EP4705458A2 - Dual silencing - Google Patents
Dual silencingInfo
- Publication number
- EP4705458A2 EP4705458A2 EP24726696.8A EP24726696A EP4705458A2 EP 4705458 A2 EP4705458 A2 EP 4705458A2 EP 24726696 A EP24726696 A EP 24726696A EP 4705458 A2 EP4705458 A2 EP 4705458A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- nucleic acid
- seq
- double stranded
- nucleotide sequence
- acid molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01076—Retinol O-fatty-acyltransferase (2.3.1.76)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/312—Phosphonates
- C12N2310/3125—Methylphosphonates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3519—Fusion with another nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3521—Methyl
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
- C12N2310/3533—Halogen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/51—Physical structure in polymeric form, e.g. multimers, concatemers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Public Health (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Saccharide Compounds (AREA)
Abstract
The disclosure relates to isolated nucleic acid molecules comprising at least two double stranded inhibitory ribonucleic acid (RNA) molecules adapted to silence by RNA interference either the same gene or different genes to enhance silencing thereby modulating gene expression.
Description
DUAL SILENCING
Field of the Disclosure
The disclosure relates to isolated nucleic acid molecules comprising at least two double stranded inhibitory ribonucleic acid (RNA) molecules adapted to silence by RNA interference either the same gene or different genes to enhance silencing thereby modulating gene expression.
Background to the Disclosure
A technique to specifically ablate gene function is through the introduction of double stranded inhibitory RNA, also referred to as small inhibitory or interfering RNA (siRNA), into a cell which results in the destruction of mRNA complementary to the sequence included in the siRNA molecule. The siRNA molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule. The siRNA molecule is typically, but not exclusively, derived from exons of the gene which is to be ablated. Many organisms respond to the presence of double stranded RNA by activating a cascade that leads to the formation of siRNA. The presence of double stranded RNA activates a protein complex comprising RNase III which processes the double stranded RNA into smaller fragments (siRNAs, approximately 21-29 nucleotides in length) which become part of a ribonucleoprotein complex. The siRNA acts as a guide for the RNase complex to cleave mRNA complementary to the antisense strand of the siRNA thereby resulting in destruction of the mRNA.
Typically, RNA silencing utilises a single siRNA species directed to a single gene to silence expression. It is known to link siRNAs to enable the silencing of two or more genes. For example, WO2016205410 discloses oligonucleotides linked together directly, via functional end-substitutions, or indirectly by way of a linking agent. The oligonucleotide can be bound directly to a linker. Such bonding can be achieved, for example, through use of 3'-thionucleosides. WO2018145086 discloses oligonucleotides in the form of a multimeric oligonucleotide having monomeric subunits of oligonucleotide joined by covalent linkers to decrease clearance due to glomerular filtration. WO2 013040429A1 discloses multi-oligomeric complexes that comprise two or more targeting oligonucleotides linked together by a cleavable linker. WO2015113922
discloses oligo oligonucleotides conjugates where two or more antisense oligonucleotides are covalently linked by physiologically labile linkers, and to a biocleavable functional group such as a conjugate group. W02010141511 discloses bivalent or multivalent nucleic acid molecules or complexes of nucleic acid molecules having two or more target-specific regions, in which the target-specific regions are complementary to a single target gene at more than one distinct nucleotide site, and/or in which the target regions are complementary to more than one target gene or target sequence. WO2017188707 discloses a dicer substrate RNA nanostructure exhibiting enhanced gene silencing effects. The RNA nanostructure includes a plurality of the same or different RNAi sequences in a single RNA nanostructure. The use of oligomeric nanostructures comprising more than one siRNA or antisense molecule is known in the art.
There is a desire to provide alternative and simpler approaches to the delivery of more than one inhibitory RNA to a cell with the objective of silencing the expression of one or more gene targets to obtain enhanced therapeutic effects.
Cardiovascular disease associated with hypercholesterolemia is a common condition and results in heart disease and a high incidence of death and morbidity and can be a consequence of poor diet, obesity, or an inherited dysfunctional gene. For example, mutations in Low Density Lipoprotein Receptor (LDL-receptor) or apolipoprotein B (ApoB) as in familial hypercholesterolemia. Cholesterol is essential for membrane biogenesis in animal cells. The lack of water solubility means that cholesterol is transported around the body in association with lipoproteins. Apolipoproteins form together with phospholipids, cholesterol and lipids which facilitate the transport of lipids such as cholesterol, through the bloodstream to the different parts of the body. Lipoproteins are classified according to size and can form HDL (High-density lipoprotein), LDL (Low-density lipoprotein), IDL (intermediate-density lipoprotein), VLDL (very low- density lipoprotein) and ULDL (ultra-low-density lipoprotein) lipoproteins.
Familial hypercholesterolemia is an orphan disease and results from elevated levels of LDL cholesterol (LDL-C) in the blood. The disease is an autosomal dominant disorder with both the heterozygous (350-550mg/dL LDL-C) and homozygous (650-1000m g/dL LDL-C) states resulting in elevated LDL-C. The heterozygous form of familial hypercholesterolemia is around 1:500 of the population. The homozygous state is much rarer and is approximately 1 :1 ,000,000. The normal levels of LDL-C are in the region 130mg/dL.
Hypercholesterolemia is particularly acute in paediatric patients which if not diagnosed early can result in accelerated coronary heart disease and premature death. If diagnosed and treated early the child can have a normal life expectancy. In adults, high LDL-C, either because of mutation or other factors, is directly associated with increased risk of atherosclerosis which can lead to coronary artery disease, stroke or kidney problems. Lowering levels of LDL-C is known to reduce the risk of atherosclerosis and associated conditions. LDL-C levels can be lowered initially by administration of statins which block the de novo synthesis of cholesterol by inhibiting the HMG-CoA reductase. Some subjects can benefit from combination therapy which combines a statin with other therapeutic agents such as ezetimibe, colestipol or nicotinic acid. However, expression and synthesis of HMG-CoA reductase adapts in response to the statin inhibition and increases over time, thus the beneficial effects are only temporary or limited after statin resistance is established.
The disclosure relates to isolated nucleic acid molecules comprising at least two double stranded inhibitory ribonucleic acid (RNA) molecules adapted to silence by RNA interference either the same gene or different genes to enhance silencing thereby modulating gene expression.
Statements of Invention
According to an aspect of the invention there is provided a nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a nucleotide sequence comprising a gene to be silenced and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand; and ii) a second nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a different or the same gene to be silenced as set forth in i) above and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand wherein the single stranded
deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
In a preferred embodiment of the invention said a single stranded deoxyribonucleic acid (DNA) is linked to said first or second double stranded inhibitory RNA molecule wherein said linkage is selected from the group: i) 5’ sense strand of said first double stranded inhibitory RNA and 5’ antisense stand of said second double stranded RNA molecule; ii) 5’ sense strand of said first double stranded inhibitory RNA and 3’ sense strand of said second double stranded RNA molecule; iii) 5’ sense strand of said first double stranded inhibitory RNA and 5’ antisense strand of said second inhibitory RNA molecule; iv) 5’ sense strand of said first double stranded inhibitory RNA and the 3’ antisense strand of said second double stranded inhibitory RNA molecule; v) 3’ sense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule; vi) 3’ sense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; vii) 3’ sense strand of said first double stranded inhibitory RNA and the 5’ antisense strand of said second double stranded inhibitory RNA molecule; viii) 3’ sense strand of said first double stranded inhibitory RNA and the 3’ antisense of said second double stranded inhibitory RNA molecule; ix) 5’ antisense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule; x) 5’ antisense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; xi) 5’ antisense strand of said first double stranded inhibitory RNA and the 5’ antisense strand of said second double stranded inhibitory RNA molecule; xii) 5’ antisense strand of said first double stranded inhibitory RNA and the 3’ antisense strand of said second double stranded inhibitory RNA molecule; xiii) 3’ antisense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule;
xiv) 3’ antisense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; xv) 3’ antisense strand of said first double stranded inhibitory RNA and the 3’ antisense of said second double stranded inhibitory RNA molecule; and xvi) 3’ antisense strand of said first double stranded inhibitory RNA and the 5’ antisense of said second double stranded inhibitory RNA molecule.
In a preferred embodiment of the invention said the first and second gene to be silenced is the same gene.
In an alternative preferred embodiment of the invention said first and second gene to be silenced are different genes.
In a preferred embodiment of the invention said first and second double stranded inhibitory RNA molecules comprise different nucleotide sequences.
In a preferred embodiment of the invention said first or second gene to be silenced is the Apo B gene.
In a preferred embodiment of the invention said Apo B gene comprises a nucleotide sequence set forth in SEQ ID NO: 1 wherein said double stranded inhibitory RNA is 19- 23 nucleotides in length.
In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 607 to 906.
In a preferred embodiment of the invention said Apo B double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 907 to 1206.
In a further alternative preferred embodiment of the invention said first or second gene to be silenced is DGAT2.
In a preferred embodiment of the invention said DGAT2 gene comprises a nucleotide sequence set forth in SEQ ID NO: 6 wherein said double stranded inhibitory RNA is 19- 23 nucleotides in length.
In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 7 to 306.
In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 307 to 606.
In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4830.
In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprises or consists of a sense nucleotide sequence set forth in SEQ ID NO: 4829.
In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 4840 to 4848.
In a preferred embodiment of the invention said double stranded DGAT2 inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 4831 to 4839.
In an alternative preferred embodiment of the invention said first or second gene to be silenced is PCSK9.
In a preferred embodiment of the invention said PCSK9 gene comprises a nucleotide sequence set forth in SEQ ID NO: 2 wherein said double stranded inhibitory RNA is 19- 23 nucleotides in length.
In a preferred embodiment of the invention said double stranded PCSK9 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 1207 to 1510.
In a preferred embodiment of the invention said double stranded PCSK9 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 1511 to 1814.
In a preferred embodiment of the invention said double stranded PCSK9 inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO:
4822.
In a preferred embodiment of the invention said double stranded PCSK9 inhibitory RNA comprises or consists of a sense nucleotide sequence set forth in SEQ ID NO: 4821.
In a further alternative embodiment of the invention said first or second gene to be silenced is lipoprotein A (Lp(a)).
In a preferred embodiment of the invention said lipoprotein A gene comprises a nucleotide sequence set forth in SEQ ID NO: 3 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
In a preferred embodiment of the invention said lipoprotein A double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 1815 to 2114.
In a preferred embodiment of the invention said lipoprotein A double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 2115 to 2414.
In a preferred embodiment of the invention said lipoprotein A double stranded inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4824.
In a preferred embodiment of the invention said lipoprotein A double stranded inhibitory RNA comprises or consists of an sense nucleotide sequence set forth in SEQ ID NO:
4823.
In a further alternative embodiment of the invention said first or second gene to be silenced is angiotensinogen.
In a preferred embodiment of the invention said angiotensinogen gene comprises a nucleotide sequence set forth in SEQ ID NO: 4 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
In a preferred embodiment of the invention said double stranded angiotensinogen inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 2415 to 2714.
In a preferred embodiment of the invention said double stranded angiotensinogen inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 2715 to 3014.
In a further alternative preferred embodiment of the invention said first or second gene to be silenced is Apo CHI .
In a preferred embodiment of the invention said Apo CHI gene comprises a nucleotide sequence set forth in SEQ ID NO: 5 wherein said double stranded inhibitory RNA is 19- 23 nucleotides in length.
In a preferred embodiment of the invention said double stranded ApoCi II inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 3015 to 3314.
In a preferred embodiment of the invention said double stranded ApoCi II inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 3315 to 3614.
In a preferred embodiment of the invention said double stranded ApoCi II inhibitory RNA comprise or consists of a sense nucleotide sequence set forth in SEQ ID NO 4860.
In a preferred embodiment of the invention said double stranded ApoCi II inhibitory RNA comprise or consists of an antisense nucleotide sequence set forth in SEQ ID NO 4859.
In a preferred embodiment of the invention said first or second gene to be silenced is ANGPTL3.
In a preferred embodiment of the invention said ANGPTL3 gene comprises a nucleotide sequence set forth in SEQ ID NO: 4819 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
In a preferred embodiment of the invention said double stranded ANGPTL 3 inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 3615 to 3914.
In a preferred embodiment of the invention said double stranded ANGPTL 3 inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 3915 to 4214.
In a preferred embodiment of the invention said double stranded ANGPTL3 inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 4826 or 4828.
In a preferred embodiment of the invention said double stranded ANGPTL3 inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 4825 or 4827.
In a preferred embodiment of the invention said first or second gene to be silenced is ANGPTL4.
In a preferred embodiment of the invention said ANGPTL4 gene comprises a nucleotide sequence set forth in SEQ ID NO: 4820 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
In a preferred embodiment of the invention said ANGPTL4 double stranded inhibitory RNA comprise or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 4215 to 4514.
In a preferred embodiment of the invention said ANGPTL4 double stranded inhibitory RNA comprise or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 4515 to 4814.
In a preferred embodiment of the invention said first or second gene to be silenced is selected from the group consisting of: Apo B, DGAT2, PCSK9, Lp(a), APOCHI, angiotensinogen, ANGPTL3 and ANGPTL4
In a preferred embodiment of the invention said first gene is Apo B and said second gene is DGAT2.
In a preferred embodiment of the invention said first gene is Apo B and said second gene is PCSK9.
In a preferred embodiment of the invention said first gene is Apo B and said second gene is angiotensinogen.
In a preferred embodiment of the invention said first gene is Apo B and said second gene is Apo CHI.
In a preferred embodiment of the invention said first gene is Apo B and said second gene is Lp(a).
In a preferred embodiment of the invention said first gene is PCSK9 and said second gene is angiotensinogen.
In a preferred embodiment of the invention said first gene is PCSK9 and said second gene is Apo Cll I .
In a preferred embodiment of the invention said first gene is PCSK9 and said second gene is DGAT2.
In a preferred embodiment of the invention said first gene is PCSK9 and said second gene is Lp(a).
In a preferred embodiment of the invention said first gene is angiotensinogen and said second gene is Apo CHI.
In a preferred embodiment of the invention said first gene is angiotensinogen and said second gene is DGAT2.
In a preferred embodiment of the invention said first gene is angiotensinogen and said second gene is Lp(a).
In a preferred embodiment of the invention said first gene is Apo CHI and said second gene is DGAT2.
In a preferred embodiment of the invention said first gene is Apo CHI and said second gene is Lipoproetin (a).
In a preferred embodiment of the invention said first gene is DGAT2 and said second gene is Lipoprotein (a).
In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is ApoB.
In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is PCSK9.
In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is angiotensinogen.
In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is APOCHI.
In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is Lp(a).
In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is DGAT2.
In a preferred embodiment of the invention said first gene is ANGPLT3 and said second gene is ANPTLT4.
In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is Apo B.
In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is PCSK9.
In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is angiotensinogen.
In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is Apo CHI.
In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is Lp(a).
In a preferred embodiment of the invention said first gene is ANGPLT4 and said second gene is DGAT2.
In an alternative preferred embodiment of the invention said first gene is DGAT2 and comprises a nucleotide sequence set forth in SEQ ID NO: 6 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length and wherein said double stranded DGAT2 inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4830 or 4840 to 4848, and/or a sense nucleotide sequence set forth in SEQ ID NO: 4829 or 4831 to 4839.
In a further preferred embodiment of the invention said first gene is PCSK9 and comprises a nucleotide sequence set forth in SEQ ID NO: 2 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length and wherein said double stranded PCSK9 inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4822, and/or comprises or consists of a sense nucleotide sequence set forth in SEQ ID NO: 4821.
In an alternative preferred embodiment of the invention said first gene is lipoprotein A and comprises a nucleotide sequence set forth in SEQ ID NO: 3 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length and wherein said double stranded lipoprotein A inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4824, and /or of a sense nucleotide sequence set forth in SEQ ID NO: 4823.
In a further preferred embodiment of the invention said first gene is ANGPTL 3 and comprises a nucleotide sequence set forth in SEQ ID NO: 4819 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length and wherein said double stranded ANGPTL 3 inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4826 or 4828, and/or comprise or consists of a sense nucleotide sequence set forth in SEQ ID NO: 4825 or 4827.
In an alternative preferred embodiment of the invention said first gene is ApoC3 and comprises a nucleotide sequence set forth in SEQ ID NO: 5 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length and wherein said double stranded ApoC3 inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4859, and /or of a sense nucleotide sequence set forth in SEQ ID NO: 4860.
In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815).
Preferably said complementary single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816).
In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815) and is attached to the 5’ end of the sense nucleotide sequence.
In an alternative preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815) and is attached to the 5’ end of the antisense nucleotide sequence.
In a preferred embodiment of the invention said complementary single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816) and is attached to the 5’ end of the sense nucleotide sequence.
In a preferred embodiment of the invention said complementary single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816) and is attached to the 5’ end of the antisense nucleotide sequence.
In a preferred embodiment of the invention said first and/or said second double stranded inhibitory RNA molecule comprises or consists of natural nucleotides.
In an alternative preferred embodiment of the invention said first and/or said second double stranded inhibitory RNA molecule comprises modified nucleotides and/or modified sugar(s).
In a preferred embodiment of the invention said modified nucleotides/sugars are selected from the group: a 3 '-terminal deoxy- thymine (dT) nucleotide, a 2'-0-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'- O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2' -hydroxyl- modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-0- alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising phosphorodithioate (PS2), a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5’- phosphate, and a nucleotide comprising a 5 ‘-phosphate mimic, for example a 5’-vinyl phosphate, a nucleotide comprising a 2’-deoxy-2’-fluro and a 2’ methyl sugar base and glycol nucleic acid.
In a preferred embodiment of the invention said first or and/or second double stranded inhibitory RNA molecule comprises at least one modified nucleotide wherein said modification is 2'-deoxy-2'-fluoro.
In a preferred embodiment of the invention said first and/or said second double stranded inhibitory RNA molecule comprises at least one modified nucleotide wherein said modification is 2'-O-methyl.
In a further preferred embodiment of the invention said first and/or said second double stranded inhibitory RNA molecule comprises at least one phosphorothioate linkage.
In a further preferred embodiment of the invention said first and/or said second double stranded inhibitory RNA molecule comprises at least one 5'-vinyl phosphate.
In an embodiment of the invention said first and/or said second double stranded inhibitory RNA molecule comprises at least one modified sugar.
A sugar modification includes a modified version of the ribosyl moiety, such as -O- modified RNA such as 2'-O-alkyl or 2'-O-(substituted)alkyl e.g. 2'-0-methyl, T-0-(2- cyanoethyl), 2'-0-(2-methoxy)ethyl (2'-MOE), 2'-0-(2-thiomethyl)ethyl, 2'-O-butyryl, -O- propargyl, 2'-O-allyl, 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2- amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl, e.g. 2'-0-(2-chloroethoxy)methyl (MCEM), -O- (2,2-dichloroethoxy)methyl (DCEM); 2'-<3- alkoxycarbonyl e.g. T-0-[2- (methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N- methylcarbamoyl)ethyl] (MCE), T-0-[2-(N,N- dimethylcarbamoyl)ethyl] (DCME); 2'-halo e.g. 2'-F, FANA (2'-F arabinosyl nucleic acid); carbasugar and azasugar modifications; 3 '-O-alkyl e.g. 3'-0-methyl, 3 '-O-butyryl, V-O- propargyl and their derivatives.
In a preferred embodiment of the invention there is provided a nucleic acid molecule according to the invention wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4829) and an antisense strand (SEQ ID NO: 4830) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
In a preferred embodiment of the invention there is provided a nucleic acid molecule according to the invention wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4821) and an antisense strand (SEQ ID NO: 4822) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
In a preferred embodiment of the invention there is provided a nucleic acid molecule according to the invention wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4823) and an antisense strand (SEQ ID NO: 4824) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
In a preferred embodiment of the invention there is provided a nucleic acid molecule according to the invention wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4825) and an antisense strand (SEQ ID NO: 4826) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
In a preferred embodiment of the invention there is provided a nucleic acid molecule according to the invention wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4827) and an antisense strand (SEQ ID NO: 4828) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
In a preferred embodiment of the invention there is provided a nucleic acid molecule according to the invention wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4860) and an antisense strand (SEQ ID NO: 4859) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
In a preferred embodiment of the invention there is provided a nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4821) and an antisense strand (SEQ ID NO: 4822) wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand; and ii) a second nucleic acid comprising a double stranded inhibitory (RNA) molecule comprising a sense strand (SEQ ID NO: 4823) and an antisense strand (SEQ ID NO: 4824) and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ of said sense strand wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
In a preferred embodiment of the invention there is provided a nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4825) and an antisense strand (SEQ ID NO: 4826) wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand; and
ii) a second nucleic acid comprising a double stranded inhibitory (RNA) molecule comprising a sense strand (SEQ ID NO: 4829) and an antisense strand (SEQ ID NO: 4830) and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ of said sense strand wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
In a preferred embodiment of the invention there is provided a nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4829) and an antisense strand (SEQ ID NO: 4830) wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand; and ii) a second nucleic acid comprising a double stranded inhibitory (RNA) molecule comprising a sense strand (SEQ ID NO: 4860) and an antisense strand (SEQ ID NO: 4859) and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ of said sense strand wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815).
Preferably said complementary single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816).
In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815) and is attached to the 5’ end of the sense nucleotide sequence.
In an alternative preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815) and is attached to the 5’ end of the antisense nucleotide sequence.
In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816) and is attached to the 5’ end of the sense nucleotide sequence.
In a preferred embodiment of the invention said single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816) and is attached to the 5’ end of the antisense nucleotide sequence.
In a further preferred embodiment of the invention said nucleic acid comprises or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4849 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4822
In an alternative further preferred embodiment of the invention said nucleic acid comprises or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4850 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4822.
In a further preferred embodiment of the invention said nucleic acid comprises or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4851 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4824.
In a further preferred embodiment of the invention said nucleic acid comprises or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4852 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4824.
In a further preferred embodiment of the invention said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4853 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4826.
In an alternative further preferred embodiment of the invention said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4854 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4826.
In a further preferred embodiment of the invention said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4855 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4828.
In an alternative further preferred embodiment of the invention said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4856 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4828.
In an alternative further preferred embodiment of the invention said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4857 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4830.
In an alternative further preferred embodiment of the invention said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4858 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4830
In an alternative further preferred embodiment of the invention said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4861 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4859
In an alternative further preferred embodiment of the invention said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4862 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4859.
In a preferred embodiment of the invention there is provided a nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand selected from the group consisting of SEQ ID NO 607 to 906 and an antisense strand selected from the group consisting of SEQ ID NO 907 to 1206 wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand; and ii) a second nucleic acid comprising a double stranded inhibitory (RNA) molecule comprising a sense strand selected from the group consisting of SEQ ID NO: 7 to 306, 4829, 4831 to 4839, 4857 and 4858 and an antisense strand selected from the group consisting of SEQ ID NO 307-606, 4830 and 4840 to 4848 and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ of said sense strand and wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
In a preferred embodiment of the invention said second nucleic acid comprises a double stranded inhibitory (RNA) molecule comprising a sense strand set forth in SEQ ID NO 4857 and an antisense strand set forth in SEQ ID NO 4830.
In an alternative preferred embodiment of the invention said second nucleic acid comprises a double stranded inhibitory (RNA) molecule comprising a sense strand set forth in SEQ ID NO 4858 and an antisense strand set forth in SEQ ID NO 4830.
In a preferred embodiment of the invention said nucleic acid molecule is covalently linked to A/-acetylgaiactosamine.
The sugar moiety in N-acety!galactosamine can comprise glycosidic linkages to improve stability. A variety of glycosidic bonds are known in the art and formed between the hemiacetal of the sugar moiety and several chemical groups forming O-, N-, S- or C- glycosidic bonds. Preferably the N-acetylgalactosamine comprises an O-, N-, S- or C- glycosidic bond.
In a further embodiment of the invention said N-acetylgalactosamine is linked to either the antisense part of said inhibitory RNA or the sense part of said inhibitory RNA.
In a further embodiment of the invention said N-acetylgalactosamine is linked to either the antisense strand or the sense strand of said double stranded inhibitory RNA molecule of said first nucleic acid.
In a further embodiment of the invention said N-acetylgalactosamine is linked to either the antisense strand or the sense strand of said double stranded inhibitory RNA molecule of said second nucleic.
In a further embodiment of the invention N-acetylgalactosamine is linked to either the antisense strand or the sense strand of said double stranded inhibitory RNA molecule of said first nucleic acid and is linked to either the antisense strand or the sense strand of said double stranded inhibitory RNA molecule of said second nucleic.
Preferably, N-acetylgalactosamine is linked to the 3’ terminus is of said sense RNA.
In an alternative embodiment of the invention N-acetylgalactosamine is linked to the 5’ terminus of said sense RNA.
In an alternative preferred embodiment of the invention said N-acetylgalactosamine is linked to the 3’ terminus of said antisense RNA.
In a preferred embodiment of the invention N-acetylgalactosamine is monovalent.
In a preferred embodiment of the invention N-acetylgalactosamine is divalent.
In an alternative embodiment of the invention N-acetylgalactosamine is trivalent.
In a preferred embodiment of the invention said nucleic add molecule is covalently linked to a molecule comprising the structure:
In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure:
In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure:
In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure:
In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure:
In an alternative embodiment of the invention said nucleic acid molecule is covalently linked to a molecule comprising the structure:
According to a further aspect of the invention there is provided a medicament comprising a nucleic acid according to the invention.
According to a further aspect of the invention there is provided a pharmaceutical composition comprising a nucleic acid molecule according to the invention.
In a preferred embodiment of the invention said composition further includes a pharmaceutical carrier and/or excipient.
According to a further aspect of the invention there is provided a nucleic acid molecule or a pharmaceutical composition according to the invention for use in the treatment or prevention of a subject that has or is predisposed to hypercholesterolemia.
In a preferred embodiment of the invention said use is the treatment or prevention of diseases associated with hypercholesterolemia.
In a preferred embodiment of the invention said disease associated with hypercholesterolemia is selected from the group consisting of: stroke prevention, hyperlipidaemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger’s disease, renal artery stenosis, hyper-apobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis.
When administered the compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers and optionally other therapeutic agents, such as cholesterol lowering agents, which can be administered separately from the nucleic acid molecule according to the invention or in a combined preparation if a combination is compatible.
The combination of a nucleic acid according to the invention and the other, different therapeutic agent is administered as simultaneous, sequential, or temporally separate dosages.
The therapeutics of the invention can be administered by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, transdermal or transepithelial.
The compositions of the invention are administered in effective amounts. An “effective amount” is that amount of a composition that alone, or together with further doses, produces the desired response. In the case of treating a disease, such as cardiovascular disease, the desired response is inhibiting or reversing the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods.
Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of a nucleic acid molecule according to the invention for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by determining regression of cardiovascular disease and decrease of disease symptoms etc.
The doses of the nucleic acid molecule according to the invention administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. If a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. It will be apparent that the method of detection of the nucleic acid according to the invention facilitates the determination of an appropriate dosage for a subject in need of treatment.
In general, doses of the nucleic acid molecules herein disclosed of between 1nM - 1pM generally will be formulated and administered according to standard procedures. Preferably doses can range from 1nM- 500nM, 5nM-200nM, 10nM-100nM. Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing. The administration of compositions to mammals other than humans, (e.g., for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a nonhuman primate, cow, horse, pig, sheep, goat, dog, cat or rodent.
When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically acceptable amounts and in pharmaceutically acceptable compositions. The term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents e.g. statins. When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
Compositions may be combined, if desired, with a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term “pharmaceutically acceptable carrier” in this context denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate, for example, solubility and/or stability. The components of the pharmaceutical compositions also are capable of being co-mingled with the molecules of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
The pharmaceutical compositions may contain suitable buffering agents, including acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives.
The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of nucleic acid, which is preferably isotonic with the blood of the recipient. This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1, 3-butane diol. Among the acceptable solvents that may be employed are water, Ringer’s solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.
According to a further aspect of the invention there is provided a method to treat a subject that has or is predisposed to hypercholesterolemia comprising administering an effective dose of a nucleic acid or a pharmaceutical composition according to the invention thereby treating or preventing hypercholesterolemia.
In a preferred method of the invention the hypercholesterolemia is familial hypercholesterolemia.
In a preferred method of the invention there is provided the treatment or prevention of diseases associated with hypercholesterolemia.
In a preferred method of the invention said disease associated with hypercholesterolemia is selected from the group consisting of: stroke prevention, hyperlipidaemia, cardiovascular disease, atherosclerosis, coronary heart disease, aortic stenosis, cerebrovascular disease, peripheral arterial disease, hypertension, metabolic syndrome, type II diabetes, non-alcoholic fatty acid liver disease, non-alcoholic steatohepatitis, Buerger’s disease, renal artery stenosis, hyper-apobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis.
Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of the words, for example “comprising” and “comprises”, means “including but not limited to”, and is not intended to (and does not) exclude other moieties, additives, components, integers or steps. “Consisting essentially” means having the essential integers but including integers which do not materially affect the function of the essential integers.
Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.
Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.
An embodiment of the invention will now be described by example only and with reference to the following materials, methods and examples:
MATERIALS AND METHODS
Transfection in primary mouse hepatocytes
Duplex siRNAs and heterodimer siRNAs synthesized by Bio-Synthesis (Lewisville, TX) (Table 3 and 5), were resuspended in nuclease-free water (Invitrogen™ AM9932) to generate a stock solution of 10 pM. For serum stability assay, stock siRNAs were incubated in vehicle (nuclease-free water) or in various concentrations (20% - 80%) of human serum (HS) for 2 hours at 37°C. After pre-incubation in serum or vehicle, siRNAs were transfected into primary mouse hepatocytes in triplicates in a 384-well plate
(Thermo Scientific™ 164688) at various concentrations ranging from 2.5 nM to 100 nM using 0.15 pL of Lipofectamine RNAiMAX (I nvitrogen™ 13778075) per well. Transfected cells were incubated at 37°C and 5% CO2 for 48 hours. Cells receiving no siRNA treatment were used as control.
Free-uptake assay of GalNAc-conjugated ApoB-mTTR heterodimers in primary mouse hepatocytes
Standard siRNA controls (mTTR and ApoB_C3_01) and GalNAc-conjugated ApoB- mTTR heterodimers (Table 7) were synthesized at Bio-Synthesis (Lewisville, TX). GalNAc-conjugated constructs and standard siRNA controls were resuspended in nuclease-free water (Invitrogen™ AM9932) to generate a stock solution of 10 pM. Stock siRNAs were distributed in triplicates in 384-well plates (Thermo Scientific™ 164688) to a final concentration of 4 nM, 25 nM and 100 nM and primary mouse hepatocytes were added at a concentration of 5,000 cells per well for free-uptake assay. After treatment, cells were incubated at 37°C and 5% CO2 for 48 hours. Cells receiving no siRNA treatment were used as control.
Duplex RT-qPCR
Cells were processed for RT-qPCR read-out using the Cells-to-CT 1-step TaqMan Kit (Invitrogen™ A25603). Briefly, cells were washed with 50pL ice-cold PBS and lysed in 20 pl Lysis solution containing DNase I. Lysis was stopped after 5 minutes by addition of 2 pl STOP Solution for 2 min. For the RT-qPCR analysis, 1 pL of lysate was dispensed per well into a 96-well PCR plate in a 10 pL RT-qPCR reaction volume. RT-qPCR was performed using the TaqMan® 1-Step qRT-PCR Mix from the Cells-to-CT 1-step TaqMan Kit, with TaqMan probes for GAPDH (VIC_PL, Assay Id Mm99999915_g1), mTTR (FAM, Assay Id Mm00443267_m1), ApoB (FAM, Assay Id Mm01545150_m1) or DGAT2 (FAM, Assay Id Mm00499536_m1). RT-qPCR was performed using a QuantStudio 5 thermocycling instrument (Applied BioSystems). Relative quantification was determined using the AACT method, where GAPDH was used as internal control and expression changes normalized to the reference sample (no siRNA treatment).
Receptor-mediated uptake assays of GalNAc-conjugated ApoB-DGAT2 heterodimers vs single siRNA counterparts
GalNAc-conjugated ApoB (CS13) and DAGT2 (CS8) single siRNA controls and ApoB- DGAT2 (CS15 & CS16) heterodimer siRNAs (Table 3), were synthesized at CatSci
(Cardiff, UK). Constructs were resuspended in nuclease-free water (Invitrogen™ AM9932) to generate a stock solution of 100 pM.
Freshly prepared or *serum pre-incubated stock siRNAs were distributed in triplicates in collagen-coated 384-well plates (Corning™ 354666) to a final concentration of 0.1 nM, 1 nM, 4 nM and 25 nM and primary mouse hepatocytes were added at a concentration of 6,000 cells per well. After treatment, cells were incubated at 37°C and 5 % CO2 for 48 hours. Cells receiving no siRNA treatment were used as control. (*Stock siRNAs were exposed to 80 % human serum (HS) for 2 hours at 37°C).
Duplex RT-qPCR
Cells were processed for RT-qPCR read-out using the Cells-to-CT 1-step TaqMan Kit (Invitrogen™ A25603). Briefly, cells were washed with 50 pL ice-cold PBS and lysed in 20 pl Lysis solution containing DNase I. Lysis was stopped after 5 minutes by addition of 2 pl STOP Solution for 2 min. For the RT-qPCR analysis, 1 pL of lysate was dispensed per well into a 96-well PCR plate in a total of 10 pL RT-qPCR reaction volume. RT-qPCR was performed using the TaqMan® 1-Step qRT-PCR Mix from the Cells-to-CT 1-step TaqMan Kit, with TaqMan probes for GAPDH (VIC_PL, Assay Id Mm99999915_g1), mTTR (FAM, Assay Id Mm00443267_m1), ApoB (FAM, Assay Id Mm01545150_m1) or DGAT2 (FAM, Assay Id Mm00499536_m1). RT-qPCR was performed using a QuantStudio 5 thermocycling instrument (Applied BioSystems). Relative quantification was determined using the AACT method, where GAPDH was used as internal control and expression changes normalized to the reference sample (no siRNA treatment).
In vivo mouse study
Methodology
Male C57BL/6J mice (20-25 g) were group housed in the Saretius animal unit at the University of Reading, and maintained under a 12 h light/dark cycle, at 23°C with humidity controlled according to Home Office regulations. Mice were given access to standard rodent chow SDS rat expanded diet (RM3-E-FG) for the duration of the study.
Formulation of siRNA compounds
Heterodimer compounds CS15 and CS16 (Table 3) were each formulated in RNase free PBS to concentrations of 2 and 5 mg/mL to provide doses of 10 and 20 mg/kg when given subcutaneously (SC) in a 5 mL/kg dosing volume. Single siRNA control compounds CS8, CS13 and PAR-ApoB control (Table 3) were each formulated in RNAase free PBS to concentrations of 1 and 2 mg/mL to provide doses of 5 and 10 mg/kg when given SC in 5 mL/kg dosing volumes. mTTR control siRNA (Table 3) was formulated in RNAase free PBS to a concentration of 2 mg/mL to provide a dose of 10 mg/kg when given SC in 5 mL/kg dosing volume.
Liver processing for RT-qPCR
At Day 5 and Day 14 following siRNA compound or Vehicle injection (n=4), each treatment group was terminally sampled by cardiac puncture under isoflurane. Liver tissue was excised and snap frozen in liquid N2. Total RNA was extracted from homogenates of snap-frozen whole liver using QIAGEN RNeasy Mini Kit (74104).
Duplex RT-qPCR was performed using the ThermoFisher TaqMan Fast 1-Step Master Mix with TaqMan probes for GAPDH (VIC_PL, Assay Id Mm99999915_g1), mTTR (FAM, Assay Id Mm00443267_m1), ApoB (FAM, Assay Id Mm01545150_m1) or DGAT2 (FAM, Assay Id Mm00499536_m1). Relative quantification (RQ) of target mRNA was determined using the AACT method, where GAPDH was used as internal control and the expression changes of the target gene were normalized to the vehicle control.
SEQ ID correspondence:
Example 1
As shown in Table 1, when transfected in primary mouse hepatocytes at concentrations of 2.5-100 nM to test efficacy, ApoB_C3_S19 and ApoB_C3_S18 (single siRNAs with hybridized complementary DNA at the 5' end of the sense strand - Table 3) showed knockdown of ApoB comparable to ApoB_C3_OR with no complementary DNA hybridized to the DNA crook at the 5’ end of the sense strand. As for the ApoB-mTTR heterodimer, the mTTR portion showed knockdown of mTTR target comparable to the modified single siRNA mTTR (bottom 2 rows in Table 1) while the ApoB portion showed reduced efficacy (KD range: 64.2% - 76.3%) compared to the single siRNA counterpart ApoB_C3_OR (KD range: 90.1% - 92.8%).
To test stability in human serum, all the siRNA constructs were preincubated in human serum for 2 hours and transfected in primary mouse hepatocytes for 48 hours when knockdown of target gene was measured by RT-qPCR. As shown in Table 2, the mTTR portion in the ApoB-mTTR heterodimer was stable across different concentrations of human serum showing KD levels between 87% and 94.5% which were comparable to KD levels of the standard mTTR siRNA (KD between 74.3% and 93.1%). As for the ApoB portion of the ApoB-mTTR heterodimer siRNA, serum stability was high in 20% human serum showing 92.1% and 84.7% KD at 2.5 nM and 25 nM respectively, while KD was reduced after incubation in 80% human serum showing values of 32.5% and 23.9% KD at 2.5 nM and 25 nM respectively. In contrast, the standard ApoB siRNA counterpart ApoB_C3_OR showed stable KD ranging from 82.4% to 97.6% across different serum concentrations (Table 2).
Table 1. Efficacy of ApoB-mTTR heterodimer siRNA and standard siRNAs
Table 2. Serum stability of ApoB-mTTR heterodimer siRNA and standard siRNAs
Table 3. siRNA and ApoB-mTTR heterodimer siRNA description
Example 2
As shown in Table 4, DGAT2-ApoB-A and DGAT2-ApoB-B heterodimers pre-incubated in vehicle showed high level of knockdown (KD) for both target genes DGAT2 and ApoB (KD range: 82.7% - 93%) when transfected in primary mouse hepatocytes at concentration of 25 nM. When pre-incubated in 50% human serum followed by transfection in primary mouse hepatocytes at 25 nM, both DGAT2-ApoB-A and DGAT2- ApoB-B heterodimers showed high KD levels fully comparable to pre-incubation in vehicle (KD range after serum pre-incubation at 25 nM: 75.9% - 89.8%) suggesting stability in 50% human serum. Interestingly, the KD levels of target genes ApoB and DGAT2 showed by DGAT2-ApoB-A and DGAT2-ApoB-B heterodimers when preincubated in vehicle or 50% human serum followed by transfection, were fully comparable to the KD levels of their single siRNA control counterparts, ApoB_C3_OR, ApoB_REVCR, DGAT2_3 at 25 nM (KD range for siRNA controls: 90.2% - 93.7%). A full description of siRNA structures can be found in Table 5.
As for GS-mTTR-A and GS-mTTR-B heterodimers, pre-incubation in vehicle showed high levels of KD for both target genes ApoB and mTTR (KD range: 83.2% - 97%) when transfected in primary mouse hepatocytes at concentration of 25 nM. When preincubated in 50% human serum followed by transfection in primary mouse hepatocytes at 25 nM, both GS-mTTR-A and GS-mTTR-B heterodimers showed high KD levels fully comparable to pre-incubation in vehicle (KD range after serum pre-incubation followed by transfection at 25 nM: 87.5% - 96.2%) suggesting high serum stability for these heterodimers. The KD levels of target genes ApoB and mTTR showed by GS-mTTR-A and GS-mTTR-B heterodimers when pre-incubated in vehicle or 50% human serum followed by transfection, were fully comparable to the KD levels of their single siRNA control counterparts mTTR, mTTR-AC, mTTR-ARG, PAR-ApoB, GS-AC and GS-ARG (KD range for siRNA controls: 90.2% - 98.2%). A full description of siRNA structures used here can be found in Table 5.
Table 4. Serum stability of heterodimer siRNAs DGAT2-ApoB and GS-mTTR and standard siRNA controls
Table 5. Description of control siRNAs and ApoB-mTTR heterodimer siRNAs
Example 3
As shown in Table 6, ApoB-mTTR_AG1 and ApoB-mTTR_AG2 heterodimers showed ApoB KD levels of 51.9% and 57% respectively at 100 nM and KD levels of 48% and 46.2% respectively at 25 nM in free-uptake. When primary hepatocytes were treated with the single ApoB siRNA counterpart, ApoB_C3_01 , at 100 nM and 25 nM, KD levels were 68.6% and 54.5% respectively suggesting that the heterodimer worked almost as effectively as single siRNA control in silencing target gene ApoB. Overall, ApoB-mTTR heterodimer structures showed to be highly effective in silencing mTTR target in all the ApoB-mTTR heterodimers tested here showing KD levels of mTTR ranging from 88.4% to 97.7% at 25 nM and 100 nM treatment in free-uptake assay. mTTR KD values showed by treatment with heterodimers were similar to KD values obtained with single mTTR siRNA control treatment (KD level at 25 nM and 100 nM: 98.1%). A full description of siRNA structures used can be found in Table 7.
Table 6. Efficacy of GalNAc-conjugated ApoB-mTTR heterodimer siRNAs or standard siRNA controls by free-uptake in primary mouse hepatocytes
Table 7. Standard control siRNAs and GalNAc-conjugated ApoB-mTTR heterodimer siRNA structures
Example 4
As shown in Table 8, ApoB-DGAT2 (CS15 and CS16) heterodimer siRNAs showed ApoB KD levels of 64% and 60% respectively at 25 nM and KD levels of 49% and 50% respectively at 4 nM by receptor-mediated uptake in primary mouse hepatocytes. When cells were treated with single siRNA counterpart, CS13, ApoB KD was 72% and 53% respectively at 25nM and 4nM. For DGAT2 target KD, heterodimer siRNAs showed KD levels of 76% and 65% at 25nM and 55% and 57% at 4nM. In comparison, single siRNA CS8 led to 76% DGAT2 KD at 25nM and 48% at 4nM.
These results demonstrate that ApoB-DGAT2 heterodimer siRNAs perform as well as single ApoB or DGAT2 siRNAs of the same sequence, in receptor-mediated assays, leading to highly effective silencing of two targets in the same cell. A full description of siRNA structures used can be found in Table 9.
Table 8 Target mRNA Knock-down (%) in primary mouse hepatocytes by heterodimer siRNAs or single siRNA controls, with or without preincubation in 80 % human serum for 2 h at 37°C.
Example 5
To test stability in human serum, siRNA constructs were preincubated in 80% human serum (HS) for 2 hours at 37C and receptor-mediated uptake assays subsequently performed in primary mouse hepatocytes. Knockdown of target genes was measured after 48hrs by RT-qPCR.
As shown in Table 8, ApoB-DGAT2 heterodimer siRNAs, CS15 and CS16, showed equivalent levels of target KD when compared to single siRNAs of the same sequence, CS13 and CS8. ApoB KD was 71% and 73% respectively for CS15 and CS16 heterodimer siRNAs at 25nm and 52% and 49% at 4nM. This level of silencing compares favourably with that shown by single siRNA counterpart CS13; 71% and 60% KD at 25nM and 4nM, respectively. Similarly, levels of DGAT2 KD achieved by heterodimer siRNAs was 75% and 73% at 25nM (64% and 58% at 4nM) versus 80% and 67% from single siRNA CS8 at 25nM and 4nM, respectively.
These results demonstrate that ApoB-DGAT2 heterodimer siRNAs are highly stable in 80% human serum and perform as well as single siRNAs of the same sequence in receptor-mediated uptake assays. A full description of siRNA structures used can be found in Table 9 below.
Table 9. ApoB-DGAT2 Heterodimer siRNAs and single siRNA constructs
Example 4
Comparing in vivo silencing effect of heterodimer siRNA (ApoB-DGAT2) to single siRNA controls.
Mouse study
Groups of 4 mice for each treatment group were injected subcutaneously (SC) with either vehicle (PBS), or GalNAc-conjugated ApoB-DGAT2 (CS15 or CS16) heterodimer, or
ApoB (CS13) or DAGT2 (CS8) single siRNA controls (Table 2). Positive siRNA controls included PAR-ApoB and mTTR (Table 2).
Each compound was administered at either 5mg/kg or 10mg/kg (single siRNAs); equivalent to 10mg/kg and 20mg/kg, respectively, for heterodimer siRNAs. Following sacrifice at either day 5 or day 14, levels of liver target mRNA was measured by RT- qPCR and % knockdown (KD) measured relative to vehicle-treated controls.
Table 10 shows in vivo silencing of liver target mRNAs (ApoB and DGAT2) by heterodimer siRNA compounds (CS15 and CS16) compared to single ApoB or DGAT2 siRNA controls (CS13 and CS8, respectively).
CS15 heterodimer (20mg/kg) led to a 53% KD of both ApoB and DGAT2 mRNA at Day 5, with CS16 heterodimer providing 62% and 54% KD of ApoB and DGAT2, respectively. Single siRNAs, CS13 and CS8, at the equivalent dose (10mg/kg) led to 61% and 49% KD of ApoB and DGAT2, respectively. A positive control siRNA (PAR-ApoB; Alnylam) performed similarly, leading to 63% ApoB KD at Day 5. The silencing of ApoB was reduced at Day 14 for heterodimer CS15 and single siRNA CS13 (13% and 11%, respectively) which was not unexpected, given the positive control of the same sequence (PAR-ApoB; Alnylam) performed similarly (17% KD). The heterodimer CS16 however, provided a KD of 34% at D14.
In contrast, silencing of DGAT2 mRNA was maintained in mice receiving either heterodimer (CS15 67% KD; CS16 57%) or single siRNA CS8 (51%) at Day14. Importantly, there was a significant increase in silencing of DGAT2 by CS15 heterodimer (Day 14) at both doses when compared to single DGAT2 siRNA CS8 (P=0.02 lower dose; P=0.008 higher dose). For CS16 heterodimer at the lower dose, ApoB knockdown at Day14 was significantly greater when compared to single ApoB siRNA CS13 (P= 0.04).
Statistical analysis performed:
Two-way Anova and Tukey post-hoc tests
These results demonstrate that both ApoB and DGAT2 target KD (%) in vivo by heterodimer siRNAs is equivalent or superior to single siRNA controls at both low (5mg/kg) and high dose (10mg/kg), and at both time points (day 5 and day 14).
Table 10. Mouse study comparing knock-down (%KD) of liver target mRNA following SC administration of either ApoB-DGAT2 heterodimer siRNA or equivalent single ApoB or DGAT2 siRNAs
Table 11 shows Comparative Efficacy (%) of ApoB-DGAT2 heterodimer siRNA compared to each single siRNA (ApoB or DGAT2) on day 5 and day 14. [%KD ApoB or DGAT2 by heterodimer siRNA divided by %KD by mono siRNA (x100)].
Equivalent or superior performance is achieved by heterodimer siRNAs compared to single siRNA controls. At the lower dose, for ApoB KD, heterodimers shows efficacy of 134 - 164% (Day 5) and 210 - 280% (Day 14) and at higher dose; 87-102% (Day 5) and 114 - 298% (D14). For DGAT2 KD, at the lower dose, comparative efficacy is 84 - 124% (Day 5) and 102 - 147% (Day 14); whereas at higher dose, 109 - 111% (Day 5) and 112 - 131% (Day 14).
Table 11 Comparative efficacy (%) of ApoB-DGAT2 heterodimer siRNAs to single ApoB or DGAT2 siRNAs
Example 5: alternative sequences
Table 12
fA, fll, fC, fG = 2’-F ribonucleotides mA, mil, mC, mG = 2’ OMe ribonucleotides dT = Thymidine
U = Vinyl phosphonate
(invAb) = inverted abasic deoxyribose
*Phosphorothioate
Table 13
fA, fll, fC, fG = 2’-F ribonucleotides mA, mil, mC, mG = 2’ OMe ribonucleotides dT = Thymidine
U = Vinyl phosphonate
(invAb) = inverted abasic deoxyribose
*Phosphorothioate
Table 14: DGAT 2 Lead Sequences
Sense Antisense
AAGAAGUUCCAGAAAUACAA ( SEQ UUGUAUUUCUGGAACUUCUU ( SEQ ID NO 4831 ) ID NO 4840 )
UUGGAGAGAAUGAAGUGUAA ( SEQ ID UUACACUUCAUUCUCUCCAA ( SEQ NO 4832 ) ID NO 4841 )
CUCAUGUACAUAUUCUGCAA ( SEQ UUGCAGAAUAUGUACAUGAG ( SEQ ID NO 4833 ) ID NO 4842 )
ACCAUAGACUAUUUGCUUUA ( SEQ ID UAAAGCAAAUAGUCUAUGGU ( SEQ NO 4834 ) ID NO 4843 )
CC AAGAAGUUCCAGAAAUACAA ( SEQ UUGUAUUUCUGGAACUUCUUGG ( SEQ ID NO 4835 ) ID NO 4844 )
CCCAUAGACUAUUUGCUUUCAA ( SEQ UUGAAAGCAAAUAGUCUAUGGG ( SEQ ID NO 4836 ) ID NO 4845 )
CCUUGGAGAGAAUGAAGUGUA ( SEQ UACACUUCAUUCUCUCCAAGG ( SEQ ID NO 4837 ) ID NO 4846 )
CCCUCAUGUACAUAUUCUGCAA ( SEQ UUGCAGAAUAUGUACAUGAGGG ( SEQ ID NO 4838 ) ID NO 4847 )
CCACCAUAGACUAUUUGCUUUA ( SEQ UAAAGCAAAUAGUCUAUGGUGG ( SEQ ID NO 4839 ) ID NO 4848 )
Table 15
ApoC3 antisense strand: usCfsasCfuGfagaauAfcUfgUfcCfcGfsu (SEQ ID NO:4859) sense strand: (NAG37)s(invAb)sacgggacaGfllfAfuucucaguias(invAb) (SEQ ID NQ:4860)
Crook:
CGAAGCGCCCTACTCCACT (NAG37)s(invAb)sacgggacaGfllfAfuucucaguias(invAb) (SEQ ID NO:4861)
Anticrook:
AGTGGAGTAGGGCGCTTCG (NAG37)s(invAb)sacgggacaGfllfAfuucucaguias(invAb) (SEQ ID NO:4862) a, c, g, i, and u represent 2'-O-methyl adenosine, cytidine, guanosine, inosine, and uridine, respectively; Af, Cf, Gf, and Ilf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; s represents a phosphorothioate linkage; (invAb) represents an inverted abasic deoxyribose residue; and (NAG37) is
Claims
1. A nucleic acid molecule comprising: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a nucleotide sequence comprising a gene to be silenced and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand; and ii) a second nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense and an antisense strand designed with reference to a different or the same gene to be silenced as set forth in i) above and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to either the 5’ or 3’ end of said sense or antisense strand wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
2. Then nucleic acid molecule according to claim 1 wherein said a single stranded deoxyribonucleic acid (DNA) is linked to said first or second double stranded inhibitory (RNA) molecule wherein said linkage is selected from the group: i) 5’ sense strand of said first double stranded inhibitory RNA and 5’ antisense stand of said second double stranded RNA molecule; ii) 5’ sense strand of said first double stranded inhibitory RNA and 3’ sense strand of said second double stranded RNA molecule; iii) 5’ sense strand of said first double stranded inhibitory RNA and 5’ antisense strand of said second inhibitory RNA molecule; iv) 5’ sense strand of said first double stranded inhibitory RNA and the 3’ antisense strand of said second double stranded inhibitory RNA molecule; v) 3’ sense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule;
49
SUBSTITUTE SHEET (RULE 26)
vi) 3’ sense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; vii) 3’ sense strand of said first double stranded inhibitory RNA and the 5’ antisense strand of said second double stranded inhibitory RNA molecule; viii) 3’ sense strand of said first double stranded inhibitory RNA and the 3’ antisense of said second double stranded inhibitory RNA molecule; ix) 5’ antisense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule; x) 5’ antisense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; xi) 5’ antisense strand of said first double stranded inhibitory RNA and the 5’ antisense strand of said second double stranded inhibitory RNA molecule; xii) 5’ antisense strand of said first double stranded inhibitory RNA and the 3’ antisense strand of said second double stranded inhibitory RNA molecule; xiii) 3’ antisense strand of said first double stranded inhibitory RNA and the 5’ sense strand of said second double stranded inhibitory RNA molecule; xiv) 3’ antisense strand of said first double stranded inhibitory RNA and the 3’ sense strand of said second double stranded inhibitory RNA molecule; xv) 3’ antisense strand of said first double stranded inhibitory RNA and the 3’ antisense of said second double stranded inhibitory RNA molecule; and xvi) 3’ antisense strand of said first double stranded inhibitory RNA and the 5’ antisense of said second double stranded inhibitory RNA molecule.
3. The nucleic acid molecule according to claim 1 or 2 wherein said first and second gene to be silenced are different genes.
4. The nucleic acid molecule according to any one of claims 1 to 3 wherein said gene to be silenced is the ApoB gene.
5. The nucleic acid molecule according to claim 4 wherein said Apo B gene comprises a nucleotide sequence set forth in SEQ ID NO: 1 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
6. The nucleic acid molecule according to claim 5 wherein said Apo B double stranded inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 607 to 906.
50
SUBSTITUTE SHEET (RULE 26)
7. The nucleic acid molecule according to claim 5 wherein said Apo B double stranded inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 907 to 1206.
8. The nucleic acid molecule according to any one of claims 1 to 3 wherein said gene to be silenced is DGAT2.
9. The nucleic acid molecule according to claim 8 wherein said DGAT2 gene comprises a nucleotide sequence set forth in SEQ ID NO: 6 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
10. The nucleic acid molecule according to claim 9 wherein said double stranded DGAT2 inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 7 to 306.
11. The nucleic acid molecule according to claim 9 wherein said double stranded DGAT2 inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 307 to 606.
12. The nucleic acid molecule according to claim 9 wherein said double stranded DGAT2 inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4830.
13. The nucleic acid molecule according to claim 9 wherein said double stranded DGAT2 inhibitory RNA comprises or consists of a sense nucleotide sequence set forth in SEQ ID NO: 4829.
14. The nucleic acid molecule according to claim 9 wherein said double stranded DGAT2 inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 4840 to 4848.
15. The nucleic acid molecule according to claim 9 wherein said double stranded DGAT2 inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 4831 to 4839.
16. The nucleic acid molecule according to any one of claims 1 to 3 wherein said gene to be silenced is PCSK9.
51
SUBSTITUTE SHEET (RULE 26)
17. The nucleic acid molecule according to claim 16 wherein said PCSK9 gene comprises a nucleotide sequence set forth in SEQ ID NO: 2 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
18. The nucleic acid molecule according to claim 17 wherein said double stranded PCSK9 inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 1207 to 1510.
19. The nucleic acid molecule according to claim 17 wherein said double stranded PCSK9 inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 1511 to 1814.
20. The nucleic acid molecule according to claim 17 wherein said double stranded PCSK9 inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4822.
21. The nucleic acid molecule according to claim 17 wherein said double stranded PCSK9 inhibitory RNA comprises or consists of a sense nucleotide sequence set forth in SEQ ID NO: 4821.
22. The nucleic acid molecule according to any one of claims 1 to 3 wherein said gene to be silenced is lipoprotein A.
23. The nucleic acid molecule according to claim 22 wherein said lipoprotein A gene comprises a nucleotide sequence set forth in SEQ ID NO: 3 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
24. The nucleic acid molecule according to claim 23 wherein said lipoprotein A double stranded inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 1815 to 2114.
25. The nucleic acid molecule according to claim 23 wherein said lipoprotein A double stranded inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 2115 to 2414.
52
SUBSTITUTE SHEET (RULE 26)
26. The nucleic acid molecule according to claim 23 wherein said lipoprotein A double stranded inhibitory RNA comprises or consists of an antisense nucleotide sequence set forth in SEQ ID NO: 4824.
27. The nucleic acid molecule according to claim 23 wherein said lipoprotein A double stranded inhibitory RNA comprises or consists of an sense nucleotide sequence set forth in SEQ ID NO: 4823.
28. The nucleic acid molecule according to any one of claims 1 to 3 wherein said gene is angiotensinogen.
29. The nucleic acid molecule according to claim 28 wherein said angiotensinogen gene comprises a nucleotide sequence set forth in SEQ ID NO: 4 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
30. The nucleic acid molecule according to claim 29 wherein said double stranded angiotensinogen inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 2415 to 2714.
31. The nucleic acid molecule according to claim 29 wherein said double stranded angiotensinogen inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 2715 to 3014.
32. The nucleic acid molecule according to any one of claims 1 to 3 wherein said gene to be silenced is Apo CHI.
33. The nucleic acid molecule according to claim 32 wherein said Apo CHI gene comprises a nucleotide sequence set forth in SEQ ID NO: 5 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
34. The nucleic acid molecule according to claim 33 wherein said double stranded Apo CHI inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 3015 to 3314.
35. The nucleic acid molecule according to claim 33 wherein said double stranded Apo CHI inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 3315 to 3614.
53
SUBSTITUTE SHEET (RULE 26)
36. The nucleic acid molecule according to claim 33 said double stranded ApoCIII inhibitory RNA comprise or consists of a sense nucleotide sequence set forth in SEQ ID NO 4860.
37. The nucleic acid molecule according to claim 33 said double stranded ApoCIII inhibitory RNA comprise or consists of an antisense nucleotide sequence set forth in SEQ ID NO 4859.
38. The nucleic acid molecule according to any one of claims 1 to 3 wherein said gene to be silenced is ANGPTL3.
39. The nucleic acid molecule according to claim 38 wherein said ANGPTL3 gene comprises a nucleotide sequence set forth in SEQ ID NO: 4819 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
40. The nucleic acid molecule according to claim 39 wherein said double stranded ANGPTL 3 inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 3615 to 3914.
41. The nucleic acid molecule according to claim 39 wherein said double stranded ANGPTL 3 inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 3915 to 4214.
42. The nucleic acid molecule according to claim 39 wherein said double stranded ANGPTL3 inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 4826 or 4828.
43. The nucleic acid molecule according to claim 39 wherein said double stranded ANGPTL3 inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 4825 or 4827.
44. The nucleic acid molecule according to any one of claims 1 to 3 wherein said gene to be silenced is ANGPTL4.
45. The nucleic acid molecule according to claim 44 wherein said ANGPTL4 gene comprises a nucleotide sequence set forth in SEQ ID NO: 4820 wherein said double stranded inhibitory RNA is 19-23 nucleotides in length.
54
SUBSTITUTE SHEET (RULE 26)
46. The nucleic acid molecule according to claim 45 wherein said ANGPTL4 double stranded inhibitory RNA comprises or consists of a sense nucleotide sequence selected from the group: SEQ ID NO: 4215 to 4514.
47. The nucleic acid molecule according to claim 45 wherein said ANGPTL4 double stranded inhibitory RNA comprises or consists of an antisense nucleotide sequence selected from the group: SEQ ID NO: 4515 to 4814.
48. The nucleic acid molecule according to any one of claims 1 to 35 wherein said first or second gene to be silenced is selected from the group consisting of: Apo B, DGAT2, PCSK9, Lp(a), APOCI II, angiotensinogen, ANGPTL3 and ANGPTL4
49. The nucleic acid molecule according to claim 48 wherein said first gene is Apo B and said second gene is DGAT2.
50. The nucleic acid molecule according to any one of claims 1 to 49 wherein said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815).
51. The nucleic acid molecule according to any one of claims 1 to 50 wherein said complementary single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816).
52. The nucleic acid molecule according to claims 50 wherein said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815) and is attached to the 5’ end of the sense nucleotide sequence.
53. The nucleic acid molecule according to claims 50 wherein said single stranded DNA comprises the nucleotide sequence CGAAGCGCCCTACTCCACT (SEQ ID NO: 4815) and is attached to the 5’ end of the antisense nucleotide sequence.
54. The nucleic acid molecule according to claims 51 wherein said said complementary single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816) and is attached to the 5’ end of the sense nucleotide sequence.
55
SUBSTITUTE SHEET (RULE 26)
55. The nucleic acid molecule according to claims 50 wherein said complementary single stranded DNA comprises the nucleotide sequence AGTGGAGTAGGGCGCTTCG (SEQ ID NO: 4816) and is attached to the 5’ end of the antisense nucleotide sequence.
56. The nucleic acid molecule according to any one of claims 1 to 55 wherein said first and/or said second double stranded inhibitory (RNA) molecule comprises modified nucleotides and/or modified sugar(s).
57. The nucleic acid molecule according to any one of claims 1 to 56 wherein said first and/or second double stranded inhibitory (RNA) molecule comprises at least one modified nucleotide wherein said modification is 2'-deoxy-2'-fluoro.
58. The nucleic acid molecule according to any one of claims 1 to 57 wherein said first and/or said second double stranded inhibitory RNA molecule comprises at least one modified nucleotide wherein said modification is 2'-O-methyl.
59. The nucleic acid molecule according to any one of claims 1 to 58 wherein said first and/or said second double stranded inhibitory (RNA) molecule comprises at least one modified nucleotide wherein said modification 5'-vinyl phosphate.
60. The nucleic acid molecule according to any one of claims 1 to 59 wherein said first and/or said second double stranded inhibitory RNA molecule comprises at least one phosphorothioate linkage.
61. The nucleic acid molecule according to any one of claims 1 to 60 wherein said first and/or said second double stranded inhibitory (RNA) molecule comprises at least one modified sugar.
62. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 61 wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4829) and an antisense strand (SEQ ID NO: 4830) wherein said single stranded deoxyribonucleic acid (DNA) molecule is conjugated to the 5’ sense strand.
63. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 61 wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4821) and an
56
SUBSTITUTE SHEET (RULE 26)
antisense strand (SEQ ID NO: 4822) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
64. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 61 wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4823) and an antisense strand (SEQ ID NO: 4824) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
65. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 61 wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4825) and an antisense strand (SEQ ID NO: 4826) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
66. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 61 wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4827) and an antisense strand (SEQ ID NO: 4828) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
67. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 61 wherein said nucleic acid molecule comprises at least one double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4860) and an antisense strand (SEQ ID NO: 4859) wherein said a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand.
68. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 67 wherein said nucleic acid molecule comprises: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4821) and an antisense strand (SEQ ID NO: 4822) wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand; and ii) a second nucleic acid comprising a double stranded inhibitory (RNA) molecule comprising a sense strand (SEQ ID NO: 4823) and an antisense strand (SEQ ID NO: 4824) and wherein there is provided a single stranded deoxyribonucleic acid (DNA)
57
SUBSTITUTE SHEET (RULE 26)
molecule conjugated to the 5’ of said sense strand wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
69. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 67 wherein said nucleic acid molecule comprises: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4825) and an antisense strand (SEQ ID NO: 4826) wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand; and ii) a second nucleic acid comprising a double stranded inhibitory (RNA) molecule comprising a sense strand (SEQ ID NO: 4829) and an antisense strand (SEQ ID NO: 4830) and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ of said sense strand wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
70. The nucleic acid molecule according to any one of claims 1 to 52, 54 and 56 to 67 wherein said nucleic acid molecule comprises: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand (SEQ ID NO: 4829) and an antisense strand (SEQ ID NO: 4830) wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand; and ii) a second nucleic acid comprising a double stranded inhibitory (RNA) molecule comprising a sense strand (SEQ ID NO: 4860) and an antisense strand (SEQ ID NO: 4859) and wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ of said sense strand wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
58
SUBSTITUTE SHEET (RULE 26)
71. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprises or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4849 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4822.
72. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprises or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4850 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4822.
73. The nucleic acid molecule according to any one of claims 1 to 61 wherein acid comprises or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4851 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4824.
74. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprises or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4852 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4824.
75. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4853 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4826.
76. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4854 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4826.
77. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4855 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4828.
59
SUBSTITUTE SHEET (RULE 26)
78. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4856 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4828.
79. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4857 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4830.
80. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4858 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4830.
81. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4861 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4859.
82. The nucleic acid molecule according to any one of claims 1 to 61 wherein said nucleic acid comprise or consists of a sense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4862 and an antisense strand comprising or consisting of the nucleotide sequence set forth in SEQ ID NO 4859.
83. The nucleic acid molecule according to any one of claims 1 to 61 a nucleic acid molecule comprises: i) a first nucleic acid comprising a double stranded inhibitory ribonucleic acid (RNA) molecule comprising a sense strand selected from the group consisting of SEQ ID NO 607 to 906 and an antisense strand selected from the group consisting of SEQ ID NO 907 to 1206 wherein there is provided a single stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ sense strand; and ii) a second nucleic acid comprising a double stranded inhibitory (RNA) molecule comprising a sense strand selected from the group consisting of SEQ ID NO: 7 to 306, 4829 and 4831 to 4839 and an antisense strand selected from the group consisting of SEQ ID NO 307-606, 4830 and 4840 to 4848 and wherein there is provided a single
60
SUBSTITUTE SHEET (RULE 26)
stranded deoxyribonucleic acid (DNA) molecule conjugated to the 5’ of said sense strand and wherein the single stranded deoxyribonucleic acid (DNA) molecule is substantially complementary to the single stranded deoxyribonucleic acid (DNA) molecule set forth in i) above and anneals by complementary base pairing to form a double stranded DNA linker that links the first and second double stranded inhibitory ribonucleic acid (RNA) molecules.
84. The nucleic acid molecule according to claim 83 wherein said second nucleic acid comprises a double stranded inhibitory RN) molecule comprising a sense strand set forth in SEQ ID NO 4857 and an antisense strand set forth in SEQ ID NO 4830.
85. The nucleic acid molecule according to claim 83 wherein said second nucleic acid comprises a double stranded inhibitory (RNA) molecule comprising a sense strand set forth in SEQ ID NO 4858 and an antisense strand set forth in SEQ ID NO 4830.
86. The nucleic acid molecule according to according to any one of claims 1 to 85 wherein said nucleic acid molecule is covalently linked to N-acetylgalactosamine.
87. A pharmaceutical composition comprising a nucleic acid molecule according to any one of claims 1 to 86 and including a pharmaceutical carrier and/or excipient.
88. A nucleic acid molecule or a pharmaceutical composition according to any one of claims 1 to 87 for use in the treatment or prevention of a subject that has or is predisposed to hypercholesterolemia.
SUBSTITUTE SHEET (RULE 26)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB2306589.9A GB2629617B (en) | 2023-05-04 | 2023-05-04 | Dual Silencing |
| GBGB2404488.5A GB202404488D0 (en) | 2024-03-28 | 2024-03-28 | Dual silencing |
| PCT/GB2024/051168 WO2024228030A2 (en) | 2023-05-04 | 2024-05-03 | Dual silencing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4705458A2 true EP4705458A2 (en) | 2026-03-11 |
Family
ID=91465569
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24726696.8A Pending EP4705458A2 (en) | 2023-05-04 | 2024-05-03 | Dual silencing |
Country Status (7)
| Country | Link |
|---|---|
| EP (1) | EP4705458A2 (en) |
| KR (1) | KR20260006569A (en) |
| CN (1) | CN121057819A (en) |
| AU (1) | AU2024265748A1 (en) |
| GB (3) | GB2635479A (en) |
| IL (1) | IL323761A (en) |
| MX (1) | MX2025012698A (en) |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2505648A1 (en) * | 2006-05-05 | 2012-10-03 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression of PTP1B |
| US8236943B2 (en) * | 2009-07-01 | 2012-08-07 | Protiva Biotherapeutics, Inc. | Compositions and methods for silencing apolipoprotein B |
| WO2011141703A1 (en) * | 2010-05-12 | 2011-11-17 | Protiva Biotherapeutics Inc. | Compositions and methods for silencing apolipoprotein b |
| AU2014300981B2 (en) * | 2013-06-27 | 2017-08-10 | Ricc A/S | Antisense oligomers and conjugates targeting PCSK9 |
| DK3324980T3 (en) * | 2015-07-17 | 2022-02-14 | Alnylam Pharmaceuticals Inc | MULTI-TARGETED SIMPLICITY CONJUGATES |
| CN113116918B (en) * | 2017-12-29 | 2022-06-14 | 中国科学院上海药物研究所 | Application of PCSK 9-targeted microRNA in treatment of LDLC-related metabolic diseases |
| TW202221120A (en) * | 2020-08-04 | 2022-06-01 | 美商黛瑟納製藥公司 | Compositions and methods for the treatment of metabolic syndrome |
| AU2021382621A1 (en) * | 2020-11-23 | 2023-06-22 | University Of Massachusetts | Oligonucleotides for dgat2 modulation |
-
2024
- 2024-05-03 CN CN202480030389.6A patent/CN121057819A/en active Pending
- 2024-05-03 EP EP24726696.8A patent/EP4705458A2/en active Pending
- 2024-05-03 AU AU2024265748A patent/AU2024265748A1/en active Pending
- 2024-05-03 KR KR1020257035331A patent/KR20260006569A/en active Pending
- 2024-05-07 GB GB2501121.4A patent/GB2635479A/en active Pending
- 2024-05-07 GB GB2406314.1A patent/GB2629679B/en active Active
- 2024-05-07 GB GB2414903.1A patent/GB2631903B/en active Active
-
2025
- 2025-10-04 IL IL323761A patent/IL323761A/en unknown
- 2025-10-23 MX MX2025012698A patent/MX2025012698A/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| CN121057819A (en) | 2025-12-02 |
| GB2629679B (en) | 2025-05-14 |
| GB2631903B (en) | 2025-07-02 |
| GB2629679A (en) | 2024-11-06 |
| GB2631903A8 (en) | 2025-02-12 |
| GB2631903A (en) | 2025-01-15 |
| AU2024265748A1 (en) | 2025-10-23 |
| GB202406314D0 (en) | 2024-06-19 |
| KR20260006569A (en) | 2026-01-13 |
| MX2025012698A (en) | 2026-01-07 |
| GB2635479A (en) | 2025-05-14 |
| GB202414903D0 (en) | 2024-11-27 |
| GB202501121D0 (en) | 2025-03-12 |
| IL323761A (en) | 2025-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102723833B1 (en) | RNAi agents and compositions for inhibiting the expression of apolipoprotein C-III (APOC3) | |
| TWI880645B (en) | Compositions and methods for inhibiting gene expression of lpa | |
| AU2013296321B2 (en) | Modified RNAi agents | |
| CN117701562A (en) | RNAi agents and compositions for inhibiting expression of angiopoietin-like 3 (ANGPTL 3) and methods of use | |
| WO2024228030A2 (en) | Dual silencing | |
| JP2024531728A (en) | Treatment of Cardiovascular Disease | |
| EP2436399B1 (en) | Polymeric nano-particles for siRNA delivery using charge interaction and covalent bonding | |
| JP2026510791A (en) | Compositions and methods for inhibiting the expression of the inhibin subunit beta E (INHBE) gene | |
| JP2024086876A (en) | RNAi agents and compositions for inhibiting asialoglycoprotein receptor 1 expression | |
| US20250249027A1 (en) | Products and compositions | |
| KR101783444B1 (en) | Prevention or Treatment for ischemic stroke using miR-33-5p | |
| AU2024265748A1 (en) | Dual silencing | |
| GB2629617A (en) | Dual silencing | |
| CN118103508A (en) | Treatment of cardiovascular disease | |
| WO2026087871A1 (en) | Gene silencing of cardiovascular genes | |
| WO2024189348A1 (en) | Conjugate comprising a double stranded rna molecule linked to a single stranded dna molecule | |
| GB2618915A (en) | Treatment of cardiovascular disease | |
| CN121127587A (en) | RNAi agents for inhibiting LPA expression and their applications | |
| WO2026092544A1 (en) | Oligonucleotide targeting mtarc1 gene and use thereof | |
| CN120752336A (en) | Products and compositions | |
| TW202509216A (en) | Oligonucleotides targeting proangiotensin and uses thereof | |
| WO2025252184A1 (en) | iRNA COMPOSITION AND METHOD OF USING SAME | |
| CN119563025A (en) | A dsRNA molecule for inhibiting LP(a) gene expression and its application | |
| Yoshioka et al. | Molecular Technology for Highly Efficient Gene Silencing: DNA/RNA Heteroduplex Oligonucleotides | |
| WO2024254589A2 (en) | Products and compositions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20251007 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |