hearts and failing hearts following TAC. Altering CPT1a expression does not induce a consistent change FAO, however the induction of gene expression is inversely related to the expression of CPT1a, as is the change in contractile function after the exposure to the pathological stress of TAC. FIGS. 9A and 9B show the vector constructs for AAV9.cTnT.Cpt1a (Figure 9A) and AAV9.cTnT.miR370 vector (Figure 9B). FIGS.10A and 10B show the CPT1a protein expression (Figure 10A) in adult f/f mice and csCPT1a ko mice 1 wk and 14 wks. after birth. Figure 10B shows the survival curve for csCPT1a ko mice and f/f control mice following transverse aortic constriction (TAC) (0.016 clip) or sham surgery. The pearson coefficient for csCPT1a ko TAC survival was r=-0.8118, p=0.05. FIGS.11A, 11B, 11C, and 11D show the AAV9.cTnT.Cpt1a gene delivery led to cardiac specific increase in CPT1a expression and a decrease in long chain fatty acid oxidation. Western Docket No.103361-521WO1 blot (Figure 11A) and mean data (Figure 11B) showing CPT1a protein expression in hearts of mice 10 d after AAV9.cTnT.Cpt1a i.v. (n=5) vs. PBS (n=4) normalized to calsequestrin (CASQ). Western blot (Figure 11C) and mean data (Figure 11D) showing CPT1a protein content in liver following AAV9.cTnT.Cpt1a (n=5) or PBS (n=4) normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). *p<0.05, **p<0.01, unpaired 2-tailed t-test. FIG.12 shows the rate pressure produce and contractility (+dp/dt and –dp/dt) measured in floxed (f/f) and cardiac specific CPT1a knockout (csCPT1a ko) mice 8 wks after transverse aortic constriction (TAC) or sham surgery (Sham). *p<0.05, **p<0.01; via 2-way ANOVA with Tukey's multiple comparisons test (n=4 f/f sham, n=4 csCPT1a ko sham, n=5 f/f TAC, n=7 csCPT1a ko TAC). FIG.13 shows the rate pressure produce and contractility (+dp/dt and –dp/dt) measured in vehicle treated (PBS) and AAV9.cTnT.Cpt1a treated mice 8 wks after transverse aortic constriction (TAC) or sham surgery. **p<0.01, ***p<0.001, ***p<0.0001; via 2-way ANOVA with Tukey's multiple comparisons test (n=12 PBS sham, n=5 AAV9.cTnT.Cpt1a sham, n=11 PBS TAC, n=6 AAV9.cTnT.Cpt1a TAC). #p<0.05 via two-tailed t-test. FIG. 14 shows the cardiac specific miR370 expression after AAV9.cTnT.miR370 gene delivery. MiR370 measured in heart, liver and skeletal muscle in PBS injected mice and in mice 4 and 10 days after AAV9.cTnT.miR370 delivery. FIG. 15 shows the cardiac ANP gene (Nppa) expression was increased 10 d after AAV9.cTnT.Cpt1a delivery (n=4) vs AAV9.Emp (n=5). *p<0.05, unpaired 2-tailed t-test. FIGS. 16A and 16B show the ANP gene (Nppa) expression (Figure 16A) and β-myosin heavy chain gene (Myh7) expression (Figure 16B) in the hearts of mice sacrificed 4 wks after after TAC or sham surgery in mice previously injected with PBS or AAV9.cTnT.Cpt1a (n=4 PBS sham, n=5 AAV9.cTnT.Cpt1a sham, n=4 PBS TAC, n=5 AAV9.cTnT.Cpt1a TAC). **p<0.01, ***p<0.001; via 2-way ANOVA with Tukey's multiple comparisons test. FIG.17 shows the phosphor-histone H3 (PHH3+ve) cardiomyocytes. C57Bl/6 mice were injected with AAV9 containing empty virus (AAV9.Emp) or AAV9.cTnT.Cpt1a and 10 d after injection hearts were collected and processed for immunostaining of PHH3+ve cardiomyocytes (CM). PHH3+ve cardiomyocyte staining was only counted if the signal was confirmed by DAPI to be localized to the nucleus. FIG.18 shows the change in gene expression patterns induced in sham csCPT1 ko mice and sham AAV9.cTnT.Cpt1a mice vs. indicated control mice. The number of genes which underwent a significant increase or decrease in expression in sham hearts following either loss of Docket No.103361-521WO1 CPT1a (ff sham (n=4) vs. csCPT1 ko sham (n=4)) or CPT1a overexpression (PBS sham (n=3) vs AAV9.cTnT.Cpt1a sham (n=4)) are indicated. FIGS.19A, 19B, and 19C show collagen and transforming growth factor β (Tgfb) mRNA expression. Figure 19A shows the collagen type I alpha 1 chain mRNA (Col1a1) and collagen type III alpha 1 chain mRNA (Col3a1) expression 8 wks after TAC or sham surgery in TAC or sham surgery in PBS, AAV9.cTnT.Cpt1a, or AAV9.cTnT.miR370 mice (n=3 PBS sham, n=4 AAV9.cTnT.Cpt1a sham, n=4 AAV9.cTnT.miR370 sham, n=3 PBS TAC, n=4 AAV9.cTnT.Cpt1a TAC, n=4 AAV9.cTnT.miR370 TAC). Figure 19B shows the Col1a1 and Col3a1 expression 8 wks after TAC or sham surgery in f/f or csCPT1a ko mice (n=5 f/f sham, n=4 csCPT1a ko sham, n=6 f/f TAC, n=4 csCPT1a ko TAC) (Figure 19C) Collagen type I alpha 1 chain mRNA (Col1a1) expression 8 wks after TAC or sham surgery in f/f or csCPT1a ko mice (n=5 f/f sham, n=4 csCPT1a ko sham, n=6 PBS TAC, n=4 csCPT1a ko TAC). Figure 19C shows the Col1a1, Col3a1, and Tgfb mRNA expression measured in mice treated with AAV9.cTnT.Cpt1a or AAV9.Emp 4 wks after TAC or sham surgery. Hearts were harvested 4 wks after treatment (n=3 AAV sham AAV9.Emp, n=4 sham AA9.Cpt1a, n=5 TAC AAV9.Emp, n=5 TAC AAV9.cTnT.Cpt1a. *p<0.05, **p<0.01; 2-way ANOVA with Tukey's multiple comparisons test. DETAILED DESCRIPTION The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof. Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Docket No.103361-521WO1 Terminology Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a”, “an”, “the”, include plural referents unless the context clearly dictates otherwise. The following definitions are provided for the full understanding of terms used in this specification. The terms "about" and "approximately" are defined as being “close to” as understood by one of ordinary skill in the art. In one non-limiting embodiment the terms are defined to be within 10%. In another non-limiting embodiment, the terms are defined to be within 5%. In still another non-limiting embodiment, the terms are defined to be within 1%. As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient. “Composition” refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, a vector, polynucleotide, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the term “composition” is used, then, or when a particular composition is specifically identified, it is to be understood that the term includes the composition per se as well as pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc. An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average Docket No.103361-521WO1 increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase so long as the increase is statistically significant. A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant. By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic (e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control. By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed. The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician. The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, Docket No.103361-521WO1 pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of'' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of'' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and/or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure. As used herein, “enhance”, “enhanced”, “enhancement”, “enhancing”, and any grammatical variations thereof as used herein, refers to an act of intensifying, increasing, or further improving the quality, value, or extent of a biological function, composition, compound, cell, or tissue. “Expression” as used herein refers to the process by which information from a gene is used in the synthesis of a functional gene product that enables it to produce a peptide/protein end product, and ultimately affect a phenotype, as the final effect. A “delivery vehicle” refers to any vehicle that carries a polynucleotide or nucleic acid sequence into a cell for the expression of the polynucleotide or nucleic acid sequence in the cell. The vector may be, for example, a plasmid, a virus, a phage particle, or a nanoparticle. Once introduced into a suitable host, the vector may replicate and function independently of the host genome, or may in some instances, integrate into the genome itself. In some embodiments, the vector is a DNA construct containing a DNA sequence which is operably linked to a suitable control sequence capable of affecting the expression of the DNA in a suitable host cell. Such control sequences can include a promoter to effect transcription, an optional operator sequence to Docket No.103361-521WO1 control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences which control the termination of transcription and translation. In some embodiments, the expression vector comprises a plasmid or a virus or viral vector. A plasmid or a viral vector can be capable of extrachromosomal replication or, optionally, can integrate into the host genome. As used herein, the term "integrated" used in reference to an expression vector (e.g., a viral vector) means the expression vector, or a portion thereof, is incorporated (physically inserted or ligated) into the chromosomal DNA of a host cell. As used herein, a “viral vector” refers to a virus-like particle containing genetic material which can be introduced into a eukaryotic cell without causing substantial pathogenic effects to the eukaryotic cell. A wide range of viruses or viral vectors can be used for transduction but should be compatible with the cell type the virus or viral vector are transduced into (e.g., low toxicity, capability to enter cells). Suitable viruses and viral vectors include adenovirus, lentivirus, retrovirus, among others. As used herein a “viral vector” refers to a tool used in molecular biology to deliver genetic material (including DNA, RNA, and any other nucleic acid variations thereof) into a cell. This process is performed either inside a living organism or in cell culture. The viral genome is engineered to incorporate a desired gene or gene product, and following transduction, or transfer, of the virus into the host, said gene or gene product is expressed within the host. An “adeno-associated virus” or an “AAV” as used herein refers to a small virus belonging to the genus Dependoparvovirus which are replicative defective, non-enveloped viruses with linear single-stranded DNA. These virus are commonly used for creating viral vectors for gene therapy, wherein said viruses can infect dividing and quiescent cells and persist in an extrachromosomal state without integrating into the host genome. AAVs can be engineered to express desired genes or gene products such as mRNA, shRNA, or miRNAs to overexpress or silence a target gene. The term “administer,” “administering”, or derivatives thereof refer to delivering a composition, substance, inhibitor, or medication to a subject or object by one or more the following routes: oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation or via an implanted reservoir. The term “parenteral” includes subcutaneous, intravenous, intramuscular, intra- articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injections or infusion techniques. A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular polypeptide or protein after being transcribed and translated. Any Docket No.103361-521WO1 of the polynucleotides sequences described herein may be used to identify larger fragments or full-length coding sequences of the gene with which they are associated. A "gene product" refers to the amino acid (e.g., peptide or polypeptide) generated when a gene is transcribed and translated. The terms “treat,” “treating,” and grammatical variations thereof as used herein, include partially or completely delaying, alleviating, mitigating, or reducing the intensity of one or more attendant symptoms of a disorder or condition and/or alleviating, mitigating, or impeding one or more causes of a disorder or condition. Treatments according to the disclosure may be applied preventively, prophylactically, palliatively, or remedially. Treatments are administered to a subject prior to onset (e.g., before obvious signs of cardiovascular disease or heart failure), during early onset (e.g., upon initial signs and symptoms of cardiovascular disease or heart failure or after an established development of cardiovascular disease or heart failure. A “pharmaceutically effective amount” of a drug necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily, or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. The term “promoter” refers to a sequence of DNA to which proteins binds to initiate transcription of a single RNA transcript from the DNA downstream of the promoter. A “nucleic acid” is a chemical compound that serves as the primary information-carrying molecules in cells and make up the cellular genetic material. Nucleic acids comprise nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). A chimeric nucleic acid comprises two or more of the same kind of nucleic acid fused together to form one compound comprising genetic material. A “full length” polynucleotide sequence is one containing at least a translation initiation codon (e.g., methionine) followed by an open reading frame and a translation termination codon. A “full length” polynucleotide sequence encodes a “full length” polypeptide sequence. A “variant,” “mutant,” or “derivative” of a particular nucleic acid sequence may be defined as a nucleic acid sequence having at least 50% sequence identity to the particular nucleic acid sequence over a certain length of one of the nucleic acid sequences using blastn with the “BLAST 2 Sequences” tool available at the National Center for Biotechnology Information's website. (See Tatiana A. Tatusova, Thomas L. Madden (1999), “Blast 2 sequences—a new tool for comparing protein and nucleotide sequences”, FEMS Microbiol Lett.174:247-250). In some embodiments a Docket No.103361-521WO1 variant polynucleotide may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater sequence identity over a certain defined length relative to a reference polynucleotide. An “enzyme” is a biological molecule, usually a protein or peptide, that acts under certain conditions, such as pH, temperature, and/or salt concentration, to accelerate biochemical reactions, either inside or outside of a tissue or cell. The molecules upon which enzymes initiate a reaction are called “substrates”, and the enzyme converts the substrates into different molecules called “products”. Enzyme functions are usually measured based on the enzyme “activity” which refers to the amount of substrate converted into a product or products by the enzyme within a given amount of time. Methods of treating, preventing, reversing, and/or ameliorating cardiovascular disease Carnitine palmitoyl transferase 1 (CPT1) is a rate-limiting enzyme for long chain fatty acid oxidation (FAO) in cardiac mitochondria. In adult hearts, CPT1b predominates, while CPT1a is co-expressed at lower levels. Pathological stress on the heart is known to induce CPT1a expression, but it’s role in pathological remodeling is unknown. The present disclosure provides CPT1 gene therapies and methods of treating, preventing, reversing, and/or ameliorating cardiovascular disease using the CPT1 gene therapies. In one aspect, disclosed herein is a method of treating or preventing a cardiovascular disease in a subject, the method comprising administering a pharmaceutically effective amount of a composition comprising a nucleic acid encoding a carnitine palmitoyltransferase 1 (CPT1) protein (such as, for example a CPT1a protein) and pharmaceutically acceptable carrier, wherein the composition increases expression of the CPT1 protein (such as, for example CPT1a) in the subject relative to an untreated subject. In some embodiments, the method comprises administering a composition comprising a nucleic acid encoding a CPT1a protein. In some embodiments, the composition increases expression of the CPT1a protein by 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, any percentage less than, any percentage more than, or any percentage in-between the mentioned percentages relative to an untreated subject. In some embodiments, the nucleic acid delivery vehicle comprises a viral vector selected from an adeno-associated viral (AAV) vector, an adenoviral (AV) vector, a lentiviral vector, and a retroviral vector. Docket No.103361-521WO1 Retroviral Vectors A retrovirus is an animal virus belonging to the virus family of Retroviridae, including any types, subfamilies, genus, or tropisms. Retroviral vectors, in general, are described by Verma, I.M., Retroviral vectors for gene transfer. A retrovirus is essentially a package which has packed into it nucleic acid cargo. The nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat. In addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus. Typically a retroviral genome, contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell. Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serve as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome. The removal of the gag, pol, and env genes allows for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle. This amount of nucleic acid is sufficient for the delivery of a one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert. Since the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically generated by placing them into a packaging cell line. A packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal. When the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals. Adenoviral Vectors The construction of replication-defective adenoviruses has been described (Berkner et al., J. Virology 61:1213-1220 (1987); Massie et al., Mol. Cell. Biol.6:2872-2883 (1986); Haj-Ahmad Docket No.103361-521WO1 et al., J. Virology 57:267-274 (1986); Davidson et al., J. Virology 61:1226-1239 (1987); Zhang "Generation and identification of recombinant adenovirus by liposome-mediated transfection and PCR analysis" BioTechniques 15:868-872 (1993)). The benefit of the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest.92:381-387 (1993); Roessler, J. Clin. Invest.92:1085-1092 (1993); Moullier, Nature Genetics 4:154-159 (1993); La Salle, Science 259:988-990 (1993); Gomez-Foix, J. Biol. Chem. 267:25129-25134 (1992); Rich, Human Gene Therapy 4:461-476 (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, Circulation Research 73:1201-1207 (1993); Bout, Human Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); and Ragot, J. Gen. Virology 74:501-507 (1993)). Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51:650-655 (1984); Seth, et al., Mol. Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319 (1993)). A viral vector can be one based on an adenovirus which has had the E1 gene removed and these virons are generated in a cell line such as the human 293 cell line. In another preferred embodiment both the E1 and E3 genes are removed from the adenovirus genome. Adeno-asscociated viral vectors Another type of viral vector is based on an adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred. An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and/or a marker gene, such as the gene encoding the green fluorescent protein, GFP. In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell-specific expression Docket No.103361-521WO1 operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or B19 parvovirus. Typically the AAV and B19 coding regions have been deleted, resulting in a safe, noncytotoxic vector. The AAV ITRs, or modifications thereof, confer infectivity and site-specific integration, but not cytotoxicity, and the promoter directs cell-specific expression. United states Patent No.6,261,834 is herein incorporated by reference for material related to the AAV vector. Large payload viral vectors Molecular genetic experiments with large human herpesviruses have provided a means whereby large heterologous DNA fragments can be cloned, propagated and established in cells permissive for infection with herpesviruses (Sun et al., Nature genetics 8: 33-41, 1994; Cotter and Robertson,.Curr Opin Mol Ther 5: 633-644, 1999). These large DNA viruses (herpes simplex virus (HSV) and Epstein-Barr virus (EBV), have the potential to deliver fragments of human heterologous DNA > 150 kb to specific cells. EBV recombinants can maintain large pieces of DNA in the infected B-cells as episomal DNA. Individual clones carried human genomic inserts up to 330 kb appeared genetically stable The maintenance of these episomes requires a specific EBV nuclear protein, EBNA1, constitutively expressed during infection with EBV. Additionally, these vectors can be used for transfection, where large amounts of protein can be generated transiently in vitro. Herpesvirus amplicon systems are also being used to package pieces of DNA > 220 kb and to infect cells that can stably maintain DNA as episomes. Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors. In some embodiments, the AAV vector comprises an AAV9 serotype. It should be noted that the AAV9 vector is more specific to heart muscle cells than other cell types, and is targeted to cardiac tissues with the cTNT promoter discussed below. In some embodiments, the composition further comprises a nucleic acid encoding a cardiac-specific promoter. In some embodiments, the cardiac-specific promoter includes, but is not limited to cardiac troponin T (cTnT), alpha-myosin heavy chain (αMHC), Homebox Protein Nkx-2.5 (Nkx2.5), and ventricular myosin light chain-2 (MLC2V). In some embodiments, the pharmaceutically acceptable carrier comprises a nucleic acid delivery vehicle, excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or a combination thereof. In some embodiments, the method comprises administering a composition comprising a nucleic acid comprising at least 70% sequence identity to SEQ ID NO: 23. In some embodiments, the method comprises administering a composition comprising a nucleic acid comprising 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% sequence identity to SEQ ID NO: 23. In some Docket No.103361-521WO1 embodiments, the method comprises administering a composition comprising a nucleic acid comprising SEQ ID NO: 23. The composition of any preceding aspect may be administered in such amounts, time, and route deemed necessary in order to achieve the desired result. The exact amount of the composition of any preceding aspect composition will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the cardiovascular disease, the particular composition, its mode of administration, its mode of activity, and the like. The composition of any preceding aspect is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the composition will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the cardiovascular disease being treated and the severity of the cardiovascular disease; the activity of the composition employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific composition employed; and like factors well known in the medical arts. The composition of any preceding aspect may be administered by any route. In some embodiments, the composition of any preceding aspect is administered via a variety of routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the composition (e.g., its stability in the environment of the subject’s body), the condition of the subject (e.g., whether the subject is able to tolerate the chosen route of administration), etc. The exact amount of composition of any preceding aspect required to achieve a therapeutically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult. Docket No.103361-521WO1 In one aspect, disclosed herein is composition of any preceding aspect and a pharmaceutically acceptable carrier selected from an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, a nanoparticle, and a cream. In some embodiments, the composition of any preceding aspect is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more times. In some embodiments, the composition of any preceding aspect is administered daily. In some embodiments, the composition of any preceding aspect is administered every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, or more. In some embodiments, the composition of any preceding aspect is administered every week, every 2 weeks, every 3 weeks, every 4 weeks, or more. In some embodiments, the composition of any preceding aspect is administered every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months, or more. In some embodiments, the composition of any preceding aspect is administered every year, every 2 years, every 3 years, every 4 years, every 5 years, or more. In some embodiments, the cardiovascular disease includes, but is not limited to myocardial infarction (heart attack), cardiac arrest/heart failure, coronary heart disease, a stroke, an arrhythmia, heart valve complications, high blood pressure, peripheral artery disease, peripheral vein disease, carotid artery disease, aortic disease, pericardial disease congenital heart disease, deep vein thrombosis (DVT), rheumatic heart disease, a vascular disease, high/low blood pressure, congestive heart failure, congenital heart defects/diseases (including, but not limited to atrial septal defects, atrioventricular septal defects, coarctation of the aorta, double-outlet right ventricle, d-transposition of the great arteries, Ebstein anomaly, hypoplastic left heart syndrome, and interrupted aortic arch), stroke, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathies, hypertensive heart disease, pulmonary heart disease, cardiac dysrhythmias, endocarditis, inflammatory cardiomegaly, myocarditis, eosinophilic myocarditis, and other related cardiovascular diseases. In some embodiments, the method further treats or prevents a metabolic disease associated with cardiovascular dysfunction. In some embodiments, the metabolic disease incudes, but is not limited to alcoholic cardiomyopathy, systemic carnitine deficiency, malonyl carboxylase deficiency, malonic aciduria, carnitine-acylcarnitine translocase deficiency, carnitine palmitoyltransferase II deficiency, deficiencies to mitochondrial beta-oxidation (including, but not Docket No.103361-521WO1 limited to medium-chain acyl-coenzyme A (coA) dehydrogenase (MCAD) deficiency, short-chain acyl-coA dehydrogenase (SCAD) deficiency, very-long-chain acyl-coA dehydrogenase (VLCAD) deficiency, and long-chain 3-hydroxyacyl-coA dehydrogenase (LCHAD) deficiency), deficiencies to the mitochondrial electron respiratory chain (including, but not limited to Kearns- Sayre syndrome, MELAS syndrome, MERRF syndrome, Barth syndrome, Leigh’s syndrome, Pearson syndrome, respiratory chain complex I deficiency, and Complex III deficiency), Glycogen storage disease type II (Pompe disease), Glycogen storage disease type III, Niemann- Pick disease, Gaucher disease, I-cell disease, mucopolysaccharidosis type I (Hurler syndrome), mucopolysaccharidosis type II (Hunter syndrome), mucopolysaccharidosis type III (Harris- Sanfilippo syndrome), mucopolysaccharidosis type IV (Morquio syndrome), mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome), GM1 gangliosidosis, galactosialidosis, carbohydrate deficient glycoprotein syndromes, Sandhoff’s disease, congenital heart defects, and hereditary heart defects. In some embodiments, the method prevents or reverses pathological heart symptoms or functions selected from cardiac hypertrophy, cardiac fibrosis, cell death, myocarditis, endocarditis, pericarditis, reduced cardiac output, reduced ejection fraction, enlarged heart chambers, narrowed heart chambers, elevated heart rate, reduced heart rate, and abnormal heart rhythms. In some embodiments, the subject is a human or a rodent. A number of embodiments of the disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims. By way of non-limiting illustration, examples of certain embodiments of the present disclosure are given below. EXAMPLES The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art. Docket No.103361-521WO1 Example 1: Increased CPT1a expression is a critical cardioprotective response to pathological stress that suppresses gene programs for remodeling and enables rescue by gene transfer. Methods: CPT1 isoform expression was assayed in myocardium of human heart failure (HF) patients with nonischemic cardiomyopathy (NICM). To explore the role of CPT1a upregulation in response to pathological stress, mice were subjected to cardiac pressure overload via transverse aortic constriction (TAC) or sham surgery (sham) with cardiac-specific CPT1a knockdown or cardiac-specific, AAV9 mediated overexpression of CPT1a (AAV9.cTnT.Cpt1a). MiR370, known to suppress hepatic CPT1a, was also overexpressed to determine if miR370 regulates cardiac CPT1a expression. Results: CPT1a protein was elevated and miR370 reduced in myocardium of male and female NICM patients (204% vs. non-failing unused donor hearts), as well as in failing mouse hearts. AAV mediated miR370 overexpression in mouse hearts suppressed CPT1a expression and attenuated the response of CPT1a to TAC. Preventing CPT1a upregulation in response to TAC in cardiac specific CPT1a knockout mice (csCPT1a ko) exacerbated adverse remodeling during TAC, causing severe dysfunction and increased mortality. In contrast, CPT1a overexpression (2.8 fold), attenuated impaired ejection fraction (EF, by 54%), fractional shortening (FS, 65%) and +/- dp/dt, and reduced ANP expression and heart mass/tibia length vs. PBS-infused TAC hearts (p<0.05). Delivery of AAV9.cTnT.Cpt1a 4 wks after TAC surgery during cardiac dysfunction, led to significant rescue of EF and FS vs. animals receiving empty virus and mitigated the exacerbated dysfunction of csCPT1a ko hearts at 4 wks TAC. RNA-seq and reverse transcription- quantitative PCR revealed a novel function of CPT1a in suppressing hypertrophic, profibrotic and cell death gene programs in both sham and TAC hearts, irrespective of changes in FAO. Conclusions: The effects of CPT1a in the heart extend beyond FAO and include a non- canonical regulation of cardiac gene programs. In addition to an animal model of HF, CPT1a upregulation occurs in failing human hearts, and is a critical and cardioprotective adaptation to pathological stress that attenuates adverse cardiac remodeling. In response to pathological stress, the adult heart upregulates several fetal isoform genes. These changes include shifts in the relative expression of the two co-expressed isoforms of the rate limiting enzyme complex for long chain fatty acid (LCFA) oxidation in the cardiomyocyte, carnitine palmitoyl transferase 1 (CPT1), that resides on the outer mitochondrial membrane. LCFAs are the primary fuel for oxidative production of ATP, and alterations in CPT1 can impact the metabolic fate of LCFA. In adult hearts, the CPT1b isoform is in greater abundance than the Docket No.103361-521WO1 CPT1a isoform, which is more highly expressed in the fetal heart, each having distinct enzyme kinetics and different modes of allosteric regulation. An early component of the response to pathological stress on the heart in animal models is increased CPT1a expression that occurs prior to cardiac dysfunction and persists into overt heart failure (HF). This increase in CPT1a coincides with the well-reported reduction in LCFA oxidation and increased reliance, albeit inefficient, on glucose for energy production, a pattern of substrate utilization consistent with prior radiolabeling studies of humans with heart failure with reduced ejection fraction (HFrEF). Interestingly, elevating CPT1a content by cardiac-specific gene delivery in the otherwise normal heart results in a paradoxical reduction in LCFA oxidation that recapitulates the phenotype of LCFA oxidation in pathological hearts. These effects of CPT1a content on cardiac LCFA oxidation occur in the absence of changes in CPT1b levels. Although CPT1a has been shown to be less sensitive to allosteric inhibition by malonyl CoA than CPT1b in isolated mitochondria from liver and muscle cells, its role in the adult heart is unknown. Furthermore, augmenting CPT1a in the hearts of otherwise healthy rodents induces cardiac natriuretic peptide expression, as also occurs in response to pathological stress, when CPT1a is upregulated. Thus, CPT1a, and potentially upstream factors controlling CPT1a expression, appears to provide a fundamental link between metabolic remodeling and the cardiac response to increased afterload stress. However, whether this shift toward elevated CPT1a is adaptive or maladaptive and how it affects the progression of pathological hypertrophy to overt failure are entirely unknown. Therefore, CPT1a content was examined and that of a microRNA known to control hepatic CPT1a expression, miR370, in the left ventricular myocardium of patients with non-ischemic cardiomyopathy (NICM) and the metabolic and pathophysiological consequences of altered CPT1a expression in mouse models of cardiac pressure overload. Results show for the first time increased CPT1a protein in hearts of HFrEF patients, replicated in two different NICM patient cohorts at two different institutions. The pathogenesis of decompensatory cardiac hypertrophy and failure was explored during restricted, cardiac specific (cs) CPT1a expression via genetic knockdown and adeno-associated virus serotype 9 (AAV9) vector mediated cardiac specific, miR370 overexpression, as well as with AAV9 vector mediated, cardiac specific CPT1a overexpression. For the first time, it was shown that induction of CPT1a expression is an adaptive rather than a maladaptive stress response that attenuates adverse cardiac remodeling. Further, a directional regulation of CPT1a expression by miR370 was elucidated in a preclinical animal model, and a direct effect of CPT1a expression in mediating cardiac natriuretic peptide (NP) production. Beyond the role of CPT1a in LCFA Docket No.103361-521WO1 oxidation, herein is the first evidence that CPT1a functions in the adult heart to inhibit gene programs associated with adverse remodeling, including profibrotic, hypertrophic, and cell death responses. The findings reveal that CPT1a is requisite in the adaptive response to pathological stress that can influence LCFA oxidation, but also functions independently of LCFA oxidation to attenuate contractile dysfunction in the failing heart. Methods Data, analytic methods, and study materials are available to other researchers for purposes of reproducing results or replicating procedures upon reasonable request. Animals. Mice with cardiac specific knockdown of CPT1a (csCPT1a ko) were generated by crossing CPT1a floxed (f/f) mice (see online data supplement) with hemizygous αMHC-Cre mice (stock# 011038, The Jackson Laboratory). CPT1a was overexpressed in 10-12 week old male C57Bl/6 mice (The Jackson Laboratory) with adeno-associated virus (AAV) 9 delivery under control of the cardiac specific promoter cTNT via jugular vein injection (i.v.). To suppress CPT1a the microRNA (miR370) was inserted into the same AAV9 construct and injected i.v. (Virovek, www.virovek.com). For vector construct design and sequences see Table 2 and Figure 9. Previously published findings demonstrated that cardiac effects of viral vector mediated CPT1a overexpression do not result from responses to viral vector administration, by comparison to scrambled virus delivery (Lewandowski ED, et al. Acute liver carnitine palmitoyltransferase I overexpression recapitulates reduced palmitate oxidation of cardiac hypertrophy. Circ Res. 2013;112:57–65). Control mice received either PBS or AAV9 containing an empty vector sequence (AAV9.Emp). For the purposes of this disclosure, given that similar increases in CPT1a occurred in failing hearts of male and female NICM patients, only male mice were used. All experimental procedures relating to the use of vertebrate animals for these protocols were approved by the Institutional Animal Care and Use Committees (IACUC) at the University of Illinois at Chicago and the Ohio State University. Pathological cardiac hypertrophy. Pathological hypertrophy was induced by transverse aortic constriction (TAC), as previously described with modification for different clip sizes. CsCPT1a ko mice and f/f littermate controls underwent TAC using a 0.018 inch micro-clip or sham surgery at 10-14 weeks of age. A subset of csCPT1a ko mice underwent TAC surgery (0.018 clip) and 1 wk later received AAV9.cTnT.Cpt1a or AAV9.Emp. Docket No.103361-521WO1 Mice injected with AAV9.cTnT.miR370 or AAV9.cTnT.Cpt1a (i.v.) underwent TAC 10 d after injection with a 0.016 inch micro-clip. A subset of C57Bl/6 mice underwent TAC (0.016 clip) or sham surgery followed by AAV9.cTnT.Cpt1a or AAV9.Emp 4 wks post-TAC. In vivo echocardiography. Transthoracic ultrasound imaging was performed on TAC and sham mice at 8 weeks post-surgery (Vevo 2100, VisualSonics). Isolated heart perfusion. After 8 weeks post-TAC or sham, isolated hearts were retrogradely perfused with a modified Krebs-Henseleit buffer containing 0.4 mmol/L unlabeled palmitate/albumin complex (3:1 molar ratio), 10 mmol/L glucose, and 1 mmol/L lactate. 19,20. Prior to cardiectomy, mice received heparin (50 U/10 g) and anesthesia via Ketamine (80 mg/kg, i.p.) and xylazine (12 mg/kg, i.p.). Hearts were situated in a 10 mm broadband probe that was placed within a vertical wide-bore (89mm) 14.1 T nuclear magnetic resonance (NMR) magnet. Temperature in the sample chamber of the probe was maintained at 37 °C. Initially, a two-minute 31P NMR spectrum was acquired and a natural abundance 13C background NMR spectrum. Perfusate was then switched to similar media containing [2,4,5,6,8,10,12,14,16-13C8] palmitate. Hearts were then frozen in liquid N2 cooled tongs. In vitro NMR spectroscopy for substrate selection. The fractional contribution (Fc) of 13C palmitate into the tricarboxylic acid (TCA) cycle as acetyl CoA was determined by glutamate isotopomer analysis from in vitro 13C NMR spectra of left ventricular tissue extracts 21. See online data supplement for full details. Human heart tissue collection. Protocols for tissue sampling at the time of heart transplantation were approved by the University of Pennsylvania Institutional Review Board and for transmural LV apical core sampling at CF-LVAD implant by the University of Utah Institutional Review Board. Written informed consent for use of heart tissues was obtained prospectively from transplant recipient patients and from next-of-kin in the case of organ donors. Use of hearts from brain-dead organ donors for sampling at the University of Pennsylvania was approved by the Gift-of-Life donor Program in Philadelphia, PA. Use of non-failing donor hearts not allocated for human transplantation because of noncardiac reasons were approved for use at the University of Utah by DonorConnect of Salt Lake City, UT. Individuals with advanced HF due to non-ischemic cardiomyopathy (NICM) were selected. All samples were from subjects without history of diabetes. Procurement of human myocardial tissue at the University of Pennsylvania was performed. Transmural apical biopsies at University of Utah were immediately frozen and stored at -80oC for metabolic enzyme expression analysis. See online data supplement for full details and patient and donor characteristics (Table 2 and Table 3). Docket No.103361-521WO1 Metabolic enzyme expression and content. Protein expression was determined by western blot by loading 20 ug of protein per lane and band intensities quantified by LI-COR Odyssey Fc or BioRad ChemiDoc and normalized to the expression of calsequestrin (CASQ) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a loading control while mRNA levels were determined by quantitative reverse transcription polymerase chain reaction in frozen heart tissue and normalized to S29. Antibodies, antibody dilutions (Table 4) and primers (Table 5) are listed. MiR370 Assay. MiR370 expression was measured using the Taqman MicroRNA assays, 462611_mat for mice and assay ID 002275 Cat# 4427975 for human samples (Applied Biosystems) and normalized to U6 expression (Assay ID 001973, Cat# 4427975). Immunohistochemistry on heart sections. Immunohistochemistry was performed on hearts 10d post AAV.Cpt1a or AAV9. Emp injection to access phospho-histone H3 levels. RNA-Seq. RNA-Seq analysis was performed by the Biomedical Informatics Shared Resource at The Ohio State University. Statistical Analysis. Data is presented as mean±SEM. Comparisons between two mean values were performed using the Students t-test and among more than two mean values using one- way analysis of variance (ANOVA), 2-way ANOVA or mixed-effects ANOVA with Tukey’s multiple comparison post-hoc test as indicated. The statistical method utilized is indicated in each figure legend along with the individual n and p values. Means were deemed statistically significant at p<0.05. CPT1a protein expression is selectively increased in non-ischemic cardiomyopathy. CPT1a expression increases in animal models of HF , but recent reporting suggests that CPT1a protein is unchanged in myocardium from patients with dilated cardiomyopathy (DCM), measured via semi-quantitative proteomics. Given the distinctions across pathologies, samples from patients with NICM from two different cohorts were examined under different sampling protocols, that may have pathological hypertrophy more similar to that of animal models of HF due to chronic pressure overload that show increased CPT1a. CPT1 expression in myocardium was compared between unused donor hearts and patients with NICM (Figures 1A-1L) collected at both the University of Pennsylvania and the University of Utah. CPT1a protein was significantly increased in both male (Figures 1A,1B,1D & 1E) and female (Figures 1G,1H,1J & 1K) NICM patients sampled at both institutions, with no detectable change in CPT1b. This lack of change in CPT1b is consistent with animal models and a previous report in humans. Importantly, clear evidence emerged for significantly elevated CPT1a protein content in human Docket No.103361-521WO1 failing heart. Cpt1a mRNA expression trended towards increased expression in NICM samples, but reached significance only in male samples from the University of Pennsylvania. Increased CPT1a is an adaptive and essential response to pressure overload. To elucidate whether the CPT1a upregulation is adaptive or maladaptive in the pathologically stressed hearts, cardiac specific CPT1a knockout mice (csCPT1a ko) and mice overexpressing CPT1a in a cardiac specific manner through delivery of AAV9 vector containing code for CPT1a under the control of the cardiac specific Troponin T promoter (AAV9.cTnT.Cpt1a), were exposed to chronic pressure overload via transverse aortic constriction (TAC) or sham surgery (sham) (Figure 2A). CPT1a expression was reduced but still present 1 wk after birth in hearts from csCPT1a ko mice but absent in adult csCPT1 ko mice (Figure 10A). Using an established TAC protocol, csCPT1a ko mice suffered increased mortality when TAC was performed with a 0.016 inch clip (Figure 10B). In response to this increase in mortality, a more moderate constriction (0.018 inches) was chosen. Sham hearts of csCPT1a ko mice had significantly reduced CPT1a protein versus that of f/f mice (Figure 2B), with no change in CPT1b protein expression (Figure 2B). At 8 wks post- TAC, f/f mice did not have an increase in CPT1a or a decreased ejection fraction (EF) (Figure 2C). However, loss of cardiac CPT1a in csCPT1a ko mice resulted in a 40% decrease in EF (Figure 2C), despite a similar increase in LV mass from echocardiography as in f/f littermates (Figure 2D). Heart weight to tibia length (HW:TL) (Figure 3) was significantly in higher csCPT1a ko TAC vs. f/f TAC. As CPT1a expression appears to be an essential adaptive component of the cardiac response to pathological stress, an increase in cardiac CPT1a content was evaluated that could mediate the response to TAC. CPT1a expression was increased in a cardiac specific manner through i.v. injection of AAV9.cTnT.Cpt1a (Figure 10). AAV9.cTnT.Cpt1a delivery increased CPT1a protein expression in the heart (54% increase) (Figures 11A and 11B), but not in liver (Figures 11C and 11D) 10 d after i.v. injection (2x1013 viral genome/kg body weight to maintain cardiac selectivity of AAV9). TAC was induced in PBS or AAV9.cTnT.Cpt1a mice 10 d after i.v. injection (see Figure 2A). The increase in CPT1a expression was sustained in AAV9.cTnT.Cpt1a sham hearts (2.8-fold vs. PBS sham) for the duration of the 8 wk protocol (Figure 2F) with no compensatory changes in CPT1b (Figure 2E&F). Because AAV9.cTnT.Cpt1a treated mice did not show the increased susceptibly to TAC as did csCPT1a ko mice, a more aggressive TAC protocol was possible (0.016 inch clip). Thus, CPT1a expression increased and EF was reduced in hearts of PBS infused mice Docket No.103361-521WO1 subjected to TAC with this tighter constriction (Figure 2E&F) (Figure 2G). CPT1a protein content was further augmented in hearts of AAV9.cTnT.Cpt1a TAC mice (Figure 2E&F) compared to PBS TAC (1.4-fold). Importantly, the decline in EF (Figure 2G) and fractional shortening (FS) (Figure 2H) 8 wks after TAC was attenuated in AAV9.cTnT.Cpt1a TAC versus PBS TAC mice, despite similar echocardiographic measurement of LV mass (Figure 2I). However, HW:TL of excised hearts was only increased in PBS TAC mice vs. sham (Figure 3). To ensure that the attenuated pathological remodeling with AAV9.cTnT.Cpt1a was not an effect of viral load, TAC or sham surgery was also performed in mice 10d after AAV9.cTnT.Cpt1a injection or injection with an AAV9 vector containing an empty coding sequence (AAV9.Emp) (Figure 2A). Both the decline in EF or FS were significantly attenuated in mice injected with AAV9.cTnT.Cpt1a vs. AAV9.Emp (Figure 2J). LCFA oxidation and CPT1a expression occur independently. Utilization of LCFA was assessed in isolated hearts perfused with 13C-labeled palmitate ([2,4,6,8,10,12,14,16-13C8] palmitate) in a physiological mix with glucose and lactate. Consistent with unaltered CPT1a expression in TAC f/f mice following a less severe TAC, the contribution of LCFA to the oxidative metabolism of the tricarboxylic acid (TAC) cycle remained unchanged (Figure 3A&B). However, contractile function (Figure 12) and LCFA contribution to oxidative metabolism (Figure 3A) were significantly reduced in csCPT1a ko TAC hearts. Strikingly, in sham hearts, loss of CPT1a expression had no effect on LCFA entry into the TCA cycle (Figure 3B). Increasing CPT1a expression led to reduced LCFA entry into the TCA cycle (Figure 3D), as well as a 5.8-fold increase in ANP gene expression (Nppa) (Figure 3D) after 10 d before any surgical intervention. As was elucidated 10 d after AAV9.cTnT.Cpt1a delivery, the entry of LCFA into the TCA cycle (Figure 3E&F) was lower in AAV9.cTnT.Cpt1a sham hearts, but there was no TAC-induced decline in the contribution of LCFA to oxidative metabolism as was otherwise present in PBS TAC hearts (Figure 3F). However, there was no difference in the contribution of LCFA to oxidation in the TCA cycle between PBS TAC and AAV9.cTnT.Cpt1a TAC hearts. The function of isolated hearts was significantly reduced in both PBS TAC and AAV9.cTnT.Cpt1a TAC hearts (Figure 13) relative to sham. Although mean isolated heart function showed a strong trend towards increased function in AAV9.cTnT.Cpt1a TAC hearts relative to PBS TAC, the observed increase in the mean values for rate pressure product (RPP) and rates of pressure development (+dp/dt) and relaxation (-dp/dt) did not reach statistical significance when measured via 2-way ANOVA, but Docket No.103361-521WO1 mean RPP and dp/dt values were indicated as significantly higher for AAV9.cTnT.Cpt1a TAC hearts in one-to-one comparisons to those of PBS TAC hearts via Students t-test. Upstream and endogenous microRNA regulation of cardiac CPT1a expression in response to pathological stress. MiR370 suppresses Cpt1a expression in the liver, but the impact of miR370 expression on cardiac Cpt1a has previously not been investigated. MiR370 content was significantly reduced in failing hearts of both mice (Figure 4A) and patients collected at both institutions (Figure 4B&C), suggesting a potential mechanism for the observed increases in CPT1a content in both animal models of HF and patients (Figure 1). Overexpression of miR370 in the heart suppressed Cpt1a gene expression (Figure 4D) without affecting Cpt1b (Figure 4E). AAV9.cTnT.miR370 did not alter the expression of miR370 in the liver or skeletal muscle (Figure S6). Delivering AAV9.cTnT.miR370 to mice 10d prior to TAC (Figure 4F) suppressed upregulation of CPT1a by TAC (Figure 4G). However, cardiac function was equally suppressed in mice following PBS or miR370 delivery prior to TAC (Figure 4H), and the TAC-induced decrease in fatty acid oxidation was unaffected (Figure 4I). Notably, Cpt1a expression was not completely abolished by miR370 overexpression and content remained higher than that of the csCPT1a ko hearts. Thus, these findings show a requisite level of Cpt1a expression is required to attenuate pathological remodeling in response to chronic pressure overload. Elevated ANP expression in response to CPT1a overexpression is transient. AAV9.cTnT.Cpt1a delivery led to an increase in Nppa at 10 d post-injection (Figure 3C). Nppa was not induced by AAV9.Emp (Figure 15) and the increase was a selective effect of CPT1a, as AAV9.cTnT.miR370 also failed to increase Nppa expression (Figure 5A). Strikingly, by 8 wks post-surgery the upregulation of Nppa expression was no longer evident in AAV9.cTnT.Cpt1a mice regardless of whether they received TAC or sham surgery (Figure 5B). As expected, TAC increased Nppa expression in PBS TAC hearts (Figure 5B). Conversely, in csCPT1a ko mice there was a strong trend towards elevated Nppa expression in sham hearts, while in csCPT1a ko TAC hearts Nppa levels were significantly increased (Figure 5B), in agreement with the increased sensitivity to pathological stress of the knockout (Figure 2). To distinguish the transient increased expression of Nppa in response to CPT1a overexpression from the TAC-induced response in Nppa, hearts were examined at 5 d after TAC or sham surgery (Figure 5B). Results were compared to csCPT1a ko mice 5 d after TAC or sham Docket No.103361-521WO1 surgery, using the TAC protocols depicted in Figure 2A for csCPT1a ko mice and AAV9.cTnT.Cpt1a mice. In AAV9.cTnT.Cpt1a sham hearts there was a strong trend toward increased Nppa expression vs PBS sham 5 d after surgery. However, TAC did not lead to a further increase in Nppa (Figure 5B); while in f/f and csCPT1a ko hearts there was no difference in Nppa expression during the acute response to TAC (Figure 5B). In AAV9.cTnT.Cpt1a treated mice, the priming of Nppa upregulation in advance of TAC surgery was associated with attenuation of the hypertrophic remodeling at this early time point, delaying the upregulation of β-myosin heavy chain mRNA (Myh7) (Figure 5B), while in csCPT1a ko mice there was a strong trend towards increased expression of Myh7 (Figure 5B) at this early time point. By 4 wks after TAC or sham surgery Nppa expression was no longer increased in AAV9.cTnT.Cpt1a treated mice (Figure 16A), and Myh7 expression (Figure 16B) was not different between PBS and AAV9.cTnT.Cpt1a treated mice. Intervening with CPT1a overexpression after onset of cardiac dysfunction during pressure overload mitigates adverse remodeling and functional decline. To determine if the overexpression of CPT1a is required prior to pathological, the therapeutic prospect of increasing CPT1a expression post-TAC after the onset of dysfunction was examined. There was a significant reduction in EF and FS (Figure 6) prior to AAV9 gene delivery, which was rescued by AAV9.cTnT.Cpt1a administration at both 2 and 4 wks after injection (Figure 6D). As anticipated, CPT1a protein expression was increased in both sham and TAC mice receiving AAV9.cTnT.Cpt1a (Figure 6E). Predictably, Nppa expression was increased in mice treated with empty virus after TAC. In contrast, AAV9.cTnT.Cpt1a TAC mice did not have increased Nppa (Figure 6F). Both AAV9.cTnT.Cpt1a and AAV9.Emp TAC hearts did have elevated Myh7 expression at 8 wks post-TAC (Figure 6G). In addition to demonstrating a therapeutic prospect in wild type mice, rescue with AAV9.cTnT.Cpt1a treatment was also effective in csCPT1a ko mice during TAC. CsCPT1a ko mice underwent TAC surgery and were given AAV9.cTnT.Cpt1a or AAV9.Empty 1 week later (Figure 6H). Introducing CPT1a into the hearts of csCPT1a ko mice significantly attenuated the dramatic decline in EF otherwise occurring in csCPT1a ko mice treated with empty virus (Figure 6I). Therefore, CPT1a overexpression prior to pathological stress is not required to exert cardioprotective effects, and can effectively mitigate adverse remodeling after the onset of dysfunction. Docket No.103361-521WO1 The expression of CPT1a regulates cardiac gene expression. In sham hearts, cardiac specific CPT1a knockdown led significant changes in expression of 1328 genes, primarily through induced expression, while CPT1a overexpression led to a change in expression of 852 genes, primarily by suppressing expression (Figure 18). A number of genes suppressed by AAV9.cTnT.Cpt1a were highly enriched in pathways involved in fibrosis, cell growth and apoptosis (Table 6). Focusing on the genes altered by both CPT1a knockdown and CPT1a overexpression in sham hearts yielded 82 commonly affected genes (Figure 7A). The relative change in the expression of these genes is plotted (heatmap) in Figure 7A. Thus, CPT1a knockout increased gene expression, and CPT1a overexpression reduced expression (Figure 7B). Pathway enrichment analysis showed the common genes that were altered (Figure 7A) were enriched in apoptotic pathways, profibrotic-related pathways, and the response to TGFb; they also extend to pathways involved in cell cycle regulation and lipid metabolism. A recent study of CPT1b knockdown seemed to show upregulated proliferative pathways in the heart. Although histochemistry revealed a trend towards increased cardiomyocytes with PHH3 positive nuclei after AAV9.cTnT.Cpt1a injection, this did not reach full statistical significance (p=0.054, Figure 15). In TAC hearts, the inverse relationship between CPT1a expression and gene expression patterns was maintained. Figure 7D shows overlap between patterns induced by CPT1a overexpression in both sham (AAV9.cTnT.Cpt1a sham vs. PBS sham) and TAC hearts (AAV9.cTnT.Cpt1a TAC vs. PBS TAC). Overall, 133 genes were altered by AAV9.cTnT.Cpt1a (Figure 7D,E). AAV9.cTnT.Cpt1a delivery induced an 82% increase in CPT1a in sham hearts (AAV9.cTnT.Cpt1a vs. PBS sham) but only a 42% increase comparing TAC hearts ((AAV9.cTnT.Cpt1a TAC vs. PBS TAC), as CPT1a was induced by TAC itself (Figure 2). The relative reduction in gene expression between the groups compared (Figure 7E) was proportional to the relative change in CPT1a shown in Figure 2. As LCFA oxidation was either unchanged or reduced, irrespective of CPT1a expression levels, changes in gene regulation were not directionally consistent with the changes in FAO induced by changes in CPT1a and indicate independence (Figure 7F). Based on the RNAseq results, the expression of collagen markers was accessed in TAC hearts from both AAV9 treated and csCPT1a ko mice (Figure 19). Collagen type III alpha 1 (Col3a1) was found to be selectively upregulated in models with reduced CPT1a expression 8 wks after TAC, AAV9.cTnI.miR370 TAC hearts and csCPT1a ko TAC hearts (Figures 19A & 19B). In hearts from C57Bl/6 mice treated with AAV9.cTnT.Cpt1a 4 wks after TAC surgery there was Docket No.103361-521WO1 a significant reduction in both Col3a1 and Tgfb expression vs. TAC AAV9.Emp treated mice (Figure 19C). Discussion This is the first disclosure to evaluate the role for, and impact of CPT1a upregulation in the development of HF. The data are consistent with previously reported increases in cardiac expression of CPT1a in animal models of HF, and clearly demonstrate CPT1a upregulation in failing human hearts of male and female NICM patients. This disclosure elucidates upregulation of CPT1a to be a critical, cardioprotective response to pathological stress. The absence of CPT1a sensitizes the heart to chronic pressure overload, leading to accelerated decompensation and LV dilation, while overexpressing CPT1a attenuates the progression of decompensatory hypertrophy. Importantly, cardioprotection was realized with AAV9.cTnT.Cpt1a delivery even at the point of decompensated hypertrophy and dysfunction in both C57/Bl6 and csCPT1a ko mice. A rate limiting step for LCFA entry into oxidation is at CPT1 on the mitochondrial membrane. In adult hearts, CTP1b is the predominant isoform, while developing hearts express CPT1a at relatively high levels. Ex vivo tissue studies report that negative feedback inhibition of CPT1b occurs by allosteric regulation by malonyl CoA, but CPT1a is less sensitive to malonyl CoA inhibition. Hearts with elevated CPT1a, such as the fetal heart, failing heart, and genetic modified CPT1a overexpressing heart, all show reduced levels of LCFA oxidation and increased reliance on glucose metabolism. Increasing in vivo CPT1a expression in the adult heart, whether via Adv vector delivery, or AAV9.cTnT.Cpt1a administration to mice in the present study (Figure 3), leads to a reduction in cardiac LCFA oxidation at the level of LCFA entry into the mitochondria without any change in mechanical work output by the heart. Surprisingly, decreasing CPT1a did not alter baseline LFCA oxidation. Baseline content of CPT1a in the adult heart is low, estimated to contribute less than 10% to total activity. Therefore, loss of CPT1a may not be sufficient to significantly affect LCFA entry into mitochondria. In contrast, increasing CPT1a in the adult heart does impact LCFA oxidation. While CPT1a overexpression reduces cardiac LCFA in otherwise normal hearts, increased CPT1a content in pressure overloaded hearts improved cardiac function and limited metabolic remodeling, as reflected in preserved LCFA oxidation. Alternatively, LCFA oxidation in csCTP1a ko hearts was greatly reduced with TAC, a consequence of the accelerated remodeling and increased sensitivity to chronic pressure overload in the absence of CPT1a. Therefore, in the failing heart reduced LCFA oxidation bears out as more a consequence of pathological state rather Docket No.103361-521WO1 than a specific consequence the level of CPT1a expression. This was further demonstrated in mice overexpressing cardiac miR370 which showed similar reductions in FAO following TAC as in control hearts, despite suppression of the CPT1a response to TAC. Upregulation of CPT1a in the failing hearts is a reversal of the shift in cardiac CPT1 isoforms that occurs during development from neonate to adult. Although it is sometimes argued that CPT1b is expressed at lower levels in fetal than adult hearts, CPT1b protein content is fairly consistent throughout development, while CPT1a decreases. Herein, it was reconfirmed that CPT1b protein is not altered in failing hearts of mice and humans. Thus, if CPT1a is associated with reduced LCFA oxidation, which persists throughout prolonged CPT1a overexpression in adult hearts, then the decline in CPT1a in the normal adult heart may serve to activate overall CPT1 activity. This would further indicate that reducing CPT1a expression beyond this inherently low level, as done in the herein with CPT1a knockdown and miR370 overexpression, does not further augment LCFA oxidation because the action of CPT1b on LCFA oxidation is already maximal. The present disclosure clearly demonstrates that induction of CPT1a in response to pathological stress on the heart is an adaptive response that confers cardioprotection and holds therapeutic potential. ANP is often viewed as a marker of the cardiac response to pressure overload and pathological hypertrophy. However, previous studies show that ANP attenuates pathological remodeling and blocking ANP formation accelerates cardiac decompensation. Acutely increasing CPT1a expression has previously been shown to increase cardiac NP expression. However, this disclosure shows the increase is not maintained chronically, showing that the timing of TAC surgery in relation to the induction of CPT1a levels is potentially significant. However, induction of ANP prior to pathological stress is not requisite for CPT1a to have a beneficial effect, because delivery of AAV9.cTnT.Cpt1a after a reduction in EF led to a partial correction of in EF, demonstrating the strong therapeutical prospect for modulation of CPT1a content and activity in HF even after onset of HFrEF. CPT1a protein content was increased in myocardium of patients with NICM. CPT1a mRNA expression has been reported to be unchanged in human HF, but protein expression has not been widely reported. The results show that mRNA and protein expression cannot be used interchangeably. A recent study did not observe an increase in CPT1a protein in patients with DCM using a semi-quantitative proteomics-based method. The differing results could reflect the nature of analysis or the heterogeneity of HF in humans, even among patients with HFrEF. Significantly, increased CPT1a expression was observed in samples from separate cohorts of NICM patients at two different institutions. Docket No.103361-521WO1 Substrate labelling studies in HF patients are consistent with a reduction in fatty acid oxidation, and could be a consequence of not only altered mitochondrial fatty acyl CoA entry, but also a reduction in fatty acid uptake and activation in the heart. Irrespective of these differences in past observations, the most salient findings of the present disclosure are not the degree to which CPT1a expression is increased in the failing heart, but rather the adaptive and essential nature of that increase, and the therapeutic prospect of increasing CPT1a expression in the failing heart. The increase in CPT1a induced by TAC and observed in NICM was associated with a reduction in miR370 expression. In the liver miR370 has been shown to regulate CPT1a expression, and this is the first disclosure of miR370 regulating cardiac CPT1a expression. Overexpressing miR370 prevented the TAC induced increase in CPT1a, but did not greatly sensitize the heart to pathological stress. MiR370 has been shown to have effects beyond the regulation of CPT1a , but it is important to consider that CPT1a expression was not absent in AAV9.cTnT.miR370 hearts. The significant impact that CPT1a expression has on gene regulatory pathways and the adaptive response to chronic pressure overload is striking. CPT1a has previously been identified as a key regulator of gene expression in cancer cells, with increased CPT1a expression resulting increased acetylation and tumor progression through inhibition of apoptosis. Recently it was reported by Braun, et al, that the suppression of CPT1b in cardiomyocytes led to upregulation of a proliferative pattern of gene expression (Li X, et al. Inhibition of fatty acid oxidation enables heart regeneration in adult mice. Nature.2023;622:619–626). While they did not report a change in CPT1a due to reduced CPT1b, the ratio of the two isoforms may have been altered. Just as for LCFA oxidation, the gene expression patterns of the heart may be sensitive to the ratio of CPT1a to CPT1b. Based on the finding presented herein, the increases in CPT1a expression and content play an essential role in the cardiac stress response in mediating cardiac metabolic and functional remodeling, as well as the regulation of stress-induced cardiac gene expression. Importantly, as it relates to the translational relevance of the present work, overexpressing CPT1a after the development of reduced EF reversed the decline in EF and partial correction of HFrEF and the csCPT1a ko mouse can be partially rescued after the induction of pathological stress through re- expression of CPT1a. Expression of CPT1a in the adult heart has an essential role in regulating gene expression patterns (Figure 8), even in the absence of pathological stress, with the capacity of the heart to both respond to pathological stress and regulate cardiac gene expression proportional to the induction of CPT1a expression. The changes in gene expression do not Docket No.103361-521WO1 correlate with a specific change in FAO and reveal a previously unknown non-canonical role of CPT1a in responding to the pathological stress in the heart. Example 2: Additional Methods Animals. Mice with cardiac specific knockdown of CPT1a (csCPT1a ko) were generated by crossing CPT1a floxed mice with hemizygous αMHC-Cre mice (stock# 011038, The Jackson Laboratory). CPT1 knockout first ES cells were purchased from EUCOMM/KOMP-CSD ES Cell resource (JM8A3N.1), which contained an IRES: lacZ trapping cassette and a floxed promoter- driven neo cassette inserted into the intron between exon3 and exon4 of the CPT-1 gene. The exon deleted in exon 4 is an out-of-frame deletion, so even if spliced around, the sequence will not make a protein. The presence of an engrailed splice acceptor in the internal ribosome entry site:lacZ trapping cassette disrupts CPT-1 gene function. Exposure to a source of flippase (Flp) recombinase removed the gene trap cassette, converting the “knock-out-first” allele to a conditional allele (floxed exon, f/+), restoring gene activity. This was achieved by breeding germline transmitted “knock-out-first” mice with Flp mice. Chimeric founders were bred to albino C57Bl/6 mice to verify germ-line transmission. CPT1 f/+ mice were mated to generate CPT1a F/F mice. CPT1a f/f mice were bred with hemizygouse αMHC-Cre recombinase (Cre/+) mice (stock# 011038, The Jackson Laboratory) to generate cardiac specific CPT1a knockout mice (CPT1a f/f Cre/+, csCPT1a ko). These were backcrossed to the C57/bl6 background. Subsequently csCPT1a ko male mice were bred to CPT1a f/f female mice. CPT1a was overexpressed in the adult heart by adeno-associated virus (AAV) 9 delivery of CPT1a under control of the cardiac specific promoter cTNI via tail vein injection. To suppress CPT1a in the adult heart the microRNA (miR370) was inserted into the same AAV9 construct and injected via the tail vein. Both AAV9 vectors were purchased from Virotek (www.virovek.com). For vector construct design and sequences see Table 2 and Figure 10. Male C57Bl/6 mice (The Jackson Laboratory) underwent tail vein injection at 10-12 weeks of age. For the purposes of this study, given that similar increases in CPT1a occurred in failing hearts of male and female NICM patients, only male mice were used. All experimental procedures relating to the use of vertebrate animals for these protocols were approved by the Institutional Animal Care and Use Committees (IACUC) at the University of Illinois at Chicago and the Ohio State University. Pathological cardiac hypertrophy. Pathological hypertrophy was induced by transverse aortic constriction (TAC), with modification for different clip sizes. CsCPT1a ko mice and f/f littermate controls underwent TAC using a 0.017 inch micro-clip or a sham surgery at 10-14 weeks Docket No.103361-521WO1 of age. Mice injected with AAV9.cTnT.miR370 or AAV9.cTnT.Cpt1a (tail vein) underwent TAC 10 d after injection with a 0.016 inch micro-clip. In vivo echocardiography. Transthoracic ultrasound imaging was performed on TAC and sham mice at 8 weeks post-surgery (Vevo 2100, VisualSonics). Mice were anaesthetized with isoflurane (3% for induction, 1 to 2% isoflurane for maintenance). Mice were placed on a heated stage and body temperature was maintained at 37oC. The MS400 transducer was used on mice following hair removal and warmed ultrasound gel was applied to the thorax. Isolated heart perfusion. After 8 weeks post-TAC or sham, isolated hearts were retrogradely perfused with a modified Krebs-Henseleit buffer containing 0.4 mmol/L unlabeled palmitate/albumin complex (3:1 molar ratio), 10 mmol/L glucose, and 1 mmol/L lactate. Prior to cardiectomy, mice received heparin (50 U/10 g) and anesthesia via Ketamine (80 mg/kg, i.p.) and xylazine (12 mg/kg, i.p.). Hearts were situated in a 10 mm broadband probe that was placed within a vertical wide-bore (89mm) 14.1 T nuclear magnetic resonance (NMR) magnet. Temperature in the sample chamber of the probe was maintained at 37 °C. Initially, a two-minute 31P NMR spectrum was acquired and a natural abundance 13C background NMR spectrum. Perfusate was then switched to similar media containing [2,4,5,6,8,10,12,14,16-13C8] palmitate. Hearts were then frozen in liquid N2 cooled tongs. In vitro NMR spectroscopy for substrate selection. The fractional contribution (Fc) of 13C palmitate into the tricarboxylic acid (TCA) cycle as acetyl CoA was determined by glutamate isotopomer analysis from in vitro 13C NMR spectra of left ventricular tissue extracts. Human Heart Tissue Collection. The protocol for obtaining heart tissue at the time of heart transplantation was approved by the University of Pennsylvania Institutional Review Board and the use of hearts from brain-dead organ donors for was approved by the Gift-of-Life donor Program in Philadelphia, PA. Written informed consent transplant for research use of heart tissues was obtained prospectively from transplant recipients and from next-of-kin in the case of organ donors. From the transplant recipients, we selected individuals with advanced heart failure due to non-ischemic cardiomyopathy (NICM). In all cases, hearts were arrested in situ with ice- cold, high-potassium cardioplegia (UW formula: 125 mmol/L K+, 30 mmol/L Na+, 5 mmol/L Mg2+, 25 mmol/L phosphate, 5 mmol/L SO4 2-, 100 mmol/L lactobionate, 30 mmol/L raffinose, 1 mmol/L allopurinol, 5 mmol/L adenosine, 3 mmol/L glutathione, 5% pentastarch), excised from the body, and transported to the lab in ice-cold Krebs-Henseleit Buffer. Myocardial tissue was obtained from the LV free wall at time of transplant. Samples taken from the left ventricular free wall were flash frozen and stored at -80oC for metabolic enzyme expression analysis. Patient characteristics are listed in Table 3. Each left ventricle (LV), including the interventricular septum, Docket No.103361-521WO1 was weighed following removal of the atria, great vessels and right ventricular free wall. The LV ejection fraction and LV end-diastolic diameter were derived from the most recent echocardiogram before cardiac explantation. All samples were from subjects without history of diabetes. Patient and donor characteristics from the University of Pennsylvania are listed in Table 2. The protocol for surgical sampling of myocardium from patients was approved by the University of Utah Institutional Review Board. All patients provided written informed consent before inclusion. Myocardial tissue was obtained from the LV apical core at CF-LVAD implant from 5 male patients and 5 female patients. Transmural apical core biopsies also were acquired from 5 non-failing male and 4 female donor hearts that were not allocated for human transplantation because of noncardiac reasons. Each transmural biopsy was immediately frozen and stored at -80oC for metabolic enzyme expression analysis. All samples were from subjects without history of diabetes. Patient and donor characteristics from the University of Utah are listed in Table 3. Metabolic Enzyme Expression and content. Protein expression was determined by western blot loading 20 ug of protein per lane and band intensities quantified by LI-COR Odyssey Fc or BioRad ChemiDoc and normalized to the expression of calsequestrin (CASQ) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a loading control while mRNA levels were determined by quantitative reverse transcription polymerase chain reaction in frozen heart tissue and normalized to S29. Antibodies and antibody dilutions (Table 4) and primers (Table 5) used are listed in the Supplement. miR370 Assay. miR370 expression was measufred using the Taqman MicroRNA assays, 462611_mat for mice and assay ID 002275 Cat# 4427975 for human samples (Applied Biosystems). MiR370 expression was normalized to U6 expression (Assay ID 001973, Cat# 4427975). RNA-Seq. The RNA Integrity Number (RIN) for DNase-treated total RNA was assessed using Agilent BioAnalyzer RNA Nano Kit (#5067-1511; Agilent Technologies, Inc., Santa Clara, CA) and the RNA amount was assayed with the Invitrogen Qubit RNA HS Assay Kit (#Q32852; Therma Fisher Scientific, Waltham, MA). Samples with RIN > 7 were used in mRNA-seq library generation using the NEBNext® Ultra™ II Directional (stranded) RNA Library Prep Kit (#E7760L; Ipswich, MA) plus the NEBNext Poly (A) mRNA Magnetic Isolation Module (#E7490). Briefly, 200 ng total RNA was used as input. RNA fragmentation was set at 10 minutes for 12 PCR cycles and were used in final library generation. Library quantification and characterization was assessed with Agilent BioAnalyzer HS DNA Kit (#5067-4626) and the Docket No.103361-521WO1 Invitrogen Qubit DNA HS Assay Kit (#Q32854). Libraries were pooled together with other index – compatible RNA-seq libraries for sequencing on Illumina NovaSeq 6000 (San Diego, CA) paired-end 100bp flow cell to a minimum depth of 20 million clusters per sample. RNA-Seq analysis was performed by the Biomedical Informatics Shared Resource at The Ohio State University. Analysis was performed using in-house pipeline. Raw fastq was aligned to mouse reference genome GRCm38 with hisat2 v2.1.0. Gene wise counts were generated with featureCounts from the subread package v1.5.1 for genes annotated by ensembl Mus_musculus.GRCm38.102, counting the primary alignment in the case of multimapped reads. Raw counts were normalized by voom and differential expression was performed with limma. Genes were included if at least half of the samples had an expression of 2 CPM. Functional enrichment performed with Ingenuity Pathway Analysis to enrich for IPA Canonical pathways and with clusterProfiler to enrich for KEGG and GO terms. Immunohistochemistry on Heart Sections. The immunohistochemistry process commenced post-euthanization of mice as described above 10d post AAV.Cpt1a or AAV9. Emp injection. The dissected hearts were initially washed with ice-cold PBS. Subsequently, they were fixed overnight at 4 °C using pre-chilled 4% paraformaldehyde in PBS. The fixation was followed by a sequential overnight incubation: first in 15% sucrose in PBS, then in 30% sucrose in PBS, both at 4 °C. The fixed hearts were then embedded in O.C.T. compound and rapidly frozen in pre- chilled isopentane. The hearts were sectioned at 8-µm thickness using a cryostat. Following sectioning, the heart sections were allowed to air dry for 5 minutes, followed by three washes with PBS. They were then refixed with pre-chilled 4% paraformaldehyde in PBS on ice for 20 minutes and washed again three times with PBS. For permeabilization, 0.1% Triton X-100 in PBS was used for 20 minutes, followed by three more PBS washes. Blocking involved treating the sections with M.O.M mouse IgG blocking reagent (Vector Labs, cat# MKB-2213-1) for 1 hour, then with 3% BSA in PBS for an additional hour at room temperature. Primary antibody incubation was carried out overnight at 4 °C using antibodies against Phospho-Histone H3 (Ser10) (D2C8) XP (Rabbit mAb, Cell Signaling Technology, cat# 3377T, 1:200 dilution). The next day, the sections were washed three times with PBS and incubated with Wheat Germ Agglutinin (WGA) (Invitrogen, cat# W11261, 10.0 µg/mL) and secondary antibody Donkey anti-Rabbit Alexa Fluor™ 647 (Invitrogen, cat# A32795, 1:400 dilution) at room temperature for 1 hour. This was followed by three PBS washes before mounting the slides with Antifade Mounting Medium containing DAPI (Vector Labs, cat# H-1800). A cover slip was placed on each slide and sealed with nail polish and stored at 4°C in a light-protected environment. Finally, imaging was performed using a Nikon A1R confocal microscope with a 20x objective. Docket No.103361-521WO1 Statistical Analysis. Data is presented as mean±SEM. The first author had full access to all the data in the study and takes responsibility for its integrity and the data analysis. Comparisons between two mean values were performed using the Student’s t-test and among more than two mean values using one-way analysis of variance (ANOVA), 2-way ANOVA or mixed-effects ANOVA with Tukey’s multiple comparison post-hoc test as indicated. The statistical method utilized is indicated in each figure legend along with the individual n and p values. Means were said to be statistically significant at p<0.05. Example 3: Clinical Prospectives • CPT1a protein expression is increased in myocardium of male and female patients with heart failure due to NICM, and this shift in cardiac CPT1 isoforms is inverse to the shift in miR370 expression, as is consistent with miR370 regulation of CPT1a in mouse hearts. • Upregulation of CPT1a in response to pathological stress is an essential adaptive response, and increasing CPT1a expression in the failing heart significantly mitigates adverse pathological remodeling, resulting in improved cardiac metabolism and function. • Independent of effects on fatty acid oxidation, CPT1a expression induces the suppression of gene expression programs including but not limited to those involved in pathological remodeling. • Increased cardiac CPT1a in response to pathological stress is a critical and cardioprotective adaptation with augmented cardioprotection afforded by CPT1a overexpression. • CPT1a is shown to be a potential therapeutic target for heart failure that rescues contractile function when overexpressed after hypertrophic decompensation. The beneficial effects of cardiac specific, CPT1a gene delivery to failing hearts is a candidate gene therapy approach to mitigate adverse pathological remodeling that leads to overt heart failure. It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims. Docket No.103361-521WO1 TABLES Table 1 - Sequences for construction of AAV9 vectors Docket No.103361-521WO1 Docket No.103361-521WO1 Table 2 – Patient characteristics from samples collected at the University of Pennsylvania Table 3 – Patient characteristics from samples collected at the University of Utah Docket No.103361-521WO1 Table 4 – Antibodies Table 5 – Primer sequences
Docket No.103361-521WO1 Table 6 – Pathway enrichment analysis showing the genes modified in the indicated metabolic pathways by AAV9.Cpt1a (n=4) vs. PBS (n=3) measured 8 wks after sham surgery. Docket No.103361-521WO1
Docket No.103361-521WO1 SEQUENCES 1. SEQ ID NO: 1 - Calsequestrin 2- Cis Regulatory Module Sequence (CS-CRM4) GGCGCGCCAGTAGAAAAACAGCCAAGCTAGGGAGGCTGGGAGGCCAAGCCCCAGA TACCTTACATAGCTCTGCTCAGCCTCTGTCTCATTAGGAACTCCATTTTTAGGATGCA GTTGTTTCAGGCTAAAAATAAATCATGCAATGAATAAAAAAGTTAGATACGACACT GTAGAGGGATTCGCTGATACAGTCTGTCCGA ACGCGTG 2. SEQ ID NO: 2 - Cardiac troponin T (cTnT) promoter (mouse) AGGAGAGTGGCCATTCTTGAGTTACTTCCGCCAGCGGAAGGAAGGAGGCTACTTCT GTGAGGATGACATAGTGTGTGGCCTTGGGGCTCATGGAGAAGACTAGATACCCTCA CCAAGGCCTGCAGAGCCATCTATCTGCCTGAGGCCATTTGGCTCATGAGAAGCAGC CAGCAGCCCAGAGGACGTCATTACCCCCAGCCTCATTTCCAACAGTGTTCTTGTCCT TTGTTCCCTAGGACCTGGCTCAGAGGCTCGTGAAGTGTCTCTGAGGTTGACTTCTGC CCTCAACTCTGCTCCCAGCTTGCTCTTCTGGGCCTGGGCTCCTGGCATCTGCTTTATC GGGATTCTCAAGAGGGACAGCTGGTTTATGTTACAAGCCTGTTCCCTGCATATCTGC TCTGGTTTTAAATAGCTTTATCTGAGCAGCTGGAGGACCACATGAGCTTATATGGCG TGGGGTACTTGTTCTTTTAGCCCTGTGCCGGGCACCTGCCAAAATAGCAGCCAACAC CCCCCATTGTGTTGTTCCCCCCCCCCCCCATCTCCTGCTGCACATTCCTCCCTCCGCG GGGCTTGGCTCACAAGGCCCCAGCCCACATG 3. SEQ ID NO: 3 - Atrial natriuretic peptide (Anp), mouse (Forward) GAG CAA ATC CCG TAT ACA GTG C 4. SEQ ID NO: 4 - Atrial natriuretic peptide (Anp), mouse (Reverse) ATC TTC TAC CGG CAT CTT CTC C 5. SEQ ID NO: 5 - Carnitine palmitoyl transferase 1a (Cpt1a), human (Forward) GCAGCGTTCTTTGTGACGTT 6. SEQ ID NO: 6 - Carnitine palmitoyl transferase 1a (Cpt1a), human (Reverse) AGGAGTGTTCAGCGTTGAGG 7. SEQ ID NO: 7 - Carnitine palmitoyl transferase 1a (Cpt1a), mouse (Forward) GGC ATA AAC GCA GAG CAT TCC TG Docket No.103361-521WO1 8. SEQ ID NO: 8 - Carnitine palmitoyl transferase 1a (Cpt1a), mouse (Reverse) CAG TGT CCA TCC TCT GAG TAG C 9. SEQ ID NO: 9 - Carnitine palmitoyl transferase 1b (Cpt1b), human (Forward) GGA GTG AAC CCG AGC TGT G 10. SEQ ID NO: 10 - Carnitine palmitoyl transferase 1b (Cpt1b), human (Reverse) AGG AGA TGT CCA CGT TGC AG 11. SEQ ID NO: 11 - Carnitine palmitoyl transferase 1b (Cpt1b), mouse (Forward) GCG GAA GCA CAC CAG GCA GTA 12. SEQ ID NO: 12 - Carnitine palmitoyl transferase 1b (Cpt1b), mouse (Reverse) ATG TTT GGA AGC TAT AGA GCA 13. SEQ ID NO: 13 - Collagen, type 1, alpha 1 (Col1a1), mouse (Forward) CTG GCA CTC TTA AGG TCA TCT C 14. SEQ ID NO: 14 - Collagen, type 1, alpha 1 (Col1a1), mouse (Reverse) GTC CAG GGT CTC CTT TCA TTC 15. SEQ ID NO: 15 - Collagen, type 3, alpha 1 (Col3a1), mouse (Forward) GGT GGT ATA CTG AGA CAC CTT G 16. SEQ ID NO: 16 - Collagen, type 3, alpha 1 (Col3a1), mouse (Reverse) CCC AAG GAA AGG TAG GTG ATA G 17. SEQ ID NO: 17 - Myosin heavy chain beta (Myh7), mouse (Forward) ATG TGC CGG ACC TTG GAA G 18. SEQ ID NO: 18 - Myosin heavy chain beta (Myh7), mouse (Reverse) CCT CGG GTT AGC TGA GAG ATA A Docket No.103361-521WO1 19. SEQ ID NO: 19 - S29, human (Forward) TCT CGC TCT TGT CGT GTC TG 20. SEQ ID NO: 20 - S29, human (Reverse) TCC CAG TGA ACT TGG TGC TC 21. SEQ ID NO: 21 - S29, mouse (Forward) TCT GAT CCG TAA ATA CGG GC 22. SEQ ID NO: 22 - S29, mouse (Reverse) CTG TGT GCG CAA AGA CTA GC 23. SEQ ID NO: 23 – CS-CRM-CPT1A gcggccgcaCGCGTCCAGTAGAAAAACAGCCAAGCTAGGGAGGCTGGGAGGCCAAGCC CCAGATACCTTACATAGCTCTGCTCAGCCTCTGTCTCATTAGGAACTCCATTTTTAG GATGCAGTTGTTTCAGGCTAAAAATAAATCATGCAATGAATAAAAAAGTTAGATAC GACACTGTAGAGGGATTCGCTGATACAGTCTGTCCGAACGCGTGTctagagcagtctgggcttt cacaagacagcatttggggctgcggcagagggtcgggtccgaagcgctgccttatcagcgtccccagccctgggaggtgacaaaaggc tggcttgtgtcagcccctcgggcactcacgtatctccatccgacgggtttaaaatagcaaaactctgaggccacacaatagcttgggcttata tgggctcctgtgggggaagggggagcacggagggggccggggccgctgctgccaaaatagcagctcacaagtgttgcattcctctctg ggcgccgggcacattcctgctggctctgcccgccccggggtgggcgccggggggaccttaaagcctctgccccccaaggagcccttcc cagacagccgccggcacccaccgctccgtgggacctaagcttaCCGGTGCCACCATGGCAGAGGCTCACCA AGCTGTGGCCTTCCAGTTCACAGTCACCCCTGATGGCATCGATCTCCGCCTGAGCCA TGAAGCCCTCAAACAGATCTGCCTGTCAGGGCTGCACTCCTGGAAGAAGAAGTTCA TCCGATTCAAGAATGGCATCATCACTGGTGTGTTCCCCGCGAGTCCCTCCAGCTGGC TTATCGTGGTGGTGGGTGTGATATCATCCATGCATACCAAAGTGGACCCCTCCCTGG GCATGATTGCAAAGATCAATCGGACCCTAGACACCACTGGCCGCATGTCAAGCCAG ACGAAGAACATCGTGAGTGGCGTCCTCTTTGGCACAGGGCTCTGGGTGGCGATCAT CATGACTATGCGCTACTCGCTGAAGGTGCTGCTCTCCTACCATGGCTGGATGTTTGC AGAGCACGGCAAAATGAGCCGCAGCACCAGAATCTGGATGGCTATGGTCAAGGTCT TCTCGGGTCGAAAGCCCATGTTGTACAGCTTCCAGACGTCTCTGCCGCGCCTGCCTG TCCCAGCTGTCAAAGATACCGTGAGCAGGTACCTGGAGTCTGTGAGGCCACTGATG AAGGAGGGAGACTTCCAACGCATGACAGCACTGGCCCAGGATTTTGCTGTCAACCT TGGACCCAAATTGCAGTGGTATTTGAAGCTAAAATCCTGGTGGGCCACAAATTATG Docket No.103361-521WO1 TGAGTGACTGGTGGGAGGAATACATCTACCTGCGGGGCCGAGGGCCGATCATGGTT AACAGCAACTACTACGCCATGGAGATGCTCTACATCACCCCAACCCATATTCAGGC AGCGAGAGCTGGCAACACCATCCACGCCATACTGCTGTATCGTCGCACGGTAGACC GTGAGGAACTCAAACCTATTCGTCTTCTGGGATCTACAATTCCCCTCTGCTCTGCTC AGTGGGAGCGACTCTTCAATACTTCCCGCATCCCTGGGGAGGAGACAGACACCATC CAACACGTCAAGGACAGCAGGCACATTGTCGTGTACCACAGAGGCCGTTACTTCAA GGTCTGGCTCTACCATGACGGGAGGCTGCTGAGGCCCCGTGAGCTGGAGCAGCAGA TGCAGCAGATCCTGGATGACACCTCAGAGCCGCAGCCCGGGGAAGCCAAGCTTGCC GCCCTCACTGCCGCAGACAGAGTGCCCTGGGCGAAGTGTCGGCAGACCTATTTTGC ACGAGGAAAAAATAAGCAATCTCTGGATGCGGTAGAAAAGGCAGCATTCTTCGTGA CGTTGGACGAATCGGAACAGGGATATAGAGAGGAGGACCCTGAGGCATCTATTGAC AGCTATGCCAAATCTCTGCTGCATGGTAGATGTTTCGACAGGTGGTTTGACAAGTCC ATCACCTTTGTTGTCTTCAAAAACAGCAAGATAGGCATAAACGCAGAGCATTCCTG GGCGGACGCGCCCATCGTGGGCCATCTGTGGGAGTATGTCATGGCCACCGACGTCT TCCAGCTGGGCTACTCAGAGGATGGACACTGTAAAGGAGACAAGAACCCCAACATC CCCAAACCCACCAGGCTACAGTGGGACATTCCAGGAGAATGCCAGGAGGTCATAGA GACATCCCTAAGCAGTGCCAGTTTTTTGGCAAATGATGTGGACCTGCATTCCTTCCC ATTTGACACCTTTGGCAAAGGCTTGATCAAGAAGTGCCGGACGAGTCCCGATGCCT TCATCCAGCTGGCACTGCAGCTCGCACATTACAAGGACATGGGCAAGTTCTGCCTC ACGTATGAGGCTTCCATGACTCGGCTCTTCCGAGAGGGGAGGACAGAGACTGTACG CTCCTGCACTACGGAGTCCTGCAACTTTGTGCTGGCCATGATGGACCCCACAACAAC GGCAGAGCAGAGGTTCAAGCTGTTCAAGATAGCTTGTGAAAAGCACCAGCACCTGT ACCGCCTCGCCATGACGGGCGCTGGCATCGACCGCCACCTCTTCTGCCTCTATGTGG TGTCCAAGTATCTGGCAGTCGACTCACCTTTCCTGAAGGAGGTACTGTCTGAGCCAT GGAGGTTGTCCACGAGCCAGACTCCTCAGCAGCAGGTGGAACTGTTTGACTTTGAG AAATACCCTGACTATGTGTCCTGTGGCGGGGGCTTTGGGCCGGTTGCTGATGACGGC TATGGTGTTTCCTACATTATTGTGGGAGAGAATTTCATCCACTTCCATATTTCTTCCA AGTTCTCTAGCCCTGAGACAGACTCACACCGCTTTGGGAAGCACTTGAGACAAGCC ATGATGGACATTATCACCTTGTTTGGCCTCACCGCCAATTCCAAAAAGTAACcatggccc aacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttg tccaaactcatcaatgtatcttatcatgtctggatctccggacacgtgcggaccgagcggccgc CS-CRM4 bp 17-215 Chicken cardiac Troponin T promoter bp 222-628 Cpt1a bp 647-2968 Docket No.103361-521WO1 SV40pA-144bp bp 2970-3113 24. SEQ ID NO: 24 – Cpt1a (mouse) ATGGCAGAGGCTCACCAAGCTGTGGCCTTCCAGTTCACAGTCACCCCTGATGGCATC GATCTCCGCCTGAGCCATGAAGCCCTCAAACAGATCTGCCTGTCAGGGCTGCACTCC TGGAAGAAGAAGTTCATCCGATTCAAGAATGGCATCATCACTGGTGTGTTCCCCGC GAGTCCCTCCAGCTGGCTTATCGTGGTGGTGGGTGTGATATCATCCATGCATACCAA AGTGGACCCCTCCCTGGGCATGATTGCAAAGATCAATCGGACCCTAGACACCACTG GCCGCATGTCAAGCCAGACGAAGAACATCGTGAGTGGCGTCCTCTTTGGCACAGGG CTCTGGGTGGCGATCATCATGACTATGCGCTACTCGCTGAAGGTGCTGCTCTCCTAC CATGGCTGGATGTTTGCAGAGCACGGCAAAATGAGCCGCAGCACCAGAATCTGGAT GGCTATGGTCAAGGTCTTCTCGGGTCGAAAGCCCATGTTGTACAGCTTCCAGACGTC TCTGCCGCGCCTGCCTGTCCCAGCTGTCAAAGATACCGTGAGCAGGTACCTGGAGTC TGTGAGGCCACTGATGAAGGAGGGAGACTTCCAACGCATGACAGCACTGGCCCAGG ATTTTGCTGTCAACCTTGGACCCAAATTGCAGTGGTATTTGAAGCTAAAATCCTGGT GGGCCACAAATTATGTGAGTGACTGGTGGGAGGAATACATCTACCTGCGGGGCCGA GGGCCGATCATGGTTAACAGCAACTACTACGCCATGGAGATGCTCTACATCACCCC AACCCATATTCAGGCAGCGAGAGCTGGCAACACCATCCACGCCATACTGCTGTATC GTCGCACGGTAGACCGTGAGGAACTCAAACCTATTCGTCTTCTGGGATCTACAATTC CCCTCTGCTCTGCTCAGTGGGAGCGACTCTTCAATACTTCCCGCATCCCTGGGGAGG AGACAGACACCATCCAACACGTCAAGGACAGCAGGCACATTGTCGTGTACCACAGA GGCCGTTACTTCAAGGTCTGGCTCTACCATGACGGGAGGCTGCTGAGGCCCCGTGA GCTGGAGCAGCAGATGCAGCAGATCCTGGATGACACCTCAGAGCCGCAGCCCGGG GAAGCCAAGCTTGCCGCCCTCACTGCCGCAGACAGAGTGCCCTGGGCGAAGTGTCG GCAGACCTATTTTGCACGAGGAAAAAATAAGCAATCTCTGGATGCGGTAGAAAAGG CAGCATTCTTCGTGACGTTGGACGAATCGGAACAGGGATATAGAGAGGAGGACCCT GAGGCATCTATTGACAGCTATGCCAAATCTCTGCTGCATGGTAGATGTTTCGACAGG TGGTTTGACAAGTCCATCACCTTTGTTGTCTTCAAAAACAGCAAGATAGGCATAAAC GCAGAGCATTCCTGGGCGGACGCGCCCATCGTGGGCCATCTGTGGGAGTATGTCAT GGCCACCGACGTCTTCCAGCTGGGCTACTCAGAGGATGGACACTGTAAAGGAGACA AGAACCCCAACATCCCCAAACCCACCAGGCTACAGTGGGACATTCCAGGAGAATGC CAGGAGGTCATAGAGACATCCCTAAGCAGTGCCAGTTTTTTGGCAAATGATGTGGA CCTGCATTCCTTCCCATTTGACACCTTTGGCAAAGGCTTGATCAAGAAGTGCCGGAC GAGTCCCGATGCCTTCATCCAGCTGGCACTGCAGCTCGCACATTACAAGGACATGG Docket No.103361-521WO1 GCAAGTTCTGCCTCACGTATGAGGCTTCCATGACTCGGCTCTTCCGAGAGGGGAGG ACAGAGACTGTACGCTCCTGCACTACGGAGTCCTGCAACTTTGTGCTGGCCATGATG GACCCCACAACAACGGCAGAGCAGAGGTTCAAGCTGTTCAAGATAGCTTGTGAAAA GCACCAGCACCTGTACCGCCTCGCCATGACGGGCGCTGGCATCGACCGCCACCTCTT CTGCCTCTATGTGGTGTCCAAGTATCTGGCAGTCGACTCACCTTTCCTGAAGGAGGT ACTGTCTGAGCCATGGAGGTTGTCCACGAGCCAGACTCCTCAGCAGCAGGTGGAAC TGTTTGACTTTGAGAAATACCCTGACTATGTGTCCTGTGGCGGGGGCTTTGGGCCGG TTGCTGATGACGGCTATGGTGTTTCCTACATTATTGTGGGAGAGAATTTCATCCACT TCCATATTTCTTCCAAGTTCTCTAGCCCTGAGACAGACTCACACCGCTTTGGGAAGC ACTTGAGACAAGCCATGATGGACATTATCACCTTGTTTGGCCTCACCGCCAATTCCA AAAAGTAA 25. SEQ ID NO: 25 – SV40pA Catggcccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctag ttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatct 26. SEQ ID NO: 26 - miR370 (mouse) AGACGGAGAGACCAGGTCACGTCTCTGCAGTTACACAGCTCATGAGTGCCTGCTGG GGTGGAACCTGGTTTGTCTGTCT

Claims

Docket No.103361-521WO1 CLAIMS What is claimed is: 1. A method of treating or preventing a cardiovascular disease in a subject, the method comprising administering a pharmaceutically effective amount of a composition comprising a nucleic acid encoding a carnitine palmitoyltransferase 1a (CPT1a) protein and pharmaceutically acceptable carrier, wherein the composition increases expression of the CPT1a protein in the subject relative to an untreated subject. 2. The method of claim 1, wherein the composition comprises a viral vector selected from an adeno-associated viral (AAV) vector, an adenoviral (AV) vector, a lentiviral vector, and a retroviral vector. 3. The method of claim 2, wherein the AAV vector comprises an AAV9 serotype. 4. The method of any one of claims 1-3, wherein the composition further comprises a nucleic acid encoding a cardiac-specific promoter. 5. The method of claim 4, wherein the cardiac-specific promoter comprises cardiac troponin T (cTnT). 6. The method of any one of claims 1-5, wherein the pharmaceutically acceptable carrier comprises a nucleic acid delivery vehicle, excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or a combination thereof. 7. The method of any one of claims 1-6, wherein the composition is administered intravenously. 8. The method of any one of claims 1-7, wherein the cardiovascular disease comprises myocardial infarction (heart attack), heart failure, coronary heart disease heart valve complications, high blood pressure, peripheral artery disease, aortic disease, pericardial disease congenital heart disease. 9. The method of any one of claims 1-8, wherein the method prevents or reverses pathological heart symptoms or functions selected from cardiac hypertrophy, cardiac fibrosis, cell death, Docket No.103361-521WO1 reduced cardiac output, reduced ejection fraction, enlarged heart chambers, narrowed heart chambers. 10. The method of any one of claims 1-9, wherein the subject is a human or a rodent.
EP24816514.4A 2023-05-31 2024-05-31 Cpt1 gene therapy and methods for treating or preventing cardiovascular diseases Pending EP4719493A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202363505085P 2023-05-31 2023-05-31
US202363520161P 2023-08-17 2023-08-17
PCT/US2024/031879 WO2024249772A2 (en) 2023-05-31 2024-05-31 Cpt1 gene therapy and methods for treating or preventing cardiovascular diseases

Publications (1)

Publication Number Publication Date
EP4719493A2 true EP4719493A2 (en) 2026-04-08

Family

ID=93658770

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24816514.4A Pending EP4719493A2 (en) 2023-05-31 2024-05-31 Cpt1 gene therapy and methods for treating or preventing cardiovascular diseases

Country Status (2)

Country Link
EP (1) EP4719493A2 (en)
WO (1) WO2024249772A2 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017054086A1 (en) * 2015-10-01 2017-04-06 Exerkine Corporation Treatment of genetic myopathies using bioengineered exosomes
MX2022009883A (en) * 2020-02-13 2022-10-03 Tenaya Therapeutics Inc Gene therapy vectors for treating heart disease.

Also Published As

Publication number Publication date
WO2024249772A2 (en) 2024-12-05
WO2024249772A3 (en) 2025-01-16

Similar Documents

Publication Publication Date Title
US12616713B2 (en) Methods for enhancing vascular density
Li et al. MicroRNA-214 suppresses gluconeogenesis by targeting activating transcriptional factor 4
US20210079392A1 (en) Inhibition of mir-22 mirna by apt-110
Huang et al. Cardiomyocyte-enriched protein CIP protects against pathophysiological stresses and regulates cardiac homeostasis
WO2012065027A2 (en) Compositions, kits and methods for treatment of cardiovascular, immunological, and inflammatory diseases
JP6978774B2 (en) Pharmaceutical composition for the prevention or treatment of heart failure
JP7193874B2 (en) Treatment of heart disease by inhibition of muscle A kinase anchor protein (mAKAP) action
Ni et al. PKM2 deficiency exacerbates gram-negative sepsis-induced cardiomyopathy via disrupting cardiac calcium homeostasis
Wei et al. Tert promotes cardiac regenerative repair after MI through alleviating ROS-induced DNA damage response in cardiomyocyte
US11261434B2 (en) Telomerase reverse transcriptase-based therapies for treatment of conditions associated with myocardial infarction
US20220249623A1 (en) Vectors and methods for regenerative therapy
WO2008143637A2 (en) Compositions and methods for making therapies delivered by viral vectors reversible for safety or allele-specificity
WO2024249772A2 (en) Cpt1 gene therapy and methods for treating or preventing cardiovascular diseases
Bell et al. Adrenomedullin gene delivery is cardio-protective in a model of chronic nitric oxide deficiency combining pressure overload, oxidative stress and cardiomyocyte hypertrophy
Fan et al. Leucine zipper protein 1 attenuates pressure overload-induced cardiac hypertrophy through inhibiting Stat3 signaling
US20190381125A1 (en) Methods of Treating Angiogenesis-Related Disorders Using JNK3 Inhibitors
US20250163420A1 (en) Promotion of Cardiomyocyte Proliferation and Regenerative Treatment of the Heart by Inhibition of microRNA-128
EP1977747A1 (en) Adaptive cardiac remodeling by beta-catenin downregulation
US8496928B2 (en) Method for preventing and treating cardiovascular diseases with BRCA1
Ambler et al. Prolonged administration of a dithiol antioxidant protects against ventricular remodeling due to ischemia-reperfusion in mice
Cheng ATF3 protects against pressure overload heart failure via autophagy molecule

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20251230

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR