EP4705463A1

EP4705463A1 - Interfering rna biopesticide compositions and methods of use

Info

Publication number: EP4705463A1
Application number: EP24800641.3A
Authority: EP
Inventors: Molly Duman SCHEEL; Keshava MYSORE
Original assignee: Indiana University; Indiana University Bloomington
Current assignee: Indiana University; Indiana University Bloomington
Priority date: 2023-05-03
Filing date: 2024-05-03
Publication date: 2026-03-11
Also published as: WO2024229320A1

Abstract

Disclosed herein are methods for producing microbial biopesticide compositions comprising interfering RNA targeting insect pests, such as invasive Drosophila species. In addition, disclosed are methods of contacting such insect pests with a microbial cell comprising interfering RNA, such as a yeast cell engineered to produce disclosed interfering RNA, effective to disrupt the expression of insect pest genes, thereby causing toxicity and undermining the fitness of the pests. Also disclosed are compositions of such biopesticides, alone and in combination with additional insecticides, attractants, and phagostimulants, such as attractive targeted sugar baits.

Description

INTERFERING RNA BIOPESTICIDE COMPOSITIONS AND METHODS OF USE

FIELD OF THE INVENTION

[0001] This disclosure generally relates to nucleic acid molecules, such as interfering RNA, for targeting and inhibiting the expression of specific pest genes, such as by RNA interference. The disclosure also relates to compositions comprising interfering RNA in combination with microbial cells, such as microbial cells producing the interfering RNA, and additional insecticidal or attractive elements. The disclosure further relates to methods of contacting insect pests with a microbial cell comprising interfering RNA to inhibit expression of specific pest genes, thereby undermining the fitness and/or survival of such pests.

BACKGROUND

[0002] Drosophila suzukii, also known as spotted wing drosophila (SWD), is an invasive vinegar fly of East Asian origin with a global reach. The pest has wreaked havoc on various crops worldwide, disrupting, in particular, production of fruit and wine. Weekly insecticide applications are necessary in locations where SWD are well-established, which results in substantial economic cost. Additionally, application of broad-spectrum insecticide results in detrimental environmental effects from disruptions in untargeted organism populations. In addition to posing risks to environmental and consumer safety, increased use of insecticides will inevitably select for resistant populations of SWD and other pests. Accordingly, the development of new strategies for controlling SWD, e g., providing improved classes of biorational pesticides and cost-effective technologies, is critical for multiple reasons.

[0003] The application of RNA interference (RNAi) to pest management is one strategy that has various advantages over broad-spectrum insecticides. For example, provided its sequence- dependent mechanism of action, RNAi may be tailored to target unique mRNA sequences within pest species, thereby sparing beneficial organisms. However, RNAi pesticides can also be designed to target a broad range of insects by selecting sequences that are highly conserved between more than one target organism. Additionally, RNA is biodegradable and can be efficiently produced within microorganisms.

[0004] While various approaches have been explored to control insect pests, including RNAi, many suffer drawbacks that limit their application in the field. There exists a need to specifically target insect pests, such as at the species level, to prevent propagation of pesticide resistance and disruption of other insect populations. From a manufacturing perspective, there is a need to cost- effectively produce such an insecticide at scale. Additionally, favorable storage stability of the insecticide is necessary, e.g., to enable shipment and storage without concerns over poor stability and efficacy. Improved biopesticides would reduce crop loss, the cost of insecticides, and broadspectrum insecticide use, thereby promoting environmental and economic vitality of the agricultural community and society at large. Aspects of the invention disclosed herein address these needs.

INCORPORATION BY REFERENCE

[0005] Each patent, publication, and non-patent literature cited in the application is hereby incorporated by reference in its entirety as if each was incorporated by reference individually, and as if each is fully set forth herein. However, where such reference is made, and whether to patents, publications, non-patent literature, or other sources of information, it is for the general purpose of providing context for discussing features of the invention. Accordingly, unless specifically stated otherwise, the reference is not to be construed as an admission that the document or underlying information, in any jurisdiction, is prior art, or forms part of the common general knowledge in the art.

SUMMARY OF THE INVENTION

[0006] A first aspect of the invention includes interfering RNA which has a nucleotide sequence which is partially or perfectly complementary to mRNA transcribed from a target DNA sequence within a target gene and which inhibits gene expression of the target gene and/or the production of a protein encoded by the target gene in a Drosophila fly pest by RNA interference. [0007] A second aspect of the invention includes an expression cassette which has a polynucleotide sequence which encodes interfering RNA having a nucleotide sequence which is partially or perfectly complementary to mRNA transcribed from a target DNA sequence within a target gene and which inhibits gene expression of the target gene and/or the production of a protein encoded by the target gene in a Drosophila fly pest by RNA interference.

[0008] A third aspect of the invention includes a microbial cell which has an expression cassette including a polynucleotide sequence which encodes interfering RNA having a nucleotide sequence which is partially or perfectly complementary to mRNA transcribed from a target DNA sequence within a target gene and which inhibits gene expression of the target gene and/or the production of a protein encoded by the target gene in a Drosophila fly pest by RNA interference.

[0009] A fourth aspect of the invention includes a composition having an expression cassette which includes a polynucleotide sequence which encodes interfering RNA having a nucleotide sequence which is partially or perfectly complementary to mRNA transcribed from a target DNA sequence within a target gene and which inhibits gene expression of the target gene and/or the production of a protein encoded by the target gene in a Drosophila fly pest by RNA interference. [0010] A fifth aspect of the invention includes methods for controlling a Drosophila fly pest, which include contacting the Drosophila fly pest with an interfering RNA molecule which has a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target DNA sequence within a target gene and which inhibits gene expression of the target gene and/or the production of a protein encoded by the target gene in a Drosophila fly pest by RNA interference.

[0011] A first embodiment is an interfering ribonucleic acid that includes a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a target DNA sequence having 88%, 92%, 96%, or 100% identity to a) the entire length of SEQ ID NO: 1, SEQ ID NO:2, or SEQ ID NO:3, and wherein the interfering RNA inhibits the production of polyglutamine-repeat protein pqn-41 or an ortholog thereof in a Drosophila fly pest by RNA interference; or b) the entire length of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, and wherein the interfering RNA inhibits the production of potassium voltage-gated channel protein Shaker in a Drosophila fly pest by RNA interference. [0012] A second embodiment is an interfering RNA which is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide, preferably an shRNA.

[0013] A third embodiment is the interfering RNA having a nucleotide sequence of 25 contiguous nucleotides.

[0014] A fourth embodiment is the interfering RNA having a nucleotide sequence which is partially or perfectly complementary to mRNA transcribed from a target DNA sequence in a

Drosophila fly pest which is any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila bipectinate, Drosophila elegans, Drosophila kikkawai, Drosophila melanogaster,

Drosophila sinndans, Drosophila suzukii, and Drosophila takahashii.

[0015] A fifth embodiment is interfering RNA having a nucleotide sequence which is partially or perfectly complementary to mRNA transcribed from a target DNA sequence in the Drosophila fly pest Drosophila suzukii and which inhibits the expression of poly glutamine-repeat protein pqn- 41 (LOC108012261).

[0016] A sixth embodiment is interfering RNA having a nucleotide sequence which is partially or perfectly complementary to mRNA transcribed from a target DNA sequence in the Drosophila fly pest Drosophila suzukii and which inhibits the expression of potassium voltage-gated channel protein Shaker (LOCI 08016735).

[0017] A seventh embodiment is an expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence which encodes the interfering RNA molecule as described herein, e.g., in any of the preceding embodiments.

[0018] An eighth embodiment is an expression cassette which has a regulatory sequence operably linked to a nucleotide sequence which encodes an interfering RNA molecule that includes a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a DNA sequence having 88%, 92%, 96%, or 100% identity to a) the entire length of any one of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, and wherein the interfering RNA inhibits the production of poly glutamine-repeat protein pqn-41 or an ortholog thereof in a Drosophila fly pest by RNA interference; or b) the entire length of any one of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and wherein the interfering RNA inhibits the production of potassium voltage-gated channel protein Shaker in a Drosophila fly pest by RNA interference. [0019] A ninth embodiment is an expression cassette which has a nucleotide sequence which encodes an interfering RNA molecule including 25 nucleotides which are partially or perfectly complementary to a mRNA transcribed from the entire length of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0020] A tenth embodiment is an expression cassette which has a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of a) SEQ ID NO:7 or the complement thereof; or b) SEQ ID NO:8 or the complement thereof.

[0021] An eleventh embodiment is an expression cassette which has a regulatory sequence having a GPD promoter.

[0022] A twelfth embodiment is an expression cassette which is integrated into the genomic DNA of Saccharomyces cerevisiae.

[0023] A thirteenth embodiment is a microbial cell including an expression cassette as described herein, e.g., in any of the preceding embodiments.

[0024] A fourteenth embodiment is a microbial cell which has an expression cassette integrated into the genomic DNA of a microbial cell.

[0025] A fifteenth embodiment is a microbial cell which has an expression cassette integrated into its genomic DNA, wherein the microbe is Escherichia coli or Saccharomyces cerevisiae.

[0026] A sixteenth embodiment is a composition including any one or more of an interfering RNA, an expression cassette, or a microbial cell as described herein, e.g., in any of the preceding embodiments.

[0027] A seventeenth embodiment is a composition which has an expression cassette which includes a promoter operably linked to a DNA sequence encoding an interfering RNA molecule which is partially or perfectly complementary to a target sequence in a target gene, wherein the target gene encodes polyglutamine-repeat protein pqn-41 or potassium voltage-gated channel protein Shaker in a Drosophila fly pest and the interfering RNA specifically inhibits expression of the target gene.

[0028] An eighteenth embodiment is a composition which includes an interfering RNA which is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide, preferably an shRNA.

[0029] A nineteenth embodiment is a composition which includes an expression cassette which includes a promoter operably linked to a DNA sequence encoding an interfering RNA molecule which is partially or perfectly complementary to a target DNA sequence in a target gene in a Drosophila fly pest which is any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila bipectinate, Drosophila elegans, Drosophila kikkawai, Drosophila melanogaster, Drosophila simulans, Drosophila suzukii, and Drosophila takahashii, preferably Drosophila suzukii.

[0030] A twentieth embodiment is a composition which includes an expression cassette which includes a promoter operably linked to a DNA sequence encoding an interfering RNA molecule which is partially or perfectly complementary to a target sequence in a target gene which is is 88%, 92%, 96%, or 100% identical to the entire length of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0031] A twenty-first embodiment is a composition which includes an expression cassette which has a nucleotide sequence with at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of a) SEQ ID NO: 7 or the complement thereof; or b) SEQ ID NO: 8 or the complement thereof. [0032] A twenty-second embodiment is a composition which includes an expression cassette which includes the entire length of SEQ ID NO: 7 and SEQ ID NO: 8.

[0033] A twenty-third embodiment is a composition which includes interfering RNA which has a nucleotide sequence of at least 25 contiguous nucleotides which are partially or perfectly complementary to mRNA transcribed from the entire length of SEQ ID NO: 1, SEQ ID NO:2, or SEQ ID NO:3, and wherein the interfering RNA is capable of inhibiting the expression of polyglutamine-repeat protein pqn-41 (LOCI 08012261) in Drosophila suzukii.

[0034] A twenty-fourth embodiment is a composition which includes interfering RNA which has a nucleotide sequence of at least 25 contiguous nucleotides which are partially or perfectly complementary to a portion of mRNA transcribed from SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, and wherein the interfering RNA is capable of inhibiting the expression of potassium voltage-gated channel protein Shaker (LOCI 08016735) in Drosophila suzukii.

[0035] A twenty-fifth embodiment is a composition which includes an expression cassette which is integrated into the genome of a yeast cell, preferably Saccharomyces cerevisiae.

[0036] A twenty-sixth embodiment is a composition which includes a yeast cell which is killed by heat and/or lyophilized.

[0037] A twenty-seventh embodiment is a composition which includes a sugar bait.

[0038] A twenty-eight embodiment is a composition which includes a sugar bait including sugar and any one or more of at least one pheromone, at least one attractive symbiont, preferably Saccharomyces cerevisiae and/or Hanseniaspora uvarum, and at least one insecticide.

[0039] A twenty-ninth embodiment is a composition which is present within a trap.

[0040] A thirtieth embodiment is a composition which is selectively insecticidal to a

Drosophila fly pest. [0041] A thirty-first embodiment is a method for controlling a Drosophila fly pest, which includes contacting the pest with an interfering RNA, an expression cassette, a microbial cell, or a composition, as described herein, e.g., in any of the preceding embodiments, thereby controlling the Drosophila fly pest.

[0042] A thirty-second embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which includes a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target sequence within a target gene and which specifically inhibits expression of the target gene in the Drosophila fly pest, thereby controlling the Drosophila fly pest, wherein the target gene encodes polyglutamine-repeat protein pqn-41 or potassium voltage-gated channel protein Shaker. [0043] A thirty-third embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide, preferably an shRNA.

[0044] A thirty-fourth embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which includes a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target sequence within the target gene which has at least 84%, 88%, 92%, or 96% identity to the entire length of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0045] A thirty-fifth embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which includes a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target sequence within a target gene, wherein the target sequence is SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NON, SEQ ID NON, SEQ ID NO:5, or SEQ ID NO:6.

[0046] A thirty-sixth embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which is produced by a microbial cell which includes an expression cassette which includes a regulatory sequence operably linked to a nucleotide sequence encoding the interfering RNA, wherein the expression cassette is integrated into the genome of the microbial cell.

[0047] A thirty-seventh embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which is produced by a microbial cell having an expression cassette which includes a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of SEQ ID NO: 7 or the complement thereof; or SEQ ID NO: 8 or the complement thereof.

[0048] A thirty-eighth embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which is produced by a microbial cell having an expression cassette which includes nucleotide sequences identical to the entire length of SEQ ID NO:7 and SEQ ID NO:8 or the complement thereof.

[0049] A thirty-ninth embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with a microbial cell, which is dead or alive.

[0050] A fortieth embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with Saccharomyces cerevisiae, which is dead or alive.

A forty-first embodiment is a method for controlling a Drosophila fly pest which is any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila bipectinate, Drosophila elegans, Drosophila kikkawai, Drosophila melanogaster, Drosophila simulans, Drosophila suzukii, and Drosophila takahashii, preferably Drosophila suzukii.

[0051] A forty-second embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which includes a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target sequence within a target gene which encodes Drosophila suzukii polyglutamine-repeat protein pqn-41 (LOC108012261).

[0052] A forty-third embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which includes a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target sequence within a target gene which encodes Drosophila suzukii potassium voltage-gated channel protein Shaker (LOCI 08016735).

[0053] A forty-fourth embodiment is a method for controlling a Drosophila fly pest, which includes contacting the Drosophila fly pest with an interfering RNA molecule which includes at least 25 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to a portion of mRNA transcribed from any one of a) SEQ ID NO:1 or SEQ ID NO:2, and wherein the interfering RNA inhibits the expression of Drosophila suzukii polyglutamine-repeat protein pqn-41 (Gene ID: 108012261) and/or Drosophila elegans sex determination protein fox-1 (LOC108150175) by RNA interference; and b) SEQ ID NO:3, and wherein the interfering RNA inhibits the expression of polyglutamine-repeat protein pqn-41 or an ortholog thereof in any one or more of Drosophila biarmipes (LOCI 08034786), Drosophila ananassae (LOC6493466), Drosophila takahashii (LOC 108060998), Drosophila kikkawai (LOCI 08071906), and Drosophila bipectinata RNA binding protein fox-1 homolog 1

(LOCI 08119065) by RNA interference.

BRIEF DESCRIPTION OF THE FIGURES

[0054] The accompanying drawings are included to provide a further understanding of the disclosure and are incorporated in and constitute a part of this specification, illustrate embodiments, and together with the description serve to explain the principles of the disclosure.

[0055] FIG 1. Exemplary DNA sequence encoding shRNA for inhibition of polyglutamine- repeat protein pqn-41 in Drosophila suzukii (top strand corresponds to SEQ ID NO: 7 and bottom strand corresponds to SEQ ID NO: 8).

[0056] FIG 2. Bar graph shows insecticidal activity (percent mortality) of a sugar solution (ASB), a sugar solution containing unmodified yeast (Control), and a sugar solution containing yeast strain DsuzRbfoxl-A in Drosophila suzukii.

DETAILED DESCRIPTION

[0057] Current strategies to control Drosophila fly pests, such as spotted wing Drosophila (SWD), have detrimental environmental and economic consequences. For example, the application of chemical insecticides can lead to adverse environmental effects resulting from loss of non-target organisms, such as bees and other pollinators. Alternative strategies for SWD control include use of botanical repellents, distractive mulches, insect netting, introduction of natural enemies, and planting alternative host plants to prevent fruit infestations.

[0058] An emerging strategy for fly pest control entails introducing, such as by oral administration to the pest, interfering RNA (iRNA) that is effective to inhibit the expression of genes implicated in the fitness and/or survival by RNA interference (RNAi). One theoretical advantage of iRNA pesticides, which may also be referred to as iRNA biopesticides, is target specificity. That is, inhibiting expression of an organism-specific gene should result in selective toxicity for the target organism, such as SWD, without observable impact to non-target organisms. Accordingly, such selectivity would not be expected to contribute to broad-spectrum toxicity and selection of insecticide-resistant organisms.

[0059] RNA interference (RNAi) is activated when an organism recognizes double-stranded RNA (dsRNA) molecules and hydrolyzes them. In addition to their use of Argonaute family proteins, a common thread among RNAi-related pathways is their dependence on sequencespecific binding between short interfering RNAs (approximately 20 to 30 nucleotides) and target sequences (Obbard et al., Philos. Trans. R. Soc. Land. B. Biol. Sci. 2009; 364:99-115). Oral administration of dsRNA, such as comprising iRNA, to insects and its absorption into the cells that line the midgut can activate the RNAi pathway. Exogenous RNA constructs, such as dsRNA and small or short hairpin RNA (shRNA), are usually processed into 20-30 nucleotide duplexes by the ribonuclease III enzyme DICER. See, e.g., Kim & Rossi, Biotechniques . 2008 Apr; 44(5): 613-616 and Sheng et al., Front Bioeng Biotechnol. 2020 Aug 7;8:940. These nucleotide duplexes are then incorporated into the RNA induced silencing complex (RISC) by the catalytic component Argonaute. The two strands of RNA are unwound, and one strand is used as a guide strand, which binds to complementary mRNAs. The RISC complex will cleave the mRNA when base pair matching is perfectly complementary, or the complex can bind to the intact mRNA and suppress translation when there are mismatched base pairs, thereby mediating degradation or suppression of the endogenous transcript. Degradation or suppression of transcripts that code for essential genes in the insect may result in decreased amounts of critical gene products, reduced fitness, and increased mortality. See, e.g., Zotti & Smagghe, Neotrop Entomol. 2015 Jun;44(3): 197-213 and Burand & Hunter, J Invertebr Pathol. 2013 Mar;112 Suppl:S68-74. [0060] Various strategies have been explored to deliver iRNA biopesticides to a desired target insect pest population. However, oral administration of iRNA, in contrast to, e.g., injection, has clear advantages for delivery in the field. As examples, the feasibility of delivering iRNA to a target organism has been explored using naked double stranded RNA (dsRNA), dsRNA combined with a transfection reagent, and nucleic acid molecules mixed with an artificial diet. See, e.g., Taning et al., Journal of Pest Science April 2016;89:803-814. Improved strategies, such as those described herein, additionally exploit the phagostimulant activity, i.e., sustained feeding, of fly pests with certain yeasts.

[0061] Leveraging the Drosophila-atractant properties of Saccharomyces cerevisiae, also known as baker’s yeast, now described are yeast modified to express iRNA pesticides targeting essential Drosophila genes. Use of yeast facilitates cost-effective production of the iRNA biopesticides at various scales. Yeast may either be left alive or killed, such as by exposure to heat, to provide a stable iRNA biopesticide composition. Interestingly, the yeast has been found to retain its attractive properties and insecticidal activity even when heat-killed prior to deployment.

[0062] As described herein, additional pest control strategies may also be combined with iRNA biopesticides, including attractive, phagostimulant, and insecticidal elements, e.g., bait, pheromones, and attracticidal spheres. Herein, baits and attractants may be referred to interchangeably. In one example, attractive targeted sugar baits (ATSBs) can be used to deliver iRNA biopesticides to provide compositions with excellent shelflife and residual activity, thereby reducing overall insecticide use. Together, disclosed are species-specific, cost-effective, scalable, user-friendly, and sustainable iRNA biopesticides produced by yeast that target Drosophila fly pests to control population, such as by undermining fitness and/or survival. [0063] The term “iRNA” refers to ribonucleic acid (RNA) sequences and constructs that are able to operate within the RNA interference (RNAi) pathway by interfering with transcriptional or post-transcriptional gene expression resulting in reduced or inhibited expression of a specific gene. For purposes herein, the term “iRNA” refers to short interfering RNA (siRNA), short hairpin RNA (shRNA) and double stranded RNA (dsRNA) that operate within the RNAi pathway. In some instances, the iRNA is produced within a cell via a DNA construct that encodes said iRNA. The iRNA of the present invention are synthetic and can be expressed in a vector or host cell in which the iRNA is not normally expressed. For example, the siRNA may target an insect gene, e.g., a Drosophila fly gene, and be expressed by an exogenous vector or expressed in a bacterial or yeast cell that does not naturally contain the target gene or target sequence to which the siRNA binds. The iRNA may be modified in a manner that facilitates exogenous expression by the host cell, e.g., the nucleic acid or the complementary sequence used to express the iRNA may be modified at its ends or incorporated into an exogenous sequence to allow for expression in the target host cell. In some embodiments, the nucleic acid encoding the iRNA is operably linked to an exogenous sequence that allows for its expression.

[0064] RNAi strategies typically employ a synthesized, non-naturally occurring “iRNA” or “iRNA molecule,” which typically comprises at least an RNA fragment against a target gene, a spacer sequence, and a second RNA fragment which is complementary to the first, so that a doublestranded RNA (dsRNA) structure can be formed. The introduced dsRNA takes advantage of the native RNAi pathways in the insect to trigger down -regulation of target genes that may lead to the cessation of feeding and/or growth, which may result in the death of the insect pest.

[0065] The target nucleotide sequence may be selected from any suitable region or nucleotide sequence of the target gene or RNA transcript thereof. For example, the target nucleotide sequence may be located within the 5'UTR or 3'UTR of the target gene or RNA transcript or within exonic or intronic regions of the gene. The skilled person will be aware of methods of identifying the most suitable target nucleotide sequences within the context of the full-length target gene. For example, multiple dsRNAs targeting different regions of the target gene can be synthesized and tested. Alternatively, digestion of the RNA transcript with enzymes such as RNAse H can be used to determine sites on the RNA that are in a conformation susceptible to gene silencing. Target sites may also be identified using in silico approaches, for example, the use of computer algorithms designed to predict the efficacy of gene silencing based on targeting different sites within the full- length gene.

[0066] The term “siRNA,” or “small interfering RNA,” refers to short interfering RNA or silencing RNA, which are short double-stranded RNA molecules of <30 base pairs in length, for example, about 19-30 base pairs in length that operate through the RNAi pathway. Each siRNA is unwound into two single-stranded RNAs (ssRNAs), one of which is incorporated into the RNA- induced silencing complex (RISC) leading to post-transcriptional gene silencing. siRNAs can be generated in several ways. In some cases, long dsRNA is introduced to a cell, either by a virus, endogenous RNA expression (i.e., microRNA), or exogenously delivered dsRNA. The enzyme DICER cleaves the long duplex RNAs into siRNAs. Another way to introduce siRNA into cells is to express small hairpin RNA (shRNA) from plasmid vectors. Alternatively, chemically synthesized siRNA duplexes, which mimic the structure of DICER-processed products, are commonly used in research for gene silencing. Chemically synthesized siRNAs simply bypass the DICER cleavage step. In some preferred embodiments, the siRNA is about 25 bp in length. While use of longer (300-400 bp) double stranded RNA (dsRNA) molecules is one approach for producing iRNA, the short length (21-25 bp) of custom small interfering RNAs (siRNAs) facilitates the design of highly specific iRNA.

[0067] The terms “short hairpin RNA” and “small hairpin RNA” are encompassed by the term “shRNA.” shRNAs are artificial RNAs having a secondary structure such that a portion of the RNA strand forms a hairpin loop. Expression of shRNA in cells is typically accomplished by delivery of a DNA construct to the cell, e.g., through a recombinant vector having an expression cassette facilitating transcription of the encoding DNA and production of the shRNA. shRNA is transcribed under the control of RNA Pol-II or Pol-III promoters, and folds into a structure resembling a siRNA duplex. shRNAs are then processed by DICER into siRNAs.

[0068] The term “dsRNA” (double stranded RNA) refers to long double-stranded RNA molecules that are cleaved by the enzyme DICER into short double-stranded fragments of about 20-25 nucleotide siRNAs.

[0069] RNA interference (RNAi) or Post-Transcriptional Gene Silencing (PTGS) refers to the biological process in which RNA molecules interfere or inhibit the expression of specific genes with complementary nucleotide sequences to the iRNA (gene-specific suppression of gene expression). RNAi results in the degradation of mRNA after transcription, resulting in reduced translation and protein expression.

[0070] RNA interference techniques employ genetic constructs that encode iRNA molecules, such as dsRNA and shRNA. Typically, the RNA constructs comprise sense and anti-sense sequences which are placed in regions flanking an intron sequence in proper splicing orientation with donor and acceptor splicing sites. Alternatively, spacer sequences of various lengths can be employed to separate self-complementary regions of sequence in the construct. During processing of the gene construct transcript, intron sequences can be spliced-out, allowing sense and anti-sense sequences, as well as splice junction sequences, to bind forming double-stranded RNA. Alternatively, where secondary structure inhibits splicing machinery, the intron sequences are not spliced out and the dsRNA is supplied as a hairpin structure. When the dsRNA is expressed in a cell, ribonucleases bind to and cleave the double-stranded RNA, initiating a cascade of events leading to degradation of the target mRNA molecules, and thereby silencing such target genes. The phenomenon of RNA interference using shRNA is described in Sheng et al., Front Bioeng Biotechnol. 2020 Aug 7;8:940 and generally in Bass, Nature 411 : 428-29 (2001); Elbahir et al., Nature 411 : 494-98 (2001); and Fire et al., Nature 391 : 806-11 (1998); and WO 01/75164, where methods of making interfering RNA also are discussed.

[0071] The iRNAi can hybridize with the full-length mRNA encoded by the target gene or hybridize to a fragment of the target RNA or DNA (the target sequence). For example, to reduce expression of a target gene in an insect pest using RNAi, an expression cassette encoding an iRNA having the sequence of an mRNA transcribed from the target gene, or a substantially identical sequence (including those engineered not to translate the protein), or fragment thereof, is introduced into a yeast cell. The resulting yeast cell can then be fed to the insect pest to determine its ability to inhibit expression of the target gene and/or inhibit growth of the insect pest. Although the sequence of the iRNA used for RNAi need not be completely identical to mRNA transcribed from the target sequence of the target gene, it is typically substantially identical, e.g., at least 70%, 80%, 90%, 95%, 98%, or more identical to mRNA transcribed from the target sequence. It is known in the art that dsRNA molecules that are not perfectly complementary to mRNA transcribed from the target sequence (for example, having only 95% identity to mRNA transcribed from the target sequence) are effective to control insect pests (see, for example, Narva et al., U.S. Pat. No. 9,012,722). [0072] Target genes can be selected based on a number of criteria, including gene essentiality, midgut expression level, and divergence from related species sequences. In the case of Drosophilids, suitable target genes encode, for example, polyglutamine-repeat protein pqn-41,and potassium voltage-gated channel protein Shaker. As an example, Drosophila suzukii genes corresponding to the polyglutamine-repeat protein pqn-41 and potassium voltage-gated channel protein Shaker targets are Gene ID: 108012261 and Gene ID: 108016735, respectively. Suitable orthologs of polyglutamine-repeat protein pqn-41 include RNA-binding Fox protein 1 (Rbfoxl) and sex determination protein Fox-1.

[0073] In some examples, inhibiting a target gene interferes with the production of an essential protein. Regarding exemplary target genes described herein, the protein product of the Rbfoxl gene, which is orthologous to poly glutamine-repeat protein pqn-41 and sex determination protein Fox-1, has been shown to contribute to muscle diversity in adult Drosophila (Nikonova et al., Life Sci Alliance. 2022 Jan 7;5(4):e202101342). Shaker encodes encode a structural component of a voltage-dependent potassium channel (Papazian et al., Science. 1987 Aug 14;237(4816):749-53 and Tempel et al., Science. 1987 Aug 14;237(4816):770-5). In some embodiments, the disclosed iRNA molecules, compositions, and methods include targeting more than one gene, such as polyglutamine-repeat protein pqn-41 in combination with potassium voltage-gated channel protein Shaker, or orthologs of the same.

[0074] Suitable target genes for D. suzukii can also be identified in the Spotted Wing Flybase (see, spottedwingflybase.oregonstate.edu), and the genome has been described, e.g., by Chiu et al., G3 (Bethesda). 2013 Dec; 3(12): 2257-2271. In accordance with the nucleic acids, compositions, and methods described herein, such target genes may also be leveraged to control other Diptera pests, including, e.g., Anastrepha spp., e.g., Anastrepha ludens, Anastrepha suspensa, Bactrocera spp., e.g., Bactrocera cucurhitae, Bactrocera dorsalis, Bactrocera zonata, Ceratitis spp., e.g., Ceratitis capitata, Mayetiola spp., e.g., Mayetiola destructor, Rhagoletis spp., e.g., Rhagoletis cerasi, and Zapriom s spp., e.g., Zaprionus indianus.

[0075] Gene suppression” or “down-regulation of gene expression” or “inhibition or suppression of gene expression” are used interchangeably and refer to a measurable or observable reduction in gene expression or a complete abolition of detectable gene expression at the level of protein product (“gene silencing”), and/or mRNA product from the gene. In some embodiments, gene suppression results in gene silencing, referring to the ability of the iRNA to target mRNA for degradation, resulting in disrupted translation, which prevents protein expression. The ability of the iRNA to suppress or down-regulate at least one gene leads to the suppression or inhibition of the Drosophila fly ’ s growth or maturation or death of the Drosophila fly larvae or adult Drosophila fly. The downregulation or inhibition may occur at the translational or post-translational stage of expression of the gene of interest by promoting transcript turnover, cleavage, or disruption of translation.

[0076] Inhibition of target gene expression may be quantified by measuring either the endogenous target RNA or the protein produced by translation of the target RNA and the consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism. Techniques for quantifying RNA and proteins are well known to one of ordinary skill in the art. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, spectinomycin, rifampicin, and tetracyclin, and the like.

[0077] In addition to inhibiting gene expression the provided nucleic acids, host cells, such as microbial cells, compositions, and methods may additionally reduce the production of the protein product of a target gene. Methods of quantifying proteins, such as comparing the production of a specific protein, e.g., Rbfoxl or orthologs thereof, or Shaker, in a Drosophila fly pest after exposure to a microbial cell engineered to produce disclosed iRNA targeting that specific protein compared to a protein levels in a Drosophila fly pest exposed to a microbial cell engineered to produce iRNA targeting a gene absent from the genome of a Drosophila fly pest, are known in the art and include, e.g., ELISA and Western blot analysis. See, e.g., Jay et al., Proc Natl Acad Sci U S A. 2021 Oct 26; 118(43): e2107427118, Chang & Lovett, Biochem Mol Biol Educ. 2011 Jul;39(4):291-7, and Spencer et al., Biochem Biophys Res Commun. 1993 Feb 26; 191 (l):201 -6. [0078] The term “gene” refers to a polynucleotide sequence that comprises control and coding sequences necessary for production of a polypeptide (protein). The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence. A gene includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene (e.g., promoters, enhancers, etc.). A gene may be an uninterrupted coding sequence or may include one or more introns contained between splice junctions. As used herein, a gene may include variants of the gene, which include, but are not limited to, modifications such as mutations, insertions, deletions, or substitutions of one or more nucleotides. A “target gene” is the gene targeted for down-regulation or suppression by the iRNA of the present technology. A “gene product” can refer to either the mRNA or protein expressed from a particular gene.

[0079] The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” refer to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. The monomer is typically referred to as a nucleotide. Nucleic acids can include modified nucleotides that permit correct read through by a polymerase and do not significantly alter expression of a polypeptide encoded by that nucleic acid.

[0080] The phrase “nucleic acid sequence encoding” refers to a nucleic acid, such as DNA, which is the template for transcription of a specific RNA molecule, e.g., a shRNA, a dsRNA, or an mRNA that is translated into a protein. The nucleic acid sequences include both the full-length nucleic acid sequences as well as non-full -length sequences derived from the full-length sequences. A coding sequence can include degenerate codons (relative to the native sequence) or sequences that provide codon preference in a specific host cell.

[0081] The term “promoter” refers to regions or sequence located upstream and/or downstream from the start of transcription and which are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A “yeast promoter” is a promoter capable of initiating transcription in yeast cells. A yeast promoter can be a nucleic acid sequence originally isolated from a yeast, but promoters not initially isolated from a yeast are also considered “yeast promoters” for the purposes of this disclosure.

[0082] An “expression cassette” refers to a nucleic acid construct, which when introduced into a host cell (e.g., a yeast cell), results in transcription of an RNA molecule (e.g., dsRNA or mRNA). An expression cassette typically includes a sequence to be expressed, and sequences necessary for expression of the sequence to be expressed, such as a promoter operably linked to the sequence. Generally, an expression cassette is inserted into an expression vector to be introduced into a host cell.

[0083] The words “complementary” or “complementarity” refer to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide. For example, the sequence A-G-T is complementary to the sequence T-C-A. Complementarity can be partial, in which only some of the nucleic acids match according to base pairing, or complete, such as fully complementary or perfectly complementary, where all the nucleic acids match according to base pairing.

[0084] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.

[0085] The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified.

[0086] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or proteins of the invention, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters, or by manual alignment and visual inspection. See e.g., the NCBI web site at ncbi.nlm.nih.gov/BLAST/. For example, the sequence of a dsRNA of the invention can be compared using the above techniques to the sequence of a target gene in an insect pest, taking into account the presence of uracil in the dsRNA and thymidine in the DNA. Sequences that have at least about 90% sequence identity using the methods described above are said to be “substantially identical.” This definition also refers to, and can be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. Optimal alignment of such sequences can be carried out by any of the publicly available algorithms or programs for determining sequence identity and alignment, e.g., BLAST.

[0087] In some embodiments, the reduction, inhibition, or suppression of expression of the target gene results in life cycle disruptions, such as reduced viability, growth, development or reproduction of the targeted insect pest. Such assessments are within the grasp of one of skill in the art and described in, e.g., US11252965B2, US11117938B2, US20210054379A1, and US11198868B2. In some embodiments, the reduction, inhibition, or suppression of target gene expression is determined relative to a wild type Drosophila fly pest. In some embodiments, the reduction, inhibition, or suppression of target gene expression is determined relative to a Drosophila fly pest contacted with a wild type yeast, such as wild type Saccharomyces cerevisiae. In some embodiments, the reduction, inhibition, or suppression of target gene expression is determined relative to a Drosophila fly pest contacted with a yeast, such as Saccharomyces cerevisiae, engineered to express an iRNA that does not target a Drosophila gene, e.g., lacks complementarity to mRNA transcribed from a Drosophila gene. Exemplary effects include the inability of larvae to mature to adults, reductions in fitness, such as reproductive fitness, including reduced capacity for sexual reproduction by the insect, inhibition of differentiation and development, e.g., growth inhibition, inhibited muscle, leg, or wing formation, and death. In some embodiments, the target gene required for maturation and/or growth refers to a gene necessary for the survival, growth, or development of larvae into an adult and may ultimately result in death. In some embodiments, the gene may inhibit the ability of the larvae to develop into pupae, of pupae from developing into adults, or any intervening developmental step. In some instances, the inhibition or suppression of the target gene results in the inability of an adult insect to survive.

[0088] In some examples, downregulation or inhibition of gene expression in cells of a Drosophila fly can be confirmed by phenotypic analysis of the cell or the whole Drosophila fly, for example death of the Drosophila fly larva, pupa or adult Drosophila fly (which can be quantitated, for example, as percent (%) mortality). Suitably, the iRNA or compositions provide a % mortality of at least about 50%, alternatively at least about 60%, alternatively at least about 70%, alternatively at least about 75%, alternatively at least about 80%, at least about 90%, alternatively at least about 95%, alternatively at least about 98%, alternatively at least about 100%, wherein each range is inclusive and including any and all numerical values and ranges in between. [0089] Other methods of confirming downregulation of the gene expression are known in the art, and include, but are not limited to, measurement of mRNA or protein expression using molecular techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (MA), other immunoassays, or fluorescence-activated cell analysis (FACS) and the like.

[0090] In some embodiments, the effectiveness of larvicide is characterized by the lethal concentrations (LC) for mortality and inhibition of adult emergence (IE). In some embodiments, the effectiveness of the insecticide is characterized by the lethal concentration or lethal dose (LD) for an adult insecticide.

[0091] Suitable target genes for use in the present invention include genes identified as disrupting inhibiting any one or more of viability, growth, development and reproduction of the insect pest. In some examples, a suitable target gene is a larval lethal gene in one or more species of Drosophila fly, as described herein. In other examples, a suitable target gene is an adult lethal gene in one or more species of Drosophila fly, as described herein. Larval lethal genes are genes that result statistically significant lethality when compared to a control siRNA treatment. In some embodiments, the larval lethal genes result in at least 50% mortality of targeted pests. In some embodiments, larval lethal genes result in at least 60% mortality, alternatively at least 70% mortality, alternatively at least 80% mortality, alternatively at least 90% mortality, alternatively at least 95% mortality, alternatively 100% mortality of targeted pests. In some embodiments, the larval lethal gene is also an adult lethal gene.

[0092] Additional suitable genes for use in the present invention include genes identified as adult lethal genes for one or more species of Drosophila fly. Adult lethal genes are genes that result in statistically significant lethality when compared to a control siRNA treatment. In some embodiments, the adult lethal genes result in at least 60% mortality, alternatively at least 70% mortality, alternatively at least 80% mortality, alternatively at least 90% mortality, alternatively at least 95% mortality, alternatively 100% mortality of targeted pests.

[0093] In some embodiments, disclosed iRNA specifically inhibit gene expression and result in larvae death or inhibition of maturation of a Drosophila fly pest. In some embodiments, disclosed iRNA specifically inhibit gene expression and result in larvae death, adult death, or inhibition of maturation in at least two, three, or four Drosophila fly pests. In some embodiments, the Drosophila fly pest is any one or more of Drosophila nanassae, Drosophila biarmipes, Drosophila hipectinata, Drosophila elegans, Drosophila erecta, Drosophila funehris, Drosophila grim shew i, Drosophila kikkawai, Drosophila melanogaster, Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willistoni, and Drosophila yakuba.

[0094] In some embodiments, disclosed iRNA specifically inhibit gene expression and result in larvae death, adult death, or inhibition of maturation in Drosophila ananassae, Drosophila biarmipes, Drosophila elegans, Drosophila erecta, Drosophila funebris, Drosophila grimshawi, Drosophila melanogaster, Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willistoni, Drosophila yakuba, or any combination thereof.

[0095] In some embodiments, disclosed iRNA specifically inhibit gene expression and result in larvae death, adult death, or inhibition of maturation in Drosophila ananassae, Drosophila biarmipes. In some embodiments, disclosed iRNA specifically inhibit gene expression and result in larvae death or inhibition of maturation in Drosophila biarmipes and Drosophila suzukii. In some embodiments, disclosed iRNA specifically inhibit gene expression and result in larvae death or inhibition of maturation in Drosophila biarmipes and Drosophila suzukii. In some embodiments, disclosed iRNA specifically inhibit gene expression and result in larvae death, adult death, or inhibition of maturation in Drosophila melanogaster. In some embodiments, disclosed iRNA specifically inhibit gene expression and result in larvae death, adult death, or inhibition of maturation in Drosophila suzukii.

[0096] In a preferred embodiment, disclosed iRNA target sequences are conserved in multiple Drosophila fly species but not conserved in non-targeted species. Through the identification and use of multiple larval lethal genes and multiple target sequences to each gene, the present invention is able to reduce, inhibit or eliminate insecticide resistance arising from a point mutation in any one target sequence. Tn other words, the iRNA of the present invention is designed to reduce the likelihood of producing insecticide resistant strains by combining multiple target genes and multiple sequences within those target genes that are conserved among a number of species.

[0097] Suitably, the sequences and genes targeted by the present technology are specific to fly pests, such as Drosophila flies. Downregulation or inhibition of target gene expression is “specific” when downregulation or inhibition of the target gene occurs without resulting in any detrimental effects on other genes of the targeted organism or genes of other non-related organisms (e.g., humans, mammals, etc.). The targeted sequences selected were analyzed and determined to have little risk for targeting genes in humans. Methods of determining if sequences specifically target human genes are known in the art, and include, for example, assessing human risk empirically through toxicity testing on human cells in vitro and on animal models in vivo, and in silico methods to select only risk-reduced sequences for siRNA synthesis.

[0098] Interfering RNA (iRNA) and Other Nucleic Acid Molecules

[0099] In some aspects, provided herein are interfering RNA molecules (iRNA) effective to inhibit the expression of a gene in a Drosophila fly pest, such as by RNA interference. In additional aspects, provided are nucleic acid sequences, such as DNA sequences, encoding the disclosed iRNA molecules. Also provided are nucleic acid constructs comprising the iRNA molecules and nucleic acid sequences encoding the same. In further aspects, provided are microbial host cells, such as a yeast cell, bacterial cell, plant cell, or algal cell comprising the disclosed iRNA and nucleic acid sequences encoding the same. Herein, the disclosed iRNA molecules may be referred to simply as “iRNA.”

[00100] Interfering RNA (iRNA) [00101] In some aspects, provided is an iRNA molecule comprising at least one dsRNA, such as an shRNA, where the dsRNA is a region of double-stranded RNA comprising annealed strands that are either partially or fully complementary. In some embodiments, one strand of the dsRNA comprises a sequence of at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, or at least 300 contiguous nucleotides which is partially or fully complementary to a target nucleotide sequence within a Drosophila fly pest target gene.

[00102] In some embodiments, disclosed iRNA has at least 60% identity, at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to a target nucleotide sequence within a Drosophila fly pest target gene.

[00103] In some embodiments, the disclosed percent identity is to at least a 19, at least a 20, at least a 21, at least a 22, at least a 23, at least a 24, at least a 25, at least a 26, at least a 27, at least a 28, at least a 29, at least a 30, at least a 35, at least a 40, at least a 45, at least a 50, at least a 55, at least a 60, at least a 65, at least a 70, at least a 75, at least a 80, at least a 85, at least a 90, at least a 95, at least a 100, at least a 110, at least a 120, at least a 130, at least a 140, at least a 150, at least a 160, at least a 170, at least a 180, at least a 190, at least a 200, at least a 210, at least a 220, at least a 230, at least a 240, at least a 250, at least a 260, at least a 270, at least a 280, at least a 290, or at least a 300 contiguous nucleotide fragment of a target pest gene.

[00104] In some embodiments, the iRNA effective to inhibit the expression of a gene in a Drosophila fly pest is a small interfering RNA (siRNA), a short hairpin RNA (shRNA), double stranded RNA (dsRNA), or RNA construct. In some embodiments, the siRNA, shRNA, dsRNA, or RNA construct is encoded by a DNA construct, such as a recombinant vector comprising an expression cassette, which allows for expression of the iRNA within a host cell, such as a yeast cell.

[00105] In some embodiments, disclosed iRNA inhibits the expression of a gene, such as a target gene, in any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila elegans, Drosophila erecta, Drosophila funebris, Drosophila grimshawi, Drosophila melanogaster, Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willi stoni, and Drosophila yakuba. In some embodiments, disclosed iRNA inhibits the expression of a gene, such as a target gene, in Drosophila ananassae and/or Drosophila biarmipes. In some embodiments, disclosed iRNA inhibits the expression of a gene, such as a target gene, in Drosophila suzukii.

[00106] In some embodiments, disclosed iRNA selectively inhibits the expression of a gene, such as a target gene, in Drosophila suzukii. In some embodiments, disclosed iRNA does not inhibit the expression of an orthologous Drosophila suzukii target gene in any one or more of Drosophila ananassae, Drosophila biarmipes, and Drosophila melanogaster.

[00107] In some embodiments, disclosed iRNA inhibits the expression of polyglutamine-repeat protein pqn-41 in a Drosophila fly pest. In some embodiments, disclosed iRNA inhibits the expression of polyglutamine-repeat protein pqn-41 in any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila elegans, Drosophila erecta, Drosophila funebris, Drosophila grimshawi, Drosophila melanogaster, Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willistoni, and Drosophila yaku ba .

[00108] In some embodiments, disclosed iRNA selectively inhibits the expression of polyglutamine-repeat protein pqn-41 in Drosophila suzukii. In some embodiments, disclosed iRNA inhibits gene expression of Drosophila suzukii polyglutamine-repeat protein pqn-41 (Gene ID: 108012261). In some embodiments, disclosed iRNA reduces the production of Rbfoxl in any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila elegans, Drosophila funebris, Drosophila melanogaster, Drosophila simulans, Drosophila subpulchrella, and Drosophila suzukii. In some embodiments, disclosed iRNA selectively reduces the production of Rbfoxl in Drosophila suzukii .

[00109] In some embodiments, disclosed iRNA inhibits the expression of potassium voltagegated channel protein Shaker in a Drosophila fly pest. In some embodiments, disclosed iRNA inhibits the expression of potassium voltage-gated channel protein Shaker in any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila elegans, Drosophila erecta, Drosophila funebris, Drosophila grimshawi, Drosophila melanogaster, Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoohscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willistoni, and Drosophila yakuba. [00110] In some embodiments, disclosed iRNA selectively inhibits the expression of potassium voltage-gated channel protein Shaker (Gene ID: 108016735) in Drosophila suzukii. In some embodiments, disclosed iRNA inhibits gene expression of Drosophila suzukii potassium voltagegated channel protein Shaker (Gene ID: 108016735).

[00111] In some embodiments, the target gene comprises a target nucleotide sequence that is at least 80%, 84%, 88%, 90%, 92%, or 96% identical to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 In some embodiments, the target pest gene comprises a target nucleotide sequence having about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the target pest gene comprises a nucleotide sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[00112] In some embodiments, an iRNA molecule effective to inhibit the expression of a gene in a Drosophila fly pest is partially complementary to the nucleobase sequence of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 In some embodiments, an iRNA molecule effective to inhibit the expression of a gene in a Drosophila fly pest is fully complementary to the nucleobase sequence of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 In some embodiments, an iRNA molecule effective to inhibit the expression of a gene in a Drosophila fly pest is partially complementary to the mRNA transcribed from any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 In some embodiments, an iRNA molecule effective to inhibit the expression of a gene in a Drosophila fly pest is fully complementary to the mRNA transcribed from any one of SEQ ID NO:1, SEQ ID NO:2, SEQ

ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6

[00113] In some embodiments, the iRNA molecule effective to inhibit the expression of a gene in a Drosophila fly pest comprises a sequence of 20-30, 21-29, 22-28, 23-27, or 24-26 contiguous nucleotides that is complementary to a target gene sequence, wherein each range is inclusive. In some embodiments, the iRNA molecule effective to inhibit the expression of a gene in a Drosophila y pest comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 contiguous nucleotides that are partially or perfectly complementary to mRNA transcribed from a target gene in a Drosophila fly pest. In some embodiments, the target gene encodes polyglutamine-repeat protein pqn-41. In some embodiments, the Drosophila fly pest target sequence contributes to the expression of any of polyglutamine-repeat protein pqn-4/ Rbfoxl, potassium voltage-gated channel protein Shaker, and homologs thereof.

[00114] In some embodiments, the iRNA is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% complementary to a portion of mRNA transcribed from the target sequence. In some embodiments, the iRNA is about 70% to 99%, 75% to 95%, 80% to 90%, or 85% to 90% complementary to a portion of mRNA transcribed from the target sequence, wherein each range is inclusive. In some embodiments, the iRNA is about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, more complementary to a portion of mRNA transcribed from the target sequence. In some embodiments, the iRNA is perfectly complementary to a portion of mRNA transcribed from the target sequence.

[00115] In some embodiments, the iRNA is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide. In preferred embodiments, the iRNA is an shRNA. [00116] In some embodiments, the Drosophila fly pest is any of Drosophila hiarmipies, Drosophila melanogaster, Drosophila simulans, and Drosophila suzukii. In some embodiments, the Drosophila fly pest is Drosophila suzukii.

[00117] In some embodiments, disclosed iRNA is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% complementary to a portion of mRNA transcribed from any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 In some embodiments, disclosed iRNA is about 70% to 99%, 75% to 95%, 80% to 90%, or 85% to 90% complementary to a portion of mRNA transcribed from any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, wherein each range is inclusive. In some embodiments, disclosed iRNA is about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to a portion of mRNA transcribed from any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 In some embodiments, disclosed iRNA is perfectly complementary to a portion of mRNA transcribed from any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6

[00118] In some embodiments, disclosed iRNA inhibits the expression of polyglutamine-repeat protein pqn-41 in Drosophila suzukii by RNAi. In some embodiments, disclosed iRNA comprises a sequence of at least 25 contiguous nucleotides that is partially or fully complementary to a portion of mRNA transcribable from any one of SEQ ID NO:1, SEQ NO:2, and SEQ ID NO:3. In some embodiments, inhibition of polyglutamine-repeat protein pqn-41 (Gene ID 108012261) by RNA interference results in reduced production of Rbfoxl.

[00119] In some embodiments, disclosed iRNA inhibits the expression of potassium voltagegated channel protein Shaker va Drosophila suzukii (Gene ID: 108016735). In some embodiments, disclosed iRNA comprises a sequence of at least 25 contiguous nucleotides that is partially or fully complementary to a portion of mRNA transcribable from any one of SEQ ID NO:4, SEQ NO:5, and SEQ ID NO:6

[00120] Nucleic Acid Sequences Encoding iRNA

[00121] In some aspects, provided herein are nucleic acid sequences, such as DNA sequences, encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, an expression vector comprises the DNA sequence encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, a microbial cell, such as a yeast cell, comprises the expression vector. Herein, the term “expression vector” may be used interchangeably with “recombinant vector.”

[00122] Suitable DNA constructs will depend on the type of cell in which to express the RNA. In some embodiments, the DNA construct is a linear or a closed circular plasmid or expression vector. In some embodiments, the DNA constructs will be integrated into the host cell genome, for example, integrated into a yeast or bacterial cell genome.

[00123] In some embodiments, the DNA construct is a suitable expression vector. Sequences that encode the iRNA of the present technology can be inserted into a vector under the control of a suitable promoter that functions in one or more microbial hosts to drive expression of a linked coding sequence or other DNA sequence. Suitable vectors are known in the art and selecting the appropriate vector will depend on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector. Vectors may include one, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more selectable marker genes, terminators, enhancers and/or a constitutive or inducible promoter allowing expression of exogenous DNA. Vectors can also include viral vectors and the like. [00124] Methods for producing recombinant yeast cells are well known to one of skill in the art. Exemplary yeasts of interest include Saccharomyces cerevisiae, Pichia pastoris, and Hanseniaspora uvarum. H. uvarum has been isolated as the most common yeast species in the gut of D. suzukii and is particularly useful for control of this species. Certain microbes, such as Saccharomyces cerevisiae or Hanseniaspora uvarum, have a symbiotic relationship with Drosophila spp. are highly attractive to Drosophila fly pests and are referred to herein as “attractive microbes.” Leveraging the symbiotic-attractant relationship, use of such microbes as Drosophila fly pest bait has been described. See, e.g., Hamby et al., Appl Environ Microbiol. 2012 Jul;78(14):4869-73, Huang & Gut, J Insect Sci. 2021 Mar 1;21(2):4, Starmer et al., Anim. Behav. 1988;36: 1691-1695 and Rehermann et al., Pest Manag Sci. 2022 Mar;78(3):896-904.

[00125] Suitable promoters for expression in yeast are also well known and include, for example, the bacteriophage T7 promoter, promoters from GALI (which is induced by the presence of galactose), ADH1, the TEF 1 promoter and the AOX promoter (a methanol inducible promoter), and the like. Many yeast cloning vectors have been designed and are readily available. Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant products polypeptides are also well known. Transformed cells are selected by phenotype determined by a selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine).

[00126] In some embodiments, auxotrophic yeast strains are transformed with exogenous DNA encoding disclosed iRNA. Use of these strains relies on marker genes that encode key enzymes in various essential metabolic pathways. Examples include the URA, HIS3, LEU2, TRP1, and MET 15 marker genes, which encode essential enzymes for de novo synthesis of pyrimidines, 1- histidine, 1-leucine, 1 -tryptophan, and 1-methionine, respectively. Yeast strains are auxotrophic for the nutrient in question due to the absence of a functional chromosomal copy of the marker gene. The auxotrophic yeast strains can thus be propagated only in media that contain the appropriate nutrients. Synthetic auxotrophs may also be engineered to require particular compounds.

[00127] In some embodiments, more than one iRNA may be expressed by a single recombinant vector introduced into a host cell, such as a microbial cell. In some embodiments, more than one iRNA may be expressed by multiple recombinant vectors introduced into a host cell, such as a microbial cell. In some embodiments, the recombinant vector comprises multiple expression sites, each site able to drive the expression of a different nucleotide sequence. By this method, multiple iRNAs can be expressed in a single cell, where the multiple iRNA can either target multiple sites on a single gene or target multiple genes within at least one insect, preferably at least one Drosophila fly species.

[00128] In some embodiments the vector is a plasmid. Other vectors include artificial chromosomes and linear nucleic acid molecules that are distinct from linearized plasmids. In some embodiments the vector is an integrating vector. In some embodiments the vector comprises an expression control element operably linked to a nucleic acid to be transcribed, e.g., DNA encoding disclosed iRNA. Three well known plasmid systems used for recombinant expression and replication in yeast cells include integrative plasmids, low-copy-number ARS-CEN plasmids, and high-copy-number 2p plasmids. See, e.g., Christianson et al., Gene. 1992; 110: 119-22; Sikorski, "Extrachromosomal cloning vectors of Saccharomyces cerevisiae", in Plasmid, A Practical Approach, Ed. K. G. Hardy, IRL Press, 1993; Parent, S.A., and Bostian, K.A., Recombinant DNA technology: yeast vectors, p. 121-178. In Wheals, A.E., et al. (eds.) The yeasts, vol. 6. Yeast genetics. Academic Press, Longon, UK (1995). [00129] An example of integrating plasmids of use in budding yeast are Yip plasmids, which are maintained at one copy per haploid genome and inherited in Mendelian fashion. Such a plasmid, containing a nucleic acid of interest, a bacterial origin of replication and a selectable gene (typically an antibiotic- resistance marker), is typically produced in bacteria. The purified vector may be linearized and used to transform competent yeast cells. YCp plasmids, which contain the autonomous replicating sequence (ARS1) and a centromeric sequence (CEN4), are examples of low-copy- number ARS-CEN plasmids. These plasmids are usually present at 1-2 copies per cell. An example of the high-copy-number 2p plasmids are YEp plasmids, which contain a sequence approximately 1 kb in length (named the 2p sequence). The 2p sequence acts as a yeast replicon giving rise to higher plasmid copy number. These plasmids may require selection for maintenance. [00130] In some embodiments, the recombinant vector comprises an expression cassette comprising a promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of a target gene in a Drosophila fly pest. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a yeast promoter.

[00131] Yeast vectors, e.g., plasmids, described herein may also contain expression control sequences, e g., promoter sequences. A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and transcription factors, to initiate the transcription of a nucleic acid sequence. The phrase "operably linked" indicates that an expression control element, e.g., a promoter, is in an appropriate location and/or orientation in relation to a nucleic acid to control transcriptional initiation and/or expression of the nucleic acid. [00132] A promoter may be one that is naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment. Alternatively, a promoter may be a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid segment in its natural environment. Such promoters may include promoters of other genes and promoters that are not naturally occurring. An expression control element may be derived from a yeast of the species or strain in which RNAi is to be used or in which the RNAi pathway is to be engineered. For example, if RNAi is to be used in S. cerevisiae, it may be desirable to use a S. cerevisiae promoter to direct expression of a dsRNA. However, any expression control element capable of directing transcription in the cell of interest may be used.

[00133] The promoters employed may be either constitutive or inducible. For example, various yeast-specific promoters may be employed to regulate the expression in yeast cells. Examples of inducible yeast promoters include GALI- 10, GALI, GALL, GALS, TET, CUP1, VP16 and VP16-ER. Examples of repressible yeast promoters include Met25. Examples of constitutive yeast promoters include glyceraldehyde 3 -phosphate dehydrogenase promoter (GPD), phosphoglycerate kinase (PGK), alcohol dehydrogenase promoter (ADH), translation- elongation factor- 1 -alpha promoter (TEF), cytochrome c-oxidase promoter (CYC1), and MRP7. Promoters containing steroid response elements (e.g., glucocorticoid response element) inducible by glucocorticoid or other steroid hormones can also direct expression in yeast. Yet other yeast constitutive or inducible promoters such as those of the genes for alpha factor, phosphate pathway genes (e.g., PH05), or alcohol oxidase may be used. In some embodiments, the vector comprises an expression control element known as an upstream activating sequence (UAS). [00134] Such elements, which are considered functional equivalents of metazoan enhancers, can activate gene transcription from remote positions, e.g., up to about 1,000 - 1,200 bp from the promoter. See, e.g., Petrascheck, M, et al., Nucleic Acids Res., 33(12): 3743-3750, 2005, for discussion. The level of expression achieved using an inducible promoter can be regulated, e.g., by controlling the amount of inducing agent or the length of exposure. Further, mutant promoters that result in lower expression levels than a wild type promoter can be used. In some embodiments, an expression control element originates from a species in which the expression control element is to be used to direct expression while in other embodiments the expression control element originates from a different species.

[00135] In some embodiments, the recombinant vector is a plasmid, such as an integrating plasmid. In some embodiments, the plasmid is a pRS plasmid (e.g., pRS3O3, pRS304, pRS305 or pRS306 or other integrative plasmids). In some embodiments, the plasmid is an extrachromosomal plasmid (e.g., pRS313, pRS314, pRS315, pRS316, pRS413, pRS414, pRS415, pRS416, pRS423, pRS424, pRS425, pRS426). In some embodiments the plasmid is a member of the YES™ Vector Collection, e.g., pYES (Invitrogen, Carlsbad, CA). In some embodiments, the plasmid is a Gateway plasmid. See, e g., Geiser. Biotechniques, 38:378-382 (2005); Van Mullem V, et al., Construction of a set of Saccharomyces cerevisiae vectors designed for recombinational cloning. See, e.g., Alberti et al., Yeast, 2007;24(10):913-9. Such vectors are described in, e.g., W02011031319A8.

[00136] In some embodiments, the recombinant vector comprises an expression cassette comprising a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of a target gene in a Drosophila fly pest. In some embodiments, the expression cassette comprises a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of polyglutamine-repeat protein pqn-41 , potassium voltage-gated channel protein Shaker, or a homolog or ortholog thereof.

[00137] In some embodiments, the expression cassette comprises a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule targeting a nucleotide sequence that is at least 80%, 84%, 88%, 90%, 92%, or 96% identical to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 In some embodiments, the expression cassette comprises a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule targeting a nucleotide sequence having about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the expression cassette comprises a yeast promoter operably linked to a DNA sequence encoding an iRNA molecule targeting any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the yeast promoter is a GPD promoter, which is also known as a GADPH or TDH3 promoter. The GPD promoter is a strong constitutive yeast expression promoter from glyceraldehyde 3-phosphage dehydrogenase.

[00138] In some embodiments, the expression vector comprising DNA nucleic acid sequences encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest is pRS426 GPD vector. An exemplary pRS426 sequence is represented by SEQ ID NO: 9, and a GPD promoter sequence is represented by SEQ ID NO: 10. The pRS426 GPD yeast shuttle vector permits constitutive expression of inserts cloned into the multiple cloning sites downstream of a GPD promoter and upstream of a cycl terminator. See, e.g., Mumberg & Funk, Gene. 1995 Apr 14;156(1): 119-22 and Mysore et al., Methods Mol Biol. 2019; 1858: 213-231. [00139] In some embodiments, the pRS426 GPD vector comprises an expression cassette encoding iRNA effective to inhibit the expression of polyglutamine-repeat protein pqn-41, potassium voltage-gated channel protein Shaker, or a homolog or ortholog thereof in a Drosophila fly pest. In some embodiments, the pRS426 GPD vector comprises an expression cassette encoding iRNA effective to inhibit the expression of polyglutamine-repeat protein pqn-41, potassium voltage-gated channel protein Shaker, or a homolog or ortholog thereof in any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila elegans, Drosophila erecta, Drosophila fimebris, Drosophila grimshawi, Drosophila melanogaster, Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willistoni, and Drosophila yakuba.

[00140] In some embodiments, the pRS426 GPD vector comprises an expression cassette encoding iRNA effective to inhibit the expression of polyglutamine-repeat protein pqn-41 (LOC 108012261) or potassium voltage-gated channel protein Shaker (LOCI 08016735) in D. suzukii.

[00141] In some embodiments, the DNA sequence encoding disclosed iRNA is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire length of SEQ ID NO:7 or the complement thereof. In some embodiments, the DNA sequence encoding disclosed iRNA is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the entire length of SEQ ID NO:8 or the complement thereof. In some embodiments, the DNA sequence encoding disclosed iRNA is about 70% to 99%, 75% to 95%, 80% to 90%, or 85% to 90% identical to the entire length of SEQ ID NO:7 or the complement thereof, wherein each range is inclusive. In some embodiments, the DNA sequence encoding disclosed iRNA is about 70% to 99%, 75% to 95%, 80% to 90%, or 85% to 90% identical to the entire length of SEQ ID NO:8 or the complement thereof, wherein each range is inclusive. In some embodiments, the DNA sequence encoding disclosed iRNA is about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, more identical to the entire length of SEQ ID NO:7 or the complement thereof. In some embodiments, the DNA sequence encoding disclosed iRNA is about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, more identical to the entire length of SEQ ID NO:8 or the complement thereof. In some embodiments, the DNA sequence encoding disclosed iRNA is 100% identical to the entire length of SEQ ID NO:7 or SEQ ID NO:8. In some embodiments, a DNA construct comprising DNA encoding disclosed iRNA has double stranded DNA that is identical (100% identity) to the entire length of SEQ ID NO:7 and SEQ ID NO:8.

[00142] Alternatively, techniques available to one of skill in the art may be used to achieve stable integration of the disclosed expression cassettes, such as stable transformation and expression into a host organism, e.g., Saccharomyces cerevisiae. Exemplary methods and techniques include transposon systems, e.g., PiggyBac, CRISPR, lithium acetate (LiAc)-based methodologies, electroporation, gene gun transformation, and protoplast transformation. Such methods are described in, e.g., Uetake & Niki, 7/z Vitro Cell Dev Biol Anim. 2011 Dec;47(10):689- 94, Kildegaard et al., Yeast. 2019 May; 36(5): 237-247.

[00143] In some embodiments, the iRNA is produced by a host cell which can express the iRNA from a DNA construct or expression vector comprising an expression cassette comprising DNA encoding the iRNA. Suitable cells include, but are not limited to, a bacterial, algal or yeast cell engineered to produce or express the iRNA from the encoding DNA sequence. Other suitable host cells, e.g., microorganism cells or plant cells, are known in the art. In some embodiments, the host cell expresses at least two iRNA molecules, alternatively at least three iRNA molecules, alternatively at least four iRNA molecules. In some embodiments, the host cell expresses from 1 to 10 iRNA molecules.

[00144] Microbial Host Cells Containing iRNA and Nucleic Acid Sequences Encoding the Same

[00145] In some aspects, provided herein are microbial host cells comprising iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, the microbial host cell comprises an expression vector comprising nucleic acid sequences, such as DNA sequences, encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, the microbial host cell is a yeast cell, bacterial cell, algal cell, or plant cell. In some embodiments, the microbial host cell is alive. In some embodiments, the microbial host cell is dead. Herein, “microbial host cell” and “microbial cell” are used interchangeably.

[00146] In some embodiments, the microbial host cell expresses at least one iRNA which targets a gene of interest for inhibition. In some embodiments, the microbial host cell expresses at least two, three, four, or five iRNA which target a gene of interest for inhibition. In some embodiments, the microbial host cell expresses any of from 1 to 15, 1 to 10, or 1 to 5 iRNA which target a gene of interest for inhibition.

[00147] In some embodiments, the microbial cell expresses at least two iRNA that target a single gene, alternatively at least three iRNA that target a single gene, alternatively at least four RNA that target a single gene. In some embodiments, the microbial cell expresses at least two iRNA that target two different genes, alternatively at least three iRNA that target at least two different genes, alternatively at least three iRNA that target at least two different genes, alternatively at least three different iRNA that target at least two different genes. [00148] In some embodiments, a microbial cell, such as a yeast cell, expresses at least two iRNA that target a single gene. In some embodiments, a host cell expresses at least three iRNA that target a single gene. In some embodiments, a host cell expresses at least three iRNA that target a single gene. In some embodiments, a microbial cell expresses at least four iRNA that target a single gene.

[00149] In some embodiments, a microbial cell expresses at least two iRNA targeting at least two different genes required for maturation from larva to adult of at least one insect, preferably a Drosophila fly. In another embodiment, a microbial cell expresses at least two iRNA targeting at least one gene required for adult insect survival, alternatively at least three iRNA targeting at least one gene required for adult insect survival, alternatively at least four iRNA targeting at least one gene required for adult insect survival, alternatively at least five iRNA targeting at least one gene required for adult insect survival, alternatively at least two iRNA targeting at least two different genes required for adult insect survival, alternatively at least three iRNA targeting at least two different genes required for adult insect survival, alternatively at least four iRNA targeting at least two different genes required for adult insect survival, etc. In a preferred embodiment, the insect is a Drosophila fly.

[00150] In some embodiments, a microbial cell expresses at least three iRNA targeting at least two different genes, alternatively at least four iRNA targeting at least two different genes, alternatively at least five iRNA targeting at least two different genes, alternatively at least three iRNA targeting at least three different genes, alternatively at least four iRNA targeting at least three different genes, alternatively at least five iRNA targeting at least three different genes, alternatively at least six different iRNA targeting at least three different genes, etc. In some preferred embodiments, the microbial cell is a yeast cell or bacterial cell. In some embodiments, multiple iRNAs may target at least one, at least two, at least three, at least four, at least five different genes required for maturation or development from larva to adult of at least one insect and/or adult insect survival, wherein the insect is preferably a Drosophila fly, alternatively at least two or more insects, preferably two or more Drosophila species.

[00151] In one embodiment, a disclosed microbial cell, e.g., a yeast cell expresses at least four iRNA, wherein the at least four iRNA target a single gene required for maturation from larva to adult of at least one insect, preferably a Drosophila fly pest. In another embodiment, the microbial cell, e.g., a yeast cell, expresses at least four iRNA, wherein the at least four iRNA target at least two different genes required for maturation from larva to adult of at least one insect, preferably a Drosophila fly. In some embodiments, the target gene may also be required for adult insect survival.

[00152] In some embodiments, the microbial host cells are stably transformed with nucleic acid sequences encoding iRNA. In some embodiments, a disclosed expression cassette is integrated into the genomic DNA of the microbial host cell, such as Saccharomyces cerevisiae. In some embodiments, DNA encoding disclosed iRNA is integrated into the genomic DNA of the microbial host cell, such as Saccharomyces cerevisiae. Stable transformants may be produced by incorporating a DNA construct comprising a nucleotide sequence encoding iRNA into the host cell genome. Methods of forming stable transformants of host cells are known in the art and include, e.g., transformation of integrative plasmids.

[00153] In some embodiments, a yeast cell comprises iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, a bacterial cell comprises iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, the bacterial cell is Escherichia coli, Bacillus thuringiensis israelensis and Lactobacillus spp. among others. In some embodiments, an algal cell comprises iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, a plant cell comprises iRNA effective to inhibit the expression of a gene in a Drosophila fly pest.

[00154] In some embodiments, a yeast cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, a bacterial cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a gene in Drosophila fly pest. In some embodiments, the bacterial cell is Escherichia coli. In some embodiments, an algal cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, a plant cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest.

[00155] In some embodiments, a yeast cell comprises iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, the yeast cell is a species of Saccharomyces. In some embodiments, the yeast cell is Saccharomyces cerevisiae. In some embodiments, a Saccharomyces cerevisiae cell comprises iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. Other suitable host cells will be evident to one of skill in the art.

[00156] In some embodiments, a yeast cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, the target gene encodes polyglutamine-repeat protein pqn-41, potassium voltage-gated channel protein Shaker, or a homolog or ortholog thereof. In some embodiments, the target gene has a target sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3,

SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[00157] In some embodiments, the yeast cell is a species of Candida. In some embodiments, the yeast cell is Candida robusta. In some embodiments, a Candida robusta cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, the yeast cell is a species of Saccharomyces. In some embodiments, the yeast cell is Saccharomyces cerevisiae. In some embodiments, a Saccharomyces cerevisiae cell comprises a DNA sequence encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In some embodiments, the . cerevisiae cell is alive. In preferred embodiments, the 5. cerevisiae cell is dead. In additional preferred embodiments, the S. cerevisiae cell is heat-killed and/or lyophilized.

[00158] In some embodiments, Saccharomyces cerevisiae comprises an expression vector comprising DNA sequences encoding iRNA effective to inhibit the expression of a target gene in D. suzukii. In some embodiments, the target gene encodes polyglutamine-repeat protein pqn-41 (Gene ID: 108012261), potassium voltage-gated channel protein Shaker (Gene ID: 108016735), or a homolog or ortholog thereof. In some embodiments, the target gene has a target sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the expression vector comprises an expression cassette comprising a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:7, SEQ ID NO:8, or the complement thereof operably linked to a promoter. In some embodiments, the expression vector comprises an expression cassette comprising SEQ ID NO:7, SEQ ID NO:8, or the complement thereof, operably linked to a promoter. In some embodiments, the expression vector comprises double stranded DNA that is identical (100% identity) to the entire length of SEQ ID NO:7 and SEQ ID NO:8 In some embodiments, the recombinant vector is a pRS426 GPD vector. In preferred embodiments, the S. cerevisiae cell is heat-killed and/or lyophilized.

[00159] In order to avoid introducing the replicating host cells or live microorganisms into the environment, host cells may be killed or inactivated, e.g., unable to grow and/or replicate, before being incorporated into the compositions described herein. Host cells are preferably killed or inactivated in a manner that maintains the ability of the host cell to act as a larvicide, i.e., the inactivation does not disrupt the iRNAs contained within said host cell. In some embodiments, the iRNA can be purified from the host cell before incorporating into the compositions. Suitable methods of killing or inactivating the host cell are known in the art, and include, but are not limited to, heat-inactivation, high pressure, plasma treatment at atmospheric pressure, sonication, low- amperage electric treatment, or dense phase carbon dioxide processing. Concerns about introducing live organisms into treated sites can be ameliorated by using heat-killed microbial host cells, which retain insecticidal potency.

[00160] Compositions

[00161] In some aspects, provided herein are compositions comprising iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In additional aspects, provided are compositions comprising nucleic acid sequences, such as DNA sequences, encoding iRNA effective to inhibit the expression of a gene in a Drosophila fly pest. In further aspects, provided are compositions comprising microbial cells comprising disclosed iRNA and nucleic acid sequences encoding the same. Also provided are compositions further comprising an attractant, a phagostimulant, an insecticide, or a combination thereof, in addition to the disclosed iRNA, nucleic acid sequences encoding the iRNA, and microbial host cells comprising the same.

[00162] In some embodiments, a disclosed composition comprises two or more iRNA molecules, wherein the two or more iRNA molecules are present on, such as encoded by, the same nucleic acid construct, on different nucleic acid constructs, or any combination thereof. In some embodiments, a disclosed composition comprises two or more nucleic acid sequences, such as DNA sequences, wherein the two or more nucleic acid sequences each encode a different interfering RNA molecule.

[00163] In some embodiments, a disclosed composition comprises bacterial cells, yeast cells, algal cells, or a combination thereof. In some embodiments, a disclosed composition comprises nanoparticles, e.g., chitosan nanoparticles. In some embodiments, a disclosed composition is suitable for larval soaking. In some embodiments, a disclosed composition is suitable for sugar feeding. In some embodiments, a disclosed composition is provided in a trap, such as a fly trap. In some embodiments, a disclosed composition is provided in the form of a dried tablet. In some embodiments, a disclosed composition is suitable for topical application, such as application on areas or surfaces where Drosophila fly pests are likely to encounter the compositions. Other suitable methods of delivery are known in the art. Thus, compositions may include the necessary components to deliver the iRNA to insects, such as Drosophila fly pests. For example, compositions may comprise nanoparticles, bacterial cells, yeast cells, algal cells and the like that contain or express the iRNA.

[00164] Microbial Host Cell Compositions

[00165] In some aspects, provided are compositions comprising a microbial cell containing an expression cassette comprising a promoter operably linked to a DNA sequence encoding an iRNA molecule that specifically inhibits expression of a target gene in a Drosophila fly pest. In some embodiments, the microbial cell is a yeast cell, a bacterial cell, a plant cell, or an algal cell. In preferred embodiments, the microbial cell is a yeast cell.

[00166] In some embodiments, the composition comprises a yeast cell engineered to produce iRNA effective to inhibit expression of a target gene in a Drosophila fly pest. In some embodiments, the composition comprises a bacterial cell engineered to produce iRNA effective to inhibit expression of a target gene in a Drosophila fly pest. In some embodiments, the composition comprises an algal or plant cell engineered to produce iRNA effective to inhibit expression of a target gene in a Drosophila fly pest.

[00167] In some embodiments, the target gene encodes poly glutamine-repeat protein pqn-41, potassium voltage-gated channel protein Shaker, or a homolog or ortholog thereof.

[00168] In some embodiments, the target gene has a target sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[00169] In some embodiments, any of the yeast, bacterial, algal, or plant cell is alive. In preferred embodiments, any of the yeast, bacterial, algal, or plant cell is dead. In other preferred embodiments, any of the yeast, bacterial, algal, or plant cell is killed by heat, such as heat-killed, and/or lyophilized. In some embodiments, any of the yeast, bacterial, algal, or plant cell is synthesized into a ready-to use dry formulation.

[00170] In some embodiments, disclosed compositions comprise Saccharomyces cerevisiae comprises an expression vector comprising DNA sequences encoding iRNA effective to inhibit the expression of a target gene in D. suzukii. Tn some embodiments, the target gene is polyglutamine-repeat protein pqn-41 (Gene ID: 108012261), potassium voltage-gated channel protein Shaker (Gene ID: 108016735), or a homolog or ortholog thereof.

[00171] In some embodiments, the target gene has a target sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the expression vector comprises an expression cassette comprising a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:7, SEQ ID NO:8, or the complement thereof operably linked to a promoter. In some embodiments, the expression vector comprises an expression cassette comprising SEQ ID NO:7, SEQ ID NO:8, or the complement thereof operably linked to a promoter. In some embodiments, the recombinant vector is a pRS426 GPD vector. In preferred embodiments, the 5. cerevisiae cell is heat-killed and/or lyophilized.

[00172] In some embodiments, disclosed compositions further comprise at least one suitable carrier, excipient, or diluent, such as an agriculturally acceptable carrier, excipient, or diluent. In some embodiments, disclosed compositions further comprise an attractant, phagostimulant, or an insecticide. In preferred embodiments, disclosed compositions further comprise an attractant, e.g., a sugar bait, such as an attractive sugar targeted bait.

[00173] In some embodiments, disclosed compositions are insecticidal. In some embodiments, upon contact with an organism having a target gene, such as a target organism, the disclosed compositions result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality, including any and all numerical values and ranges in between. In some embodiments, the target organism is any one or more of more of Drosophila ananassae, Drosophila biarmipes, Drosophila elegans, Drosophila erecta, Drosophila funebris, Drosophila grimshawi, Drosophila melanogaster, Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willistoni, and Drosophila yakuba.

[00174] Attractants, Phagostimulants, and Insecticides

[00175] In some embodiments, the disclosed compositions are effective to inhibit expression of a target gene in a Drosophila fly pest by RNA interference (RNAi). In some embodiments, the compositions comprise any of disclosed iRNA, nucleic acid sequences encoding said iRNA, constructs comprising the iRNA and nucleic acid sequences encoding the same, expression vectors comprising the nucleic acid sequences, expression cassette comprising the nucleic acid sequences operably linked to a promoter, and microbial cells containing the preceding in any combination. In some embodiments, a disclosed composition further comprises an attractant, phagostimulant, insecticide, or a combination thereof. In some embodiments, a disclosed composition further comprises at least one suitable carrier, excipient, or diluent, such as an agriculturally acceptable carrier, excipient, or diluent.

[00176] In some embodiments, the compositions further comprising an attractant, phagostimulant, insecticide, or a combination thereof are insecticidal. In some embodiments, upon contact with an organism having a target gene, such as a target organism, the disclosed compositions result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality, including any and all numerical values and ranges in between. In some embodiments, the target organism is any one or more of more of Drosophila ananassae, Drosophila biarmipes, Drosophila elegans, Drosophila erecta, Drosophila funebris, Drosophila grimshawi, Drosophila melanogaster, Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willistoni, and Drosophila yakuba.

[00177] In some embodiments, a disclosed composition further comprises a bait and/or a trap, such as a lure trap. In some embodiments, the bait comprises an attractant. In some embodiments, the attractant is sugar. In some embodiments, the bait is an attractive targeted sugar bait or an attractive toxic sugar bait (ATSB). Attractive targeted sugar baits typically contain an attractant, including a form of sugar, such as a fruit syrup, and a toxic agent, such as a chemical insecticide. See, e.g., Wongthangsiri et al., Agriculture and Natural Resources, 2018;52(4):393-398.

[00178] Lure traps are commonly used to attract and kill insect pests. Design and use of such traps are well known to those of skill in the art. A lure trap of the invention can be any device into which the recombinant yeast of the invention are placed, and that prevents the insect pest from escaping once the insect pest has come into contact with the trap. The traps can be of various sizes, shapes, colors, and materials. Traps may be designed and manufactured specifically for use as an insect trap, or can be a container converted and adapted from other uses such as, for example, a glass Petri dish, a metal coffee can, a cardboard box, or any ordinary plastic, metal, fiberglass, composite or ceramic container.

[00179] In some embodiments, disclosed compositions, e.g., microbial host cell compositions, are dispersed onto a plant surface, e.g., fruit and/or leaves. Exemplary plants coated with disclosed compositions include fruiting shrubs, trees, or vines, such as blackberry plants, blueberry bushes, cherry trees, grape vines, raspberry plants, and strawberry plants.

[00180] Considerable research has been directed at determining the natural volatile compounds that attract vinegar flies to their hosts and incorporating them into lures for commercial traps. For example, yeast have been incorporated into lure traps for vinegar flies (see e.g., U.S. Pat. No. 8,940,287). Such a trap may comprise yeast in combination with a growth medium (e.g., sugar and water). The growth medium can also include chemicals or nutrients necessary to induce expression of the dsRNA in transformed yeast cell. The trap may also comprise dried or fresh vegetable matter.

[00181] In some embodiments, a disclosed composition further comprises an insecticide, such as a chemical insecticide. In some embodiments, the chemical insecticide is any one of spinosad, cyantraniliprole, malathion, spinetoram, lambda-cyhalothrin, fenpropathrin, cyclaniliprole, acetamiprid, pyrethrin, or azadirachtin.

[00182] Methods

[00183] In some aspects, disclosed herein are methods of controlling a Drosophila fly pest by contacting the pest with a nucleic acid sequence that is or is capable of producing an iRNA effective to inhibit expression of a target gene in the pest. “Controlling” refers to, e.g., preventing and/or controlling Drosophila fly populations and/or infestations. In some embodiments, the method comprises contacting the pest with a microbial cell comprising the nucleic acid sequence that is or is capable of producing an iRNA effective to inhibit expression of a target gene in the pest.

[00184] Methods and cells delivering disclosed iRNA for contact with an insect include, but are not limited to, e.g. larval soaking, nanoparticles (e.g., chitosan nanoparticles), bacterial cells, yeast cells, algal cells, ovitraps, dried tablets, sugar feeding, and topical applications, among others. Other suitable methods of delivery are known in the art. Thus, compositions may include the necessary components to deliver the iRNA to the insects, such as the Drosophila fly pests. For example, compositions may comprise nanoparticles, bacterial cells, yeast cells, algal cells and the like that contain or express the iRNA.

[00185] In some embodiments, the disclosed methods comprise contacting the Drosophila fly pest with a microbial cell comprising a nucleic acid sequence that is or is capable of producing an iRNA effective to inhibit expression of a target gene in the pest. In some embodiments, the microbial cell is a yeast cell, abacterial cell, a plant cell, or an algal cell. In preferred embodiments, the microbial cell is a yeast cell.

[00186] In some embodiments, the disclosed methods comprise contacting a Drosophila fly pest with a yeast cell engineered to produce iRNA effective to inhibit expression of a target gene in a Drosophila fly pest. In some embodiments, the disclosed methods comprise contacting a Drosophila fly pest with a bacterial cell engineered to produce iRNA effective to inhibit expression of a target gene in a Drosophila fly pest. In some embodiments, the disclosed methods comprise contacting a Drosophila fly pest with an algal or plant cell engineered to produce iRNA effective to inhibit expression of a target gene in a Drosophila fly pest. In some embodiments, the Drosophila fly pest any one or more of more of Drosophila nanassae, Drosophila biarmipes, Drosophila elegans, Drosophila erecta, Drosophila funebris. Drosophila grimshawi, Drosophila melanogaster. Drosophila, mojavensis, Drosophila persimilis, Drosophila pseudoobscura, Drosophila sechellia, Drosophila simulans, Drosophila subpulchrella, Drosophila suzukii, Drosophila takahashii, Drosphila virillis, Drosophila willistoni, and Drosophila yakuba. [00187] In some embodiments, the disclosed methods comprise targeting a gene, such as a target gene, encoding polyglutamine-repeat protein pqn-41, potassium voltage-gated channel protein Shaker, or a homolog or ortholog thereof in order to control a Drosophila fly pest.

[00188] In some embodiments, the target gene has a target sequence represented by any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[00189] In some embodiments, the disclosed methods comprise contacting a Drosophila fly pest with a yeast cell comprising an expression cassette comprising a nucleotide sequence encoding iRNA. In some embodiments, the iRNA is perfectly or partially complementary to a portion of mRNA transcribable from a nucleotide sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the iRNA is perfectly or partially complementary to a portion of mRNA transcribable from any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[00190] In some embodiments, the disclosed methods comprise contacting a Drosophila fly pest with a yeast cell comprising an expression cassette comprising a DNA sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:7, SEQ ID NO:8, or the complement thereof, operably linked to a promoter. In some embodiments, the disclosed methods comprise contacting a Drosophila fly pest with a yeast cell comprising an expression cassette comprising SEQ ID NO:7, SEQ ID NO:8, or the complement thereof operably linked to a promoter. In some embodiments, the expression cassette is integrated into the genome of the yeast cell. In some embodiments, the recombinant vector is a pRS426 GPD vector. [00191] In some embodiments, the disclosed methods comprise contacting a Drosophila fly pest with a dead microbial host cell as disclosed herein, such as heat-killed. In some embodiments, it is preferred that the microbial host cell is heat inactivated to reduce or eliminate the ability of the microbial host cell to grow once released into a treatment area. In preferred embodiments, a yeast cell for contacting the Drosophila pest is heat inactivated to reduce or eliminate the ability of the yeast to grow once released into a treatment area. In some embodiments, the yeast is being synthesized into a ready-to use dry formulation. In some embodiments, the yeast is S. cerevisiae. [00192] In some embodiments, the disclosed methods further comprise contacting the pest with a bait, such as a sugar bait. In some embodiments, the bait is present within a trap, such as a lure trap. In some embodiments, the bait and/or the trap comprises any of the nucleic acids, engineered microbial host cell, or compositions disclosed herein. In some embodiments, the attractant comprises any of an attractive microbe, such as an attractive symbiont microbe, sugar, or a combination thereof. In some embodiments, the attractant is a yeast, such as Saccharomyces cerevisiae or Hanseniaspora uvarum.

[00193] In some embodiments, the disclosed methods comprise contacting a Drosophila fly pest with an attractant comprising sugar, e.g., sucrose, fructose, glucose, or any combination thereof and/or a sugar substitute. In some embodiments, the attractant comprises any one or more of corn syrup, fruit, fruit puree, and fruit juice.

[00194] In some embodiments, the bait is a sugar bait, such as an attractive targeted sugar bait or an attractive toxic sugar bait (ATSB). In some embodiments, the sugar bait comprises sugar and any one or more of at least one pheromone, at least one attractive symbiont, and at least one insecticide. ATSB’s, which are known in the art and commercially available, may include a sugar bait and a toxic agent, e.g., an insecticide. ATSBs are described in, e.g., WO2020185583A1, W02009150254A1, Hapairai et al., Insect Biochem Mol Biol. 2020 May; 120: 103359, Mysore et al., PLoS Negl Prop Dis. 2020 Jul; 14(7): e0008479, Wongthangsiri et al., Agric. Nat. Resour. 2018;52(4):393-398, Khan etal., ZoS( we. 2013 Sep 24;8(9):e77225, Fraser et al., Malar J. 2021 Mar 17;20(l):15.

[00195] In some embodiments, disclosed methods comprise contacting a Drosophila fly pest with disclosed nucleic acids, engineered microbial host cells, compositions, or any combination thereof, which has been dispersed onto a plant surface, e.g., fruit and/or leaves. Exemplary plants coated with disclosed nucleic acids, engineered microbial host cells, compositions, or any combination thereof, include fruiting shrubs, trees, or vines, such as blackberry plants, blueberry bushes, cherry trees, grape vines, raspberry plants, and strawberry plants. In one example, contacting a Drosophila fly pest with any of the disclosed nucleic acids, engineered microbial host cells, compositions, or any combination thereof, dispersed onto a plant surface is useful to exert larvicidal activity, as adult Drosophila fly pests are known to lay eggs on or into such plant surfaces, such as into the fruit of a plant.

[00196] In some embodiments, disclosed methods comprise contacting a Drosophila fly pest, such as Drosophila suzukii, with heat-killed and/or lyophilized Saccharomyces cerevisiae comprising an expression vector comprising DNA sequences encoding iRNA effective to inhibit the expression of a target gene in D. suzukii. In some embodiments, the target gene is polyglutamine-repeat protein pqn-41 (Gene ID: 108012261), potassium voltage-gated channel protein Shaker (Gene ID: 108016735), or a homolog or ortholog thereof. [00197] In some embodiments, the target gene has a target sequence represented by any one of

SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 or a sequence having at least 84%, 88%, 92%, or 96% sequence identity to the entire length of any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the expression vector comprises an expression cassette comprising SEQ ID NO:7, SEQ ID NO:8, or the complement thereof, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity to the entire length of SEQ ID NO:7, SEQ ID NO:8, or the complement thereof.

[00198] In some embodiments, the disclosed methods further comprise contacting the pest with an additional attractant. In some embodiments, the additional attractant comprises any of a microbe, sugar, vinegar, pheromones, or a combination thereof. In some embodiments, the additional attractant comprises any of an attractive microbe, such as an attractive symbiont, sugar, fruit, fruit puree, fruit juice, wine, vinegar, e.g., apple cider vinegar, and a pheromone, e.g., ethanol, acetic acid, methionol, and acetoin, or a combination thereof. In some embodiments, the attractive symbiont is Saccharomyces cerevisiae, Hanseniaspora uvarum, or a combination thereof.

[00199] In some embodiments, the disclosed methods further comprise contacting the pest with an insecticide, such as a chemical insecticide. In some embodiments, the insecticide contacting the pest is any one of spinosad, cyantraniliprole, malathion, spinetoram, lambda-cyhalothrin, fenpropathrin, cyclaniliprole, acetamiprid, pyrethrin, or azadirachtin. In some embodiments, the insecticide is any combination of spinosad, cyantraniliprole, malathion, spinetoram, lambda- cyhalothrin, fenpropathrin, cyclaniliprole, acetamiprid, pyrethrin, and azadirachtin. [00200] In some embodiments, the disclosed methods result in a percent (%) mortality of at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 100% mortality, including any and all numerical values and ranges in between.

EXAMPLES

[00201] Example 1: Preparation of Yeast Strain DsuzRbfoxl-A and Evaluation of Biopesticide Activity in Spotted Wing Drosophila (SWD)

[00202] Saccharomyces cerevisiae, also known as baker’s yeast, is a potent attractant for SWD. This characteristic was exploited by modifying the yeast to express interfering RNA (iRNA) targeting SWD-specific genes. In an exemplary study, S. cerevisiae was modified to produce an iRNA that inhibits the expression of the SWD RNA-binding Fox protein 1 (Rbfoxl) gene. The Rbfoxl gene has been shown to contribute to muscle diversity in adult Drosophila (Nikonova et al., Life Sci Alliance. 2022 Jan 7;5(4):e202101342).

[00203] An iRNA targeting a sequence CCATTGGCGATACTATCCAATCCGG (SEQ ID NO:1), within the Drosophila suzukii target gene encoding polyglutamine-repeat protein pqn-41 (LOCI 08012261) was developed and cloned into an expression vector. Specifically, an shRNA expression cassette having the sequence shown below in FIG. 1 and represented by SEQ ID NO:7 and SEQ ID NO:8 was cloned into the pRS426 GPD vector.

[00204] Preparation of a Saccharomyces cerevisiae Expressing an shRNA Targeting SWD Rbfoxl (DsuzRbfox l -A): Yeast preparation and cloning were performed according to the methods described in Mysore et al., Methods Mol Biol. 2019; 1858: 213-231 with modifications. Briefly, an shRNA expression vector was constructed using a pRS426 GPD yeast shuttle vector and custom oligonucleotides encoding the shRNA transcript shown in FIG. 1. [00205] Laboratory Insecticide Trial: To assess the insecticidal activity of DsuzRbfoxl-A in SWD, 40 mg of heat-inactivated lyophilized yeast (Rbfoxl-A or control yeast) was mixed with 100 ul of 10% sucrose (ASB) in a tube. Drops of the mixture were placed in a petri dish. Adult D. suzukii females were permitted to feed for 4-6 hours ad libitum on the attractive targeted sugar bait (ATSB) or control mixtures and then returned to vials and reared on normal fly media. Fly survival was monitored for six days following iRNA yeast biopesticide consumption.

[00206] Ingestion of DsuzRbfoxl-A was associated with a nearly 8-fold increase in mortality. Accordingly, this study shows the potent insecticidal activity of yeast containing nucleic acid constructs encoding shRNA designed to inhibit expression of SWD gene Rbfoxl. As shown here, yeast modified as described herein may be combined with an attractive substance, such as sugar. Such modified yeast may also be combined with additional insecticides, attractants, pheromones, and phagostimulants.

[00207] Example 2: Production of Yeast Biopesticides Comprising Interfering RNA (iRNA) Effective to Selectively Decrease Expression of shaker in a Drosophila fly pest [00208] Generation of yeast containing iRNA: Yeast strains expressing iRNA effective to specifically silence Drosophila fly pest gene shaker, will be constructed according to methods previously described in (Hapairai et al., Scientific Reports. 2017;7: 13223) with modifications. DNA oligonucleotides encoding short hairpin RNAs (shRNAs) corresponding to the Drosophila target sequence, e.g., SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, and a control hairpin with no known Drosophila sequence target are custom synthesized for two different types of yeast transformants.

[00209] Transient transformation: For transient transformation assays, the shRNA expression cassettes are cloned into a suitable vector. Following sequencing to confirm the inserts, the plasmids are transformed into a strain of S. cerevisiae, such as BY474243, genotype MATa hi s3 Al leu2A0 lys2A0 ura3 AO. Transformants are selected by growth on minimal media lacking uracil.

[00210] Generation of stable transformants: DNA encoding the SWD-sequence-targeting shRNA or control shRNA is ligated downstream of the Gall promoter and upstream of the cycl terminator. The resulting Gall promoter-shRNA-cycl terminator expression cassettes are cloned into the multiple cloning sites of pRS404 and pRS40646, yeast integrating plasmid shuttle vectors bearing TRP1 and URA3 markers, respectively. The resulting plasmids are used for genome integration of the shRNA expression cassettes at the trpl and ura3 loci of the S. cerevisiae strain. Stable transformants are selected by growth on synthetic complete media lacking tryptophan or uracil. Integration events at both loci are confirmed via PCR and sequencing.

[00211] Yeast culturing: Following selection, yeasts are grown under standard conditions in synthetic media to an ODeoo of 3.0. For galactose induction experiments, yeasts are cultured in 20 ml synthetic complete medium (SCD) medium containing 20 g/L glucose to early stationary growth phase. Cells are harvested by centrifugation and transferred into 200 ml of fresh SCD medium containing 20 g/L galactose along with 2 g/L glucose. Cells are then cultured at 30 °C and 250 rpm for 18h (ODeoo- 3.0).

[00212] Preparation of yeast larvicide formulations: Yeast-agarose tablets for feeding assays are prepared from 50 ml of liquid yeast culture to produce pellets of live and heat-inactivated yeasts, as described by Whyard et al., Parasites & Vectors 2015;8(96). Yeast cultures are grown as described herein to prepare dried tablet formulations. The cultures are then transferred to 50 ml conical tubes, each containing 50 ml of culture for transient transformants or 40 ml of culture for stable transformants, and pelleted by centrifugation for 20 min at 4000 rpm. The supernatant (media) is discarded before placing the pellet in a 70 °C water bath for 5 mins. The yeast pellet is then placed into a 2 ml tube containing 10 mg of liver powder as a nutritional supplement and centrifuged for 1 min at -13.2 rpm. The supernatant is discarded again, and the tubes are left open in an incubator at 30 °C for 48 hrs to evaporate remaining media. The tablets are allowed to dry before storage in capped microfuge tubes at -20 °C. The final weight of transiently-transformed yeast and stable yeast transformant tablets is then determined.

[00213] Lethal dose determination: Drosophila fly pest larvae, such as D. suzukii larvae, are exposed to various amounts of control yeast and yeast comprising iRNA to determine the range of efficacy. Control yeast are mixed with iRNA yeast in various concentrations to generate the dried inactivated yeast tablets. Drosophila fly pest larvae are then fed with the compositions and assessed. Abbot’s formula is used to account for mortality in control animals. Data from all replicates are pooled for analysis. The median lethal dose (LDso) with 95% confidence intervals are calculated from a log dosage-probit mortality regression line using computer software.

[00214] Exposure to yeast expressing the described nucleic acid molecules is expected to interfere with larval maturation to adulthood. An insecticide assay in Example 1 may also be completed with compositions selectively targeting shaker in Drosophila fly pests. Similarly, exposure to the modified yeast is expected reduce fitness, which may include disruptions in locomotor activity, fecundity, and result in mortality.

[00215] Example 3: Evaluating the Efficacy of Disclosed Yeast Biopesticides Combined with Attractive Targeted Sugar Baits (ATSB) in Spotted Wing Drosophila (SWD)

[00216] Disclosed yeast biopesticides will be prepared and delivered to spotted wing drosophila (SWD) using attractive targeted sugar bait (ATSB) lures. The impact of yeast biopesticide-ATSB consumption will be assessed using yeast strains that target various SWD genes, as described herein. [00217] Studies will include examination of the best mechanisms of yeast delivery in both laboratory and field conditions. In the lab, two-point assays will be conducted in conjunction with other baits. Similar studies will be conducted in the field, where baits can be marked with dyes that allow tracking upon recapture. Efficacy will be evaluated by, e.g., confirming target gene silencing and assessing the impact of ATSB treatments on neural activity using immunohistochemical analysis. Such methods will be conducted as previously described in Hapairai et al., Insect Biochem Mol Biol. 2020 May; 120: 103359 and Mysore et al., PLoS Negl Prop Dis. 2020 Jul; 14(7): e0008479 with modifications.

[00218] At the conclusion of the studies, it is anticipated that ATSBs containing disclosed yeast biopesticides will specifically target SWD genes, resulting in toxicity ranging from reductions in fitness, such as reproductive fitness, or death. Additionally, processes necessary for manufacturing SWD-specific yeast-based biopesticides, combining such biopesticides with additional insecticide compositions, such as ATSBs, and for delivering the same to SWD populations, will be developed.

[00219] EQUIVALENTS AND SCOPE

[00220] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present invention is not intended to be limited to the above, but rather is as set forth in the appended claims.

[00221] In the claims articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.

[00222] Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses and descriptive terms, from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim.

[00223] Where elements are presented as lists, e.g., in Markush group format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the invention is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the term “comprising” is intended to be open and permits the inclusion of additional elements or steps.

[00224] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranged can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. [00225] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of the ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5% or up to 1% of a given value. Alternatively, the term can mean within an order of magnitude, for example within 5-fold, or within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.

[00226] In addition, it is to be understood that any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the method of the invention can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.

[00227] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

[00228] Sequences

Claims

CLAIMS I claim

Claim 1. An interfering ribonucleic acid comprising a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a target DNA sequence having 88%, 92%, 96%, or 100% identity to: a) the entire length of SEQ ID NO: 1, SEQ ID NO:2, or SEQ ID NO:3, and wherein the interfering RNA inhibits the production of polyglutamine-repeat protein pqn-41 or an ortholog thereof in a Drosophila fly pest by RNA interference; or b) the entire length of SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, and wherein the interfering RNA inhibits the production of potassium voltage-gated channel protein Shaker in a Drosophila fly pest by RNA interference.

Claim 2. The interfering RNA of claim 1, wherein the interfering RNA is an RNA construct, a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.

Claim 3. The interfering RNA of claim 1 or claim 2, wherein the interfering RNA is an shRNA.

Claim 4. The interfering RNA of any one of claims 1 to 2, wherein the nucleotide sequence of the interfering RNA comprises 25 contiguous nucleotides.

Claim 5. The interfering RNA of any one of claims 1 to 2, wherein the Drosophila fly pest is any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila bipectinate, Drosophila elegans, Drosophila kikkawai, Drosophila melanogaster, Drosophila simulans,

Drosophila suzukii, and Drosophila takahashii.

Claim 6. The interfering RNA of claim 5, wherein the Drosophila fly pest is Drosophila suzukii and the expression of polyglutamine-repeat protein pqn-41 (LOC108012261) is inhibited.

Claim 7. The interfering RNA of claim 5, wherein the Drosophila fly pest is Drosophila suzukii and the expression of potassium voltage-gated channel protein Shaker (LOCI 08016735) is inhibited.

Claim 8. An expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence which encodes the interfering RNA molecule of any one of claims 1 to 2.

Claim 9. An expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence which encodes an interfering RNA molecule comprising a nucleotide sequence of 20 to 30 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to mRNA transcribed from a DNA sequence having 88%, 92%, 96%, or 100% identity to: a) the entire length of any one of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, and wherein the interfering RNA inhibits the production of polyglutamine-repeat protein pqn-41 or an ortholog thereof in a Drosophila fly pest by RNA interference; or b) the entire length of any one of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and wherein the interfering RNA inhibits the production of potassium voltage-gated channel protein Shaker in a Drosophila fly pest by RNA interference.

Claim 10. The expression cassette of claim 9, wherein the nucleotide sequence of the interfering RNA molecule comprises 25 nucleotides which are partially or perfectly complementary to a mRNA transcribed from the entire length of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

Claim 11. The expression cassette of claim 9 or claim 10, comprising a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity to the entire length of: a) SEQ ID NO:7 or the complement thereof; or b) SEQ ID NO: 8 or the complement thereof.

Claim 12. The expression cassette of claim 9 or claim 9, wherein the regulatory sequence comprises a GPD promoter.

Claim 13. The expression cassette of any one of claims 8 to 9, wherein the expression cassette is integrated into the genomic DNA of Saccharomyces cerevisiae.

Claim 14. A microbial cell comprising the expression cassette of any one of claims 8 to 9.

Claim 15. The microbial cell of claim 14, wherein the expression cassette is integrated into the genomic DNA of the microbial cell.

Claim 16. The microbial cell of claim 14, wherein the microbe is Escherichia coli or Saccharomyces cerevisiae.

Claim 17. A composition comprising any one or more of the interfering RNA of claim 1, the expression cassette of claim 8, and the microbial cell of claim 14.

Claim 18. A composition comprising an expression cassette comprising a promoter operably linked to a DNA sequence encoding an interfering RNA molecule which is partially or perfectly complementary to a target sequence in a target gene, wherein the target gene encodes polyglutamine-repeat protein pqn-41 or potassium voltage-gated channel protein Shaker in a Drosophila fly pest and the interfering RNA specifically inhibits expression of the target gene.

Claim 19. The composition of claim 18, wherein the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.

Claim 20. The composition of claim 19, wherein the interfering RNA is a short hairpin RNA (shRNA).

Claim 21. The composition of any one of claims 18 to 20, wherein the Drosophila fly pest is any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila bipectinate, Drosophila elegans, Drosophila kikkawai, Drosophila melanogaster, Drosophila simulans,

Drosophila suzukii, and Drosophila takahashii.

Claim 22. The composition of claim 21, wherein the Drosophila fly pest is Drosophila suzukii.

Claim 23. The composition of any one of claims 18 to 20, wherein the target sequence within the target gene is 88%, 92%, 96%, or 100% identical to the entire length of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

Claim 24. The composition of any one of claims 18 to 20, wherein the expression cassette comprises a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of: c) SEQ ID NO:7 or the complement thereof; or d) SEQ ID NO: 8 or the complement thereof.

Claim 25. The composition of any one of claims 18 to 20, wherein the expression cassette comprises the entire length of SEQ ID NO:7 and SEQ ID NO:8.

Claim 26. The composition of any one of claims 18 to 20, wherein the interfering RNA comprises a nucleotide sequence of at least 25 contiguous nucleotides which are partially or perfectly complementary to mRNA transcribed from the entire length of SEQ ID NO: 1, SEQ ID NO:2, or SEQ ID NO:3, and wherein the interfering RNA is capable of inhibiting the expression of polyglutamine-repeat protein pqn-41 (LOC108012261) in Drosophila suzukii.

Claim 27. The composition of any one of claims 18 to 20, wherein the interfering RNA comprises a nucleotide sequence of at least 25 contiguous nucleotides which are partially or perfectly complementary to a portion of mRNA transcribed from SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, and wherein the interfering RNA is capable of inhibiting the expression of potassium voltage-gated channel protein Shaker (LOCI 08016735) in Drosophila suzukii.

Claim 28. The composition of any one of claims 18 to 20, wherein the expression cassette is integrated into the genome of a yeast cell.

Claim 29. The composition of claim 28, wherein the yeast cell is Saccharomyces cerevisiae.

Claim 30. The composition of claim 28, wherein the yeast cell is killed by heat and/or lyophilized.

Claim 31. The composition of any one of claims 18 to 20, further comprising a sugar bait.

Claim 32. The composition of claim 31, wherein the sugar bait comprises sugar and any one or more of at least one pheromone, at least one attractive symbiont, and at least one insecticide.

Claim 33. The composition of claim 32, wherein the at least one attractive symbiont is

Saccharomyces cerevisiae and/ or Hanseniaspora uvarum.

Claim 34. The composition of any one of claims 18 to 20, wherein the composition is within a trap.

Claim 35. The composition of any one of claims 18 to 20, wherein the composition is selectively insecticidal to a Drosophila fly pest.

Claim 36. A method for controlling a Drosophila fly pest, comprising contacting the pest with the interfering RNA of claim 1, the expression cassette of claim 8, the microbial cell of claim 14, or the composition of claim 18, thereby controlling the Drosophila fly pest.

Claim 37. A method for controlling a Drosophila fly pest, the method comprising contacting the Drosophila fly pest with an interfering RNA molecule comprising a nucleotide sequence that is partially or perfectly complementary to mRNA transcribed from a target sequence within a target gene and which specifically inhibits expression of the target gene in the Drosophila fly pest, thereby controlling the Drosophila fly pest, wherein the target gene encodes polyglutamine- repeat protein pqn-41 or potassium voltage-gated channel protein Shaker.

Claim 38. The method of claim 37, wherein the interfering RNA is a double stranded RNA (dsRNA), a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an anti-sense oligonucleotide.

Claim 39. The method of claim 37 or claim 38, wherein the interfering RNA is a short hairpin RNA (shRNA).

Claim 40. The method of any one of claims 37 to 38, wherein the target sequence within the target gene has at least 84%, 88%, 92%, or 96% identity to the entire length of SEQ ID NO: 1, SEQ ID NON, SEQ ID NO:3, SEQ ID NON, SEQ ID NO:5, or SEQ ID NO:6

Claim 41. The method of any one of claims 37 to 38, wherein the target sequence is SEQ ID NO: 1, SEQ ID NON, SEQ ID NON, SEQ ID NON, SEQ ID NON, or SEQ ID NON.

Claim 42. The method of any one of claims 37 to 38, wherein the interfering RNA is produced by a microbial cell comprising an expression cassette comprising a regulatory sequence operably linked to a nucleotide sequence encoding the interfering RNA, wherein the expression cassette is integrated into the genome of the microbial cell.

Claim 43. The method of claim 42, wherein the expression cassette comprises a nucleotide sequence having at least about 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to the entire length of: a) SEQ ID NON or the complement thereof; or b) SEQ ID NON or the complement thereof.

Claim 44. The method of claim 43, wherein the expression cassette comprises the entire length of SEQ ID NON and SEQ ID NON.

Claim 45. The method of claim 42, wherein the method comprises contacting the Drosophila fly pest with the microbial cell.

Claim 46. The method of claim 45, wherein the microbial cell is dead or alive.

Claim 47. The method of claim 45, wherein the microbial cell is Saccharomyces cerevisiae.

Claim 48. The method of any one of claims 37 to 38, wherein the Drosophila fly pest is any one or more of Drosophila ananassae, Drosophila biarmipes, Drosophila bipectinate, Drosophila elegans, Drosophila kikkawai, Drosophila melanogaster, Drosophila simulans, Drosophila suzuki i, and Drosophila takahashii.

Claim 49. The method of claim 48, wherein the Drosophila fly pest is Drosophila suzukii.

Claim 50. The method of claim 49, wherein the target gene encodes Drosophila suzukii polyglutamine-repeat protein pqn-41 (LOC108012261).

Claim 51. The method of claim 49, wherein the target gene encodes Drosophila suzukii potassium voltage-gated channel protein Shaker (LOC108016735).

Claim 52. The method any one of claims 37 to 38, wherein the interfering RNA comprises at least 25 contiguous nucleotides, wherein the nucleotide sequence is partially or perfectly complementary to a portion of mRNA transcribed from any one of: a) SEQ ID NO: 1 or SEQ ID NO:2, and wherein the interfering RNA inhibits the expression of Drosophila stizukii polyglutamine-repeat protein pqn-41 (Gene ID: 108012261) and/or Drosophila elegans sex determination protein fox-1 (LOC108150175) by RNA interference; and b) SEQ ID NO:3, and wherein the interfering RNA inhibits the expression of polyglutamine-repeat protein pqn-41 or an ortholog thereof in any one or more of Drosophila biarmipes (LOCI 08034786), Drosophila ananassae (LOC6493466), Drosophila takahashii (LOCI 08060998), Drosophila kikkawai (LOCI 08071906), and Drosophila bipectinata RNA binding protein fox-1 homolog 1 (LOC108119065) by RNA interference.

Claim 53. The method of any one of claims 37 to 38, wherein the interfering RNA comprises 25 nucleotides which are partially or perfectly complementary to a portion of mRNA transcribed from SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6, and wherein the interfering RNA inhibits the expression of potassium voltage-gated channel protein Shaker in Drosophila melanogaster by RNA interference.

Claim 54. The method of any one of claims 37 to 38, wherein the method further comprises contacting the Drosophila fly pest with a sugar bait, a pheromone, an attractive symbiont, an insecticide, or any combination thereof.