EP4704907A2 - Lipids, pharmaceutical compositions comprising the same and methods of delivering active pharmaceutical ingredients - Google Patents

Lipids, pharmaceutical compositions comprising the same and methods of delivering active pharmaceutical ingredients

Info

Publication number
EP4704907A2
EP4704907A2 EP24798045.1A EP24798045A EP4704907A2 EP 4704907 A2 EP4704907 A2 EP 4704907A2 EP 24798045 A EP24798045 A EP 24798045A EP 4704907 A2 EP4704907 A2 EP 4704907A2
Authority
EP
European Patent Office
Prior art keywords
compound
mmol
dcm
group
concentrated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24798045.1A
Other languages
German (de)
French (fr)
Inventor
Chandraiah Lagisetti
Bharat Majeti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nitto Denko Corp
Original Assignee
Nitto Denko Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nitto Denko Corp filed Critical Nitto Denko Corp
Publication of EP4704907A2 publication Critical patent/EP4704907A2/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D207/00Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/04Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D207/10Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D207/12Oxygen or sulfur atoms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C237/00Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups
    • C07C237/02Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atoms of the carboxamide groups bound to acyclic carbon atoms of the carbon skeleton
    • C07C237/04Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atoms of the carboxamide groups bound to acyclic carbon atoms of the carbon skeleton the carbon skeleton being acyclic and saturated
    • C07C237/12Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by amino groups having the carbon atoms of the carboxamide groups bound to acyclic carbon atoms of the carbon skeleton the carbon skeleton being acyclic and saturated having the nitrogen atom of at least one of the carboxamide groups bound to an acyclic carbon atom of a hydrocarbon radical substituted by carboxyl groups
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C323/00Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups
    • C07C323/50Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and carboxyl groups bound to the same carbon skeleton
    • C07C323/51Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and carboxyl groups bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton
    • C07C323/57Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and carboxyl groups bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton the carbon skeleton being further substituted by nitrogen atoms, not being part of nitro or nitroso groups
    • C07C323/58Thiols, sulfides, hydropolysulfides or polysulfides substituted by halogen, oxygen or nitrogen atoms, or by sulfur atoms not being part of thio groups containing thio groups and carboxyl groups bound to the same carbon skeleton having the sulfur atoms of the thio groups bound to acyclic carbon atoms of the carbon skeleton the carbon skeleton being further substituted by nitrogen atoms, not being part of nitro or nitroso groups with amino groups bound to the carbon skeleton
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D207/00Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom
    • C07D207/02Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D207/04Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D207/08Heterocyclic compounds containing five-membered rings not condensed with other rings, with one nitrogen atom as the only ring hetero atom with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon radicals, substituted by hetero atoms, attached to ring carbon atoms
    • C07D207/09Radicals substituted by nitrogen atoms, not forming part of a nitro radical
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/08Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
    • C07D211/18Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms
    • C07D211/34Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with substituted hydrocarbon radicals attached to ring carbon atoms with hydrocarbon radicals, substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D211/00Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
    • C07D211/04Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D211/06Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
    • C07D211/36Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D211/60Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D211/62Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals attached in position 4

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)

Abstract

The present application relates a lipid, a pharmaceutical composition comprising the same, and a method of delivering an active pharmaceutical ingredient to a cell or a subject.

Description

LIPIDS, PHARMACEUTICAL COMPOSITIONS COMPRISING THE SAME AND METHODS OF DELIVERING ACTIVE PHARMACEUTICAL INGREDIENTS
FIELD
[0001] The present application relates to a lipid, a pharmaceutical composition comprising the lipid and a method of delivering an active pharmaceutical ingredient to a cell or a subject.
BACKGROUND
[0002] Therapeutic agents such as drug compounds, nucleic acid molecules and other active pharmaceutical ingredients operate by uptake into cells, tissues, and organs of a subject. Transfection of agents and molecules into cells is often a limiting step in therapeutic action.
[0003] F or example, one way to cany out transfection of a nucleic acid is to encapsulate it in a lipid nanoparticle,
[0004] PCT publication No. WO2017/049245 discloses lipids having a head group linked to a nitrogen atom via a methylene group, one linear lipophilic tail linked to the nitrogen atom and one branched lipophilic tail linked to the nitrogen atom, such as Compound R1 of the following formula (also referred to as “SM-102” hereinbelow), PCT publication No. WO2017/049245 discloses that Compound Rl is useful for preparing nanoparticles that have favorable transfection property. Compound R1
[0005] PCT publication No. WO2016/210190 discloses lipids having a head group linked to a nitrogen atom via a carbonyl group and two linear lipophilic tails linked to the nitrogen atom, such as Compound R2 of the following Formula. PCT publication No. W02016/210190 discloses that Compound R2 is useful for preparing nanoparticles that have favorable transfection property. Compound R2
[0006] There is a continuing need for lipid molecules and compositions for efficient transfection of nucleic acid molecules and other agents to cells and subjects.
SUMMARY
[0007] The present disclosure relates to a lipid that is useful for preparing nanoparticles that have favorable transfection property.
[0008] Specifically, the present disclosure includes the following embodiments.
[0009] Embodiment 1. A compound of Formula I or pharmaceutically acceptable salt thereof: wherein
A1 is selected from the group consisting of: the arrow indicates the connection to the carbonyl group,
R1 and R2 are the same or different and are a hydrogen or a hydroxy,
R3, R5, R6, R7, R8, R9, and R10 are the same or different and are a linear Cl to C4 alkyl, R4 is a linear Cl to C4 alkyl or (Cl b):.: OH. pl and p2 are the same or different and are an integer each independently selected from the group consisting of 1, 2, 3, and 4, p3 is an integer selected from the group consisting of 0, 1, 2, 3, and 4, p4 is an integer selected from the group consisting of 2, 3, and 4,
X' is a pharmaceutically acceptable counter anion, each A2 is independently a linear C4 to C10 alkyl, a linear C4 to C10 alkenyl, or a linear C4 to C10 alkadienyl, m is an integer selected from the group consisting of 5, 6, 7, 8, and 9, n is an integer selected from the group consisting of 2, 3, 4, 5, and 6,
A3 is — OC(O)— or — C(O)O— , and
A4 is a linear C10-C18 alkyl, a linear C10-C18 alkenyl, or a linear C10-C18 alkadienyl.
[0010] Embodiment 2. The compound of Embodiment 1, or pharmaceutically acceptable salt thereof, wherein each A2 is independently a linear C4 to C10 alkyl.
[0011] Embodiment 3. The compound of Embodiment 1, or pharmaceutically acceptable salt thereof, wherein each A2 is the same.
[0012] Embodiment 4. The compound of any of Embodiment 1 to 3, or pharmaceutically acceptable salt thereof, wherein m is an integer selected from the group consisting of 5, 6, 7, and 8.
[0013] Embodiment 5. The compound of any of Embodiment 1 to 4, or pharmaceutically acceptable salt thereof, wherein n is an integer selected from the group consisting of 2, 3, 4, and 5,
[0014] Embodiment 6. The compound of any one of Embodiments 1 to 5, or pharmaceutically acceptable salt thereof, wherein the number of carbon atoms in A4— A3— (CUT is 15 to 21.
[0015] Embodiment 7. The compound of any one of Embodiments 1 to 6, or pharmaceutically acceptable salt thereof, wherein A1 is selected from the group consisting of wherein the arrow indicates connection to the carbonyl group.
[0016] Embodiment 8. The compound of any one of Embodiments 1 to 6, or pharmaceutically acceptable salt thereof, wherein A1 is selected from the group consisting of wherein the arrow indicates connection to the carbonyl group.
[0017] Embodiment 9. The compound of any one of Embodiments 1 to 6, or pharmaceutically acceptable salt thereof, wherein A1 is selected from the group consisting of wherein the arrow indicates connection to the carbonyl group.
[0018] Embodiment 10. The compound of any one of Embodiments 1 to 6, or pharmaceutically acceptable salt thereof, wherein A1 is selected from the group consisting of: wherein the arrow indicates connection to the carbonyl group.
[0019] Embodiment 11. The compound of any one of Embodiments 1 to 10, or pharmaceutically acceptable salt thereof, wherein the compound is selected from the group consisting of Compound Nos. 1 to 30 as shown in the following Table 1: TABLE 1
[0020] Embodiment 12. A pharmaceutical composition, comprising: a lipid nanoparticle; and an active pharmaceutical ingredient encapsulated in the lipid nanoparticle, wherein the lipid nanoparticle comprises the compound of any one of Embodiments 1 to 11, or pharmaceutically acceptable salt thereof.
[0021] Embodiment 13. The pharmaceutical composition according to Embodiment 12, wherein the active pharmaceutical ingredient is selected from the group consisting of siRNA, mRNA, antisense oligonucleotide, and miRNA.
[0022] Embodiment 14. A method of delivering an active pharmaceutical ingredient to a cell, comprising contacting the pharmaceutical composition of Embodiment 12 or 13 with the cell.
[0023] Embodiment 15. A method of delivering an active pharmaceutical ingredient to a subject in need thereof, comprising administering the pharmaceutical composition of Embodiment 12 or 13 to the subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 illustrates a reaction scheme for a method of making Compound 1 as described in Example 1.
[0025] FIG. 2 illustrates a reaction scheme for a method of making Compound 2 as described in Example 2.
[0026] FIG. 3 illustrates a reaction scheme for a method of making Compound 3 as described in Example 3.
[0027] FIG. 4 illustrates a reaction scheme for a method of making Compound 4 as described in Example 4.
[0028] FIG. 5 illustrates a reaction scheme for a method of making Compound 5 as described in Example 5.
[0029] FIG. 6 illustrates a reaction scheme for a method of making Compound 6 as described in Example 6.
[0030] FIG. 7 illustrates a reaction scheme for a method of making Compound 7 as described in Example 7.
[0031] FIG. 8 illustrates a reaction scheme for a method of making Compound 8 as described in Example 8. [0032] FIG. 9 illustrates a reaction scheme for a method of making Compound 9 as described in Example 9.
[0033] FIG. 10 illustrates a reaction scheme for a method of making Compound 10 as described in Example 10.
[0034] FIG. 11 illustrates a reaction scheme for a method of making Compound 11 as described in Example 11.
[0035] FIG. 12 illustrates a reaction scheme for a method of making Compound 12 as described in Example 12.
[0036] FIG. 13 illustrates a reaction scheme for a method of making Compound 13 as described in Example 13.
[0037] FIG. 14 illustrates a reaction scheme for a method of making Compound 14 as described in Example 14.
[0038] FIG. 15 illustrates a reaction scheme for a method of making Compound 15 as described in Example 15.
[0039] FIG. 16 illustrates a reaction scheme for a method of making Compound 16 as described in Example 16.
[0040] FIG. 17 illustrates a reaction scheme for a method of making Compound 17 as described in Example 17,
[0041] FIG. 18 illustrates a reaction scheme for a method of making Compound 18 as described in Example 18,
[0042] FIG. 19 illustrates a reaction scheme for a method of making Compound 19 as described in Example 19.
[0043] FIG. 20 illustrates a reaction scheme for a method of making Compound 20 as described in Example 20.
[0044] FIG. 21 illustrates a reaction scheme for a method of making Compound 21 as described in Example 21.
[0045] FIG. 22 illustrates a reaction scheme for a method of making Compound 22 as described in Example 22.
[0046] FIG. 23 illustrates a reaction scheme for a method of making Compound 25 as described in Example 25. [0047] FIG. 24 illustrates a reaction scheme for a method of making Compound 28 as described in Example 28.
[0048] FIG. 25 illustrates a reaction scheme for a method of making Compound 30 as described in Example 30.
[0049] FIG. 26 illustrates a graph showing Flue mRNA distribution after administration of LNP No. 1.
[0050] These and other embodiments are described in greater detail below.
DETAILED DESCRIPTION
Compound
[0051] Some embodiments of the present disclosure relate to a compound of
Formula I or pharmaceutically acceptable salt thereof: wherein
A1 is selected from the group consisting of: the arrow indicates the connection to the carbonyl group,
R1 and R2 are the same or different and are a hydrogen or a hydroxy,
RJ, R5, R6, R?, R8, R9, and R10 are the same or different and are a linear Cl to C4 alkyl,
R4 is a linear Cl to C4 alkyl or — (CHz)p4 — OH, pl and p2 are the same or different and are an integer each independently selected from the group consisting of 1, 2, 3, and 4, p3 is an integer selected from the group consisting of 0, 1, 2, 3, and 4, p4 is an integer selected from the group consisting of 2, 3, and 4,
X' is a pharmaceutically acceptable counter anion, each A2 is independently a linear C4 to C10 alkyl, a linear C4 to C10 alkenyl, or a linear C4 to C10 alkadienyl, m is an integer selected from the group consisting of 5, 6, 7, 8, and 9, n is an integer selected from the group consisting of 2, 3, 4, 5, and 6,
A3 is — OC(O)— or — C(O)O— ,
A4 is a linear C10-C18 alkyl, a linear C10-C18 alkenyl, or a linear C10-C18 alkadienyl. [0052] In some embodiments, R{ and R2 are hydroxy groups.
[0053] In some embodiments, RJ, R5, R6, R7, R8, R9, and R5u are the same or different and are methyl or ethyl.
[0054] In some embodiments, R4 is methyl, ethyl or — (CH2)2 — OH.
[0055] In some embodiments, pl and p2 are the same or different and are an integer independently selected from the group consisting of 1, 2, and 3, In some embodiments, pl and p2 are the same or different and are 1 or 2. In some embodiments, pl and p2 are 1.
[0056] In some embodiments, p3 is an integer independently selected from the group consisting of 0, 1, 2, and 3, In some embodiments, p3 is an integer independently selected from the group consisting of 0, 1 , and 2. In some embodiments, p3 is 0 or 1 .
[0057] In some embodiments, each A2 is independently a linear C4 to C9 alkyl, a linear C4 to C9 alkenyl, or a linear C4 to C9 alkadienyl. In some embodiments, each A2 is independently a linear C8 to C9 alkyl, a linear C8 to C9 alkenyl, or a linear C8 to C9 alkadienyl. In some embodiments, each A2 is independently a linear C8 to C10 alkyl, a linear C8 to C10 alkenyl, or a linear C8 to C10 alkadienyl. In some embodiments, each ,A2 is independently a linear C4 to C10 alkyl. In some embodiments, each A2 is independently a linear C4 to C9 alkyl. In some embodiments, each Az is independently a linear C7 or C8 alkyl. In some embodiments, each A2 in the compound is the same. For example, m some embodiments, each A2 is n-octyl. [0058] In some embodiments, m is an integer selected from the group consisting of 5, 6, 7, and 8. In some embodiments, m is 5, 6, or 7. In some embodiments, m is 7 or 8. In some embodiments, m is 7.
[0059] In some embodiments, n is an integer selected from the group consisting of 2, 3, 4, and 5.
[0060] In some embodiments. A4 is a linear C11-C18 alkyl, a linear C11-C18 alkenyl, or a linear C11-C18 alkadienyl. In some embodiments. A4 is a linear C10-CI7 alkyl, a linear C10-C17 alkenyl, or a linear C10-C17 alkadienyl. In some embodiments, A4 is a linear C11-C17 alkyl, a linear C11-C17 alkenyl, or a linear C11-C17 alkadienyl.
[0061] In some embodiments, the number of carbon atoms in A4 — A3 — (CHz)n — is 15 to 21. In some embodiments, the number of carbon atoms in A4 — A3 — (CHdk. — is 16 to 20.
[0062] In some embodiments, A1 is selected from the group consisting of:
(wherein the arrow' indicates connection to the carbonyl group).
[0063] In some embodiments, A1 is selected from the group consisting of:
(wherein the arrow indicates connection to the carbonyl group).
[0064] In some embodiments, A1 is selected from the group consisting of:
(wherein the arrow indicates connection to the carbonyl group).
[0065] In some embodiments. A1 is selected from the group consisting of
(wherein the arrow indicates connection to the carbonyl group).
[0066] In some embodiments. A1 is selected from the group consisting of
(wherein the arrow indicates connection to the carbonyl group).
[0067] In some embodiments, A! is selected from the group consisting of
(wherein the arrow indicates connection to the carbonyl group).
[0068] In some embodiments, X’ is a pharmaceutically acceptable counter anion selected from the group consisting of a chloride, bromide, fluoride, iodide, nitrate, sulfate, methyl sulfate, phosphate, acetate, benzoate, citrate, glutamate, and lactate. [0069] As used herein, the term “linear alkyl” refers to a linear hydrocarbyl radical of a saturated aliphatic group, which can be of any length unless otherwise specified. The term “linear C1 to C4 alkyl” includes methyl, ethyl, n-propyl, and n-butyl. The term “linear C4 to C10 alkyl” includes n-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, and n-decyl. As used herein, the term “linear C10-C18 alkyl” includes n-decyl, n-undecyl, n-dodecyl, n- tridecyl, n-tetradecyl, n-pentadecyl, n-hexadecyl, n-heptadecyl, and n-octadecyl.
[0070] As used herein, the term “linear alkenyl” refers to a linear hydrocarbyl radical having one carbon-carbon double bond, which can be of any length unless otherwise specified. The term “linear C4 to C10 alkenyl” includes 1-butenyl, 2-butenyl, 3-butenyl, 1- pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 1 -hexenyl, 2- hexenyl, 3- hexenyl, 4- hexenyl, 5- hexenyl, 1 -heptenyl, 2-heptenyl, 3-heptenyl, 4-heptenyl, 5-heptenyl, 6-heptenyl, 1 -octenyl, 2- octenyl, 3-octenyl, 4-octenyl, 5-octenyl, 6-octenyl, 7-octenyl, 1-nonenyl, 2-nonenyl, 3- nonenyl, 4-nonenyl, 5-nonenyl, 6-nonenyl, 7-nonenyl, 8-nonenyl, 1 -decenyl, 2-decenyl, 3- decenyl, 4-decenyl, 5-decenyl, 6-decenyl, 7-decenyl, 8-decenyl and 9-decenyl. The term “linear C10-C18 alkenyl” includes 1 -decenyl, 2-decenyl, 3-decenyl, 4-decenyl, 5-decenyl, 6- decenyl, 7-decenyl, 8-decenyl, 9-decenyl, 1 -undecenyl, 2-undecenyl, 3-undecenyl, 4- undecenyl, 5-undecenyl, 6-undecenyl, 7-undecenyl, 8-undecenyl, 9-undecenyl, 10-undecenyl, 1 -dodecenyl, 2-dodecenyl, 3-dodecenyl, 4-dodecenyl, 5-dodecenyl, 6-dodecenyl, 7-dodecenyl, 8-dodecenyl, 9-dodecenyl, 10-dodecenyl, 11 -dodecenyl, 1 -tridecenyl, 1 -tridecenyl, 2- tridecenyl, 3-tridecenyl, 4-tridecenyl, 5-tridecenyl, 6-tridecenyl, 7-tridecenyl, 8-tridecenyl, 9- tridecenyl, 10-tridecenyl, 11 -tridecenyl, 12-tridecenyl, 1 -tetradecenyl, 2-tetradecenyl, 3- tetradecenyl, 4-tetradecenyl, 5-tetradecenyl, 6-tetradecenyl, 7-tetradecenyl, 8 -tetradecenyl, 9- tetradecenyl, 10-tetradecenyl, 11 -tetradecenyl, 12-tetradecenyl, 13-tetradeceny, 1 - pentadecenyl, 2-pentadecenyl, 3 -pentadecenyl, 4-pentadecenyl, 5-pentadecenyl, 6- pentadecenyl, 7-pentadecenyl, 8-pentadecenyl, 9-pentadecenyl, 10-pentadecenyl, 11 - pentadecenyl, 12-pentadecenyl, 13 -pentadecenyl, 14-pentadecenyl, 1 -hexadecenyl, 2- hexadecenyl, 3 -hexadecenyl, 4-hexadecenyl, 5-hexadecenyl, 6-hexadecenyl, 7-hexadecenyl, 8-hexadecenyl, 9-hexadecenyl, 10-hexadecenyl, 11 -hexadecenyl, 12-hexadecenyl, 13- hexadecenyl, 14-hexadecenyl, and 15-hexadecenyl, 1 -hepta decenyl, 2-heptadecenyl, 3- heptadecenyl, 4-heptadecenyl, 5-heptadecenyl, 6-heptadecenyl, 7-heptadecenyl, 8- heptadecenyl, 9-heptadecenyl, 10-hepta decenyl, 11 -heptadecenyl, 12-heptadecenyl, 13- heptadecenyl, 14-heptadecenyl, 15-heptadecenyl, 16-heptadecenyl, 1 -octadecenyl, 2- octadecenyl, 3 -octadecenyl, 4-octadecenyl, 5-octadecenyl, 6-octadecenyl, 7-octadecenyl, 8- octadecenyl, 9-octadecenyl, 1 O-octadecenyl, 11 -octadecenyl, 12-octadecenyl, 13 -octadecenyl, 14-octadecenyl, 15-octadecenyl, 16-octadecenyl, and 17-octadecenyl.
[0071] As used herein, the term “linear alkadienyl“ refers to a linear hydrocarbyl radical having two carbon-carbon double bonds, winch can be of any length unless otherwise specified. The term “linear C4 to C10 alkadienyl” includes 1,3-butadienyl, 1,3 -pentadienyl,
1.4-pentadienyl, 2,4-pentadienyl, 1,3-hexadienyl, 1,4-hexadienyl, 1,5-hexadienyl, 2,4- hexadienyl, 2, 5 -hexadienyl, 3,5-hexadienyl, 1,3-heptadienyl, 1,4-heptadienyl, 1,5- heptadienyl, 1 ,6-heptadienyl, 2,4-heptadienyl, 2,5-heptadienyl, 2,6-heptadienyl, 3,5- heptadienyl, 3,6-heptadienyl, 4,6-heptadienyl, 1,3 -octadienyl, 1,4-octadienyl, 1,5-octadienyL 1,6-octadienyl, 1,7-octadienyl, 2,4-octadienyl, 2,5-octadienyL 2,6-octadienyl, 2,7-octadienyl,
3.5-octadienyl, 3,6-octadienyl, 3,7-octadienyl, 4,6-octadienyl, 4,7-octadienyl, 5,7-octadienyl,
1.3-nonadienyl, 1,4-nonadienyl, 1,5-nonadienyl, 1,6-nonadienyl, 1,7-nonadienyl, 1,8- nonadienyl, 2,4-nonadienyl, 2, 5 -nonadienyl, 2,6-nonadienyl, 2,7-nonadienyl, 2,8-nonadienyL
3.5-nonadienyl, 3,6-nonadienyl, 3,7-nonadienyl, 3,8-nonadienyl, 4,6-nonadienyl, 4,7- nonadienyl, 4,8-nonadienyl, 5,7-nonadienyl, 5,8-nonadienyl, 6,8-nonadienyl, 1,3 -decadienyl,
1.4-decadienyl, 1,5-decadienyl, 1,6-decadienyl, 1,7-decadienyl, 1,8-decadienyl, 1,9- decadienyl, 2,4-decadienyl, 2,5-decadienyl, 2,6-decadienyl, 2,7-decadienyl, 2,8-decadienyl, 2,9-decadienyl, 3,5-decadienyl, 3,6-decadienyl, 3,7-decadienyl, 3,8-decadienyl, 3,9- decadienyl, 4,6-decadienyl, 4,7-decadienyl, 4,8-decadienyl, 4,9-decadienyl, 5,7-decadienyl,
5.8-decadienyl, 5,9-decadienyl, 6,8-decadienyl, 6,9-decadienyl and 7,9-decadienyl. The term “linear C10-C18 alkadienyl” includes 1 ,3-decadienyl, 1 ,4-decadienyl, 1,5-decadienyl, 1,6- decadienyl, 1,7-decadienyl, 1,8-decadienyl, 1 ,9-decadienyl, 2,4-decadienyl, 2,5-decadienyl,
2.6-decadienyl, 2,7-decadienyl, 2,8-decadienyl, 2,9-decadienyl, 3,5-decadienyl, 3,6- decadienyl, 3,7-decadienyl, 3,8-decadienyl, 3,9-decadienyl, 4,6-decadienyl, 4,7-decadienyl,
4.8-decadienyl, 4,9-decadienyl, 5,7-decadienyl, 5,8-decadienyl, 5,9-decadienyl, 6,8- decadienyl, 6,9-decadienyl, 7,9-decadienyl, 1,3-undecadienyl, 1,4-undecadienyl, 1,5- undecadienyl, 1 ,6-undecadienyl, 1 ,7-undecadienyl, 1,8-undecadienyl, 1,9-undecadienyl, 1,10- undecadienyl, 2,4-undecadienyl, 2,5-undecadienyl, 2,6-undecadienyl, 2,7-undecadienyl, 2,8- undecadienyl, 2,9-undecadienyl, 2,10-undecadienyl, 3,5-undecadienyl, 3,6-undecadienyl, 3,7- undecadienyl, 3,8-undecadienyl, 3,9-undecadienyl, 3,10-undecadienyl, 4,6-undecadienyl, 4,7- undecadienyl, 4,8-undecadienyl, 4, 9- tin decadi enyl, 4,10- tin decadi enyl, 5,7-undecadienyl, 5,8- undecadienyl, 5,9-undecadienyl, 5,10-undecadienyl, 6,8-undecadienyl, 6,9-undecadienyl,
6.10-undecadienyl, 7,9-tindecadienyl, 7,10-undecadienyl, 8,10-undecadienyl, 1,3- dodecadienyl, 1,4-dodecadienyl, 1,5-dodecadienyl, 1 ,6-dodecadienyl, 1,7-dodecadienyl, 1,8- dodecadienyl, 1,9-dodecadienyl, 1,10-dodecadienyl, 1,11 -dodecadienyl, 2,4-dodecadienyl,
2.5-dodecadienyl, 2,6-dodecadienyl, 2,7-dodecadienyl, 2,8-dodecadienyl, 2,9-dodecadienyl,
2.10-dodecadienyl, 2,11 -dodecadienyl, 3,5-dodecadienyl, 3,6-dodecadienyl, 3,7- dodecadienyl, 3,8-dodecadienyl, 3,9-dodecadienyl, 3,10-dodecadienyl, 3, 11 -dodecadi enyl,
4.6-dodecadienyl, 4,7-dodecadienyl, 4,8-dodecadienyl, 4,9-dodecadienyl, 4, 10-dodecadienyl,
4.11 -dodecadienyl, 5,7-dodecadienyl, 5,8-dodecadienyl, 5,9-dodecadienyl, 5,10- dodecadienyl, 5, 11 -dodecadienyl, 6,8-dodecadienyl, 6,9-dodecadienyl, 6, 10-dodecadienyl,
6.11 -dodecadienyl, 7,9-dodecadienyl, 7,10-dodecadienyl, 7, 11 -dodecadienyl, 8,10- dodecadienyl, 8, 11 -dodecadienyl, 9,11 -dodecadienyl, 1,3-tridecadienyl, 1,4-tri decadienyl, 1,5-tridecadienyL 1, 6-tri decadienyl, 1,7-tridecadienyl, 1, 8-tridecadienyl, 1,9- tridecadienyl,
1.10-tridecadienyl, 1,11 -tridecadienyl, 1 , 12-tridecadienyl, 2, 4-tri decadienyl, 2,5- tri decadi enyl, 2, 6-tri decadi enyl, 2,7-tridecadienyl, 2, 8-tri decadi enyl, 2, 9-tri decadienyl, 2,10- tridecadienyl, 2,11 -tri decadi enyl, 2,12-tridecadienyl, 3,5-tridecadienyl, 3, 6-tri decadi enyl, 3,7- tri decadi enyl, 3, 8-tri decadi enyl, 3,9-tridecadienyl, 3,10-tridecadienyl, 3,11 -tri decadienyl,
3.12-tridecadienyl, 4,6-tridecadienyl, 4,7-tridecadienyl, 4, 8-tridecadienyl, 4,9-tridecadienyl,
4.10-tridecadienyl, 4,1 1 -tri decadi enyl, 4,12-tridecadienyl, 5,7-tridecadienyl, 5,8- tridecadienyl, 5,9-tridecadienyl, 5,10-tridecadienyl, 5,1 1 -tri decadi enyl, 5,12-tridecadienyl, 6, 8-tridecadienyl, 6,9-tridecadienyl, 6, 10- tridecadienyl, 6,11 -tridecadienyl, 6,12- tridecadienyl, 7,9-tridecadienyl, 7,10-tridecadienyl, 7,1 1 -tri decadi enyl, 7, 12-tn decadienyl,
8.10-tridecadienyl, 8,11 -tridecadienyl, 8,12-tridecadienyl 9,11 -tn decadienyl, tridecadienyl, 10,12-tridecadienyl, 1 ,3 -tetradecadi enyl, 1 ,4-tetradecadieny 1, tetradecadieny], 1 ,6- tetradecadienyl 1 , 7 -tetradecadieny 1 , 1 , 8-tetradecadienyl, tetradecadienyl, 1 , 1 O-tetradecadienyl, 1,11 -tetradecadienyl, 1 , 12-tetradecadi enyl, tetradecadieny], 2, 4- tetradecadienyl, 2, 5 - tetradecadieny 1 , 2, 6- tetradecadieny 1 , 2,7- tetradecadienyl, 2,8-tetradecadienyl, 2,9-tetradecadienyl, 2, 1 O-tetradecadienyl, tetradecadieny], 2, 12-tetradecadi enyl, 2, 13-tetradecadienyl, 3,5-tetradecadienyl, 3,6- tetradecadienyl, 3,7-tetradecadienyl, 3,8-tetradecadienyl, 3,9-tetradecadienyl, 3,10- tetradecadienyl, 3,1 1 -tetradecadienyl, 3,12-tetradecadienyl, 3,13-tetradecadienyl, 4,6- tetradecadienyl, 4,7-tetradecadienyl, 4,8-tetradecadienyl, 4,9-tetradecadienyl, 4,10- tetradecadienyl, 4, 11 -tetradecadienyl, 4,12-tetradecadienyl, 4, 13 -tetradecadienyl, 5,7- tetradecadienyl, 5,8-tetradecadienyl, 5,9-tetradecadienyl, 5,10-tetradecadienyl, 5,11- tetradecadienyl, 5,12-tetradecadienyl, 5,13-tetradecadienyl, 6,8-tetradecadienyl, 6,9- tetradecadienyl, 6,10-tetradecadienyl, 6, 11 -tetradecadienyl, 6,12-tetradecadienyl, 6,13- tetradecadienyl, 7,9-tetradecadienyl, 7,10-tetradecadienyl, 7,11 -tetradecadienyl, 7,12- tetradecadienyl, 7, 13 -tetradecadienyl, 8,10-tetradecadienyl, 8,11 -tetradecadienyl, 8,12- tetradecadienvl, 8,13-tetradecadienvl, 9,11-tetradecadienvl, 9,12-tetradecadienvl, 9,13- tetradecadienyl, 10,12-tetradecadienyl, 10, 13 -tetradecadienyl, 11, 13 -tetradecadienyl, 1,3- pentadecadienyl, 1 ,4-pentadecadienyl, 1,5-pentadecadienyl, 1,6-pentadecadienyl, 1,7- pentadecadienyi, 1,8-pentadecadienyl, 1,9-pentadecadienyl, 1,10-pentadecadienyl, 1,11- pentadecadienyl, 1,12-pentadecadienyl, 1,13 -pentadecadienyl, 1,14-pentadecadienyl, 2,4- pentadecadienyl, 2,5-pentadecadienyl, 2,6-pentadecadienyl, 2,7-pentadecadienyl, 2,8- pentadecadienyl, 2,9-pentadecadienyl, 2,10-pentadecadienyl, 2, 11 -pentadecadienyl, 2,12- pentadecadienyl, 2,13-pentadecadienyl, 2,14-pentadecadienyl, 3,5-pentadecadienyl, 3,6- pentadecadienyl, 3,7-pentadecadienyl, 3,8-pentadecadienyl, 3,9-pentadecadienyl, 3,10- pentadecadienyl, 3,11 -pentadecadienyl, 3,12-pentadecadienyl, 3,13-pentadecadienyl, 3,14- pentadecadienyl, 4,6-pentadecadienyl, 4,7-pentadecadienyI, 4,8-pentadecadienyl, 4,9- pentadecadienyl, 4,10-pentadecadienyl, 4,1 1 -pentadecadienyl, 4,12-pentadecadienyl, 4,13- pentadecadienyl, 4,14-pentadecadienyl, 5,7-pentadecadienyl, 5,8-pentadecadienyl, 5,9- pentadecadienyl, 5,10-pentadecadienyl, 5,1 1 -pentadecadienyl, 5,12-pentadecadienyl, 5,13- pentadecadienyl, 5,14-pentadecadienyl, 6,8-pentadecadienyl, 6,9-pentadecadienyl, 6,10- pentadecadienyl, 6, 1 1 -pentadecadienyl, 6, 12-pentadecadieny 1, 6, 13 -pentadecadienyl, 6, 14- pentadecadienyl, 7,9-pentadecadienyl, 7,10-pentadecadienyl, 7,11 -pentadecadienyl, 7,12- pentadecadienyl, 7, 13 -pentadecadienyl, 7,14-pentadecadienyl, 8,10-pentadecadienyl, 8,11 - pentadecadienyl, 8, 12-pentadecadienyl, 8,13-pentadecadienyl, 8,14-pentadecadienyl, 9,11- pentadecadienyl, 9,12-pentadecadienyl, 9, 13 -pentadecadienyl, 9,14-pentadecadienyl, 10,12- pentadecadienyl, 10, 13 -pentadecadienyl, 10,14-pentadecadienyl, 11,13 -pentadecadienyl, 11,14-pentadecadienyl, 12,14-pentadecadienyl, 1,3 -hexadecadienyl, 1 ,4-hexadecadienyl, 1,5- hexadecadienyl, 1 ,6-hexadecadienyl, 1 ,7-hexadecadienyl, 1 ,8-hexadecadienyl, 1,9- hexadecadienyl, 1 , 1 O-hexadecadi enyl, 1,11 -hexadecadi enyl, 1 , 12-hexadecadi enyl, 1,13- hexadecadienyl, 1,14-hexadecadienyl, 1,15 -hexadecadienyl, 2,4-hexadecadienyl, 2,5- hexadecadienyl, 2,6-hexadecadienyl, 2,7-hexadecadienyl, 2,8-hexadecadienyl, 2,9- hexadecadienyl, 2, 10- hexadecadienyl, 2,11-hexadecadi enyl, 2,12-hexadecadienyl, 2,13- hexadecadienyl, 2,14-hexadecadienyl, 2, 15 -hexadecadienyl, 3, 5-hexadecadienyl, 3,6- hexadecadienyl, 3,7-hexadecadienyl, 3,8-hexadecadienyl, 3,9-hexadecadienyl, 3,10- hexadecadienyl, 3, 11 -hexadecadienyl, 3,12-hexadecadienyl, 3, 13 -hexadecadienyl, 3,14- hexadecadienyl, 3,15-hexadecadienyl, 4,6-hexadecadienyl, 4,7-hexadecadienyl, 4,8- hexadecadienyl, 4,9-hexadecadienyl, 4,10-hexadecadienyl, 4,11 -hexadecadienyl, 4,12- hexadecadienyl, 4, 13 -hexadecadienyl, 4,14-hexadecadienyl, 4,15-hexadecadienyl, 5,7- hexadecadienyl, 5,8-hexadecadienyl, 5,9-hexadecadienyl, 5,10-hexadecadienyl, 5,11- hexadecadienyl, 5,12-hexadecadi enyl, 5, 13 -hexadecadienyl, 5,14-hexadecadienyl, 5,15- hexadecadienyl, 6,8-hexadecadienyl, 6,9-hexadecadienyl, 6,10-hexadecadienyl, 6,11- hexadecadienyl, 6,12-hexadecadi enyl, 6, 13 -hexadecadienyl, 6,14-hexadecadienyl, 6,15- hexadecadienyl, 7,9-hexadecadienyl, 7,10-hexadecadienyl, 7,11-hexadecadi enyl, 7,12- hexadecadienyl, 7,13-hexadecadienyl, 7,14-hexadecadienyl, 7,15-hexadecadi enyl, 8,10- hexadecadienyl, 8,11 -hexadecadienyl, 8,12-hexadecadi enyl, 8,13 -hexadecadienyl, 8,14- hexadecadienyl, 8,15-hexadecadi enyl, 9,1 1-hexadecadi enyl, 9,12-hexadecadi enyl, 9,13- hexadecadienyl , 9, 14-hexadecadienyl, 9, 15-hexadecadienyl, 10, 12-hexadecadienyl, 10, 13- hexadecadienyl, 10,14~hexadecadi enyl, 10,15-hexadecadi enyl, 11,13~hexadecadienyl, 11,14- hexadecadienyl, 11 ,15-hexadecadienyl, 12,14-hexadecadienyl, 12,15-hexadecadienyl, 13,15- hexadecadienyl, 1,3-heptadecadienyl, 1,4-heptadecadienyl, 1 ,5-heptadecadienyl, 1,6- heptadecadienyl, 1,7-heptadecadienyl, 1,8-heptadecadienyl, 1,9-heptadecadienyl, 1,10- heptadecadienyl, 1 , 1 1 -heptadecadienyl, 1 , 12-heptadecadieny 1, 1 , 13-heptadecadienyl, 1,14- heptadecadienyl, 1,15-heptadecadienyl, 1,16-heptadecadienyl, 2,4-heptadecadienyl, 2,5- heptadecadienyl, 2,6-heptadecadienyl, 2,7-heptadecadienyl, 2,8-heptadecadienyl, 2,9- heptadecadienyl, 2,10-heptadecadienyl, 2,11 -heptadecadienyl, 2,12-heptadecadienyl, 2,13- heptadecadienyl, 2,14-heptadecadienyl, 2,15-heptadecadienyl, 2,16-heptadecadienyl, 3,5- heptadecadienyl, 3,6-heptadecadienyl, 3,7-heptadecadienyl, 3,8-heptadecadienyl, 3,9- heptadecadienyl, 3,10-heptadecadienyl, 3,11 -heptadecadienyl, 3,12-heptadecadienyl, 3,13- heptadecadienyl, 3,14-heptadecadienyl, 3,15-heptadecadienyl, 3,16-heptadecadienyl, 4,6- heptadecadienyl, 4,7-heptadecadienyl, 4,8-heptadecadienyl, 4,9-heptadecadienyl, 4,10- heptadecadienyl, 4, 11 -heptadecadienyl, 4,12-heptadecadienyl, 4, 13 -heptadecadienyl, 4,14- heptadecadienyl, 4,15-heptadecadienyl, 4,16-heptadecadienyl, 5,7-heptadecadienyl, 5,8- heptadecadienyl, 5,9-heptadecadienyl, 5,10-heptadecadienyl, 5,1 1 -heptadecadienyl, 5,12- heptadecadienyl, 5, 13 -heptadecadi enyl, 5,14-heptadecadienyl, 5,15-heptadecadienyl, 5,16- heptadecadienyl, 6,8-heptadecadienyl, 6,9-heptadecadienyl, 6,10-heptadecadienyl, 6,11- heptadecadienyl, 6,12-heptadecadienyl, 6,13-heptadecadienyl, 6,14-heptadecadienyl, 6,15- heptadecadienyl, 6,16-heptadecadienyl, 7,9-heptadecadienyl, 7,10-heptadecadienyl, 7,11- heptadecadienyl, 7,12-heptadecadienyl, 7, 13 -heptadecadienyl, 7,14-heptadecadienyl, 7,15- heptadecadienyl, 7,16-heptadecadienyl, 8,10-heptadecadienyl, 8,11 -heptadecadienyl, 8,12- heptadecadienyl, 8, 13 -heptadecadienyl, 8,14-heptadecadienyl, 8,15-heptadecadienyl, 8,16- heptadecadienyl, 9, 11 -heptadecadienyl, 9,12-heptadecadienyl, 9, 13 -heptadecadienyl, 9,14- heptadecadienyl, 9, 15-heptadecadienyl, 9, 16-heptadecadienyl, 10, 12-heptadecadienyl, 10, 13- heptadecadienyl, 10, 14-heptadecadienyl, 10, 15-heptadecadienyl, 10, 16-heptadecadienyl, 11, 13 -heptadecadi enyl, 11,14-heptadecadienyl, 11,15-heptadecadienyl, 11,16- heptadecadienyl, 12, 14-heptadecadienyl, 12, 15-heptadecadienyl, 12, 16-heptadecadienyl, 13,15-heptadecadienyl, 13,16-heptadecadienyl, 14,16-heptadecadienyl, 1 ,3 -octadecadienyl, 1 , 4-octadecadienyl 1 , 5-octadecadienyl, 1 , 6-octadecadieny 1 , 1 , 7-octadecadienyl, octadecadienyl, 1 .9-octadecadienyl, 1.10-octadecadienyl, 1 , 1 1 -octadecadienyl, octadecadienyl, 1.13 -octadecadienyl, 1.14-octadecadienyl, 1.15-octadecadienyl, octadecadienyl, 1 , 17-octadecadienyl 2,4-o ctadecadi eny 1 , 2, 5-octa.decadi enyl, octadecadienyl, 2, 7-octadecadienyl, 2,8-octadecadienyl, 2,9- octadecadieny 1 , octadecadienyl, 2, 1 1 -octadecadienyl, 2, 12-octadecadienyl, 2, 13 -octadecadienyl, 2,14- octadecadienyl, 2, 15-octadecadienyl, 2, 16-octadecadienyl, 2, 17-octadecadienyl, octadecadienyl, 3.6-octadecadienyl, 3.7-octadecadienyl, 3.8-octadecadienyl, 3,9- octadecadienyl, 3.10-octadecadienyl, 3,1 1 -octadecadienyl, 3.12-octadecadienyl, octadecadienyl, 3. 14-octadecadienyl, 3.15-octadecadienyl, 3.16-octadecadienyl, octadecadieny!, 4.6-octadecadienyl, 4.7-octadecadienyl, 4.8-octadecadienyl, 4,9- octadecadieny 1, 4.10-octadecadienyi, 4.11 -octadecadienyl, 4.12-octadecadienyl, 4,13- octadecadienyl. 4.14-octadecadienyl, 4.15-octadecadienyl, 4.16-octadecadienyl, octadecadienyl, 5, 7-octadecadienyl, 5.8-octadecadieny 1, 5.9- octadecadi eny 1, 5,10- octadecadienyl, 5, 1 1 -octadecadienyl, 5,12-octadecadieny 1, 5.13 -octadecadienyl, 5,14- octadecadienyl, 5,15-octadecadienyl, 5, 16-octadecadienyl, 5, 17-octadecadienyl, 6,8- octadecadienyl, 6,9-octadecadienyl, 6, 10-octadecadienyl, 6, 11 -octadecadienyl, octadecadienyl, 6, 13 -octadecadieny 1, 6, 14-octadecadienyl, 6, 15 -octadecadienyl, 6,16- octadecadienyl, 6, 17-octadecadienyl, 7.9-octa decadienyl, 7.10-oc tadecadi enyl, octadecadienyl, 7.12-octadecadieny 1, 7.13 -octadecadienyl 7.14-octadecadienyl, octadecadienyl, 7.16-octadecadienyl, 7.17-octadecadienyl, 8, 10-octadecadienyl, octadecadienyl, 8, 12-octadecadienyl, 8.13 -octadecadienyl, 8.14-octadecadienyl, 8,15- octadecadienyl, 8. 16-octadecadienyl, 8.17-octadecadienyl, 9, 11 -octadecadienyl, octadecadienyl, 9, 13 -octad ecadienyl, 9.14-octad ecadienyl, 9.15-octadecadienyl, 9.16- octadecadienyl, 9, 17-octadecadienyl, 10, 12-octadecadienyl, 10, 13 -octadecadienyl, 10,14- octadecadienyl, 10, 15-octadecadienyl, 10, 16-octadecadienyl, 10, 17-octadecadienyl, 11.13- octadecadienyl, 11.14-octadecadienyl, 11.15-octadecadienyl, 11.16-octadecadienyl, 11,17 octadecadienyl, 12.14-octad ecadienyl, 12.15-octadecadienyl, 12.16-octadecadienyl, 12.17- octadecadienyl, 13.15-octadecadienyl, 13.16-octadecadienyl, 13.17-octadecadienyl, 14,16- octadecadienyl, 14,17-octadecadienyl, and 15,17-octadecadienyl.
[0072] As used herein, the term “pharmaceutically acceptable” refers to being compatible with use in subjects, for example, mammals such as human.
[0073] The pharmaceutically acceptable counter anion of the present disclosure includes, but is not limited to, a chloride, bromide, fluoride, iodide, nitrate, sulfate, methyl sulfate, phosphate, acetate, benzoate, citrate, glutamate, and lactate.
[0074] The pharmaceutically acceptable salt of the present disclosure includes, but not limited to, salts containing a chloride, bromide, fluoride, iodide, nitrate, sulfate, methyl sulfate, phosphate, acetate, benzoate, citrate, glutamate, and/or lactate. The pharmaceutically acceptable salt of the compound of Formula I of the present disclosure can be synthesized by conventional chemical methods. For example, the salt of the compound is prepared either by ion exchange chromatography or by reacting the free base in the compound with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. [0075] In general, a compound may contain one or more chiral centers. Compounds containing one or more chiral centers may include those described as an “isomer”, a “stereoisomer”, a “diastereomer”, an “enantiomer”, an “optical isomer”, or a “racemic mixture”. Conventions for stereochemical nomenclature, for example the stereoisomer naming rules of Cahn, Ingold and Prelog, as well as methods for the determination of stereochemistry and the separation of stereoisomers are known in the art. See, for example, Michael B. Smith and Jerry March, March’s Advanced Organic Chemistry, 5th edition, 2001. The compounds and structures of the present disclosure, including chemical drawings, are meant to encompass all possible isomers, chemically reasonable positional isomers, stereoisomers, diastereomers, enantiomers, and/or optical isomers that would be understood to exist for the specified compound or structure, including any mixture, racemic or otherwise, thereof.
[0076] The compounds of Formula I of the present disclosure can be prepared by at least one of the techniques described herein or known organic synthesis techniques.
[0077] For example, a compound of Formula I can be obtained as shown in Scheme I below'. In Scheme I, the definitions of the variables n, m, A1, A2, A3, A4, and A’ are the same as for Formula I as described herein. Compound al can react with compound a2 to afford Compound a3. Step 1 can take place in an organic solvent (e.g., methylene chloride) in the presence of, e.g., EDCHCl and DMAP. Step 1 can take place at 0 °C to 50 °C for 1 hour to 24 hours. Compound a4 can react with Compound a5 to afford Compound a6. Instead of Boc group in Compound a5, other acid-labile protecting groups can be also used. Step 2 can take place in an organic solvent (e.g,, methylene chloride) in the presence of, e.g., EDC HCl, triethyl amine and DMAP. Step 2 can take place at 0 °C to 50 °C for 1 hour to 24 hours. Boc group of Compound a6 can be deprotected to afford Compound a7. Step 3 can take place in an organic solvent (e.g., methylene chloride) in the presence of an acid (e.g., methane sulfonic acid). Step 3 can take place at 0 °C to 50 °C for 1 hour to 24 hours. Compound a7 can react with Compound a3 to afford Compound a8. Step 4 can take place in an organic solvent (e.g., acetonitrile, cyclopropyl methyl ether or a mixed solvent thereof) in the presence of a base (e.g., potassium carbonate). KI can be added to promote the reaction. Step 4 can take place at 0 °C to 100 °C for 1 hour to 24 hours. Compound a8 can react with Compound a.9 to afford a compound of Formula I. Step 5 can take place in an organic solvent (e.g., methylene chloride) in the presence of e.g., the combination of EDC HCl, triethyl amine and DMAP or the combination of HATU and triethyl amine. Step 5 can take place at 0 °C to 50 °C for 1 hour to 24 hours.
Scheme I
[0078] A compound of Formula I can be also obtained as shown in Scheme II below. In Scheme IL the definitions of the variables n, m, pl, p2, R1, R2, R< R4, A1, A2, AL A4, and A5 are the same as for Formula I as described herein. Compound aS, that can be prepared according to Scheme I, can react with compound bl to afford Compound b2. Step 1 can take place in an organic solvent (e.g., methylene chloride) in the presence of a base, e.g., triethyl amine. Step 1 can take place at 0 °C to 50 °C for 5 minutes to 24 hours. Compound b2 can react with Compound b3 to afford a compound of Formula I. Step 2 can take place in an organic solvent (e.g., acetonitrile, THF or a mixed solvent thereof) in the presence of a base, e.g., DBU. Step 2 can take place at 0 °C to 100 °C for 1 hour to 24 hours.
[0079] A compound of Formula I can be also obtained as shown in Scheme III. In Scheme III, the definitions of the variables n, m, A1, A2, A3, A4, and A5 are the same as for Formula I as described herein. Compound a3, that can be prepared according to Scheme I, can react with compound cl. Step 1 can take place in an organic solvent (e.g., acetonitrile, cyclopropyl methyl ether or a mixed solvent thereof) in the presence of a base (e.g,, potassium carbonate). Step 1 can take place at 0 °C to 100 °C for 1 hour to 24 hours. The resultant product of Step 1 can react with BOC2O to afford Compound cl. Step 2 can take place in an organic solvent (e.g., methylene chloride) in the presence of a base (e.g., triethyl amine). Step 2 can take place at 0 °C to 50 °C for 1 hour to 24 hours. Instead of Boc group in Compound cl, other acid-labile protecting groups can be also used. Compound cl can react with Compound c2. Step 3 can take place in an organic solvent (e.g,, methylene chloride) in the presence of a base (e.g., triethyl amine). Step 3 can take place at 0 °C to 50 °C for 10 minutes to 24 hours. The resultant, product, of Step 3 can be deprotected to afford Compound c3. Step 4 can take place in an organic solvent (e.g., methylene chloride) in the presence of an acid (e.g., methane sulfonic acid). Step 4 can take place at 0 °C to 50 °C for 1 hour to 24 hours. Step 5 can be carried out according to the procedures of Step 5 in Scheme I or Steps 1 and 2 in Scheme II.
[0080] When A1 of the compound of Formula I includes tertiary amine, the amine can be alkylated with an alkylating agent (e.g., Mel). The reaction can take place at 0 °C to 50 °C for 1 hour to 24 hours.
Pharmaceutical Composition
[0081] Some embodiments of the present disclosure relate to a pharmaceutical composition comprising: a lipid nanoparticle, and an active pharmaceutical ingredient encapsulated in the lipid nanoparticle, wherein the lipid nanoparticle comprises the compound of Formula I or pharmaceutically acceptable salt thereof as described elsewhere herein.
[0082] As used herein, the term “lipid nanoparticle” (also referred to as “LNP” or “liposome”) refers to a nanoparticle comprising lipid molecules.
[0083] As used herein, the term “encapsulate” refers to the ability of a nanoparticle to carry an active pharmaceutical ingredient within its structure, or on its surface, such that the active pharmaceutical ingredient is not removed by solvent or mobile phase exterior to the particle.
[0084] The term “lipid” is used broadly herein to encompass substances that are soluble in organic solvents but sparing soluble or insoluble in water. [0085] The “ionizable cationic lipid” of the present disclosure is characterized by the weak basicity of its lipid head group, which affects the surface charge of the lipid in a pH- dependent manner, rendering it positively charged at acidic pH but close to charge-neutral at physiologic pH. In some embodiments, the compound of Formula I of the present disclosure is an ionizable cationic lipid. The “cationic lipid” of the present disclosure is characterized by monovalent or multivalent cationic charge on its headgroup, which renders it positively charged at neutral pH. In some embodiments, the compound of Formula I of the present disclosure is a cationic lipid. In certain embodiments, the cationic and ionizable cationic lipids are capable of complexing with hydrophilic bioactive molecules to produce a hydrophobic complex that partitions into the organic phase of a two-phase aqueous/ organic system. It is contemplated that both monovalent and polyvalent cationic lipids may be utilized to form hydrophobic complexes with bioactive molecules.
[0086] In some embodiments, the lipid nanoparticle comprises a structural lipid, such as a sterol lipid. In some embodiments, the structural lipid is a sterol lipid such as beta- sitosterol, stigmasterol, ergosterol, ergocalciferol, cholesterol, or derivatives thereof.
[0087] In some embodiments, the lipid nanoparticle comprises a stabilizer lipid such as a phospholipid. In some embodiments, the stabilizer lipid is a phospholipid such as diphytanoyl phosphatidyl ethanolamine (DPhPE) and l,2-Diphytanoy1-.w?-Glycero-3- Phosphocholine (DPhPC). Examples of stabilizer lipids include l,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholme (DPPC), 1 ,2-dioleoyl- sn-glycero-3-phosphocholme (DOPC), 1 ,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE), and 1,2-dioleoy1-sn-glycero-3-phosphoethanolantine (DOPE).
[0088] In some embodiments, the lipid nanoparticle comprises a lipid for reducing immunogenicity such as a pegylated lipid. The PEG regions of the pegylated lipid can be of any molecular mass. In some embodiments, a PEG region can have a molecular mass of 200, 300, 350, 400, 500, 550, 750, 1000, 1500, 2000, 3000, 3500, 4000, or 5000 Da. In some embodiments, the pegylated lipid includes DSPE-PEG, DMPE-PEG, DPPE-PEG, DOPE-PEG and DMG-PEG.
[0089] In some embodiments, the lipid nanoparticle comprises 40-60 mol% of the compound of Formula I or pharmaceutically acceptable salt thereof as described elsewhere herein; 30-50 mol% of the sterol lipid to the total lipid amount of the lipid nanoparticle; 5-15 mol% of the phospholipid selected from the group consisting of DSPC, DOPC, and DOPE to the total lipid amount of the lipid nanoparticle; and 1 -5 mol% of the lipid for reducing immunogenicity that is DMG-PEG to the total lipid amount of the lipid nanoparticle. The molar ratio of the cationic lipids of the present disclosure, the sterol, the phospholipid selected from the group consisting of DSPC, DOPC, and DOPE, and DMG-PEG in the lipid nanoparticle according to the present disclosure (compound of Formula I or pharmaceutically acceptable salt thereof'' sterol lipid/ phosphotipid/DMG-PEG) includes, but not limited to, (60/31/8/1), (60/31/7.5/1.5), (60/31/7/2), (60/31/6.5/2.5), (60/31/6/3), (60/31/5.5/3.5), (60/31/5/4), (60/31/4.5/4.5), (60/31/4/5), (60/31.5/7.5/1), (60/30.5/7.5/2), (60/30/7.5/2.5), (60/29.5/7.5/3), (60/29/7.5/3.5), (60/28.5/7.5/4), (60/28/7.5/4.5), (60/27.5/7.5/5), (59/32/7.5/1.5),
(58/33/7.5/1.5), (57/34/7.5/1.5), (56/35/7.5/1.5), (55/36/7.5/1.5), (60/29/10/1),
(60/28.5/10/1.5), (60/28/10/2), (60/27.5/10/2.5), (60/27/10/3), (60/26.5/10/3.5), (60/26/10/4), (60/25.5/10/4.5), (60/25/10/5), (60/27/12/1), (60/27/11.5/1.5), (60/27/11/2), (60/27/10.5/2.5), (60/27/9.5/3.5), (60/27/9/4), (60/27/8.5/4.5), (60/27/8/5), (59/28/10/3), (58/29/10/3), (57/30/10/3), (56/31/10/3), (55/32/10/3), (50/39/10/1), (50/38.5/10/1.5), (50/38/10/2), (50/37.5/10/2.5), (50/37/10/3), (50/36.5/10/3.5), (50/36/10/4), (50/35.5/10/4.5), (50/35/10/5), (50/38.5/10.5/1), (50/38.5/9.5/2), (50/38.5/9/2.5), (50/38.5/8.5/3), (50/38.5/8/3.5), (50/38.5/7.5/4), (50/38.5/7/4.5), (50/38.5/6.5/5), (51/37.5/10/1.5), (52/36.5/10/1.5), (53/35.5/10/1 .5), (54/34.5/10/1.5), (55/33.5/10/1.5), (49/39.5/10/1.5), (48/40.5/10/1 .5), (47/41.5/10/1.5), (46/42.5/10/1.5), (45/43.5/10/1.5), (51/34/10/5), (52/33/10/5), (53/32/10/5), (54/31/10/5), (55/30/10/5), (40/44/15/1), (40/43.5/15/1.5), (40/43/15/2), (40/42.5/15/2.5), (40/42/15/3), (40/41.5/15/3.5), (40/41/15/4), (40/40.5/15/4.5), (40/40/15/5), (41/39/15/5), (42/38/15/5), (43/37/15/5), (44/36/15/5), (45/35/15/5), (41/41/14/4), (42/42/13/3), (43/43/12/2), and (44/44/1 1/1).
[0090] In some embodiments, the lipid nanoparticle comprises a cationic lipid and/or an ionizable cationic lipid in addition to the compound of Formula I.
[0091] In some embodiments, the average particle size of the lipid nanoparticle is from 50 to 250 nm (for example, 50 nm to 200 nm, 50 nm to 175 nm or 50 nm to 150 nm). In some embodiments, the polydispersity index (PDI) of the lipid nanoparticle is less than 0.2. The average particle size and PDI of LNPs can be evaluated by dynamic light scattering (DLS). [0092] In some embodiments, the active pharmaceutical ingredient includes a nucleic acid. In some embodiments, the nucleic acid comprises an interfering RNA molecule such as, e.g., an siRNA, aiRNA, miRNA, or mixtures thereof. In certain other instances, the nucleic acid comprises single-stranded or double-stranded DNA, RNA, or a DNA/RNA hybrid such as, e.g., an antisense oligonucleotide, a ribozyme, a plasmid, an immunostimulatory oligonucleotide, or mixtures thereof. In certain instances, the nucleic acid comprises an mRN A molecule.
[0093] In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” (also referred to as an “excipient”) is pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle. Pharmaceutically acceptable carriers can be liquid or solid and can be selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties. Typical pharmaceutically acceptable carriers include, but not limited to, water, saline solution, binding agents (e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose), fillers (e.g., lactose and other sugars, gelatin, or calcium sulfate), lubricants (e.g., starch, polyethylene glycol, or sodium acetate), disintegrates (e.g., starch or sodium starch glycolate), and wetting agents (e.g., sodium lauryl sulfate).
[0094] Pharmaceutical compositions may be prepared in a variety' of forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions may be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical and/or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), suspensions, powders, and other forms.
[0095] The lipid nanoparticle of the present disclosure may be synthesized and loaded with encapsulated cargo by any suitable process, including adaptations of processes known in the art. In some embodiments, the lipid nanoparticles can be prepared by a submersion injection process. Some examples of processes for preparing lipid nanoparticles are given in U.S. publication 2013/0115274. Some examples for preparing liposomes are given in Szoka, Ann. Rev. Biophys. Bioeng. 9:467 (1980); Liposomes, Marc I Ostro, ed., Marcel Dekker, Inc., New York, 1983, Chapter 1. In general, lipid nanoparticles can be synthesized by mixing lipid components in an organic solvent with an aqueous buffer solution containing active nucleic acid agents. The liposomes can be sized by filtration or extrusion. The liposome suspension or solution may be further transformed by diafiltration. In some embodiments, the lipid nanoparticles can be synthesized by injecting ethanol solution of lipids into a buffer solution including an active pharmaceutical ingredient in the same manner as described in U.S. publication 2013-0022665, PCT publication No. WO2019/090359, and PCT publication No. W02020/102668. In some embodiments, the lipid nanoparticles can be synthesized by combining a lipid solution with an active pharmaceutical ingredient solution using a microfluidic mixing device such as NanoAssemblr (Precision Nano Systems).
Method of delivering an active pharmaceutical ingredient to a cell or a subject
[0096] Some embodiments of the present disclosure relate to a method of delivering an active pharmaceutical ingredient to a cell, comprising contacting the pharmaceutical composition as described herein with the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in vivo. In certain embodiments, the cell is ex vivo.
[0097] Some embodiments of the present disclosure relate to a method of delivering an active pharmaceutical ingredient to a subject in need thereof, comprising administering the pharmaceutical composition as described above to the subject. For example, the active pharmaceutical ingredient can be siRNA effective for knockdown of GSTp gene as described in Example 22 belowr The subject includes, but not limited to, mammals such as human, monkeys, rats and mice. The pharmaceutical composition may be administered by any means known in the art including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, or airway (aerosol) administration.
EXAMPLES
Abbreviations
Example 1: Synthesis of Compound 1 of Table 1 (heptadecan-9-yl 8-(2-(dimethylandno)-N- (6-oxo-6-(undecyloxy)hexyl)acetamido)octanoate)
[0098] Compound 1 was prepared according to Scheme 1 shown in FIG. 1.
[0099] Step 1: To a solution of heptadecane-9-ol (2 g, 7.7 mmol, 1 eq.) and 8- bromooctanoic acid (2.2 g, 10 mmol, 1.3 eq.) in anhydrous methylene chloride (DCM, 40 ml), EDC HC1 (1.8 g, 9.7 mmol, 1.25 eq.) and DMAP (95 mg, 0.77 mmol, 0. 1 eq.) were added. The clear solution was stirred at room temperature overnight (18 hours). Next day, the reaction was stopped and diluted with DCM. The organics was washed sequentially with saturated sodium bicarbonate solution (25 mL), water (25 mL), and brine (25 mL). The separated organic phase was dried with sodium sulfate, filtered. The organic phase was concentrated, and the crude product was purified by ISCO MPLC using a silica gel column (80 g), and the column was eluted with (0-20) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated to yield Intermediate 1 (2.7g, 75% yield) as oil.
[0100] Step 2: To a solution of undecane- 1 -ol (8 g, 46.4 mmol, 1 eq.) and 6-N-Boc amino hexanoic acid (12.8 g, 55.7 mmol, 1.2 eq.) in anhydrous DCM (150 nil), EDCHC1 (10.6 g, 55.7 mmol, 1.2 eq.), triethyl amine (12.9 mL, 92.8 mmol), and DMAP (0.5 g, 4.64 mmol, 0.1 eq.) were added. The clear reaction solution was stirred at room temperature overnight under N?. gas. IPC (LC/'MS) showed corresponding product peak (m/z=385 (M+H)) along with saturated sodium bicarbonate solution (50 mL), and brine (50 mL). The organic phase was dried with sodium sulfate, filtered, and the solvent was evaporated via rotary evaporator, yielding crude product. 5 g of crude product was taken out for the next reaction and the rest of material was dissolved in anhydrous DCM (100 mL). EtzN and BoczO were added to the above solution and stirred overnight. LC/MS confirmed complete conversion of de-Boc amine to Boc-amme desired product. The organic layer was washed with water and brine solution. The organic phase was dried with NazSCti and filtered. The organic phase was concentrated, and the crude product was purified by ISCO MPLC using a silica gel column (220 g) and the column was eluted with (0-100) % Hexane- Ethyl acetate gradient. Fractions were combined and concentrated to yield Intermediate 2 (12.5 g) as oil. The obtained product was kept in freezer to form the product as white solid.
[0101] Step 3: Intermediate 2 (3.4 g, 8.8 mmol) was dissolved in DCM (40 mL), and methane sulfonic acid (1.2 mL, 20.7 mmol, 2eq) was added. The clear solution was stirred at room temperature overnight. Next day, LC/MS confirmed complete conversion of the starting material to the product. The reaction mixture was diluted with DCM (25 mL) and washed with saturated sodium bicarbonate solution (25 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated and dried to give free amine Intermediate 3 in quantitative yields. This material w'as used in the next step without further purification.
[0102] Step 4: A solution of Intermediate 1 (1.8 g, 3.8 mmol, 1 eq.) and Intermediate 3 (2.2 g, 7.6 mmol, 2 eq.) in a mixture of acetonitrile/ cyclopropyl methyl ether (40 mL, 1:1) was treated with potassium carbonate (134 mg, 10.8 mmol, 2 eq.) under N2 gas. The reaction flask was heated at 72-75 °C for 5 hours. LC/MS showed formation of the desired peak along with a small peak that corresponds to dialkylated side product. The reaction mixture was cooled to room temperature and filtered through a pad of celite and washed with DCM (20 mL). The obtained product was concentrated and purified by ISCO MPLC system using a silica column (80 g). Column was eluted with (0-20) % DCM/MeOH gradient. Fractions were combined and concentrated under reduced pressure via rotary' evaporator to provide Intermediate 4 as solid (2.2 g, 84% yield).
[0103] Step 5: A solution of Intermediate 4 (2.2 g, 3.3 mmol, 1 eq) in anhydrous DCM (30 mL) was stirred and cooled at 0 °C. Chloroacetyl chloride (0.26 mL, 3.3 mmol, 1 eq) was added, followed by slow addition of EtsN (1.3 mL, 9.9). After 10 minutes, LC/MS confirmed that the reaction was completed. The reaction mixture was diluted with DCM (25 mL) and washed with saturated NaHCO3 solution (25 mL), and brine (25 mL). The organic phase was dried with NaaSCh and filtered. The organic phase was concentrated, and purified by ISCO MPLC using a silica gel column (80 g), and the column was eluted with (0-50) % Hexane/Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using rotary evaporator to yield Intermediate 5 (2.0 g, 83 % yield) as oil.
[0104] Step 6: To a solution of Intermediate 5 (1 g, 1.3 mmol, leq) in LC/MS grade acetonitrile (20 mL), dimethyl amine (3.3 mL, 6.7 mmol, 5 eq, 2M in I'HF) and DBU (0.4 mL, 2.6 mmol, 2 eq) were sequentially added under Na gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete conversion to product. The reaction mixture was concentrated under reduced pressure and diluted with DCM (55 mL), and washed with saturated NaHCO3 solution (25 niL), and brine (25 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated, and the crude product was purified by MPLC7ISCO using silica column (40 g). The column was eluted with (0-100) % Hexane-EtOAc and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated using rotary evaporator to yield Compound 1 as oil (720 mg, 71% yield) as oil. ESI MS (m/z): 751.74 (M+H)T
Example 2: Synthesis of Compound 2 of Table 1 (2-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6- oxo-6-(undecyloxy)hexyl)amino)-N,N,N-trimethyl-2-oxoethan-l-aminium chloride)
[0105] Compound 2 was prepared according to Scheme 2 shown in FIG. 2.
[0106] Compound 1 (210 mg, 0.27 mmol, leq) was taken in 15 mL scintillation vial and Mel (1.5 mL, excess) was added. The resulted clear solution was stirred at room temperature overnight. Next day, LC/MS showed that the starting material was completely converted to methyl salt. The excess Mel was evaporated and the intermediate was purified by ISCO MPLC using 25 g silica column. Column was eluted with (0-20) % DCM-MeOH gradient. Pure fractions were concentrated to yield Intermediate as iodide counter ion. This material was dissolved in DCM (4 mL) and passed through a column of Amberlyst A26 (5.5g, activated with HC1). Column was eluted with 100% DCM and all fractions were concentrated. The resulted residue was again dissolved in minimum volume of DCM and passed through the above column. Column was eluted again with DCM and all fractions were concentrated. Dried product under high vacuum to give Compound 2 as chloride counter ion (130 mg, 60% yield). ESI MS (m/z): 765.85 (M)+. Example 3: Synthesis of Compound 3 of Table 1 (heptadecan~9~yl 8~(2~((2~ (dimethylamino)ethyl)Mo)~N~(6~oxo~6~(undecyloxy)hexyl)acetamido)octanoate)
[0107] Compound 3 was prepared according to Scheme 3 shown in FIG. 3.
[0108] Step 5: Steps 1 to 4 of Scheme 3 were carried out according to the same procedure as described in the above Steps 1 to 4 of Scheme 1. To a mixture of Intermediate 4 (800 mg, 1.2 mmol, 1 eq) and {(2-dimethyl ammo) ethyl thio] acetic acid (391 mg, 2.4 mmol, 2eq) in anhydrous DCM (20 mL) in DCM (20 mL), Et?,N (0.33 mL, 2.4 mmol), DMAP (14 mg, 0.12 mmol, 0.1 eq), and EDC.HC1 (287 mg, 1.56 mmol, 1.2 eq) were sequentially added at room temperature under N?_ gas. The resulted mixture was stirred overnight at room temperature. Next day, LCZMS confirmed product formation. The reaction mixture was diluted with DCM (30 mL) and washed with saturated aqueous NaHCO3 solution (20 mL) and brine (20 mL). The organic phase was dried with Na2.SO4 and filtered. The organic phase was concentrated, and purified by ISCO MPLC using a silica gel column (40 g), and the column was eluted with (0-100) % Hexane/Ethyl acetate and (0-20%) DCM-MeOH gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Compound 3 (405 mg, 43% yield) as oil. ESI MS (m/z): 811.71 (M+H)+.
Example 4: Synthesis of Compound 4 of Table 1 (2-((2-((8-(heptadecan-9-yloxy)-8- oxooctyl)(6-oxo-6-(unde(yloxy)hexyl)amino)-2-oxoethyl)thio)-N,N,N-trimethylethan-l- aminium chloride.)
[0109] Compound 4 was prepared according to Scheme 4 shown in FIG. 4.
[0110] Compound 3 (120 mg, 0.14 mmol, leq) was weighed in 15 mL scintillation vial then Mel (1.5 mL, excess) was added. The resulted clear solution was stirred at room temperature overnight. Next day, LC/MS showed corresponding product peak along with another peak that corresponds to m/z =834. Excess Mel was evaporated, and the intermediate was purified by ISCO MPLC using 25 g silica column. Column was eluted with (0-20) % DCM-MeOH gradient. Pure fractions were concentrated to yield Intermediate as iodide counter ion. The intermediate was dissolved in DCM (4 mL) and passed through a column of Amberlyst A26 (5g, activated with HC1). Column was eluted with 100% DCM and all fractions were concentrated. The resulted residue was again dissolved in minimum volume of DCM and passed through the above column. Column was eluted again with DCM and all fractions were concentrated. The product was dried under high vacuum to give desired product Compound 4 as chloride counter ion (82 mg, 67% yield). ESI MS (tn/z): 825.78 (M)T
Example 5: Synthesis of Compound 5 of Table 1 (heptadecan~9~yl 8-(2~(cis~3,4- dihydroxypyf’rolidin~l~yl)-N~(6~oxo~6~(undecyloxy)hexyl)acetamido)octanoate)
[0111] Compound 5 was prepared according to Scheme 5 shown in FIG. 5.
[0112] Step 6: Steps 1 to 5 of Scheme 5 were carried out according to the same procedure as described in the above Steps 1 to 5 of Scheme 1 . Intermediate 5 (600 mg, 0.81 mmol, leq) and cfr-DIIP.HCl (225 mg, 1.6 mmol, 2eq) were suspended in LCZMS grade acetonitrile (40 mL). DBU (0.23 mL, 1.6 mmol, 2 eq) was added and the reaction flask was heated at 45 °C and stirred overnight under Na gas. Next day, LC/MS confirmed complete conversion to product. The heating bath was removed, and the reaction flask was cooled to room temperature. The reaction mixture was concentrated under reduced pressure using rotary evaporator and the crude product was purified by MPLC/ISCO using silica column (40 g). Column was eluted with (0-100) % Hexane- EtO Ac and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated using rotary evaporator to yield Compound 5 (455 mg, 70% yield) as oil. ESI MS (m/z): 809.72 (M H) .
Example 6: Synthesis of Compound 6 of Table 1 (l-(2~((8~(hept(idecan.-9-yloxy)~8~ oxooctyl)(6-oxo-6-(und£cyloxy)hexyl)amino)~2~oxoethyl)-cis-3,4-dihydroxy-l- methylpyrrolidin- 1 -ium chloride)
[0113] Compound 6 was prepared according to Scheme 6 shown in FIG. 6.
[0114] Compound 5 (120 mg, 0.14 mmol, leq) was taken in 15 mL scintillation vial and Mel (1.3 mL, excess) was added. The resulted clear solution was stirred at room temperature overnight. Next day, LC/MS showed that the starting material was completely converted to methyl iodide salt. Excess Mel was evaporated and the residue was dissolved in DCM (4 mL). This solution was passed through a column of Amberlyst A26 (5g, activated with HC1). Column was eluted with 100% DCM and all fractions were concentrated. The resulted residue was again dissolved in minimum volume of DCM and passed through the above column. Column was eluted again with DCM and all fractions were concentrated. The product was dried under high vacuum to give Compound 6 as chloride counter ion (116 mg, 89% yield). ESI MS (m/z): 823.73 (M)7
Example 7: Synthesis of Compound 7 of Table 1 (heptadecan~9~yl 8~(2~((2~ hydroxy ethyl)(methyl)anuno)-N-(6~oxo~6~(unde(yloxy)hexyl)acetaniido)octanoate)
[0115] Compound 7 was prepared according to Scheme 7 shown in FIG. 7.
[0116] Step 6: Steps 1 to 5 of Scheme 7 were carried out according to the same procedure as described in the above Steps 1 to 4 of Scheme 1. To a mixture of Intermediate 5 (450 mg, 0.60 mmol, 1 eq) and N-methyl N-hydroxy ethylamine (91 mg, 1 .21 mmol, 2 eq) in LC/MS grade acetonitrile (20 mL), DBU (0.17 mL, 1.2 mmol, 2 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete conversion to product. The product was concentrated under reduced pressure and diluted with DCM (40 mL), and washed with saturated NaHCO3 solution (2 mL), and brine (20 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated, and the crude product was purified by MPLC/ISCO using silica column (40 g). Column was eluted with (0-100) % Hexane-EtOAc and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated using rotary evaporator to yield Compound 7 (204 nig, 43 % yield) as oil. ESI MS (ni/z): 781.77 (M + H) .
Example 8: Synthesis of Compound 8 of Table 1 (2-(2-(dimethylamino)~N-(8-(heptadecan~ 9-yloxy)~8~oxooctyl)acetamido)ethyl tetradecanoate)
[0117] Compound 8 was prepared according to Scheme 8 shown in FIG. 8.
[0118] Step 1: To a stirred solution of heptadecane-9-ol (10 g, 38.9 mmol, leq.) and 8-bromo octanoic acid (10.4 g, 46.7 mmol, 1.2eq.) in DCM (100 mL), triethyl amine (10.8 mL, 77.9 mmol, 2eq.), DMAP (470 mg, 3.89 mmol, 0.1 eq.), and EDC 'HQ (8.9 g, 46.7 mmol, 1.2 eq.) were added. The clear reaction solution was stirred at room temperature for 5 hours under nitrogen gas. The reaction mixture was diluted with DCM (50 mL) then washed with saturated sodium bicarbonate solution (70 mL), water (50 mL), and brine (50 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated, and the crude product was purified by ISCO/MPLC using a silica gel column (220 g). Column was eluted with (0-30) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Intermediate 1 (11 g, 61% yield).
[0119] Step 2: Intermediate 1 (6 g, 12.9 mmol, I eq.) and ammo ethanol (5.9 g, 97.4 mmol, 7.5eq.) were suspended in a mixture of acetonitrile/CPME (60 mL, 1 :1). K2CO3 (1.8 g, 12.9 mmol, leq.) was added to the above mixture. The reaction mixture was heated to 70 °C and stirred for 3 hours. LC/MS confirmed that the reaction was complete. The heating bath was removed, and the reaction mixture was cooled to room temperature. The solids were filtered and washed with acetonitrile. Concentrated filtrate and suspended the residue in DCM (50 5L). The organic layer was washed with saturated aqueous NaHCO3 (25 mL), water (25 mL), and brine (20 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated to provide mono-N-alkylated product in quantitative yields. This intermediate was dissolved in DCM (50 mL) then triethyl amine (3.6 mL, 25.8 mmol, 2eq.) and BoczO (3.1 g, 14.1 mmol, l.leq.) were added. The mixture was allowed to stir overnight at room temperature. Next day, LC/MS showed that the reaction was complete. The reaction mixture was diluted with DCM (30 mL) then washed with saturated sodium bicarbonate solution (40 mL), and brine (40 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated, and the crude product was purified by ISCO/MPLC using a silica gel column (120 g). Column was eluted with (0-100) % Hexane- Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary' evaporator to yield Intermediate 2 as oil (4.6 g, 66.6% yield).
[0120] Step 3: To a solution of Intermediate 2 (2. 1 g, 3.8 mmol, 1 eq.) in anhydrous DCM (25 ml), EteN (1.0 mL, 7.7 mmol, 2eq.) and Myristoyl chloride (1.16 mL, 4.2 mmol, 1.1 eq) were added at room temperature. After 2 hours, LC/MS confirmed that the reaction was complete. The reaction was stopped and diluted with DCM (20 mL). The organics were washed sequentially with saturated sodium bicarbonate solution (20 mL), water (20 mL), and brine solution (20 mL). The organic phase was dried with sodium sulfate, filtered. The organic phase was concentrated, and the crude product was purified by ISCO/MPLC using a silica gel column (80 g), and column was eluted with (0-50) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Intermediate 3 as oil (2.2 g, 76% yield). [0121] Step 4: To a solution of Intermediate 3 (1.7 g, 2.2 mmol, 1.0 eq) in DCM (25 ml), methane sulfonic acid (MSA, 0.29 mL, 4.4 mmol, 2,0 eq) was added under N2 gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The reaction flask was cooled with an ice-bath then chloroacetyl-chloride (0.2 mL, 2.6 mmol, 1.15 eq.) was added, followed by dropwise addition of triethyl amine (1.6 mL, 11.2 mmol, 5.0 eq. ). After 15 minutes, LC/MS confirmed that the reaction was complete. The reaction mixture was diluted with DCM (15 mL) and washed with water (20 ml) and brine (20 ml). The organic phase was dried with Na?.SO4, filtered. The organic phase was concentrated, and purified by IS CO MPLC system using a silica column (80 g). Column was eluted with (0-50) % Hexane-Ethyl Acetate gradient. Fractions were combined and concentrated via rotary’ evaporator to yield Intermediate 4 as solid (1.6 g, 87% yield).
[0122] Step 5: To a solution of Intermediate 4 (480 nig, 0.65 mmol, leq) in LC/MS grade acetonitrile (40 mL), dimethyl amine (1.64 mL, 3.2 mmol, 5 eq, 2M in THF) and DBU (2eq.) were added at room temperature. The reaction mixture was stirred at room temperature overnight under N2 gas. Next day, LC/MS confirmed that the starting material was consumed and the complete conversion to product. The reaction mixture was concentrated and the residue was suspended in DCM. The product was washed with saturated aqueous NaHCO3, water, and brine. The organic phase was dried with NacSCL, filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0- 100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 8 as oil (325 mg, 68% yield). ESI MS (m/z): 737.72 (M i l) .
Example 9: Synthesis of Compound 9 of Table 1 (2-(2-(cis-3,4~dihydroxypyrrolidin~l-yl)-N~ (8-(heptadecan-9-yloxy)-8~oxooctyl)acetamido)ethyl tetradecanoate)
[0123] Compound 9 was prepared according to Scheme 9 shown in FIG, 9.
[0124] To a solution of Intermediate 4 of Example 8 (520 mg, 0.71 mmol, l eq) in LC/MS grade acetonitrile (40 mL), cDHP.HCl (199 mg, 1 ,42 mmol, 2eq) and DBU (2eq.) were added at room temperature. The reaction mixture was stirred at 45 °C overnight under N2 gas. Next day, LC/MS confirmed that the starting material was consumed and complete conversion to product. The reaction mixture was concentrated and the residue was suspended in DCM. The product was washed with saturated aqueous NaHCOa, water, and brine. The organic phase was dried with Na2SO4, filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane- Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 9 as viscous oil (450 mg, 79% yield). ESI MS (m/z): 795.74 (M H) .
Example 10: Synthesis of Compound 10 of Table 1 (2-(N-(8~(heptadecan-9-yloxy)~8~ oxooctyl)-l-methylpiperidine~4~carboxanudo)ethyl tetradecanoate)
[0125] Compound 10 was prepared according to Scheme 10 shown in FIG. 10.
[0126] Step 4: Steps 1 to 3 of Scheme 10 were carried out according to the same procedure as described in the above Steps 1 to 3 of Scheme 8. To a solution of Intermediate 3 (500 mg, 0.66 mmol, 1.0 eq) in DCM (20 ml), methane sulfonic acid (MSA, 86 pL, 1.32 mmol, 2.0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The reaction flask was cooled with an ice-bath then saturated aqueous NaHCO3 solution was added. The reaction mixture was slowly warmed to room temperature. Then the organic phase was separated. The aqueous phase was extracted with DCM (20 mL). The combined organic layers were dried with Na2SO4 and filtered. The organic phase was concentrated to give crude amine intermediate which was taken to next step without further purification. This anime intermediate was dissolved in DCM (20 mL) and cooled to 0 °C. N-methyl piperidine carboxylic acid (142 mg, 0.99 mmol, 1.5eq.), HATU (290 mg, 0.76 mmol, 1,15eq.), and triethyl amine (0.18 mL, 1.32 mmol, 2eq.) were sequentially added to the above mixture. After 15 minutes, cooling was removed, and the reaction was stirred at room temperature for 2 hours. LC/MS confirmed formation of the product. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCOz (25 mL), water (20 mL), and brine (20 mL). The organic phase was dried with NazSOr and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 10 as oil (300 mg, 59% yield). ESI MS (m/z): 777.73 (M+H)+.
Example 11: Synthesis of Compound 11 of Table 1 (4-(N~(8-(heptadecan~9~yloxy)-8- oxooctyl)- 1 -methylpiperidine-4-carboxamido) butyl tetradecanoate)
[0127] Compound 1 1 was prepared according to Scheme 11 shown in FIG. 11.
[0128] Step 2: Step 1 of Scheme 1 1 was carried out according to the same procedure as described in the above Step 1 of Scheme 8. Intermediate 1 (3 g, 6.4 mmol, leq.) and amino butanol (1.7 g, 19.4 mmol, 3 eq.) were suspended in a mixture of acetonitrile/CPME (40 mL, 1: 1). K2CO3 (0.89 g, 6.4 mmol, l eq.) was added to the above mixture. The reaction mixture was heated to 70 °C and stirred for 5 hours. LC/MS confirmed that the reaction v/as complete. The heating bath was removed, and the reaction mixture was cooled to room temperature. The solids were filtered and washed with acetonitrile. The reaction mixture was concentrated and the residue was suspended in DCM (50 mL). The organic layer was washed with saturated aqueous NaHCO?, (25 mL), water (25 mL), and brine (20 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated to provide mono-N -alkylated product in quantitative yields. This intermediate was dissolved in DCM (25 mL) then BoczO (1.6 g, 7.1 mmol, l.leq.) and triethyl amine (1.8 mL, 12.9 mmol, 2eq.) were added. The reaction mixture was allowed to stir overnight at room temperature. Next day, LC/MS showed that the reaction was complete. The reaction mixture was diluted with DCM (30 mL) then washed with saturated sodium bicarbonate solution (40 mL), and brine (40 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated and the crude product purified by ISCO/MPLC using a silica gel column (120 g). Column was eluted with (0-60) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Intermediate 2 as oil (2.0 g, 54% yield).
[0129] Step 3: To a solution of Intermediate 2 (2.0 g, 3,5 mmol, leq.) in anhydrous DCM (25 ml), EtsN (0.97 mL, 7,0 mmol, 2eq.) and Myristoyl chloride (1.05 mL, 3.8 mmol, 1. 1 eq) were added at. room temperature. After 1 hour, LC/MS confirmed that the reacti on was complete. The reaction was stopped and diluted with DCM (20 mL). The organics washed sequentially with saturated sodium bicarbonate solution (20 mL), water (20 mL), and brine solution (20 mL). The organic phase was dried with sodium sulfate, filtered. The organic phase was concentrated, and the crude product was purified by ISCO/MPLC using a silica gel column (80 g), and the column was eluted with (0-50) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Intermediate 3 as oil (2.4 g, 89% yield).
[0130] Step 4: To a solution of Intermediate 3 (500 mg, 0.64 mmol, 1.0 eq) in DCM (15 ml), methane sulfonic acid (MSA, 86 L, 1.32 mmol, 2.0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The reaction flask was cooled with an ice-bath then N-methyl piperidine carboxylic acid (183 mg, 1.28 mmol, 2eq.), HATU (365 mg, 1.28 mmol, 1.5eq.), and triethyl amine (0.26 mL, 1.92 mmol, 3eq.) were sequentially added. After 15 minutes, the ice-bath was removed, and the reaction was stirred for 30 minutes. LC/MS confirmed formation of the product. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried with NazSCL and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 11 as oil (356 mg, 69% yield). ESI MS (m/z): 805.8 (M H)
Example. 12: Synthesis of Compound 12 of Table 1 (4-(2-(dimethylanuno)-N-(8- (heptadecan-9-yloxy)-8-oxoocdyl)acetamido)butyl tetradecanoate)
[0131] Compound 12 was prepared according to Scheme 12 shown in FIG. 12.
[0132] Step 4: Step 1 of Scheme 12 was carried out according to the same procedure as described in the above Step 1 of Scheme 8. Steps 2 and 3 of Scheme 12 were carried out according to the same procedure as described in the above Steps 2 and 3 of Scheme 11. To a solution of Intermediate 3 (1.8 g, 2.3 mmol, 1 .0 eq) in DCM (25 ml), methane sulfonic acid (MSA, 0.3 mL, 4.6 mmol, 2,0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The reaction flask was cooled with an ice-bath then chloroacetyl-chloride (0.2 mL, 2.7 mmol, 1.1 eq.) was added, followed by drop wise addition of triethyl amine (1.6 mL, 1 1.5 mmol, 5.0 eq.). After 15 minutes, LC/MS confirmed that the reaction was complete. The reaction mixture was diluted with DCM (20 mL) and washed with water (20 ml) and brine (20 ml). The organic phase was dried with NazSCh, filtered. The organic phase was concentrated and purified by ISCO MPLC system using a silica column (80 g). Column was eluted with (0-50)% Hexane-Ethyl Acetate gradient. Fractions were combined and concentrated via rotary evaporator to yield Intermediate 4 as oil (1.5 g, 88% yield).
[0133] Step 5: To a solution of Intermediate 4 (600 nig, 0.79 mmol, leq) in LC/MS grade acetonitrile (40 mL), dimethyl anime (1.9 mL, 3.9 mmol, 5 eq, 2M in TFIF) and DBU (2eq.) were added at room temperature. The reaction mixture was stirred at room temperature overnight under Nz gas. Next day, LC/MS confirmed that the starting material was consumed and complete conversion to product. The reaction mixture was concentrated and the residue was suspended in DCM, and washed with saturated aqueous NaHCO3, water, and brine. The organic phase was dried with NazSOi, filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 12 as oil (436 mg, 72% yield). ESI MS (m/z): 765.3 (M H)
Example. 13: Synthesis of Compound 13 of Table 1 (4-(2-(cis-3,4-dihydroxypyrrolidin-l-yl)~ N-(8-(heptadecan-9-yloxy)-8-oxooctyl)acetamido)butyl tetradecanoate)
[0134] Compound 13 was prepared according to Scheme 13 shown in FIG. 13.
[0135] To a solution of Intermediate 4 of Example 12 (580 mg, 0.76 mmol, leq) in LC/MS grade acetonitrile (40 mL), cDHP.HCI (212 mg, 1 ,53 mmol, 2eq) andDBU (2eq.) were added at room temperature. The reaction mixture was stirred at 45 °C overnight under Nz gas. Next day, LC/MS confirmed that the starting material was consumed and complete conversion to the product. The reaction mixture was concentrated and the residue was suspended in DCM, and washed with saturated aqueous NaHCOz, water, and brine. The organic phase was dried with Na2SO4, filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 13 as viscous oil (476 mg, 75% yield). ESI MS (m/z): 823.79
Example 14: Synthesis of Compound 14 of Table 1 (3~(2~(dimethylamino)~N~(8~ (heptadecan-9~yloxy)~8~oxooctyl)acetamido)propyl tetradecanoate)
[0136] Compound 14 was prepared according to Scheme 14 shown in FIG. 14.
[0137] Step 2: Step 1 of Scheme 14 was carried out according to the same procedure as described in the above Step 1 of Scheme 8. Intermediate 1 (2.8 g, 6.06 mmol, leq.) and amino propanol (1.4 g, 18.1 mmol, 3eq.) were suspended in a mixture of acetonitrile/CPME (40 mL, 1 : 1). K2CO3 (0.83 g, 12.9 mmol, leq.) was added to the above mixture. The reaction mixture was heated to 70 °C and stirred for 5 hours. LC/MS confirmed that the reaction was complete. The heating bath was removed, and the reaction mixture was cooled to room temperature. The solids were filtered and washed with acetonitrile. The reaction mixture was concentrated filtrate and the residue was suspended in DCM (40 mL). The organic layer was washed with saturated aqueous NaHCO?. (25 mL), water (25 mL), and brine (20 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated to provide mono-N- alkylated product in quantitative yields. This intermediate was dissolved in DCM (30 mL) then BoczO (1.6 g, 7.2 mmol, 1.2eq.) and triethyl amine (1.7 mL, 12.1 mmol, 2eq.) were added. The reaction mixture was allowed to stir overnight at room temperature. Next day, LC/MS showed that the reaction was complete. The reaction mixture was diluted with DCM (30 mL) then washed with saturated sodium bicarbonate solution (40 mL), and brine (40 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated and the crude product was purified by ISCO/MPLC using a silica gel column (120 g). Column was eluted with (0-100) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary? evaporator to yield Intermediate 2 as oil (2,0 g, 61% yield),
[0138] Step 3: To a solution of Intermediate 2 (2.0 g, 3,6 mmol, leq.) in anhydrous DCM (25 ml), EtsN (0.97 mL, 7,2 mmol, 2eq.) and Myristoyl chloride (1.08 mL, 3.9 mmol, 1.1 eq) were added at room temperature. After 2 hours, LC/MS confirmed that the reaction was complete. The reaction was stopped and diluted with DCM (20 mL). The organics were washed sequentially with saturated sodium bicarbonate solution (20 mL), water (20 mL), and brine solution (20 mL). The organic phase was dried with sodium sulfate, filtered. The organic phase was concentrated, and the crude product was purified by ISCO/MPLC using a silica gel column (80 g), and the column was eluted with (0-50) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Intermediate 3 as oil (1 .8 g, 66.6% yield).
[0139] Step 4: To a solution of Intermediate 3 (450 mg, 0.58 mmol, leq) in DCM (30 ml), methane sulfonic acid (MSA, 2.0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The reaction flask was cooled with an ice-bath then saturated aqueous NaHCOz solution was added. The reaction mixture was slowly warmed to room temperature. Then the organic phase was separated. The aqueous phase was extracted with DCM (20 mL). The combined organic layers were dried with Na2SO4 and filtered. The organic phase was concentrated to give crude amine intermediate which was taken to next step without further purification. This amine intermediate was dissolved in DCM (20 mL) and cooled to 0 °C. N, N’ -dimethylglycine HC1 (163 mg, 1.17 mmol, 2eq.), HATU (1.15eq.), and triethyl anime (2eq.) were sequentially added to the above mixture. After 15 minutes, cooling was removed, and the reaction was stirred at room temperature for required time. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCOz (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried with NazSOa and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 14 as oil (275 mg, 63% yield). ESI MS (m/z): 751 .83 (M H) .
Example 15: Synthesis of Compound 15 of Table 1 (3-(N~(8-(heptadecan-9-yloxy)-8~ oxooctyl)-2-(l-methylpiperidin-4-yl)acetanddo)propyl tetradecanoate)
[0140] Compound 15 was prepared according to Scheme 15 shown in FIG. 15.
[0141] To a solution of Intermediate 3 of Example 14 (450 mg, 0.58 mmol, leq) in DCM (30 ml), methane sulfonic acid (MSA, 2,0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The reaction flask was cooled with an ice-bath then saturated aqueous NaHCCh solution was added. The reaction mixture was slowly wanned to room temperature. Then the organic phase was separated. The aqueous phase was extracted with DCM (20 mL). The combined organic layers were dried with NazSO-r and filtered. The organic phase was concentrated to give crude amine intermediate winch was taken to next step without further purification. This amine intermediate was dissolved in DCM (20 mL) and cooled to 0 °C. N- methyl piperidine 4-aceticacid (227 nig, 1.17 mmol, 2eq), HATU (1.15eq.), and triethyl amine (2eq.) were sequentially added to the above mixture. After 15 minutes, cooling was removed, and the reaction was stirred at room temperature for required time. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried with NacSCU and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 15 as viscous oil (290 mg, 61% yield). ESI MS (m/z): 805.88 (M+H)T
Example 16: Synthesis of Compound 16 of Table 1 (3~(N~(8~(hept(idecan.-9-yloxy)~8~ oxooctyl)-l-methylpiperidine-4-carboxanudo)propyl tetnuiecanoate)
[0142] Compound 16 was prepared according to Scheme 16 shown in FIG. 16.
[0143] To a solution of Intermediate 3 of Example 14 (450 mg, 0.58 mmol, leq) in DCM (30 ml), methane sulfonic acid (MSA, 2.0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The reaction flask was cooled with an ice-bath then saturated aqueous NaHCCti solution was added. The reaction mixture was slowly warmed to room temperature. Then the organic phase was separated. The aqueous phase was extracted with DCM (20 mL). The combined organic layers were dried with Na2SO4 and filtered. The organic phase was concentrated to give crude amine intermediate which was taken to next step without further purification. This amine intermediate was dissolved in DCM (20 mL) and cooled to 0 °C. N- methyl piperidine 4-carboxilic acid (167 mg, 1.17, 2eq.), HATU (1.15eq.), and triethyl amine (2eq.) were sequentially added to the above mixture. After 15 minutes, cooling was removed, and the reaction was stirred at room temperature for required time. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCOz (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column v/as eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 16 as oil (292 mg, 63% yield). ESI MS (m/z): 790.87 (M+ H ) +
Exampie 17: Synthesis of Compound 17 of Table 1 (3~(2~(cis~3,4~dihydroxypymj>Hdin~l~yl)~ N~(8~(heptadecan-9~yloxy)~8~oxooctyl)acetamido)propyl tetradecanoate)
[0144] Compound 17 was prepared according to Scheme 17 shown in FIG. 17.
[0145] Step 4: Step 1 of Scheme 17 wax carried out according to the same procedure as described in the above Step 1 of Scheme 8. Steps 2 and 3 of Scheme 17 were carried out according to the same procedure as described in the above Steps 2 and 3 of Scheme 14. To a solution of Intermediate 3 (450 g, 0.58 mmol, 1.0 eq) in DCM (15 ml), methane sulfonic acid (MSA, 80 mL, 1.17 mmol, 2.0eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The reaction flask was cooled with an ice-bath then chloroacetylchloride (52 pL, 0.64 mmol, 1.1 eq.) was added, followed by dropwise addition of triethyl anime (0.4 mL, 2.9 mmol, 5.0 eq.). After 15 minutes, the ice-bath was removed, and the reaction was cooled to room temperature. After 1 hour stirring, LC/MS confirmed that the reaction was complete. The reaction mixture was diluted with DCM (20 mL) and washed with water (20 ml) and brine (20 ml). The organic phase was dried with NazSCL, filtered. The organic phase was concentrated and purified by ISCO MPLC system using a silica column (40 g). Column was eluted with (0-50) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated via rotary evaporator to yield Intermediate 4 as solid (425 mg, 97% yield).
[0146] Step 5: Intermediate 4 (425 mg, 0.57 mmol, l eq) and cA-DHP.HCl (159 mg, 1.14 mmol, 2eq.) were suspended in LC/MS grade acetonitrile (20 mL). DBU (144 pL, 1.14 mmol, 2eq.) was added to the above mixture. The reaction flask was heated at 45 °C and stirred for 4 hours under Nz gas. LC/MS confirmed that the starting material was consumed and formation of product. The heating bath was removed, and the reaction was stirred overnight at room temperature. The reaction mixture was concentrated, and the residue was suspended in DCM (30 mL), and washed with saturated aqueous NaHCO3 (15 mL), water (15 mL), and brine (15 mL). The organic phase was dried with Na2S()4, filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 17 as viscous oil (307 mg, 67% yield). ESI MS (ni/z): 809.77 (M+H)'1'.
Example 18: Synthesis of Compound 18 of Table 1 (2-(2~(dimethylaimno)-N~(8~ (heptadecan~9-yloxy)-8-oxooctyl)acetamido)ethyl (9Z,12Z)-octadeca~9,12-dienoate)
[0147] Compound 18 was prepared according to Scheme 18 shown in FIG. 18.
[0148] Step 3: Steps 1 and 2 of Scheme 18 were carried out according to the same procedure as described in the above Steps I and 2 of Scheme 8. To mixture of Intermediate 2 (2.5 g, 4.6 mmol, leq.) and Linoleic acid (2.6 g, 9.2 mmol, 2eq.) in anhydrous DCM (20 ml), EDC.HC1 (1.7 g, 9.2 mmol, 1.5 eq.), EtsN (1.28 mL, 9.2 mmol, 2eq.), and DMAP (220 mg, 1.8 mmol, 0.4 eq.) were sequentially added under nitrogen gas. The clear solution was stirred overnight at room temperature. Next day, LC/MS confirmed that the reaction was complete. The reaction was stopped and diluted with DCM (30 mL). The organics were washed sequentially with saturated sodium bicarbonate solution (30 mL) and brine solution (30 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated and the crude product was purified by ISCO/MPLC using a silica gel column (80 g) and the column was eluted with (0-50) % Hexane-Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Intermediate 3 as oil (3.15 g, 87% yield).
[0149] Step 4: To a solution of Intermediate 3 (1.2 g, 1.5 mmol, 1.0 eq) in DCM (20 ml), methane sulfonic acid (MSA, 0,2 mL, 3.0 mmol, 2.0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of the Boc group. The reaction flask was cooled with an ice-bath then chloroacetyl-chloride (138 uL, 1.7 mmol, 1.15 eq.) was added, followed by dropwise addition of triethyl amine (1.0 mL, 7.5 mmol, 5,0 eq.). After 30 minutes, LC/MS confirmed that the reaction was complete. The reaction mixture was diluted with DCM (20 mL) and washed with water (20 ml) and brine (20 ml). The organic phase was dried with Na2SO4, filtered. The organic phase was concentrated and purified by ISCO MPLC system using a silica column (40 g). Column was eluted with (0-40) % Hexane-Ethyl Acetate gradient. Fractions were combined and concentrated via rotary evaporator to yield Intermediate 4 as solid (1 .03 g, 88% yield).
[0150] Step 5: To a solution of Intermediate 4 (500 mg, 0.64 mmol, leq) in LC/MS grade acetonitrile (40 mL), dimethyl amine (1.6 mL, 3.2 mmol, 5 eq, 2M in THE) and DBU (2eq.) were added at room temperature. The reaction mixture was stirred at room temperature overnight under Nz gas. Next day, LC/MS confirmed that the starting material was consumed and complete conversion to product. The reaction mixture was concentrated and the residue was suspended in DCM, and washed with saturated aqueous NaFICOz, water, and brine. The organic phase was dried with Na2SO4, filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 18 as oil (335 mg, 66% yield). ESI MS (m/z): 789.83 (M+H)+.
Example 19: Synthesis of Compound 19 of Table 1 (2-(2-(cis-3,4-dihydroxypyrrolidin-l-yl)- N-(8-(heptadecan-9-yloxy)-8-oxooctyl)acetamido)ethyl (9Z,12Z)-octadeca-9,12-dienoate)
[0151] Compound 19 was prepared according to Scheme 19 shown in FIG. 19.
[0152] To a solution of Intermediate 4 of Example 18 (500 mg, 0.64 mmol, leq) in LC/MS grade acetonitrile (40 mL), cDHP.HCi (177 mg, 1.28 mmol, 2eq) and DBU (2eq.) were added at room temperature. The reaction mixture was stirred at 45 °C overnight under Nz gas. Next day, LC/MS confirmed that the starting material was consumed and complete conversion to product. The reaction mixture was concentrated, and the residue was suspended in DCM, and washed with saturated aqueous NaHCO3, water, and brine. The organic phase was dried with Na2SO4, filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 19 as viscous oil (400 mg, 74% yield). ESI MS (m/z): 847,89 (M+H)7 Example 20: Synthesis of Compound 20 of Table 1 (2~(N~(8-(heptadecan~9~yloxy)~8- oxooctyl)~2~(l~methylpiperidin-4-yl)acetanudo)ethyl (9Z,12Z)-octadeca-9,12~dienoate)
[0153] Compound 20 was prepared according to Scheme 20 shown in FIG. 20.
[0154] Step 4: Steps 1 and 2 of Scheme 20 were carried out according to the same procedure as described in the above Steps 1 and 2 of Scheme 8. Step 3 of Scheme 20 was carried out according to the same procedure as described in the above Step 3 of Example 18. To a solution of Intermediate 3 (1.9 g, 2.3 mmol, 1.0 eq) in DCM (20 ml), methane sulfonic acid (MSA, 0.32 mL, 4.7 mmol, 2.0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The resulted amine intermediate was dissolved in DCM (20 mL) and cooled to 0 °C. N-methyl piperidine 4-acetic acid (1.5eq.), HATU (1.15eq.), and triethyl amine (2eq.) were sequentially added to the above mixture. After 15 minutes, cooling was removed, and the reaction was stirred at room temperature for required time. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0-20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 20 as oil (503 mg, 75% yield). ESI MS (m/z): 843.4 (M H)
Example. 21: Synthesis of Compound 21 of Table 1 (2-(N-(8-(heptadecan-9-yloxy)-8- oxooctyl)-l-methylpiperidine-4-carboxamido)ethyl (9Z,12Z)-octadeca-9,12-dienoate)
[0155] Compound 21 was prepared according to Scheme 21 shown in FIG. 21.
[0156] To a solution of Intermediate 3 of Example 20 (1.9 g, 2.3 mmol, 1.0 eq) in DCM (20 ml), methane sulfonic acid (MSA, 0.32 mL, 4.7 mmol, 2.0 eq) was added under Nz gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of Boc group. The resulted amine intermediate was dissolved in DCM (20 mL) and cooled to 0 °C. N-methyl piperidine 4-carboxilic acid (1.5eq.), HATU (1.15eq.), and triethyl amine (2eq.) were sequentially added to the above mixture. After 15 minutes, cooling was removed, and the reaction was stirred at room temperature for required time. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCCh (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried with NacSOr and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (40 g). Column was eluted with (0-100) % Hexane-Ethyl acetate and (0- 20) % DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 21 as viscous oil (530 mg, 82% yield). ESI MS (m/z): 829.4 (M H) .
Example 22: Synthesis of Compound 22 of Table 1 (2-(2-(dlmethylandno)~N-(6-oxo~6~ (trldecan- 7~yloxy)hexyl)acetanudo)ethyl (9Z, 12Z)-octadeca-9,12~dienoate)
[0157] Compound 22 was prepared according to Scheme 22 shown in FIG. 22.
[0158] Step 1 : DMAP (300 mg, 2.9 mmol, 0. 1 eq.) and EDC I {Cl (6.8 g, 35.9 mmol, 1.2 eq.) were added to a stirred solution of tridecan-7-ol (6 g, 29.9 mmol, leq.) and 6-bromo hexanoic acid (7 g, 35.9 mmol, 1.2eq.) in DCM (70 mL). The clear reaction solution was stirred at room temperature overnight under nitrogen gas. The reaction mixture was diluted with DCM (50 mL) then washed with saturated sodium bicarbonate solution (40 mL), water (40 mL), and brine (40 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated to yield Intermediate 1 (7.2 g, 66% yield).
[0159] Step 2: Intermediate 1 (2.3 g, 6.1 mmol, leq.) and ammo ethanol (2.6 g, 42.7 mmol, 7 eq.) were suspended in a mixture of acetonitrile/CPME (60 mL, 1:1). K2CO3 (0.84 g, 12.9 mmol, leq.) was added to the above mixture. The reaction mixture was heated to 70 °C and stirred for 5h. LC/MS confirmed that the reaction was complete. The heating bath was removed, and the reaction mixture was cooled to room temperature. The solids were filtered and washed with acetonitrile. Concentrated filtrate and suspended the residue in DCM (60 mL). The organic layer was washed with saturated aqueous NaHCO3 (30 mL), water (30 mL), and brine (30 mL). The organic phase was dried with NaaSOa and filtered. The organic phase was concentrated to provide mono-N-alkylated product in quantitative yields. This intermediate was dissolved in DCM (50 mL) then BOC2O (1.4 g, 6.7 mmol, 1. leq.) and triethyl amine (1.7 mL, 12.2 mmol, 2eq.) were added to the mixture. The mixture was allowed to stir overnight at room temperature. Next day, LC/MS showed the reaction was complete. The reaction mixture was diluted with DCM (30 mL) then washed with saturated sodium bicarbonate solution (40 mL), and brine (40 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated, and the crude product was purified by ISCO/MPLC using a silica gel column (80 g). Column was eluted with (0-100)% Hexane- Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Intermediate 2 as oil (1.3 g, 62% yield).
[0160] Step 3: EDC.IICl (0.81 g, 4.2 mmol, 1.5 eq.), Et?.N (0.79 mL, 5.6 mmol, 2eq.), and DMAP (138 mg, 1.1 mmol, 0.4 eq.) were sequentially added to mixture of Intermediate 2 (1.3 g, 2.8 mmol, leq.) and linoleic acid (1.2 g, 4.2 mmol, 1.5eq.) in anhydrous DCM (20 ml) under nitrogen gas. The clear solution was stirred overnight at room temperature. Next day, LC/MS confirmed that the reaction was complete. The reaction was stopped and diluted with DCM (30 mL). The organics were sequentially washed with saturated sodium bicarbonate solution (30 mL) and brine solution (30 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated, and the crude product was purified by ISCO/MPLC using a silica gel column (80 g), and the column was eluted with (0- 50)% Hexane-Ethyl acetate gradient. Fractions were combined and concentrated under reduced pressure using a rotary evaporator to yield Intermediate 3 as oil (1.5 g, 75% yield).
[0161] Step 4: Methane sulfonic acid (MSA, 72 uL, 1.1 mmol, 2.0 eq) was added to a solution of Intermediate 3 (400 mg, 0.55 mmol, 1.0 eq) in DCM (20 ml) under N2 gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of the Boc group. To the above reaction mixture, N,N’ -dimethyl glycine (72 mg, 0,72 mmol, 1.3 eq), HATU (316 mg, 0.83 mmol, 1,4 eq), and diisopropyl ethyl amine (0.5 mL, 2.7 mmol, 5 eq) were sequentially added. The resulting solution was stirred at ambient temperatures under a N2 gas for 3 hours. LC/MS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (10 mL), water (10 mL), and brine (10 mL). The organic phase was dried with Na2SOi and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (24 g). Column was eluted with (0-100)% Hexane- Ethyl acetate and (0-20)% DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 22 as oil (145 mg, 37% yield). ESI MS (m/z): 705.66 (M+H)i Example 23: Synthesis of Compound 23 of Table I (2~(4~(dimethylatnino)-N~(6~oxo-6- (tridecan-7-yloxy)hexyl)butananudo)ethyl (9Z,12Z)-octadeca-9,12~dienoate)
[0162] Methane sulfonic acid (MSA, 72 pL, 1.1 mmol, 2.0 eq) was added to a solution of Intermediate 3 of Example 22 (400 mg, 0.55 mmol, 1.0 eq) in DCM (20 maunder N2 gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of the Boc group. To the above reaction mixture, N,N ’ -dimethyl butanoic acid (94 mg, 0.72 mmol, 1.3 eq), HATU (316 mg, 0.83 mmol, 1.4 eq), and diisopropyl ethyl amine (0.5 mL, 2.7 mmol, 5 eq) were sequentially added. The resulting solution was stirred at ambient temperatures under a Nz gas for 3 hours. LC/MS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCOz (10 mL), water (10 mL), and brine (10 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (24 g). Column was eluted with (0-100)% Hexane-Ethyl acetate and (0-20)% DCM-MeOH gradient. Fractions were combined and concentrated via rotary’ evaporator to yield Compound 23 as oil (160 nig, 37% yield). ESI MS (m/z): 733.71 (M+H)C
Example 24: Synthesis of Compound 24 of Table 1 (2-(2-((2-(dimethylamino)ethyl)thio)-N- (6-oxo-6-(tridecan-7-yloxy)hexyl)acetamido)ethyl (9Z,12Z)-octadeca.-9,12-dienoate)
[0163] Methane sulfonic acid (MSA, 72 pL, 1.1 mmol, 2.0 eq) was added to a solution of Intermediate 3 of Example 22 (400 nig, 0.55 mmol, 1.0 eq) in DCM (20 ml) under Nz. gas. The clear solution was allowed to stir overnight at room temperature. Next day, LC/MS confirmed complete cleavage of the Boc group. To the above reaction mixture, N,N’ -dimethyl ethylthio acetic acid (117 mg, 2.7 mmol, 5 eq), HATU (316 mg, 0.83 mmol, 1.4 eq), and diisopropyl ethyl amine (0.5 mL, 1.0 mmol) were sequentially added. The resulting solution was stirred at ambient temperatures under a N2 gas for 3 hours. LC/MS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCOz (10 mL), water (10 mL), and brine (10 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (24 g). Column was eluted with (0- 100)% Hexane-Ethyl acetate and (0-20)% DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 24 as oil (170 mg, 37% yield). ESI MS (m/z): 765.98 (M+H)+.
Example 25: Synthesis of Compound 25 of Table 1 (tridecan- 7~yl 6-(2-(dimethylamino)~N- (6~oxo~6-(undecyloxy)hexyl)acetamido)hexanoate)
[0164] Compound 25 was prepared according to Scheme 23 shown in FIG. 23.
[0165] Step 1 : DMAP (300 mg, 2.9 mmol, 0.1 eq.) and EDC HC1 (6.8 g, 35.9mmol, 1.2 eq.) were added to a stirred solution of tridecan-7-ol (6 g, 29.9 mmol, leq.) and 6-bromo hexanoic acid (7 g, 35.9 mmol, 1.2eq.) in DCM (70 mL). The clear reaction solution was stirred at room temperature overnight under nitrogen gas. The reaction mixture was diluted with DCM (50 mL) then washed with saturated sodium bicarbonate solution (40 mL), water (40 mL), and brine (40 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated to yield Intermediate 1 (7.2 g, 66% yield).
[0166] Step 2: To a solution of undecan- l-ol (5 g, 29.0 mmol, 1 eq.) and 6-N-Boc amino hexanoic acid (8 g, 34.8 mmol, 1.2 eq.) in anhydrous DCM (70 ml), EDCHC1 (8.3 g, 43.5 mmol, 1.5 eq.), triethyl amine (5.8 mL, 58 mmol), and DMAP (700 mg, 2.9 mmol, 0.2 eq.) were added. The clear reaction solution was stirred at room temperature overnight under N2 gas. Next day, LCZMS confirmed completion of the reaction. The reaction mixture was diluted with DCM (50 mL) then washed with saturated sodium bicarbonate solution (60 mL), and brine (60 mL). The organic phase was dried with sodium sulfate, filtered, and the solvent was evaporated via rotary evaporator, yielding crude product. The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated and the crude product was purified by ISCO MPLC using a silica gel column (120 g), and the column was eluted with (0- 100)% Hexane-Ethyl acetate gradient. Fractions were combined and concentrated to yield Intermediate 2 (9.3 g, 79% yield) as oil.
[0167] Step 3: Intermediate 2 (6 g, 15.5 mmol, leq) was dissolved in DCM (60 mL), and methane sulfonic acid (2.0 mL, 31.1 mmol, 2eq) was added to the solution. The clear solution was stirred at room temperature overnight. Next day, LC/MS confirmed that complete conversion of starting material to product. The reaction mixture was diluted with DCM (40 mL) and washed with saturated sodium bicarbonate solution (40 mL). The organic phase was dried with NacSCh and filtered. The organic phase was concentrated and dried to give free amine Intermediate in quantitative yields. This material was used in the next step without further purification. A solution of Intermediate 1 (1.5 g, 3.9 mmol, leq.) and deprotected product of Intermediate 2 (2.2 g, 7.9 mmol, 2 eq.) in a mixture of acetonitrile/cyclopropyl methyl ether (60 mL, 1 : 1) was treated with potassium carbonate (1.0 g, 7.9 mmol, 2 eq.) under N2 gas. The reaction flask was heated at 70 °C overnight. LCZMS showed formation of the desired peak that corresponding to monoalkylated product. The reaction mixture was cooled to room temperature and filtered through a pad of celite and washed with DCM (40 mL). The organic phase was concentrated, and purifiedby ISCO MPLC system using a silica column (80 g). Column was eluted with (0-100)% hexane/EtOAc gradient. Fractions were combined and concentrated under reduced pressure via rotary evaporator to provide Intermediate 3 as solid (450 nig, 20% yield). ESI MS (m/z): 582.63 (M+H)+.
[0168] Step 4: To a mixture of Intermediate 3 (150 nig, 0.25 mmol, leq) and N,N’- dimethyl glycine (31 mg, 0.30 mmol, 1.2 eq) in DCM (5 ml), diisopropyl ethyl amine (184 pL, 1.0 mmol) was added, followed by addition of HATU (137 mg, 0.37 mmol, 1.4 eq). The resulting solution was stirred at ambient temperatures under a N2 gas overnight. Next day, LCMS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (10 mL), water (10 mL), and brine (10 mL). The organic phase was dried with Na2SO4 and filtered. The orgam phase was concentrated and purified by ISCO/MPLC system using a silica column (12 g). Column w'as eluted with (0-100)% Hexane-Ethyl acetate and (0-20)% DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 25 as oil (96 mg, 56% yield), ESI MS (m/z): 667.66 (M • 11) .
Example 26: Synthesis of Compound 26 of Table 1 (trldecan-7-yl 6~(N-(6-oxo~6~ (undecyloxy)hexyl)-2-(pyrrolidinA-yl)a£etanudo)hexanoate)
[0169] To a mixture of Intermediate 3 of Example 25 (150 mg, 0.25 mmol, leq) and pyrrolidine acetic acid (51 mg, 0.30 mmol, 1.2 eq) in DCM (5 ml), diisopropyl ethyl amine (184 pL, 1 .0 mmol) was added, followed by addition of HATU (137 mg, 0.37 mmol, 1.4 eq). The resulting solution was stirred at ambient temperatures under a N2 gas overnight. Next day, LCMS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (10 mL), water (10 mL), and brine (10 mL). The organic phase was dried with NacSCh and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (12 g). Column was eluted with (0-100)% Hexane-Ethyl acetate and (0-20)% DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 26 as oil (146 mg, 82% yield). ESI MS (m/z): 693.67 (M+ H ) +.
Example 27: Synthesis of Compound 27 of Table 1 (tridecan~7~yl 6-(2-((2~ (dimethylamino)ethyl)thio)-N-(6-oxo-6~(undecyloxy)hexyl)acetanudo)hexanoate)
[0170] To a mixture of Intermediate 3 of Example 25 (150 mg, 0.27 mmol, leq) and N,N’-dimethyl ethylthio acetic acid (50 mg, 0.30 mmol, 1.2 eq) in DCM (5 ml), diisopropyl ethyl amine (184 pL, 1.0 mmol) was added, followed by addition of HATH (137 mg, 0.37 mmol, 1.4 eq). The resulting solution was stirred at ambient temperatures under a N? gas overnight. Next day, LCMS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NallCOs (10 mL), water (10 mL), and brine (10 mL). The organic phase was dried with Na2.SO4 and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (12 g). Column was eluted with (0-100)% Hexane-Ethyl acetate and (0-20)% DCM- MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 27 as oil (115 mg, 61% yield). ESI MS (m/z): 727.6 (M+H)T
Example 28: Synthesis of Compound 28 of Table 1 (tridecan-7-yl 6-(2-(dimethylanuno)-N- (4-oxo-4-(unde(yloxy)butyl)acetanudo)hexanoate)
[0171] Compound 28 was prepared according to Scheme 24 shown in FIG. 24.
[0172] Step 1: To a stirred solution of tridecan-7-ol (6 g, 29.9 mmol, leq.) and 6- bromo hexanoic acid (7 g, 35.9 mmol, 1.2eq.) in DCM (70 mL), DMAP (300 nig, 2.9 mmol, 0.1 eq.) and EDC HC1 (6.8 g, 35.9 mmol, 1.2 eq.) were added. The clear reaction solution was stirred at room temperature overnight under nitrogen gas. The reaction mixture was diluted with DCM (50 mL) then washed with saturated sodium bicarbonate solution (40 mL), water (40 mL), and brine (40 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated to yield Intermediate 1 (7.2 g, 66% yield). [0173] Step 2: To a solution of undecane-l-ol (3 g, 17.4 mmol, 1 eq.) and 6-N-Boc amino butanoic acid (4.2 g, 20.8 mmol, 1.2 eq.) in anhydrous DCM (50 ml), EDCHC1 (5 g, 26.4 mmol, 1.5 eq.), triethyl amine (4.9 mL, 34.8 mmol), and DMAP (424 nig, 3.4 mmol, 0.2 eq.) were added. The clear reaction solution was stirred at room temperature overnight under N2 gas. Next day, LCZMS confirmed completion of the reaction. The reaction mixture was diluted with DCM (30 mL) then washed with saturated sodium bicarbonate solution (40 mL), and brine (40 mL). The organic phase was dried with sodium sulfate, filtered, and the solvent was evaporated via rotary evaporator, yielding crude product. The organic phase was dried with Na2SO4 and filtered. The crude product was concentrated and purified by ISCO MPLC using a silica gel column (120 g), and the column was eluted with (0-100)% Hexane-Ethyl acetate gradient. Fractions were combined and concentrated to yield Intermediate 2 (5.5 g, 88% yield) as oil.
[0174] Step 3: Intermediate 2 (3.7 g, 10.3 mmol) was dissolved in DCM (40 mL), and methane sulfonic acid (1.3 mL, 20.6 mmol, 2eq) was added to the solution. The clear solution was stirred at room temperature overnight. Next day, LC/MS confirmed that complete conversion of starting material to product. The reaction mixture was diluted with DCM (25 mL) and washed with saturated sodium bicarbonate solution (25 mL). The organic phase was dried with NazSOr and filtered. The organic phase was concentrated and dried to give free amine Intermediate in quantitative yields. This material was used in the next step without further purification. A solution of Intermediate 1 (1.0 g, 2.6 mmol, leq.) and deprotected product of Intermediate 2 (1.3 g, 5.2 mmol, 2 eq.) in a mixture of acetonitrile/cyclopropyl methyl ether (50 mL, 1 : 1) was treated with potassium carbonate (730 mg, 5.3 mmol, 2 eq.) under Nz gas. The reaction flask was heated at 70 °C overnight. LC/MS showed formation of the desired peak corresponding to monoalkylated product. The reaction mixture was cooled to room temperature and filtered through a pad of celite and washed with DCM (20 mL). The organic phase was concentrated and purified by the ISCO MPLC system using a silica column (80 g). Column was eluted with (0-100)% hexane/EtOAc gradient. Fractions were concentrated under reduced pressure via rotary evaporator to provide Intermediate 3 as solid (300 mg, 21% yield). ESI MS (m/z): 554.56 (M+H)\
[0175] Step 4 : To a mixture of Intermediate 3 (150 mg, 0.27 mmol, leq) and N,N’~ dimethyl glycine (33 mg, 0.32 mmol, 1.2 eq) in DCM (5 ml), triethyl amine (152 pL, 1.0 mmol) was added, followed by addition of HATU (144 mg, 0.37 mmol, 1.4 eq). The resulting solution was stirred at ambient temperatures under a N2 gas overnight. Next day, LCMS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried with NazSCti and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (12 g). Column was eluted with (0- 100)% Hexane-Ethyl acetate and (0-20)% DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 28 as oil (96 mg, 55% yield). ESI MS (m/z): 639.63 (M i l) .
Example 29: Synthesis of Compound 29 of Table 1 (tridecan-7-yl 6-(2-((2- (dimethylamino)ethyl)thio)-N-(4-oxo-4-(undecyloxy)butyl)acetamid&)hexanoate)
[0176] To a mixture of Intermediate 3 of Example 28 (150 mg, 0.27 mmol, leq) and N,N’-dimethyl ethylthio acetic acid (52 mg, 0.32 mmol, 1.2 eq) in DCM (5 ml), triethyl amine (152 uL, 1.0 mmol) was added, followed by addition of HAITI (144 mg, 0.37 mmol, 1.4 eq). The resulting solution was stirred at ambient temperatures under a N?. gas overnight. Next day, LCMS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (20 mL), water (20 mL), and brine (20 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated and purified by ISCO/MPLC system using a silica column (12 g). Column was eluted with (0-100)% Hexane-Ethyl acetate and (0-20)% DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 29 as oil (147 mg, 77% yield). ESI MS (m/z): 699.63 (M+H)+.
Example 30: Synthesis of Compound 30 of Table 1 (tetradecan- 5-yl 6-(2-(dimethylamino)- N-(6-oxo-6-(undecyloxy)hexyl)acetamido)hexanoate)
[0177] Compound 30 was prepared according to Scheme 25 shown in FIG. 25.
[0178] Step 1: To a stirred solution of tetradecan-5-ol (3.0 g, 13.9 mmol, leq.) in anhydrous DCM (40 mL), tri ethyl amine (3.9 mL, 27 mmol, 2eq) was added. After 10 minutes stirring, 6-bromo hexanoyl chloride (3.2 g, 35.9 mmol, 1.2eq.) was slowly added to the above mixture. The clear reaction solution was stirred at room temperature for 5 hours under nitrogen gas. The reaction mixture was diluted with DCM (50 mL) then washed with water (40 mL) and brine (40 mL). The organic phase was dried with sodium sulfate and filtered. The organic phase was concentrated, and the crude product was purified by ISCO MPLC using a silica gel column (120 g), and the column was eluted with (0-30)% Hexane-Ethyl acetate gradient. The organic phase was concentrated to yield Intermediate 1 (1.4 g, 66% yield).
[0179] Step 2: To a solution of undecane- l-ol (5 g, 29.0 mmol, 1 eq.) and 6-N-Boc ammo hexanoic acid (8 g, 34.8 mmol, 1.2 eq.) in anhydrous DCM (70 ml), EDC HC1 (8.3 g, 43.5 mmol, 1.5 eq.), triethyl amine (5.8 mL, 58 mmol), and DMAP (700 mg, 2.9 mmol, 0.2 eq.) were added. The clear reaction solution was stirred at room temperature overnight under Nz gas. Next day, LC./MS confirmed completion of the reaction. The reaction mixture was diluted with DCM (50 mL) then washed with saturated sodium bicarbonate solution (60 mL), and brine (60 mL). The organic phase was dried with sodium sulfate, filtered, and the solvent was evaporated via rotary evaporator, yielding crude product. The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated, and the crude product was purified by ISCO MPLC using a silica gel column (120 g), and the column was eluted with (0- 100)% Hexane-Ethyl acetate gradient. Fractions were combined and concentrated to yield Intermediate 2 (9.3 g, 79% yield) as oil,
[0180] Step 3: Intermediate 2 (6 g, 15.5 mmol, leq) was dissolved in DCM (60 mL), and methane sulfonic acid (2.0 mL, 31.1 mmol, 2eq) was added. The clear solution was stirred at room temperature overnight. Next day, LC/MS confirmed complete conversion of the starting material to the product. The reaction mixture was diluted with DCM (40 mL) and washed with saturated sodium bicarbonate solution (40 ml,). The organic phase was dried with NazSOr and filtered. The organic phase was concentrated and dried to give free amine Intermediate in quantitative yields. This material was used m the next step without further purification. A solution of Intermediate 1 (0.8 g, 2.0 mmol, leq.) and the deprotected product of Intermediate 2 (1.1 g, 4.0 mmol, 2 eq.) in a mixture of acetonitrile/cyclopropyl methyl ether (40 mL, 1 :1) was treated with potassium carbonate (280 mg, 2,0 mmol, 2 eq.) under Nz gas. The reaction flask was heated at. 70 °C for 3 hours. LC/MS showed formation of the desired peak corresponding to monoalkylated product. The reaction mixture was cooled to room temperature and filtered through a pad of celite and washed with DCM (20 mL). The crude product was concentrated and purified by ISCO MPLC system using a silica column (80 g). Column was eluted with (0-100)% hexane/EtOAc gradient. Fractions were combined and concentrated under reduced pressure via rotary evaporator to provide Intermediate 3 as solid (130 mg, 10% yield).
[0181] Step 4: Compound 30: To a mixture of Intermediate 3 (130 nig, 0.21 mmol, leq) and N,N ’-dimethyl glycine (26 nig, 0.30 mmol, 1.2 eq) in DCM (5 ml), diisopropyl ethyl amine (77 pL, 0.43 mmol) was added, followed by addition of HATU (116 mg, 0.30 mmol, 1.4 eq). The resulting solution was stirred at ambient temperatures under a N?. gas overnight. Next day, LCMS showed that the reaction was complete conversion. The reaction mixture was diluted with DCM (20 mL), and washed with saturated aqueous NaHCO3 (10 mL), water (10 mL), and brine (10 mL). The organic phase was dried with Na2SO4 and filtered. The organic phase was concentrated and purified by ISCO./MPLC system using a silica column (12 g). Column was eluted with (0-100)% Hexane-Ethyl acetate and (0-20)% DCM-MeOH gradient. Fractions were combined and concentrated via rotary evaporator to yield Compound 30 as oil (74 mg, 50% yield). ESI MS (m/z): 682.69(M+H)+.
Example 31: In vitro activities of LNP formulations
[0182] The sequence of the siRNA used in this study was as shown below:
» sense strand SEQ ID NO: 1 ( 5 ’ • : >3 ’ ): GAAGCCUUUUGAGACCCUAUU;
• antisense strand SEQ ID NO:2 (5’->3’): fUAGgGuCuCAAAAGGCUUCUU; wherein A, G, C, and U refer to ribo- A, ribo-G, ribo-C, and ribo-U, respectively; lower case leters a, u, g, c, t refer to 2’ -deoxy-A, 2’ -deoxy-U, 2’ -deoxy-G, 2’ -deoxy-C, and deoxythymidine (dT = T = t) respectively; underlining refers to 2’ -OMe-substituted; and the lower case letter f refers to 2’ -deoxy-2’ -fluoro substitution. The siRNA can knockdown GSTp gene and it is disclosed in PCT publication No. WO2016/106400, which is hereby expressly incorporated by reference in its entirety.
[0183] LNP formulations were prepared with the following compositions:
(Test compound/ cholesterol/DSPC/DMG-PEG) = 50/38/10/2 (mol%)
The test compound is one selected from the group consisting of Compounds Nos.
1 to 21 , R1 and R2. R1 was a commercial product. R2 was prepared according to PCT publication No. W02016/210190. [0184] LNP formulations were prepared by injecting ethanol solution of lipids into a dsRNA buffer solution, in the same manner as described in U.S. publication 2013-0022665, PCT publication No. WO2019/090359, and PCT publication No. W02020/102668. Those documents are hereby expressly incorporated by reference in their entireties. The average particle size (PS), the polydispersity index (PDI), the encapsulation efficiency for siRNA (%EE), and the yield of each LN P formulation is shown in Table 2. The pKa value of each LNP was determined using an assay based on fluorescence of 2-(p-toluidino)-6-napthalene sulfonic acid (TNS).
[0185] In vitro activity of the LNP formulations v/ere measured according to the following protocol:
[0186] Lung adenocarcinoma (A549) cells were cultured in vitro, in presence of DMEM medium (HyClone Cat. # SH 30243. 01) with 10% FBS (Invitrogen cat # A4766801) at 37°C, 5% CO2 humidifier atmosphere incubator. The day before transfection, cells seeded in 96- well plate at 2 x 10J cells/well. The next day siRNA'LNP complex was prepared at room temperature, after 24 hours 10 pl siRN ATJNP complex was added on top of the cells. The 96 plates w?ere mixed gently and incubated back at 37CC, 5% CO2 humidifier atmosphere incubator. Target gene knockdown efficiency was established after 24h, 48h and 72h by QRT- PCR. For total RNA isolation, at. respective time points the medium was removed from each well, and washed with IX DPBS. Cell lysis: 50 pl of Cell-to-Ct Lysis Buffer (Life Technologies Cat. #4391851 C) was added on top of the cells and incubated at room temperature with gentle shaking/5 min. The cell lysates were treated with 5 pl of Stop Solution to stop the cell lysis reaction. At mRNA level target gene knockdown was measured by QRT- PCR with TAQMAN kit following the manufacture’s instruction.
[0187] Experimental result for the in vitro gene silencing study is shown in Table 2.
TABLE 2
N/A== not applicable
Exantple 32: Formulation Distribution Study
[0188] LNP No. 1 (Compound No. 1/ cholesterolZDSPC/DMG-PEG == 50/38.5/10/1.5 (mol%)) with Flue mRNA (TriLink, 5moU) was prepared using NanoAssemblr IM (precision NanoSystems) according to the manufacturer’s instructions. Balb/c mice (n=4) were intravenously given a single injection with LNP No. 1, at a dose of 0.5 mg/kg. Mice were anesthetized 6-8 hours after mRNA injection. Animals were then sacrificed immediately, and tissues (pancreas, spleen, liver, kidney, lung, and muscle) were harvested. Tissues were homogenized in CCLR lysis buffer and centrifuged. The resultant supernatants were used for luciferase activity assay using PromegaE4510 assay reagents. The mRNA was predominantly transfected and translated in liver and spleen (see Fig. 26).
Example 33: In vitro expression of Flue mRNA
[0189] LNP formulations with Flue mRNA were prepared with the following compositions:
(Test compound/ cholesterol/DSPC/DMG-PEG2000) = 50/38/10/2 (mol%)
The test compound is any one of Compounds Nos. 1, 2, and 4 to 30, Rl, and R2, [0190] LNP formulations were prepared by injecting ethanol solution of lipids into a Flue mRNA (TriLink, 5moU) buffer solution, in the same manner as described in U.S. publication No. 2013-0022665, PCT publication No. WO2019/090359, and PCT publication No. W02020/102668, which are hereby expressly incorporated by reference in their entirety . The average particle size (PS), the poly dispersity index (PDI), the encapsulation efficiency for mRNA (%EE), and the yield of each LNP formulation obtained are shown in the following Table 3. PS and PDI were obtained by using Malvern Zetasizer Nano-ZS ZEN 3600. %EE was obtained by the Ribogreen fluorescence assay following GenVoy-ILM1M User Guide by Precision NanoSystems.
In vitro expression of Fine mRNA were measured according to the following Protocols I or 2:
Protocol 1:
[0191] Hep3B and Panc-1 cell lines w'ere cultured in media supplemented with 10% HI-FBS (Gibco Ref # 10082-147). EMEM media (ATCC Ref # 30-2003) and DMEM media (Gibco Ref # 11965-092) were used respectively. On day 0, cells were plated in white opaque 96-weti TC-treated plates (Greiner Ref # 655083) at a density of 5000 cells/well using 90uL of cell mixture per well. The plates were placed in a 37°C incubator with 5% CO2 overnight to allow' cell attachment. On day 1, the mRNA/LNP complex w'as equilibrated to room temperature, then diluted with DPBS (Gibco Ref # 14190-144) to create a dose-response curve and added to plates at a volume of lOpL/well. The plates were placed back in the 37°C incubator with 5% CO2 for 24 hours. On day 2, the Promega Luciferase Assay System (Ref # El 501 ) buffer and substrate were equilibrated to room temperature and combined, then added to the SpectraMax L Luminometer (Molecular Devices) injectors. The plates were prepared according to Promega kit guidelines by first removing the media in each well, then gently rinsing the well with DPBS, and finally adding 20pL of IX reporter lysis buffer (Ref # E397A) to each well. The plates were placed in the Luminometer and injected with 100 pL of luciferase buffer/substrate mixture per well while luminescence values were obtained. ECso values were determined by fitting dose-response curve with 4-parameter logistic model using GraphPad/Pfism. ECso values of the LNP formulation including any one of Compounds 2, 4, 8, 14, 18, 19, and R2 were determined according to Protocol 1.
Protocol 2:
[0192] Hep3B and Panc-1 cell lines were cultured in media supplemented with 10% HI-FBS (Gibco Ref # 10082-147). EMEM media (ATCC Ref # 30-2003) and DMEM media (Gibco Ref # 11965-092) were used respectively. On day 0, cells were plated in white opaque 384- well TC-treated plates (USA Scientific Ref # 5678-1080) at a density of 1500 cells/well using the Multidrop Combi+ (Thermo Scientific) by adding 30gL of cell mixture per well. The plates were placed in a 37°C incubator with 5% CO?, overnight to allow cell attachment. On day 1, the mRNAZLNP complex was equilibrated to room temperature, then diluted with DPBS (Gibco Ref # 14190-144) to create a dose-response curve and added to plates at a volume of 3.3pL/well. The plates were placed back in the 37°C incubator with 5% CO?, for 24 hours. On day 2, the ONE-Glo EX Luciferase Assay System (Promega Ref # E8130) was equilibrated to room temperature and combined. The plates were prepared according to Promega kit guidelines by adding 33.3p.L of reagent mixture to each well. The plates were placed on a plate shaker for 3 minutes to assure cell lysis. Once lysis was complete, the plates were added to the Luminometer (Molecular Devices) and luminescence values were obtained. ECso values were determined by fitting dose-response curve with 4-parameter logistic model using GraphPad/Prism. ECso values of the LNP formulation including one of Compounds 1, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, 17, 20-30, and R1 were determined according to Protocol 2. Experimental results are shown in Table 3 below. TABLE 3
[0193] When LNP la, 2a, 7a, 8a, 10a, 14a, 18a, 19a, 20a, 22a, 23a, 25a, 26a, 28a, 29a, or 30a was applied to HEP3B cells, the ECso value was lower than when any one of the controls LNPs (LNP Ria and LNP R2a) was applied to the same cells. When LNP 2a, 4a, 5a, 7a, 8a, 9a, 1 la, 13a, 14a, 16a, 17a, 18a, 19a, 20a, 21a, 22a, 24a, 25a, 26a, 27a, 29a, or 30a was applied to PANC-1 cells, the ECso value was lower than when any one of the controls LNPs (LNP Ria and LNP R2a) was applied to the same cells. When LNP 6a, 12a, or 15a was applied to PANC-1 cells, the E(ho value was lower than when LNP Ria was applied to the same cells.
[0194] The term “comprising” as used herein is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.
[0195] The above description discloses several methods and materials of the present invention. This invention is susceptible to modifications in the methods and materials, as well as alterations in the fabrication methods and equipment. Such modifications wall become apparent to those skilled in the art from a consideration of this disclosure or practice of the invention disclosed herein. Consequently, it is not intended that this invention be limited to the specific embodiments disclosed herein, but that it covers all modifications and alternatives coming within the true scope and spirit of the invention.
[0196] All references cited herein, including but not limited to published and unpublished applications, patents, and literature references, are incorporated herein by reference in their entirety and are hereby made a part of this specification. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material.

Claims

WHAT IS CLAIMED IS:
1. A compound of Formula I or pharmaceutically acceptable salt thereof: wherein
A1 is selected from the group consisting of: wherein the arrow indicates connection to the carbonyl group,
R1 and R2 are the same or different and are a hydrogen or a hydroxy,
R3, R5, R°, R7, R8, R9, and R10 are the same or different and are a linear Cl to C4 alkyl,
R4 is a linear Cl to C4 alkyl or — (CH2)P4 — OH, pl and p2 are the same or different and are an integer each independently selected from the group consisting of 1, 2, 3, and 4, p3 is an integer selected from the group consisting of 0, 1,
2, 3, and 4, p4 is an integer selected from the group consisting of 2, 3, and 4,
X" is a pharmaceutically acceptable counter anion, each A2 is independently a linear C4 to C10 alkyl, a linear C4 to C10 alkenyl, or a linear C4 to Cl 0 alkadienyl, m is an integer selected from the group consisting of 5, 6, 7, 8, and 9, n is an integer selected from the group consisting of 2, 3, 4, 5, and 6,
A3 is OC(O) or Ci 0)0 . and A4 is a linear C10-C18 alkyl, a linear C10-C18 alkenyl, or a linear C10-C18 alkadienyl.
The compound of claim 1, or pharmaceutically acceptable salt thereof, wherein each A2 is independently a linear C4 to C10 alkyl.
3. The compound of claim 1, or pharmaceutically acceptable salt thereof, wherein each A2 is the same.
4. The compound of claim 1 , or pharmaceutically acceptable salt thereof, wherein m is an integer selected from the group consisting of 5, 6, 7, and 8.
5. The compound of claim 1, or pharmaceutically acceptable salt thereof, wherein n is an integer selected from the group consisting of 2, 3, 4, and 5.
6. The compound of claim 1, or pharmaceutically acceptable salt thereof, wherein the number of carbon atoms in said A4 — A3 — (CHcK — is 15 to 21.
7. The compound of claim 1 , or pharmaceutically acceptable salt thereof, wherein each A2 is independently a linear C4 to C10 alkyl, m is an integer selected from the group consisting of 5, 6, 7, and 8, n is an integer selected from the group consisting of 2, 3, 4, and 5, and the number of carbon atoms in said A4 — A3 — (CHOn — is 15 to 21.
8. The compound of claim 1, wherein A’1 is selected from the group consisting of: wherein the arrow indicates connection to the carbonyl group.
9. The compound of claim I , or pharmaceutically acceptable salt thereof, wherein A1 is selected from the group consisting of:
wherein the arrow indicates connection to the carbonyl group.
10, The compound of claim 1 , or pharmaceutically acceptable salt thereof, wherein A1 is selected from the group consisting of: wherein the arrow indicates connection to the carbonyl group.
11. The compound of claim 1 , or pharmaceutically acceptable salt thereof, wherein
A1 is selected from the group consisting of: wherein the arrow indicates connection to the carbonyl group.
12. The compound of claim 1, or pharmaceutically acceptable salt thereof, wherein each A2 is independently a linear C4 to C10 alkyl, ni is an integer selected from the group consisting of 5, 6, 7, and 8, n is an integer selected from the group consisting of 2, 3, 4, and 5, the number of carbon atoms in said A4 — A3 — (CHck — is 15 to 21, and A1 is selected from the group consisting of:
wherein the arrow indicates connection to the carbonyl group.
13. The compound of claim 1, or pharmaceutically acceptable salt thereof, wherein the compound is selected from the group consisting of Compound Nos. 1 to 30 as shown in the following Table 1:
TABLE 1
14. A pharmaceutical composition, comprising: a lipid nanoparticle; and an active pharmaceutical ingredient encapsulated in the lipid nanoparticle, wherein the lipid nanoparticle comprises the compound of claim 1, or pharmaceutically acceptable salt thereof.
15. The pharmaceutical composition according to claim 14, wherein the active pharmaceutical ingredient is selected from the group consisting of siRNA, mRNA, antisense oligonucleotide, and miRNA.
16. A method of delivering an active pharmaceutical ingredient to a cell, comprising contacting the cell with the pharmaceutical composition of claim 14.
17. A method of delivering an active pharmaceutical ingredient to a subject in need thereof; comprising administering the pharmaceutical composition of claim 14 to the subject.
EP24798045.1A 2023-04-28 2024-04-26 Lipids, pharmaceutical compositions comprising the same and methods of delivering active pharmaceutical ingredients Pending EP4704907A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363499024P 2023-04-28 2023-04-28
PCT/US2024/026489 WO2024226958A2 (en) 2023-04-28 2024-04-26 Lipids, pharmaceutical compositions comprising the same and methods of delivering active pharmaceutical ingredients

Publications (1)

Publication Number Publication Date
EP4704907A2 true EP4704907A2 (en) 2026-03-11

Family

ID=93257385

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24798045.1A Pending EP4704907A2 (en) 2023-04-28 2024-04-26 Lipids, pharmaceutical compositions comprising the same and methods of delivering active pharmaceutical ingredients

Country Status (5)

Country Link
EP (1) EP4704907A2 (en)
JP (1) JP2026512548A (en)
CN (1) CN121039098A (en)
TW (1) TW202511244A (en)
WO (1) WO2024226958A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2026003582A2 (en) 2024-06-27 2026-01-02 Axelyf ehf. Lipids and lipid nanoparticles

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3083556B1 (en) * 2013-12-19 2019-12-25 Novartis AG Lipids and lipid compositions for the delivery of active agents
US10167253B2 (en) * 2015-06-24 2019-01-01 Nitto Denko Corporation Ionizable compounds and compositions and uses thereof
JP6948313B6 (en) * 2015-09-17 2022-01-14 モデルナティエックス インコーポレイテッド Compounds and compositions for intracellular delivery of therapeutic agents
US20220009878A1 (en) * 2018-10-02 2022-01-13 Intellia Therapeutics, Inc. Ionizable amine lipids

Also Published As

Publication number Publication date
WO2024226958A2 (en) 2024-10-31
WO2024226958A3 (en) 2025-02-06
JP2026512548A (en) 2026-04-16
TW202511244A (en) 2025-03-16
CN121039098A (en) 2025-11-28

Similar Documents

Publication Publication Date Title
US11690922B2 (en) Lipid compound as well as lipid carrier, nucleic acid lipid nanoparticle composition and pharmaceutical preparation containing same
EP2364085A1 (en) Releasable cationic lipids for nucleic acids delivery systems
CN116675624B (en) Lipid compound and lipid nanoparticles
EP4704907A2 (en) Lipids, pharmaceutical compositions comprising the same and methods of delivering active pharmaceutical ingredients
WO2024230844A1 (en) Cationic lipids and preparation method thereof
TW202345835A (en) Asymmetric piperazine-based cationic lipids
WO2025096940A1 (en) Lipid compounds
CN121889371A (en) Lipids and their compositions
US20040043952A1 (en) Multifunctional polyamines for delivery of biologically-active polynucleotides
WO2024222243A1 (en) Ionizable lipid for delivery of therapeutic agent and use thereof
WO2012108397A1 (en) Novel lipid
JP6980230B2 (en) New branched chain amphipathic lipids
WO2024152512A1 (en) Lipid compound for delivery of therapeutic agent, preparation method therefor and use thereof
CN118515706B (en) A phosphatidylcholine structural compound and preparation method thereof
CN120081892A (en) An ionizable cationic lipid compound and its application
WO2025153097A1 (en) Use of blank lipid nanoparticles in preparation of in-vivo delivery product
CN120078734A (en) Lipid nanoparticles for delivering nucleic acids and preparation method and use thereof
WO2025119217A1 (en) New cationic lipid compound, and preparation method therefor, composition thereof and use thereof
CN120081891A (en) An ionizable cationic lipid compound and its application
CN106432338A (en) Posaconazole derivative, synthesis and application in prolonged action preparation thereof
WO2024211865A2 (en) Lipids and lipid-like compounds for therapeutic lipid nanoparticle (lnp) delivery
CN120227354A (en) Lipid nanoparticles for delivering nucleic acids and preparation method and use thereof
CN120230169A (en) Ionizable cationic lipid compound and application thereof
WO2025194409A1 (en) Ionizable cationic lipid compounds for delivery system and uses thereof
WO2026000082A1 (en) Ionizable lipids with modified head groups for the delivery of nucleic acids and other therapeutic agents

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20251128

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR