EP4687450A1 - New strain of bacillus haynesii and its use in agriculture - Google Patents
New strain of bacillus haynesii and its use in agricultureInfo
- Publication number
- EP4687450A1 EP4687450A1 EP24716224.1A EP24716224A EP4687450A1 EP 4687450 A1 EP4687450 A1 EP 4687450A1 EP 24716224 A EP24716224 A EP 24716224A EP 4687450 A1 EP4687450 A1 EP 4687450A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- plant
- haynesii
- bacillus
- cfu
- vwc18
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
- A01N63/22—Bacillus
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
- A01P21/00—Plant growth regulators
Definitions
- the present invention falls within the fields of agro-environmental microbiology and agriculture. More specifically, the invention relates to a new strain of prokaryotic microorganism belonging to the Bacillus haynesii species and its use in agriculture as a plant biostimulant.
- a plant biostimulant is any substance or microorganism that is applied to plants with the aim of improving nutritional efficiency, tolerance to abiotic stress and/or quality characteristics of crops, regardless of nutrient content (Fusco, G. M., Nicastro, R., Rouphael, Y., & Carillo, P. (2022). The Effects of the Microbial Biostimulants Approved by EU Regulation 2019/1009 on Yield and Quality of Vegetable Crops. Foods, 11(17), 2656).
- biostimulants in agriculture has been known and widely spread for some time.
- commercially available plant biostimulants require the concomitant use of other products, such as insecticides, fungicides and/or nematicides.
- Grena special GRENA
- Idrogena Universal GRENA
- SinerVeg CIFO
- Basfoliar® COMPONENT
- Basfoliar® Aktiv SL COMPONENT SL
- Zip DIACHEM
- K62 PLUS DVA
- Eco Osmobetan DVA
- Alfan FERTIGLOBAL
- Cautha FERTIGLOBAL
- Creo FERTIGLOBAL
- Megastim XEDA ITALIA
- Solargo 900 WDG XEDA ITALIA
- Yoduo ROTAM ITALIA
- Dinamic HYDRO FERT
- Biimore TRADECORP
- a first object of the present invention is therefore to provide a plant biostimulant which is essentially natural.
- Another object of the present invention is to provide a plant biostimulant which does not require the concomitant use of synthetic biostimulants, fungicides, insecticides and/or nematicides.
- a further object of the present invention is to provide a plant biostimulant which has a low production cost and whose application to crops does not require specialized labour.
- the present invention provides a new strain of the prokaryotic microorganism Bacillus haynesii, called VWC18.
- VWC18 the prokaryotic microorganism Bacillus haynesii
- Bacillus haynesii strain VWC18 has proven to be extremely effective in agriculture as a plant biostimulant without requiring the concomitant use of other products, such as synthetic biostimulants, fungicides, insecticides and/or nematicides.
- the use of the Bacillus haynesii strain VWC18 in agriculture as a plant biostimulant exhibits numerous advantages. It first of all allows the use of chemical fertilizers which, as is known, have a negative impact on soil fertility and environmental pollution to be eliminated or reduced. A further advantage consists in that the use of the Bacillus haynesii strain VWC18 in agriculture as a plant biostimulant does not require the long preparation times that are normally associated with the calculations that need to be performed for the application of conventional formulations based on bi-trivalent chemical compounds. Furthermore, as described in the experimental section, the Bacillus haynesii strain VWC18 was isolated from a natural habitat, i.e. waste material of plant origin.
- the invention is characterized by a low production cost and its use on crops brings production improvements, acting on both the aerial and the root systems.
- the increase in root biomass represents a further advantage as it makes the plant more resistant to water stress.
- the new Bacillus haynesii strain VWC18 which is the subject of the present invention is characterized by the 16S RNA gene sequence represented below: TAAAACTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACC TTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCG GTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGC GCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGG GTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCAC GTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCG ACTCTGGTCTGTAACTGACGCTGAGGCGCGAAAGCGTGGGGAGCGAACAAGGTG ACTCTGGTCTGTAACTGACGCTGAGGCGCGAAAGCGTGGGGAGCGAACAAGGTTCG ACTCTGGTCTGTAACTGACG
- Bacillus haynesii strain VWC18 of the invention is formulated in a plant biostimulant composition in the form of a liquid suspension or, alternatively, in the form of a granular formulation.
- a liquid suspension includes viable cells or spores of Bacillus haynesii VWC18 which act as an active substance, in association with at least one diluent, for example water possibly added with a source of nutrients such as molasses.
- the amount of viable Bacillus haynesii VWC18 cells present in the liquid suspension is between 10 3 CFU/ml and 10 9 CFU/ml (where CFU stands for "colony forming unit").
- Bacillus haynesii VWC18 is prepared as a granular formulation.
- the granular formulation includes, for example, spores of Bacillus haynesii VWC18 which, through a pelleting process and combination with other phytoingredients, becomes more compact and easier to distribute in the soil.
- the preparation of granular formulations of microorganisms for use in agriculture is in itself conventional.
- the plant biostimulant composition (both in the case of the liquid suspension and in that of the granular formulation) is free from further active substances such as synthetic biostimulants, insecticides, fungicides and nematicides.
- the plant biostimulant composition of the invention is used in agriculture to improve the growth of leaf and root biomass, the content of photosynthetic pigments such as chlorophyll-a, chlorophyll-b and carotenoids) and the content of macronutrients, micronutrients and other minerals of plants, preferably horticultural and floricultural species.
- photosynthetic pigments such as chlorophyll-a, chlorophyll-b and carotenoids
- the plant biostimulant composition of the invention is applied in methods of biostimulant treatment, which include or consist of the application of the aforementioned biostimulant composition to plants or seedlings recently germinated from the seed.
- the treatment is generally carried out by immersing the root system of the seedlings packaged in sockets or by fertigation following transplanting into pots or in a field.
- the treatment is generally carried out on growing plants by applying the composition of the invention on the rhizospheric soil, with the aim of improving the vigor of the plants themselves and increasing the absorption efficiency by the roots.
- the treatment of plants or seedlings with the plant biostimulant composition of the invention may be carried out according to a regime which provides for a single treatment (single inoculationlum) or alternatively treatments repeated over time (multiple inoculations).
- Figure 1 is a bar graph showing the fresh, dry weight, and % dry matter of lettuce plants.
- S-CTR control; S-Bl, S-B2.
- Different letters (a, b) indicate a significant difference (Tukey HSD test) 0.05.
- Figure 2 is a bar graph showing leaf and root biomass of lettuce plants.
- L-CTR control; L-Bl, L- B2: plants treated with B. haynesii.
- Different letters (a, b) indicate a significant difference (Tukey HSD test) 0.05.
- Figure 3 is a bar graph showing the leaf and root biomass of basil plants.
- B-CTR control;
- B-Bl, B-B2 plants treated with B. haynesii.
- Different letters (a, b) indicate a significant difference (Tukey HSD test) 0.05.
- the strain VWC18 of Bacillus haynesii was isolated from compost of mixed plant material of different origins (agricultural waste, ornamental greenery and urban waste) collected in heaps in the open field (April 2018, Bologna, Emilia Romagna, Italy). The temperature of the compost was 75 °C at approximately 30 cm depth and the sampling material was taken at approximately 20 cm depth. Compost samples were serially diluted and plated on Tryptic Soy agar (TSA, Oxoid, ThermoFisher). The plates were incubated for 2-3 days at 30 °C, under aerobic conditions. The isolated strain was then identified by 16S rRNA gene sequencing.
- TSA Tryptic Soy agar
- the nucleotide sequence of the gene encoding the 16S rRNA gene of Bacillus haynesii VWC18 was determined as follows. Genomic DNA was extracted from a Bacillus haynesii VWC18 cell culture using a kit for DNA extraction from prokaryotic microorganisms (Wizard® Genomic DNA Purification Kit, Promega). The gene coding for 16S rRNA was then amplified with the following primers: 8- forward 8F (5'-AGA GTT TGA TGC TGG CTC AG -3') (SEQ ID NO:2) e 1520-reverse 1520R (5'- AAG GGA GGT GAT CCA GCC GCA -3') (SEQ ID NO:3).
- the amplification product was purified using a known methodology (NucleoSpin DNA purification Kit, Macherey-Nagel) and sent to the Eurofins Genomics sequencing service (Edelsberg, Germany).
- the assignment to the microbial species B. haynesii was carried out by comparing the sequence obtained with a database of known sequences using the local alignment search tool Nucleotide Blast (Basic Local Alignment Search Tool) available on the NCBI website at http ://www .ncbi. nlm .nih.gov/BLAST.
- Homogeneous lettuce seedlings (Lactuca sativa L.), belonging to the two-leafed green Gentilina type, were supplied by Orto Mio s.r.l. (Verona, Italy). Twenty days after sowing, the seedlings were transplanted into individual pots (2L capacity). All the pots were filled with the same substrate composed of acid peat, humified peat, non-composted green soil improver (pH: 7.5, total porosity v/v: 80%, dry bulk density: 450 kg/m 2 ) supplied by Gramoflor gmbh & Co, Vechta, Germany. The experiment was designed according to a randomized block design which included four different doses of Bacillus haynesii VWC18 treatment:
- —S single inoculation: administration of a single inoculation with Bacillus haynesii VWC18 in the soil immediately after transplanting;
- -M multiple inoculations: administration of a plurality of inoculations with Bacillus haynesii VWC18, the first carried out immediately after transplanting and the subsequent ones repeated at 10-day intervals until harvest.
- Each treatment with the microorganism i.e. the combination of dose of microorganism administered and treatment regimen applied: S-Bl, S-B2, S-B3, S- B4 and M-Bl, M-B2, M-B3, M-B4 was administered in 10 pots, to which 10 pots were added for each control treatment (S-CTR and M-CTR), for a total of 100 pots.
- the cultivation cycle lasted 33 days from transplanting to harvesting.
- L-CTR lettuce control plants not treated with Bacillus haynesii VWC18
- L-Bl lettuce plants treated with Bacillus haynesii VWC18 (10 3 CFU/ml)
- L-B2 lettuce plants treated with Bacillus haynesii VWC18 (10 9 CFU/ml)
- B-CTR basil control plants not treated with Bacillus haynesii VWC18
- B-B1 basil plants treated with Bacillus haynesii VWC18 (10 3 CFU/ml)
- B-B2 basil plants treated with Bacillus haynesii VWC18 (10 9 CFU/ml).
- Bacillus haynesii VWC18 was grown in 50 ml of Tryptone-Soy-Broth (TSB, Oxoid, ThermoFisher) for 20 h at 28 °C with horizontal stirring. Subsequently, the microbial biomass was inoculated into IL of TSB and grown at 28 °C to an optical density of 1.0, corresponding to 2xl0 9 colony forming units (CFU)/ml. Correspondence between OD and CFU was defined after plate counting performed three times (data not shown). Bacteria were collected by centrifugation for 10 minutes at 5,000 rpm and then diluted in 100 ml of sterile deionized water.
- TAB Tryptone-Soy-Broth
- CFU colony forming units
- the suspension in water thus obtained was used for the administration of the microorganism to the plants as irrigation water administered on the soil surface.
- the treatments were carried out by applying 10 ml to the base of each plant (collar) until reaching a final concentration of 10 4 , 10 6 , 10 8 , 10 10 CFU per plant.
- concentration of 10 4 per plant was achieved by applying 10 ml of a microorganism solution at a concentration of 10 3 CFU/ml.
- the same volume of water was used to water the control plants, without applying any other nutrients or microbial inoculations .
- Dried lettuce and basil samples (six plants/treatment in the preliminary experiment; five plants/culture/replicate in the second experiment) were analyzed for macro- and micronutrients after wet digestion according to the United States Environmental Protection Agency (US EPA) method 3052: 0.250-0.300 mg of each dried sample was treated with 8 ml of nitric acid (65%) and 2 ml of hydrogen peroxide (30%) at 180 °C in an Ethos TC microwave (Mile-stone, Bergamo, Italy), and mineral concentration was performed by inductively coupled plasma optical emission spectroscopy (ICP-OES) (Ametek Spectro Arcos EOP, Kleve, Germany) .
- ICP-OES inductively coupled plasma optical emission spectroscopy
- Nitrogen (N) was determined by the Kjeldahl method by mineralizing 0.300 g of sample with 10 ml of sulfuric acid (95%) and catalyst (a mixture of anhydrous potassium sulfate and anhydrous copper sulfate, nitrogen-free), at 420 °C for 180 min, and subsequent distillation with 32% NaOH solution (32%), and finally titration with 0.1 M sulfuric acid.
- Figure 1 represents, with reference to leaf biomass, the fresh weight (Fig. la), the dry weight (Fig. lb) and the % dry matter (Fig. lc) in the case of the single inoculation, the fresh weight (Fig. Id), the dry weight (Fig. le) and the % dry matter (Fig. If) in the case of multiple inoculations.
- the statistical analysis to observe a difference between the theses was carried out using the one-way Anova test and subsequent pairwise comparison with the Tukey test. Different letters (a, b) indicate a significant difference (Tukey HSD test) at ⁇ 0.05.
- plants receiving the microorganism showed a significant difference in fresh weight, dry weight and % dry matter measurements, compared to M-CTR ( Figure ld- f)•
- M-Bl and M-B4 increased significantly, more than 40%. Similarly, dry weight was significantly higher than M-CTR (p ⁇ 0.05). Dry matter % was higher and significant in M-CTR compared to M-B4 (7.5710.37% vs 6.6710.74%; p ⁇ 0.05). M-Bl, M-B2 and M-B3 recorded intermediate dry matter values, belonging to the same significance groups (7.3411.00%, 7.3410.51%, 7.2110.76%) . Table 1 shows the effect of the microbial inoculation on the N, P and K contents determined by chemical analysis on leaf biomass, while Table 2 shows the trace element contents determined in the same samples.
- Table 1 Nitrogen (N), phosphorus (P) and potassium (K) content (mg/plant) on untreated lettuce and treated with single (S) and multiple (M) inoculation of Bacillus haynesii VWC18. Mean values ( ⁇ SD) are reported; Bl (10 3 CFU/ml), B2 (10 5 CFU/ml), B3 (10 7 CFU/ml) and B4 (10 9 CFU/ml). S-CTR and M-CTR: control plants (single and multiple treatment theses) that had received only water. Different letters within each column indicate significant differences according to Tukey's post- hoc test (p ⁇ 0.05). ns, **, *** not significant or significant at p 0.01 and 0.001, respectively.
- Table 2 Mineral content of lettuce plants untreated and treated with single (S) and multiple (M) inoculation of Bacillus haynesii VWC18. Mean 5 values ( ⁇ SD) Bl (10 3 CFU/ml), B2 (10 5 CFU/ml), B3 (10 7 CFU/ml) and B4 (10 9 CFU/ml) are reported. S- CTR and M-CTR: control plants (single and multiple treatment theses) that had received only water. Different letters within each column indicate 10 significant differences according to Tukey's post- hoc test (p ⁇ 0.05). ns, **, *** not significant or significant at p 0.01 and 0.001, respectively. Final test on lettuce
- Figure 2 represents, for leaf biomass, the fresh weight (Fig. 2a), the dry weight (Fig. 2b) and the % dry matter (Fig. 2c) and, for root biomass, the fresh weight (Fig. 2d), the dry weight (Fig. 2e) and the % dry matter (Fig. 2f).
- Different letters (a, b) indicate a significant difference (Tukey HSD test) at p 0.01.
- Table 3 shows the concentration of chlorophyll (a and b) and carotenoids extracted from the leaves themselves. Despite the obvious increase, the 10 values for chlorophyll-a, chlorophyll-b and carotenoids in L-Bl were not significantly different compared to L-CTR. Lettuce plants treated with the highest dose of Bacillus haynesii VWC18 (L-B2) showed significantly higher values (p ⁇ 15 0.05) compared to the untreated control (L-CTR).
- Table 3 Chlorophyll-a, chlorophyll-b, and carotenoid concentrations determined on lettuce 20 leaves untreated with Bacillus haynesii VWC18 (L-
- Table 4 Mineral content of untreated (L-CTR) and Bacillus haynesii VWC18-treated lettuce plants. Mean values ( ⁇ SD) L-Bl (10 3 CFU/ml), L-B2 (10 9 CFU/ml) . Different letters within each column indicate significant differences according to Tukey's post-hoc test (p ⁇ 0.05). *, **, *** significance for p ⁇ 0.05, 0.01 and 0.001, respectively . Final test on basil
- Figure 3 represents, for leaf biomass, the fresh weight (Fig. 3a), the dry weight (Fig. 3b) and the % dry matter (Fig. 3c) and, for root biomass, the fresh weight (Fig. 3d), the dry weight (Fig. 3e) and the % dry matter (Fig. 3f).
- Different letters (a, b) indicate a significant difference (Tukey HSD test) at p 0.01.
- B-Bl and B-B2 are significant (p ⁇ 0.001) compared to B-CTR and to each other, with the exception of root fresh weight.
- Leaf fresh weight in B-Bl is two times higher than in B-CTR.
- % of dry matter there is a significant increase in the leaves for B-Bl and B-B2, while the percentage of root dry matter decreases in both treatments, compared to B-CTR.
- Table 5 shows the chlorophyll and carotenoid values relative to the control plants (B-CTR) and to the plants treated with the two doses of Bacillus haynesii VWC18 tested. All parameters analyzed are significantly higher in the two treatments with the microorganism compared to B-
- Table 5 Table 5: Concentrations of chlorophyll-a, chlorophyll-b and carotenoids analyzed on untreated and Bacillus haynesii VWC18-treated basil leaves. Mean values ( ⁇ SD) are reported; B-CTR: control plants not treatued with Bacillus haynesii VWC18; B-Bl (10 3 CFU/ml), B-B2 (10 9 CFU/ml). Different letters within each column indicate significant differences according to Tukey's post-hoc test (p ⁇ 0.05). **, *** significance at p 0.01 and 0.001, respectively . Table 6 shows that minerals absorbed at leaf level following the two microbial treatments B-Bl and B-B2 led to a significant increase compared to the B-CTR control.
- N, P, and K increased by 485%, 99.5%, and 389% in B-Bl and by 832%, 110%, and 500% in B-B2. Furthermore, the comparison between the two doses of VWC18 shows statistically higher values in B-B2 compared to B-Bl for most nutrients.
- Table 6 Mineral content in untreated and Bacillus 5 haynesii VWC18-treated basil leaves. Mean values ( ⁇ SD) are reported.
- B-CTR control not treated with Bacillus haynesii VWC18; B-Bl (10 3 CFU/ml), B-B2 (10 9 CFU/ml).
- B-CTR control not treated with Bacillus haynesii VWC18; B-Bl (10 3 CFU/ml), B-B2 (10 9 CFU/ml).
- Different letters within each column indicate significant differences according to 0 Tukey's post-hoc test (p ⁇ 0.05). **, *** significant at p ⁇ 0.01 and 0.001, respectively.
- the preliminary test carried out on lettuce made it possible to highlight a general effectiveness of the microbial treatment with Bacillus haynesii VWC18 in terms of leaf development and absorption of nutritional elements.
- This test also made it possible to optimize the most effective doses of microorganism (10 3 CFU/ ml and 10 9 CFU/ ml) and the treatment intervals, with the treatment performed every 10 days proving to be more effective ( Figure 1, Table 1 and 2).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Health & Medical Sciences (AREA)
- Environmental Sciences (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Agronomy & Crop Science (AREA)
- Biotechnology (AREA)
- Botany (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Dentistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a new strain of Bacillus haynesii called VWC18 deposited at the Microbial Strain Collection of Latvia (MSCL) on 28 February 2023 with accession number P1649) and its uses in agriculture as a plant biostimulant, in particular for horticultural and floricultural crops.
Description
Description of the industrial invention entitled: "New strain of Bacillus haynesii and its use in agriculture"
By: ALMA MATER STUDIORUM-UNIVERSITY OF BOLOGNA, Italian nationality, via Zamboni 33, 40126 Bologna (Italy)
Designated inventors: GAGGIA, Francesca;
PAGLIARINI, Elia; DI GIOIA, Diana. Filed on:
★ ★ ★
DESCRIPTION
The present invention falls within the fields of agro-environmental microbiology and agriculture. More specifically, the invention relates to a new strain of prokaryotic microorganism belonging to the Bacillus haynesii species and its use in agriculture as a plant biostimulant.
A plant biostimulant is any substance or microorganism that is applied to plants with the aim of improving nutritional efficiency, tolerance to abiotic stress and/or quality characteristics of crops, regardless of nutrient content (Fusco, G. M., Nicastro, R., Rouphael, Y., & Carillo, P. (2022). The Effects of the Microbial Biostimulants Approved by EU Regulation 2019/1009 on Yield and
Quality of Vegetable Crops. Foods, 11(17), 2656).
The use of biostimulants in agriculture has been known and widely spread for some time. Most of the biostimulant products currently available on the market have a composite formulation in which the microbial component, if present, is generally associated with other components, such as mycorrhizal fungi, food waste, amino acids, phytohormones, vitamins, bioactive polyphenols, complexed chemical elements, organic substances and soil improvers such as leonardite. Furthermore, in many cases, commercially available plant biostimulants require the concomitant use of other products, such as insecticides, fungicides and/or nematicides. Below is a list of the main plant biostimulants currently on the Italian market: Grena special (GRENA), Idrogena Universal (GRENA), SinerVeg (CIFO), Basfoliar® (COMPOEXPERT), Basfoliar® Aktiv SL (COMPOEXPERT), Zip (DIACHEM), K62 PLUS (DVA), Eco Osmobetan (DVA), Alfan (FERTIGLOBAL), Cautha (FERTIGLOBAL), Creo (FERTIGLOBAL), Megastim (XEDA ITALIA), Solargo 900 WDG (XEDA ITALIA), Yoduo (ROTAM ITALIA), Dinamic (HYDRO FERT), Biimore (TRADECORP).
With a view to the development of sustainable
agricultural practices, there is a need to provide a plant biostimulant which has an adequate level of effectiveness but which does not include, or which does not necessarily require, the concomitant use of synthetic chemical compounds or organic substances obtained by extraction with the use of organic solvents, but which on the contrary is an essentially natural product.
A first object of the present invention is therefore to provide a plant biostimulant which is essentially natural.
Another object of the present invention is to provide a plant biostimulant which does not require the concomitant use of synthetic biostimulants, fungicides, insecticides and/or nematicides.
A further object of the present invention is to provide a plant biostimulant which has a low production cost and whose application to crops does not require specialized labour.
These and other objects are achieved by the present invention, which provides a new strain of the prokaryotic microorganism Bacillus haynesii, called VWC18. As far as the inventors are aware, in the prior art there are no disclosures relating to the use of the microorganism Bacillus haynesii as a
plant biostimulant.
As described in the experimental part that follows, the Bacillus haynesii strain VWC18 has proven to be extremely effective in agriculture as a plant biostimulant without requiring the concomitant use of other products, such as synthetic biostimulants, fungicides, insecticides and/or nematicides.
The use of the Bacillus haynesii strain VWC18 in agriculture as a plant biostimulant exhibits numerous advantages. It first of all allows the use of chemical fertilizers which, as is known, have a negative impact on soil fertility and environmental pollution to be eliminated or reduced. A further advantage consists in that the use of the Bacillus haynesii strain VWC18 in agriculture as a plant biostimulant does not require the long preparation times that are normally associated with the calculations that need to be performed for the application of conventional formulations based on bi-trivalent chemical compounds. Furthermore, as described in the experimental section, the Bacillus haynesii strain VWC18 was isolated from a natural habitat, i.e. waste material of plant origin. Its production therefore does not require chemical
synthesis or chemical extraction processes with solvents, which represents a clear further advantage in terms of eco-sustainability . The application of this product to crops is also simple and does not require specialized labour, nor are activation processes required, but simply the dilution of the freeze-dried microorganism in water or its diffusion into the soil, if it is formulated as a granular preparation.
In economic terms, the invention is characterized by a low production cost and its use on crops brings production improvements, acting on both the aerial and the root systems. The increase in root biomass represents a further advantage as it makes the plant more resistant to water stress.
The new Bacillus haynesii strain VWC18 which is the subject of the present invention is characterized by the 16S RNA gene sequence represented below: TAAAACTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACC TTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCG GTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGC GCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGG GTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCAC GTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCG
ACTCTCTGGTCTGTAACTGACGCTGAGGCGCGAAAGCGTGGGGAGCGAACA
GGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGTGTTA
GAGGGTTTCCGCCCTTTAGTGCTGCAGCAAACGCATTAAGCACTCCGCCTG GGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGGCCCGCAC AAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAG GTCTTGACATCCTCTGACAACCCTAGAGATAGGGCTTCCCCTTCGGGGGCA GAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGG TTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAGTT GGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGAC GTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGTGCTACAATGGG CAGAACAAAGGGCAGCGAAGCCGCGAGGCTAAGCCAATCCCACAAATCTGT TCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGAAGCTGGAATCGCT AGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCGGGCCTTGTACA CACCGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGTCGGTGAGGTAA CCTTTTGGAGCCAGCCGCCGAAGG (SEQ ID NO:1)
Bacillus haynesii VWC18 was deposited on 28 February 2023 at the International Depositary Authority Microbial Strain Collection of Latvia (MSCL) under accession number P1649.
It is a rod-shaped aerobic-spore-forming microorganism provided with flagella, capable of growing on minimal media based on peptones and meat extracts at a temperature of 22-37 °C.
For use in agriculture, the Bacillus haynesii strain VWC18 of the invention is formulated in a
plant biostimulant composition in the form of a liquid suspension or, alternatively, in the form of a granular formulation.
A liquid suspension includes viable cells or spores of Bacillus haynesii VWC18 which act as an active substance, in association with at least one diluent, for example water possibly added with a source of nutrients such as molasses. According to a preferred embodiment, the amount of viable Bacillus haynesii VWC18 cells present in the liquid suspension is between 103 CFU/ml and 109 CFU/ml (where CFU stands for "colony forming unit").
Alternatively, Bacillus haynesii VWC18 is prepared as a granular formulation. The granular formulation includes, for example, spores of Bacillus haynesii VWC18 which, through a pelleting process and combination with other phytoingredients, becomes more compact and easier to distribute in the soil. The preparation of granular formulations of microorganisms for use in agriculture is in itself conventional.
In a further preferred embodiment, the plant biostimulant composition (both in the case of the liquid suspension and in that of the granular formulation) is free from further active substances
such as synthetic biostimulants, insecticides, fungicides and nematicides.
The plant biostimulant composition of the invention is used in agriculture to improve the growth of leaf and root biomass, the content of photosynthetic pigments such as chlorophyll-a, chlorophyll-b and carotenoids) and the content of macronutrients, micronutrients and other minerals of plants, preferably horticultural and floricultural species.
For this purpose, the plant biostimulant composition of the invention is applied in methods of biostimulant treatment, which include or consist of the application of the aforementioned biostimulant composition to plants or seedlings recently germinated from the seed.
In the case of seedlings, the treatment is generally carried out by immersing the root system of the seedlings packaged in sockets or by fertigation following transplanting into pots or in a field.
In the case of plants, the treatment is generally carried out on growing plants by applying the composition of the invention on the rhizospheric soil, with the aim of improving the
vigor of the plants themselves and increasing the absorption efficiency by the roots.
The treatment of plants or seedlings with the plant biostimulant composition of the invention may be carried out according to a regime which provides for a single treatment (single inoculationlum) or alternatively treatments repeated over time (multiple inoculations).
The experimental part which follows is provided for purely illustrative and non-limiting purposes of the scope of the invention as defined in the appended claims. In the experimental part reference is made to the following figures:
Figure 1 is a bar graph showing the fresh, dry weight, and % dry matter of lettuce plants. S-CTR: control; S-Bl, S-B2. S-B3, S-B4 plants subjected to treatment with B. haynesii. Different letters (a, b) indicate a significant difference (Tukey HSD test) 0.05.
Figure 2 is a bar graph showing leaf and root biomass of lettuce plants. L-CTR: control; L-Bl, L- B2: plants treated with B. haynesii. Different letters (a, b) indicate a significant difference (Tukey HSD test)
0.05.
Figure 3 is a bar graph showing the leaf and
root biomass of basil plants. B-CTR: control; B-Bl, B-B2: plants treated with B. haynesii. Different letters (a, b) indicate a significant difference (Tukey HSD test)
0.05.
EXPERIMENTAL PART
Materials and methods
Isolation of Bacillus haynesii strain VWC18
The strain VWC18 of Bacillus haynesii was isolated from compost of mixed plant material of different origins (agricultural waste, ornamental greenery and urban waste) collected in heaps in the open field (April 2018, Bologna, Emilia Romagna, Italy). The temperature of the compost was 75 °C at approximately 30 cm depth and the sampling material was taken at approximately 20 cm depth. Compost samples were serially diluted and plated on Tryptic Soy agar (TSA, Oxoid, ThermoFisher). The plates were incubated for 2-3 days at 30 °C, under aerobic conditions. The isolated strain was then identified by 16S rRNA gene sequencing.
Determination of the 16S rRNA gene sequence
The nucleotide sequence of the gene encoding the 16S rRNA gene of Bacillus haynesii VWC18 was determined as follows. Genomic DNA was extracted from a Bacillus haynesii VWC18 cell culture using a
kit for DNA extraction from prokaryotic microorganisms (Wizard® Genomic DNA Purification Kit, Promega). The gene coding for 16S rRNA was then amplified with the following primers: 8- forward 8F (5'-AGA GTT TGA TGC TGG CTC AG -3') (SEQ ID NO:2) e 1520-reverse 1520R (5'- AAG GGA GGT GAT CCA GCC GCA -3') (SEQ ID NO:3). The amplification product was purified using a known methodology (NucleoSpin DNA purification Kit, Macherey-Nagel) and sent to the Eurofins Genomics sequencing service (Edelsberg, Germany). The assignment to the microbial species B. haynesii was carried out by comparing the sequence obtained with a database of known sequences using the local alignment search tool Nucleotide Blast (Basic Local Alignment Search Tool) available on the NCBI website at http ://www .ncbi. nlm .nih.gov/BLAST.
Preliminary greenhouse study on lettuce
A preliminary greenhouse study was conducted on lettuce (Lactuca sativa L.) with different doses of Bacillus haynesii VWC18 followed by two conclusive greenhouse pot tests on lettuce and basil (Ocinum basilicum L.) using the two doses that in the preliminary study had given better agronomic and nutritional results.
For the preliminary greenhouse study on lettuce, different microbial doses and two different application frequencies were used, and some agronomic growth parameters (the weight of fresh and dry leaves) and the absorption of macro/micronutrients at leaf level were analyzed. The preliminary test was conducted in a protected greenhouse located at the Paganotto Ortofloricolo Nursery (Verona, Italy). Homogeneous lettuce seedlings (Lactuca sativa L.), belonging to the two-leafed green Gentilina type, were supplied by Orto Mio s.r.l. (Verona, Italy). Twenty days after sowing, the seedlings were transplanted into individual pots (2L capacity). All the pots were filled with the same substrate composed of acid peat, humified peat, non-composted green soil improver (pH: 7.5, total porosity v/v: 80%, dry bulk density: 450 kg/m2) supplied by Gramoflor gmbh & Co, Vechta, Germany. The experiment was designed according to a randomized block design which included four different doses of Bacillus haynesii VWC18 treatment:
- B1 (103 CFU/ml)
- B2 (105 CFU/ml)
- B3 (107 CFU/ml)
- B4 (109 CFU/ml)
The aforementioned doses Bl, B2, B3 and B4 were compared with a control (CTR) not treated with the microorganism but only with an equal volume of sterile deionized water (to verify the absence of a contribution of nutrients provided by the water).
Each dose was administered according to two treatment regimens:
—S = single inoculation: administration of a single inoculation with Bacillus haynesii VWC18 in the soil immediately after transplanting;
-M = multiple inoculations: administration of a plurality of inoculations with Bacillus haynesii VWC18, the first carried out immediately after transplanting and the subsequent ones repeated at 10-day intervals until harvest.
Each treatment with the microorganism (i.e. the combination of dose of microorganism administered and treatment regimen applied: S-Bl, S-B2, S-B3, S- B4 and M-Bl, M-B2, M-B3, M-B4) was administered in 10 pots, to which 10 pots were added for each control treatment (S-CTR and M-CTR), for a total of 100 pots. The cultivation cycle lasted 33 days from transplanting to harvesting.
Final test on lettuce and basil
20-Day-old lettuce seedlings (Lactuca sativa L.), as indicated above, and 40-day-old basil seedlings (supplied by Orto Mio s.r.l., Verona, Italy) belonging to the Genovese type (Ocimum basilicum L. cv. Superbo) were raised in the same place and under the same conditions mentioned in the previous section. The experimental design consisted of a randomized block design with three treatments for each culture and three replicates (6 pots for each replicate). Based on the results of the preliminary test, the study envisaged the two best performing microbial doses (103 CFU/ml and 109 CFU/ml) and multiple inoculations (at transplant and every 10 days until harvest) as follows: a) L-CTR: lettuce control plants not treated with Bacillus haynesii VWC18; b) L-Bl: lettuce plants treated with Bacillus haynesii VWC18 (103 CFU/ml); c) L-B2: lettuce plants treated with Bacillus haynesii VWC18 (109 CFU/ml); d) B-CTR: basil control plants not treated with Bacillus haynesii VWC18; e) B-B1 : basil plants treated with Bacillus haynesii VWC18 (103 CFU/ml); f) B-B2 : basil plants treated with Bacillus
haynesii VWC18 (109 CFU/ml).
In total, 54 lettuce plants (L-CTR, L-Bl, L-B2) and 54 basil plants (B-CTR, B-Bl, B-B2) were prepared. Preparation of the inoculation
Bacillus haynesii VWC18 was grown in 50 ml of Tryptone-Soy-Broth (TSB, Oxoid, ThermoFisher) for 20 h at 28 °C with horizontal stirring. Subsequently, the microbial biomass was inoculated into IL of TSB and grown at 28 °C to an optical density of 1.0, corresponding to 2xl09 colony forming units (CFU)/ml. Correspondence between OD and CFU was defined after plate counting performed three times (data not shown). Bacteria were collected by centrifugation for 10 minutes at 5,000 rpm and then diluted in 100 ml of sterile deionized water.
Administration of the cell suspension
The suspension in water thus obtained was used for the administration of the microorganism to the plants as irrigation water administered on the soil surface. The treatments were carried out by applying 10 ml to the base of each plant (collar) until reaching a final concentration of 104, 106, 108, 1010 CFU per plant. For example, the
concentration of 104 per plant was achieved by applying 10 ml of a microorganism solution at a concentration of 103 CFU/ml. The same volume of water was used to water the control plants, without applying any other nutrients or microbial inoculations .
Destructive determinations for the analysis of growth parameters
Preliminary test on lettuce
33 days after transplanting (10 days from the last microbial inoculation in the case of multiple treatment), six plants from each treatment and control (60 plants) were randomly selected and transported to the laboratory. Within 4 hours, the plants were cut at the base; fresh weight was determined by weighing the lettuce head immediately after cutting. The leaf material was then placed in a paper bag and dried at 70 °C for 72 hours. The weight difference before and after drying was used to calculate the dry weight of the sample sprouts. The percentage of dry matter was calculated as: dry weight/fresh weight x 100. Subsequently, the dried samples were ground into powder in a Willey-type mill and stored until further analysis. Final test on lettuce and basil
31 (lettuce) and 54 (basil) days after transplanting and 10 days after the last treatment
5 plants for each replicate and treatment (15 plants for each crop) were randomly selected and transported to the laboratory. The determination of the fresh weight, the dry weight and the percentage of dry matter were carried out as indicated in the previous section for both the leaf part and the root part. Furthermore, the chlorophyll and carotenoid content in the leaves was determined.
For the determination of chlorophyll-a, chlorophyll-b and carotenoids, leaf samples from three plants not subjected to drying were macerated in acetone, centrifuged and then the absorbance was measured at 665 nm, 649 nm and 470 nm in the supernatant (Porra, R.J.; Thompson, W.A.A.; Kriedemann, P. E. Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochimica et Biophysica Acta (BBA)-Bioenergetics, 1983, 975, 384-394; Lichtenthaler, H. K.; Wellburn, A. R.
Determinations of total carotenoids and
chlorophylls a and b of leaf extracts in different solvents, 1983).
Analysis of main nutrients and micronutrients
Dried lettuce and basil samples (six plants/treatment in the preliminary experiment; five plants/culture/replicate in the second experiment) were analyzed for macro- and micronutrients after wet digestion according to the United States Environmental Protection Agency (US EPA) method 3052: 0.250-0.300 mg of each dried sample was treated with 8 ml of nitric acid (65%) and 2 ml of hydrogen peroxide (30%) at 180 °C in an Ethos TC microwave (Mile-stone, Bergamo, Italy), and mineral concentration was performed by inductively coupled plasma optical emission spectroscopy (ICP-OES) (Ametek Spectro Arcos EOP, Kleve, Germany) . The following nutrients were studied: phosphorus (P), potassium (K), sodium (Na), calcium (Ca), magnesium (Mg), manganese (Mn), iron (Fe), zinc (Zn), copper (Cu), boron (B), chromium (Cr), molybdenum (Mo) and selenium (Se). Nitrogen (N) was determined by the Kjeldahl method by mineralizing 0.300 g of sample with 10 ml of sulfuric acid (95%) and catalyst (a mixture of anhydrous potassium sulfate and anhydrous copper
sulfate, nitrogen-free), at 420 °C for 180 min, and subsequent distillation with 32% NaOH solution (32%), and finally titration with 0.1 M sulfuric acid. Results
Preliminary greenhouse test on lettuce
The effects of single (S) and multiple (M) microbial inoculation at the four doses used in the preliminary experiment on greenhouse lettuce plants (Bl = 103 CFU/ml), B2 = 105 CFU/ml, B3 = 107 CFU/ml and B4 = 109 CFU/ml) were evaluated with respect to the S-CTR and M-CTR controls by measuring the following growth parameters: fresh and dry leaf biomass and percentage of total dry matter (Figure la-f).
More specifically, Figure 1 represents, with reference to leaf biomass, the fresh weight (Fig. la), the dry weight (Fig. lb) and the % dry matter (Fig. lc) in the case of the single inoculation, the fresh weight (Fig. Id), the dry weight (Fig. le) and the % dry matter (Fig. If) in the case of multiple inoculations. The statistical analysis to observe a difference between the theses was carried out using the one-way Anova test and subsequent pairwise comparison with the Tukey test. Different
letters (a, b) indicate a significant difference (Tukey HSD test) at ≤ 0.05.
All plants that received the single microbial inoculation at different concentrations showed higher fresh weight values compared to S-CTR (Figure la); in particular, S-Bl and S-B2 recorded significantly higher fresh weight values.
The dry weight increased significantly in S-B2 (Figure lb). S-CTR showed the highest dry matter % but no significant differences between values were reported (Figure lc).
Regarding multiple inoculation, plants receiving the microorganism showed a significant difference in fresh weight, dry weight and % dry matter measurements, compared to M-CTR (Figure ld- f)•
The fresh weight of M-Bl and M-B4 increased significantly, more than 40%. Similarly, dry weight was significantly higher than M-CTR (p ≤ 0.05). Dry matter % was higher and significant in M-CTR compared to M-B4 (7.5710.37% vs 6.6710.74%; p ≤ 0.05). M-Bl, M-B2 and M-B3 recorded intermediate dry matter values, belonging to the same significance groups (7.3411.00%, 7.3410.51%, 7.2110.76%) .
Table 1 shows the effect of the microbial inoculation on the N, P and K contents determined by chemical analysis on leaf biomass, while Table 2 shows the trace element contents determined in the same samples. From the reported data, it may be deduced that the single microbial treatment did not determine significant differences in the N, P and K contents between S-CTR, S-Bl, S-B2, S-B3 and S-B4, although all the average values were higher in the treated plants. The multiple inoculation instead determined significantly higher values in the treated plants compared to the non-inoculated control (p ≤ 0.01 and p ≤ 0.001). Some essential nutrients had double or nearly triple values compared to M-CTR. Comparing S-Bl, S-B2, S-B3 and S-B4 with M-Bl, M-B2, M-B3 and M-B4 the increase was significant for N, P and K, with a double increase for P.
The other minerals are shown in Table 2. With the exception of sodium in S-Bl, lettuce receiving the single inoculation showed no significant difference compared to S-CTR, although all treatments recorded higher values. In the multiple inoculation, the measurements obtained showed a significant increase (p ≤ 0.001), greater than 50%
in all treated plants.
Table 1
Table 1: Nitrogen (N), phosphorus (P) and potassium (K) content (mg/plant) on untreated lettuce and treated with single (S) and multiple (M) inoculation of Bacillus haynesii VWC18. Mean values (± SD) are reported; Bl (103 CFU/ml), B2 (105 CFU/ml), B3 (107 CFU/ml) and B4 (109 CFU/ml). S-CTR and M-CTR: control plants (single and multiple treatment theses) that had received only water. Different letters within each column indicate significant differences according to Tukey's post- hoc test (p ≤ 0.05). ns, **, *** not significant or significant at p
0.01 and 0.001, respectively.
Table 2
Table 2: Mineral content of lettuce plants untreated and treated with single (S) and multiple (M) inoculation of Bacillus haynesii VWC18. Mean 5 values (± SD) Bl (103 CFU/ml), B2 (105 CFU/ml), B3 (107 CFU/ml) and B4 (109 CFU/ml) are reported. S- CTR and M-CTR: control plants (single and multiple treatment theses) that had received only water. Different letters within each column indicate 10 significant differences according to Tukey's post- hoc test (p ≤ 0.05). ns, **, *** not significant or significant at p
0.01 and 0.001, respectively. Final test on lettuce
The effects of the microbial treatment carried
out in the final experiment on lettuce plants at the two selected doses of Bacillus haynesii VWC18 (L-Bl = 103 CFU/ml and L-B2 = 109 CFU/ml) were evaluated with respect to the control (L-CTR) by measuring the following leaf and root biomass growth parameters: fresh weight, dry weight and percentage of dry matter (Figure 2a-f).
More specifically, Figure 2 represents, for leaf biomass, the fresh weight (Fig. 2a), the dry weight (Fig. 2b) and the % dry matter (Fig. 2c) and, for root biomass, the fresh weight (Fig. 2d), the dry weight (Fig. 2e) and the % dry matter (Fig. 2f). Different letters (a, b) indicate a significant difference (Tukey HSD test) at p
0.01.
The experiment was performed using the growth conditions optimized in the preliminary test. As highlighted in Figure 2, multiple inoculation at the two best performing doses L-Bl (103 CFU/ml) and L-B2 (109 CFU/ml) led to a significant increase (p ≤ 0.001) of leaves and roots in both fresh weight and dry weight compared to the control not treated with Bacillus haynesii VWC18 (L-CTR); leaf fresh weight increased by 32% (L-Bl) and 28% (L-B2), while root fresh weight by 86% (L-Bl) and 200% (L-
B2) compared to the untreated control (L-CTR). The percentage of dry matter did not show any change in the aboveground biomass, which on the contrary in the root part was significantly different between 5 the treatments with the highest value in L-CTR (25.54 ± 7.22%; p ≤ 0.05).
Table 3 shows the concentration of chlorophyll (a and b) and carotenoids extracted from the leaves themselves. Despite the obvious increase, the 10 values for chlorophyll-a, chlorophyll-b and carotenoids in L-Bl were not significantly different compared to L-CTR. Lettuce plants treated with the highest dose of Bacillus haynesii VWC18 (L-B2) showed significantly higher values (p ≤ 15 0.05) compared to the untreated control (L-CTR).
Table 3
Table 3: Chlorophyll-a, chlorophyll-b, and carotenoid concentrations determined on lettuce 20 leaves untreated with Bacillus haynesii VWC18 (L-
CTR) and treated with Bacillus haynesii VWC18 (L-Bl
and L-B2). Mean values (± SD) are reported; L-CTR: control plants not treated with the bacterial inoculation; L-Bl (103 CFU/ml) and L-B2 (109 CFU/ml). Different letters within each column indicate significant differences based on Tukey 's post-hoc test (p ≤ 0.05) *, **, *** significance at p ≤ 0.05, 0.01 and 0.001, respectively.
In this final test a wider range of minerals was analyzed (Table 4), Cr, Mo and Se also being taken into consideration. Except for Mo in L-Bl plants (103 CFU/ml), all values recorded in lettuce subjected to microbial treatments are significantly higher (p ≤ 0.001, 0.01 and 0.05) compared to the control not treated with the microorganism (L-CTR); no significant difference was observed between the two doses of Bacillus haynesii VWC18, with the exception of Mg and Mn which showed significantly higher values between the two doses of administration (L-B2 compared to L-Bl). Taking the untreated control (L-CTR) into consideration, the N, P and K content grows up to 40% (N), 100% (P) and 132% (K). The remaining elements recorded an increase of more than 50%, reaching 100% (e.g. Na, Mg, Fe, Zn, B, Mo) or exceeding it (e.g. Mn). Table 4
Table 4: Mineral content of untreated (L-CTR) and Bacillus haynesii VWC18-treated lettuce plants. Mean values (± SD) L-Bl (103 CFU/ml), L-B2 (109 CFU/ml) . Different letters within each column indicate significant differences according to Tukey's post-hoc test (p ≤ 0.05). *, **, *** significance for p ≤ 0.05, 0.01 and 0.001, respectively . Final test on basil
The effects of the microbial treatment carried out in the final experiment on basil plants at the two selected doses of Bacillus haynesii VWC18 (B-Bl (103 CFU/ml) and B-B2 (109 CFU/ml)) were evaluated with respect to the control (B-CTR) by measuring
the following leaf and root biomass growth parameters: fresh weight, dry weight and percentage of dry matter (Figure 3a-f).
More specifically, Figure 3 represents, for leaf biomass, the fresh weight (Fig. 3a), the dry weight (Fig. 3b) and the % dry matter (Fig. 3c) and, for root biomass, the fresh weight (Fig. 3d), the dry weight (Fig. 3e) and the % dry matter (Fig. 3f). Different letters (a, b) indicate a significant difference (Tukey HSD test) at p
0.01.
As highlighted in the figure, B-Bl and B-B2 are significant (p ≤ 0.001) compared to B-CTR and to each other, with the exception of root fresh weight. Leaf fresh weight in B-Bl is two times higher than in B-CTR. Regarding the % of dry matter, there is a significant increase in the leaves for B-Bl and B-B2, while the percentage of root dry matter decreases in both treatments, compared to B-CTR.
Table 5 shows the chlorophyll and carotenoid values relative to the control plants (B-CTR) and to the plants treated with the two doses of Bacillus haynesii VWC18 tested. All parameters analyzed are significantly higher in the two
treatments with the microorganism compared to B-
CTR.
Table 5
Table 5: Concentrations of chlorophyll-a, chlorophyll-b and carotenoids analyzed on untreated and Bacillus haynesii VWC18-treated basil leaves. Mean values (± SD) are reported; B-CTR: control plants not treatued with Bacillus haynesii VWC18; B-Bl (103 CFU/ml), B-B2 (109 CFU/ml). Different letters within each column indicate significant differences according to Tukey's post-hoc test (p ≤ 0.05). **, *** significance at p
0.01 and 0.001, respectively . Table 6 shows that minerals absorbed at leaf level following the two microbial treatments B-Bl and B-B2 led to a significant increase compared to the B-CTR control. N, P, and K increased by 485%, 99.5%, and 389% in B-Bl and by 832%, 110%, and 500% in B-B2. Furthermore, the comparison between the two doses of VWC18 shows statistically higher
values in B-B2 compared to B-Bl for most nutrients.
Table 6
Table 6: Mineral content in untreated and Bacillus 5 haynesii VWC18-treated basil leaves. Mean values (± SD) are reported. B-CTR: control not treated with Bacillus haynesii VWC18; B-Bl (103 CFU/ml), B-B2 (109 CFU/ml). Different letters within each column indicate significant differences according to 0 Tukey's post-hoc test (p ≤ 0.05). **, *** significant at p≤
0.01 and 0.001, respectively. Conclusions
In conclusion, the preliminary test carried out
on lettuce made it possible to highlight a general effectiveness of the microbial treatment with Bacillus haynesii VWC18 in terms of leaf development and absorption of nutritional elements. This test also made it possible to optimize the most effective doses of microorganism (103 CFU/ ml and 109 CFU/ ml) and the treatment intervals, with the treatment performed every 10 days proving to be more effective (Figure 1, Table 1 and 2).
In the final tests with lettuce and basil, the treatments with the lowest dose (103 CFU/ ml) and the highest dose (109 CFU/ ml) of Bacillus haynesii VWC18 applied at transplanting the crop and at 10 day intervals worked by increasing leaf and root mass (Fig. 2 for lettuce and Fig. 3 for basil), chlorophyll and carotenoid content (Table 3 for lettuce and Table 5 for basil) and mineral absorption (Table 4 for lettuce and Table 6 for basil) in both lettuce and basil, with a pronounced dose-dependent action on basil, in which the higher dose is more effective.
Overall, the application of Bacillus haynesii VWC18 resulted in a significant increase in all parameters analyzed with increases even greater than 100% compared to untreated controls. The
weight of the roots is doubled or tripled compared to the control plants; the chlorophyll concentration reached even higher values. Both parameters recorded a dose-dependent increase. It should be underlined that the increased root biomass determined by the application of the microorganism at the doses and methods considered is extremely important in terms of increased soil exploration and capture of the water present, proving very advantageous in a scenario of water saving and resistance to dry conditions.
Claims
1. Bacillus haynesii strain WVC18 deposited at Microbial Strain Collection of Latvia (MSCL) on 28 February 2023 under accession number P1649.
2. A plant biostimulant composition comprising an active substance and at least one carrier and/or at least one diluent acceptable in agriculture, characterized in that the active substance comprises viable cells and/or spores of Bacillus haynesii strain WVC18 as defined in claim 1.
3. The plant biostimulant composition according to claim 2, which is formulated as a liquid suspension or as a granular formulate.
4. The plant biostimulant composition according to claim 3, which is a liquid suspension comprising 103 to 109 CFU/ml of viable cells of Bacillus haynesii strain WVC18.
5. The plant biostimulant composition according to any one of claims 2 to 4, which is free of synthetic biostimulants, insecticides, fungicides and/or nematicides.
6. Use of the plant biostimulant composition according to any one of claims 2 to 5 as a plant biostimulant in agriculture.
7. A method of biostimulant treatment of a plant,
comprising or consisting of the step of applying to said plant the plant biostimulant composition according to any one of claims 2 to 5.
8. The method according to claim 7, wherein the plant biostimulant composition is applied to the rhizosphere soil of said plant.
9. The method according to claim 8, wherein the plant biostimulant composition is applied to the rhizosphere soil of said plant as a single inoculum or as a multiple inocula.
10. The method according to any one of claims 7 to 9, wherein said plant is a plant of a horticultural or floricultural crop, in a pot or in a field.
11. A method of biostimulant treatment of a seedling, comprising or consisting of the step of immersing said seedling in a plant biostimulant composition according to any one of claims 2 to 5 formulated as a liquid suspension.
12. The method according to claim 11, wherein said seedling is a seedling of a horticultural or floricultural crop.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IT102023000006816A IT202300006816A1 (en) | 2023-04-06 | 2023-04-06 | New strain of Bacillus haynesii and its use in agriculture |
| PCT/IB2024/052241 WO2024209288A1 (en) | 2023-04-06 | 2024-03-08 | New strain of bacillus haynesii and its use in agriculture |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4687450A1 true EP4687450A1 (en) | 2026-02-11 |
Family
ID=87036304
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24716224.1A Pending EP4687450A1 (en) | 2023-04-06 | 2024-03-08 | New strain of bacillus haynesii and its use in agriculture |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP4687450A1 (en) |
| IT (1) | IT202300006816A1 (en) |
| WO (1) | WO2024209288A1 (en) |
-
2023
- 2023-04-06 IT IT102023000006816A patent/IT202300006816A1/en unknown
-
2024
- 2024-03-08 WO PCT/IB2024/052241 patent/WO2024209288A1/en not_active Ceased
- 2024-03-08 EP EP24716224.1A patent/EP4687450A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024209288A1 (en) | 2024-10-10 |
| IT202300006816A1 (en) | 2024-10-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sani et al. | Impact of application of Trichoderma and biochar on growth, productivity and nutritional quality of tomato under reduced NPK fertilization | |
| Saxena et al. | Impact of addition of biochar along with Bacillus sp. on growth and yield of French beans | |
| AU2016389840B2 (en) | Microbial consortia | |
| RU2628411C2 (en) | Microbial inoculants and fertilisers composition containing them | |
| Hungria et al. | Inoculant preparation, production and application | |
| Simsek Ersahin et al. | Vermicompost suppresses Rhizoctonia solani Kühn in cucumber seedlings | |
| WO2010109436A1 (en) | Microbial formulation for widespread uesd in agricultural practices | |
| Altuntaş | A comparative study on the effects of different conventional, organic and bio-fertilizers on broccoli yield and quality. | |
| ABDIPOOR et al. | Effects of humic acid and cow manure biochar (CMB) in culture medium on growth and mineral concentrations of basil plant | |
| Baysal et al. | Field management effects on damping-off and early season vigor of crops in a transitional organic cropping system | |
| Mostafa et al. | Effect of different types of biochar on soil chemical properties, microbial community, pathogenic fungi and faba bean productivity | |
| Dogbatse et al. | 4. Physicochemical and biological properties of different Cocoa Pod Husk-based composts | |
| EP4687450A1 (en) | New strain of bacillus haynesii and its use in agriculture | |
| Anuradha et al. | Microbial biofertilization to improve yield and quality of strawberry | |
| Purnomo et al. | Utilization of indigenous phosphate-solubilizing bacteria to optimize the use of coal fly ash for increasing available-P in an Ultisol | |
| Gangaraddi et al. | Screening of the selected formulations of a microbial consortium for their effectiveness on the growth of finger millet (Eleusine coracana L. Gaertn.) | |
| Filho et al. | Corn response to an integrated plant nutrition system (IPNS) with humic acid and biofertilizers | |
| CN113308379B (en) | Preparation and application method of a wheat seed biostimulant SB-HXF-10 | |
| Domagała-Świątkiewicz et al. | Short-term effects of brassica cover crops on soil quality indicators in organic production in high tunnels | |
| DUGGAL et al. | Plant growth-promoting bacteria from the Thar desert for yield augmentation in wheat (Triticum aestivum L.). | |
| Mokhtar et al. | Effect of Organic and Bio-Fertilization on Promoting Vegetative Growth of Pear Seedling Cv.(Basateen MKM) Under Intensive Cultivars Conditions. | |
| Osaro-Matthew et al. | Tomato plant growth promotion potential of Janibacter sp strain RC18 | |
| GAMAL et al. | Effects of rhizosphere microbiome on alleviate environmental stress on strawberry crop: A review | |
| Panchal et al. | Biofertilizer from Vegetative Waste and Animal Excretory Waste by Using PGPR-A Way for Sustainable Agriculture | |
| Fetouh et al. | Bio-production of Origanum vulgare L. plant under Egyptian sandy soil condition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20251014 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |