EP4695300A2 - Antibodies and conjugates against prostaglandin f2 receptor inhibitor and uses thereof - Google Patents
Antibodies and conjugates against prostaglandin f2 receptor inhibitor and uses thereofInfo
- Publication number
- EP4695300A2 EP4695300A2 EP24789289.6A EP24789289A EP4695300A2 EP 4695300 A2 EP4695300 A2 EP 4695300A2 EP 24789289 A EP24789289 A EP 24789289A EP 4695300 A2 EP4695300 A2 EP 4695300A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- antibody
- ptgfrn
- variable region
- cells
- chain variable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
- G01N33/5759—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites involving compounds localised on the membrane of tumour or cancer cells
Definitions
- the present disclosure relates to fully human antibodies and related molecules that bind to Prostaglandin F2 Receptor Inhibitor (PTGFRN).
- PTGFRN Prostaglandin F2 Receptor Inhibitor
- the present disclosure also relates to molecules comprising, or alternatively consisting of, full-length antibodies, antibody fragments or variants thereof.
- the present disclosure further relates to the amino acid and nucleic acid sequences coding for such antibodies.
- the present disclosure also relates to antibodies against PTGFRN (anti-PTGFRN antibodies) and, in some especially preferred embodiments, antibody conjugates (e.g., antibody-drug conjugates or immunoconjugates) comprising the anti-PTGFRN antibodies, compositions comprising the anti- PTGFRN antibodies, and methods for using the anti-PTGFRN antibodies, and their conjugates for treating conditions associated with PTGFRN expression (e.g., cancer).
- the disclosure further comprises the use of said antibodies, antigen-binding fragment thereof, or antibody-drug conjugates and corresponding processes, for detecting and diagnosing pathological disorders associated with expression of PTGFRN.
- the disclosure finally comprises products and/or compositions or kits comprising at least such antibody or antibody-drug conjugate for the prognosis or diagnostic or therapy monitoring of such disorders.
- PTGFRN Prostaglandin F2 receptor negative regulator
- Tetraspanins are proteins which bind and interact with each other, and with multiple partners, forming what is knowns the “tetraspanin web”.
- This “web” and its members serve as signalling molecules for a wide range of processes, such as fertilization (Glazar, et al. Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: Evidence of distinct functions for CD9 and a CD9- associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 2009;21(2):293- 303; Sdorf et al.
- PTGFRN has been observed to affect extracellular vesicle bioactivity (Xu et al. Human perivascular stem cell-derived extracellular vesicles mediate bone repair. Elife. 2019;8: 1-23), non-alcohol fatty liver disease (Hotta et al. Identification of the genomic region under epigenetic regulation during non-alcoholic fatty liver disease progression. Hepatol Res. 2018;(48):320-34), and Alzheimer’s disease (Gerber et al. The APMAP interactome reveals new modulators of APP processing and beta-amyloid production that are altered in Alzheimer’s disease. Acta Neuropathol Commun. 2019;7(l): 13).
- Tetraspanins are the basis for complexes known as Tetraspanin-Enriched Microdomains (TEMs).
- TEMs have been found to facilitate signalling in many different cellular pathways by acting as scaffolds for protein interaction and/or stabilization (Mazzocca et al. Tetraspanin-enriched microdomains and hepatocellular carcinoma progression. Cancer Lett [Internet], 2014;351(1):23— 9 available from: http://dx.doi.Org/10.1016/j.canlet.2014.05.016; Yauch et al.
- PTGFRN expression is increased in metastatic cancer cells (Karhemo et al. An optimized isolation of biotinylated cell surface proteins reveals novel players in cancer metastasis. J Proteomics [Internet], 2012;77:87-100. Available from: http://dx.doi.org/10.1016/jjprot.2012.07.009). Moreover, PTGFRN expression is associated with biological functions that play important roles in tumor development. Aguila et al. showed that PTGFRN was overexpressed in glioblastoma, and higher expression of PTGFRN in tumors correlated with worse survival (Aguila et al.
- the Ig superfamily protein PTGFRN coordinates survival signaling in Glioblastoma multiforme. Cancer Lett. 2019;462(April):33-42). This laboratory has found by immunohistochemistry analysis of paraffin embedded mesothelioma lesions using an anti- PTGFRN antibody developed in this laboratory' and disclosed herein that PTGFRN expression was negative in normal pleura and increased in tumors proceeding from benign to malignant sessions (see, e.g., Fig. 1).
- PTGFRN was found to be essential for angiogenesis, a necessary process in tumor growth (Colin et al. Br J Cancer. 2011; 105(7): 1002— 11). It has also been shown that PTGFRN can be internalized, and to connect the upregulation of PTGFRN to the ability to target cancer cells through an antibody- drug conjugate (ADC) (Marquez, et al. PLoS One 16(1): e0246197). Given that PTGFRN is upregulated in metastatic cancers, developing an antibody which could be used as-is or as an antibody drug conjugate (ADC) would be beneficial as a potential targeted therapy.
- ADC antibody- drug conjugate
- ADCs antibody drug conjugates
- ADCs are a combination of biological and small-molecule drugs that have recently received increased interest as therapeutic choices in oncology.
- ADCs are composed of a monoclonal antibody (mAb), which specifically binds to a cell surface target, a linker, and a cytotoxic payload. After binding to its cell-surface antigen, the mAb induces endocytosis of said antigen, shuttling the toxic payload inside the cell.
- mAb monoclonal antibody
- the toxic payload is released from the mAb via a cleavable linker, and exits the lysosome either before or during proteolysis (Tsuchikama, et al. Antibody-drug conjugates: recent advances in conjugation and linker chemistries. Protein Cell. 2018;9(1):33— 46).
- the payload cannot enter the cytosol until after the lysosome fully degrades, at which point it is then free to perform its anti-cancer effect (Jain et al. Current ADC Linker Chemistry. Pharm Res. 2015;32(11 ):3526— 40).
- ADCs with non-radioactive conjugates that still rely on extracellular cleavage of their linker, which allows for the diffusion of the cleaved drug across the cell.
- ADC Troveldy (Sacituzumab govitecan) operates in just such a manner (Cardillo et al. Clin Cancer Res. 2011; 17(10):3157 -69).
- An ADC approved for solid tumor-targeting is Kadcyla, or T-DM1 (Diamantis, et al. Br J Cancer 2016; 114(4):362— 7) to treat HER-2 overexpressing breast cancer.
- Trastuzumab which has been originally approved by the FDA as an unconjugated therapeutic antibody for the treatment of HER2 overexpressing breast cancer.
- Trastuzumab is conjugated to emtansine via a non-reducible thioether linker.
- T-DM1 Once T-DM1 enters the cell, emtansine binds tubulin, it leads to cell death by mitotic arrest (Teicher, et al. The Promise of Antibody-Drug Conjugates. N Engl J Med. 2012;367(19): 1847- 8).
- T-DM1 has been reported to be more potent than Trastuzumab.
- HER- 2-positive cancer patients treated with T-DM1 have a 3-year disease-free survival rate of 88.3%, compared to 77% in patients treated with Trastuzumab (Von Minckwitz et al. Trastuzumab Emtansine for Residual Invasive HER2 -Positive Breast Cancer. N Engl J Med. 2018;380(7):617).
- the newest generation in HER2-targeting ADCs, Trastuzumab deruxtecan shows great effect even in patients whose HER2 expression was immunohistologically scored as lower than 3+ and considered “HER2 negative”(Modi, et al. (2022).
- ADCs include, for example, rentuximab Vedotin, which targets CD30/TNFRSF8; Gemtuzumab Ozogamici which targets CD33/SIGLEC-3; Inotuzumab ozogamicin, which targets CD22; polutuzumab vedotin-piiq, which targets CD79b; Enfortumab vedotin, which targets Nectin-4; and, Belantamab mafodotin, which targets CD269.
- FIG. 1 PTGFRN expression by immunohistochemistry (IHC) in paraffin- embedded lung (normal, Fig. 1A) and mesothelioma (benign, Fig. IB; malignant, Fig. 1C) tissues using an anti-PTGFRN mouse monoclonal antibody [(1B4??)] for staining. Tissue microarrays were stained using the IHC antibody 1B4 to assess expression level of PTGFRN. Healthy non-cancerous tissue, such as colon (Fig. ID), breast (Fig. IE), lung (Fig. IF), kidney (Fig. 1G), prostate (Fig. 1H), and spleen (Fig.
- IHC immunohistochemistry
- Fig. 1J cancerous tissue samples from squamous cell carcinoma
- Fig. IK cancerous tissue samples from squamous cell carcinoma
- Fig. IK pancreatic duct adenocarcinoma
- Fig. IM papillary renal cell carcinoma
- Fig. IN clear cell carcinoma
- FIG. 2 PTGFRN expression level after transfection of shRNA or PTGFRN cDNA.
- FIG. 3 Flow Cytometry Analysis of PTGFRN expression level after transfection of shRNA or PTGFRN cDNA.
- Flow cytometry analysis using the anti- PTGFRN antibody 8C7 confirms that PTGFRN expression was significantly decreased after shRNA transfection in (A) Control shRNA A431, (B and C) A431 shRNAl and shRNA2, (D) Control shRNA DAOY, (E and F) DAOY shRNAl and shRNA2.
- FIG. 5 Effect of PTGFRN expression on migration capability.
- A PTGFRN silencing via shRNA in A431 and DAOY cells results in a significant reduction in cell migration, while
- B overexpressing PTGFRN in MSTO-211H cells resulted in a significant increase in migration levels.
- FIG. 7 Knockdown of PTGFRN expression inhibits spheroid formation.
- Fig. 7C. PTGFRN shRNA transfected A431 cells grown in spheroid culture conditions did not show increase in Integrin ⁇ 1 and E. Cadherin levels seen in control shRNA spheroids. This decrease in E. Cadherin and Integrin ⁇ 1 after PTGFRN knockdown was not seen in cells grown in 2D culture conditions. Relative increase or decrease in expression was estimated using commercial quantitative software, normalized to GAPDH expression. Data are presented as mean ⁇ SD (n 3).
- FIG. 8 Co-localization of PTGFRN, E. Cadherin, and Integrin ⁇ 1.
- Immunofluorescence using specific antibodies show that E. Cadherin (Green) (Fig. 8A), PTGFRN (Red) (Fig. 8B), and Integrin ⁇ 1 (Purple) (Fig. 8C) co-localize together in the cell junction areas (Pink).
- FIG. 9A Effect of siRNA Knockdown on Expression Level of Other Proteins. siRNA knockdown of E. Cadherin and Integrin ⁇ 1 has no effect on the expression of PTGFRN (Fig. 9A).
- siRNA knockdown of PTGFRN and Integrin ⁇ 1 has no effect on the expression of E. Cadherin (Fig, 9B).
- siRNA knockdown of PTGFRN has no effect on the expression of Integrin ⁇ 1, while E. Cadherin expression seems to slightly increase after siRNA knockdown of Integrin ⁇ 1 (Fig. 9C).
- FIG. 11 Mass Spectrometric Proteome Analysis after PTGFRN Knockdown. Heat map displaying the top 20 cellular processes upregulated after PTGFRN knockdown based on upregulated protein expression (Fig. 11 A), and the top 20 cellular processes downregulated after PTGFRN knockdown based on downregulated protein expression (Fig. 11B). Statistical significance was determined by Student T-test analysis. All results shown meet threshold of p ⁇ 0.05.
- FIG. 12 Enriched Biological Processes / Pathways after PTGFRN Knockdown.
- FIG. 13 A431 cells were preincubated for 6 hours with 10ug/ml of either hlgG, non-internalizing anti-PTGFRN 3G3, or internalizing 8C7 before being detached and evaluated for migration by the transwell assay.
- FIG. 14 Flow cytometric analysis using the 8C7 antibody.
- FIG. 15 Internalization of PTGFRN by 8C7. Binding of 8C7 antibody to PTGFRN induces endocytosis of the receptor. Incubation with 8C7 (Green) at 37°C for Time 0 (Fig. I 5A), three (3) hours (Fig. I 5B), and five (5) hours (Fig. I 5C). Hoechst 33342 was used to counterstain nuclei (Blue); 60X Magnification.
- FIG. 16 Effect of selected fully human anti-PTGFRN antibodies on A431 cell proliferation and viability.
- FIG. 17 Effect of 8C7-Duocarmycin and 4F8-Duocarmycin conjugates on the proliferation and viability on several cell lines.
- FIG. 18 Effect of increasing concentrations of 6B2-duocarmycin conjugate on A431 proliferation and viability.
- FIG. 20 Administration of fully human anti-PTGFRN 8C7-Duocarmycin antibody drug conjugate inhibits in a dose-dependent fashion the tumor growth of the three human cancer cell lines A431 (Fig. 20A-B), MSTO-211H (Fig. 20C-D), and DAOY (Fig. 20E-F).
- FIG. 21 Western Blot analysis of PTGFRN expression in seven head neck cancer in patient derived tumors. 30 ⁇ g of seven different PDX tumor lysates were analyzed by SDS-PAGE electrophoresis followed by transfer onto PVDF membrane for western blot analysis using anti-PTGFRN antibody. As positive control, 30 ug of A431 cell lysates were analyzed. The expression of GAPDH was used as an internal standard for equal loading.
- FIG. 22 Effect of 8C7-ADC compared to isotype control ADC on the growth of patient-derived Head and Neck tumors in NRG mice.
- Female NRG mice were implanted with head and neck tumors JZ0628. When tumors reached 100 mm 3 , the mice were randomized into two experimental groups, the first group receiving once weekly ip (intraperitoneal) for 44 days isotype control duocarmycin ADC and the second group receiving 8C7-duocarmycin ADC.
- FIG. 23 Long term effect of 8C7-ADC on H/N tumor growth after stopping treatment. On day 44, the 8C7 treatment was stopped in the 8C7-ADC group and mice were maintained under observation for an additional 15 days to determine tumor growth.
- FIG. 24 In Vivo Treatment of PTGFRN -Negative Tumors in Nude Mice. Treatment of nude mice bearing PTGFRN-negative MDA-MB-231 tumors with our 8C7- Duocarmycin antibody shows no difference in tumor growth compared to Control ADC, with no obvious signs of toxicity, indicating high specificity of our 8C7 antibody.
- FIG. 25 Exemplary 4F8-IgG(VH) antibody amino acid and nucleotide sequences.
- FIG. 26 Exemplary 4F8-IgK(VL) antibody amino acid and nucleotide sequences.
- FIG. 27 Exemplary 6B2-IgG (VH) antibody amino acid and nucleotide sequences.
- FIG. 28 Exemplary 6B2-IgK (VL) antibody amino acid and nucleotide sequences.
- FIG. 29 Exemplary 8C7-IgG (VH) antibody amino acid and nucleotide sequences.
- FIG. 30 Exemplary 8C7-IgK (VL) antibody amino acid and nucleotide sequences.
- FIG. 31 Exemplary 12D8 -l-lgG (VH) antibody amino acid and nucleotide sequences.
- FIG. 32 Exemplary 12D8- I-lgK(VL) antibody amino acid and nucleotide sequences. SUMMARY OF THE DISCLOSURE
- This disclosure relates to and provides isolated antibodies, antigen binding fragments, and/or derivatives thereof, the antibodies being antibodies 4F8, 6B2, 8C7, or 12D8, the antibodies comprising: a) a heavy chain variable region comprising the complementarity determining region (CDR) sequences shown in any of Tables 1-13 (optionally in some preferred embodiments including the framework (FR) amino acid sequences thereof); or a derivative of any one of the above, optionally wherein said derivative comprises one to four amino acid substitutions in at least one CDR thereof; wherein the antibody or derivative thereof specifically binds to human Prostaglandin F2 Receptor Inhibitor (PTGFRN).
- CDR complementarity determining region
- FR framework
- PTGFRN Prostaglandin F2 Receptor Inhibitor
- this disclosure provides antibody -drug conjugates (ADCs) of the same.
- ADCs antibody -drug conjugates
- Polynucleotides and host cells comprising such polynucleotides are also provided.
- Other embodiments are also provided as will be apparent to those of ordinary skill in the art from this disclosure.
- PTGFRN prostaglandin F2 receptor inhibitor
- CD91P1 CD9 partner 1
- EWIF Glu-Trp-Ile EWI motif-containing protein F
- FPRP Glu-Trp-Ile EWI motif-containing protein F
- KIAA1436 Prostaglandin F2 receptor negative regulator
- Prostaglandin F2-alpha receptor regulatory protein Prostaglandin F2-alpha receptor regulatory protein
- prostaglandin F2-alpha receptor-associated protein among others.
- Such antibodies, antigen-binding fragments, and derivatives thereof may be attached to one or more functional (or effector) moieties (e.g., detectable moieties, cytotoxic moieties, etc.).
- the disclosure also includes the amino acid sequences of the variable heavy and light chain of the antibodies and their corresponding nucleic acid sequences.
- an antibody of the disclosure may be a monoclonal antibody.
- the present disclosure provides an isolated antibody or an antigen binding fragment thereof that specifically binds to Prostaglandin F2 Receptor Inhibitor (PTGFRN) and is internalized.
- PTGFRN Prostaglandin F2 Receptor Inhibitor
- this disclosure provides experiments using cell lines overexpressing PTGFRN by the non-limiting techniques of PTGFRN cDNA transfection or inhibition of PTGFRN expression by SiRNA or Sh RNA transfection. These experiments demonstrated that PTGFRN expression was associated with the ability to proliferate in low- serum conditions, and to form colonies at low cell density, migrate through the transwell, and form spheroids in three-dimensional culture conditions. Since these are hallmarks and characteristic of cancer stem cells, this indicates that PTGFRN is a marker of and/or is associated with cancer stem cell phenotype. It is known that therapeutic development targeting proteins involved with cancer stem cell phenotype will provide powerful therapeutic solutions to address drug resistance caused by the maintenance of cancer stem cells that are not eliminated by standard of care therapies. This makes targeting PTGFRN important since its expression is associated or directly involved in cancer stem cells.
- this disclosure provides information about the direct development of fully human monoclonal antibodies to PTGFRN.
- the advantage of this strategy is that it bypasses the need to humanize mouse monoclonal antibody or to affinity mature by phage display antibodies. These processes are time consuming and cumbersome, and may bring changes to antibody affinity, structure or sequences leading to a decreased efficacy and an increased risk of immunogenicity when administered to patients.
- this disclosure provides for the use of human antibody producing mice (TC-mAb TM mice).
- the present disclosure provides an antibody or antigen- binding fragment thereof that specifically binds to the same Prostaglandin F2 Receptor Inhibitor (PTGFRN) epitope as an antibody selected from the group consisting of those comprising any combination of the complementarity determining regions (CDRs) of each of the antibodies referred to herein as 4F8, 6B2, 8C7, and 12D8 are shown in Table 1, as well as in Figs. 6-13 (alternate (“ALT”) CDRs, meaning not necessarily identified by the Kabat or Chothia methods), as well as the nucleotide coding sequences therefor.
- the framework and CDR sequences are also presented in Tables 2-13, as well as the nucleotide coding sequences therefor.
- any of the CDRs presented herein, or any determined by any other known method in the art from the VH and VL amino acid polypeptide and preferred nucleotide sequences of the respective antibodies are contemplated by this disclosure. Variants and derivatives of the same are also contemplated as discussed herein.
- the present disclosure provides an antibody or antigen- binding fragment thereof that specifically binds to Prostaglandin F2 Receptor Inhibitor (PTGFRN), wherein said antibody or fragment thereof competitively inhibits an antibody shown above as determined using any standard competitive binding assay.
- PTGFRN Prostaglandin F2 Receptor Inhibitor
- the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to Prostaglandin F2 Receptor Inhibitor (PTGFRN); the antibody or fragment thereof comprises a heavy chain variable region (VH) and light chain variable region (VL) of the 4F8, 6B2, 8C7, and 12D8 antibodies; the VH and VL comprise complementarity determining regions CDR1, CDR2, and CDR3 the 4F8, 6B2, 8C7, and 12D8 antibodies; the VH-CDR1, VH-CDR2, and VH-CDR3 and the VL-CDR1, VL-CDR2, and VL-CDR3 the 4F8, 6B2, 8C7, and 12D8 antibodies, and/or comprising 1, 2, 3, or 4 conservative amino acid substitutions providing binding to PTGFRN is substantially maintained; and/or, the antibody or antigen-binding fragment thereof of the present disclosure comprises polypeptide sequences that are at least 90%, 95%, 99%, or 100% identical to polypeptide sequence
- a nucleic acid molecule encoding one or more antibodies described herein may be inserted into one or more expression vectors, as discussed below in greater detail.
- the antibody may be encoded by nucleotides corresponding to the amino acid sequence.
- the particular combinations of nucleotides (codons) that encode the various amino acids (AA) are well known in the art, as described in various references used by those skilled in the art (e.g., Lewin, B. Genes V, Oxford University Press, 1994).
- the nucleotide sequences encoding the amino acids of said antibodies may be ascertained with reference to Table 15, for example. Nucleic acid variants may use any combination of nucleotides that encode the antibody. Table 15
- the antibody or antigen binding fragment thereof (which may collectively be referred to herein as “antibody” or “antibodies”) is internalized.
- the antibody or antigen binding fragment thereof murine, human, humanized, or chimeric.
- the antibody or antigen binding fragment thereof is CDR- grafted, recombinant, or resurfaced.
- the antibody or antigen binding fragment thereof further comprises human or human-derived heavy and light chain variable region frameworks.
- the antibody or antigen binding fragment thereof comprises an IgGl or IgG2 constant region.
- the antibody or antigen binding fragment thereof is capable of inhibiting cell proliferation and inducing cell death.
- the antibody or antigen binding fragment thereof binds to human PTGFRN. In some preferred embodiments, the antibodies and/or derivatives thereof inhibit one or more cellular functions of PTGFRN including but not limited to migration and cell proliferation. In some embodiments, the antibody or antigen binding fragment thereof binds to murine PTGFRN. In some embodiments, the antibody is a full-length antibody. In some embodiments, it is an antigen binding fragment.
- the antibody or antigen binding fragment thereof comprises a Fab, Fab', F(ab')2, Fd, single chain Fv or scFv, disulfide linked Fv, V-NAR domain, IgNar, intrabody, IgGACH2, minibody, F(ab')3, tetrabody, triabody, diabody, single-domain antibody, DVD-Ig, Fcab, mAb2, (scFv)2, or scFv-Fc.
- the present disclosure further provides an antibody conjugate of the formula: Ab- L-M, wherein: (a) Ab is an antibody or antigen binding fragment thereof that specifically binds to PTGFRN; (b) L is a linker; and (c) M is a functional moiety.
- the Ab in the antibody conjugate is an antibody or antigen binding fragment thereof disclosed herein.
- the M in the antibody conjugate is selected from the group consisting of a cytotoxic reagent, an immunomodulating agent, an imaging agent, a therapeutic protein, a biopolymer, ionizing agent, radioisotope and an oligonucleotide.
- the M is a cytotoxic reagent.
- cytotoxic reagents may be used as M, either conjugated to the same antibody or as a combination of antibodies (ADCs) that each comprise one or more different cytotoxic reagents.
- the cytotoxic reagent is selected from the group consisting of an anthracycline, an auristatin, a camptothecin, a combretastain, a dolastatin, a duocarmycin, an enediyne, a geldanamycin, an indolino-benzodiazepine dimer, a maytansine, a puromycin, a pyrrolobenzodiazepine dimer, a taxane, a vinca alkaloid, a tubulysin, a hemiasterlin, a spliceostatin, a pladienolide, and calicheamicin.
- the cytotoxic reagent is selected from monomethyl auristatin E, monomethyl auristatin F, maytansinoid DM1, maytansinoid DM4, calicheamicin, ozogamicin, ⁇ -amanitin, yttrium-90, and iodine-131, topoisomerase inhibitor (e.g., exatecan, deruxtecan), DNA replication inhibitor and/or a DNA repair inhibitor.
- the linker in the antibody conjugate is selected from the group consisting of a cleavable linker, a non-cleavable linker, a hydrophilic linker, and a dicarboxylic acid-based linker.
- the antibody conjugate provided in the present disclosure binds PTGFRN and is internalized.
- the present disclosure further provides a pharmaceutical composition
- a pharmaceutical composition comprising a therapeutically effective amount of the antibody or antigen binding fragment thereof, or the antibody conjugate encompassed by the disclosure, and a pharmaceutically acceptable carrier.
- a method for treating a disorder associated with PTGFRN function or expression in a subject comprising administering to a subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
- the disorder is a cancer.
- the present disclosure also provides a method for decreasing or inhibiting tumor growth or progression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
- the present disclosure further provides a method for decreasing or inhibiting metastasis of PTGFRN-expressing cancer cells in a subject, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
- the present disclosure provides a method for inducing tumor regression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
- the present disclosure also provides a method for imaging a cell, comprising (1) contacting the cell with the antibody or antigen binding fragment thereof or the antibody conjugate encompassed by the disclosure; and (2) detecting the antibody or antigen binding fragment thereof or the conjugate.
- the present disclosure also provides a method for identifying the expression of PTGFRN in a tumor, comprising (1) obtaining a sample of the tumor, (2) contacting the sample with the antibody or antigen binding fragment thereof or the antibody conjugate encompassed by the disclosure; and (3) detecting the antibody or antigen binding fragment thereof or the conjugate.
- the detecting is by immunochemistry.
- the present disclosure also provides a method for preventing tumor regrowth in a subject who has, or has had, a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
- the present disclosure also provides a method for ameliorating symptoms in a subject who has, or has had, a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
- a diagnostic reagent comprising the antibody or antigen binding fragment thereof of the present disclosure.
- the antibody or antigen binding fragment thereof is labeled.
- the label is selected from the group consisting of a radiolabel, a fluorophore, a chromophore, an imaging agent and a metal ion.
- the present disclosure also provides a kit comprising the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
- the disclosure also provides an isolated polynucleotide.
- the polynucleotide comprises a sequence that encodes a polypeptide at least 90%, 95%, 99%, or 100% identical to a sequence selected from those shown herein.
- the polynucleotide comprises a sequence that is at least 90%, 95%, 99%, or 100% identical to those shown herein.
- the disclosure also provides a vector comprising the polynucleotide, and/or a host cell comprising the vector thereof.
- the present disclosure includes use of the complementary determining region (CDR) sequences of the antibodies of the disclosure to obtain binding molecules that bind PTGFRN.
- CDR complementary determining region
- Such binding molecules typically comprise one or more CDR regions, or CDR-derived regions, of an antibody of the disclosure.
- the disclosure provides antibody-drug conjugates (ADCs) comprising the anti-PTGFRN antibodies disclosed herein.
- ADCs antibody-drug conjugates
- the disclosure comprises the use of anti-PTGFRN antibody, antigen-binding fragments thereof, and antibody-drug conjugates and corresponding processes, for detecting and diagnosing disorders associated with expression or function of PTGFRN.
- the disclosure comprises products and/or compositions or kits comprising at least one such antibody, antigen binding fragment, or antibody-drug conjugate for the prognosis or diagnostic or therapy monitoring of certain cancers.
- the present disclosure provides pharmaceutical compositions comprising an anti-PTGFRN antibody, antigen binding fragment thereof, or antibody-drug conjugate, disclosed herein and a pharmaceutically acceptable carrier.
- the present disclosure provides a method for treating cancer that expresses PTGFRN in a subject.
- Such methods may comprise administering to the subject a composition comprising an anti-PTGFRN antibody, or an antigen binding fragment thereof.
- anti-PTGFRN antibodies and/or fragments are conjugated via a linker to a functional moiety comprised of cytotoxic payload.
- the conjugates may be administered in an amount sufficient to prevent, reduce or inhibit the growth of the subject's cancer (and/or tumor).
- the anti-PTGFRN antibody or antigen binding fragment comprises: (a) three heavy chain complementarity determining regions (VH CDR1, VH CDR2, and VH CDR3) comprising the amino acid sequences of the 4F8, 6B2, 8C7, and 12D8 antibodies; and (b) three light chain complementarity determining regions (VL CDR1, VL CDR2, and VL CDR3) comprising amino acid sequences the 4F8, 6B2, 8C7, and 12D8 antibodies; and/or derivatives thereof (see, e.g., Tables 1-15).
- Any cancer that expresses PTGFRN may be treated using the antibodies, compositions, and/or methods of this disclosure. Cancer cells and/or tissue and/or bodily fluid expressing PTGFRN can be measured by measuring PTGFRN protein expression in cancer tissue using an anti-PTFRN antibody or measuring PTGFRN DNA or RNA expression.
- an antibody conjugate of the disclosure may comprise a functional moiety M that may be a cytotoxic reagent, an immunomodulating agent, an imaging agent, a therapeutic protein, a biopolymer, or an oligonucleotide.
- M may be a drug, in particular one that can be used to treat cancer.
- M can be any cytotoxic reagent that can be used in an ADC. Any cytotoxic reagent known to those skilled in the art may be used in the practice of the disclosure, such as enzymes, toxins, peptides, and anthracy clines.
- M can be one or more reagents that cause a decrease in cell growth and/or cell death, block DNA replication, DNA repair, protein synthesis (any of which are considered cytotcytotoxic).
- M can be any nucleoside antagonist (e.g., 5-fluorouracil, 6-mercaptopurine, arabinosylcytosine, capecitabine, clofarabine, cytarabine, dacarbazine, fludarabine, gemcitabine, and nelarabine), any intercalating agent (e.g., oxaliplatin, cisplatin, and carboplatin), any microtubule assembly inhibitor (e.g., auristatins, monomethyl auristatin E, monomethyl auristatin F, taxanes, docetaxel, paclitaxel, ixabepilone, vinca alkaloids, vindesine, vincristine, vinorelbine, vinblastine
- nucleoside antagonist e.g
- M is selected from the group consisting of, a therapeutic agent, a cytotoxic reagent, abrin A chain, an anthracycline, an amantin (a- amanitin), an auristatin (e.g., monomethyl auristatin E, monomethyl auristatin F), a calicheamicin, camptothecin, a combretastain, crotin, a cryptophycin, curcin, a dolastatin, a duocarmycin, a DNA alkylating agent, DNA repair inhibitor, a duocarmycin, an enediyne, exatecan or a derivative thereof (e.g., DX-8951), exotoxin A chain, deruxtecan, diphtheria A chain, enomycin, a geldanamycin, a hemiasterlin, an inhibitor of ataxia telangiectasia and Rad3 related kinase (A)
- Antibodies or antigen binding fragments thereof suitable for use in methods of the disclosure include, but are not limited to, human antibodies or antigen binding fragments thereof, humanized antibodies or antigen binding fragments thereof, CDR-grafted antibodies or antigen binding fragments thereof, and chimeric antibodies or antigen binding fragments thereof.
- the anti-PTGFRN antibody may comprise human or human- derived heavy and light chain variable region frameworks (which can be part of a bi-specific antibody or other type of target antibody).
- antibodies of the disclosure may comprise a heavy chain variable region that comprises one or more of the amino acid sequences of the 4F8, 6B2, 8C7, and 12D8 antibodies, and/or derivatives thereof.
- An antibody or antigen binding fragment suitable for forming an antibody conjugate of the disclosure may be a humanized, chimeric, CDR grafted, or recombinant human antibody. The antibody is preferably a fully human antibody.
- the disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of an antibody or antigen binding fragment thereof of the disclosure or an antibody conjugate of the disclosure and a pharmaceutically acceptable carrier.
- the disclosure provides a method for treating a disorder associated with PTGFRN function or expression in a subject comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- Disorders that may be treated include cancer.
- the disclosure provides a method for decreasing or inhibiting tumor growth or progression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the disclosure provides a method for decreasing or inhibiting metastasis of PTGFRN-expressing cancer cells in a subject, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the disclosure provides a method for inducing tumor regression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the disclosure provides a method for preventing tumor regrowth in a subject who has had a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the present disclosure provides a method for ameliorating symptoms in a subject who has, or has had, a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the disclosure provides a method for imaging a cell, comprising contacting the cell with an antibody or antigen binding fragment thereof of the disclosure or an antibody conjugate of the disclosure; and detecting the antibody or antigen binding fragment thereof or the antibody conjugate.
- the disclosure provides a method for determining PTGFRN expression in tissues comprising contacting the tissue with an antibody or antigen binding fragment thereof of the disclosure or an antibody conjugate of the disclosure; and detecting the antibody or antigen binding fragment thereof or the antibody conjugate.
- the present disclosure provides antibodies and antibody conjugates (e.g., antibody- drug conjugates) that bind to PTGFRN (e.g., human PTGFRN, mouse PTGFRN, cygno PTGFRN).
- PTGFRN e.g., human PTGFRN, mouse PTGFRN, cygno PTGFRN
- PTGFRN e.g., human PTGFRN, mouse PTGFRN, cygno PTGFRN
- the disclosure also provides polynucleotides encoding the 4F8, 6B2, 8C7, or 12D8 antibody, compositions comprising antibodies of the disclosure, and methods of making and using these antibodies.
- antibodies of the disclosure comprise all or a portion of the variable regions of the particular heavy and light chain sequences disclosed herein.
- antibodies of the disclosure comprise the amino acid sequence of one or more of the CDR regions disclosed herein.
- the present disclosure further comprises methods for using antibodies of the disclosure, for example, to detect PTGFRN, to modulate PTGFRN activity and/or for targeting to PTGFRN expressing cells for killing (e.g., ADCs) (such as for treating and/or preventing cancer).
- the methods can be and/or include methods for determining PTGFRN expression in cells and/or tissues to determine the cells, tissues, and/or cancer types that would be susceptible to treatment with an anti-PTGFRN antibody ADC conjugate.
- the determining step can be by detecting and measuring the expression of RNA or protein encoding PTGFRN proteins in a cell and/or tissue.
- Prostaglandin F2 receptor inhibitor is known by several names in the art, for example, FPRP; CD315; EWI-F; CD9P-1; SMAP-6, KIAA1436, Prostaglandin F2- Alpha Receptor Regulatory Protein, Prostaglandin F2-Alpha Receptor-Associated Protein, Prostaglandin F2 Receptor Negative Regulator, Glu-Trp-Ile EWI Motif-Containing Protein F.
- PTGFRN has the following accession numbers: UniProt Q9P2B2, Entrez Gene ID: 5738, Ensemble: ENSG00000134247, OMIM: 601204, and HGNC: 9601.
- antibody refers to an immunoglobulin molecule capable of recognizing and binding to a specific target or antigen.
- Antibodies of the disclosure typically comprise at least one antigen recognition site, located in the variable region of the immunoglobulin molecule.
- Antibodies of the disclosure may be monoclonal antibodies, polyclonal antibodies, and antigen binding fragments thereof that retain the ability to specifically bind to PTGFRN.
- antibodies of the disclosure may be single chain (ScFv) and single domain antibodies (e.g., shark and camelid antibodies).
- Antibodies of the disclosure may be humanized antibodies, chimeric antibodies, or fully human antibodies.
- Fully human antibodies have no murine sequence (see, e.g., adalimumab (Humira), panitumumab (Vectibix), golimumab (Simponi)). Fully human antibodies can, for example, be prepared using transgenic mice (as in the Examples herein), phage display, B cell cloning, phage display, and/or other techniques available to those of skill in the art. Antibodies of the disclosure may be from any source known to those skilled in the art, for example, antibodies of the disclosure may be of murine, rat, camel, human, or any other origin or may be synthesized.
- antibody encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, and Fv fragments, all of which would be antigen binding fragments), single chain Fv (scFv) mutants, fully human antibodies, multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen determination portion of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site so long as the antibodies exhibit the desired biological activity.
- antibody fragments such as Fab, Fab', F(ab')2, and Fv fragments, all of which would be antigen binding fragments
- single chain Fv (scFv) mutants fully human antibodies
- multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen determination portion of an antibody, and any other modified immunoglobulin molecule comprising an anti
- An antibody can be of any the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2), based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively.
- the different classes of immunoglobulins have different and well-known subunit structures and three-dimensional configurations.
- Antibodies can be naked or conjugated to other molecules such as toxins, radioisotopes, etc.
- antibodies of the disclosure may be humanized antibodies conjugated to drug molecules.
- the antibody can be a “naked” antibody, i.e., an antibody that is not conjugated to a cytotoxic moiety.
- the antibody can be antibody-drug conjugate (ADC), i.e., an antibody that is conjugated to a cytotoxic moiety.
- ADC antibody-drug conjugate
- a “naked” antibody or an ADC can be used, in preferred embodiments to treat and/or prevent cancer.
- a “naked” antibody and an ADC can be used in combination (in the same or different compositions, administered essentially simultaneously or not), in preferred embodiments, to treat and/or prevent cancer.
- antibodies of the disclosure may be humanized.
- humanized antibody refers to forms of non-human (e.g., murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences.
- humanized antibodies are human immunoglobulins in which residues from the complementary determining region (CDR) are replaced by residues from the CDR of a non-human species (e.g., mouse, rat, rabbit, hamster) that have the desired specificity, affinity, and capability (Jones et al., 1986, Nature, 321 :522-525; Riechmann et al., 1988, Nature, 332:323-327; Verhoeyen et al., 1988, Science, 239: 1534-1536).
- the Fv framework region (FR) residues of a human immunoglobulin are replaced with the corresponding residues in an antibody from a non-human species that has the desired specificity, affinity, and capability.
- the humanized antibody can be further modified by the substitution of additional residues either in the Fv framework region and/or within the replaced non-human residues to refine and optimize antibody specificity, affinity, and/or capability.
- the humanized antibody will comprise substantially all of at least one, and typically two or three, variable domains containing all or substantially all of the CDR regions that correspond to the non-human immunoglobulin whereas all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
- the humanized antibody can also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Humanization may be by any method known in the art, for example, using the methods disclosed in Jones et al.
- an antibody is humanized by replacing all or a portion of one or more of the CDRs of a human antibody with all or a portion of one or more of the CDRs of a non-human antibody of the disclosure.
- U.S. Pat. Nos. 5,225,539; 5,585,089; 5,693,761; 5,693,762; 5,859,205 are herein incorporated by reference for their disclosures relating to humanization of antibodies.
- antibodies of the disclosure may be made in cells of animals other than mice, for example, antibodies of the disclosure may be made in cells from chickens, pigs, guinea pigs, hamsters, horses, rats, camels, llamas, goats, rabbits, donkeys, sheep, and/or other suitable animals.
- Antibodies of the disclosure may be synthetic antibodies.
- anti-PTGFRN antibody or “an antibody that binds to PTGFRN” refers to an antibody that is capable of binding PTGFRN with sufficient affinity such that the antibody is useful as a diagnostic and/or therapeutic agent in targeting PTGFRN.
- the extent of binding of an anti-PTGFRN antibody to an unrelated, non-PTGFRN protein can be less than about 10% of the binding of the antibody to PTGFRN as measured, e.g., by an immunoassay.
- an antibody that binds to PTGFRN has a dissociation constant (Kd) of ⁇ 1 ⁇ M, ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, or ⁇ 0.1 nM.
- Kd dissociation constant
- the anti-PTGFRN antibodies of this disclosure can be any type of antibody, and in preferred embodiments are fully human antibodies.
- antibody fragment refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody.
- antibody fragments include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, single chain antibodies, single chain scFv, and multispecific antibodies formed from antibody fragments.
- human antibody means an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human (preferably not including any source (e.g., mouse, rat) amino acid sequences) made using any technique known in the art.
- This definition of a human antibody includes intact or full-length antibodies, fragments thereof, and/or antibodies comprising at least one human heavy and/or light chain polypeptide such as, for example, an antibody comprising murine light chain and human heavy chain polypeptides.
- humanized antibody refers to forms of non-human (e.g., murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences.
- humanized antibodies are human immunoglobulins in which residues from the complementary determining region (CDR) are replaced by residues from the CDR of a non-human species (e.g., mouse, rat, rabbit, hamster) that have the desired specificity, affinity, and capability.
- CDR complementary determining region
- the Fv framework region (FR) residues of a human immunoglobulin are replaced with the corresponding residues in an antibody from a non-human species that has the desired specificity, affinity, and capability.
- the humanized antibody can be further modified by the substitution of additional residues either in the Fv framework region and/or within the replaced non-human residues to refine and optimize antibody specificity, affinity, and/or capability.
- the humanized antibody will comprise substantially all of at least one, and typically two or three, variable domains containing all or substantially all of the CDR regions that correspond to the non-human immunoglobulin whereas all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
- the humanized antibody can also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Examples of methods used to generate humanized antibodies are described in U.S. Pat. No. 5,225,539.
- chimeric antibodies refers to antibodies wherein the amino acid sequence of the immunoglobulin molecule is derived from two or more species.
- the variable region of both light and heavy chains corresponds to the variable region of antibodies derived from one species of mammals (e.g., mouse, rat, rabbit, etc.) with the desired specificity, affinity, and capability while the constant regions are homologous to the sequences in antibodies derived from another (usually human) to avoid eliciting an immune response in that species.
- epitopes or “antigenic determinant” are used interchangeably herein and refer to that portion of an antigen capable of being recognized and specifically bound by a particular antibody.
- the antigen is a polypeptide
- epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing.
- An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.
- Binding affinity generally refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, “binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen).
- the affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein.
- Low-affinity antibodies generally bind antigen slowly and tend to dissociate readily, whereas high-affinity antibodies generally bind antigen faster and tend to remain bound longer.
- a variety of methods of measuring binding affinity are known in the art, any of which can be used for purposes of the present disclosure. Specific illustrative embodiments are described in Examples herein.
- binding affinity refers to a stronger binding between a molecule and its binding partner.
- “Or better” when used herein refers to a stronger binding, represented by a smaller numerical Kd value.
- an antibody which has an affinity for an antigen of “0.3 nM or better” the antibody's affinity for the antigen is ⁇ 0.3 nM, i.e., 0.29 nM, 0.28 nM, 0.27 nM, etc., or any value less than 0.3 nM.
- an antibody binds to an epitope via its antigen binding domain, and that the binding entails some complementarity between the antigen binding domain and the epitope. According to this definition, an antibody is said to “specifically bind” to an epitope when it binds to that epitope, via its antigen binding domain more readily than it would bind to a random, unrelated epitope.
- the term “specificity” is used herein to qualify the relative affinity by which a certain antibody binds to a certain epitope.
- antibody “A” may be deemed to have a higher specificity for a given epitope than antibody “B,” or antibody “A” may be said to bind to epitope “C” with a higher specificity than it has for related epitope “D ”
- preferentially binds it is meant that the antibody specifically binds to an epitope more readily than it would bind to a related, similar, homologous, or analogous epitope.
- an antibody which “preferentially binds” to a given epitope would more likely bind to that epitope than to a related epitope, even though such an antibody may cross-react with the related epitope.
- An antibody is said to “competitively inhibit” binding of a reference antibody to a given epitope if it preferentially binds to that epitope to the extent that it blocks, to some degree, binding of the reference antibody to the epitope.
- Competitive inhibition may be determined by any method known in the art, for example, competition ELISA assays.
- An antibody may be said to competitively inhibit binding of the reference antibody to a given epitope by at least 90%, at least 80%, at least 70%, at least 60%, or at least 50%.
- substantially pure refers to material which is at least 50% pure (i.e., pure meaning free from contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.
- a linker may be attached to an antibody of the disclosure using any technique known to those skilled in the art, for example, through surface lysines, reductive-coupling to oxidized carbohydrates, cysteine residues liberated by reducing interchain disulfide linkages, reactive cysteine residues engineered at specific sites, and acyl donor glutamine-containing tag or an endogenous glutamine made reactive by polypeptide engineering in the presence of transglutaminase and an amine.
- a variety of ADC linkage systems are known in the art, including hydrazone-, disulfide- and peptide-based linkages.
- a linker can and toxin can be expressed as part of the antibody by way of DNA recombination
- a “linker” is any moiety (chemical or protein such as dipeptide or tripeptide linker that is capable of linking a compound, usually a drug, such as a maytansinoid, or a toxin to a cell-binding agent such as an anti PTGFRN antibody or a fragment thereof in a stable, covalent manner.
- Linkers can be susceptible to or be substantially resistant to acid-induced cleavage, light-induced cleavage, enzyme-induced cleavage such peptidase-induced cleavage, esterase-induced cleavage, transglutaminase-induced cleavage, cathepsin induced cleavage and disulfide bond cleavage, at conditions under which the compound or the antibody remains active.
- Suitable linkers are well known in the art and include, for example, disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups and esterase labile groups.
- Linkers also include charged linkers, and hydrophilic forms thereof as described herein and known in the art.
- the linker can be, for example, a cleavable linker, a non-cleavable linker, a hydrophilic linker, or a dicarboxylic acid-based linker.
- cancer refers to or describe the physiological condition in mammals in which a population of cells is characterized by unregulated cell growth.
- examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia.
- Tumor and “neoplasm” refer to one or more cells that result from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions and metastatic sites. Any cancer that expresses PTGFRN may be detected and/or treated using methods of the disclosure.
- cancer types that can be treated and/or prevented using an antibody, ADC, or combination thereof also include, but are not limited to, solide tumor, adenocarcinoma of the lung, bladder cancer, blastoma, breast cancer (including triple negative breast carcinoma), carcinoma, choriocarcinoma, colon cancer, colorectal cancer, cervical cancer, endometrial cancer, epidermoid carcinoma, gastrointestinal cancer, glioblastoma, head and neck cancer/carcinoma, gastric, hepatic carcinoma, hepatocellular cancer, hepatoma, kidney (renal) cancer, leiomyosarcomas, liver cancer, lung cancer, , medulloblastoma, mesothelioma, neuroblastoma, non-small cell and small cell lung cancer, osteosarcoma, ovarian cancer/carcinoma, pancreatic cancer/carcinoma, peritoneal cancer
- cancer cell refers to the total population of cells derived from a tumor or a pre-cancerous lesion or metastatic sites, including both non-tumorigenic cells, which comprise the bulk of the tumor cell population, and tumorigenic stem cells (cancer stem cells) stromal and surrounding cells .
- tumorigenic stem cells cancer stem cells
- tumorigenic stem cells cancer stem cells
- stromal and surrounding cells tumorigenic stem cells
- the antibodies and ADCs of this disclosure can be combined with any suitable additional agent, such as, for instance, one or more chemotherapeutic agents, one or more anti-payload antibodies (i.e., a binding region and/or antibody against a cytotoxic moiety (or one or more cytotoxic moieties (M)) attached to an ADC) to reduce toxicity of free payload, other types anti-id, an immunotherapeutic regimen (e.g,. CAR-T therapy).
- any suitable additional agent such as, for instance, one or more chemotherapeutic agents, one or more anti-payload antibodies (i.e., a binding region and/or antibody against a cytotoxic moiety (or one or more cytotoxic moieties (M)) attached to an ADC) to reduce toxicity of free payload, other types anti-id, an immunotherapeutic regimen (e.g,. CAR-T therapy).
- an “effective amount” of an antibody as disclosed herein is an amount sufficient to carry out a specifically stated purpose.
- An “effective amount” can be determined empirically and in a routine manner, in relation to the stated purpose.
- the term “therapeutically effective amount” refers to an amount of an antibody or other drug effective to “treat” a disease or disorder in a subject or mammal.
- the therapeutically effective amount of the drug can reduce the number of cancer cells; reduce the tumor size; inhibit (i.e., slow to some extent or stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent or stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the cancer. See the definition herein of “treating”.
- the drug can prevent growth and/or kill existing cancer cells, it can be cytostatic and/or cytotoxic.
- prophylactically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
- label when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody, so as to generate a “labeled” antibody.
- the label can be detectable by itself (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, can catalyze chemical alteration of a substrate compound or composition which is detectable.
- a “chemotherapeutic agent” is a chemical compound useful in the treatment of cancer, regardless of mechanism of action.
- Chemotherapeutic agents include but are not limited to, for example, antagonists of CD20 such as Rituximab and cyclophosphamide, doxorubicin, vincristine, prednisone, fludarabine, etoposide, methotrexate, lenalidomide, chlorambucil, bentamustine, platins, taxanes, tubulins, enzyme inhibitors, inhibitors of cellulr processes necessary for cell growth and viability and/or modified versions of such chemotherapeutics.
- antagonists of CD20 such as Rituximab and cyclophosphamide, doxorubicin, vincristine, prednisone, fludarabine, etoposide, methotrexate, lenalidomide, chlorambucil, bentamustine, platins, taxanes, tubulins, enzyme inhibitor
- Terms such as “treating” or “treatment” or “to treat” or “alleviating” or “to alleviate” refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent and/or slow the development of a targeted pathologic condition or disorder; and/or, 3) general such as increased length of disease-free survival or overall survival.
- those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented.
- a subject is successfully “treated” for cancer according to the methods of the present disclosure if the patient shows one or more of the following: a reduction in the number of or complete absence of cancer cells; lack of progression of the disease, a reduction in the tumor size; inhibition of or an absence of cancer cell infiltration into peripheral organs including, for example, the spread of cancer into soft tissue and bone; inhibition of or an absence of tumor metastasis; inhibition or an absence of tumor growth; relief of one or more symptoms associated with the specific cancer; reduced morbidity and mortality; improvement in quality of life; reduction in tumorigenicity, tumorigenic frequency, or tumorigenic capacity, of a tumor; reduction in the number or frequency of cancer stem cells in a tumor; differentiation of tumorigenic cells to a non-tumorigenic state; or some combination of effects.
- Polynucleotide refers to polymers of nucleotides of any length, and include DNA and RNA.
- the nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase.
- a polynucleotide can comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure can be imparted before or after assembly of the polymer.
- the sequence of nucleotides can be interrupted by non-nucleotide components.
- a polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.
- Other types of modifications include, for example, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, cabamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, ply-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g
- any of the hydroxyl groups ordinarily present in the sugars can be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or can be conjugated to solid supports.
- the 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of from 1 to 20 carbon atoms.
- Other hydroxyls can also be derivatized to standard protecting groups.
- Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2'-0-methyl-, 2'-0-allyl, 2'-fluoro- or 2'- azido-ribose, carbocyclic sugar analogs, .alpha. -anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside.
- One or more phosphodiester linkages can be replaced by alternative linking groups.
- linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(O)S (“thioate”), P(S)S (“dithioate”), “(0)NR 2 (“ami date”), P(O)R, P(O)OR, CO or CH 2 (“formacetal”), in which each R or R is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether ( — O — ) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.
- vector means a construct, which is capable of delivering, and optionally expressing, one or more gene(s) or sequence(s) of interest in a host cell.
- vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.
- polypeptide “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length.
- the polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids.
- the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
- polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids, etc.
- the polypeptides of this disclosure are based upon antibodies, in certain embodiments, the polypeptides can occur as single chains or associated chains.
- nucleic acids or polypeptides refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity.
- the percent identity can be measured using sequence comparison software or algorithms or by visual inspection.
- sequence comparison software or algorithms or by visual inspection.
- Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences.
- One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al, 1990, Proc. Natl. Acad.
- Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402.
- BLAST-2 Altschul et al., 1996, Methods in Enzymology, 266:460-480
- ALIGN ALIGN-2
- ALIGN-2 Genentech, South San Francisco, Calif.
- Megalign Megalign
- the percent identity between two nucleotide sequences is determined using the GAP program in GCG software (e.g., using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6).
- the GAP program in the GCG software package which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5).
- the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4: 11-17 (1989)).
- the percent identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with residue table, a gap length penalty of 12 and a gap penalty of 4.
- Appropriate parameters for maximal alignment by a particular alignment software can be determined by one skilled in the art.
- the default parameters of the alignment software are used.
- the percentage identity “X” of a first amino acid sequence to a second sequence amino acid is calculated as 100x(Y/Z), where Y is the number of amino acid residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be longer than the percent identity of the second sequence to the first sequence.
- whether any particular polynucleotide has a certain percentage sequence identity can, in certain embodiments, be determined using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 5371 1). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482 489 (1981), to find the best segment of homology between two sequences.
- the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
- two nucleic acids or polypeptides of the disclosure are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection.
- Identity can exist over a region of the sequences that is at least about 10, about 20, about 40-60, about 60-80, about 90-100 residues in length or any value between the same, and in some embodiments, the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a nucleotide sequence for example.
- a “conservative amino acid substitution” is one in which one amino acid residue is replaced with another amino acid residue having a similar side chain.
- Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
- basic side chains e
- substitution of a phenylalanine for a tyrosine is a conservative substitution.
- conservative substitutions in the sequences of the polypeptides and antibodies of the disclosure do not abrogate the binding of the polypeptide or antibody containing the amino acid sequence, to the antigen(s), i.e., the PTGFRN to which the polypeptide or antibody binds.
- Methods of identifying nucleotide and amino acid conservative substitutions which do not eliminate antigen binding are well-known in the art (see, e.g., Brummell et al., Biochem. 32: 1 180-1 187 (1993); Kobayashi et al. Protein Eng. 12(10):879-884 (1999); and Burks et al. Proc. Natl. Acad. Sci. USA 94: 412-417 (1997)).
- the term “and/or” as used in a phrase such as “A and/or B” herein is intended to include both “A and B,” “A or B,” “A,” and “B ”
- the term “and/or” as used in a phrase such as “A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
- the present disclosure provides agents that specifically bind PTGFRN.
- the antibody or antigen binding fragment thereof binds to murine PTGFRN.
- the antibody is a full-length antibody.
- it is an antigen binding fragment.
- the antibody or antigen binding fragment thereof comprises a Fab, Fab', F(ab') 2 , Fd, single chain Fv or scFv, disulfide linked Fv, V-NAR domain, IgNar, intrabody, IgG ⁇ CH 2 , camelid, nanobody, minibody, F(ab') 3 , tetrabody, triabody, diabody, single-domain antibody, DVD-Ig, Fcab, mAb 2 , (SCFV) 2 , or scFv-Fc.
- the cytotoxic reagent is selected from the group consisting of an anthracycline, an auristatin, a camptothecin, a combretastain, a dolastatin, a duocarmycin, an enediyne, a geldanamycin, an indolino-benzodiazepine dimer, a maytansine, a puromycin, a pyrrolobenzodiazepine dimer, a taxane, a vinca alkaloid, a tubulysin, a hemiasterlin, a spliceostatin, a pladienolide, and calicheamicin, topoisomerase inhibitor, DNA synthesis inhibitor, DNA repair inhibitor.
- the PTGFRN-binding agents bind to cell surface PTGFRN antigens. In certain embodiments, the PTGFRN-binding agents bind to the extracellular domain (ECD) of PTGFRN. In certain embodiments, cancer cells have multiple cell surface PTGFRN antigens. In certain embodiments, the PTGFRN and the PTGFRN- binding agents are internalized into the cells.
- the PTGFRN-binding agents are capable of cell killing.
- the cell killing is effected by the anti-PTGFRN antibodies.
- the cell killing is effected by the cytotoxic drug conjugated to the anti- PTGFRN antibodies.
- the cell killing is effected by the anti- PTGFRN antibodies and the cytotoxic drug conjugated to the anti-PTGFRN antibodies.
- the polynucleotides comprise the coding sequence for the mature polypeptide fused in the same reading frame to a polynucleotide which aids, for example, in expression and secretion of a polypeptide from a host cell (e.g., a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell).
- a polypeptide having a leader sequence is a preprotein and can have the leader sequence cleaved by the host cell to form the mature form of the polypeptide.
- the polynucleotides can also encode for a proprotein which is the mature protein plus additional 5' amino acid residues.
- a mature protein having a prosequence is a proprotein and is an inactive form of the protein.
- the polynucleotides comprise the coding sequence for the mature polypeptide fused in the same reading frame to a marker sequence that allows, for example, for purification of the encoded polypeptide.
- the present disclosure further relates to variants of the hereinabove described polynucleotides encoding, for example, fragments, analogs, and derivatives.
- the polynucleotide variants can contain alterations in the coding regions, non-coding regions, or both. In some embodiments, the polynucleotide variants contain alterations, which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide.
- nucleotide variants are produced by silent substitutions due to the degeneracy of the genetic code.
- Polynucleotide variants can be produced for a variety of reasons, e.g., to optimize codon expression for a particular host (change codons in the human mRNA to those preferred by a bacterial host such as A. coif).
- Vectors and cells comprising the polynucleotides described herein are also encompassed by the present disclosure.
- antibodies and/or antibody conjugates of the disclosure may be formulated as pharmaceutical compositions. Pharmaceutical compositions of the disclosure will typically comprise from about 0.1% to about 75% by weight of an antibody or antibody drug conjugate of the disclosure.
- a pharmaceutical composition of the disclosure may comprise from about 0.2% to about 75%, from about 0.5% to about 75%, from about 1% to about 75%, from about 2% to about 75%, from about 5% to about 75%, from about 10% to about 75%, from about 20% to about 75%, or from about 50% to about 75% by weight of an antibody or antibody drug conjugate of the disclosure.
- Pharmaceutical compositions of the disclosure may be formulated in any manner known to those skilled in the art.
- pharmaceutical compositions of the disclosure are formulated as injectable compositions which may be liquid solutions or suspensions or solid forms to be dissolved or suspended in liquid prior to injection.
- Pharmaceutical compositions of the disclosure may be formulated for delayed release, for example, may be formulated for depot injections.
- a pharmaceutical composition of the disclosure will typically comprise one or more pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier includes any and all aqueous solvents (e.g., water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles, such as sodium chloride, Ringer's dextrose, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oil, and injectable organic esters, such as ethyloleate), dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, anti-oxidants, chelating agents, and inert gases), isotonic agents, absorption delaying agents, salts, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, fluid and nutrient replenishers, such like materials and combinations thereof, as would be known to
- the present disclosure also provides methods of treatment using the antibodies of the disclosure.
- Methods of the disclosure will typically comprise administration of a pharmaceutical composition of the disclosure to a patient in need thereof.
- the quantity to be administered both according to number of treatments and dose, may be determined by those skilled in the art. Determination of the quantity and timing of administration of a pharmaceutical composition of the disclosure can be made by consideration of factors such as body weight, the age, health, and sex of the subject, the type of disease being treated, the extent of disease penetration, previous or concurrent therapeutic interventions, idiopathy of the patient, the route of administration, and the potency, stability, and toxicity of the particular therapeutic substance.
- antibodies of the disclosure may be used for imaging applications.
- antibodies of the disclosure may be conjugated to a functional moiety suitable for imaging.
- Functional moieties suitable for imaging include, but are not limited to, moieties that may be detected by microscopy, e.g., fluorescent microscopy, confocal microscopy, or electron microscopy.
- Other functional moieties may be detected by other analytical techniques, for example, by magnetic resonance imaging, tomography, such as gamma (SPECT/CT, planar) and positron emission tomography (PET/CT), radiography, or ultrasound.
- SPECT/CT gamma
- PET/CT positron emission tomography
- Functional moieties suitable for use in imaging applications of the disclosure may include luminescent molecules, chemiluminescent molecules, fluorochromes, fluorescent quenching agents, colored molecules, radioisotopes, scintillants, massive labels (for detection via mass changes), biotin, avidin, streptavidin, protein A, protein G, antibodies or fragments thereof, Grb2, polyhistidine, Ni2 + , Flag tags, myc tags, heavy metals, enzymes, alkaline phosphatase, peroxidase, luciferase, electron donors/acceptors, acridinium esters, and colorimetric substrates.
- the PTGFRN-binding agents (including antibodies, immunoconjugates, and polypeptides) of the disclosure are useful in a variety of applications including, but not limited to, therapeutic treatment methods, such as the treatment of cancer.
- the agents are useful for inhibiting tumor growth, inducing differentiation, reducing tumor volume, and/or reducing the tumorigenicity of a tumor, inhibiting metastasis.
- the methods of use can be in vitro, ex vivo, or in vivo methods and in patients.
- anti-PTGFRN antibodies and immunoconjugates of the disclosure are useful for detecting the presence of PTGFRN in a biological sample.
- detecting encompasses quantitative or qualitative detection.
- a biological sample comprises a cell or tissue or biological fluid.
- tissue include normal and/or cancerous tissues that express PTGFRN at higher levels relative to other tissues.
- the disclosure provides a method of detecting the presence of PTGFRN in a biological sample.
- the method comprises contacting the biological sample with an anti-PTGFRN antibody under conditions permissive for binding of the anti-PTGFRN antibody to PTGFRN, and detecting whether a complex is formed between the anti-PTGFRN antibody and PTGFRN.
- this disclosure provides a method of diagnosing a disorder, such as cancer.
- the method comprises contacting a test cell or tissue with an anti-PTGFRN antibody; determining the level of expression (either quantitatively or qualitatively) of PTGFRN by the test cell by detecting binding of the anti- PTGFRN antibody to PTGFRN; and comparing the level of expression of PTGFRN by the test cell with the level of expression of PTGFRN by a control cell (e.g., a normal cell of the same tissue origin as the test cell or a cell that expresses PTGFRN at levels comparable to such a normal cell), wherein a higher level of expression of PTGFRN by the test cell as compared to the control cell indicates the presence of a disorder associated with increased expression of PTGFRN.
- the test cell is obtained from an individual suspected of having a disorder associated with increased expression of PTGFRN.
- the disorder is a cell proliferative disorder, such as
- a method of diagnosis or detection comprises detecting binding of an anti-PTGFRN antibody to PTGFRN expressed on the surface of a cell or in a membrane preparation obtained from a cell expressing PTGFRN on its surface.
- the method comprises contacting a cell with an anti-PTGFRN antibody under conditions permissive for binding of the anti-PTGFRN antibody to PTGFRN, and detecting whether a complex is formed between the anti-PTGFRN antibody and PTGFRN on the cell surface.
- An exemplary assay for detecting binding of an anti-PTGFRN antibody to PTGFRN expressed on the surface of a cell is a flow binding assay using a flow cytometer.
- Certain other methods can be used to detect binding of anti-PTGFRN antibodies to PTGFRN.
- antigen-binding assays that are well known in the art, such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoprecipitation assays, fluorescent immunoassays, protein A immunoassays, lateral flow assays and immunohistochemistry (IHC).
- anti-PTGFRN antibodies are labeled.
- Labels include, but are not limited to, labels or moieties that are detected directly (such as fluorescent, chromophoric, electron-dense, chemiluminescent, and radioactive labels), as well as moieties, such as enzymes or ligands, that are detected indirectly, e.g., through an enzymatic reaction or molecular interaction.
- the disease treated with the PTGFRN-binding agent is one or more types of cancer (preferably a human cancer).
- the cancer is characterized by PTGFRN expressing cells to which the PTGFRN-binding agent (e.g., antibody or conjugate) binds.
- the type of cancer is a head and/or neck cancer, squamous carcinoma, epidermoid carcinoma, medulloblastoma, mesothelioma, and a hematopoietic cancer, and/or as disclosed herein or may otherwise be determined by one of skill in the art.
- the present disclosure provides for such methods of treating cancer comprising administering a therapeutically effective amount of a PTGFRN-binding agent to a subject (e.g., a subject in need of treatment).
- a subject e.g., a subject in need of treatment.
- the method includes determining over-expression of PTGFRN protein in the cells of a cancer to be treated as compared to a control / non-cancerous sample (e.g., cells or tissues).
- the over-expression is determined by measuring the expression of RNA encoding PTGFRN and/or the PTGFRN protein.
- the present disclosure further provides methods for inhibiting tumor growth using the antibodies or conjugates described herein.
- the method of inhibiting the tumor growth comprises contacting the cell with a PTGFRN-binding agent (e.g., antibody or conjugate) in vitro.
- a PTGFRN-binding agent e.g., antibody or conjugate
- an immortalized cell line or a cancer cell line that expresses PTGFRN is cultured in medium to which is added the antibody or other agent to inhibit tumor growth.
- tumor cells are isolated from a patient sample such as, for example, patient derived tumor cells that are used in patient derived xenograft or a tissue biopsy, pleural effusion, or blood sample and cultured in medium to which is added a PTGFRN-binding agent to inhibit tumor growth.
- the method of inhibiting tumor growth comprises contacting the tumor or tumor cells with the PTGFRN-binding agent (e.g., antibody or conjugate) in vivo.
- contacting a tumor or tumor cell with a PTGFRN-binding agent is undertaken in an animal model.
- PTGFRN-binding agents can be administered to xenografts of human cell lines or patient-derived cells expressing PTGFRN that have been grown in immunocompromised mice to inhibit tumor growth.
- the method of inhibiting tumor growth comprises administering to a subject a therapeutically effective amount of a PTGFRN-binding agent.
- the subject is a human.
- the subject has a tumor or has had a tumor removed.
- the tumor expresses the PTGFRN to which the PTGFRN- binding agent or antibody binds. In certain embodiments, the tumor overexpresses the human PTGFRN. In certain embodiments, the methods can comprise isolating tissue and/or cells of the cancer and determining whether the cancer tissue overexpresses PTGFRN as compared to non-cancerous cells, optionally wherein the PTGRGN expression is determined by measuring PTGFRN protein and/or expression of RNA encoding PTGFRN.
- the disclosure provides a method for treating a disorder associated with PTGFRN function or expression in a subject comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- Disorders that may be treated include cancer.
- the disclosure provides a method for decreasing tumor growth or progression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the disclosure provides a method for decreasing metastasis of PTGFRN-expressing cancer cells in a subject, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the disclosure provides a method for inducing tumor regression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the disclosure provides a method for inhibiting cancer stem cells growth in a subject who has had a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. In some embodiments, the disclosure provides a method for preventing tumor regrowth in a subject who has had a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. In some embodiments, the present disclosure provides a method for ameliorating symptoms in a subject who has, or has had, a PTGFRN- expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
- the disclosure provides a method for imaging a cell, comprising contacting the cell with an antibody or antigen binding fragment thereof of the disclosure or an antibody conjugate of the disclosure; and, detecting the antibody or antigen binding fragment thereof or the antibody conjugate.
- the present disclosure provides a method for identifying the expression of PTGFRN in a tumor, comprising (1) obtaining a sample of the tumor, (2) contacting the sample with the antibody or antigen binding fragment thereof or the antibody conjugate encompassed by the disclosure; and, (3) detecting the antibody or antigen binding fragment thereof or the conjugate.
- the detecting is by any immunochemical method.
- the method for identifying the expression of PTGFRN in a tumor can be done by immunochemistry (IHC).
- IHC immunochemistry
- such methods can be done by, but are not limited to, antigen-binding assays that are well known in the art, such as western blots, lateral flow assays, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoprecipitation assays, fluorescent immunoassays, and protein A immunoassays.
- the methods include in vivo imaging such as for identifying the presence and/or position of tumor cells and/or tumors.
- the methods can include targeted therapy to the tumors to deliver toxic compound bound to the antibody or targeted radiation of tumor using antibody.
- the present disclosure provides monoclonal antibodies (mAbs) termed 4F8, 6B2, 8C7, and 12D8 that specifically bind Prostaglandin F2 Receptor Inhibitor (PTGFRN) which preferentially expressed in certain cancer cells, particularly medulloblastoma and mesothelioma.
- Monoclonal antibodies of the disclosure bind to cells naturally expressing PTGFRN and to cells transfected to express PTGFRN.
- Monoclonal antibodies of the disclosure can also be monoclonal antibodies that are internalized in PTGFRN expressing cancer cells and as such are potential payload carriers to kill targeted cells.
- ADC antibody-drug-conjugate
- this disclosure provides the following preferred embodiments.
- this disclosure provides an isolated antibody or antigen binding fragment thereof, comprising: a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 1, 2, and 3, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively (4F8 K); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 4, 5, and 6, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively (4F8 Ch); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 4, 5, and 6, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively (4F8 Alt); the heavy chain variable region of SEQ ID NO: 189 and the light chain variable region of SEQ ID NO: 190 (4F8); a heavy chain variable region comprising the complementarity determining region (
- the antibody binds to a cell expressing PTGFRN in vitro and/or in vivo.
- this disclosure provides antibodies that compete with any of the antibodies above for binding to PTGFRN on a cell.
- this disclosure provides combinations of the antibodies above, as well as other reagents, and regimens.
- this antibody is an isolated monoclonal antibody, preferably a human monoclonal antibody.
- the antibody is derived from a human antibody, human IgG, human IgGl, human IgG2, human IgG2a, human IgG2b, human IgG3, human IgG4, human IgM, human IgA, human IgAl, human IgA2, human IgD, human IgE, canine antibody, canine IgGA, canine IgGB, canine IgGC, canine IgGD, chicken antibody, chicken IgA, chicken IgD, chicken IgE, chicken IgG, chicken IgM, chicken IgY, feline antibody, goat antibody, goat IgG, mouse antibody, mouse IgG, pig antibody, rat antibody, Haman antibody, alpacan antibody, shark antibody and a camel antibody.
- this disclosure provides derivatives of such antibodies, optionally selected from the group consisting of an F ab , F ab2 , Fab’ single chain antibody, F v , single chain, mono-specific antibody, bispecific antibody, trimeric antibody, multi-specific antibody, multivalent antibody, chimeric antibody, canine-human chimeric antibody, canine- mouse chimeric antibody, antibody comprising a canine Fc, humanized antibody, human antibody, caninized antibody, CDR-grafted antibody, shark antibody, and a nanobody.
- a derivative of any of the antibodies disclosed herein can comprise a detectable label fixably attached thereto, optionally wherein the detectable label is selected from the group consisting of fluorescein, DyLight, Cy3, Cy5, FITC, HiLyte Fluor 555, HiLyte Fluor 647, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein, 5-FAM, hydroxy tryptamine, 5-hydroxy tryptamine (5-HAT), 6-carboxyfluorescein (6-FAM), FITC, 6-carboxy-l,4-di chi oro-2’, 7’ -di chlorofluorescein (TET), 6-carboxy-l,4-dichloro-2’,4’,5’,7’- tetrachlorofluorescein (HEX), 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein (6-JOE),
- the antibody can comprise an effector moiety attached thereto, optionally wherein the effector moiety is selected from the group consisting of a cytotoxic drug, toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and radiochemical.
- the cytotoxic drug is duocarmycin.
- a non-cleavable or cleavable linker is positioned between the antibody and the effector moiety, wherein said cleavable linker releases the effector moiety into or within a cell.
- this disclosure provides isolated polynucleotide encoding an antibody disclosed herein, or a polynucleotide comprising at least one polynucleotide having at least about 90% identity with any of the same.
- the polynucleotide can be contained within an expression vector.
- this disclosure provides a host cell comprising the isolated polynucleotide and / or the expression vector.
- this disclosure provides a composition comprising at least antibody or derivative disclosed herein; at least one isolated polynucleotide and/or one or more expression vector comprising the same; and / or, at least one host cell comprising the same; or a combination thereof; and, a pharmaceutically acceptable carrier.
- this disclosure provides methods for detecting PTGFRN on a cell and/or tissue, the method comprising contacting a test biological sample with an antibody or derivative of this disclosure and detecting the antibody bound to the biological sample or components thereof.
- the methods comprise comparing the amount of binding to the test biological sample or components thereof to the amount of binding to a control biological sample or components thereof, wherein increased binding to the test biological sample or components thereof relative to the control biological sample or components thereof indicates the presence of a cell expressing PTGFRN in the test biological sample (preferably, e.g., mammalian cell, tissue, or biological fluid such as blood).
- the method is an in vivo method or an in vitro method.
- this disclosure provides in vivo methods for detecting tumor cells, and/or diagnosing cancer, the method comprising administering at least one antibody, combination, or derivative and detecting the at least one antibody bound to the tumor cells.
- the at least one antibody or derivative comprises at least one detectable label.
- the method comprising using at least two antibodies and/or derivatives that each comprise at least one detectable label, the detectable label of each antibody and/or derivative being the same or different.
- the method comprises imaging a tumor for targeted treatment of cancer. In some preferred embodiments, the method further comprises treating the cancer.
- this disclosure provides methods for treating cancer, the method comprising administering at least one antibody, combination, or derivative of this disclosure to a mammal.
- the at least one antibody or derivative comprises an effector moiety.
- the methods comprising using at least two antibodies or derivatives that each comprise at least one effector moiety, the effector moiety of each antibody or derivative being the same or different.
- the methods comprise administering at least two antibodies to the mammal, wherein at least one antibody is a naked antibody that does not include a cytotoxic effector moiety attached thereto and at least one antibody includes a cytotoxic effector moiety attached thereto.
- this disclosure provides methods for detecting, diagnosing, and treating cancer, the method comprising imaging a tumor comprising the antibody, combination, or derivative of this disclosure attached thereto and targeting treatment of cancer to the tumor or cells thereof.
- the diagnostic methods of this disclosure can include measuring PTGFRN protein in biological fluids (e.g., blood, plasma, exosomes) and/or in tissues using imaging and/or other techniques such as immunohistochemistry.
- the antibody or derivative thereof comprises a detectable label and/or an effector moiety.
- this disclosure provides methods for treating, preventing and / or ameliorating cancer in a mammal comprising administering to the mammal at least one effective dose of a pharmaceutical composition comprising at least one antibody and/or derivative of this disclosure.
- the antibody comprises a cytotoxic effector moiety (preferably the group “M” in the general formula provided herein) attached thereto, optionally wherein the effector moiety is as disclosed herein or as may be otherwise available to those of skill in the art (e.g., a cytotoxic drug, toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and radiochemical).
- the cytotoxic drug is duocarmycin.
- Other cytotoxic drugs are also suitable, as disclosed herein and as may be otherwise available to those of skill in the art.
- a non-cleavable or cleavable linker is positioned between the antibody and the effector moiety, wherein said cleavable linker releases the effector moiety into or within a cell.
- the antibody is administered as an antibody-drug conjugate.
- multiple doses are administered to the animal; and/or, the antibody is administered in a dosage amount of about 1 to 50 mg / kg.
- this disclosure provides a kit for detecting the expression of PTGFRN in or on a cell, tissue, or biological fluid, the kit comprising one or more antibodies an antibody or derivative disclosed herein and instructions for use.
- the antibody or derivative is in lyophilized form.
- Ranges may be expressed herein as from about one particular value, and/or to about another particular value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent about or approximately, it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. Ranges (e.g., 90-100%) are meant to include the range per se as well as each independent value within the range as if each value was individually listed. All references cited within this disclosure are hereby incorporated by reference in their entirety. Certain embodiments are further described in the following examples. These embodiments are provided as examples only and are not intended to limit the scope of the claims in any way.
- TC-mAb mice carrying mini-chromosomes with human immunoglobulin (Ig) loci can contribute to the development of fully human therapeutic monoclonal antibodies (Abs) when immunized with antigen of interest followed by fusion of the mouse B cells with a myeloma cells and to form hybridoma and plating these cells in semi-solid culture conditions to obtain single hybridoma clones which can be picked and evaluated, hybridoma single clones, Out of 1248 clones examined, we narrowed down by a series of progressive iteration encompassing several biochemical and biological assays including flow binding and internalization to four (4) fully human anti-PTGFRN antibodies producing hybridomas with sequencing of their Heavy and light chains. Two families of antibodies have been identified.
- the first group represented by 8C7 can bind to many different types of cells expressing varying levels of cell surface PTGFRN.
- the second group is represented by 4F8, 12D8 and 6B2 which appear to preferentially bind to cell expressing very high level of PTGFRN. It has been shown that when presented as ADC, these various antibodies can inhibit proliferation of human cancer cells expressing PTGFRN and thus have therapeutic applications for human disease where PTGFRN is overexpressed including but not limited to cancer and metastasis.
- This example shows the use of stable shRNA and cDNA transfections to respectively knockdown and over-express PTGFRN in three different cancer cell lines, two of which are representative of rare and aggressive cancers (Mesothelioma and Pediatric Medulloblastoma), to produce new cell lines (clones) with changed PTGFRN expression.
- the characteristics of the resulting clones showed a decrease in proliferation, migration, colony formation, and spheroid growth capabilities in cells where PTGFRN expression had been inhibited, while cells overexpressing PTGFRN showed the opposite.
- This example also shows that PTGFRN directly binds to two protein partners, Integrin ⁇ 1 and E. Cadherin, the latter of which is a novel direct binding partner to PTGFRN.
- this example shows that silencing PTGFRN expression impacts the cellular process of autophagy, thereby providing another avenue by which PTGFRN potentially contributes to a cancer cell phenotype.
- Cell lines were obtained from the American Type Culture Collection (ATCC, Manassas, VA). A431 (CRL-1555), DAOY (HTB-186), and MSTO-21 1H (CRL-2081) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 medium (DMEM/F12 1 : 1 mixture) supplemented with 50 ⁇ g/ml Gentamycin and 5% FBS, and maintained in a 5% CO 2 incubator at 37°C.
- DMEM Modified Eagle Medium
- F12 medium DMEM/F12 1 : 1 mixture
- PTGFRN silencing A431 and DAOY cells were transfected with two different human PTGFRN shRNAs (Fenics Bio, HSH321177-100), in order to silence PTGFRN expression (shRNA #1 sequence: TAGCCTTAAGAATGAATATGAA; shRNA #2 sequence: GTGGTATGTTTTGCTTTCCTAA), as well as one scrambled shRNA as control.
- shRNA #1 sequence TAGCCTTAAGAATGAATATGAA
- shRNA #2 sequence GTGGTATGTTTTGCTTTCCTAA
- MSTO-211H cells were transfected with pcDNA3.1 plasmid vector (Thermo Fisher, V79020) with the human PTGFRN gene insert to overexpress PTGFRN. Empty vector was used as negative control. All transfections were conducted with Lipofectamine 3000 reagent (Thermo Fisher, L3000015), according to manufacturer’s instructions. After transfection, the pooled cells were sorted and dispensed as single cells into a 96-well plate by the Hana Single Cell Dispenser (Namocell, #NI004). These single cell clones were then expanded and screened via flow cytometry and immunoblot for the lowest and highest PTGFRN-expressing clones for each cell line.
- pcDNA3.1 plasmid vector Thermo Fisher, V79020
- Empty vector was used as negative control. All transfections were conducted with Lipofectamine 3000 reagent (Thermo Fisher, L3000015), according to manufacturer’s instructions. After
- membranes were washed in PBST, then incubated in Rabbit-anti-Sheep-HRP conjugated antibody (Jackson ImmunoResearch, 313-035-045) in 5% milk-PBST (1:2000) for 1 hour at room temperature. Membranes were then developed with ECL chemiluminescent solution in an Azure Biosystems 280 chemiluminescent unit.
- A431 cells were transfected with siRNA coding for either PTGFRN, E. Cadherin, and Integrin ⁇ 1 (Thermo Fisher). Transfections were conducted with Lipofectamine 3000 reagent (Thermo Fisher, L3000015), according to manufacturer’s instructions. After transfection and 48-hour incubation, cells were washed three times with PBS, and lysed in 1% Brij-O10 + protease inhibitor cocktail. Confirmation of specific knockdown was performed using western blot analysis.
- Transwell inserts and a 96-well plate were coated overnight at 4°C with Type II Rat Collagen (Corning) (40 ⁇ g/mL) in sterile deionized water. The coating solution was aspirated the next morning and allowed to completely air dry.
- For MSTO-211 H cells a 24- hour serum-starvation step was performed before cell collection. Cells were detached with 5mM EDTA, and washed and re-suspended with DMEM/F 12 + 0.1% BSA. 7.5xl0 4 cells (for A431) or 5xl0 4 cells (For DAOY and MSTO-211H) were seeded inside the inner chamber of the insert.
- the outer chamber was filled with DMEM/F 12 + 5% FBS, A431 cells were allowed to migrate for 18 hours, DAOY cells for 6 hours, and MSTO-21 1H cells for 48 hours.
- A431 cells were allowed to migrate for 18 hours, DAOY cells for 6 hours, and MSTO-21 1H cells for 48 hours.
- a standard curve with pre-specified cell numbers was plated in the 96-well plate, and cells were allowed to attach for 5 hours before being fixed and stained with Crystal Violet as described below. All incubations were done in a humidified, 5% CO 2 , 37°C incubator.
- A431 and DAOY shRNA transfected clones, and MSTO-211H overexpressing clones were plated in duplicate at 200, 100, and 50 cells/well in a 6 well plate in DMEM/F 12 + 5% FBS. These plates were incubated at 37°C for 10 days, at which point the cell culture media was aspirated, the wells were washed with PBS, and the cells were fixed for 10 minutes in 4% Paraformaldehyde. After fixation, paraformaldehyde was removed, and the cells were stained in a 0.005% Crystal Violet solution for 20 minutes. Wells were washed 3 times with H 2 O, images of stained colonies were captured, and colony numbers were counted.
- DAOY spheroids 500 cells/well were plated in a 96-well, ultra-low attachment plate (Costar, 7007) in complete 3D Tumorsphere Medium XF (Promo Cell, C- 28070). Spheroids were allowed to form for 10 days before imaging and lysate collection.
- Chambered coverslips (Thermo Fisher, #155380) were coated overnight at 4°C in 50 ⁇ g/mL Poly-D-Lysine (Millipore Sigma, P6407) in sterile deionized water. Next day, collagen solution was aspirated from the coverslips, and was allowed to air dry for 2 hours at room temperature. 8xl0 4 cells were seeded in each chamber and allowed to attach overnight in a 37°C humidified 5% CO 2 incubator. The next day, the cells were washed once with PBS and fixed with 100% methanol chilled to -20°C for 10 minutes.
- the cells were incubated with I ⁇ g/mL 8C7-Alexa Fluor 555, 1 :200 Anti-E. Cadherin-Alexa Fluor 488 (Cell Signaling, 3199S), 1 : 100 anti-Integrin ⁇ 1-Alexa Fluor 647 (Abeam, ab214706), and I ⁇ g/mL Hoechst 33342 (Thermo Fisher, H1399) diluted in 0.2% PBST + 1% BSA overnight at 4°C. The next day, the coverslips were washed three times with 0.2% PBST, then mounted in ProLongTM Glass Antifade Mountant solution (Thermo Fisher Scientific, P36982). The slides were kept overnight at 4°C, then viewed using a Nikon Al point-scanning laser confocal microscope (NIS-Elements, 100X).
- I ⁇ g/mL 8C7-Alexa Fluor 555 1 :200 Anti-E.
- Cadherin-Alexa Fluor 488 Cell Signaling
- coverslips and cells were prepared using the same method, with the exception of the fixation step. These cells were fixed in 4% Paraformaldehyde for 10 minutes, then permeabilized in 0.2% TritonX-100, followed by three PBS washes. Incubation with I ⁇ g/mL anti-LC3B antibody (Abeam, ab48394) and Hoechst 33342 was performed overnight at 4°C. After three washes in PBST, incubation with 5 ⁇ g/mL Goat-anti-Rabbit-Alexa Fluor 555 (Abeam, abl50078) was done at 4° for 2 hours. Washing, mounting, and visualization were performed as described above.
- the anti-E. Cadherin western blot (WB) antibody was purchased from Cell Signaling (3195S).
- the anti-Integrin ⁇ 1 WB antibody was purchased from Fortis Life Sciences (A303-735A).
- the anti-GAPDH WB antibody was purchased from Cell Signaling (2118S).
- the Goat-anti-Rabbit-HRP (111-035-144) antibody was purchased from Jackson ImmunoReseach Laboratories.
- A431 and DAOY cells are two cell lines which have high level of PTGFRN expression (Marquez et al., 2021). For both cell lines, we generated clone derivatives where PTGFRN expression had been significantly and stably inhibited by PTGFRN shRNA plasmid transfection as described in the method section. These clones are referred to as A431 shRNAl and A431 shRNA2, DAOY shRNAl, and DAOY shRNA 2, respectively. Control cells were transfected with scrambled shRNA plasmid.
- PTGFRN expression also affected the clonogenic ability of the cells tested. As shown in Figure 6A, A431 and DAOY shRNAl and shRNA2 clones showed a significant decrease in the number of colonies formed (80% and 66% reduction of colony numbers, respectively). Alternatively, PTGFRN overexpression in MSTO-PTG cells significantly increased the number of colonies formed, showing 50+ colonies formed, compared to the MSTO-211H control cell line, where almost no colonies were formed, even at the highest cell number tested ( Figure 6B).
- DAOY control shRNA clone spheroids could be manipulated freely without the breakdown of the spheroids into single cells. This indicates that a positive PTGFRN expression is associated with the cells ability to form spheroids in 3D culture.
- FIG. 7C the expression levels of Integrin ⁇ 1 and E Cadherin in 3D culture of control shRNA A431 cells, which form spheroids, with that of 3D culture of A431 shRNA cells that did not form spheroids. It was shown that both Integrin ⁇ 1 and E. Cadherin both retained high levels of expression in the control A431 spheroids, whereas the PTGFRN shRNA A431 cells that could not form spheroids have significantly lower levels of expression of these two proteins. Additionally, this decrease in expression was not seen in the shRNAl and shRNA2 cells grown in 2D culture conditions compared to control shRNA A431 cells in 2D Culture.
- FIG. 8 demonstrates that when using confocal fluorescent microscopy, fluorescent antibodies raised against E. Cadherin (Fig. 8A), PTGFRN (Fig. 8B), Integrin ⁇ 1 (Fig. 8C), and co-localized in the junctions between cells grown in 2D culture (Fig. 8D)
- Co-immunoprecipitation assays were also carried out by lysing cells in a weak Brij O10 detergent in order to preserve direct protein-protein interactions.
- Immunoprecipitation using anti -PTGFRN antibody 8C7 showed the presence of both Integrin ⁇ 1 and E. Cadherin in the IP fraction.
- IP using an anti -Integrin ⁇ 1 antibody showed the presence of PTGFRN and E. Cadherin, and IP using an anti-E. Cadherin antibody showed the presence of PTGFRN and Integrin ⁇ 1.
- CD9 has been shown to both promote, as well as suppress, migration ability depending on the cell type studied. CD9 was reported to inhibit migration and metastasis in the small-cell lung cancer (Funakoshi et al., 2003; Zheng et al., 2005).
- CD9 has been reported to have opposite effects, promoting migration and metastasis in cutaneous melanoma, and collagen-induced migration in triple negative breast cancer, but suppressing migration and metastasis in these same cancers in response to fibronectin (Castro-Sanchez, Soto-Guzman, Navarro-Tito, Martinez-Orozco, & Salazar, 2010; Longo et al., 2001; Powner, Kopp, Monkley, Critchley, & Berditchevski, 2011; Yin et al., 2014).
- Clonogenicity is considered a hallmark property of malignant cancer cells, or cells transforming from benign to malignant type (Brix, Samaga, Belka, Lauber, & Zitzelsberger, 2021; Fiebig, Maier, & Burger, 2004). Cells that exhibit enhanced clonogenicity have also been found to express higher amounts of stem-cell markers, such as ALDH, CD31, and OCT4 (Toledo-Guzman, Hernandez, Gomez- Gallegos, & Ortiz-Sanchez, 2018; Yang et al., 2022; Zhang et al., 2023). The data here show that that cells whose PTGFRN expression has been inhibited have a lower clonogenicity.
- Cadherin and PTGFRN likely associate with each other, either directly, or via a larger complex.
- the silencing of PTGFRN inhibiting both Integrin ⁇ 1 and E. Cadherin accumulation in 3D culture lends further evidence that PTGFRN can modulate the activity of multiple proteins and protein complexes involved in cell migration and spheroid growth.
- the integrin protein family plays a crucial role in mediating cell attachment to the extracellular matrix (ECM), and their disruption can trigger anoikis, a form of cell death (Frisch & Screaton, 2001). In these conditions, autophagy is often activated as a survival mechanism to combat detachment-induced anoikis (Vlahakis & Debnath, 2017). Additionally, Integrin ⁇ 1 specifically has been found to be involved in regulating autophagy (Zhou, Liu, Zhou, & Li, 2022). E. Cadherin is also linked to autophagy, as it is sequestered into the autophagosome in breast and lung cancers (45, 46). This autophagy-driven degradation of E.
- Cadherin is believed to regulate tumor progression, as the loss of E. Cadherin is commonly observed in migratory cells, breast cancers with poor prognosis, and dormant cancer cells (Lazova et al., 2012; Vera-Ramirez, 2020). Determining whether the observed autophagy after PTGFRN knockdown is protective or induces cell death would provide valuable insights. If this autophagy is determined to be pro-death, it would support the positive correlation between PTGFRN expression and a metastatic-like phenotype. It is hypothesized that PTGFRN knockdown leads to a disruption of Integrin ⁇ 1 complexing, which prevents E. Cadherin accumulation necessary for spheroid formation, but also induces cellular stress on cancer cells, leading to pro-survival autophagy signalling to counteract anoikis.
- PTGFRN cell-surface transmembrane protein
- A431 epidermoid carcinoma
- DAOY pediatric medulloblastoma
- MSTO-211H mesothelioma
- Example 2 Effect of PTFGRN Expression on the Proteomic Profile of A431 Cells and Determination of the PTGFRN Interactome
- A431 (CRL-1555) was cultured in Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 medium (DMEM/F12 1 : 1 mixture) supplemented with 50 ⁇ g/ml Gentamycin and 5% FBS, and maintained in a 5% CO 2 incubator at 37°C.
- DMEM Modified Eagle Medium
- Ham F12 medium
- A431 cells were stably transfected with two different human PTGFRN shRNAs (Fenics Bio, HSH321177-100), in order to silence PTGFRN expression (shRNA #1 sequence: TAGCCTTAAGAATGAATATGAA (SEQ ID NO: 209); shRNA #2 sequence: GTGGTATGTTTTGCTTTCCTAA (SEQ ID NO: 210), as well as one scrambled shRNA as control. Transfections were carried out with Lipofectamine 3000 reagent (Thermo Fisher, L3000015), according to manufacturer’s instructions.
- the pooled cells were sorted and dispensed as single cells into a 96-well plate by the Hana Single Cell Dispenser (Namocell, #NI004). These single cell clones were then expanded and screened via flow cytometry and immunoblot for the lowest PTGFRN-expressing clone.
- IP immunoprecipitations
- Proteins were extracted, and separated on a nanoACQUITY Ultra-Performance Liquid Chromatography analytical column (BEH130 C18, 1.7 pm, 75 pm x 200 mm; Waters Corporation, Milford, MA, USA) over a 185-min linear acetonitrile gradient (3-40%) with 0.1% formic acid on a nanoACQUITY Ultra-Performance Liquid Chromatography system (Waters Corporation, Milford, MA USA) and analyzed on a coupled Orbitrap Fusion Lumos Tribrid mass spectrometer (Thermo Scientific, San Jose, CA USA). Full scans were acquired at a resolution of 240,000m/z, and precursors were selected for fragmentation by high-energy collisional dissociation of 35% for a maximum 3-s cycle.
- the MS/MS raw files were processed with Proteome Discoverer (PD, version 2.5.0.400, Thermo Fisher Scientific) using Sequest HT search engine against a UniProt human reference proteome (release 2022.04, 20292 entries). Searches were configured with static modifications for carbamidomethyl on cysteines (+57.021 Da), dynamic modifications for oxidation of methionine residues (+15.995 Da), precursor mass tolerance of 20 ppm, fragment mass tolerance of 0.5 Da. Trypsin was used as digestion enzyme with maximum of two missed cleavages. The minimum and maximum peptide lengths were set as 6 and 144, respectively.
- IPA Ingenuity Pathway Analysis
- the aim of our current study was to investigate the effect of PTGFRN knockdown on the proteome of A431 cells.
- mass spectrometric analysis was performed with A431 cells where PTGFRN expression had been inhibited by shRNA transfection (A431 shRNA), and on control A431 cells transfected with a scrambled shRNA sequence, cultivated in 2D culture conditions.
- the proteomic analysis resulted in the identification of 5680 protein groups at 1% FDR after filtering the processed data as described in the method section. Among these protein groups, 3455 were quantified without missing values in any of the 12 samples. Any protein whose expression was significantly increased or decreased in response to PTGFRN knockdown was assessed.
- pathway analysis using Metascape or IPA analysis in order to determine what cellular functions and pathways were most affected by the decrease of PTGFRN expression.
- these results could also be pointing to an intracellular form of PTGFRN whose functions differ from those associated with its plasma membrane form. It is unclear at this time if these differing functions could be due to distinct isoforms through alternative splicing, different glycosylation patterns, or if the subcellular location of PTGFRN influences its overall function. It is known that PTGFRN may have 3 putative splice sites, which could very well result in different isoforms with differing functions (Cunningham, et al. Nucleic Acids Res [Internet], 2022 Jan 7;50(Dl):D988-95).
- PTGFRN seems to be overwhelmingly associated with proteins involved in mRNA and protein translation/trafficking contributes other mechanisms by which PTGFRN affects cell proliferation and migration contributing to cancer metastasis.
- mass spectrometric analysis shed new light on the effect of PTGFRN expression on the proteome of A431 cells.
- Previously published findings were also confirmed, such as PTGFRN’ s role in VEGF signalling.
- Interactome analysis also provided added information regarding PTGFRN binding partners, showing PTGFRN association with proteins involved in mRNA/protein translation and processing. This information provides some pathways with which PTGFRN expression may affect cancer cell phenotype, and how it may correlate with metastatic-like profile, as previously reported.
- TC-mAb mice Human Ab producing Tc mice
- TC-mAb mice stably maintain a mouse- derived engineered chromosome containing the entire human Ig heavy and kappa chain loci in a mouse Ig knockout background
- Trans- chromosomic mice carrying mini-chromosomes with human immunoglobulin (Ig) loci can contribute to the development of fully human therapeutic monoclonal antibodies (Abs) when immunized with antigen of interest.
- TC-mAb mice were immunized with human recombinant PTGFRN extracellular domain protein (PTGFRN ECD) according to a schedule that has been previously validated.
- PTGFRN ECD human recombinant PTGFRN extracellular domain protein
- the anti -PTGFRN serum titer of immunized mice was checked by enzyme-linked immunoassay (ELISA) by incubating the sera with human PTGFRN ECD immobilized to 96-well plates, followed by incubation with HRP-conjugated goat anti-human Fc secondary antibody followed by addition of peroxidase substrate tetramethylbenzidine (TMB) and reading the absorbance at 650 nm of each well with a microtiter plate reader.
- TMB peroxidase substrate tetramethylbenzidine
- Fused hybridomas were single cell plated in semi-solid hybridoma culture medium in 10 cm tissue culture plates. After 11 days, 1248 single hybridoma clones were picked from the semi-solid medium plates and transferred to 96 well dishes (one clone per well) in hybridoma culture medium. After 4 days, culture media of the hybridoma clones were assayed in an initial screen by PTGFRN-ECD enzyme-linked immunoassay (ELISA) as described above.
- ELISA enzyme-linked immunoassay
- the top 246 positive clones were selected, transferred to 48-wells and supernatant assayed for a confirmatory screen by ELISA soloed by flow binding on Hek-293A cells overexpressing human PTGFRN cDNA (HEK-PTG) compared to binding to HEK293A cells (PTGFRN negative cells). 207 clones were confirmed strong positive for both ELISA and flow binding. These clones were transferred to six (6) well plates in duplicate and were cryo-preserved in appropriate culture conditions for long-term storage in liquid nitrogen while culture media containing secreted human anti-PTGFRN immunoglobulin were collected and stored for future evaluation and selection of hybridoma of interest.
- the anti-PTGFRN antibodies produced by these selected hybridoma clones were examined for several properties. Cell surface binding of the antibodies was determined by flow cytometric assay to HEK293 cells overexpressing PTGFRN (HEK-PTG) versus HEK293A (PTGFRN negative). Candidate anti-PTGFRN antibodies showing cell surface binding to HEK-PTG and less or no binding to HEK293A were then selected for further development. Internalization of candidate antibodies in the HEK-PTG cell line was determined using HEK-cells as negative control. Binding and internalization of candidate antibodies were then determined with human cancer cells known to naturally express PTGFRN including A431 cells, DAOY cells, and MSTO- 211H.
- A431 cells which express a high level of PTGFRN
- anti-PTGFRN antibodies without conjugation to cytotoxic agents was found to induce inhibition biological events which are hallmarks of metastasis (e.g., migration).
- FBS fetal bovine serum
- the cells were then treated with either 10 ⁇ g/ml of 8C7 antibody (anti-PTGFRN internalizing), 3G3 (anti-PTGFRN non internalizing), or Human IgG as control. After six (6) hours incubation with the respective antibodies, the cells were detached with PBS-EDTA and their migration ability determined by plating 7.5 x 10 4 cells in duplicate in collagen-treated Transwell devices in DME-F12 medium 0.1% bovine serum albumin on top of the Transwell device and DME-F12 medium with 5% FBS in the bottom well as attractant for migration for 20 hours. After the 20-hour period, the cells in the bottom of the Transwell were stained with crystal violet using standard protocol known to people in the art and counted (Table 23; each antibody being included at 10 ⁇ g/ml).
- FIG. 13 Additional data relating to the 8C7 antibody is presented in Fig. 13.
- A431 cells were incubated with non-immune human IgG and with an anti-PTGFRN antibody 3G3 which binds to PTGFRN but is not internalizing. All antibodies were assayed at a concentration of 10ug/ml. At the end of the incubation period, the cells were detached and evaluated for their migration potential by the transwell assay for five hours. As shown in Table 24 and Fig. 13, the cells that had been incubated in the presence of 8C7 antibody showed a 67% inhibition of migration over hlgG and a 75% inhibition of migration over the cells treated with 3G3. This indicates that even as a naked antibody without conjugation to a linker payload, 8C7 neutralizes the biological effect of PTGFRN. This neutralization effect of 8C7 antibody is probably associated with the ability to internalize PTGFRN.
- A431 cells had been preincubated for 6 hours with 10ug/ml of either hlgG, non-internalizing anti-PTGFRN 3G3 and internalizing 8C7 before being detached and evaluated for migration by the transwell assay.
- Exposure of A431 cells for 6 hours to 10 ug/ml of internalizing anti-PTGFRN 8C7 antibody led to a 70% inhibition of cell migration whereas incubation with non-internalizing anti-PTGFRN antibody 3G3 had no inhibitory effect on A431 cell migration when compared to negative control human IgG.
- the 8C7 antibody was further tested by flow cytometry and in additional internalization studies.
- the cell lines used in these studies were obtained from the American Type Culture Collection (ATCC, Manassas, VA).
- A431 CL-1555
- DAOY HBV-186
- MSTO-211H CL-2081
- MDA-MB-231 CM-HTB-26 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 medium (DMEM/F12 1 :1 mixture) supplemented with 50 ⁇ g/ml Gentamicin and 5% FBS, and maintained in a 5% CO 2 incubator at 37°C.
- DMEM Modified Eagle Medium
- F12 medium DMEM/F12 1 :1 mixture
- the anti-PTGFRN antibody 8C7 was selected for its internalizing properties, and its KD of 10 -12 M determined by Bi-Layer Interferometry (BLI) using Octet Red96.
- the 8C7 antibody is an IgGl, which is considered to be a favorable isotype for ADC development (Baah, et al. Molecules.
- cytotoxic assays used to characterize candidate antibodies include inhibition of cell proliferation and viability using indirect antibody drug conjugate combination assays (Marquez, et al. (2021) "Identification of Prostaglandin F2 Receptor Negative Regulator (PTGFRN) as an internalizing target in cancer cells for antibody-drug conjugate development.” PLoS One 16(1): e0246197). These assays are briefly described below.
- PTGFRN positive cancer cells were incubated for three days with candidate anti-PTGFRN antibodies (e.g., 4F8, 6B2, 8C7, and 12D8) and with Fab Anti-Human IgG Fc-Duocarmycin DM Antibody including a cleavable linker.
- Negative control consisted of cells incubated with human IgG and the Fab anti-human IgG-duocarmycin conjugate. After three (3) days, cells were lysed, and cell proliferation was measured by the Cell-Glo assay (Promega).
- the indirect assay data for the 8C7, 4F8 and 12D8 antibodies is summarized in Fig. 16. As shown in Fig- 16, all three antibodies (8C7, 4F8 and 12D8) evaluated showed ability to inhibit A431 cell proliferation and viability (being equivalent to survival) in a dose- dependent fashion with 8C7 being the most potent.
- duocarmycin conjugates of candidate anti-PTGFRN antibodies were prepared using the method described below. Briefly, the candidate antibody was conjugated to Mc-Vc-PAB-Duocarmycin (VcDuo) linker payload (MedChem Express HY- 128904) via cysteine.
- Candidate antibody solution in 10% N,N-dimethylacetamide (DMA) was incubated for 1 hour on ice with Vc-Duocarmycin (MedChem Express HY- 128904 ) (1 eq M -SH: 1.2 eq M Payload).
- the reaction was stopped by adding 20X M excess of Cysteine-HCl (IM Stock) at room temperature for 30 minutes followed by buffer exchange to phosphate buffer saline (PBS).
- An antibody-drug conjugate (ADC) is thereby produced. This can be followed by purification, such as using hydrophobic chromatography on a butyl-Sepharose column.
- the resulting ADC can then be buffer exchanged into PBS, sterile filtered and aliquoted in separate tubes, kept frozen at -80°C until use.
- duocarmycin was efficacious in combination with anti-PTGFRN to inhibit the proliferation and viability of cells expressing PTGFRN.
- ADC antibody drug conjugate
- the cell lines examined were the human epidermoid carcinoma A431, the breast cancer cell MDA-MB-468 2E12 (which moderately expresses PTGFRN), and MDA-MB-468 4C5 cell lines (which overexpress PTGFRN by cDNA transfection).
- Increasing doses of 8C7-ADC or 4F8-ADC from 0.1 nM to 10 nM (8C7-ADC at 0.1 nM, 1 nM, and 10 nM) and 20 nM (4F8-ADC at 0.1 nM, 1 nM, 10 nM, and 20 nM) were assayed on cell survival of the three cell lines.
- the data are presented in Fig. 17.
- 8C7-ADC at concentration ⁇ 1 nM inhibits the cell survival of the high expressing PTGFRN cell lines A431 (blue bars) and MDA-4C5 (grey bars) with a modest effect on the low PTGFRN expressing cell line MDA-2E12 at concentration of 10nM.
- 4F8-ADC at concentration ⁇ 1 nM strongly inhibits the cell survival of MDA-4C5 with a modest, effect, on A431 except at 20nM with a 40% inhibition of A431 cell survival at 20 nM, with no effect on the low PTGFRN expressing cell line MDA-2E12.
- a 6B2 duocarmycin conjugate was also prepared as described above and tested in vitro on A431 cells.
- Fig. 18 The results for 0.1 nM, 0.5 nM, 1 nM, 5 nM, 10 nM and 20 nM of 6B2-ADC on A431 proliferation are presented in Fig. 18.
- the data presented in Figs. 17-18 show that the ADCs have different efficacy in cells expressing different levels of PTGFRN and are distinct and have both distinct utilities going forward to develop anti -PTGFRN ADC drug.
- FIG. 19 An additional study regarding the 8C7-ADC is presented in Figure 19.
- the 8C7-ADC was examined in vitro for its ability to inhibit the proliferation of PTGFRN-expressing cell lines such as epidermoid carcinoma (A431), biphasic mesothelioma (MSTO-211H), and pediatric medulloblastoma (DAOY).
- PTGFRN-expressing cell lines such as epidermoid carcinoma (A431), biphasic mesothelioma (MSTO-211H), and pediatric medulloblastoma (DAOY).
- ADC epidermoid carcinoma
- MDA-MB-231 triple-negative breast cancer cell line
- treatment with the 8C7-ADC showed a dose-dependent inhibition of cell proliferation in all cell lines expressing PTGFRN.
- A431 proliferation was reduced by 95%
- DAOY proliferation was reduced by 80%
- MSTO-211H proliferation was reduced by approximately 40% at the highest dose tested of 10nM. This degree of inhibition appears to follow the level of expression of PTGFRN in these three cell lines.
- the low PTGFRN- expressing MSTO-211H cells still demonstrated a reduced, yet significant inhibition of proliferation, compared to high PTGFRN-expressing cell lines A431 and DAOY.
- the PTGFRN-negative cancer line, MDA-MB-231 showed no growth inhibition when treated with 8C7-ADC, even at the highest concentration evaluated, indicating the specificity of the 8C7-ADC for PTGFRN.
- mice were injected subcutaneously (s.c.) with cells (from 0.5 x 10 6 to 2 x 10 6 cells/mouse) depending on the cell line. When the tumor become apparent and reached 50-100 mm 3 , mice were randomized to the experimental groups (8 mice/group).
- Antibody drug conjugate was injected intraperitoneally (i.p.) once a week with control group being injected with an isotope control human antibody directly conjugated to duocarmycin using the method described above. Tumor dimensions were determined weekly with a caliper and tumor volume calculated from them. At the end of the experiment, mice were euthanized to collect tumors and determine body, tumor and organ weights. Data regarding the 8C7 ADC is shown in Fig. 20A-F Figs. 20A-B present data using A431 squamous carcinoma cells. Figs. 20C-D present data generated using DAOY medulloblastoma cells. Figs. 20E-F present data generated using MSTO-211 H mesothelioma cells.
- the 4F8 and 8C7 antibodies were found to exhibit excellent Kd measurements ranging up to 10 -12 M to 5.2 x 10 -9 M, suitable for drug development.
- PDX patient derived xenografts
- Tumor sample PDX1 exhibited the highest level of expression when normalized to GAPDH expression as internal standard. Based on this data and on the growth rate of these tumors, PDX1 was selected as a PDX tumor candidate to examine the effect of 8C7-ADC in vivo.
- Figs. 22 and 23 The effect of 8C7-ADC compared to isotype control ADC on the growth of patient-derived head and neck tumors in NRG mice (xenografts) is shown in Figs. 22 and 23.
- Female NRG mice were implanted with head and neck tumors JZ0628. When tumors reached 100 mm 3 , the mice were randomized into two experimental groups, the first group receiving once weekly ip (intraperitoneal) for 44 days isotype control duocarmycin ADC and the second group receiving 8C7-duocarmycin ADC.
- Fig. 22 shows a steady tumor growth in the control group while the 8C7 treated group showed little growth (p ⁇ 0.05).
- the tumor growth in mice treated with 8C7-ADC showed a 73% decrease in doubling time (Fig.
- Fig. 23 shows that even after stopping treatment, the tumors in the 8C7-group did not start growing (square symbols as compared to round symbols), indicating that the 8C7- ADC has a long-lasting effect.
- PTGFRN is an excellent therapeutic target elevated in several human cancers and no or low level in normal tissues.
- PTHFRN is associated with several hallmarks of aggressive cancers such as increased migration, ability to grow in colonies, ability to proliferate in low serum conditions and to form spheroids in 3D-culture conditions.
- 8C7 was shown to inhibit migration of A431 cells. Taken together, these results indicate that PTGFRN could be a valuable new ADC target as PTGFRN negative cells showed no response to the 8C7-ADC, while tumors that express low level of PTGFRN, such as the MSTO-211H tumors, still demonstrated a statistically significant response to the 8C7-ADC. Tumors that displayed high PTGFRN expression, such as A431 and DAOY tumors, exhibited a high reduction in tumor growth in response to the 8C7-ADC, demonstrating its efficacy.
- Examples 1-3 herein show that PTGFRN is overexpressed in cancer and is negative or at low level in healthy tissues.
- PTGFRN silencing in the epidermoid carcinoma A431 cells leads to inhibition of hallmarks of cancer aggressiveness such as migration, proliferation in low serum, clonogenicity and 3D spheroid formation.
- This disclosure provides fully human antibodies produced by immunizing humanized transgenic mice with human PTGFRN. By combining the use of TC mice with a proprietary immunization approach, several functional anti-PGRN antibodies have been developed and selected. The Kd of these antibodies varies between 10 -12 M and 10 -9 M.
- selected antibody 8C7 is rapidly internalized and forms an ADC by cysteine conjugation with Val-Cit- Duocarmycin.
- the 8C7-ADC inhibited in vitro proliferation of A431 cells in a dose dependent fashion.
- the 8C7-ADC inhibited A431 tumor formation and shown to be cytostatic for tumor growth of Head and Neck PDX.
- the hybridoma cell line for each antibody was thawed and put in culture. The cells were counted and reverse transcription performed to convert the RNA thereof to cDNA. Several PCR reactions were performed to amplify the heavy chain and light chain variable region sequences of each antibody with several pairs of mouse heavy and light chain specific primers. PCR products were loaded on an agarose gel and electrophoresis performed to confirm the correct PCR bands were produced. The PCR products were mixed and each sequenced by Miseq sequencer. The NGS sequencing data for each PCR product was processed with BCR analysis software.
- nucleotide and amino acid sequences of four fully human antibodies produced by the 4F8, 6B2, 8C7, and 12D8 hybridoma clones were determined as described below. DNA sequence data from all constructs were analyzed and consensus sequences for heavy and light chain determined. The consensus sequences are compared to known variable region sequences to rule out artifacts and/or process contamination. Consensus sequences are then analyzed to verify that the sequences could encode a productive immunoglobulin.
- the amino acid sequences of the complementarity determining regions (CDRs) for each of the 4F8, 6B2, 8C7, and 12D8 were determined according to the Kabat and Chothia methods as presented below (presented in bold and underlined for each).
- CDRs were also determined by an alternative method as shown in Figs. 6-13 and Tables 4-7.
- the 4F8 antibody was determined to be an IgG4 Kappa antibody.
- the 6B2, 8C7 and 12D8 antibodies were determined to be IgGl Kappa antibodies.
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Life Sciences & Earth Sciences (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
This disclosure provides antibodies and methods for preparing and using the same wherein the antibodies bind to PTGFRN on a cell.
Description
ANTIBODIES AND CONJUGATES AGAINST PROSTAGLANDIN F2 RECEPTOR INHIBITOR AND USES THEREOF
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Ser. No. 63/495,835 filed on April 13, 2023, which is incorporated herein in its entirety.
FIELD OF THE DISCLOSURE
[0002] The present disclosure relates to fully human antibodies and related molecules that bind to Prostaglandin F2 Receptor Inhibitor (PTGFRN). The present disclosure also relates to molecules comprising, or alternatively consisting of, full-length antibodies, antibody fragments or variants thereof. The present disclosure further relates to the amino acid and nucleic acid sequences coding for such antibodies. The present disclosure also relates to antibodies against PTGFRN (anti-PTGFRN antibodies) and, in some especially preferred embodiments, antibody conjugates (e.g., antibody-drug conjugates or immunoconjugates) comprising the anti-PTGFRN antibodies, compositions comprising the anti- PTGFRN antibodies, and methods for using the anti-PTGFRN antibodies, and their conjugates for treating conditions associated with PTGFRN expression (e.g., cancer). The disclosure further comprises the use of said antibodies, antigen-binding fragment thereof, or antibody-drug conjugates and corresponding processes, for detecting and diagnosing pathological disorders associated with expression of PTGFRN. The disclosure finally comprises products and/or compositions or kits comprising at least such antibody or antibody-drug conjugate for the prognosis or diagnostic or therapy monitoring of such disorders.
BACKGROUND OF THE DISCLOSURE
[0003] Prostaglandin F2 receptor negative regulator (“PTGFRN”) is a member of the subfamily of proteins known as tetraspanins. Tetraspanins are proteins which bind and interact with each other, and with multiple partners, forming what is knowns the “tetraspanin web”. This “web” and its members serve as signalling molecules for a wide range of processes, such as fertilization (Glazar, et al. Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: Evidence of distinct functions for CD9 and a CD9- associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 2009;21(2):293-
303; Swegen et al. From Peptide Masses to Pregnancy Maintenance: A Comprehensive Proteomic Analysis of The Early Equine Embryo Secretome, Blastocoel Fluid, and Capsule. Proteomics. 2017; 17(17—18): 1—13), migration (Chambrion, et al. The tetraspanins CD9 and CD81 regulate CD9P1- induced effects on cell migration. PLoS One. 2010;5(6)), and accumulation of lipids in preadipocytes (Orlicky et al. Synthesis and accumulation of a receptor regulatory protein associated with lipid droplet accumulation in 3T3-L1 cells. J Lipid Res. 1998;39(6): 1152-61). In addition, PTGFRN has been observed to affect extracellular vesicle bioactivity (Xu et al. Human perivascular stem cell-derived extracellular vesicles mediate bone repair. Elife. 2019;8: 1-23), non-alcohol fatty liver disease (Hotta et al. Identification of the genomic region under epigenetic regulation during non-alcoholic fatty liver disease progression. Hepatol Res. 2018;(48):320-34), and Alzheimer’s disease (Gerber et al. The APMAP interactome reveals new modulators of APP processing and beta-amyloid production that are altered in Alzheimer’s disease. Acta Neuropathol Commun. 2019;7(l): 13). While the molecular mechanism of these interactions is not fully established, it has been hypothesized that members of tetraspanins binding to each other may facilitate and strengthen their binding to other partners (Charrin et al. Multiple levels of interactions within the tetraspanin web. Biochem Biophys Res Commun. 2003;304(l): 107-12, 2003; Mazurov et al. Tetraspanin protein CD9 interacts with metalloprotease CD10 and enhances its release via exosomes. FEBS J. 2013;280(5): 1200-13).
[0004] Tetraspanins are the basis for complexes known as Tetraspanin-Enriched Microdomains (TEMs). TEMs have been found to facilitate signalling in many different cellular pathways by acting as scaffolds for protein interaction and/or stabilization (Mazzocca et al. Tetraspanin-enriched microdomains and hepatocellular carcinoma progression. Cancer Lett [Internet], 2014;351(1):23— 9 available from: http://dx.doi.Org/10.1016/j.canlet.2014.05.016; Yauch et al. Highly stoichiometric, stable, and specific association of integrin α3β1 with CD151 provides a major link to pho sphatidylinositol 4-kinase and may regulate cell migration. Mol Biol Cell. 1998;9(10):2751- 65). It has been shown that cell surface PTGFRN is internalized upon antibody binding, and this suggests PTGFRN as a therapeutic target for certain cancer cell types expressing PTGFRN (Marquez, et al. Identification of Prostaglandin F2 Receptor Negative Regulator (PTGFRN) as an internalizable target in cancer cells for antibody-drug conjugate development." PLoS One 16(1): e0246197). At the mRNA level, PTGFRN expression is increased in metastatic cancer cells (Karhemo et al. An optimized isolation of biotinylated
cell surface proteins reveals novel players in cancer metastasis. J Proteomics [Internet], 2012;77:87-100. Available from: http://dx.doi.org/10.1016/jjprot.2012.07.009). Moreover, PTGFRN expression is associated with biological functions that play important roles in tumor development. Aguila et al. showed that PTGFRN was overexpressed in glioblastoma, and higher expression of PTGFRN in tumors correlated with worse survival (Aguila et al. The Ig superfamily protein PTGFRN coordinates survival signaling in Glioblastoma multiforme. Cancer Lett. 2019;462(April):33-42). This laboratory has found by immunohistochemistry analysis of paraffin embedded mesothelioma lesions using an anti- PTGFRN antibody developed in this laboratory' and disclosed herein that PTGFRN expression was negative in normal pleura and increased in tumors proceeding from benign to malignant sessions (see, e.g., Fig. 1).
[0005] In a study published by Colin et. al, PTGFRN was found to be essential for angiogenesis, a necessary process in tumor growth (Colin et al. Br J Cancer. 2011; 105(7): 1002— 11). It has also been shown that PTGFRN can be internalized, and to connect the upregulation of PTGFRN to the ability to target cancer cells through an antibody- drug conjugate (ADC) (Marquez, et al. PLoS One 16(1): e0246197). Given that PTGFRN is upregulated in metastatic cancers, developing an antibody which could be used as-is or as an antibody drug conjugate (ADC) would be beneficial as a potential targeted therapy. There have been several antibody drug conjugates (ADCs) approved by the Food and Drug Administration for hematological and solid tumors. Antibody-Drug Conjugates (ADCs) are a combination of biological and small-molecule drugs that have recently received increased interest as therapeutic choices in oncology. ADCs are composed of a monoclonal antibody (mAb), which specifically binds to a cell surface target, a linker, and a cytotoxic payload. After binding to its cell-surface antigen, the mAb induces endocytosis of said antigen, shuttling the toxic payload inside the cell. Depending on the linker type, the toxic payload is released from the mAb via a cleavable linker, and exits the lysosome either before or during proteolysis (Tsuchikama, et al. Antibody-drug conjugates: recent advances in conjugation and linker chemistries. Protein Cell. 2018;9(1):33— 46). Alternatively, with the use of a non- cleavable linker, the payload cannot enter the cytosol until after the lysosome fully degrades, at which point it is then free to perform its anti-cancer effect (Jain et al. Current ADC Linker Chemistry. Pharm Res. 2015;32(11 ):3526— 40). Additionally, there has also been an increased focus on those that do not require internalizing into the cell interior for their therapeutic effect. There are also ADCs with non-radioactive conjugates that still rely on extracellular
cleavage of their linker, which allows for the diffusion of the cleaved drug across the cell. In fact, the recently approved ADC Troveldy (Sacituzumab govitecan) operates in just such a manner (Cardillo et al. Clin Cancer Res. 2011; 17(10):3157 -69). An ADC approved for solid tumor-targeting is Kadcyla, or T-DM1 (Diamantis, et al. Br J Cancer 2016; 114(4):362— 7) to treat HER-2 overexpressing breast cancer. It is derived from the anti-HER2 monoclonal antibody Trastuzumab which has been originally approved by the FDA as an unconjugated therapeutic antibody for the treatment of HER2 overexpressing breast cancer. In the case of Kadcyla®, Trastuzumab is conjugated to emtansine via a non-reducible thioether linker. Once T-DM1 enters the cell, emtansine binds tubulin, it leads to cell death by mitotic arrest (Teicher, et al. The Promise of Antibody-Drug Conjugates. N Engl J Med. 2012;367(19): 1847- 8). T-DM1 has been reported to be more potent than Trastuzumab. HER- 2-positive cancer patients treated with T-DM1 have a 3-year disease-free survival rate of 88.3%, compared to 77% in patients treated with Trastuzumab (Von Minckwitz et al. Trastuzumab Emtansine for Residual Invasive HER2 -Positive Breast Cancer. N Engl J Med. 2018;380(7):617). The newest generation in HER2-targeting ADCs, Trastuzumab deruxtecan shows great effect even in patients whose HER2 expression was immunohistologically scored as lower than 3+ and considered “HER2 negative”(Modi, et al. (2022). "Trastuzumab Deaixtecan in Previously Treated HER2-Low Advanced Breast Cancer." New England Journal of Medicine 387(1): 9-20). Other FDA-approved ADCs include, for example, rentuximab Vedotin, which targets CD30/TNFRSF8; Gemtuzumab Ozogamici which targets CD33/SIGLEC-3; Inotuzumab ozogamicin, which targets CD22; polutuzumab vedotin-piiq, which targets CD79b; Enfortumab vedotin, which targets Nectin-4; and, Belantamab mafodotin, which targets CD269. See, e.g., Kitson et, al Antibody-Drug Conjugates (ADCs)- Biotherapeutic bullets. Chem Today. 2013;31(August):30-6; Kantarjian et al. N Engl J Med. 2016;375(8):740— 53 ; Tilly et al. J Clin Oncol. 2019;37(15_suppl):TPS7571-TPS7571; Halford et al. Ann Pharmacother. 2020; and, Tzogani et al. Oncologist. 2020;31(0): 1 -7). Very recently, the FDA approved Sacituzumab Govitecan, which targets Trop2 for metastatic breast cancer therapy. These data emphasize the need in identifying more cancer-related targets at the basis for new ADC therapy, particularly for solid tumors with unmet needs for targeted therapies (Zhao et al. Acta Pharm Sin B. 2020; 10(9): 1589-600). These results are encouraging to develop ADC targeting PTGFRN for several cancer types such as squamous cell carcinoma, head and neck cancers, glioblastoma, pediatric medulloblastoma or mesothelioma which express PTGFRN and have limited targeted therapeutic options.
[0006] Despite the numerous examples above, there remains a need in the art for monoclonal antibody-based therapeutics. In particular, there remains a need in the art for fully human antibody therapeutics that can be used bind, detect, image, treat, and/or eliminate cancer cells, thereby providing opportunities for new therapeutic development. This need and others are met by the present disclosure. This disclosure thereby providing solutions to these and other art-recognized, and unrecognized, problems.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIG. 1. PTGFRN expression by immunohistochemistry (IHC) in paraffin- embedded lung (normal, Fig. 1A) and mesothelioma (benign, Fig. IB; malignant, Fig. 1C) tissues using an anti-PTGFRN mouse monoclonal antibody [(1B4??)] for staining. Tissue microarrays were stained using the IHC antibody 1B4 to assess expression level of PTGFRN. Healthy non-cancerous tissue, such as colon (Fig. ID), breast (Fig. IE), lung (Fig. IF), kidney (Fig. 1G), prostate (Fig. 1H), and spleen (Fig. II) show no detectable levels of PTGFRN, whereas cancerous tissue samples from squamous cell carcinoma (Fig. 1J), melanoma (Fig. IK), pancreatic duct adenocarcinoma (Fig. IL), papillary renal cell carcinoma (Fig. IM), and clear cell carcinoma (Fig. IN) all show elevated expression levels of PTGFRN.
[0008] FIG. 2. PTGFRN expression level after transfection of shRNA or PTGFRN cDNA. Western Blot analysis shows that PTGFRN expression was significantly decreased after shRNA transfection in A431 and DAOY cells, and significantly increased after cDNA transfection in MSTO-211H cells. Relative increase or decrease in expression was estimated using commercial quantitative software, normalized to GAPDH expression. Data are presented as mean ± SD (n= 3).
[0009] FIG. 3. Flow Cytometry Analysis of PTGFRN expression level after transfection of shRNA or PTGFRN cDNA. Flow cytometry analysis using the anti- PTGFRN antibody 8C7 confirms that PTGFRN expression was significantly decreased after shRNA transfection in (A) Control shRNA A431, (B and C) A431 shRNAl and shRNA2, (D) Control shRNA DAOY, (E and F) DAOY shRNAl and shRNA2. Transfection of human PTGFRN cDNA into MSTO-211H cells results in a significant increase in PTGFRN expression (G) empty vector MSTO-211H, (H) MSTO-PTG. Data are presented as mean ± SD (n= 3).
[0010] FIG. 4. Proliferative capability of cells after PTGFRN silencing/overexpression. Cells were plated in DME/F12 medium supplemented with 0.2% FBS as described in the method section. Ability to proliferate at low serum levels (0.2% FBS) was severely decreased after PTGFRN silencing by shRNA in (A) A431 and (B) DAOY cells, while PTGFRN overexpression in (C) MSTO-211H resulted in a significant increase in proliferation. Data are presented as mean ± SD (n= 3). Significance: ****p< 0.0001, relative to control cells.
[0011] FIG. 5. Effect of PTGFRN expression on migration capability. (A) PTGFRN silencing via shRNA in A431 and DAOY cells results in a significant reduction in cell migration, while (B) overexpressing PTGFRN in MSTO-211H cells resulted in a significant increase in migration levels. Data are presented as mean ± SD (n= 3). Significance: **p< 0.005, ****p<0 .0001, relative to control cells.
[0012] FIG. 6. PTGFRN expression affects cell’s ability to grow in colonies. Reduction in PTGFRN expression in A431 and DAOY (A) results in less colonies formed when plated at low cell density, while PTGFRN overexpression in MSTO-211H (B) shows a significant increase in colonies under these same conditions. Data are presented as mean ± SD (n= 3). Significance: ***p< 0.001, ****p< 0.0001, relative to control cells.
[0013] FIG. 7. Knockdown of PTGFRN expression inhibits spheroid formation. Fig. 7A and Fig. 7B. Loss of PTGFRN via shRNA knockdown prevented A431 and DAOY cells from forming spheroids in 3D culture conditions. Any aggregates that did form in the DAOY shRNA clones broke apart when disturbed. Fig. 7C. PTGFRN shRNA transfected A431 cells grown in spheroid culture conditions did not show increase in Integrin β1 and E. Cadherin levels seen in control shRNA spheroids. This decrease in E. Cadherin and Integrin β1 after PTGFRN knockdown was not seen in cells grown in 2D culture conditions. Relative increase or decrease in expression was estimated using commercial quantitative software, normalized to GAPDH expression. Data are presented as mean ± SD (n= 3).
[0014] FIG. 8. Co-localization of PTGFRN, E. Cadherin, and Integrin β1. Immunofluorescence using specific antibodies show that E. Cadherin (Green) (Fig. 8A), PTGFRN (Red) (Fig. 8B), and Integrin β1 (Purple) (Fig. 8C) co-localize together in the cell junction areas (Pink). Nucleus counterstained with Hoechst 33342 (Blue).
[0015] FIG. 9. Effect of siRNA Knockdown on Expression Level of Other Proteins. siRNA knockdown of E. Cadherin and Integrin β1 has no effect on the expression of PTGFRN (Fig. 9A). siRNA knockdown of PTGFRN and Integrin β1 has no effect on the expression of E. Cadherin (Fig, 9B). siRNA knockdown of PTGFRN has no effect on the expression of Integrin β1, while E. Cadherin expression seems to slightly increase after siRNA knockdown of Integrin β1 (Fig. 9C). Relative increase or decrease in expression was estimated using commercial quantitative software, normalized to GAPDH expression. Data are presented as mean ± SD (n= 3).
[0016] FIG. 10. PTGFRN Knockdown Influences Autophagy. Knockdown of PTGFRN in A431 cells results in an increase in the conversion of LC3B. This is visible via (Fig. 10A) fluorescent microscopy using a fluorescent antibody specific to LC3B (red), as well as (Fig. 10B) immunoblot with an antibody specific to LC3B, including the positive control of A431 cells treated with metformin. Relative increase or decrease in expression was estimated using commercial quantitative software, normalized to GAPDH expression. Data are presented as mean ± SD (n= 3). Significance: ***p< 0.001, ****p< 0.0001, relative to control cells.
[0017] FIG. 11. Mass Spectrometric Proteome Analysis after PTGFRN Knockdown. Heat map displaying the top 20 cellular processes upregulated after PTGFRN knockdown based on upregulated protein expression (Fig. 11 A), and the top 20 cellular processes downregulated after PTGFRN knockdown based on downregulated protein expression (Fig. 11B). Statistical significance was determined by Student T-test analysis. All results shown meet threshold of p<0.05.
[0018] FIG. 12. Enriched Biological Processes / Pathways after PTGFRN Knockdown.
[0019] FIG. 13. A431 cells were preincubated for 6 hours with 10ug/ml of either hlgG, non-internalizing anti-PTGFRN 3G3, or internalizing 8C7 before being detached and evaluated for migration by the transwell assay.
[0020] FIG. 14. Flow cytometric analysis using the 8C7 antibody.
[0021] FIG. 15. Internalization of PTGFRN by 8C7. Binding of 8C7 antibody to PTGFRN induces endocytosis of the receptor. Incubation with 8C7 (Green) at 37°C for Time
0 (Fig. I 5A), three (3) hours (Fig. I 5B), and five (5) hours (Fig. I 5C). Hoechst 33342 was used to counterstain nuclei (Blue); 60X Magnification.
[0022] FIG, 16, Effect of selected fully human anti-PTGFRN antibodies on A431 cell proliferation and viability.
[0023] FIG. 17, Effect of 8C7-Duocarmycin and 4F8-Duocarmycin conjugates on the proliferation and viability on several cell lines.
[0024] FIG, 18. Effect of increasing concentrations of 6B2-duocarmycin conjugate on A431 proliferation and viability.
[0025] FIG, 19. In Vitro Activity of 8C7-Duocarmycin ADC. Incubation of 8C7- Duocarmycin with PTGFRN -positive cancer cell lines results in potent anti-cancer effect. No effect is seen in a cancer cell line that is PTGFRN-negative (MDA-MB-231). Error bars are representative of standard deviation (**= P < 0.005; ****= p < 0.00005).
[0026] FIG. 20. Administration of fully human anti-PTGFRN 8C7-Duocarmycin antibody drug conjugate inhibits in a dose-dependent fashion the tumor growth of the three human cancer cell lines A431 (Fig. 20A-B), MSTO-211H (Fig. 20C-D), and DAOY (Fig. 20E-F).
[0027] FIG. 21. Western Blot analysis of PTGFRN expression in seven head neck cancer in patient derived tumors. 30 μg of seven different PDX tumor lysates were analyzed by SDS-PAGE electrophoresis followed by transfer onto PVDF membrane for western blot analysis using anti-PTGFRN antibody. As positive control, 30 ug of A431 cell lysates were analyzed. The expression of GAPDH was used as an internal standard for equal loading.
[0028] FIG. 22. Effect of 8C7-ADC compared to isotype control ADC on the growth of patient-derived Head and Neck tumors in NRG mice. Female NRG mice were implanted with head and neck tumors JZ0628. When tumors reached 100 mm3, the mice were randomized into two experimental groups, the first group receiving once weekly ip (intraperitoneal) for 44 days isotype control duocarmycin ADC and the second group receiving 8C7-duocarmycin ADC.
[0029] FIG. 23. Long term effect of 8C7-ADC on H/N tumor growth after stopping treatment. On day 44, the 8C7 treatment was stopped in the 8C7-ADC group and mice were maintained under observation for an additional 15 days to determine tumor growth.
[0030] FIG. 24. In Vivo Treatment of PTGFRN -Negative Tumors in Nude Mice. Treatment of nude mice bearing PTGFRN-negative MDA-MB-231 tumors with our 8C7- Duocarmycin antibody shows no difference in tumor growth compared to Control ADC, with no obvious signs of toxicity, indicating high specificity of our 8C7 antibody.
[0031] FIG. 25. Exemplary 4F8-IgG(VH) antibody amino acid and nucleotide sequences.
[0032] FIG. 26. Exemplary 4F8-IgK(VL) antibody amino acid and nucleotide sequences.
[0033] FIG. 27. Exemplary 6B2-IgG (VH) antibody amino acid and nucleotide sequences.
[0034] FIG. 28. Exemplary 6B2-IgK (VL) antibody amino acid and nucleotide sequences.
[0035] FIG. 29. Exemplary 8C7-IgG (VH) antibody amino acid and nucleotide sequences.
[0036] FIG. 30. Exemplary 8C7-IgK (VL) antibody amino acid and nucleotide sequences.
[0037] FIG. 31. Exemplary 12D8 -l-lgG (VH) antibody amino acid and nucleotide sequences.
[0038] FIG. 32. Exemplary 12D8- I-lgK(VL) antibody amino acid and nucleotide sequences.
SUMMARY OF THE DISCLOSURE
[0039] This disclosure relates to and provides isolated antibodies, antigen binding fragments, and/or derivatives thereof, the antibodies being antibodies 4F8, 6B2, 8C7, or 12D8, the antibodies comprising: a) a heavy chain variable region comprising the complementarity determining region (CDR) sequences shown in any of Tables 1-13 (optionally in some preferred embodiments including the framework (FR) amino acid sequences thereof); or a derivative of any one of the above, optionally wherein said derivative comprises one to four amino acid substitutions in at least one CDR thereof; wherein the antibody or derivative thereof specifically binds to human Prostaglandin F2 Receptor Inhibitor (PTGFRN). This disclosure also provides methods for making and using the same. In some preferred embodiments, this disclosure provides antibody -drug conjugates (ADCs) of the same. Polynucleotides and host cells comprising such polynucleotides are also provided. Other embodiments are also provided as will be apparent to those of ordinary skill in the art from this disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0040] The present disclosure provides isolated antibodies, antigen-binding fragments, and derivatives thereof that bind to prostaglandin F2 receptor inhibitor (PTGFRN), i.e., anti- PTGFRN antibodies. PTGFRN is also referred to by those skilled in the art as CD91P1 (CD9 partner 1), Glu-Trp-Ile EWI motif-containing protein F (EWIF), FPRP, KIAA1436, prostaglandin F2 receptor negative regulator, Prostaglandin F2-alpha receptor regulatory protein, and prostaglandin F2-alpha receptor-associated protein, among others. Such antibodies, antigen-binding fragments, and derivatives thereof may be attached to one or more functional (or effector) moieties (e.g., detectable moieties, cytotoxic moieties, etc.). The disclosure also includes the amino acid sequences of the variable heavy and light chain of the antibodies and their corresponding nucleic acid sequences. In one embodiment, an antibody of the disclosure may be a monoclonal antibody. In some embodiments, the present disclosure provides an isolated antibody or an antigen binding fragment thereof that specifically binds to Prostaglandin F2 Receptor Inhibitor (PTGFRN) and is internalized.
[0041] In some embodiments, this disclosure provides experiments using cell lines overexpressing PTGFRN by the non-limiting techniques of PTGFRN cDNA transfection or
inhibition of PTGFRN expression by SiRNA or Sh RNA transfection. These experiments demonstrated that PTGFRN expression was associated with the ability to proliferate in low- serum conditions, and to form colonies at low cell density, migrate through the transwell, and form spheroids in three-dimensional culture conditions. Since these are hallmarks and characteristic of cancer stem cells, this indicates that PTGFRN is a marker of and/or is associated with cancer stem cell phenotype. It is known that therapeutic development targeting proteins involved with cancer stem cell phenotype will provide powerful therapeutic solutions to address drug resistance caused by the maintenance of cancer stem cells that are not eliminated by standard of care therapies. This makes targeting PTGFRN important since its expression is associated or directly involved in cancer stem cells.
[0042] In some embodiments, this disclosure provides information about the direct development of fully human monoclonal antibodies to PTGFRN. The advantage of this strategy is that it bypasses the need to humanize mouse monoclonal antibody or to affinity mature by phage display antibodies. These processes are time consuming and cumbersome, and may bring changes to antibody affinity, structure or sequences leading to a decreased efficacy and an increased risk of immunogenicity when administered to patients.
[0043] In addition, in some embodiments, this disclosure provides for the use of human antibody producing mice (TC-mAbTM mice).
[0044] In some embodiments, the present disclosure provides an antibody or antigen- binding fragment thereof that specifically binds to the same Prostaglandin F2 Receptor Inhibitor (PTGFRN) epitope as an antibody selected from the group consisting of those comprising any combination of the complementarity determining regions (CDRs) of each of the antibodies referred to herein as 4F8, 6B2, 8C7, and 12D8 are shown in Table 1, as well as in Figs. 6-13 (alternate (“ALT”) CDRs, meaning not necessarily identified by the Kabat or Chothia methods), as well as the nucleotide coding sequences therefor. The framework and CDR sequences are also presented in Tables 2-13, as well as the nucleotide coding sequences therefor.
Table 1
Table 2
4F8 VH Chain Framework (FR) (preferred) and CDR Amino Acid Sequences (K)
Table 3
4F8 VH Chain Framework (FR) (preferred) and CDR Amino Acid Sequences (Ch)
F8 VL Chain Framework (FF) (preferred) and CDF. Amino Acid Sequences (K/Ch)
Table 5
Alignments of the 4F8, 6B2, 8C7, and 12D8 antibodies for light chain and heavy chain with highlighted CDRs are shown below. The CDR1, CDR2, and CDR3 amino acid sequences are labeled and underlined. The Variable Heavy ( VH) chains of the 4F8, 6B2, 8C7, and 12D8
antibodies are compared below, showing the CDR amino acid sequences as determined by Kabat method underlined:
Preferred nucleotide sequences encoding each of the variable regions are shown below:
[0045] In preferred embodiments, any of the CDRs presented herein, or any determined by any other known method in the art from the VH and VL amino acid polypeptide and preferred
nucleotide sequences of the respective antibodies are contemplated by this disclosure. Variants and derivatives of the same are also contemplated as discussed herein.
[0046] In some embodiments, the present disclosure provides an antibody or antigen- binding fragment thereof that specifically binds to Prostaglandin F2 Receptor Inhibitor (PTGFRN), wherein said antibody or fragment thereof competitively inhibits an antibody shown above as determined using any standard competitive binding assay. In some embodiments, the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to Prostaglandin F2 Receptor Inhibitor (PTGFRN); the antibody or fragment thereof comprises a heavy chain variable region (VH) and light chain variable region (VL) of the 4F8, 6B2, 8C7, and 12D8 antibodies; the VH and VL comprise complementarity determining regions CDR1, CDR2, and CDR3 the 4F8, 6B2, 8C7, and 12D8 antibodies; the VH-CDR1, VH-CDR2, and VH-CDR3 and the VL-CDR1, VL-CDR2, and VL-CDR3 the 4F8, 6B2, 8C7, and 12D8 antibodies, and/or comprising 1, 2, 3, or 4 conservative amino acid substitutions providing binding to PTGFRN is substantially maintained; and/or, the antibody or antigen-binding fragment thereof of the present disclosure comprises polypeptide sequences that are at least 90%, 95%, 99%, or 100% identical to polypeptide sequences PTGFRN.
[0047] Amino acid substitutions considered conservative and non-conservative using standard three letter or other abbreviations for amino acids as would be understood by those of skill in the art are shown below in Table 14:
Table 14
[0048] In certain embodiments, a nucleic acid molecule encoding one or more antibodies described herein may be inserted into one or more expression vectors, as discussed below in greater detail. In such embodiments, the antibody may be encoded by nucleotides corresponding to the amino acid sequence. The particular combinations of nucleotides (codons) that encode the various amino acids (AA) are well known in the art, as described in various references used by those skilled in the art (e.g., Lewin, B. Genes V, Oxford University Press, 1994). The nucleotide sequences encoding the amino acids of said antibodies may be ascertained with reference to Table 15, for example. Nucleic acid variants may use any combination of nucleotides that encode the antibody.
Table 15
Codons Encoding Amino Acids (AA)
*TERM: termination codon
[0049] In some embodiments, the antibody or antigen binding fragment thereof (which may collectively be referred to herein as “antibody” or “antibodies”) is internalized. In some embodiments, the antibody or antigen binding fragment thereof murine, human, humanized, or chimeric. In some embodiments, the antibody or antigen binding fragment thereof is CDR- grafted, recombinant, or resurfaced. In some embodiments, the antibody or antigen binding fragment thereof further comprises human or human-derived heavy and light chain variable region frameworks. In some embodiments, the antibody or antigen binding fragment thereof comprises an IgGl or IgG2 constant region. In some embodiments, the antibody or antigen binding fragment thereof is capable of inhibiting cell proliferation and inducing cell death. In some embodiments, the antibody or antigen binding fragment thereof binds to human PTGFRN. In some preferred embodiments, the antibodies and/or derivatives thereof inhibit one or more cellular functions of PTGFRN including but not limited to migration and cell proliferation. In some embodiments, the antibody or antigen binding fragment thereof binds to murine PTGFRN. In some embodiments, the antibody is a full-length antibody. In some embodiments, it is an antigen binding fragment. In some embodiments, the antibody or antigen binding fragment thereof comprises a Fab, Fab', F(ab')2, Fd, single chain Fv or scFv, disulfide linked Fv, V-NAR domain, IgNar, intrabody, IgGACH2, minibody, F(ab')3,
tetrabody, triabody, diabody, single-domain antibody, DVD-Ig, Fcab, mAb2, (scFv)2, or scFv-Fc.
[0050] The present disclosure further provides an antibody conjugate of the formula: Ab- L-M, wherein: (a) Ab is an antibody or antigen binding fragment thereof that specifically binds to PTGFRN; (b) L is a linker; and (c) M is a functional moiety. In some embodiments, the Ab in the antibody conjugate is an antibody or antigen binding fragment thereof disclosed herein. In some embodiments, the M in the antibody conjugate is selected from the group consisting of a cytotoxic reagent, an immunomodulating agent, an imaging agent, a therapeutic protein, a biopolymer, ionizing agent, radioisotope and an oligonucleotide. In some embodiments, the M is a cytotoxic reagent. Multiple different types of cytotoxic reagents may be used as M, either conjugated to the same antibody or as a combination of antibodies (ADCs) that each comprise one or more different cytotoxic reagents. In some embodiments, the cytotoxic reagent is selected from the group consisting of an anthracycline, an auristatin, a camptothecin, a combretastain, a dolastatin, a duocarmycin, an enediyne, a geldanamycin, an indolino-benzodiazepine dimer, a maytansine, a puromycin, a pyrrolobenzodiazepine dimer, a taxane, a vinca alkaloid, a tubulysin, a hemiasterlin, a spliceostatin, a pladienolide, and calicheamicin. In some embodiments, the cytotoxic reagent is selected from monomethyl auristatin E, monomethyl auristatin F, maytansinoid DM1, maytansinoid DM4, calicheamicin, ozogamicin, α-amanitin, yttrium-90, and iodine-131, topoisomerase inhibitor (e.g., exatecan, deruxtecan), DNA replication inhibitor and/or a DNA repair inhibitor. In some embodiments, the linker in the antibody conjugate is selected from the group consisting of a cleavable linker, a non-cleavable linker, a hydrophilic linker, and a dicarboxylic acid-based linker. In some embodiments, the antibody conjugate provided in the present disclosure binds PTGFRN and is internalized.
[0051] The present disclosure further provides a pharmaceutical composition comprising a therapeutically effective amount of the antibody or antigen binding fragment thereof, or the antibody conjugate encompassed by the disclosure, and a pharmaceutically acceptable carrier.
[0052] Further provided in the present disclosure is a method for treating a disorder associated with PTGFRN function or expression in a subject comprising administering to a subject in need thereof an effective amount of the antibody or antigen binding fragment
thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure. In some embodiments, the disorder is a cancer.
[0053] The present disclosure also provides a method for decreasing or inhibiting tumor growth or progression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
[0054] The present disclosure further provides a method for decreasing or inhibiting metastasis of PTGFRN-expressing cancer cells in a subject, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
[0055] The present disclosure provides a method for inducing tumor regression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
[0056] The present disclosure also provides a method for imaging a cell, comprising (1) contacting the cell with the antibody or antigen binding fragment thereof or the antibody conjugate encompassed by the disclosure; and (2) detecting the antibody or antigen binding fragment thereof or the conjugate.
[0057] The present disclosure also provides a method for identifying the expression of PTGFRN in a tumor, comprising (1) obtaining a sample of the tumor, (2) contacting the sample with the antibody or antigen binding fragment thereof or the antibody conjugate encompassed by the disclosure; and (3) detecting the antibody or antigen binding fragment thereof or the conjugate. In some embodiments, the detecting is by immunochemistry.
[0058] The present disclosure also provides a method for preventing tumor regrowth in a subject who has, or has had, a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
[0059] The present disclosure also provides a method for ameliorating symptoms in a subject who has, or has had, a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
[0060] Further provided in this disclosure is a diagnostic reagent comprising the antibody or antigen binding fragment thereof of the present disclosure. In some embodiments, the antibody or antigen binding fragment thereof is labeled. In some embodiments, the label is selected from the group consisting of a radiolabel, a fluorophore, a chromophore, an imaging agent and a metal ion.
[0061] The present disclosure also provides a kit comprising the antibody or antigen binding fragment thereof, the antibody conjugate, or the pharmaceutical composition encompassed by the disclosure.
[0062] The disclosure also provides an isolated polynucleotide. In some embodiments, the polynucleotide comprises a sequence that encodes a polypeptide at least 90%, 95%, 99%, or 100% identical to a sequence selected from those shown herein. In some embodiments, the polynucleotide comprises a sequence that is at least 90%, 95%, 99%, or 100% identical to those shown herein. The disclosure also provides a vector comprising the polynucleotide, and/or a host cell comprising the vector thereof.
[0063] In some embodiments, the present disclosure includes use of the complementary determining region (CDR) sequences of the antibodies of the disclosure to obtain binding molecules that bind PTGFRN. Such binding molecules typically comprise one or more CDR regions, or CDR-derived regions, of an antibody of the disclosure.
[0064] In some embodiments, the disclosure provides antibody-drug conjugates (ADCs) comprising the anti-PTGFRN antibodies disclosed herein. In another aspect, the disclosure comprises the use of anti-PTGFRN antibody, antigen-binding fragments thereof, and antibody-drug conjugates and corresponding processes, for detecting and diagnosing disorders associated with expression or function of PTGFRN.
[0065] In another aspect, the disclosure comprises products and/or compositions or kits comprising at least one such antibody, antigen binding fragment, or antibody-drug conjugate for the prognosis or diagnostic or therapy monitoring of certain cancers.
[0066] In some embodiments, the present disclosure provides pharmaceutical compositions comprising an anti-PTGFRN antibody, antigen binding fragment thereof, or antibody-drug conjugate, disclosed herein and a pharmaceutically acceptable carrier.
[0067] In some embodiments, the present disclosure provides a method for treating cancer that expresses PTGFRN in a subject. Such methods may comprise administering to the subject a composition comprising an anti-PTGFRN antibody, or an antigen binding fragment thereof. Typically, such anti-PTGFRN antibodies and/or fragments are conjugated via a linker to a functional moiety comprised of cytotoxic payload. The conjugates may be administered in an amount sufficient to prevent, reduce or inhibit the growth of the subject's cancer (and/or tumor). In some embodiments, the anti-PTGFRN antibody or antigen binding fragment comprises: (a) three heavy chain complementarity determining regions (VH CDR1, VH CDR2, and VH CDR3) comprising the amino acid sequences of the 4F8, 6B2, 8C7, and 12D8 antibodies; and (b) three light chain complementarity determining regions (VL CDR1, VL CDR2, and VL CDR3) comprising amino acid sequences the 4F8, 6B2, 8C7, and 12D8 antibodies; and/or derivatives thereof (see, e.g., Tables 1-15). Any cancer that expresses PTGFRN may be treated using the antibodies, compositions, and/or methods of this disclosure. Cancer cells and/or tissue and/or bodily fluid expressing PTGFRN can be measured by measuring PTGFRN protein expression in cancer tissue using an anti-PTFRN antibody or measuring PTGFRN DNA or RNA expression.
[0068] Any suitable functional moiety (“M”) may be conjugated to the antibodies of the disclosure. In some preferred embodiments, an antibody conjugate of the disclosure may comprise a functional moiety M that may be a cytotoxic reagent, an immunomodulating agent, an imaging agent, a therapeutic protein, a biopolymer, or an oligonucleotide. In some embodiments, M may be a drug, in particular one that can be used to treat cancer. In some preferred embodiments, M can be any cytotoxic reagent that can be used in an ADC. Any cytotoxic reagent known to those skilled in the art may be used in the practice of the disclosure, such as enzymes, toxins, peptides, and anthracy clines. In some preferred embodiments, M can be one or more reagents that cause a decrease in cell growth and/or cell death, block DNA replication, DNA repair, protein synthesis (any of which are considered
cytotcytotoxic). Further, in some preferred embodiments, M can be any nucleoside antagonist (e.g., 5-fluorouracil, 6-mercaptopurine, arabinosylcytosine, capecitabine, clofarabine, cytarabine, dacarbazine, fludarabine, gemcitabine, and nelarabine), any intercalating agent (e.g., oxaliplatin, cisplatin, and carboplatin), any microtubule assembly inhibitor (e.g., auristatins, monomethyl auristatin E, monomethyl auristatin F, taxanes, docetaxel, paclitaxel, ixabepilone, vinca alkaloids, vindesine, vincristine, vinorelbine, vinblastine, and maytansinoids, mertansine), any folate inhibitor (e.g., methotrexate and pemetrexed), any ribosome inactivating protein (e.g., saporin), and/or any toxin (e.g., ricin, cholera toxin). In the most preferred embodiments, M is selected from the group consisting of, a therapeutic agent, a cytotoxic reagent, abrin A chain, an anthracycline, an amantin (a- amanitin), an auristatin (e.g., monomethyl auristatin E, monomethyl auristatin F), a calicheamicin, camptothecin, a combretastain, crotin, a cryptophycin, curcin, a dolastatin, a duocarmycin, a DNA alkylating agent, DNA repair inhibitor, a duocarmycin, an enediyne, exatecan or a derivative thereof (e.g., DX-8951), exotoxin A chain, deruxtecan, diphtheria A chain, enomycin, a geldanamycin, a hemiasterlin, an inhibitor of ataxia telangiectasia and Rad3 related kinase (ATR inhibitor, e.g., Berzosertib), indolino-benzodiazepine dimer, a maytansine, maytansinoid DM1, maytansinoid DM4, ozogamicin, phenomycin, a pladienolide, plant toxin, a puromycin, a pyrrol obenzodi azepine dimer, ricin A chain, a spliceostatin, a taxane, a toxin, a tubulysin, a tumor-activated prodrug, topoisomerase inhibitor (e.g., topoisomerase I inhibitor used in Deruxtecan), a vinca alkaloid, a radiochemical (or a radioisotope) (e.g., iodine-131, yttrium-90). Other cytotoxic agents may also be suitable as disclosed herein or as may be available to those of skill in the art.
[0069] Antibodies or antigen binding fragments thereof suitable for use in methods of the disclosure include, but are not limited to, human antibodies or antigen binding fragments thereof, humanized antibodies or antigen binding fragments thereof, CDR-grafted antibodies or antigen binding fragments thereof, and chimeric antibodies or antigen binding fragments thereof. In some embodiments, the anti-PTGFRN antibody may comprise human or human- derived heavy and light chain variable region frameworks (which can be part of a bi-specific antibody or other type of target antibody). In some embodiments, antibodies of the disclosure may comprise a heavy chain variable region that comprises one or more of the amino acid sequences of the 4F8, 6B2, 8C7, and 12D8 antibodies, and/or derivatives thereof.
[0070] An antibody or antigen binding fragment suitable for forming an antibody conjugate of the disclosure may be a humanized, chimeric, CDR grafted, or recombinant human antibody. The antibody is preferably a fully human antibody.
[0071] In some embodiments, the disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of an antibody or antigen binding fragment thereof of the disclosure or an antibody conjugate of the disclosure and a pharmaceutically acceptable carrier.
[0072] In some embodiments, the disclosure provides a method for treating a disorder associated with PTGFRN function or expression in a subject comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. Disorders that may be treated include cancer.
[0073] In some embodiments, the disclosure provides a method for decreasing or inhibiting tumor growth or progression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
[0074] In some embodiments, the disclosure provides a method for decreasing or inhibiting metastasis of PTGFRN-expressing cancer cells in a subject, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
[0075] In some embodiments, the disclosure provides a method for inducing tumor regression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
[0076] In some embodiments, the disclosure provides a method for preventing tumor regrowth in a subject who has had a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
[0077] In some embodiments, the present disclosure provides a method for ameliorating symptoms in a subject who has, or has had, a PTGFRN-expressing tumor, comprising
administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
[0078] In some embodiments, the disclosure provides a method for imaging a cell, comprising contacting the cell with an antibody or antigen binding fragment thereof of the disclosure or an antibody conjugate of the disclosure; and detecting the antibody or antigen binding fragment thereof or the antibody conjugate. In some embodiments, the disclosure provides a method for determining PTGFRN expression in tissues comprising contacting the tissue with an antibody or antigen binding fragment thereof of the disclosure or an antibody conjugate of the disclosure; and detecting the antibody or antigen binding fragment thereof or the antibody conjugate.
[0079] The present disclosure provides antibodies and antibody conjugates (e.g., antibody- drug conjugates) that bind to PTGFRN (e.g., human PTGFRN, mouse PTGFRN, cygno PTGFRN). One example of such antibodies is 33B7. The disclosure also provides polynucleotides encoding the 4F8, 6B2, 8C7, or 12D8 antibody, compositions comprising antibodies of the disclosure, and methods of making and using these antibodies. In some embodiments, antibodies of the disclosure comprise all or a portion of the variable regions of the particular heavy and light chain sequences disclosed herein. In some embodiments, antibodies of the disclosure comprise the amino acid sequence of one or more of the CDR regions disclosed herein.
[0080] The present disclosure further comprises methods for using antibodies of the disclosure, for example, to detect PTGFRN, to modulate PTGFRN activity and/or for targeting to PTGFRN expressing cells for killing (e.g., ADCs) (such as for treating and/or preventing cancer). In some preferred embodiments, the methods can be and/or include methods for determining PTGFRN expression in cells and/or tissues to determine the cells, tissues, and/or cancer types that would be susceptible to treatment with an anti-PTGFRN antibody ADC conjugate. The determining step can be by detecting and measuring the expression of RNA or protein encoding PTGFRN proteins in a cell and/or tissue.
[0081] To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below.
[0082] Prostaglandin F2 receptor inhibitor (PTGFRN) is known by several names in the art, for example, FPRP; CD315; EWI-F; CD9P-1; SMAP-6, KIAA1436, Prostaglandin F2- Alpha Receptor Regulatory Protein, Prostaglandin F2-Alpha Receptor-Associated Protein, Prostaglandin F2 Receptor Negative Regulator, Glu-Trp-Ile EWI Motif-Containing Protein F. PTGFRN has the following accession numbers: UniProt Q9P2B2, Entrez Gene ID: 5738, Ensemble: ENSG00000134247, OMIM: 601204, and HGNC: 9601.
[0083] The term “antibody” as used herein refers to an immunoglobulin molecule capable of recognizing and binding to a specific target or antigen. Antibodies of the disclosure typically comprise at least one antigen recognition site, located in the variable region of the immunoglobulin molecule. Antibodies of the disclosure may be monoclonal antibodies, polyclonal antibodies, and antigen binding fragments thereof that retain the ability to specifically bind to PTGFRN. In some embodiments, antibodies of the disclosure may be single chain (ScFv) and single domain antibodies (e.g., shark and camelid antibodies). Antibodies of the disclosure may be humanized antibodies, chimeric antibodies, or fully human antibodies. Fully human antibodies have no murine sequence (see, e.g., adalimumab (Humira), panitumumab (Vectibix), golimumab (Simponi)). Fully human antibodies can, for example, be prepared using transgenic mice (as in the Examples herein), phage display, B cell cloning, phage display, and/or other techniques available to those of skill in the art. Antibodies of the disclosure may be from any source known to those skilled in the art, for example, antibodies of the disclosure may be of murine, rat, camel, human, or any other origin or may be synthesized.
[0084] As used herein, the term “antibody” encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, and Fv fragments, all of which would be antigen binding fragments), single chain Fv (scFv) mutants, fully human antibodies, multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen determination portion of an antibody, and any other modified immunoglobulin molecule comprising an antigen recognition site so long as the antibodies exhibit the desired biological activity. An antibody can be of any the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2), based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively. The
different classes of immunoglobulins have different and well-known subunit structures and three-dimensional configurations. Antibodies can be naked or conjugated to other molecules such as toxins, radioisotopes, etc. For example, in some embodiments, antibodies of the disclosure may be humanized antibodies conjugated to drug molecules.
[0085] Jin some preferred embodiments, the antibody can be a “naked” antibody, i.e., an antibody that is not conjugated to a cytotoxic moiety. In some preferred embodiments, the antibody can be antibody-drug conjugate (ADC), i.e., an antibody that is conjugated to a cytotoxic moiety. In some preferred embodiments, a “naked” antibody or an ADC can be used, in preferred embodiments to treat and/or prevent cancer. In some preferred embodiments, a “naked” antibody and an ADC can be used in combination (in the same or different compositions, administered essentially simultaneously or not), in preferred embodiments, to treat and/or prevent cancer.
[0086] In some embodiments, antibodies of the disclosure may be humanized. The term “humanized antibody” refers to forms of non-human (e.g., murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences. Typically, humanized antibodies are human immunoglobulins in which residues from the complementary determining region (CDR) are replaced by residues from the CDR of a non-human species (e.g., mouse, rat, rabbit, hamster) that have the desired specificity, affinity, and capability (Jones et al., 1986, Nature, 321 :522-525; Riechmann et al., 1988, Nature, 332:323-327; Verhoeyen et al., 1988, Science, 239: 1534-1536). In some instances, the Fv framework region (FR) residues of a human immunoglobulin are replaced with the corresponding residues in an antibody from a non-human species that has the desired specificity, affinity, and capability. The humanized antibody can be further modified by the substitution of additional residues either in the Fv framework region and/or within the replaced non-human residues to refine and optimize antibody specificity, affinity, and/or capability. In general, the humanized antibody will comprise substantially all of at least one, and typically two or three, variable domains containing all or substantially all of the CDR regions that correspond to the non-human immunoglobulin whereas all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody can also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Humanization may be by any method known in the art, for example, using
the methods disclosed in Jones et al. Nature 321 :522-525 (1986); Riechmann et al. Nature 332:323-327 (1988); Verhoeyen et al. Science 239: 1534-1536 (1988). As used herein, an antibody is humanized by replacing all or a portion of one or more of the CDRs of a human antibody with all or a portion of one or more of the CDRs of a non-human antibody of the disclosure. U.S. Pat. Nos. 5,225,539; 5,585,089; 5,693,761; 5,693,762; 5,859,205 are herein incorporated by reference for their disclosures relating to humanization of antibodies.
[0087] In some embodiments of the disclosure, antibodies of the disclosure may be made in cells of animals other than mice, for example, antibodies of the disclosure may be made in cells from chickens, pigs, guinea pigs, hamsters, horses, rats, camels, llamas, goats, rabbits, donkeys, sheep, and/or other suitable animals. Antibodies of the disclosure may be synthetic antibodies.
[0088] The term “anti-PTGFRN antibody” or “an antibody that binds to PTGFRN” refers to an antibody that is capable of binding PTGFRN with sufficient affinity such that the antibody is useful as a diagnostic and/or therapeutic agent in targeting PTGFRN. The extent of binding of an anti-PTGFRN antibody to an unrelated, non-PTGFRN protein can be less than about 10% of the binding of the antibody to PTGFRN as measured, e.g., by an immunoassay. In certain embodiments, an antibody that binds to PTGFRN has a dissociation constant (Kd) of <1 μM, <100 nM, <10 nM, <1 nM, or <0.1 nM. The anti-PTGFRN antibodies of this disclosure can be any type of antibody, and in preferred embodiments are fully human antibodies.
[0089] The term “antibody fragment” refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, single chain antibodies, single chain scFv, and multispecific antibodies formed from antibody fragments.
[0090] A “monoclonal antibody” refers to a homogeneous antibody population involved in the highly specific recognition and binding of a single antigenic determinant, or epitope. This is in contrast to polyclonal antibodies that typically include different antibodies directed against different antigenic determinants. The term “monoclonal antibody” encompasses both intact and full-length monoclonal antibodies as well as antibody fragments (such as Fab, Fab', F(ab')2, Fv), single chain (scFv) mutants, fusion proteins comprising an antibody portion, and
any other modified immunoglobulin molecule comprising an antigen recognition site. Furthermore, “monoclonal antibody” refers to such antibodies made in any number of manners including but not limited to by hybridoma, phage selection, recombinant expression, and transgenic animals.
[0091] A “variable region” of an antibody refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, either alone or in combination. The variable regions of the heavy and light chain each consist of four framework regions (FR) connected by three complementarity determining regions (CDRs) also known as hypervariable regions. The CDRs in each chain are held together in close proximity by the FRs and, with the CDRs from the other chain, contribute to the formation of the antigen- binding site of antibodies. There are at least two techniques for determining CDRs: (1) an approach based on cross-species sequence variability (i.e., Kabat et al. Sequences of Proteins of Immunological Interest, (5th ed., 1991, National Institutes of Health, Bethesda Md.)); and (2) an approach based on crystallographic studies of antigen-antibody complexes (Al-lazikani et al (1997) J. Molec. Biol. 273:927-948)). In addition, combinations of these two approaches are sometimes used in the art to determine CDRs.
[0092] The term “human antibody” means an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human (preferably not including any source (e.g., mouse, rat) amino acid sequences) made using any technique known in the art. This definition of a human antibody includes intact or full-length antibodies, fragments thereof, and/or antibodies comprising at least one human heavy and/or light chain polypeptide such as, for example, an antibody comprising murine light chain and human heavy chain polypeptides.
[0093] The term “humanized antibody” refers to forms of non-human (e.g., murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences. Typically, humanized antibodies are human immunoglobulins in which residues from the complementary determining region (CDR) are replaced by residues from the CDR of a non-human species (e.g., mouse, rat, rabbit, hamster) that have the desired specificity, affinity, and capability. In some instances, the Fv framework region (FR) residues of a human immunoglobulin are replaced with the corresponding residues in an antibody from a non-human species that has the desired specificity, affinity, and capability. The humanized antibody can be further
modified by the substitution of additional residues either in the Fv framework region and/or within the replaced non-human residues to refine and optimize antibody specificity, affinity, and/or capability. In general, the humanized antibody will comprise substantially all of at least one, and typically two or three, variable domains containing all or substantially all of the CDR regions that correspond to the non-human immunoglobulin whereas all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody can also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Examples of methods used to generate humanized antibodies are described in U.S. Pat. No. 5,225,539.
[0094] The term “chimeric antibodies” refers to antibodies wherein the amino acid sequence of the immunoglobulin molecule is derived from two or more species. Typically, the variable region of both light and heavy chains corresponds to the variable region of antibodies derived from one species of mammals (e.g., mouse, rat, rabbit, etc.) with the desired specificity, affinity, and capability while the constant regions are homologous to the sequences in antibodies derived from another (usually human) to avoid eliciting an immune response in that species.
[0095] The term “epitope” or “antigenic determinant” are used interchangeably herein and refer to that portion of an antigen capable of being recognized and specifically bound by a particular antibody. When the antigen is a polypeptide, epitopes can be formed both from contiguous amino acids and noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturing, whereas epitopes formed by tertiary folding are typically lost upon protein denaturing. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.
[0096] “Binding affinity” generally refers to the strength of the sum total of noncovalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless indicated otherwise, as used herein, “binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein. Low-affinity antibodies generally bind antigen slowly and tend to dissociate readily, whereas high-affinity antibodies generally
bind antigen faster and tend to remain bound longer. A variety of methods of measuring binding affinity are known in the art, any of which can be used for purposes of the present disclosure. Specific illustrative embodiments are described in Examples herein.
[0097] “ Or better” when used herein to refer to binding affinity refers to a stronger binding between a molecule and its binding partner. “Or better” when used herein refers to a stronger binding, represented by a smaller numerical Kd value. For example, an antibody which has an affinity for an antigen of “0.3 nM or better”, the antibody's affinity for the antigen is <0.3 nM, i.e., 0.29 nM, 0.28 nM, 0.27 nM, etc., or any value less than 0.3 nM.
[0098] By “specifically binds,” it is generally meant that an antibody binds to an epitope via its antigen binding domain, and that the binding entails some complementarity between the antigen binding domain and the epitope. According to this definition, an antibody is said to “specifically bind” to an epitope when it binds to that epitope, via its antigen binding domain more readily than it would bind to a random, unrelated epitope. The term “specificity” is used herein to qualify the relative affinity by which a certain antibody binds to a certain epitope. For example, antibody “A” may be deemed to have a higher specificity for a given epitope than antibody “B,” or antibody “A” may be said to bind to epitope “C” with a higher specificity than it has for related epitope “D ”
[0099] By “preferentially binds,” it is meant that the antibody specifically binds to an epitope more readily than it would bind to a related, similar, homologous, or analogous epitope. Thus, an antibody which “preferentially binds” to a given epitope would more likely bind to that epitope than to a related epitope, even though such an antibody may cross-react with the related epitope.
[00100] An antibody is said to “competitively inhibit” binding of a reference antibody to a given epitope if it preferentially binds to that epitope to the extent that it blocks, to some degree, binding of the reference antibody to the epitope. Competitive inhibition may be determined by any method known in the art, for example, competition ELISA assays. An antibody may be said to competitively inhibit binding of the reference antibody to a given epitope by at least 90%, at least 80%, at least 70%, at least 60%, or at least 50%.
[00101] The phrase “substantially similar,” or “substantially the same”, as used herein, denotes a sufficiently high degree of similarity between two numeric values (generally one
associated with an antibody of the disclosure and the other associated with a reference/comparator antibody) such that one of skill in the art would consider the difference between the two values to be of little or no biological and/or statistical significance within the context of the biological characteristic measured by said values (e.g., Kd values). The difference between said two values can be less than about 50%, less than about 40%, less than about 30%, less than about 20%, or less than about 10% as a function of the value for the reference/comparator antibody.
[00102] A polypeptide, antibody, polynucleotide, vector, cell, or composition which is “isolated” is a polypeptide, antibody, polynucleotide, vector, cell, or composition which is in a form not found in nature. Isolated polypeptides, antibodies, polynucleotides, vectors, cell or compositions include those which have been purified to a degree that they are no longer in a form in which they are found in nature. In some embodiments, an antibody, polynucleotide, vector, cell, or composition which is isolated is substantially pure.
[00103] As used herein, “substantially pure” refers to material which is at least 50% pure (i.e., pure meaning free from contaminants), at least 90% pure, at least 95% pure, at least 98% pure, or at least 99% pure.
[00104] In some embodiments, antibodies of the disclosure may be conjugated to a functional moiety to form an antibody conjugate. The term “immunoconjugate,” “conjugate,” or “antibody drug conjugate” as used herein interchangeably refers to a compound or a derivative thereof that is linked to a cell-binding agent (i.e., an anti-PTGFRN antibody or fragment thereof). Antibody conjugates of the disclosure may have the formula Ab-L-M, wherein: (a) Ab is an antibody, or antigen-binding fragment thereof, of the disclosure that binds to PTGFRN; (b) L is a linker; and (c) M is a functional moiety. Conjugation may be direct in which case L is simply a chemical bond between Ab and M. Conjugation may involve the use of a linker. Examples of functional moieties include, but are not limited to, drugs, fluorescent molecules, radioactive molecules, chemiluminescent molecules, molecules used for imaging, epitopes, ligands and the like. Functional moieties may be conjugated to antibodies of the disclosure using any technology known to those skilled in the art. When a linker is used, the linker may be cleavable or non-cleavable and may be of any length and any composition. When a linker is used in the practice of the disclosure, the linker may be conjugated to any part of the immunoglobulin molecule or any amino acid of the immunoglobulin molecule. A linker may be attached to an antibody of the disclosure using
any technique known to those skilled in the art, for example, through surface lysines, reductive-coupling to oxidized carbohydrates, cysteine residues liberated by reducing interchain disulfide linkages, reactive cysteine residues engineered at specific sites, and acyl donor glutamine-containing tag or an endogenous glutamine made reactive by polypeptide engineering in the presence of transglutaminase and an amine. A variety of ADC linkage systems are known in the art, including hydrazone-, disulfide- and peptide-based linkages. A linker can and toxin can be expressed as part of the antibody by way of DNA recombination
[00105] A “linker” is any moiety (chemical or protein such as dipeptide or tripeptide linker that is capable of linking a compound, usually a drug, such as a maytansinoid, or a toxin to a cell-binding agent such as an anti PTGFRN antibody or a fragment thereof in a stable, covalent manner. Linkers can be susceptible to or be substantially resistant to acid-induced cleavage, light-induced cleavage, enzyme-induced cleavage such peptidase-induced cleavage, esterase-induced cleavage, transglutaminase-induced cleavage, cathepsin induced cleavage and disulfide bond cleavage, at conditions under which the compound or the antibody remains active. Suitable linkers are well known in the art and include, for example, disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups and esterase labile groups. Linkers also include charged linkers, and hydrophilic forms thereof as described herein and known in the art. The linker can be, for example, a cleavable linker, a non-cleavable linker, a hydrophilic linker, or a dicarboxylic acid-based linker.
[00106] The terms “cancer” and “cancerous” refer to or describe the physiological condition in mammals in which a population of cells is characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. “Tumor” and “neoplasm” refer to one or more cells that result from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions and metastatic sites. Any cancer that expresses PTGFRN may be detected and/or treated using methods of the disclosure. In preferred embodiments, cancer types that can be treated and/or prevented using an antibody, ADC, or combination thereof (with one another, and/or with at least one other agent and/or regimen) also include, but are not limited to, solide tumor, adenocarcinoma of the lung, bladder cancer, blastoma, breast cancer (including triple negative breast carcinoma), carcinoma, choriocarcinoma, colon cancer, colorectal cancer, cervical cancer, endometrial
cancer, epidermoid carcinoma, gastrointestinal cancer, glioblastoma, head and neck cancer/carcinoma, gastric, hepatic carcinoma, hepatocellular cancer, hepatoma, kidney (renal) cancer, leiomyosarcomas, liver cancer, lung cancer, , medulloblastoma, mesothelioma, neuroblastoma, non-small cell and small cell lung cancer, osteosarcoma, ovarian cancer/carcinoma, pancreatic cancer/carcinoma, peritoneal cancer, prostate cancer (including castrate resistant prostate carcinoma), testicular, osteocarcinoma, osteosarcoma, rhabdomyosarcoma, leiomyosarcoma, salivary gland carcinoma, sarcoma, small-cell lung cancer, spindle cell sarcomatoid carcinoma, squamous carcinoma (including of the lung), squamous cell cancer, squamous carcinoma of the lung, thyroid cancer, uterine carcinoma, vulval cancer, hemtopoietic cancer (e.g., lymphoma (e.g., Hodgkin’s, Non-Hodgkins, cutaneous B-cell or T-cell lymphoma, Waldenstrom macroglobulinemia), leukemia (e.g., chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL)) and/or any local, near or distant metastases thereof. Other types of cancers may also be treated, as may be determined by those of ordinary skill in the art.
[00107] The terms “cancer cell,” “tumor cell,” and grammatical equivalents refer to the total population of cells derived from a tumor or a pre-cancerous lesion or metastatic sites, including both non-tumorigenic cells, which comprise the bulk of the tumor cell population, and tumorigenic stem cells (cancer stem cells) stromal and surrounding cells . As used herein, the term “tumor cell” will be modified by the term “non-tumorigenic” when referring solely to those tumor cells lacking the capacity to renew and differentiate to distinguish those tumor cells from cancer stem cells.
[00108] The term “subject” refers to any animal (e.g., a mammal), including, but not limited to humans, non-human primates, rodents, canine (dogs), feline (cats), and the like, which is to be the recipient of a particular treatment. Typically, the terms “subject” and “patient” are used interchangeably herein in reference to a human subject.
[00109] Administration “in combination with” one or more further therapeutic agents and/or modalities and/or regimens including simultaneous (concurrent) and/or consecutive administration in any chronologic order and/or physical site of administration. The antibodies and ADCs of this disclosure can be combined with any suitable additional agent, such as, for instance, one or more chemotherapeutic agents, one or more anti-payload antibodies (i.e., a binding region and/or antibody against a cytotoxic moiety (or one or more
cytotoxic moieties (M)) attached to an ADC) to reduce toxicity of free payload, other types anti-id, an immunotherapeutic regimen (e.g,. CAR-T therapy).
[00110] The term “pharmaceutical formulation” refers to a preparation which is in such form as to permit the biological activity of the active ingredient to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered. The formulation can be sterile.
[00111] An “effective amount” of an antibody as disclosed herein is an amount sufficient to carry out a specifically stated purpose. An “effective amount” can be determined empirically and in a routine manner, in relation to the stated purpose.
[00112] The term “therapeutically effective amount” refers to an amount of an antibody or other drug effective to “treat” a disease or disorder in a subject or mammal. In the case of cancer, the therapeutically effective amount of the drug can reduce the number of cancer cells; reduce the tumor size; inhibit (i.e., slow to some extent or stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow to some extent or stop) tumor metastasis; inhibit, to some extent, tumor growth; and/or relieve to some extent one or more of the symptoms associated with the cancer. See the definition herein of “treating”. To the extent the drug can prevent growth and/or kill existing cancer cells, it can be cytostatic and/or cytotoxic. A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
[00113] The word “label” when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody, so as to generate a “labeled” antibody. The label can be detectable by itself (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, can catalyze chemical alteration of a substrate compound or composition which is detectable.
[00114] A “chemotherapeutic agent” is a chemical compound useful in the treatment of cancer, regardless of mechanism of action. Chemotherapeutic agents include but are not limited to, for example, antagonists of CD20 such as Rituximab and cyclophosphamide, doxorubicin, vincristine, prednisone, fludarabine, etoposide, methotrexate, lenalidomide,
chlorambucil, bentamustine, platins, taxanes, tubulins, enzyme inhibitors, inhibitors of cellulr processes necessary for cell growth and viability and/or modified versions of such chemotherapeutics.
[00115] Terms such as “treating” or “treatment” or “to treat” or “alleviating” or “to alleviate” refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent and/or slow the development of a targeted pathologic condition or disorder; and/or, 3) general such as increased length of disease-free survival or overall survival. Thus, those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments, a subject is successfully “treated” for cancer according to the methods of the present disclosure if the patient shows one or more of the following: a reduction in the number of or complete absence of cancer cells; lack of progression of the disease, a reduction in the tumor size; inhibition of or an absence of cancer cell infiltration into peripheral organs including, for example, the spread of cancer into soft tissue and bone; inhibition of or an absence of tumor metastasis; inhibition or an absence of tumor growth; relief of one or more symptoms associated with the specific cancer; reduced morbidity and mortality; improvement in quality of life; reduction in tumorigenicity, tumorigenic frequency, or tumorigenic capacity, of a tumor; reduction in the number or frequency of cancer stem cells in a tumor; differentiation of tumorigenic cells to a non-tumorigenic state; or some combination of effects.
[00116] “Polynucleotide,” or “nucleic acid,” as used interchangeably herein, refer to polymers of nucleotides of any length, and include DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification to the nucleotide structure can be imparted before or after assembly of the polymer. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications include, for example, “caps”, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g.,
methyl phosphonates, phosphotriesters, phosphoamidates, cabamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, ply-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide(s). Further, any of the hydroxyl groups ordinarily present in the sugars can be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or can be conjugated to solid supports. The 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of from 1 to 20 carbon atoms. Other hydroxyls can also be derivatized to standard protecting groups. Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2'-0-methyl-, 2'-0-allyl, 2'-fluoro- or 2'- azido-ribose, carbocyclic sugar analogs, .alpha. -anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside. One or more phosphodiester linkages can be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments wherein phosphate is replaced by P(O)S (“thioate”), P(S)S (“dithioate”), “(0)NR2 (“ami date”), P(O)R, P(O)OR, CO or CH2 (“formacetal”), in which each R or R is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether ( — O — ) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.
[00117] The term “vector” means a construct, which is capable of delivering, and optionally expressing, one or more gene(s) or sequence(s) of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.
[00118] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can be linear or branched, it
can comprise modified amino acids, and it can be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art. It is understood that, because the polypeptides of this disclosure are based upon antibodies, in certain embodiments, the polypeptides can occur as single chains or associated chains.
[00119] The terms “identical” or percent “identity” in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences. One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al, 1990, Proc. Natl. Acad. Sci., 87:2264-2268, as modified in Karlin et al., 1993, Proc. Natl. Acad. Sci., 90:5873- 5877, and incorporated into the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25:3389-3402). In certain embodiments, Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. BLAST-2, WU- BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, Calif.) or Megalign (DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in GCG software (e.g., using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6). In certain alternative embodiments, the GAP program in the GCG software package, which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5). Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid
sequences is determined using the algorithm of Myers and Miller (CABIOS, 4: 11-17 (1989)). For example, the percent identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with residue table, a gap length penalty of 12 and a gap penalty of 4. Appropriate parameters for maximal alignment by a particular alignment software can be determined by one skilled in the art. In certain embodiments, the default parameters of the alignment software are used. In certain embodiments, the percentage identity “X” of a first amino acid sequence to a second sequence amino acid is calculated as 100x(Y/Z), where Y is the number of amino acid residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be longer than the percent identity of the second sequence to the first sequence.
[00120] As a non-limiting example, whether any particular polynucleotide has a certain percentage sequence identity (e.g., is at least 80% identical, at least 85% identical, at least 90% identical, and in some embodiments, at least 95%, 96%, 97%, 98%, or 99% identical) to a reference sequence can, in certain embodiments, be determined using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 5371 1). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2: 482 489 (1981), to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present disclosure, the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
[00121] In some embodiments, two nucleic acids or polypeptides of the disclosure are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. Identity can exist over a region of the sequences that is at least about 10, about 20, about 40-60, about 60-80,
about 90-100 residues in length or any value between the same, and in some embodiments, the sequences are substantially identical over the full length of the sequences being compared, such as the coding region of a nucleotide sequence for example.
[00122] A “conservative amino acid substitution” is one in which one amino acid residue is replaced with another amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, substitution of a phenylalanine for a tyrosine is a conservative substitution. In some embodiments, conservative substitutions in the sequences of the polypeptides and antibodies of the disclosure do not abrogate the binding of the polypeptide or antibody containing the amino acid sequence, to the antigen(s), i.e., the PTGFRN to which the polypeptide or antibody binds. Methods of identifying nucleotide and amino acid conservative substitutions which do not eliminate antigen binding are well-known in the art (see, e.g., Brummell et al., Biochem. 32: 1 180-1 187 (1993); Kobayashi et al. Protein Eng. 12(10):879-884 (1999); and Burks et al. Proc. Natl. Acad. Sci. USA 94: 412-417 (1997)).
[00123] As used in the present disclosure and claims, the singular forms “a,” “an,” and “the” include plural forms unless the context clearly dictates otherwise.
[00124] It is understood that wherever embodiments are described herein with the language “comprising,” otherwise analogous embodiments described in terms of “consisting of and/or “consisting essentially of are also provided.
[00125] The term “and/or” as used in a phrase such as “A and/or B” herein is intended to include both “A and B,” “A or B,” “A,” and “B ” Likewise, the term “and/or” as used in a phrase such as “A, B, and/or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[00126] The present disclosure provides agents that specifically bind PTGFRN. These agents are referred to herein as “PTGFRN binding agents.” In certain embodiments, the PTGFRN binding agents are antibodies, immunoconjugates or polypeptides. In some embodiments, the PTGFRN binding agents are human or humanized antibodies. In some embodiments, the anti-PTGFRN binding molecules can be antibodies or antigen binding fragments that have the CDR sequences of antibodies 4F8, 6B2, 8C7 or 12D8; or a derivative thereof; in some embodiments including =up to four (i.e., 0, 1, 2, 3, or 4) conservative amino acid substitutions per CDR.
[00127] In some embodiments, the antibody or antigen binding fragment thereof is internalized. In some embodiments, the antibody or antigen binding fragment thereof murine, human, humanized, or chimeric. In some embodiments, the antibody or antigen binding fragment thereof is CDR-grafted, recombinant, or resurfaced. In some embodiments, the antibody or antigen binding fragment thereof further comprises human or human-derived heavy and light chain variable region frameworks. In some embodiments, the antibody or antigen binding fragment thereof comprises an IgGl or IgG2 constant region. In some embodiments, the antibody or antigen binding fragment thereof is capable of inducing cell death. In some embodiments, the antibody or antigen binding fragment thereof binds to human PTGFRN. In some embodiments, the antibody or antigen binding fragment thereof binds to murine PTGFRN. In some embodiments, the antibody is a full-length antibody. In some embodiments, it is an antigen binding fragment. In some embodiments, the antibody or antigen binding fragment thereof comprises a Fab, Fab', F(ab')2, Fd, single chain Fv or scFv, disulfide linked Fv, V-NAR domain, IgNar, intrabody, IgGΔCH2, camelid, nanobody, minibody, F(ab')3, tetrabody, triabody, diabody, single-domain antibody, DVD-Ig, Fcab, mAb2, (SCFV)2, or scFv-Fc.
[00128] In some embodiments, one or more functional moieties may be conjugated to an antibody of the disclosure. The number of functional moieties per antibody can be varied by one skilled in the art using known techniques. Typically, at least one functional moiety will be conjugated per antibody. In some embodiments, the ratio of functional moieties per antibody may be from about 1 to about 8, from about 2 to about 8, from about 3 to about 8, from about 4 to about 8, from about 5 to about 8, from about 6 to about 8, or from about 7 to about 8. In some embodiments, an antibody conjugate of the disclosure may comprise 1 functional moiety, 2 functional moieties, 3 functional moieties, 4 functional moieties, 5
functional moieties, 6 functional moieties, 7 functional moieties, or 8 functional moieties. Typically, the number of functional moieties per antibody may be expressed a drug antibody ratio (DAR). The number of functional moieties per antibody can be determined using any technique known in the art, for example, UV spectroscopy, mass spectroscopy, immunoassay, radiometric methods, hydrophobic interaction chromatography (HIC), electrophoresis, or HPLC.
[00129] The immunoconjugates can, according to some embodiments described herein, be internalized into cells. The immunocongugate, therefore, can exert a therapeutic effect when it is taken up by, or internalized, by a PTGFRN-expressing cell. In some particular embodiments, the immunoconjugate comprises an antibody, antibody fragment, or polypeptide, linked to a cytotoxic agent by a cleavable linker, and the cytotoxic agent is cleaved from the antibody, antibody fragment, or polypeptide, wherein it is internalized by a PTGFRN-expressing cell.
[00130] The present disclosure further provides an antibody conjugate of the formula: Ab- L-M, wherein: (a) Ab is an antibody or antigen binding fragment thereof that specifically binds to PTGFRN; (b) L is a linker; and (c) M is a functional moiety. In some embodiments, the Ab in the antibody conjugate is an antibody or antigen binding fragment thereof of any one of the examples and/or claims of this disclosure. In some embodiments, the M in the antibody conjugate is selected from the group consisting of a cytotoxic reagent, an immunomodulating agent, an imaging agent, a therapeutic protein, a biopolymer, and an oligonucleotide. In some embodiments, the M is a cytotoxic reagent. In some embodiments, the cytotoxic reagent is selected from the group consisting of an anthracycline, an auristatin, a camptothecin, a combretastain, a dolastatin, a duocarmycin, an enediyne, a geldanamycin, an indolino-benzodiazepine dimer, a maytansine, a puromycin, a pyrrolobenzodiazepine dimer, a taxane, a vinca alkaloid, a tubulysin, a hemiasterlin, a spliceostatin, a pladienolide, and calicheamicin, topoisomerase inhibitor, DNA synthesis inhibitor, DNA repair inhibitor. In some embodiments, the cytotoxic reagent is selected from monomethyl auristatin E, monomethyl auristatin F, maytansinoid DM1, maytansinoid DM4, calicheamicin, ozogamicin, α-amanitin, yttrium-90, iodine-131, and/or a topoisomerase inhibitor. In some embodiments, the linker in the antibody conjugate is selected from the group consisting of a cleavable linker, a non-cleavable linker, a hydrophilic linker, and a dicarboxylic acid-based
linker. In some embodiments, the antibody conjugate provided in the present disclosure binds PTGFRN and is internalized.
[00131] In certain embodiments, the PTGFRN-binding agents (e.g., antibodies, antigen binding fragments thereof, and/or antibody drug conjugates) have one or more of the following effects: inhibit proliferation of tumor cells, reduce the tumorigenicity of a tumor by reducing the frequency of cancer stem cells in the tumor, inhibit tumor growth, inhibits migration to distant sites, decrease survival, trigger cell death of tumor cells, differentiate tumorigenic cells to a non-tumorigenic state, or prevent metastasis of tumor cells.
[00132] In certain embodiments, the PTGFRN-binding agents bind to cell surface PTGFRN antigens. In certain embodiments, the PTGFRN-binding agents bind to the extracellular domain (ECD) of PTGFRN. In certain embodiments, cancer cells have multiple cell surface PTGFRN antigens. In certain embodiments, the PTGFRN and the PTGFRN- binding agents are internalized into the cells.
[00133] In certain embodiments, the PTGFRN-binding agents bind to the same epitope on cell surface PTGFRN as the 4F8, 6B2, 8C7, or 12D8 antibodies; or a derivative thereof (see, e.g., the preferred embodiments of antibodies having the CDRs and/or derivatives provided by Tables 1-15). In certain embodiments, the PTGFRN-binding agents bind to different epitopes on cell surface PTGFRN than 4F8, 6B2, 8C7, or 12D8 antibodies; or a derivative thereof (see, e.g., the preferred embodiments of antibodies having the CDRs and/or derivatives provided by Tables 1-15).
[00134] In certain embodiments, the PTGFRN-binding agents are capable of cell killing. In certain embodiments, the cell killing is effected by the anti-PTGFRN antibodies. In certain embodiments, the cell killing is effected by the cytotoxic drug conjugated to the anti- PTGFRN antibodies. In certain embodiments, the cell killing is effected by the anti- PTGFRN antibodies and the cytotoxic drug conjugated to the anti-PTGFRN antibodies.
[00135] In certain embodiments, the disclosure encompasses polynucleotides comprising polynucleotides that encode a polypeptide that specifically binds PTGFRN or a fragment of such a polypeptide. For example, the disclosure provides a polynucleotide comprising a nucleic acid sequence that encodes an antibody to a human PTGFRN or encodes a fragment of such an antibody. The polynucleotides of the disclosure can be in the form of RNA or in
the form of DNA. DNA includes cDNA, genomic DNA, and synthetic DNA; and can be double-stranded or single-stranded, and if single stranded can be the coding strand or non- coding (anti-sense) strand. In certain embodiments, the polynucleotides are isolated. In certain embodiments, the polynucleotides are substantially pure. The disclosure also provides an isolated polynucleotide. In certain embodiments, the polynucleotide comprises a sequence encoding a 4F8, 6B2, 8C7, or 12D8 polypeptide (and/or CDR or variable region thereof). In some embodiments, the polynucleotide comprises a sequence that encodes a polypeptide at least 90%, 95%, 99%, or 100% identical to a sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity, or 100% identity to the preferred polynucleotides disclosed herein encoding any of the 4F8, 6B2, 8C7, or 12D8 antibodies (or CDRs and/or variable regions thereof). In certain embodiments the polynucleotides comprise the coding sequence for the mature polypeptide fused in the same reading frame to a polynucleotide which aids, for example, in expression and secretion of a polypeptide from a host cell (e.g., a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell). The polypeptide having a leader sequence is a preprotein and can have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides can also encode for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved, an active mature protein remains. In certain embodiments, the polynucleotides comprise the coding sequence for the mature polypeptide fused in the same reading frame to a marker sequence that allows, for example, for purification of the encoded polypeptide. The present disclosure further relates to variants of the hereinabove described polynucleotides encoding, for example, fragments, analogs, and derivatives. The polynucleotide variants can contain alterations in the coding regions, non-coding regions, or both. In some embodiments, the polynucleotide variants contain alterations, which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. In some embodiments, nucleotide variants are produced by silent substitutions due to the degeneracy of the genetic code. Polynucleotide variants can be produced for a variety of reasons, e.g., to optimize codon expression for a particular host (change codons in the human mRNA to those preferred by a bacterial host such as A. coif). Vectors and cells comprising the polynucleotides described herein are also encompassed by the present disclosure.
[00136] In some embodiments, antibodies and/or antibody conjugates of the disclosure may be formulated as pharmaceutical compositions. Pharmaceutical compositions of the disclosure will typically comprise from about 0.1% to about 75% by weight of an antibody or antibody drug conjugate of the disclosure. In some embodiments, a pharmaceutical composition of the disclosure may comprise from about 0.2% to about 75%, from about 0.5% to about 75%, from about 1% to about 75%, from about 2% to about 75%, from about 5% to about 75%, from about 10% to about 75%, from about 20% to about 75%, or from about 50% to about 75% by weight of an antibody or antibody drug conjugate of the disclosure. Pharmaceutical compositions of the disclosure may be formulated in any manner known to those skilled in the art. Typically, pharmaceutical compositions of the disclosure are formulated as injectable compositions which may be liquid solutions or suspensions or solid forms to be dissolved or suspended in liquid prior to injection. Pharmaceutical compositions of the disclosure may be formulated for delayed release, for example, may be formulated for depot injections. A pharmaceutical composition of the disclosure will typically comprise one or more pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” includes any and all aqueous solvents (e.g., water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles, such as sodium chloride, Ringer's dextrose, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oil, and injectable organic esters, such as ethyloleate), dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, anti-oxidants, chelating agents, and inert gases), isotonic agents, absorption delaying agents, salts, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, fluid and nutrient replenishers, such like materials and combinations thereof, as would be known to one of ordinary skill in the art. The pH and exact concentration of the various components in a pharmaceutical composition are adjusted according to well-known parameters.
[00137] The present disclosure also provides methods of treatment using the antibodies of the disclosure. Methods of the disclosure will typically comprise administration of a pharmaceutical composition of the disclosure to a patient in need thereof. The quantity to be administered, both according to number of treatments and dose, may be determined by those skilled in the art. Determination of the quantity and timing of administration of a pharmaceutical composition of the disclosure can be made by consideration of factors such as body weight, the age, health, and sex of the subject, the type of disease being treated, the
extent of disease penetration, previous or concurrent therapeutic interventions, idiopathy of the patient, the route of administration, and the potency, stability, and toxicity of the particular therapeutic substance.
[00138] In some embodiments, antibodies of the disclosure may be used for imaging applications. Typically, for imaging applications, antibodies of the disclosure may be conjugated to a functional moiety suitable for imaging. Functional moieties suitable for imaging include, but are not limited to, moieties that may be detected by microscopy, e.g., fluorescent microscopy, confocal microscopy, or electron microscopy. Other functional moieties may be detected by other analytical techniques, for example, by magnetic resonance imaging, tomography, such as gamma (SPECT/CT, planar) and positron emission tomography (PET/CT), radiography, or ultrasound. Functional moieties suitable for use in imaging applications of the disclosure may include luminescent molecules, chemiluminescent molecules, fluorochromes, fluorescent quenching agents, colored molecules, radioisotopes, scintillants, massive labels (for detection via mass changes), biotin, avidin, streptavidin, protein A, protein G, antibodies or fragments thereof, Grb2, polyhistidine, Ni2+, Flag tags, myc tags, heavy metals, enzymes, alkaline phosphatase, peroxidase, luciferase, electron donors/acceptors, acridinium esters, and colorimetric substrates.
[00139] The PTGFRN-binding agents (including antibodies, immunoconjugates, and polypeptides) of the disclosure are useful in a variety of applications including, but not limited to, therapeutic treatment methods, such as the treatment of cancer. In certain embodiments, the agents are useful for inhibiting tumor growth, inducing differentiation, reducing tumor volume, and/or reducing the tumorigenicity of a tumor, inhibiting metastasis. The methods of use can be in vitro, ex vivo, or in vivo methods and in patients.
[00140] In certain embodiments, anti-PTGFRN antibodies and immunoconjugates of the disclosure are useful for detecting the presence of PTGFRN in a biological sample. The term “detecting” as used herein encompasses quantitative or qualitative detection. In certain embodiments, a biological sample comprises a cell or tissue or biological fluid. In certain embodiments, such tissues include normal and/or cancerous tissues that express PTGFRN at higher levels relative to other tissues.
[00141] In certain embodiments, the disclosure provides a method of detecting the presence of PTGFRN in a biological sample. In certain embodiments, the method comprises
contacting the biological sample with an anti-PTGFRN antibody under conditions permissive for binding of the anti-PTGFRN antibody to PTGFRN, and detecting whether a complex is formed between the anti-PTGFRN antibody and PTGFRN.
[00142] In certain embodiments, this disclosure provides a method of diagnosing a disorder, such as cancer. In certain embodiments, the method comprises contacting a test cell or tissue with an anti-PTGFRN antibody; determining the level of expression (either quantitatively or qualitatively) of PTGFRN by the test cell by detecting binding of the anti- PTGFRN antibody to PTGFRN; and comparing the level of expression of PTGFRN by the test cell with the level of expression of PTGFRN by a control cell (e.g., a normal cell of the same tissue origin as the test cell or a cell that expresses PTGFRN at levels comparable to such a normal cell), wherein a higher level of expression of PTGFRN by the test cell as compared to the control cell indicates the presence of a disorder associated with increased expression of PTGFRN. In certain embodiments, the test cell is obtained from an individual suspected of having a disorder associated with increased expression of PTGFRN. In certain embodiments, the disorder is a cell proliferative disorder, such as a cancer or a tumor.
[00143] In certain embodiments, a method of diagnosis or detection, such as those described above, comprises detecting binding of an anti-PTGFRN antibody to PTGFRN expressed on the surface of a cell or in a membrane preparation obtained from a cell expressing PTGFRN on its surface. In certain embodiments, the method comprises contacting a cell with an anti-PTGFRN antibody under conditions permissive for binding of the anti-PTGFRN antibody to PTGFRN, and detecting whether a complex is formed between the anti-PTGFRN antibody and PTGFRN on the cell surface. An exemplary assay for detecting binding of an anti-PTGFRN antibody to PTGFRN expressed on the surface of a cell is a flow binding assay using a flow cytometer. Certain other methods can be used to detect binding of anti-PTGFRN antibodies to PTGFRN. Such methods include, but are not limited to, antigen-binding assays that are well known in the art, such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoprecipitation assays, fluorescent immunoassays, protein A immunoassays, lateral flow assays and immunohistochemistry (IHC).
[00144] In certain embodiments, anti-PTGFRN antibodies are labeled. Labels include, but are not limited to, labels or moieties that are detected directly (such as fluorescent, chromophoric, electron-dense, chemiluminescent, and radioactive labels), as well as moieties,
such as enzymes or ligands, that are detected indirectly, e.g., through an enzymatic reaction or molecular interaction.
[00145] In certain embodiments, the disease treated with the PTGFRN-binding agent (e.g., an anti-PTGFRN antibody or conjugate) is one or more types of cancer (preferably a human cancer). In certain embodiments, the cancer is characterized by PTGFRN expressing cells to which the PTGFRN-binding agent (e.g., antibody or conjugate) binds. In some preferred embodiments, the type of cancer is a head and/or neck cancer, squamous carcinoma, epidermoid carcinoma, medulloblastoma, mesothelioma, and a hematopoietic cancer, and/or as disclosed herein or may otherwise be determined by one of skill in the art. The present disclosure provides for such methods of treating cancer comprising administering a therapeutically effective amount of a PTGFRN-binding agent to a subject (e.g., a subject in need of treatment). As disclosed herein, in some preferred embodiments, the method includes determining over-expression of PTGFRN protein in the cells of a cancer to be treated as compared to a control / non-cancerous sample (e.g., cells or tissues). In preferred embodiments, the over-expression is determined by measuring the expression of RNA encoding PTGFRN and/or the PTGFRN protein.
[00146] The present disclosure further provides methods for inhibiting tumor growth using the antibodies or conjugates described herein. In certain embodiments, the method of inhibiting the tumor growth comprises contacting the cell with a PTGFRN-binding agent (e.g., antibody or conjugate) in vitro. For example, an immortalized cell line or a cancer cell line that expresses PTGFRN is cultured in medium to which is added the antibody or other agent to inhibit tumor growth. In some embodiments, tumor cells are isolated from a patient sample such as, for example, patient derived tumor cells that are used in patient derived xenograft or a tissue biopsy, pleural effusion, or blood sample and cultured in medium to which is added a PTGFRN-binding agent to inhibit tumor growth.
[00147] In some embodiments, the method of inhibiting tumor growth comprises contacting the tumor or tumor cells with the PTGFRN-binding agent (e.g., antibody or conjugate) in vivo. In certain embodiments, contacting a tumor or tumor cell with a PTGFRN-binding agent is undertaken in an animal model. For example, PTGFRN-binding agents can be administered to xenografts of human cell lines or patient-derived cells expressing PTGFRN that have been grown in immunocompromised mice to inhibit tumor growth.
[00148] In certain embodiments, the method of inhibiting tumor growth comprises administering to a subject a therapeutically effective amount of a PTGFRN-binding agent. In certain embodiments, the subject is a human. In certain embodiments, the subject has a tumor or has had a tumor removed.
[00149] In certain embodiments, the tumor expresses the PTGFRN to which the PTGFRN- binding agent or antibody binds. In certain embodiments, the tumor overexpresses the human PTGFRN. In certain embodiments, the methods can comprise isolating tissue and/or cells of the cancer and determining whether the cancer tissue overexpresses PTGFRN as compared to non-cancerous cells, optionally wherein the PTGRGN expression is determined by measuring PTGFRN protein and/or expression of RNA encoding PTGFRN.
[00150] In some embodiments, the disclosure provides a method for treating a disorder associated with PTGFRN function or expression in a subject comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. Disorders that may be treated include cancer.
[00151] In some embodiments, the disclosure provides a method for decreasing tumor growth or progression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. In some embodiments, the disclosure provides a method for decreasing metastasis of PTGFRN-expressing cancer cells in a subject, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. In some embodiments, the disclosure provides a method for inducing tumor regression in a subject who has a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. In some embodiments, the disclosure provides a method for inhibiting cancer stem cells growth in a subject who has had a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. In some embodiments, the disclosure provides a method for preventing tumor regrowth in a subject who has had a PTGFRN-expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure. In some embodiments, the present disclosure provides a method for ameliorating symptoms in a subject who has, or has had, a PTGFRN-
expressing tumor, comprising administering to the subject in need thereof an effective amount of a pharmaceutical composition of the disclosure.
[00152] In some embodiments, the disclosure provides a method for imaging a cell, comprising contacting the cell with an antibody or antigen binding fragment thereof of the disclosure or an antibody conjugate of the disclosure; and, detecting the antibody or antigen binding fragment thereof or the antibody conjugate. In some embodiments, the present disclosure provides a method for identifying the expression of PTGFRN in a tumor, comprising (1) obtaining a sample of the tumor, (2) contacting the sample with the antibody or antigen binding fragment thereof or the antibody conjugate encompassed by the disclosure; and, (3) detecting the antibody or antigen binding fragment thereof or the conjugate. In some embodiments, the detecting is by any immunochemical method. In some embodiments, the method for identifying the expression of PTGFRN in a tumor can be done by immunochemistry (IHC). In other embodiments, such methods can be done by, but are not limited to, antigen-binding assays that are well known in the art, such as western blots, lateral flow assays, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoprecipitation assays, fluorescent immunoassays, and protein A immunoassays. In some embodiments, the methods include in vivo imaging such as for identifying the presence and/or position of tumor cells and/or tumors. In some such in vivo embodiments, the methods can include targeted therapy to the tumors to deliver toxic compound bound to the antibody or targeted radiation of tumor using antibody.
[00153] The present disclosure provides monoclonal antibodies (mAbs) termed 4F8, 6B2, 8C7, and 12D8 that specifically bind Prostaglandin F2 Receptor Inhibitor (PTGFRN) which preferentially expressed in certain cancer cells, particularly medulloblastoma and mesothelioma. Monoclonal antibodies of the disclosure bind to cells naturally expressing PTGFRN and to cells transfected to express PTGFRN. Monoclonal antibodies of the disclosure can also be monoclonal antibodies that are internalized in PTGFRN expressing cancer cells and as such are potential payload carriers to kill targeted cells. One example of such a use of the monoclonal antibodies of the disclosure is provided below in the form of a generic type of antibody-drug-conjugate (ADC) consisting of a monoclonal antibody of the disclosure linked to duocarmycin Using this ADC, as demonstrated both in vitro and in vivo, the selective effect on target cells while cells not expressing the target PTGFRN were
unaffected. These data demonstrate that PTGFRN to which these monoclonal antibodies bind is a valuable target for development of novel anti-cancer agent for certain cancers.
[00154] Thus, this disclosure provides the following preferred embodiments. In some preferred embodiments, this disclosure provides an isolated antibody or antigen binding fragment thereof, comprising: a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 1, 2, and 3, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively (4F8 K); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 4, 5, and 6, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively (4F8 Ch); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 4, 5, and 6, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively (4F8 Alt); the heavy chain variable region of SEQ ID NO: 189 and the light chain variable region of SEQ ID NO: 190 (4F8); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 18, 19, and 20, and a light chain variable region comprising CDR sequences SEQ ID NOs: 24, 25, and 26, respectively (6B2 K); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 21, 22 and 23, and a light chain variable region comprising CDR sequences SEQ ID NOs: 24, 25, and 26, respectively (6B2 Ch); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 27, 28 and 29 or 30, and a light chain variable region comprising CDR sequences SEQ ID NOs: 31 or 32, and 33, and 34 or 35, respectively (6B2 Alt); the heavy chain variable region of SEQ ID NO: 191 and the light chain variable region of SEQ ID NO: 192 (6B2); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 36, 37 and 38, and a light chain variable region comprising CDR sequences SEQ ID NOs: 42, 43 and 44, respectively (8C7 K); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 39, 40 and 41, and a light chain variable region comprising CDR sequences SEQ ID NOs: 42, 43 and 44, respectively (8C7 Ch); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 45, and 46 or 47, and 48 or 49, and a light chain variable region comprising CDR sequences SEQ ID NOs: 50, and 51, and 52 or 53, respectively (8C7 Alt); the heavy chain variable region of SEQ ID NO: and the light chain variable region of SEQ ID NO: 193 and 194 (8C7); a heavy chain variable region
comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 54, 55 and 56, and a light chain variable region comprising CDR sequences SEQ ID NOs: 60, 61 and 62, respectively (12D8 K); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 57, 58 and 59, and a light chain variable region comprising CDR sequences SEQ ID NOs: 60, 61 and 62, respectively (12D8 Ch); a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 63, and 64 or 65, and 66, and a light chain variable region comprising CDR sequences SEQ ID NOs: 67, 68, and 69 or 70, respectively (12D8 Alt); the heavy chain variable region of SEQ ID NO: 195 and the light chain variable region of SEQ ID NO: 196 (12D8); or a derivative of any of the above, optionally wherein said derivative comprises one to four amino acid substitutions in at least one CDR thereof, preferably wherein said substitution(s) are conservative amino acid sequences; wherein the antibody or derivative thereof specifically binds to human Prostaglandin F2 Receptor Inhibitor (PTGFRN). In some preferred embodiments, the antibody binds to a cell expressing PTGFRN in vitro and/or in vivo. In some preferred embodiments, this disclosure provides antibodies that compete with any of the antibodies above for binding to PTGFRN on a cell. In some preferred embodiments, this disclosure provides combinations of the antibodies above, as well as other reagents, and regimens. In some preferred embodiments, this antibody is an isolated monoclonal antibody, preferably a human monoclonal antibody. In some preferred embodiments, the antibody is derived from a human antibody, human IgG, human IgGl, human IgG2, human IgG2a, human IgG2b, human IgG3, human IgG4, human IgM, human IgA, human IgAl, human IgA2, human IgD, human IgE, canine antibody, canine IgGA, canine IgGB, canine IgGC, canine IgGD, chicken antibody, chicken IgA, chicken IgD, chicken IgE, chicken IgG, chicken IgM, chicken IgY, feline antibody, goat antibody, goat IgG, mouse antibody, mouse IgG, pig antibody, rat antibody, Haman antibody, alpacan antibody, shark antibody and a camel antibody. In some preferred embodiments, this disclosure provides derivatives of such antibodies, optionally selected from the group consisting of an Fab, Fab2, Fab’ single chain antibody, Fv, single chain, mono-specific antibody, bispecific antibody, trimeric antibody, multi-specific antibody, multivalent antibody, chimeric antibody, canine-human chimeric antibody, canine- mouse chimeric antibody, antibody comprising a canine Fc, humanized antibody, human antibody, caninized antibody, CDR-grafted antibody, shark antibody, and a nanobody. In some preferred embodiments, a derivative of any of the antibodies disclosed herein can
comprise a detectable label fixably attached thereto, optionally wherein the detectable label is selected from the group consisting of fluorescein, DyLight, Cy3, Cy5, FITC, HiLyte Fluor 555, HiLyte Fluor 647, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein, 5-FAM, hydroxy tryptamine, 5-hydroxy tryptamine (5-HAT), 6-carboxyfluorescein (6-FAM), FITC, 6-carboxy-l,4-di chi oro-2’, 7’ -di chlorofluorescein (TET), 6-carboxy-l,4-dichloro-2’,4’,5’,7’- tetrachlorofluorescein (HEX), 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein (6-JOE), an Alexa fluor, Alexa fluor 350, Alexa fluor 405, Alexa fluor 430, Alexa fluor 488, Alexa fluor 500, Alexa fluor 514, Alexa fluor 532, Alexa fluor 546, Alexa fluor 555, Alexa fluor 568, Alexa fluor 594, Alexa fluor 610, Alexa fluor 633, Alexa fluor 635, Alexa fluor 647, Alexa fluor 660, Alexa fluor 680, Alexa fluor 700, Alexa fluor 750, a BODIPY fluorophores, BODIPY 492/515, BODIPY 493/503, BODIPY 500/510, BODIPY 505/515, BODIPY 530/550, BODIPY 542/563, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650-X, BODIPY 650/665-X, BODIPY 665/676, FL, FL ATP, Fl-Ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE, a rhodamine, rhodamine 110, rhodamine 123, rhodamine B, rhodamine B 200, rhodamine BB, rhodamine BG, rhodamine B extra, 5-carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidine, Phalloidine, rhodamine red, Rhod-2, 6-carboxy-X-rhodamine (ROX), carboxy-X-rhodamine (5-ROX), Sulphorhodamine B can C, Sulphorhodamine G Extra, 6-carboxytetramethyl- rhodamine (TAMRA), tetramethylrhodamine (TRITC), rhodamine WT, Texas Red, and Texas Red-X. In some preferred embodiments, the antibody can comprise an effector moiety attached thereto, optionally wherein the effector moiety is selected from the group consisting of a cytotoxic drug, toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and radiochemical. In some preferred embodiments, the cytotoxic drug is duocarmycin. In some preferred embodiments, a non-cleavable or cleavable linker is positioned between the antibody and the effector moiety, wherein said cleavable linker releases the effector moiety into or within a cell. In some preferred embodiments, this disclosure provides isolated polynucleotide encoding an antibody disclosed herein, or a polynucleotide comprising at least one polynucleotide having at least about 90% identity with any of the same. In some preferred embodiments, the polynucleotide can be contained within an expression vector. In some preferred embodiments, this disclosure provides a host cell comprising the isolated polynucleotide and / or the expression vector. In some preferred embodiments, this disclosure provides a
composition comprising at least antibody or derivative disclosed herein; at least one isolated polynucleotide and/or one or more expression vector comprising the same; and / or, at least one host cell comprising the same; or a combination thereof; and, a pharmaceutically acceptable carrier.
[00155] In some preferred embodiments, this disclosure provides methods for detecting PTGFRN on a cell and/or tissue, the method comprising contacting a test biological sample with an antibody or derivative of this disclosure and detecting the antibody bound to the biological sample or components thereof. In some preferred embodiments, the methods comprise comparing the amount of binding to the test biological sample or components thereof to the amount of binding to a control biological sample or components thereof, wherein increased binding to the test biological sample or components thereof relative to the control biological sample or components thereof indicates the presence of a cell expressing PTGFRN in the test biological sample (preferably, e.g., mammalian cell, tissue, or biological fluid such as blood). In some preferred embodiments, the method is an in vivo method or an in vitro method. In some preferred embodiments, this disclosure provides in vivo methods for detecting tumor cells, and/or diagnosing cancer, the method comprising administering at least one antibody, combination, or derivative and detecting the at least one antibody bound to the tumor cells. In some preferred embodiments, the at least one antibody or derivative comprises at least one detectable label. In some preferred embodiments, the method comprising using at least two antibodies and/or derivatives that each comprise at least one detectable label, the detectable label of each antibody and/or derivative being the same or different. In some preferred embodiments, the method comprises imaging a tumor for targeted treatment of cancer. In some preferred embodiments, the method further comprises treating the cancer. In some preferred embodiments, this disclosure provides methods for treating cancer, the method comprising administering at least one antibody, combination, or derivative of this disclosure to a mammal. In some preferred embodiments, the at least one antibody or derivative comprises an effector moiety. In some preferred embodiments, the methods comprising using at least two antibodies or derivatives that each comprise at least one effector moiety, the effector moiety of each antibody or derivative being the same or different. In some preferred embodiments, the methods comprise administering at least two antibodies to the mammal, wherein at least one antibody is a naked antibody that does not include a cytotoxic effector moiety attached thereto and at least one antibody includes a cytotoxic effector moiety attached thereto. In some preferred embodiments, this disclosure
provides methods for detecting, diagnosing, and treating cancer, the method comprising imaging a tumor comprising the antibody, combination, or derivative of this disclosure attached thereto and targeting treatment of cancer to the tumor or cells thereof. In some preferred embodiments, the diagnostic methods of this disclosure can include measuring PTGFRN protein in biological fluids (e.g., blood, plasma, exosomes) and/or in tissues using imaging and/or other techniques such as immunohistochemistry.
[00156] In some preferred embodiments, the antibody or derivative thereof comprises a detectable label and/or an effector moiety. In some preferred embodiments, this disclosure provides methods for treating, preventing and / or ameliorating cancer in a mammal comprising administering to the mammal at least one effective dose of a pharmaceutical composition comprising at least one antibody and/or derivative of this disclosure. In some preferred embodiments, the antibody comprises a cytotoxic effector moiety (preferably the group “M" in the general formula provided herein) attached thereto, optionally wherein the effector moiety is as disclosed herein or as may be otherwise available to those of skill in the art (e.g., a cytotoxic drug, toxin, diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin, and radiochemical). In some preferred embodiments, the cytotoxic drug is duocarmycin. Other cytotoxic drugs are also suitable, as disclosed herein and as may be otherwise available to those of skill in the art. In some preferred embodiments, a non-cleavable or cleavable linker is positioned between the antibody and the effector moiety, wherein said cleavable linker releases the effector moiety into or within a cell. In some preferred embodiments, the antibody is administered as an antibody-drug conjugate. In some preferred embodiments, multiple doses are administered to the animal; and/or, the antibody is administered in a dosage amount of about 1 to 50 mg / kg.
[00157] In some preferred embodiments, this disclosure provides a kit for detecting the expression of PTGFRN in or on a cell, tissue, or biological fluid, the kit comprising one or more antibodies an antibody or derivative disclosed herein and instructions for use. In some preferred embodiments, the antibody or derivative is in lyophilized form.
[00158] Other embodiments are also disclosed herein, as would be understood by those of ordinary skill in the art.
[00159] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be
suggested to persons skilled in the art and are to be included within the spirit and purview of this application. The terms “about”, “approximately”, and the like, when preceding a list of numerical values or range, refer to each individual value in the list or range independently as if each individual value in the list or range was immediately preceded by that term. The terms mean that the values to which the same refer are exactly, close to, or similar thereto. Optional or optionally means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where the event or circumstance occurs and instances where it does not. Ranges may be expressed herein as from about one particular value, and/or to about another particular value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent about or approximately, it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. Ranges (e.g., 90-100%) are meant to include the range per se as well as each independent value within the range as if each value was individually listed. All references cited within this disclosure are hereby incorporated by reference in their entirety. Certain embodiments are further described in the following examples. These embodiments are provided as examples only and are not intended to limit the scope of the claims in any way.
[00160] Examples
[00161] As shown in these examples, unique fully human anti-PTGFRN monoclonal antibodies have been developed by immunizing with recombinant human PTFRN ECD protein Human Ab producing Tc mice (TC-mAb mice) which stably maintain a mouse- derived engineered chromosome containing the entire human Ig heavy and kappa chain loci in a mouse Ig knockout background humanized mouse (Moriwaki, et al. Exp. Cell. Res. 390(2): 111914). These TC-mAb mice carrying mini-chromosomes with human immunoglobulin (Ig) loci can contribute to the development of fully human therapeutic monoclonal antibodies (Abs) when immunized with antigen of interest followed by fusion of the mouse B cells with a myeloma cells and to form hybridoma and plating these cells in semi-solid culture conditions to obtain single hybridoma clones which can be picked and evaluated, hybridoma single clones, Out of 1248 clones examined, we narrowed down by a series of progressive iteration
encompassing several biochemical and biological assays including flow binding and internalization to four (4) fully human anti-PTGFRN antibodies producing hybridomas with sequencing of their Heavy and light chains. Two families of antibodies have been identified. The first group represented by 8C7 can bind to many different types of cells expressing varying levels of cell surface PTGFRN. The second group is represented by 4F8, 12D8 and 6B2 which appear to preferentially bind to cell expressing very high level of PTGFRN. It has been shown that when presented as ADC, these various antibodies can inhibit proliferation of human cancer cells expressing PTGFRN and thus have therapeutic applications for human disease where PTGFRN is overexpressed including but not limited to cancer and metastasis.
[00162] Example 1. PTGFRN Expression Correlates with Metastatic-like Phenotype
[00163] This example shows the use of stable shRNA and cDNA transfections to respectively knockdown and over-express PTGFRN in three different cancer cell lines, two of which are representative of rare and aggressive cancers (Mesothelioma and Pediatric Medulloblastoma), to produce new cell lines (clones) with changed PTGFRN expression. The characteristics of the resulting clones showed a decrease in proliferation, migration, colony formation, and spheroid growth capabilities in cells where PTGFRN expression had been inhibited, while cells overexpressing PTGFRN showed the opposite. This example also shows that PTGFRN directly binds to two protein partners, Integrin β1 and E. Cadherin, the latter of which is a novel direct binding partner to PTGFRN. Furthermore, this example shows that silencing PTGFRN expression impacts the cellular process of autophagy, thereby providing another avenue by which PTGFRN potentially contributes to a cancer cell phenotype. These findings demonstrate the potential role of PTGFRN in cancer metastasis and suggest PTGFRN as a future target for drug development in the treatment of metastatic cancers. This example also shows that PTGFRN can provide a pre-screening target that identifies individuals that could be the subject of PTGFRN-related therapies, some of which are disclosed herein.
[00164] A. Materials and Methods
[00165] 1. Cell Lines
[00166] Cell lines were obtained from the American Type Culture Collection (ATCC, Manassas, VA). A431 (CRL-1555), DAOY (HTB-186), and MSTO-21 1H (CRL-2081) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 medium
(DMEM/F12 1 : 1 mixture) supplemented with 50μg/ml Gentamycin and 5% FBS, and maintained in a 5% CO2 incubator at 37°C.
[00167] 2. Silencing/Overexpression of PTGFRN and Clone Screening
[00168] For PTGFRN silencing, A431 and DAOY cells were transfected with two different human PTGFRN shRNAs (Fenics Bio, HSH321177-100), in order to silence PTGFRN expression (shRNA #1 sequence: TAGCCTTAAGAATGAATATGAA; shRNA #2 sequence: GTGGTATGTTTTGCTTTCCTAA), as well as one scrambled shRNA as control.
[00169] For PTGFRN overexpression, MSTO-211H cells were transfected with pcDNA3.1 plasmid vector (Thermo Fisher, V79020) with the human PTGFRN gene insert to overexpress PTGFRN. Empty vector was used as negative control. All transfections were conducted with Lipofectamine 3000 reagent (Thermo Fisher, L3000015), according to manufacturer’s instructions. After transfection, the pooled cells were sorted and dispensed as single cells into a 96-well plate by the Hana Single Cell Dispenser (Namocell, #NI004). These single cell clones were then expanded and screened via flow cytometry and immunoblot for the lowest and highest PTGFRN-expressing clones for each cell line.
[00170] For flow cytometry binding, we used a human anti-PTGFRN monoclonal antibody 8C7 that was generated in our laboratory by immunizing humanized TC mice (Takauchi et al., 2005) against the extracellular domain of PTGFRN (PTGFRN-ECD). All cells were detached and collected with PBS-5mM EDTA. 5x105 cells were incubated in increasing concentrations of either human IgG or anti-PTGFRN monoclonal antibody 8C7 in DMEM + 1% BSA for 1-hour at 4°C. Cells were then washed three times with cold PBS and incubated with 20μg/mL Goat-anti -Human IgG- Alexa Fluor 647 (Jackson ImmunoResearch, 109-605- 088) in DMEM + 1% BSA for 1-hour at 4°C. Subsequently, cells were washed three times with cold PBS, re-suspended in PBS, and binding was measured using an Intellicyt Flow Cytometer (Intellicyt HTFC Screening System).
[00171] For Western Blot analysis, cells were lysed in RIP A buffer containing protease inhibitors cocktail (Roche). 20μg of total cell lysate proteins were prepared and diluted with reducing SDS+DTT sample buffer. After heating to 100°C for 5 minutes, and cooling on ice, all samples were run on 4-12% Bis Tris gels (Genscript, M00653). After separation, proteins were transferred to a PVDF membrane, and blocked in 5% milk-PBST for 1 hour at room temperature. Following blocking, membranes were incubated with the anti-PTGFRN sheep
antibody (Bio-techne, AF4495) at a concentration of 0.2μg/mL, overnight at 4°C. The next day, membranes were washed in PBST, then incubated in Rabbit-anti-Sheep-HRP conjugated antibody (Jackson ImmunoResearch, 313-035-045) in 5% milk-PBST (1:2000) for 1 hour at room temperature. Membranes were then developed with ECL chemiluminescent solution in an Azure Biosystems 280 chemiluminescent unit.
[00172] 3, siRNA Knockdown of PTGFRN, E. Cadherin, and Integrin β1
[00173] A431 cells were transfected with siRNA coding for either PTGFRN, E. Cadherin, and Integrin β1 (Thermo Fisher). Transfections were conducted with Lipofectamine 3000 reagent (Thermo Fisher, L3000015), according to manufacturer’s instructions. After transfection and 48-hour incubation, cells were washed three times with PBS, and lysed in 1% Brij-O10 + protease inhibitor cocktail. Confirmation of specific knockdown was performed using western blot analysis.
[00174] 4. Proliferation Assay in Reduced Serum Concentration
[00175] All clones selected for functional assays were detached and collected with PBS- 5mM EDTA. 250cells/well (done in triplicate) were then plated in multiple 96-well plates in DMEM/F12 containing 0.2% fetal bovine serum (FBS). These plates were then incubated in a 5% CO2 incubator at 37°C. At each time point, proliferation was determined by measuring ATP levels with the CellTiter-Glo assay reagent (Promega, G9683) using a Molecular Devices LMaxII luminometer.
[00176] 5. Migration Assay
[00177] Transwell inserts and a 96-well plate were coated overnight at 4°C with Type II Rat Collagen (Corning) (40μg/mL) in sterile deionized water. The coating solution was aspirated the next morning and allowed to completely air dry. For MSTO-211 H cells, a 24- hour serum-starvation step was performed before cell collection. Cells were detached with 5mM EDTA, and washed and re-suspended with DMEM/F12 + 0.1% BSA. 7.5xl04 cells (for A431) or 5xl04 cells (For DAOY and MSTO-211H) were seeded inside the inner chamber of the insert. The outer chamber was filled with DMEM/F12 + 5% FBS, A431 cells were allowed to migrate for 18 hours, DAOY cells for 6 hours, and MSTO-21 1H cells for 48 hours. For each cell line, a standard curve with pre-specified cell numbers was plated in the 96-well plate, and cells were allowed to attach for 5 hours before being fixed and stained with
Crystal Violet as described below. All incubations were done in a humidified, 5% CO2, 37°C incubator.
[00178] After respective incubation times, the inserts were removed from their chamber, and non-migrated ceils on top of the transwells were removed with a cotton swab. Standard curve and inserts were fixed for 10 minutes in 4% paraformaldehyde, then placed in a 0.05% Crystal Violet solution (Fisher Scientific, C581-25), and allowed to stain overnight at room temperature. Images of the inserts were taken, and stain was eluted with a solution of 0.1M citric acid dissolved in 50% ethanol for quantification of cell number migrated compared to the cell standard curve in 96 well. The elated crystal violet solution was measured at OD590nm.
[00179] 6, Clonogenic Assay
[00180] A431 and DAOY shRNA transfected clones, and MSTO-211H overexpressing clones were plated in duplicate at 200, 100, and 50 cells/well in a 6 well plate in DMEM/F12+ 5% FBS. These plates were incubated at 37°C for 10 days, at which point the cell culture media was aspirated, the wells were washed with PBS, and the cells were fixed for 10 minutes in 4% Paraformaldehyde. After fixation, paraformaldehyde was removed, and the cells were stained in a 0.005% Crystal Violet solution for 20 minutes. Wells were washed 3 times with H2O, images of stained colonies were captured, and colony numbers were counted.
[00181] 7. 3D Spheroid Culture
[00182] To generate A431 spheroids, 8xl04 cells/well were plated in a 6-well, ultra-low attachment plate (Costar, 3471) in DMEM/F12 + 0.4% BSA + 4μg/mL Bovine Insulin. Spheroids were allowed to form and be maintained in culture for 10 days.
[00183] For DAOY spheroids, 500 cells/well were plated in a 96-well, ultra-low attachment plate (Costar, 7007) in complete 3D Tumorsphere Medium XF (Promo Cell, C- 28070). Spheroids were allowed to form for 10 days before imaging and lysate collection.
[00184] 8. Immunofluorescence
[00185] The anti-PTGFRN human monoclonal antibody 8C7 was generated in-house (manuscript submitted for publication). Conjugation of 8C7 to Alexa Fluor 555 was performed with Zip Alexa Fluor™ Rapid Antibody Labeling Kits (Thermo Fisher, Z11234), following manufacturer’s instructions.
[00186] Chambered coverslips (Thermo Fisher, #155380) were coated overnight at 4°C in 50μg/mL Poly-D-Lysine (Millipore Sigma, P6407) in sterile deionized water. Next day, collagen solution was aspirated from the coverslips, and was allowed to air dry for 2 hours at room temperature. 8xl04 cells were seeded in each chamber and allowed to attach overnight in a 37°C humidified 5% CO2 incubator. The next day, the cells were washed once with PBS and fixed with 100% methanol chilled to -20°C for 10 minutes. After three washes in PBS, the cells were incubated with Iμg/mL 8C7-Alexa Fluor 555, 1 :200 Anti-E. Cadherin-Alexa Fluor 488 (Cell Signaling, 3199S), 1 : 100 anti-Integrin β1-Alexa Fluor 647 (Abeam, ab214706), and Iμg/mL Hoechst 33342 (Thermo Fisher, H1399) diluted in 0.2% PBST + 1% BSA overnight at 4°C. The next day, the coverslips were washed three times with 0.2% PBST, then mounted in ProLong™ Glass Antifade Mountant solution (Thermo Fisher Scientific, P36982). The slides were kept overnight at 4°C, then viewed using a Nikon Al point-scanning laser confocal microscope (NIS-Elements, 100X).
[00187] For autophagy immunofluorescence, coverslips and cells were prepared using the same method, with the exception of the fixation step. These cells were fixed in 4% Paraformaldehyde for 10 minutes, then permeabilized in 0.2% TritonX-100, followed by three PBS washes. Incubation with Iμg/mL anti-LC3B antibody (Abeam, ab48394) and Hoechst 33342 was performed overnight at 4°C. After three washes in PBST, incubation with 5μg/mL Goat-anti-Rabbit-Alexa Fluor 555 (Abeam, abl50078) was done at 4° for 2 hours. Washing, mounting, and visualization were performed as described above.
[00188] 9. Co-Immunoprecipitation
[00189] Cells were lysed in 1% Brij-O10 lysis buffer containing protease inhibitor cocktail, and this lysate was precleared with 100μL of packed protein G agarose beads (Protein Mods) overnight at. The next day, aliquots of lysates (250μg) were incubated with 10μg of either control human IgG, 8C7, anti-E. Cadherin antibody (Novus Biologicals, NBP3-14687), or anti-Integrin β1 antibody (Bio-techne, MAB1778) overnight at 4°C. The next day, Protein G agarose beads were added to the lysates, and mixed constantly for 2 hours at 4°C. After 5 washes with 1% Brij lysis buffer, 2X SDS+DTT sample buffer were added, and the beads
were heated to 100°C for 5 minutes, then cooled on ice. The elutions were then run on 4-12% Bis-Tris polyacrylamide gels and analyzed by Western Blot with their respective Western Blot antibodies. The anti-E. Cadherin western blot (WB) antibody was purchased from Cell Signaling (3195S). The anti-Integrin β1 WB antibody was purchased from Fortis Life Sciences (A303-735A). The anti-GAPDH WB antibody was purchased from Cell Signaling (2118S). The Goat-anti-Rabbit-HRP (111-035-144) antibody was purchased from Jackson ImmunoReseach Laboratories.
[00190] 10. Statistical Analysis
[00191] Statistical analysis was performed using GraphPad Prism version 8.3. Flow cytometry and functional assays were carried out and repeated three times. Proliferation assays were done in triplicate three times each. Results were analyzed for statistical significance using a Welsh’s T-test.
[00192] B. PTGFRN Expression and Proliferative Potentials
[00193] It has been shown previously that A431 and DAOY cells are two cell lines which have high level of PTGFRN expression (Marquez et al., 2021). For both cell lines, we generated clone derivatives where PTGFRN expression had been significantly and stably inhibited by PTGFRN shRNA plasmid transfection as described in the method section. These clones are referred to as A431 shRNAl and A431 shRNA2, DAOY shRNAl, and DAOY shRNA 2, respectively. Control cells were transfected with scrambled shRNA plasmid. In addition, transfection of human PTGFRN cDNA in the low PTGFRN-expressing MSTO- 211H cell line resulted in a stable clone that showed increased PTGFRN expression (Referred to as MSTO-PTG). Western blot analysis of PTGFRN expression for the resulting clones are shown in Figure 2.
[00194] Flow cytometry analysis was also performed to verify our western blot results. By measuring the flow binding of an anti-PTGFRN antibody (8C7), we observed that PTGFRN expression was reduced by approximately 90% in A431 shRNA and DAOY shRNA clones, whereas transfection of PTGFRN cDNA into MSTO-211H cells resulted in a 10-fold increase in PTGFRN expression (Figure 3).
[00195] C. Effect of PTGFRN Expression on the Cell Proliferation Potential in Low-
Serum Conditions
[00196] When examining their proliferative capability in low-serum concentration, A431 shRNAl and shRNA2 clones showed a 75% reduction in proliferation in low-serum conditions, compared to the control clones (Figure 4A). In DAOY shRNAl and shRNA2 cells, knockdown of PTGFRN resulted in a 90% reduction in proliferation (Figure 4B). The MSTO-PTG cells demonstrated a significant increase in proliferation level compared to the empty vector transfected cells that did not proliferate, and even died in the low-serum conditions examined (Figure 4C).
[00197] D. Effect of PTGFRN Expression on Cell Migration
[00198] Migration capability of cells where PTGFRN expression had been inhibited or overexpressed was also examined. As shown in Figure 5A, the migration of A431 shRNAl and shRNA2 cells was decreased by 90%, and in DAOY shRNAl and shRNA2 cells (Figure 5B), migration was decreased by approximately 65% compared to control cells. In contrast to the effect of PTGFRN knockdown, PTGFRN overexpression in MSTO-PTG cells (MSTO- 211H expressing PTGFRN by transfection of PTGFRN cDNA) showed a 4-fold increase in migration levels compared to the empty vector control clone (Figure 5C).
[00199] E. PTGFRN Expression and Clonogenic Ability
[00200] PTGFRN expression also affected the clonogenic ability of the cells tested. As shown in Figure 6A, A431 and DAOY shRNAl and shRNA2 clones showed a significant decrease in the number of colonies formed (80% and 66% reduction of colony numbers, respectively). Alternatively, PTGFRN overexpression in MSTO-PTG cells significantly increased the number of colonies formed, showing 50+ colonies formed, compared to the MSTO-211H control cell line, where almost no colonies were formed, even at the highest cell number tested (Figure 6B).
[00201] G. PTGFRN Knockdown Inhibits Formation of Spheroids
[00202] The ability of cells to form spheroids in 3D culture is a hallmark of cancer cells and particularly cancer stem cells. The effect of PTGFRN expression on spheroid formation was examined. As seen in Figure 7A, after PTGFRN knockdown, A431 shRNA clones were unable to form spheroids in contrast to control shRNA transfected cells. DAOY shRNA
clones were also unable to form spheroids of the same size or shape compared to the control shRNA clones (Figure 7B). For DAOY shRNA clones, while cell aggregates formed and appeared spheroidal in shape, the moment the plates were disturbed, or we attempted to collect these aggregates, they immediately deteriorated into single cell suspension. In contrast, the DAOY control shRNA clone spheroids could be manipulated freely without the breakdown of the spheroids into single cells. This indicates that a positive PTGFRN expression is associated with the cells ability to form spheroids in 3D culture.
[00203] H. PTGFRN Knockdown Inhibits Accumulation of Integrin β1 and E. Cadherin in 3D Culture Conditions, But Not in 2D Culture Conditions
[00204] Based on the observation that spheroid formation is impacted by PTGFRN expression, we investigated mechanisms and potential protein interactions known to be associated with this process. As detailed by Lin et al., the two largest drivers of spheroid formation are the proteins E. Cadherin and Integrin β1, in which the binding of Integrin β1 to extracellular matrix (ECM) proteins triggers an upregulation and accumulation of E. Cadherin, which is responsible for the tightening of cell-cell junctions that result in cell aggregates forming tight, compact spheroids (Lin, et al. Cell Tissue Res. 324(3): 411-22 (2006)). Based on this observation, whether PTGFRN knockdown had any effect on the expression of these two proteins in both 2D and 3D culture conditions was determined.
[00205] In Figure 7C, the expression levels of Integrin β1 and E Cadherin in 3D culture of control shRNA A431 cells, which form spheroids, with that of 3D culture of A431 shRNA cells that did not form spheroids. It was shown that both Integrin β1 and E. Cadherin both retained high levels of expression in the control A431 spheroids, whereas the PTGFRN shRNA A431 cells that could not form spheroids have significantly lower levels of expression of these two proteins. Additionally, this decrease in expression was not seen in the shRNAl and shRNA2 cells grown in 2D culture conditions compared to control shRNA A431 cells in 2D Culture.
[00206] I. PTGFRN, Integrin β1, and E. Cadherin Co-Localize to Cell-Cell Junctions, and Are Capable of Directly Associating with Each Other
[00207] To evaluate the relation (or association) between PTGFRN, Integrin β1, and E. Cadherin, fluorescent microscopy was used to determine if these three proteins were present
in the same subcellular area. Figure 8 demonstrates that when using confocal fluorescent microscopy, fluorescent antibodies raised against E. Cadherin (Fig. 8A), PTGFRN (Fig. 8B), Integrin β1 (Fig. 8C), and co-localized in the junctions between cells grown in 2D culture (Fig. 8D)
[00208] Co-immunoprecipitation assays were also carried out by lysing cells in a weak Brij O10 detergent in order to preserve direct protein-protein interactions. Immunoprecipitation using anti -PTGFRN antibody 8C7 showed the presence of both Integrin β1 and E. Cadherin in the IP fraction. IP using an anti -Integrin β1 antibody showed the presence of PTGFRN and E. Cadherin, and IP using an anti-E. Cadherin antibody showed the presence of PTGFRN and Integrin β1. These results indicate that these three proteins are associated and support the co- localization results.
[00209] Whether the formation of this potential complex required all three proteins was studied next. For this purpose, the expression of each protein was inhibited by SiRNA transfection and determined whether the other two proteins were able to co- immunoprecipitate. The resulting analysis suggested that the binding of E. Cadherin was dependent on Integrin β1 and PTGFRN being bound. The data shows that when PTGFRN expression was knocked down by siRNA transfection, E. Cadherin could no longer co-IP with Integrin β1. Likewise, siRNA knockdown of Integrin β1 prevented PTGFRN and E. Cadherin to co-IP. Yet, knockdown of E. Cadherin by siRNA transfection showed no effect on the ability of PTGFRN and Integrin β1 to co-IP.
[00210] To confirm that this change in co-immunoprecipitation profile was due to the loss of binding partners, and not altered protein expression after transient siRNA transfection, the expression of all three proteins was examined in cells that had PTGFRN, E. Cadherin, and Integrin β1 knockdown by siRNA. Figure 9 shows that knockdown of PTGFRN had no effect on the expression level of E. Cadherin and Integrin β1, knockdown of E. Cadherin had no effect on PTGFRN or Integrin β1, and knockdown of Integrin β1 had no effect on PTGFRN expression. However, E. Cadherin expression seemed to slightly increase after Integrin β1 knockdown.
[00211] J. Loss of PTGFRN Expression Results in an Increase in LC3B Accumulation, Indicating an Increase in Autophagy
[00212] The PTGFRN knockdown in A431 cells resulted in a change in morphological features compared to the control shRNA clone; namely, an increase in large vacuole-like structures. Such structures are commonly viewed as an indicator of the cellular process known as autophagy. To determine if this was the case, expression levels of LC3B, a marker of autophagy, were measured using immunofluorescence (Figure 10A), as well as western blot analysis (Figure 10B). In both cases, LC3B expression was increased in the PTGFRN shRNA knockdown clones compared to the control shRNA clone. This provides another potential pathway through which PTGFRN can influence a cell’s phenotype.
[00213] K. Discussion
[00214] The identification of proteins involved or associated with the metastatic process and the understanding of their function are important. As such, the characteristics of the protein Prostaglandin F2 Receptor Negative Regulator, or PTGFRN, and its potential role in contributing to a metastatic-like phenotype were further examined.
[00215] PTGFRN is a primary binding partner to multiple members of the family of proteins called Tetraspanins. This family contains 33 unique proteins, which are capable of binding to each other, as well as to proteins outside the tetraspanin family (Jiang, Zhang, & Huang, 2015). PTGFRN’ s primary binding partner, the tetraspanin CD9, has also been found to promote proliferation of certain cell types, but is still generally categorized as a metastasis suppressor, whereas CD151, a secondary partner of PTGFRN, is classified as a metastasis promoter (Lazareth et al., 2019; Zoller, 2009). However, the cell type may play a role in determining the metastatic influence of tetraspanins. For instance, CD9 has been shown to both promote, as well as suppress, migration ability depending on the cell type studied. CD9 was reported to inhibit migration and metastasis in the small-cell lung cancer (Funakoshi et al., 2003; Zheng et al., 2005). However, in melanoma and breast cancer-derived cell lines, CD9 has been reported to have opposite effects, promoting migration and metastasis in cutaneous melanoma, and collagen-induced migration in triple negative breast cancer, but suppressing migration and metastasis in these same cancers in response to fibronectin (Castro-Sanchez, Soto-Guzman, Navarro-Tito, Martinez-Orozco, & Salazar, 2010; Longo et al., 2001; Powner, Kopp, Monkley, Critchley, & Berditchevski, 2011; Yin et al., 2014).
[00216] Recently, Mala et al. investigated the effect of PTGFRN expression in glioblastoma cells, and reported comparable results to ours, with PTGFRN silencing resulting in decreased proliferation, migration, and colony formation in GBM cells. They found that
PTGFRN shRNA silencing lowered signaling of the ERK, AKT, and mTOR pathways (Mala, Baral, & Somasundaram, 2022). However, a change in the level of ERK and AKT phosphorylation because of inhibition or overexpression of PTGFRN in the three cells lines was not observed (data not shown).
[00217] Interestingly, like GBM reported by Mala et al, two of the cell lines tested here are derived from rare cancers (Medulloblastoma and Mesothelioma). This work examines the effect of increasing PTGFRN expression in a naturally low-expressing cell line, as opposed to solely looking at PTGFRN silencing. It was shown that increasing PTGFRN expression resulted in higher migration, proliferation, and clonogenicity potential.
[00218] Previous research has indicated that the transmembrane domain, as well as the cytoplasmic domain of PTGFRN, regulate the effect on cell motility, a characteristic necessary in metastasis. (Chambrion & le Naour, 2010). In leukocytes, PTGFRN has been found to interact with ERM (Ezrin-Radixin-Moesin) proteins, which act as intermediaries between the cell membrane and cytoskeletal components in leukocytes (Sala-Valdes et al., 2006). The rearrangement of cytoskeletal proteins is a prerequisite for cell motility, and has been found to be partially driven by not only ERM, but also by the suppression of E. Cadherin, which leads to decreased cell junction tightness, as well as altered membrane protrusion activity (Alt-Holland et al., 2008).
[00219] The ability of cancer cells to proliferate and form a secondary tumor is a property that can be determined in vitro using the Clonogenic Assay. Clonogenicity is considered a hallmark property of malignant cancer cells, or cells transforming from benign to malignant type (Brix, Samaga, Belka, Lauber, & Zitzelsberger, 2021; Fiebig, Maier, & Burger, 2004). Cells that exhibit enhanced clonogenicity have also been found to express higher amounts of stem-cell markers, such as ALDH, CD31, and OCT4 (Toledo-Guzman, Hernandez, Gomez- Gallegos, & Ortiz-Sanchez, 2018; Yang et al., 2022; Zhang et al., 2023). The data here show that that cells whose PTGFRN expression has been inhibited have a lower clonogenicity.
[00220] Similar to clonogenic ability, the ability to form spheroids has previously been linked to the increased expression of sternness markers (Rozenberg et al., 2021). Attention has focused on the main proteomic drivers of spheroid formation; specifically, E. Cadherin and Integrin β1. The work done by Lin et al. showed that the binding of Integrin β1 to extracellular matrix (ECM) proteins triggered what they referred to as a “lag phase”, where cells began to upregulate the expression of E. Cadherin, which was essential for spheroid
compaction and growth (R. Lin et al., 2006). It has been shown here that PTGFRN and E. Cadherin can co-IP. This would suggest that E. Cadherin and PTGFRN likely associate with each other, either directly, or via a larger complex. The silencing of PTGFRN inhibiting both Integrin β1 and E. Cadherin accumulation in 3D culture lends further evidence that PTGFRN can modulate the activity of multiple proteins and protein complexes involved in cell migration and spheroid growth.
[00221] These experiments determined the level of organization between the three proteins. Knockdown of E. Cadherin showed no effect of the co-immunoprecipitation of PTGFRN and Integrin β1. In contrast, knockdown of PTGFRN inhibited co-immunoprecipitation of E. Cadherin and Integrin β1, and knockdown of Integrin β1 prevented the co- immunoprecipitation of PTGFRN and E. Cadherin. The data (not shown) confirm that this is due to the lack of binding partners, as individual knockdown of each protein by SiRNA transfection did not affect the expression of the other two proteins. The only change seen was a slight increase in E. Cadherin expression after Integrin β1 knockdown. The fact that no PTGFRN co-immunoprecipitated with E. Cadherin after Integrin β1 knockdown would indicate that PTGFRN and Integrin β1 must be present and interacting with each other in order for E. Cadherin to complex with these proteins.
[00222] Stable knockdown of PTGFRN by shRNA in A431 cells showed a significant increase in the conversion of LC3I into LC3B, a well-studied marker of the process known as autophagy (Lazova et al., 2012). Autophagy is a type of cell death by which a cell selectively sequesters protein aggregates, lipids, and organelles, and delivers them for lysosomal degradation in response to stress or starvation, after which the degraded material is then recycled by the cell (Levine, Kroemer, & Roussy, 2008; P. Lin, Chu, & Liu, 2020; Mizushima, 2010). This process has been found to play a pivotal role in cancer suppression, as demonstrated in liver carcinogenesis (Qu et al., 2003; Yue, Jin, Yang, Levine, & Heintz, 2003). However, the role of autophagy in survival during periods of starvation also means that it can be used as a protective mechanism by cancer cells (Degenhardt et al., 2006). In a breast cancer model, autophagy was found to be supportive of the growth of primary tumors, yet inhibited metastatic outgrowth to a secondary site (Marsh et al., 2020).
[00223] The integrin protein family plays a crucial role in mediating cell attachment to the extracellular matrix (ECM), and their disruption can trigger anoikis, a form of cell death (Frisch & Screaton, 2001). In these conditions, autophagy is often activated as a survival
mechanism to combat detachment-induced anoikis (Vlahakis & Debnath, 2017). Additionally, Integrin β1 specifically has been found to be involved in regulating autophagy (Zhou, Liu, Zhou, & Li, 2022). E. Cadherin is also linked to autophagy, as it is sequestered into the autophagosome in breast and lung cancers (45, 46). This autophagy-driven degradation of E. Cadherin is believed to regulate tumor progression, as the loss of E. Cadherin is commonly observed in migratory cells, breast cancers with poor prognosis, and dormant cancer cells (Lazova et al., 2012; Vera-Ramirez, 2020). Determining whether the observed autophagy after PTGFRN knockdown is protective or induces cell death would provide valuable insights. If this autophagy is determined to be pro-death, it would support the positive correlation between PTGFRN expression and a metastatic-like phenotype. It is hypothesized that PTGFRN knockdown leads to a disruption of Integrin β1 complexing, which prevents E. Cadherin accumulation necessary for spheroid formation, but also induces cellular stress on cancer cells, leading to pro-survival autophagy signalling to counteract anoikis.
[00224] Using three different cancer cell lines, a positive correlation between PTGFRN expression level has been shown, and the cells’ ability to proliferate in low-serum conditions, migrate through a transwell membrane, form colonies at low cell number, and, form multicellular 3D spheroids, all of which are characteristics associated with metastasis. From these studies, it has also been d that the adhesion molecule E. Cadherin as a possible direct binding partner of PTGFRN, which would make it a novel binding partner for this tetraspanin protein. Additionally, the loss of PTGFRN expression coincided with the increase in the conversion of LC3B, a key marker of autophagy, and may be another possible contributing factor of PTGFRN’ s influence on cancer metastasis.
[00225] The use of mass spectrometric proteome analysis would be useful to further examine the effect of PTGFRN on cancer cells and provide a global, untargeted approach to better assess not only proteins affected by PTGFRN expression, but also complexed partners of PTGFRN and identify the overall pathways affected by PTGFRN expression.
[00226] In summary, the expression of the cell-surface transmembrane protein PTGFRN is associated with several key cellular functions such as proliferation, migration, colony formation, and 3D spheroid formation in epidermoid carcinoma (A431), pediatric medulloblastoma (DAOY), and mesothelioma (MSTO-211H). These effects would involve the binding of PTGFRN to Integrin β1, a pairing previously reported, as well as binding to E.
Cadherin, which has not been reported until now. Remarkably, the loss of PTGFRN expression also coincided with an increase in autophagy, a regulated form of cell death. These collective findings lead us to propose that PTGFRN overexpression influences cellular phenotype, promoting a metastatic-like profile.
[00227] Example 2. Effect of PTFGRN Expression on the Proteomic Profile of A431 Cells and Determination of the PTGFRN Interactome
[00228] A. Materials and Methods
[00229] 1. Cell Lines
[00230] All cell lines studied were obtained from the American Type Culture Collection (ATCC, Manassas, VA). A431 (CRL-1555) was cultured in Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 medium (DMEM/F12 1 : 1 mixture) supplemented with 50μg/ml Gentamycin and 5% FBS, and maintained in a 5% CO2 incubator at 37°C.
[00231] 2. Silencing/Overexpression of PTGFRN and Clone Screening
[00232] A431 cells were stably transfected with two different human PTGFRN shRNAs (Fenics Bio, HSH321177-100), in order to silence PTGFRN expression (shRNA #1 sequence: TAGCCTTAAGAATGAATATGAA (SEQ ID NO: 209); shRNA #2 sequence: GTGGTATGTTTTGCTTTCCTAA (SEQ ID NO: 210), as well as one scrambled shRNA as control. Transfections were carried out with Lipofectamine 3000 reagent (Thermo Fisher, L3000015), according to manufacturer’s instructions. After transfection, the pooled cells were sorted and dispensed as single cells into a 96-well plate by the Hana Single Cell Dispenser (Namocell, #NI004). These single cell clones were then expanded and screened via flow cytometry and immunoblot for the lowest PTGFRN-expressing clone.
[00233] 3. Co-Immunoprecipitation
[00234] All immunoprecipitations (IP) were carried out in triplicate. A431 was lysed in 1% Brij-O10 lysis buffer containing protease inhibitor cocktail, and this lysate was precleared with 10OpL of packed protein G agarose beads (Protein Mods) overnight at 4°C. The next day, aliquots of lysates (250μg each) were incubated with 10μg of either control human IgG, or our anti-PTGFRN human monoclonal antibody 8C7 (generated in-house) overnight at 4°C. The next day, Protein G agarose beads were added to the lysates, and mixed constantly for 2 hours. After 5 washes with 1% Brij lysis buffer, 2X SDS+DTT sample buffer was added to
the beads. All immunoprecipitated proteins were then digested using S-trap micro columns (ProtiFi, NY). The eluted peptides from the S-trap column were dried, and peptide concentration was determined using a BCA assay kit (Thermo Fisher Scientific, A53225), after reconstitution in 0.1% formic acid.
[00235] 4. Mass Spectrometry-Based Proteomics Analysis
[00236] Cell lysis and protein digestion were performed as previously described (Weldemariam, et al. Proteomics [Internet], 2023 Jul 24;n/a(n/a):2300022). Briefly, samples were lysed in a lysis buffer containing 5% sodium dodecyl sulfate (Sigma, L4509), 50 mM triethylammonium bicarbonate (1 M, pH 8.0) (Sigma, 7408). Proteins were extracted, and separated on a nanoACQUITY Ultra-Performance Liquid Chromatography analytical column (BEH130 C18, 1.7 pm, 75 pm x 200 mm; Waters Corporation, Milford, MA, USA) over a 185-min linear acetonitrile gradient (3-40%) with 0.1% formic acid on a nanoACQUITY Ultra-Performance Liquid Chromatography system (Waters Corporation, Milford, MA USA) and analyzed on a coupled Orbitrap Fusion Lumos Tribrid mass spectrometer (Thermo Scientific, San Jose, CA USA). Full scans were acquired at a resolution of 240,000m/z, and precursors were selected for fragmentation by high-energy collisional dissociation of 35% for a maximum 3-s cycle. The MS/MS raw files were processed with Proteome Discoverer (PD, version 2.5.0.400, Thermo Fisher Scientific) using Sequest HT search engine against a UniProt human reference proteome (release 2022.04, 20292 entries). Searches were configured with static modifications for carbamidomethyl on cysteines (+57.021 Da), dynamic modifications for oxidation of methionine residues (+15.995 Da), precursor mass tolerance of 20 ppm, fragment mass tolerance of 0.5 Da. Trypsin was used as digestion enzyme with maximum of two missed cleavages. The minimum and maximum peptide lengths were set as 6 and 144, respectively. Label-free quantification was performed using Minora feature detector, a tool embedded in the PD bioinformatics platform (Palomba, et al. J Proteome Res [Internet], 2021/05/26. 2021 Jul 2;20(7):3497-507). For high confidence results, protein identification was filtered to 1% false discovery rate (FDR) in peptide spectra match (PSM), peptide, and protein levels. The FDR was calculated using the Percolator algorithm embedded in PD. Next, the exported protein abundance values were analyzed and visualized using Perseus software (version 1.6.14.0) (Tyanova, et al. Nat Methods [Internet], 2016; 13(9):731-40). To ensure high confidence in statistical analysis, data were further filtered to include only proteins identified without any missing values in all the biological
samples. The quantitative protein data were log2 transformed and further normalized using median centering. Two-tailed student’s t-test was applied for comparisons between two conditions (p < 0.05) to determine if each treatment group was significantly different from the control group. Enrichment of functions and signaling pathways of the differentially expressed proteins (DEPs) identified from different conditions was performed using Metascape (http://metascape.org) as described previously (Weldemariam, et al., supra, Zhou, et al. Nat Commun [Internet], 2019; 10(1): 1523). Once the differentially expressed proteins were identified, bioinformatic pathway analysis was used to further infer perturbed pathways. Ingenuity Pathway Analysis (IPA) analysis was used to predict canonical pathways and upstream regulators, as well as provide Z-scores to overlapping pathways from both databases (Kramer, et al. Bioinformatics [Internet], 2014 Feb 15;30(4):523-30; Huang, et al. Health Phys [Internet], 2020; 119(5)).
[00237] B. Results
[00238] 1. Effect of PTGFRN expression on the proteomic profile of A431 cells
[00239] The aim of our current study was to investigate the effect of PTGFRN knockdown on the proteome of A431 cells. To this end, mass spectrometric analysis was performed with A431 cells where PTGFRN expression had been inhibited by shRNA transfection (A431 shRNA), and on control A431 cells transfected with a scrambled shRNA sequence, cultivated in 2D culture conditions. The proteomic analysis resulted in the identification of 5680 protein groups at 1% FDR after filtering the processed data as described in the method section. Among these protein groups, 3455 were quantified without missing values in any of the 12 samples. Any protein whose expression was significantly increased or decreased in response to PTGFRN knockdown was assessed. Using the list of modulated proteins, we performed pathway analysis using Metascape or IPA analysis in order to determine what cellular functions and pathways were most affected by the decrease of PTGFRN expression.
[00240] After PTGFRN knockdown, the most downregulated biological processes or pathways were involved in the synthesis of various metabolites, metabolic precursors, and energy, including those involved in the respiratory electron transport chain. In addition to this, other significantly inhibited pathways include ER to Golgi anterograde transport, ribosome biogenesis, exosome function, NADH oxidation, and VEGFA-VEGFR2 signalling. PTGFRN knockdown also resulted in increases to other pathways, with many of them involved in immune system signaling, such as Cytokine Signaling, Interferon Signaling, and
Neutrophil Degranulation. The heatmap in Figure 11A outlines the top 20 cellular processes that were increased after PTGFRN knockdown by shRNA transfection, while Figure 11B shows the top 20 cellular processes that were found to be decreased after PTGFRN knockdown. Table 16 contains the top 10 proteins found to be upregulated after PTGFRN knockdown, while Table 17 outlines the top 10 pathways represented by those proteins upregulated after PTGFRN knockdown. Table 18 presents the top 10 proteins whose expression was downregulated after PTGFRN knockdown, followed by Table 19, which describes the pathways most impacted by those downregulated proteins.
[00241] 2. PTGFRN Interactome Analysis
[00242] In addition to looking at the effect of PTGFRN expression modulation, mass spectrometric analysis was applied to examine proteins which were associated with PTGFRN by co-immunoprecipitation with an anti-PTGFRN antibody compared to co- immunoprecipitation with control IgG. From this list of proteins found to co- immunoprecipitate with PTGFRN, pathway analysis was also performed, indicating which processes had proteins members who were either directly bound to, or associated with PTGFRN.
[00243] The cellular process which had by far the most members found to be associated with PTGFRN was the metabolism of RNA. The pathways VEGFA-VEGFR2 signaling, regulation of translation, and ribonucleoprotein complex biogenesis also had many protein constituents pulled down along with PTGFRN. Figure 12 displays the heatmap outlining the top 20 processes whose protein members were found to co-immunoprecipitate with PTGFRN, indicating protein interactions. Table 20 displays the top 10 proteins that were the most abundantly present besides PTGFRN after co-IP with 8C7, while Table 21 contains the top 10 pathways associated with these co-immunoprecipitated proteins.
[00244] 3. Discussion
[00245] The mass spectrometric analysis performed here provided new data about the effect of PTGFRN expression on the proteomic profile and proteins associated with PTGFRN. Firstly, the cellular processes whose protein members were decreased in expression after PTGFRN knockdown appear to validate findings already reported for PTGFRN, where PTGFRN knockdown was found to inhibit VEGF-induced angiogenesis, and overexpression was found to be correlated with a metastatic-like profile (Karhemo, J. Proteomics, 2021, 77:87-100; Aguila, et al. Cancer Lett., 2019, 462 (April): 33-42; Guilman, et al. Br. J. Cancer, 2011, 104(3): 496-504). The inability to biosynthesize metabolic precursors, transport proteins for appropriate post-translational modification, or even produce normal levels of ATP from NADH oxidation and the electron transport chain would certainly likely result in diminished ability for cells to proliferate, and would severely limit how many cells could grow into colonies from a single cell if said cell has lower proliferative capability. Secondly, while cellular migration was not a pathway listed in the database used to examine the proteomics data, there are indeed proteins found to be involved in migration and invasion whose expression was decreased after PTGFRN knockdown (data not shown). The proteins NUDT1, DKC1, RBBP7, and RSF-1 (all contained within the Chromosome Maintenance
pathway), as well as LRRC59 (VEGFA-VEGFR2 signaling pathway), shown here to be decreased in expression after PTGFRN knockdown, have all been found to be involved and influence the migration capability of cancer cells (Ou, et al. Aging, 2020, Apr 27, 12(8): 7363-79; Miao, et al. Invest New Drugs [Internet], 2019;37(6): 1177-86; Yu, et al. Oncol. Lett. 2018 Dec;16(6):7204-l l; Zhang, et al. Virchows Arch [Internet], 2017;470(5):553-60; Li, et al. Onco Targets Ther [Internet], 2020 Jul 3; 13:6453-63). Elevated proliferation, migration, and clonogenic potentials are all hallmarks of metastatic cancer cells (Fares, et al. Signal Transduct Target Ther [Internet], 2020;5(l):28).
[00246] When analyzing the proteins that are directly bound/complexed with PTGFRN and co-immunoprecipitate with PTGFRN with an anti-PTGFRN antibody, the pathway whose members showed the most interaction with PTGFRN was metabolism of RNA. In fact, of the top 20 pathways whose proteins are found to be bound to PTGFRN, nine are involved directly or indirectly in RNA processing and/or translation. Proteins involved in the formation of the ribosome subunits (RPL3, RPS8), RNA polymerase (POLR2H), removal of introns from pre-mRNA (SNRPB2), and translation initiation factors (EIF2a) were among the most abundantly co-immunoprecipitated along with PTGFRN. This is quite interesting, as these proteins are typically found in the cytoplasm, located nearby the endoplasmic reticulum (Reid, et al. J Biol Chem [Internet], 2011/12/23. 2012 Feb 17;287(8):5518-27), whereas PTGFRN is most commonly found in the plasma membrane. This would suggest that PTGFRN serves as a membrane anchor, working as a part of a large scaffold to stabilize the ribosome, various polymerases, and/or translation factors, so that they can properly process RNA. PTGFRN could also be functioning solely as a trafficking protein, to ensure that these components reach their required subcellular locations from the Golgi Apparatus, while not actually contributing to their overall function. Alternatively, these results could also be pointing to an intracellular form of PTGFRN whose functions differ from those associated with its plasma membrane form. It is unclear at this time if these differing functions could be due to distinct isoforms through alternative splicing, different glycosylation patterns, or if the subcellular location of PTGFRN influences its overall function. It is known that PTGFRN may have 3 putative splice sites, which could very well result in different isoforms with differing functions (Cunningham, et al. Nucleic Acids Res [Internet], 2022 Jan 7;50(Dl):D988-95).
[00247] The next most abundantly represented pathway whose protein members were found to co-IP with PTGFRN was that of VEGFA-VEGFR2 signaling. Interestingly, this same pathway was also found to be significantly decreased following PTGFRN knockdown. Notably, the only protein whose expression was found to be both downregulated after PTGFRN knockdown, as well as co-immunoprecipitated with PTGFRN in our co-IP, was LMAN1, a protein found to regulate protein folding, transport to the Golgi from the Endoplasmic Reticulum, and other organelle organization (26). This lends further support to the hypothesis that PTGFRN seems to be highly involved in RNA processing and translation, and the trafficking of the newly translated protein to the Golgi and further cellular locations. These results seemingly confirm those published by Colin et al., where it was demonstrated that transfection of a truncated form of PTGFRN into cells resulted in diminished angiogenesis, and thus tumor formation (Br J Cancer. 2011 ; 105(7): 1002— 11). Taken together, the analysis performed here provide proteomic information to support previously published observations, linking PTGFRN to VEGF-induced angiogenesis, but also further establishing a relationship between PTGFRN expression and cancer metastasis. Additionally, the discovery that PTGFRN seems to be overwhelmingly associated with proteins involved in mRNA and protein translation/trafficking contributes other mechanisms by which PTGFRN affects cell proliferation and migration contributing to cancer metastasis. In summary, mass spectrometric analysis shed new light on the effect of PTGFRN expression on the proteome of A431 cells. Previously published findings were also confirmed, such as PTGFRN’ s role in VEGF signalling. Interactome analysis also provided added information regarding PTGFRN binding partners, showing PTGFRN association with proteins involved in mRNA/protein translation and processing. This information provides some pathways with which PTGFRN expression may affect cancer cell phenotype, and how it may correlate with metastatic-like profile, as previously reported.
[00248] Example 3. Development of and Functional Characterization of Candidate
Antibodies
[00249] Human (Hu) Ab producing Tc mice (TC-mAb mice) stably maintain a mouse- derived engineered chromosome containing the entire human Ig heavy and kappa chain loci in a mouse Ig knockout background (Moriwaki, et al. Exp. Cell. Res. 390(2): 111914). Trans- chromosomic (TC) mice carrying mini-chromosomes with human immunoglobulin (Ig) loci can contribute to the development of fully human therapeutic monoclonal antibodies (Abs) when immunized with antigen of interest. In this case, TC-mAb mice were immunized with human recombinant PTGFRN extracellular domain protein (PTGFRN ECD) according to a schedule that has been previously validated.
[00250] After 30 days, the anti -PTGFRN serum titer of immunized mice was checked by enzyme-linked immunoassay (ELISA) by incubating the sera with human PTGFRN ECD immobilized to 96-well plates, followed by incubation with HRP-conjugated goat anti-human Fc secondary antibody followed by addition of peroxidase substrate tetramethylbenzidine (TMB) and reading the absorbance at 650 nm of each well with a microtiter plate reader. B cells were collected from the spleen and lymph nodes of mice exhibiting the highest anti- PTGFRN titer and fused by electroporation to mouse myeloma HL-1 cells. Fused hybridomas were single cell plated in semi-solid hybridoma culture medium in 10 cm tissue culture plates. After 11 days, 1248 single hybridoma clones were picked from the semi-solid medium plates and transferred to 96 well dishes (one clone per well) in hybridoma culture medium. After 4 days, culture media of the hybridoma clones were assayed in an initial screen by PTGFRN-ECD enzyme-linked immunoassay (ELISA) as described above. The top 246 positive clones were selected, transferred to 48-wells and supernatant assayed for a confirmatory screen by ELISA soloed by flow binding on Hek-293A cells overexpressing human PTGFRN cDNA (HEK-PTG) compared to binding to HEK293A cells (PTGFRN negative cells). 207 clones were confirmed strong positive for both ELISA and flow binding. These clones were transferred to six (6) well plates in duplicate and were cryo-preserved in appropriate culture conditions for long-term storage in liquid nitrogen while culture media containing secreted human anti-PTGFRN immunoglobulin were collected and stored for future evaluation and selection of hybridoma of interest. The anti-PTGFRN antibodies produced by these selected hybridoma clones were examined for several properties. Cell surface binding of the antibodies was determined by flow cytometric assay to HEK293 cells overexpressing PTGFRN (HEK-PTG) versus HEK293A (PTGFRN negative). Candidate anti-PTGFRN antibodies showing cell surface binding to HEK-PTG and less or no binding to HEK293A were then selected for further development. Internalization of candidate
antibodies in the HEK-PTG cell line was determined using HEK-cells as negative control. Binding and internalization of candidate antibodies were then determined with human cancer cells known to naturally express PTGFRN including A431 cells, DAOY cells, and MSTO- 211H.
[00251] Functional assays of antibodies as indirect or direct antibody drug conjugates with a cytotoxic payload were performed in vitro and in vivo to determine whether internalizing antibodies can deliver a cytotoxic payload to cells and inhibit their survival or stimulate cell killing. For the indirect antibody drug conjugate cytotoxic in vitro assays, PTGFRN positive cancer cells were incubated for three days with candidate anti-PTGFRN antibodies and with Fab Anti-Human IgG Fc-Duocarmycin DM Antibody with Cleavable Linker. Negative control consisted of cells incubated with human IgG and the fab anti-human IgG- duocarmycin conjugate. After three (3) days, cells were lysed, and cell proliferation was measured by the Cell-Glo assay (Promega). Candidate antibodies selected by this indirect assay were then examined as direct Duocarmycin antibody drug conjugate by in vitro cytotoxic assay and in vivo in mouse xenografts. The methods described below were used to make these determinations.
[00252] For cell surface flow binding, cells in suspension in V bottom plates were incubated for 1 hour at 4°C with fully human anti-PTGFRN antibodies in culture medium containing 0.5% bovine serum albumin followed by incubation with goat-anti human Immunoglobulin conjugated to fluorophore for one (1) hour at 4°C. Cells were washed and flow binding was determined by measuring fluorescence intensity with an Intellicyt.
[00253] For internalization studies using a pHab probe, goat anti -human IgG (H+L) secondary antibody was conjugated to pH probe (Promega) following the manufacturer instruction manual. Anti-PTGFRN antibodies were premixed for 30 minutes at 22-25°C with pHab labeled goat anti human antibody (antibody combination). Two (2) x 105 A431 cells were incubated with the antibody combination at 37°C for 20 hours. At the end of the incubation, cells were washed twice with cold PBS and resuspended in PBS and fluorescence was measured with flow Intellicyt as Mean FL2-H channel. Using this assay, if the antibody is internalized, the fluorescence unit value will increase.
[00254] Over 1000 (1248) single monoclonal hybridomas producing candidate anti- PTGFRN antibodies were selected for further characterization. Initial and confirmatory EIA
against PTGFRN-ECD indicated 208 strong positive candidate antibodies from this initial group of 1248. Following flow cytometric binding of HEK-PTG as compared to HEK- 293 A followed by internalization led to the selection of 17 clones (see Table 22. After testing candidate antibodies against natural human cancer cell lines, at least four hybridomas were then selected. Inhibition of PTGFRN expression by siRNA or shRNA expression specifically inhibited flow binding of these antibodies.
[00255] The data shows that certain fully human anti-PTGFRN antibodies can induce internalization of cell surface expressed PTGFRN, including 4F8, 6B2, 8C7, and 12D8. Prolonged exposure of A431 cells (which express a high level of PTGFRN) (six (6) hours) to anti-PTGFRN antibodies without conjugation to cytotoxic agents was found to induce inhibition biological events which are hallmarks of metastasis (e.g., migration). This data indicates that anti-PTGFRN antibody can have therapeutic effect even without being used as antibody drug conjugate. Briefly, A431 cells were cultured in collagen-coated six (6)-well plates in duplicate in DME-F12 medium supplemented with 5% fetal bovine serum (FBS).
The cells were then treated with either 10 μg/ml of 8C7 antibody (anti-PTGFRN internalizing), 3G3 (anti-PTGFRN non internalizing), or Human IgG as control. After six (6) hours incubation with the respective antibodies, the cells were detached with PBS-EDTA and their migration ability determined by plating 7.5 x 104 cells in duplicate in collagen-treated Transwell devices in DME-F12 medium 0.1% bovine serum albumin on top of the Transwell device and DME-F12 medium with 5% FBS in the bottom well as attractant for migration for 20 hours. After the 20-hour period, the cells in the bottom of the Transwell were stained with crystal violet using standard protocol known to people in the art and counted (Table 23; each antibody being included at 10 μg/ml).
The data show that the incubation with 8C7 antibody resulted in a 75% inhibition of migration of A431 cells whereas the incubation of the cells with 3G3, an anti-PTGFRN antibody which is not internalizing had no inhibitory effect on migration.
[00256] Additional data relating to the 8C7 antibody is presented in Fig. 13. To examine whether anti-PTGFRN antibody 8C7 had effect as a naked antibody, A431 cells were incubated with non-immune human IgG and with an anti-PTGFRN antibody 3G3 which binds to PTGFRN but is not internalizing. All antibodies were assayed at a concentration of 10ug/ml. At the end of the incubation period, the cells were detached and evaluated for their migration potential by the transwell assay for five hours. As shown in Table 24 and Fig. 13, the cells that had been incubated in the presence of 8C7 antibody showed a 67% inhibition of migration over hlgG and a 75% inhibition of migration over the cells treated with 3G3. This indicates that even as a naked antibody without conjugation to a linker payload, 8C7 neutralizes the biological effect of PTGFRN. This neutralization effect of 8C7 antibody is probably associated with the ability to internalize PTGFRN.
[00257] To generate the data presented in Fig. 13, A431 cells had been preincubated for 6 hours with 10ug/ml of either hlgG, non-internalizing anti-PTGFRN 3G3 and internalizing 8C7 before being detached and evaluated for migration by the transwell assay. Exposure of A431 cells for 6 hours to 10 ug/ml of internalizing anti-PTGFRN 8C7 antibody led to a 70% inhibition of cell migration whereas incubation with non-internalizing anti-PTGFRN antibody 3G3 had no inhibitory effect on A431 cell migration when compared to negative control human IgG. These results indicate that 8C7 antibody has a neutralizing effect even without being conjugated to a linker-cytotoxic payload. Internalization of cell surface PTGFRN by incubation with internalizing antibody leads to inhibition of migration. The data presented in Table 17, Table 18, and Fig. 13 indicate that the internalizing anti-PTGFRN antibody (8C7) has an effect on biological hallmarks of cancer without being conjugated to a payload such as an antibody drug conjugate.
[00258] In addition, the antibody 4F8 was found to inhibit 56% of the migration of the human mesothelioma cell line MSTO-211H-PTG (which, like A431, overexpresses PTGFRN). The data is summarized in Table 25 below:
[00259] The 8C7 antibody was further tested by flow cytometry and in additional internalization studies. The cell lines used in these studies were obtained from the American Type Culture Collection (ATCC, Manassas, VA). A431 (CRL-1555), DAOY (HTB-186), MSTO-211H (CRL-2081), and MDA-MB-231 (CRM-HTB-26) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 medium (DMEM/F12 1 :1 mixture) supplemented with 50μg/ml Gentamicin and 5% FBS, and maintained in a 5% CO2 incubator at 37°C. For flow cytometry binding analysis, cells were detached and collected with PBS-5mM EDTA. 5x105 cells were incubated with increasing concentrations of either human IgG or fully human anti-PTGFRN antibody 8C7 in DMEM + 1% BSA for 1 - hour at 4°C. Cells were then washed with cold PBS three times and incubated with 20μg/mL Goat-anti-Human IgG-Alexa Fluor 647 (Jackson Immunoresearch #109-605-088) in DMEM
+ 1% BSA for 1-hour at 4°C. Subsequently, cells were washed with cold PBS three times, re- suspended in PBS, and binding was measured using an Intellicyt Flow Cytometer (Intellicyt HTFC Screening System). For flow cytometry binding analysis, cells were detached and collected with PBS-5mM EDTA. 5x105 cells were incubated with increasing concentrations of either human IgG or fully human anti-PTGFRN antibody 8C7 in DMEM + 1% BSA for 1- hour at 4°C. Cells were then washed with cold PBS three times and incubated with 20μg/mL Goat-anti-Human IgG-Alexa Fluor 647 (Jackson Immunoresearch #109-605-088) in DMEM + 1% BSA for 1-hour at 4°C. Subsequently, cells were washed with cold PBS three times, re- suspended in PBS, and binding was measured using an Intellicyt Flow Cytometer (Intellicyt HTFC Screening System). For Immunofluorescence analysis, chambered coverslips (Thermo Fisher #155380) were coated overnight at 4°C with 40μg/mL type II rat collagen (Corning # 354236) in sterile deionized water. Next day, collagen solution was aspirated from the coverslips, and was allowed to air dry for 2 hours at room temperature. Ix105 cells were seeded on coverslips and were allowed to attach overnight in a 37°C humidified 5% CO2 incubator. The next day, cells were washed once with PBS and incubated with I μg/mL 8C7 antibody directly conjugated to Alexa Fluor647 diluted in 1% BSA in DMEM at 4°C for 1 hour. After binding incubation, two coverslips were returned to the 37°C incubator to initiate internalization, which was followed for 3 and 5 hours. At each time point, the coverslips were washed three times with cold PBS and fixed in 4% paraformaldehyde for 10 minutes at room temperature. After three more washes in PBS, the cells were mounted with ProLong™ Glass Antifade Mountant (Thermo Fisher #P36980) and viewed using a Nikon Al point-scanning laser confocal microscope (NIS-Elements, 60X). Following the observation of PTGFRN expression differences between normal and cancerous tissues, we developed a fully human anti-PTGFRN antibody capable of internalizing the target protein. The advantage of directly developing fully human antibodies allows us to skip the humanization process that would need to occur for antibodies of mouse origin. By immunizing humanized TC mice against the extracellular domain of PTGFRN, a library of single clone hybridomas was generated and screened to select fully human antibodies which bind to cell-surface PTGFRN, are internalizing, and have a high affinity.
[00260] Among the fully human anti-PTGFRN antibodies developed, the anti-PTGFRN antibody 8C7 was selected for its internalizing properties, and its KD of 10-12M determined by Bi-Layer Interferometry (BLI) using Octet Red96. The 8C7 antibody is an IgGl, which is considered to be a favorable isotype for ADC development (Baah, et al. Molecules.
2021;26(10))_ Figure 14 ((A) Control shRNA A43 I, (B) PTGFRN shRNA A431 Clone, (C) Control shRNA DAOY, (D) PTGFRN shRNA DAOY Clone, (E) Control MSTO-211H, (F) PTGFRN-Overexpressing MSTO-211H Clone, and (G) MDA-MB-231) demonstrates that 8C7 is capable of binding to the cell surface of A431, DAOY, and MSTO-211H cells, but binding was significantly attenuated in A431 and DAOY cells after transfection with shRNA to knockdown PTGFRN expression. In addition, 8C7 binding levels increased after MSTO- 211H cells were transfected with human PTGFRN cDNA to overexpress PTGFRN. Finally, flow binding analysis showed no 8C7 binding when compared to negative control antibody to MDA-MB-23 1 cells, which are negative for PTGFRN at both 8C7 concentrations used.
[00261] Immunofluorescence experiments were conducted to examine endocytosis of PTGFRN following 8C7 binding. As shown in Figure 15, the majority of 8C7 fluorescence was localized to the cell membrane and cell-cell junctions at time= 0. After 3 hours of incubation at 37°C, the 8C7 immunofluorescence was observed intracellularly with some of the signal still residing on the cell membranes. After five (5) hours incubation at 37°C, 8C7 fluorescence was seen primarily inside the cell, with little to no signal seen on the cell surface, confirming that PTGFRN is internalized following 8C7 antibody binding. Since 8C7 is a PTGFRN internalizing antibody, its ability to deliver a cytotoxic payload to cells was determined next.
[00262] In vitro cytotoxic assays used to characterize candidate antibodies include inhibition of cell proliferation and viability using indirect antibody drug conjugate combination assays (Marquez, et al. (2021) "Identification of Prostaglandin F2 Receptor Negative Regulator (PTGFRN) as an internalizing target in cancer cells for antibody-drug conjugate development." PLoS One 16(1): e0246197). These assays are briefly described below.
[00263] For the indirect antibody drug conjugate cytotoxic in vitro assay, PTGFRN positive cancer cells (A431 cells) were incubated for three days with candidate anti-PTGFRN antibodies (e.g., 4F8, 6B2, 8C7, and 12D8) and with Fab Anti-Human IgG Fc-Duocarmycin DM Antibody including a cleavable linker. Negative control consisted of cells incubated with human IgG and the Fab anti-human IgG-duocarmycin conjugate. After three (3) days, cells were lysed, and cell proliferation was measured by the Cell-Glo assay (Promega). The indirect assay data for the 8C7, 4F8 and 12D8 antibodies is summarized in Fig. 16. As shown in Fig- 16, all three antibodies (8C7, 4F8 and 12D8) evaluated showed ability to
inhibit A431 cell proliferation and viability (being equivalent to survival) in a dose- dependent fashion with 8C7 being the most potent.
[00264] To investigate the direct effect of anti-PTGFRN antibody-drug conjugates, duocarmycin conjugates of candidate anti-PTGFRN antibodies (e.g., 8C7, 4F8, 6B2 12D8) were prepared using the method described below. Briefly, the candidate antibody was conjugated to Mc-Vc-PAB-Duocarmycin (VcDuo) linker payload (MedChem Express HY- 128904) via cysteine. The candidate antibody in 25mM NaCl + 25mM Borate + ImM DTPA (pH: 8) was treated with Tris-(2-Carboxyethyl)phosphine TCEP at 37°C for 30-45 minutes, followed by cooling on ice. Candidate antibody solution in 10% N,N-dimethylacetamide (DMA) was incubated for 1 hour on ice with Vc-Duocarmycin (MedChem Express HY- 128904 ) (1 eq M -SH: 1.2 eq M Payload). The reaction was stopped by adding 20X M excess of Cysteine-HCl (IM Stock) at room temperature for 30 minutes followed by buffer exchange to phosphate buffer saline (PBS). An antibody-drug conjugate (ADC) is thereby produced. This can be followed by purification, such as using hydrophobic chromatography on a butyl-Sepharose column. The resulting ADC can then be buffer exchanged into PBS, sterile filtered and aliquoted in separate tubes, kept frozen at -80°C until use.
[00265] Among the cytotoxic payload examined, duocarmycin was efficacious in combination with anti-PTGFRN to inhibit the proliferation and viability of cells expressing PTGFRN. However, others were also examined and found to be efficacious. Antibody duocarmycin drug conjugates (antibody drug conjugate being abbreviated by “ADC”) were therefore prepared using the 4F8, 6B2, and 8C7 anti-PTGFRN antibodies. The effect of these ADCs on three cell lines was examined in vitro. The cell lines examined were the human epidermoid carcinoma A431, the breast cancer cell MDA-MB-468 2E12 (which moderately expresses PTGFRN), and MDA-MB-468 4C5 cell lines (which overexpress PTGFRN by cDNA transfection). Increasing doses of 8C7-ADC or 4F8-ADC from 0.1 nM to 10 nM (8C7-ADC at 0.1 nM, 1 nM, and 10 nM) and 20 nM (4F8-ADC at 0.1 nM, 1 nM, 10 nM, and 20 nM) were assayed on cell survival of the three cell lines. The data are presented in Fig. 17. As shown therein, 8C7-ADC at concentration ≥ 1 nM inhibits the cell survival of the high expressing PTGFRN cell lines A431 (blue bars) and MDA-4C5 (grey bars) with a modest effect on the low PTGFRN expressing cell line MDA-2E12 at concentration of 10nM. 4F8-ADC at concentration ≥ 1 nM strongly inhibits the cell survival of MDA-4C5 with a modest, effect, on A431 except at 20nM with a 40% inhibition of A431 cell survival at
20 nM, with no effect on the low PTGFRN expressing cell line MDA-2E12. A 6B2 duocarmycin conjugate was also prepared as described above and tested in vitro on A431 cells. The results for 0.1 nM, 0.5 nM, 1 nM, 5 nM, 10 nM and 20 nM of 6B2-ADC on A431 proliferation are presented in Fig. 18. The data presented in Figs. 17-18 show that the ADCs have different efficacy in cells expressing different levels of PTGFRN and are distinct and have both distinct utilities going forward to develop anti -PTGFRN ADC drug.
[00266] An additional study regarding the 8C7-ADC is presented in Figure 19. In these studies, the 8C7-ADC was examined in vitro for its ability to inhibit the proliferation of PTGFRN-expressing cell lines such as epidermoid carcinoma (A431), biphasic mesothelioma (MSTO-211H), and pediatric medulloblastoma (DAOY). In addition to these PTGFRN- positive cancers, we also tested the ADC with the triple-negative breast cancer cell line MDA-MB-231, previously found to be negative for PTGFRN (22). As shown in Figure 5, treatment with the 8C7-ADC showed a dose-dependent inhibition of cell proliferation in all cell lines expressing PTGFRN. Specifically, A431 proliferation was reduced by 95%, DAOY proliferation was reduced by 80%, and MSTO-211H proliferation was reduced by approximately 40% at the highest dose tested of 10nM. This degree of inhibition appears to follow the level of expression of PTGFRN in these three cell lines. The low PTGFRN- expressing MSTO-211H cells still demonstrated a reduced, yet significant inhibition of proliferation, compared to high PTGFRN-expressing cell lines A431 and DAOY. The PTGFRN-negative cancer line, MDA-MB-231, showed no growth inhibition when treated with 8C7-ADC, even at the highest concentration evaluated, indicating the specificity of the 8C7-ADC for PTGFRN.
[00267] The effect of the ADCs produced as described above were also tested in vivo using mouse xenografts. Three cell lines were used to examine the effect of fully human anti- PTGFRN ADC on tumor growth: 1) A431 human epidermoid carcinoma; 2) DAOY human medulloblastoma; and, 3) MSTO-211H human mesothelioma. Female Athymic nude mice were injected subcutaneously (s.c.) with cells (from 0.5 x 106 to 2 x 106 cells/mouse) depending on the cell line. When the tumor become apparent and reached 50-100 mm3, mice were randomized to the experimental groups (8 mice/group). Antibody drug conjugate was injected intraperitoneally (i.p.) once a week with control group being injected with an isotope control human antibody directly conjugated to duocarmycin using the method described above. Tumor dimensions were determined weekly with a caliper and tumor volume
calculated from them. At the end of the experiment, mice were euthanized to collect tumors and determine body, tumor and organ weights. Data regarding the 8C7 ADC is shown in Fig. 20A-F Figs. 20A-B present data using A431 squamous carcinoma cells. Figs. 20C-D present data generated using DAOY medulloblastoma cells. Figs. 20E-F present data generated using MSTO-211 H mesothelioma cells. Left panels A, C, and E show the effect of 8C7-Duocarmycin ADC on tumor volumes compared to hlgG-duocarmycin ADC control. Right panels B, D, and F show provide body and organ within the experimental groups The data show that intra-peritoneal (i.p) administration of fully human anti-PTGFRN 8C7- duocarmycin antibody drug conjugate inhibits the tumor growth of the three cell lines examined in a dose-dependent fashion. This apparent by >90% inhibition of tumor volumes observed with 8C7 ADC at concentrations of 1 mg/kg (DAOY) and 4 mg/kg (A431). At the four (4) mg/kg dose, the tumor growth of MSTO-21 I H cells was inhibited by 70%. Examination of body; organ and tumor weights indicate that the treatment with 8C7-ADC only affected tumor weight without any effect on body weight or weights of liver, heart, lung and kidney suggesting the lack of off target toxicity of the anti-PTGFRN ADC.
[00268] The affinity of two fully human antibodies (4F8 and 8C7) for binding to PTGFRN was examined using the Octet method. The data is presented in Table 26.
The 4F8 and 8C7 antibodies were found to exhibit excellent Kd measurements ranging up to 10-12M to 5.2 x 10-9M, suitable for drug development.
[00269] It is now regarded very important and informative in preclinical studies to examine the effect of antibody therapeutic on patient derived xenografts (PDX) as they are the closest representation of an in vivo tumors as PDX tumors are freshly extracted from patients and did not get through the establishment of cell line that may have lose the phenotypic diversity of a primary tumors. First, the expression of PTGFRN in different head and neck patient- derived tumor samples (PDX1, PDX2, PDX3, PDX4, PDX5, PDX6, and PDX7) was
measured by western blot analysis to identify those expressing PTGFRN using anti-PTGFRN antibody for detection (using lysates of A431 cells as a positive control). As shown in Fig.
21, out of seven PDX examined, six (PDX1, PDX2, PDX3, PDX4, PDX5, and PDX7) expressed PTGFRN. Tumor sample PDX1 exhibited the highest level of expression when normalized to GAPDH expression as internal standard. Based on this data and on the growth rate of these tumors, PDX1 was selected as a PDX tumor candidate to examine the effect of 8C7-ADC in vivo.
[00270] The effect of 8C7-ADC compared to isotype control ADC on the growth of patient-derived head and neck tumors in NRG mice (xenografts) is shown in Figs. 22 and 23. Female NRG mice were implanted with head and neck tumors JZ0628. When tumors reached 100 mm3, the mice were randomized into two experimental groups, the first group receiving once weekly ip (intraperitoneal) for 44 days isotype control duocarmycin ADC and the second group receiving 8C7-duocarmycin ADC. Fig. 22 (left panel) shows a steady tumor growth in the control group while the 8C7 treated group showed little growth (p<0.05). The tumor growth in mice treated with 8C7-ADC showed a 73% decrease in doubling time (Fig.
22, right panel) when compared to mice treated with isotype control (p<0.0001). The long- term effect of 8C7-ADC on patient-derived H/N tumor growth after stopping treatment is shown in Fig. 23. On day 44, the 8C7 treatment was stopped in the 8C7-ADC group and mice were maintained under observation for an additional 15 days to determine tumor growth. Fig. 23 shows that even after stopping treatment, the tumors in the 8C7-group did not start growing (square symbols as compared to round symbols), indicating that the 8C7- ADC has a long-lasting effect. Even the mesothelioma cell line, which displays lower PTGFRN expression, still displayed dose-dependent tumor growth inhibition when treated with the 8C7-ADC, whereas the PTGFRN-negative cell line, MDA-MB-231, showed no response to the 8C7-ADC, and no difference in tumor growth was observed between IgG negative control ADC and the 8C7-ADC groups (Fig. 24). There results indicate that PTGFRN is an excellent therapeutic target elevated in several human cancers and no or low level in normal tissues. PTHFRN is associated with several hallmarks of aggressive cancers such as increased migration, ability to grow in colonies, ability to proliferate in low serum conditions and to form spheroids in 3D-culture conditions. 8C7 was shown to inhibit migration of A431 cells. Taken together, these results indicate that PTGFRN could be a valuable new ADC target as PTGFRN negative cells showed no response to the 8C7-ADC, while tumors that express low level of PTGFRN, such as the MSTO-211H tumors, still
demonstrated a statistically significant response to the 8C7-ADC. Tumors that displayed high PTGFRN expression, such as A431 and DAOY tumors, exhibited a high reduction in tumor growth in response to the 8C7-ADC, demonstrating its efficacy. This data shows that fully human anti-PTGFRN internalizing antibodies disclosed herein, exemplified by 8C7, show that the antibodies (e.g., preferably 8C7-ADC) inhibit tumor formation in a dose-dependent fashion and most importantly inhibit tumor formation in head/neck patient derived tumors.
[00271] Examples 1-3 herein show that PTGFRN is overexpressed in cancer and is negative or at low level in healthy tissues. PTGFRN silencing in the epidermoid carcinoma A431 cells leads to inhibition of hallmarks of cancer aggressiveness such as migration, proliferation in low serum, clonogenicity and 3D spheroid formation. This disclosure provides fully human antibodies produced by immunizing humanized transgenic mice with human PTGFRN. By combining the use of TC mice with a proprietary immunization approach, several functional anti-PGRN antibodies have been developed and selected. The Kd of these antibodies varies between 10-12M and 10-9M. It is shown here that selected antibody 8C7 is rapidly internalized and forms an ADC by cysteine conjugation with Val-Cit- Duocarmycin. The 8C7-ADC inhibited in vitro proliferation of A431 cells in a dose dependent fashion. The 8C7-ADC inhibited A431 tumor formation and shown to be cytostatic for tumor growth of Head and Neck PDX. These data indicate that PTGFRN is a therapeutic target for several cancers including head and neck and that the fully human antibody approach disclosed herein is very efficacious to select antibody with appropriate characteristics for therapeutic development.
[00272] Example 4. Polynucleotide and Amino Acid Sequences of Candidate Antibodies
[00273] A. Sample Preparation
[00274] The hybridoma cell line for each antibody was thawed and put in culture. The cells were counted and reverse transcription performed to convert the RNA thereof to cDNA. Several PCR reactions were performed to amplify the heavy chain and light chain variable region sequences of each antibody with several pairs of mouse heavy and light chain specific primers. PCR products were loaded on an agarose gel and electrophoresis performed to confirm the correct PCR bands were produced. The PCR products were mixed and each
sequenced by Miseq sequencer. The NGS sequencing data for each PCR product was processed with BCR analysis software.
[00275] The nucleotide and amino acid sequences of four fully human antibodies produced by the 4F8, 6B2, 8C7, and 12D8 hybridoma clones were determined as described below. DNA sequence data from all constructs were analyzed and consensus sequences for heavy and light chain determined. The consensus sequences are compared to known variable region sequences to rule out artifacts and/or process contamination. Consensus sequences are then analyzed to verify that the sequences could encode a productive immunoglobulin. The amino acid sequences of the complementarity determining regions (CDRs) for each of the 4F8, 6B2, 8C7, and 12D8 were determined according to the Kabat and Chothia methods as presented below (presented in bold and underlined for each). CDRs were also determined by an alternative method as shown in Figs. 6-13 and Tables 4-7. The 4F8 antibody was determined to be an IgG4 Kappa antibody. The 6B2, 8C7 and 12D8 antibodies were determined to be IgGl Kappa antibodies.
Bl. Antibody 4F8 (AGRD014-4F8-IgK Variable light chain (VL ))
12D8 VH Preferred DNA Sequence (Kabat CDR coding sequences underlined)
Alignments of the heavy and light variable polypeptide chains of the 4F8, 6B2, 8C7, and
12D8 antibodies with highlighted CDRs are shown above. Alignments of the 4F8, 6B2, 8C7, and 12D8 antibodies for light chain and heavy chain with highlighted CDRs are shown below. The CDRl, CDR2, and CDR3 amino acid sequences are labeled and underlined. The Variable Heavy (VH) chains of the 4F8, 6B2, 8C7, and 12D8 antibodies are compared below, showing the CDR amino acid sequences as determined by Kabat method underlined:
[00276] Alternative (Alt) CDRs for each of the 4F8, 6B2, 8C7 and 12D8 antibodies are presented in Figs. 25-32 and Table 1. In preferred embodiments, any of the CDRs presented herein, or any determined by any other known method in the art from the VH and VL amino acid sequences of the respective antibodies are contemplated by this disclosure.
[00277] Other advantages of the reagents and methods of using the same are also provided herein, as would be understood by those of ordinary skill in the art.
[00278] While certain embodiments have been described in terms of the preferred embodiments, it is understood that variations and modifications will occur to those skilled in the art. Therefore, it is intended that the appended claims cover all such equivalent variations that come within the scope of the following claims.
Claims
1. An isolated antibody or antigen binding fragment thereof, comprising: a) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 1, 2, and 3, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively; b) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 4, 5, and 6, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively; c) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 4, 5, and 6, and a light chain variable region comprising CDR sequences SEQ ID NOs: 7, 8, and 9, respectively; d) the heavy chain variable region of SEQ ID NO: 189 and the light chain variable region of SEQ ID NO: 190; e) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 18, 19, and 20, and a light chain variable region comprising CDR sequences SEQ ID NOs: 24, 25, and 26, respectively; f) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 21, 22 and 23, and a light chain variable region comprising CDR sequences SEQ ID NOs: 24, 25, and 26, respectively; g) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 27, 28 and 29 or 30, and a light chain variable region comprising CDR sequences SEQ ID NOs: 31 or 32, and 33, and 34 or 35, respectively; h) the heavy chain variable region of SEQ ID NO: 191 and the light chain variable region of SEQ ID NO: 192; i) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 36, 37 and 38, and a light chain variable region comprising CDR sequences SEQ ID NOs: 42, 43 and 44, respectively;
j) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 39, 40 and 41, and a light chain variable region comprising CDR sequences SEQ ID NOs: 42, 43 and 44, respectively; k) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 45, and 46 or 47, and 48 or 49, and a light chain variable region comprising CDR sequences SEQ ID NOs: 50, and 51, and 52 or 53, respectively; l) the heavy chain variable region of SEQ ID NO: and the light chain variable region of SEQ ID NO: 193 and 194; m) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 54, 55 and 56, and a light chain variable region comprising CDR sequences SEQ ID NOs: 60, 61 and 62, respectively; n) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 57, 58 and 59, and a light chain variable region comprising CDR sequences SEQ ID NOs: 60, 61 and 62, respectively; o) a heavy chain variable region comprising the complementarity determining region (CDR) sequences SEQ ID NOs: 63, and 64 or 65, and 66, and a light chain variable region comprising CDR sequences SEQ ID NOs: 67, 68, and 69 or 70, respectively; p) the heavy chain variable region of SEQ ID NO: 195 and the light chain variable region of SEQ ID NO: 196; or a derivative of any one of a) - p), optionally wherein said derivative comprises one to four amino acid substitutions in at least one CDR thereof, preferably wherein said substitution(s) are conservative amino acid sequence(s); wherein the antibody or derivative thereof specifically binds to human Prostaglandin F2 Receptor Inhibitor (PTGFRN).
2. An antibody of claim 1 wherein the antibody binds to a cell expressing PTGFRN in vitro and/or in vivo.
3. An antibody that competes with an antibody of claim 1 for binding to PTGFRN on a cell.
4. A combination of antibodies of any preceding claim.
5. The antibody of any preceding claim that is an isolated monoclonal antibody.
6. The antibody of claim 5 wherein the monoclonal antibody is a human monoclonal antibody.
7. The antibody of any preceding claim wherein said antibody is derived from a human antibody, human IgG, human IgGl, human IgG2, human IgG2a, human IgG2b, human IgG3, human IgG4, human IgM, human IgA, human IgAl, human IgA2, human IgD, human IgE, canine antibody, canine IgGA, canine IgGB, canine IgGC, canine IgGD, chicken antibody, chicken IgA, chicken IgD, chicken IgE, chicken IgG, chicken IgM, chicken IgY, feline antibody, goat antibody, goat IgG, mouse antibody, mouse IgG, pig antibody, rat antibody, llaman antibody, alpacan antibody, shark antibody and a camel antibody.
8. A derivative of an antibody of any preceding claim, optionally selected from the group consisting of an Fab, Fab2, Fab’ single chain antibody, Fv, single chain, mono-specific antibody, bispecific antibody, trimeric antibody, multi-specific antibody, multivalent antibody, chimeric antibody, canine-human chimeric antibody, canine-mouse chimeric antibody, antibody comprising a canine Fc, humanized antibody, human antibody, caninized antibody, CDR-grafted antibody, shark antibody, and a nanobody.
9. A derivative of an antibody of any preceding claim comprising a detectable label fixably attached thereto, optionally wherein the detectable label is selected from the group consisting of fluorescein, DyLight, Cy3, Cy5, FITC, HiLyte Fluor 555, HiLyte Fluor 647, 5-carboxy-2,7-dichlorofluorescein, 5-carboxyfluorescein, 5-FAM, hydroxy tryptamine, 5-hydroxy tryptamine (5-HAT), 6-carboxyfluorescein (6-FAM), FITC, 6-carboxy-l,4- dichloro-2’, 7’ -di chlorofluorescein (TET), 6-carboxy-l,4-dichloro-2’,4’,5’,7’-tetra- chlorofluorescein (HEX), 6-carboxy-4’,5’-dichloro-2’,7’-dimethoxyfluorescein (6-JOE), an Alexa fluor, Alexa fluor 350, Alexa fluor 405, Alexa fluor 430, Alexa fluor 488, Alexa fluor 500, Alexa fluor 514, Alexa fluor 532, Alexa fluor 546, Alexa fluor 555, Alexa fluor 568, Alexa fluor 594, Alexa fluor 610, Alexa fluor 633, Alexa fluor 635, Alexa fluor 647, Alexa fluor 660, Alexa fluor 680, Alexa fluor 700, Alexa fluor 750, a BODIPY fluorophores, BODIPY 492/515, BODIPY 493/503, BODIPY 500/510, BODIPY 505/515, BODIPY 530/550, BODIPY 542/563, BODIPY 558/568, BODIPY 564/570,
BODIPY 576/589, BODIPY 581/591, BODIPY 630/650-X, BODIPY 650/665-X, BODIPY 665/676, FL, FL ATP, FI-Ceramide, R6G SE, TMR, TMR-X conjugate, TMR- X, SE, TR, TR ATP, TR-X SE, a rhodamine, rhodamine 110, rhodamine 123, rhodamine B, rhodamine B 200, rhodamine BB, rhodamine BG, rhodamine B extra, 5- carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidine, Phalloidine, rhodamine red, Rhod-2, 6-carboxy-X- rhodamine (ROX), carboxy-X-rhodamine (5-ROX), Sulphorhodamine B can C, Sulphorhodamine G Extra, 6-carboxytetramethylrhodamine (TAMRA), tetramethylrhodamine (TRITC), rhodamine WT, Texas Red, and Texas Red-X.
10. An antibody of any of any preceding claim comprising an effector moiety attached thereto, optionally wherein the effector moiety is selected from the group consisting of a therapeutic agent, a cytotoxic reagent, abrin A chain, an anthracycline, an amantin, a- amanitin, an auristatin, monomethyl auristatin E, monomethyl auristatin F, a calicheamicin, camptothecin, a combretastain, crotin, a cryptophycin, curcin, a dolastatin, a duocarmycin, a DNA alkylating agent, DNA repair inhibitor, a duocarmycin, an enediyne, exatecan or a derivative thereof, DX-8951, exotoxin A chain, deruxtecan, diphtheria A chain, enomycin, a geldanamycin, a hemiasterlin, an inhibitor of ataxia telangiectasia and Rad3 related kinase, Berzosertib, indolino-benzodiazepine dimer, a maytansine, maytansinoid DM1, maytansinoid DM4, ozogamicin, phenomycin, a pladienolide, plant toxin, a puromycin, a pyrrolobenzodiazepine dimer, ricin A chain, a spliceostatin, a taxane, a toxin, a tubulysin, a tumor-activated prodrug, a topoisomerase inhibitor, a vinca alkaloid, a radiochemical, a radioisotope, iodine-131, and yttrium-90.
11. The antibody of claim 10 wherein the cytotoxic drug is duocarmycin.
12. The antibody of claim 10 or 11, wherein a non-cleavable or cleavable linker is positioned between the antibody and the effector moiety, wherein said cleavable linker releases the effector moiety into or within a cell.
13. An isolated polynucleotide encoding antibody of any preceding claim; or a combination comprising at least one polynucleotide having at least about 90% identity with any of the same.
14. An expression vector comprising one or more polynucleotides of claim 13.
15. A host cell comprising the isolated polynucleotide of claim 13 and / or the expression vector of claim 14.
16. A composition comprising at least antibody or derivative of any one of claims 1-12; at least one isolated polynucleotide of claim 13; or at least one expression vector of claim 14; and / or, at least one host cell of claim 15; or a combination thereof; and, a pharmaceutically acceptable carrier.
17. A method for detecting PTGFRN on a cell and/or tissue, the method comprising contacting a test biological sample with an antibody or derivative of any one of claims 1- 13 and detecting the antibody bound to the biological sample or components thereof.
18. The method of claim 17, further comprising comparing the amount of binding to the test biological sample or components thereof to the amount of binding to a control biological sample or components thereof, wherein increased binding to the test biological sample or components thereof relative to the control biological sample or components thereof indicates the presence of a cell expressing PTGFRN in the test biological sample.
19. The method of claim 17 or 18 wherein the test biological sample is a mammalian cell, tissue, or biological fluids optionally wherein the biological fluid is selected from the group consisting of blood, urine, plasma, serum, cerebro-spinal fluid, saliva, and exosomes.
20. The method of any one of claims 17-19 wherein the method is an in vivo method or an in vitro method.
21. An in vivo method for detecting tumor cells, and/or diagnosing cancer, the method comprising administering at least one antibody, combination, or derivative of any one of claims 1-13 and detecting the at least one antibody bound to the tumor cells.
22. The method of claim 21 wherein the at least one antibody or derivative comprises at least one detectable label.
23. The method of claim 22 comprising at least two antibodies and/or derivatives that each comprise at least one detectable label, the detectable label of each antibody and/or derivative being the same or different.
24. The method of any one of claims 21-23 wherein the method comprises imaging a tumor for targeted treatment of cancer.
25. The method of claim 22 further comprising treating the cancer.
26. The method of claim 25 further comprising isolating cells or tissues of the cancer and determining whether the cancer tissue overexpresses PTGFRN as compared to non- cancerous cells, optionally wherein the PTGRGN expression is determined by measuring PTGFRN protein and/or expression of RNA encoding PTGFRN.
27. A method for treating cancer, the method comprising administering at least one antibody, combination, or derivative of any one of claims 1-13 to a mammal.
28. The method of claim 27 wherein the at least one antibody or derivative comprises an effector moiety.
29. The method of claim 22 comprising at least two antibodies or derivatives that each comprise at least one effector moiety, the effector moiety of each antibody or derivative being the same or different.
30. The method of any one of claims 27-29 further comprising isolating cells of the cancer and determining whether the cancer tissue overexpresses PTGFRN as compared to non- cancerous cells, optionally wherein the PTGRGN expression is determined by measuring PTGFRN protein and/or expression of RNA encoding PTGFRN.
31. A method for detecting, diagnosing, and treating cancer, the method comprising imaging a tumor comprising the antibody, combination, or derivative of any one of claims 1-13 attached thereto and targeting treatment of cancer to the tumor.
32. The method of claim 27 wherein the antibody or derivative thereof comprises a detectable label and/or an effector moiety.
33. The method of claim 31 or 32 further comprising isolating cells of the cancer and determining whether the cancer tissue overexpresses PTGFRN as compared to non- cancerous cells, optionally wherein the PTGRGN expression is determined by measuring PTGFRN protein and/or expression of RNA encoding PTGFRN.
34. A method for treating, preventing and / or ameliorating cancer in a mammal comprising administering to the mammal at least one effective dose of at least one pharmaceutical composition comprising at least one antibody and/or derivative of any one of claims 1-13.
35. The method of claim 34 wherein at least one antibody in the at least one pharmaceutical composition comprises a cytotoxic effector moiety attached thereto, optionally wherein the effector moiety is selected from the group consisting of a therapeutic agent, a cytotoxic reagent, abrin A chain, an anthracycline, an amantin, α-amanitin, an auristatin, monomethyl auristatin E, monomethyl auristatin F, a calicheamicin, camptothecin, a combretastain, crotin, a cryptophycin, curcin, a dolastatin, a duocarmycin, a DNA alkylating agent, DNA repair inhibitor, a duocarmycin, an enediyne, exatecan or a derivative thereof, DX-8951, exotoxin A chain, deruxtecan, diphtheria A chain, enomycin, a geldanamycin, a hemiasterlin, an inhibitor of ataxia telangiectasia and Rad3 related kinase, Berzosertib, indolino-benzodiazepine dimer, a maytansine, maytansinoid DM1, maytansinoid DM4, ozogamicin, phenomycin, a pladi enolide, plant toxin, a puromycin, a pyrrolobenzodiazepine dimer, ricin A chain, a spliceostatin, a taxane, a toxin, a tubulysin, a tumor-activated prodrug, a topoisomerase inhibitor, a vinca alkaloid, a radiochemical, a radioisotope, iodine-131, and yttrium-90.
36. The method of claim 35 wherein the cytotoxic drug is duocarmycin.
37. The method of claim 35 or 36 wherein a non-cleavable or cleavable linker is positioned between the antibody and the effector moiety, wherein said cleavable linker releases the effector moiety into or within a cell.
38. The method of any one of claims 34-37 wherein the antibody is administered as an antibody-drug conjugate.
39. The method of any one of claims 34-38, comprising administering at least two antibodies to the mammal, wherein at least one antibody is a naked antibody that does not include a cytotoxic effector moiety attached thereto and at least one antibody includes a cytotoxic effector moiety attached thereto.
40. The method of any one of claims 34-38 wherein multiple doses are administered to the animal; and/or, the antibody is administered in a dosage amount of about 1 to 50 mg / kg.
41. The method of any one of claims 34-39 further comprising isolating cells of the cancer and determining whether the cancer tissue overexpresses PTGFRN as compared to non- cancerous cells, optionally wherein the PTGRGN expression is determined by measuring PTGFRN protein and/or expression of RNA encoding PTGFRN.
42. The method of any one of claims 34-41 wherein the mammal is a human being.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363495835P | 2023-04-13 | 2023-04-13 | |
| PCT/US2024/023629 WO2024215624A2 (en) | 2023-04-13 | 2024-04-08 | Antibodies and conjugates against prostaglandin f2 receptor inhibitor and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4695300A2 true EP4695300A2 (en) | 2026-02-18 |
Family
ID=93059987
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24789289.6A Pending EP4695300A2 (en) | 2023-04-13 | 2024-04-08 | Antibodies and conjugates against prostaglandin f2 receptor inhibitor and uses thereof |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP4695300A2 (en) |
| CN (1) | CN122029192A (en) |
| WO (1) | WO2024215624A2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN119925347B (en) * | 2025-04-10 | 2025-07-11 | 中国人民解放军军事科学院军事医学研究院 | Medical use of compound Pladienolide B as a protective agent against ricin |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7396913B2 (en) * | 2002-10-14 | 2008-07-08 | Abbott Laboratories | Erythropoietin receptor binding antibodies |
| WO2008007648A1 (en) * | 2006-07-10 | 2008-01-17 | Institute For Antibodies Co., Ltd. | Method of classifying antigen, method of identifying antigen, method of obtaining antibody or antibody set, method of constructing antibody panel and antibody or antibody set and use of the same |
| WO2019075472A1 (en) * | 2017-10-13 | 2019-04-18 | A&G Pharmaceutical, Inc. | Monoclonal antibodies and conjugates against prostaglandin f2 receptor inhibitor and uses thereof |
-
2024
- 2024-04-08 WO PCT/US2024/023629 patent/WO2024215624A2/en not_active Ceased
- 2024-04-08 EP EP24789289.6A patent/EP4695300A2/en active Pending
- 2024-04-08 CN CN202480040074.XA patent/CN122029192A/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024215624A2 (en) | 2024-10-17 |
| WO2024215624A3 (en) | 2024-12-12 |
| CN122029192A (en) | 2026-05-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240199738A1 (en) | Monoclonal antibodies and conjugates against prostaglandin f2 receptor inhibitor and uses thereof | |
| AU2009321508B2 (en) | Antibodies that specifically block the biological activity of a tumor antigen | |
| CN109195991B (en) | Dual-functional antibodies specific for glycosylated PD-L1 and methods of using them | |
| JP5816188B2 (en) | Anti-clusterin antibodies and antigen-binding fragments and their use to reduce tumor volume | |
| JP2018162257A (en) | Dll3 modulators and methods of use | |
| UA108991C2 (en) | GCC ANTIBODY MOLECULES AND ASSOCIATED COMPOSITIONS AND METHODS OF CANCER TREATMENT | |
| US20220218836A1 (en) | Endosialin-binding antibody | |
| CA3193584A1 (en) | Nectin-4 antibodies and uses thereof | |
| Marquez et al. | Identification of Prostaglandin F2 Receptor Negative Regulator (PTGFRN) as an internalizable target in cancer cells for antibody-drug conjugate development | |
| WO2024215624A2 (en) | Antibodies and conjugates against prostaglandin f2 receptor inhibitor and uses thereof | |
| WO2011054112A1 (en) | Antibodies that specifically block the biological activity of kidney associated antigen 1 | |
| EP4226945A1 (en) | Medicine for treating cancer | |
| EP4491632A1 (en) | Ror1-targeted binding molecule and use thereof | |
| HK40040833A (en) | Monoclonal antibodies and conjugates against prostaglandin f2 receptor inhibitor and uses thereof | |
| HK1234432A1 (en) | Antibodies that specifically block the biological activity of a tumor antigen | |
| HK1234432A (en) | Antibodies that specifically block the biological activity of a tumor antigen | |
| WO2020158959A1 (en) | Anti-mc16 antibody | |
| HK1234432B (en) | Antibodies that specifically block the biological activity of a tumor antigen | |
| CA2816437A1 (en) | Antibodies that specifically block the biological activity of kidney associated antigen 1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20251111 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |