EP4665874A1 - Etx dependent diagnosis and therapy of multiple sclerosis - Google Patents

Abstract

Provided herein are compositions and methods for monitoring and therapy of patients with Multiple Sclerosis (MS) based on detection of epsilon toxin (ETX) gene/ETX gene-harboring strains of C. perfringens and/or detection of ETX bound to lymphocytes. In some aspects, provided herein are compositions and methods for detection of ETX gene (in particular, quantitative detection of relative abundance of ETX gene-harboring strains of C. perfringens) in fecal samples of a subject, e.g., for identification, monitoring, and treatment of the subject with MS. In some embodiments, provided herein are specific primers for use in such compositions and methods. In other aspects, provided herein are compositions and methods for detection of ETX bound to lymphocytes in blood samples of a subject (such as by use of flow cytometry), e.g., for identification, monitoring, and treatment of the subject with MS. In some embodiments, provided herein are specific therapies for use in MS patients with either elevated level s/abundance of the ETX gene or ETX bound to lymphocytes.

Description

ETX DEPENDENT DIAGNOSIS AND THERAPY OF MULTIPLE SCLEROSIS

CROSS-REFERENCE TO RELATED APPLICATIONS

This patent application claims the benefit of U.S. Provisional Patent Application Nos. 63/522,610, filed June 22, 2023; 63/446,677, filed February 17, 2023; and 63/446,593, filed February 17, 2023; the contents of each of which are incorporated by reference herein in their entireties.

GOVERNMENT SUPPORT

This invention was made with U.S. government support under Grant Number R21 RNS 106581 A awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD

The present invention is generally directed to compositions and methods for identifying patient populations for the prevention and treatment of multiple sclerosis by detecting relative abundance of strains of C. peifringens harboring epsilon toxin gene (ETX) in gut microbiome or detecting epsilon toxin bound to lymphocytes in the blood.

BACKGROUND

Multiple Sclerosis (MS) is a complex disease of the CNS. MS lesions are centered on post-capillary venules, and impairment of blood-brain barrier (BBB) function is considered the earliest event in lesion evolution, paving the way for entry of myelin autoreactive lymphocytes. MS disease initiation, and thus lesion formation, is believed to require an environmental trigger in a genetically susceptible individual, but biologically plausible environmental agents responsible for lesion induction have been elusive.

There remains a long felt and unmet need for identifying environmental triggers and causes of MS to develop new therapeutic and prophylactic treatments of MS.

SUMMARY OF THE INVENTION

Aspects of the invention disclosed herein include methods for confirmatory diagnosis of multiple sclerosis (MS), prognosis of MS, monitoring the progression of MS, monitoring responsiveness to treatment of MS, prevention of MS, and/or treatment ^{Attorney Docket No.: CUW-02625 of MS in a human subject at risk for or suffering from MS comprising (a) obtaining a fecal sample from the human subject; (b) detecting, in the obtained fecal sample, by} _{Polymerase Chain Reaction (PCR), optionally Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin (ETX) gene-harboring C.} ^{perfringens strains relative to the abundance of non-ETX strains of C. perfringens in the human subject; and if the abundance of ETX-harboring C. perfringens strains is above the median level for a healthy subject: (i) performing a standard-of-care MS evaluation of the human subject, (ii) administering to the human subject a standard-of-care MS therapy, and/or (iii) administering to the human subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains; and if the abundance of ETX-harboring C. perfringens strains is below or equal the median level of a healthy subject: (i) not performing a standard-of-care MS evaluation of the human subject, (ii) not administering to the subject an MS therapy, and/or (iii) not administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. In some of these embodiments, the invention} _{provides a method for confirmatory diagnosis of MS. In some of these embodiments, the invention provides a method for prognosis of MS. In some of these embodiments, the invention provides a method for monitoring the progression of MS. In some of these embodiments, the invention provides a method for monitoring responsiveness to treatment of MS. In some of these embodiments, the invention provides a method for prevention of MS. In some of these embodiments, the invention provides a method for treatment of MS. In some of these embodiments, the invention further provides a method for reducing at least one symptom of MS. In some of these embodiments, the invention further provides a method for reducing the severity of MS. In some of these embodiments, the invention further provides a method for preventing the progression of MS. In some embodiments, if the relative abundance of ETX-harboring C.} ^{perfringens strains is greater than 0.001% (or, e.g., greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%): (i) performing a standard-of-care} _{MS evaluation of the human subject, (ii) administering to the human subject a standard- of-care MS therapy, and/or (iii) administering to the human subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C.} ^{perfringens strains. In some embodiments, if the relative abundance of ETX-harboring} _{C. perfringens strains is greater than 0.001%, the human subject is administered a FH11871214.1} ^{2 Attorney Docket No.: CUW-02625 composition comprising an agent that directly or indirectly interferes with ETX or ETX- harboring C. perfringens strains (e.g., any such composition described herein, e.g., an anti-ETX antibody or an antigen binding fragment thereof). In other embodiments, a standard-of-care MS therapy is administered instead or in addition to ETX-specific therapy. In other embodiments, a standard-of-care MS evaluation of the human subject is performed instead or in addition to one or more of the treatment methods. In some aspects of the invention, provided herein are methods for detection of relative abundance of epsilon toxin (ETX) gene-harboring strains of C. perfringens in the gut microbiome of a subject comprising (a) obtaining a fecal sample from the human subject; (b) detecting, in the obtained fecal sample, by Polymerase Chain Reaction (PCR), optionally Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin gene (ETX)-harboring strains of C. perfringens relative to the abundance of non-ETX strains of C. perfringens, wherein the relative abundance of ETX-harboring strains of C. perfringens is detected if the percentage of ETX-harboring C. perfringens strains is greater than 0.001% (or, e.g., greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%). In some embodiments, the subject is a human subject at risk for or suffering from} _{multiple sclerosis (MS), and if the abundance of ETX-harboring strains of C. perfringens is detected (e.g., greater than 0.001%, 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%): (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to the subject a standard-of-care MS therapy, and/or (iii) administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. In some embodiments, if the abundance of ETX- harboring strains of C. perfringens is detected: the human subject is administered a composition comprising an agent that directly or indirectly interferes with ETX or ETX- harboring C. perfringens strains (e.g., any such composition described herein, e.g., an anti- ETX antibody or an antigen binding fragment thereof). In other embodiments, a standard-of- care MS therapy is administered instead or in addition to ETX-specific therapy. In other embodiments, a standard-of-care MS evaluation of the human subject is performed instead or in addition to one or more of the treatment methods. In some embodiments, the method further comprises a step of selecting the subject for treatment with standard-of-care MS therapy, wherein the subject is at risk for, or suffering from MS, and wherein the subject is selected for treatment wherein the relative FH11871214.1} ^{3 Attorney Docket No.: CUW-02625 abundance of ETX-harboring strains of C. perfringens is detected if the percentage of} _{ETX-harboring C. perfringens strains is greater than 0.001%. In some embodiments, the relative abundance of ETX-harboring strains of C.} ^{perfringens in the human subject is greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 0.001%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 0.01%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 0.1%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 0.5%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 1%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 5%. In some embodiments, the relative abundance of} _{ETX-harboring strains of C. perfringens in the human subject is greater than 10%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 15%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 20%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 25%. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens in the human subject is greater than 30%. In some embodiments, the abundance of ETX-harboring strains of C. perfringens is measured by detection of the ETX gene, and the abundance of ETX-harboring and non- ETX strains of C. perfringens is measured by detection of a gene present in ETX- harboring and non-ETX strains of C. perfringens. The gene present in ETX- and non- ETX harboring strains of C. perfringens may be the CPA gene or 16S rRNA gene (e.g.,} ^{C. perfringens-specific 16S rRNA gene). In some embodiments, the gene is CPA gene. In some embodiments, the gene is 16S rRNA gene (e.g., C. perfringens-specific 16S} _{rRNA gene). In some embodiments, the relative abundance of ETX-harboring strains of C.} ^{perfringens (ETX+, and CPA+ and/or C. perfringens 16S rRNA+) and non-ETX strains of C. perfringens (ETX-, and CPA+ and/or C. perfringens 16S rRNA+), in the obtained} _{fecal sample, is measured. In some embodiments, the relative abundance of ETX-harboring FH11871214.1} ^{4 Attorney Docket No.: CUW-02625 strains of C. perfringens (ETX+ and CPA+) and non-ETX strains of C. perfringens (ETX- and CPA+) in the obtained fecal sample, is measured. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens (ETX+ and C. perfringens 16S rRNA+) and non-ETX strains of C. perfringens (ETX- and C. perfringens 16S rRNA+), in the obtained fecal sample, is measured. In certain embodiments, 2–∆∆Ct analysis is used to quantify the relative abundance of ETX-harboring strains (e.g., ETX+, and CPA+ and/or C. perfringens 16S rRNA+) over non-ETX strains (e.g., ETX-, and CPA+ and/or C. perfringens 16S rRNA+) in the obtained fecal sample; optionally wherein 2–∆∆Ct value of > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9 indicates an abundance of ETX-harboring C. perfringens strains, and optionally if 2–∆∆Ct is > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, (i) performing a standard-of- care MS evaluation of the subject, (ii) administering to the subject a standard-of-care MS therapy, and/or (iii) administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. In some embodiments, if 2–∆∆Ct is > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, the human subject is administered a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains (e.g., any such composition} _{described herein, e.g., an anti-ETX antibody or an antigen binding fragment thereof). In other embodiments, a standard-of-care MS therapy is administered instead or in addition to ETX-specific therapy. In other embodiments, a standard-of-care MS evaluation of the human subject is performed instead or in addition to one or more of the treatment methods. In some of these embodiments, 2–∆∆Ct is > 0.1. In some of these embodiments, 2–∆∆Ct is > 0.25. In some of these embodiments, 2–∆∆Ct is > 0.5. In some of these embodiments, 2–∆∆Ct is > 0.75. In some embodiments, a 2–∆∆Ct value of > 1 indicates dominance of ETX-harboring C. perfringens strains with increased ETX-plasmid copy numbers, and 2–∆∆Ct value of < 1 indicates a higher percentage of non-ETX C. perfringen strains; and optionally if 2–∆∆Ct is > 1, (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to the subject a standard-of-care MS therapy, and/or (iii) administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX- harboring C. perfringens strains. In some embodiments, if 2–∆∆Ct is > 1, the human subject is administered a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains (e.g., any such composition described herein, FH11871214.1} ^{5 Attorney Docket No.: CUW-02625 e.g., an anti-ETX antibody or an antigen binding fragment thereof). In other embodiments, a standard-of-care MS therapy is administered instead or in addition to ETX-specific therapy. In other embodiments, a standard-of-care MS evaluation of the human subject is performed instead or in addition to one or more of the treatment methods. In some embodiments, between after the fecal sample is obtained and before the detection step (such as between step (a) and step (b)), bacteria is separated from nonmicrobial fecal matter of the obtained fecal sample. In some embodiments, the bacteria is separated from the nonmicrobial fecal matter by density gradient centrifugation.} I_{n some embodiments, detecting the abundance of ETX-harboring C. perfringens strains by PCR (e.g., RT-qPCR) comprises use of at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'- CATACTGTGGGAACTTCGATACA-3' and/or 5'- TCTTGTGAAGGGACATTATGAGTAA-3'. In some embodiments, detecting the abundance of ETX-harboring C. perfringens strains by PCR (e.g., RT-qPCR) comprises use of at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5’- ACTCATACTGTGGGAACTTCGA-3’ and/or 5’-ACTCATCTCCCATAACTGCACT-3’. In some embodiments, detecting the abundance of ETX-harboring C.} ^{perfringens strains by PCR (e.g., RT-qPCR) comprises use of a fluorogenic probe comprising, consisting essentially of, or consisting of sequence AGCAACTGCTAAGTTTACTGTTCCT. In some embodiments, detecting the abundance of ETX-harboring C. perfringens strains comprises detecting the relative abundance of CPA-harboring C. perfringens} _{strains by PCR (e.g., RT-qPCR) comprising use of at least one CPA-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'- CTTGGAGAGGCTATGCACTATTT-3' and/or 5'-TTGCAACCTGCTGTGTTTATTT- 3'. In some embodiments, detecting the relative abundance of CPA- harboring C.} ^{perfringens strains by PCR (e.g., RT-qPCR) comprises use of a fluorogenic probe comprising, consisting essentially of, or consisting of sequence TTACTGCCGTTGATAGCGCAGGAC.} I_{n some embodiments, detecting the abundance of ETX-harboring C. perfringens strains comprises detecting the relative abundance of C. perfringens-specific 16S rRNA FH11871214.1} ^{6 Attorney Docket No.: CUW-02625 by PCR (e.g., RT-qPCR) comprising use of at least one C. perfringens-specific 16S rRNA primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'-} _{AGATGGCATCATCATTCAAC-3' and/or 5'- GCAAGGGATGTCAAGTGT-3'. In some embodiments, detecting the relative abundance of C. perfringens-} ^{specific 16S rRNA by PCR (e.g., RT-qPCR) comprises use of a fluorogenic probe comprising, consisting essentially of, or consisting of sequence} _{AGAGTGCAGGAGAGGAGAGTGGAA. In some embodiments, detecting the abundance of ETX-harboring C.} ^{perfringens strains comprises quantifying the relative abundance of ETX-harboring (ETX+, and CPA+ and/or C. perfringens 16S rRNA+) over non-ETX strains (ETX-, and CPA+ and/or C. perfringens 16S rRNA+) in the obtained fecal sample by PCR (e.g., RT-qPCR) comprising use of an ETX-targeting primer pair comprising, consisting essentially of, or consisting of sequences: 5'-CATACTGTGGGAACTTCGATACA-3' and 5'- TCTTGTGAAGGGACATTATGAGTAA-3', or sequences 5’-ACTCATACTGTGGGAACTTCGA-3’ and 5’-ACTCATCTCCCATAACTGCACT-3’, and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of sequence AGCAACTGCTAAGTTTACTGTTCCT; and (i) CPA-targeting primer pair comprising, consisting essentially of, or} c_{onsisting of sequences: 5'- GCATGAGTCATAGTTGGGATGA-3' and 5'- CTGATGGATCATTACCCTCTGATAC -3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of sequence TGGGACTATGCAGCAAAGGTAACTTTAGC, and/or (ii) universal 16S rRNA primers comprising, consisting essentially of, or consisting of sequences 5'-GCGAGACTGCCGGTAATAAA -3', and 5'- TCGTTGTACCAGCCATTGTAG -3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of sequence CCCTTATGACCTGGGCTACACACG. In some embodiments, the CPA gene is used for comparison in detection of relative abundance of ETX gene. In some embodiments, the 16S rRNA gene is used for comparison in detection of relative abundance of ETX gene. FH11871214.1} ^{7 Attorney Docket No.: CUW-02625 In some embodiments of the invention, the methods based on the fecal sample ETX detection further comprise (c) obtaining a blood sample from the human subject; and (d) detecting, in the obtained blood sample, by flow cytometry, the presence and/or abundance of epsilon toxin (ETX) bound to lymphocytes, optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein the detecting by flow cytometry comprises isolating lymphocytes, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the fluorescently labeled anti-ETX antibody bound to lymphocytes; and optionally only if the presence and/or abundance of epsilon toxin (ETX) bound to lymphocytes is detected in the human subject (optionally if more than 0.1%, 0.2%, 0.5% or 1% of the lymphocytes are positive for ETX), proceeding to the performing and/or administering steps. In some embodiments, the performing and/or administering steps are performed if more than 0.2% of the lymphocytes are positive for ETX. In some embodiments, the performing and/or administering steps are performed if more than 0.5% of the lymphocytes are positive for ETX. Aspects of the invention provided herein include methods for confirmatory diagnosis of multiple sclerosis (MS), prognosis of MS, monitoring the progression of} _{MS, monitoring responsiveness to treatment of MS, prevention of MS, and/or treatment of MS in a human subject at risk for or suffering from multiple sclerosis (MS) comprising (a) obtaining a blood sample from the human subject; (b) detecting, in the obtained blood sample, by flow cytometry, the presence of epsilon toxin (ETX) bound to a lymphocyte, optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein the detecting comprises isolating lymphocytes from the blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the presence, and optionally percent, of lymphocytes positive for ETX; and if the presence of ETX bound to a lymphocyte is detected, optionally wherein more than 0.1%, 0.2%, 0.5% or 1% of the lymphocytes are positive for ETX: (i) performing a standard-of-care MS evaluation of the human subject, (ii) administering to the human subject a standard-of-care MS therapy, and/or (iii) administering to the human subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains; and if the presence of ETX bound to a lymphocyte is not detected or substantially not detected, or wherein less than 0.1% or 0.2% of the lymphocytes are positive for ETX: (i) not performing a standard-of-care MS FH11871214.1} ^{8 Attorney Docket No.: CUW-02625 evaluation of the human subject, (ii) not administering to the subject an MS therapy, and/or (iii) not administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. In some of these embodiments, the invention provides a method for confirmatory diagnosis of MS. In some of these embodiments, the invention provides a method for prognosis of MS. In some of these embodiments, the invention provides a method for monitoring the progression of MS. In some of these embodiments, the invention provides a method for monitoring responsiveness to treatment of MS. In some of these embodiments, the invention provides a method for prevention of MS. In some of these embodiments, the invention provides a method for treatment of MS. In some of these embodiments, the invention further provides a method for reducing at least one symptom of MS. In some of these embodiments, the invention further provides a method for reducing the severity of MS. In some of these embodiments, the invention further provides a method for preventing the progression of MS. In some embodiments, the performing and/or administering steps are performed if more than 0.2% of the lymphocytes are positive for ETX. In some} _{embodiments, the performing and/or administering steps are performed if more than 0.5% of the lymphocytes are positive for ETX. In some aspects, provided herein are methods for detection of epsilon toxin in the blood of a subject comprising (a) obtaining a blood sample from the subject; (b) detecting, in the obtained blood sample, by flow cytometry, the presence of epsilon toxin (ETX) bound to a lymphocyte, optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein the detecting comprises isolating lymphocytes from the blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the presence, and optionally percent, of lymphocytes positive for ETX. In some embodiments, the subject is a human subject at risk for or suffering from multiple sclerosis (MS), and if the ETX bound to a lymphocyte is detected, optionally wherein more than 0.1%, 0.2%, 0.5% or 1% of the lymphocytes are positive for ETX: (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to the subject a standard-of-care MS therapy, and/or (iii) administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C.} ^{perfringens strains. In some embodiments, the performing and/or administering steps are} _{performed if more than 0.2% of the lymphocytes are positive for ETX. In some FH11871214.1} ^{9 Attorney Docket No.: CUW-02625 embodiments, the performing and/or administering steps are performed if more than 0.5% of the lymphocytes are positive for ETX. In some embodiments, the method further comprises a step of selecting the subject for treatment with standard-of-care MS therapy, wherein the subject is at risk for, or suffering from MS, and wherein the subject is selected for treatment wherein the relative abundance of ETX-harboring strains of C. perfringens is detected if the percentage of ETX-harboring C. perfringens strains is greater than 0.001%. In some embodiments, the methods of blood sample ETX detection further comprise (c) obtaining a fecal sample from the human subject; and (d) detecting, in the obtained fecal sample, by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin (ETX) gene-harboring C. perfringens strains relative to the abundance of non-ETX strains of C. perfringens in the human subject; and optionally only if the abundance of ETX-harboring C. perfringens strains in the human subject is above the median level for a healthy subject, or wherein the relative abundance of ETX- harboring strains of C. perfringens in the human subject is greater than 0.001%, 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%, proceeding to the} _{performing and/or administering steps. In some embodiments, before the obtaining of a sample step (such as before step (a)), the human subject is selected, wherein the human subject has MS or has one or more symptoms of MS. In some embodiments, it is contemplated that any of the methods provided herein are performed on a subject that has been diagnosed with MS. In some embodiments, it is contemplated that any of the methods provided herein are performed on a subject that displays one, two, three or more symptoms of MS. In some embodiments, it is contemplated that any of the methods provided herein are performed on a subject that has relapsed MS or is at risk of relapse or progression of MS. In other embodiments, it is contemplated that any of the methods provided herein are performed on a subject that is at risk of MS. In some embodiments, if the abundance of ETX-harboring C. perfringens strains is above the median level for a healthy subject and/or if the presence of ETX bound to a lymphocyte is detected, administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains, thereby treating MS, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and/or preventing the progression of MS in the human subject. FH11871214.1} ^{10 Attorney Docket No.: CUW-02625 In some aspects of the invention, provided herein are methods for treating multiple sclerosis (MS), reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and/or preventing the progression of MS, in a human subject, the method comprising: (a)} _{selecting a subject for treatment, wherein the subject is at risk for, or suffering from MS, and wherein the subject is selected for treatment wherein the relative abundance of ETX- harboring strains of C. perfringens is detected if the percentage of ETX-harboring C.} ^{perfringens strains is greater than 0.001%, (b) administering to the subject a standard-of- care MS therapy, and/or administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains, thereby treating MS, reducing at least one symptom of MS, reducing the severity of MS, preventing} _{MS, and/or preventing the progression of MS in the human subject. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens is detected by: (a) obtaining a fecal sample from the human subject; (b) detecting, in the obtained fecal sample, by Polymerase Chain Reaction (PCR), optionally Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin gene (ETX)-harboring strains of C.} ^{perfringens relative to the abundance of non-ETX strains of C. perfringens. In some embodiments, the relative abundance of ETX-harboring strains of C. perfringens is detected by (a) obtaining a blood sample from the subject; (b) detecting, in the obtained blood sample, by flow cytometry, the presence of epsilon toxin (ETX) bound to a lymphocyte, optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein the detecting comprises isolating lymphocytes from the blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the presence, and optionally percent, of lymphocytes} _{positive for ETX. In some of these embodiments, the invention provides a method for treating MS. In some of these embodiments, the invention provides a method for reducing at least one symptom of MS. In some of these embodiments, the invention provides a method for reducing the severity of MS. In some of these embodiments, the invention provides a method for preventing MS. In some of these embodiments, the invention provides a method for preventing the progression of MS. In some embodiments, the standard-of-care MS evaluation comprises magnetic resonance imaging (MRI), evoked potentials tests, cerebral spinal fluid analysis, motor skills assessments, and/or blood tests. FH11871214.1} ^{11 Attorney Docket No.: CUW-02625 In some embodiments, administering to the subject a standard-of-care MS therapy comprises administering any one or more of the following therapies: (i) an injectible medication, wherein the injectable medication is interferon beta-1a, interferon beta-1b, glatiramer acetate, ofatumumab, or peginterferon beta-1a; (ii) an oral medication, wherein the oral medication is teriflunomide, monomethyl fumarate, dimethyl fumarate, fingolimod, cladribine, Siponimod, ponesimod, fingolimod, diroximel fumarate, or ozanimod; (iii) an infused medication, wherein the infused medication is ublituximab, alemtuzumab, mitoxantrone, ocrelizumab, natalizumab-sztn, or natalizumab; and (iv) rituximab or glucocorticoids. In some embodiments, administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains comprises administering to the subject a composition comprising an effective amount of an agent that directly or indirectly interferes with ETX. In some embodiments, the agent that directly or indirectly interferes with ETX is an inhibitor of ETX. In some embodiments, said inhibitor is an antibody against ETX or an antigen binding fragment thereof. In some embodiments, said antibody against ETX or an antigen binding fragment thereof: (a) prevents ETX pore formation, (b) prevents cell cytotoxicity, (c) clears ETX from circulation, (d) targets ETX for phagocytosis or antibody-} _{dependent cellular phagocytosis (ADCP), (e) neutralizes ETX, inhibits ETX binding to ETX- binding receptor, and/or (f) inhibits or prevents oligomerization of ETX. In some embodiments, said antibody against ETX or an antigen binding fragment thereof: neutralizes ETX, inhibits ETX binding to ETX-binding receptor, and/or inhibits or prevents oligomerization of ETX. In some embodiments, said antibody against ETX or an antigen binding fragment thereof: (a) prevents ETX pore formation, (b) prevents cell cytotoxicity, (c) clears ETX from circulation, and/or (d) targets ETX for phagocytosis or antibody-dependent cellular phagocytosis (ADCP). In some embodiments, said antibody or antigen-binding fragment thereof is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, and a recombinant antibody; or an antigen-binding fragment thereof. In some embodiments, said antibody is a monoclonal antibody or an antigen-binding fragment thereof. In some embodiments, said antibody is a human or humanized antibody, or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is a nanobody, a Fab fragment, a F(ab′)2 fragment, a Fd fragment, an Fv fragment, a dAb fragment, a single chain antibody, a single domain antibody, a VHH, a maxibody, a minibody, an intrabody, a diabody, a triabody, a tetrabody, an v-NAR or a bis-scFv. In some FH11871214.1} ^{12 Attorney Docket No.: CUW-02625 embodiments, the antigen-binding fragment thereof is a nanobody. In some embodiments, the antigen-binding fragment thereof is an scFv. In some embodiments, the antigen-binding fragment thereof is a Fab fragment, a F(ab′)2 fragment, a Fd fragment, an Fv fragment, an adAb fragment, or a VHH. In some embodiments, the agent that directly or indirectly interferes with ETX is an inhibitor or antagonist of an ETX- binding receptor. In some embodiments, the ETX-binding receptor is expressed on endothelial cells of blood brain barrier (BBB). In some embodiments, said ETX-binding receptor is a tetraspan integral membrane receptor, wherein the tetraspan integral membrane receptor is myelin- and-lymphocyte protein (MAL) or Hepatitis A Virus Cellular Receptor 1 (HAVcR1). In some embodiments, said agent is a soluble ETX-binding receptor protein, wherein the soluble ETX-binding receptor protein is soluble HAVcR1, a soluble MAL, or a fragment thereof. In some embodiments, the agent that directly or indirectly interferes with ETX is a phage lytic enzyme specific for Clostridium perfringens Type B or D bacterial strain. In some embodiments, said phage lytic enzyme is a muramidase derived from strain ATCC 13124 (PlyCM). In some embodiments, said agent is a probiotic strain expressing a phage lytic enzyme} _{specific for Clostridium perfringens Type B and/or D bacterial strain. In some embodiments, the agent that directly or indirectly interferes with ETX is a vaccine against Clostridium perfringens type B and/or type D, or the ETX produced therefrom. In some embodiments, the agent that directly or indirectly interferes with ETX is a probiotic supplement comprising C. peifringens type A or other bacteria type that can effectively outcompete Clostridium perfringens type B and/or D. In some embodiments, the agent that directly or indirectly interferes with ETX is an antibiotic sufficient to kill C. perfringens type B and/or D. In certain aspects, provided herein are compositions for preventing or treating multiple sclerosis (MS) in a patient in need thereof comprising a pharmaceutically acceptable excipient and an effective amount of an agent disclosed herein, optionally wherein the composition is for preventing or treating MS after the detecting disclosed herein. In some embodiments of any of the methods provided herein, PCR used is quantitative PCR. In some embodiments of any of the methods provided herein, the subject is a human subject suffering from or diagnosed with MS. In some embodiments, the subject FH11871214.1} ^{13 Attorney Docket No.: CUW-02625 is a human subject having one, two, three or more symptoms of MS. In some embodiments, the subject is suspected of having MS (e.g., based on preliminary evaluation or presence of one or more symptoms). In other embodiments, the subject is a human subject at risk of MS. In some embodiments, the subject is a human subject whose MS has relapsed or at risk of relapse or progression. In other aspects of the invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of epsilon toxin (ETX) gene-harboring strains of C. perfringens, or abundance thereof, comprising at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'- CATACTGTGGGAACTTCGATACA-3' and/or 5'- TCTTGTGAAGGGACATTATGAGTAA-3'. In another aspect of the invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of epsilon toxin (ETX) gene-harboring strains of C. perfringens, or abundance thereof, comprising at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5’- ACTCATACTGTGGGAACTTCGA-3’ and/or 5’-ACTCATCTCCCATAACTGCACT-3’.} I_{n some embodiments, the compositions or kits provided herein further comprise a fluorogenic probe comprising, consisting essentially of, or consisting of sequence AGCAACTGCTAAGTTTACTGTTCCT. In yet another aspect of the invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of CPA-harboring C. perfringens strains, or abundance thereof, comprising at least one CPA-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'- CTTGGAGAGGCTATGCACTATTT-3' and/or 5'-TTGCAACCTGCTGTGTTTATTT- 3'. In some embodiments, the compositions or kits provided herein further comprise a fluorogenic probe comprising, consisting essentially of, or consisting of sequence TTACTGCCGTTGATAGCGCAGGAC. In further aspects of the invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of C. perfringens-specific 16S rRNA, or abundance thereof, comprising at least one C. perfringens-specific 16S rRNA primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'- AGATGGCATCATCATTCAAC-3' and/or 5'- GCAAGGGATGTCAAGTGT-3'. FH11871214.1} ^{14 Attorney Docket No.: CUW-02625 In some embodiments, the compositions or kits provided herein further comprise a fluorogenic probe comprising, consisting essentially of, or consisting of sequence AGAGTGCAGGAGAGGAGAGTGGAA. In some aspects of the invention, provided herein are compositions or kits for PCR (e.g., RT-qPCR) detection of relative abundance of epsilon toxin (ETX) gene-harboring strains of C. perfringens comprising an ETX-targeting primer pair comprising, consisting essentially of, or consisting of sequences: 5'-CATACTGTGGGAACTTCGATACA-3' and 5'- TCTTGTGAAGGGACATTATGAGTAA-3', or sequences 5’-ACTCATACTGTGGGAACTTCGA-3’ and 5’-ACTCATCTCCCATAACTGCACT-3’, and optionally comprising a fluorogenic probe comprising, consisting essentially of, or consisting of sequence: AGCAACTGCTAAGTTTACTGTTCCT; and (i) CPA-targeting primer pair comprising, consisting essentially of, or consisting of sequences: 5'- GCATGAGTCATAGTTGGGATGA-3' and 5'- CTGATGGATCATTACCCTCTGATAC-3', and optionally comprising a fluorogenic} p_{robe comprising, consisting essentially of, or consisting of sequence TGGGACTATGCAGCAAAGGTAACTTTAGC, and/or (ii) universal 16S rRNA primers comprising, consisting essentially of, or consisting of sequences 5'-GCGAGACTGCCGGTAATAAA-3', and 5'- TCGTTGTACCAGCCATTGTAG-3', and optionally comprising a fluorogenic probe comprising, consisting essentially of, or consisting of sequence CCCTTATGACCTGGGCTACACACG. In some embodiments of the compositions and kits provided herein, it is the composition (and not a kit). In some embodiments, any of the compositions (for PCR detection) described herein may further comprise one or more components necessary for the PCR (e.g., RT-qPCR) reaction to proceed. Such components can be any components known in the art for this purpose, or described herein. In some embodiments of the compositions and kits provided herein, it is the kit. In some embodiments, any of the kits (for PCR detection) described herein may comprise the specified components (such as primers and probes) in one or more containers, together (e.g., mixed together) or separately (comprised FH11871214.1} ^{15 Attorney Docket No.: CUW-02625 in separate containers, e.g., each individual primer in a separate container, and/or each probe} _{in a separate container), and may further comprise instructions for use.} BRIEF DESCRIPTION OF THE DRAWINGS ^{Figures 1A-1D show the prevalence of etx in the gut microbiome of people with MS and Healthy Controls. (A) Workflow of the experimental setup. Fecal bacteria were purified by density gradient} _{centrifugation in a Nycodenz solution. (B) Initial screen by PCR targeting the 3'-terminal sequence of} ^{etx (542 bp and 390 bp (not shown)) detected more frequent presence of etx in people with MS compared to HC. (C) Subsequent PCRs targeting the 5'-terminal sequence of etx (679 bp) confirmed the initial detection results. Detection of C. perfringens-specific 16S rRNA and the chromosomally located alpha toxin (cpa/plc) gene present in all C. perfringens strains corroborates the source of the etx gene. Participant labels in red indicate negatives for etx from the initial screen (B), which served as negative controls in the confirmatory assays. Reference strains including C. perfringens type B (ATCC3626), type D (FD203), and type F (ATCC12915) were included as additional controls. C. perfringens type B and D are etx-harboring strains and type F is negative for etx. (D) Statistical analysis of etx frequency by Fisher's exact test. Figures 2A-2I show etx abundance and etx-harboring strains increase in the fecal microbiota of MS. (A-B) Representative amplification plots (A) and statistical analysis of etx abundance} _{(B) by TaqMan real-time PCR analysis. Of note, the system detected 15 etx-positive MS, fewer than what was detected by standard PCR (19). (C-E) Analysis of cpa abundance by TaqMan real-time PCR shows cpa gene increases in MS. (F) Multiplex PCR reveals different composition of strains in the fecal C. perfringens community from etx-positive participants. Lab strains include etx-negative type A and another three strains shown in Figure 1. Orange asterisks indicate the presence of C. perfringens type E, defined by the presence of cpa and itx. Blue asterisks indicate cpb, which encodes beta toxin — a virulence determinant for C. perfringens type C and is also carried by C. perfringens type B. (G-I) Analysis of etx/cpa ratio by TaqMan real-time PCR using the C. perfringens type B (ATCC3626) and type D (FD203) strains as a calibrator for the quantification of etx- harboring/non-etx strain ratios in the fecal microbiota from etx-positive participants. Quantification of the ratio of etx/cpa by 2-Act (g), etx/cpa against type D culture as calibrator by 2-ΔΔct (H). Estimate of maximum of percentages of etx-harboring/non-etx strain in etx+ FH11871214.1} ^{16 Attorney Docket No.: CUW-02625} HC and MS (I). The estimates assume participants with 2^-ΔΔct above 1 (type D) contains 100% ^{etx-harboring strains. Mann-Whitney test (non-Gaussian distribution). Black lines in graphs B, C-E, and H indicate medians.} _{Figures 3A-3E show the characterization of patient derived strain SHDS0050 and its comparison to environmental and laboratory ETX-producing strains. (A) The circular map of} ^{etx+ plasmid (pSHDS0050) from a MS patient-derived SHDS0050 strain is shown with a black backbone. Hypothetical and proteins of unknown function ORFs are colored black, those involved in conjugation are purple, toxin ORFs are red, DNA methylases are green, transposases and recombinases are gray, ribonucleases are pink, plasmid replication ORFs are blue, conserved etx plasmid ORFs are red, and ABC transporters are magenta (reproduced herein in grayscale). The plasmid shows two transposases, a Tn3 and IS1151 upstream of etx, followed by two IS256 and a mutator transposase downstream. (B) GView BLAST Atlas map comparing the circular chromosomes of pSHDS0050 as the reference genome, to the type D strains CN3842, FU17, and NCTC8346, and the type B strains ATCC3626 and NCTC3110. Type D chromosomes are shades of blue, while type B are shades of red. Colored in regions for each genome show where there is a BLAST hit to the reference genome. Empty slots in the query genomes show where there are no matching BLAST hits to the reference genome, indicating unique regions in the} _{reference genome. This indicates that the SHDS0050 genome has distinct regions from the other etx-encoding strains. (C) Linearized plasmid map comparisons comparing pSHDS0050 with the etx plasmids of two type D collection strains pFU17etx and pNCTC8346etx and two type B strains pATCC3626etx and pNCTC3110etx. The linearized maps are color coordinated in the same manner as A, with different transposase ORFs having different pattern fillings. The three type D strains share the same gene content and share many of the same genes with both type B strains, however, the type B strains are larger and have genes not present in their type D counterparts. (D) Western blot analysis for proETX (pETX) production from C. perfringens strains grown overnight in TGY broth. 10ng pETX spiked into PBS or broth were used as positive controls. Broth only was used as a negative control. (E) Susceptibility of CHO cells expressing human MAL (hMAL-CHO) or GFP control (GFP-CHO) to ETX produced by C. perfringens strains. To activate ETX, harvested broth was activated with trypsin. To determine if cell death was ETX mediated, activated broth was pretreated with a FH11871214.1} ^{17 Attorney Docket No.: CUW-02625 neutralizing anti-ETX antibody (.1004). Broth alone was used as a negative control. Cell death was determined by PI staining. n = 3. p < 0.0001 determined by two-way ANOVA with Sidak's multiple comparisons test. Figures 4A-4C show the comparison of ETX- and PTX-EAE in the spinal cord using the classical scoring scale. (A) Classical EAE score time-course of mice from indicated experimental groups. Pertussis toxin (PTX, 5µg/kg b.w,), ETX at 50 ng/kg b.w.(low, Lo) or 500 ng/kg b.w.(high, Hi) was injected intraperitoneally on day 0 and day 1 following CFA/M0G35_55 immunization. (B) ETX- EAE mice exhibit demyelination in the spinal cord in a pattern similar to that of PTX-EAE model. Mice immunized with CFA/PBS or CFA/M0G35_55 followed with two injections of 5 µg/kg bw PTX (top row) or 500 ng/kg bw ETX (bottom row) on day 0 and day 1, then sacrificed at day 30. Shown on the left panel are representative slides from the lumbar spinal cord stained with Luxol Fast Blue (LFB) for myelin visualization. Both PTX and ETX induce limited focal demyelination in the dorsal column (red circles) and severe diffusive demyelination in lateral and ventral funiculus (arrow heads). Dashed red lines demarcate the border of lesions in ventral white matter (WM) tracts. Quantification (middle panel) of LFB intensity within WM reveals a similar degree of demyelination in both ETX} _{and PTX models. Right panels are representative binary images generated by applying a same threshold across all treatment groups that were used for quantification. Myelin integrity is defined by the ratio of LFB-stained area within the WM (pixel with thresholding) over the total area of the WM (pixel without thresholding) as a percentage. (C) Thin section electron microscopy shows demyelination and decompaction of myelin sheath in ETX-EAE mice. Mice immunized with CFA/PBS or CFA/M0G35_55 followed with ETX injections. Shown are representative 75 nm-thick sections taken from the ventral funiculus of lumbar spinal cord. Red asterisks indicate demyelinated axons. Regions framed with yellow rectangles illustrate ultrastructural changes of myelin sheath at a high magnification. Cyan arrowhead points to a myelin sheath segment in decompaction; yellows arrowheads point to splitting myelin sheath and debris; a red arrow points to expanded space between an axon (A in blue) and myelin sheath. Quantification of the number of unmyelinated axons per unit area (middle panel) and the percentage of unmyelinated axons with each field (right panel). Data in A, the left panel, are means ± SEM; data in in A, the right panels, and in B represent median ± range; Kruscal-Wallis test (non-parametric); ns, not significant; n = 4 mice for controls (PBS>PTX; PBS>ETX-Hi), n = 6 mice for MOG>EAE-Lo, and n = 8 mice for FH11871214.1} ^{18 Attorney Docket No.: CUW-02625 groups including MOG>PTX and MOG>ETX-Hi. Data in C represent mean ± SD; unpaired t-test; *** p < 0.001; n = 24 fields from 2 mice. Scale bars, 1 mm in B, 500 nm (top panels) and 200 nm (lower panels) in C. Similar results were achieved in two independently repeated experiments. Figures 5A-5C show ETX-EAE is characterized by multifocal demyelination in the CNS. (A) ETX-EAE mice developed atypical EAE, which is characterized by ataxia, along with classical EAE symptoms defined by ascending paralysis. (B) ETX targets broader brain regions compared to PTX. ETX-EAE mice (left column) exhibit significantly more focal demyelinating lesions (arrowheads and red dashed circles) in the cerebellum (top row) and corpus callosum (cc, lower row) within WM tracts when compared to PTX-EAE mice (right column). Asterisk indicates cc. Black arrows indicate borders of a cc lesion, which is also framed with a red dashed rectangle). A corresponding location in PTX- EAE mice (right column) is indicated by white arrows. (C) Quantification of lesions in the cerebellum and corpus collosum. Data in A are means ± SEM, and data in C represent median ± range; Kruscal-Wallis test (non-parametric). n = 4 mice for controls (PBS>PTX; PBS>ETX-Hi), n = 6 mice for MOG>ETX-Lo, and n = 8 mice for groups including MOG>PTX and} _{MOG>ETX-Hi. ns, not significant. Scale bars, 1 mm in B and 100 p.m in the inserts. Similar results were achieved in two independently repeated experiments. Figures 6A-6F show ETX-EAE mice show increased CD4+ lymphocyte infiltration in the cerebellum and thalamus compared to PTX-EAE. Sections from mice sacrificed at day 30 post- immunization with CFA/M0G35_55 and followed by either ETX or PTX were immunostained with anti-CD4 antibody. (A-C) are representative micrographs of CD4 staining in the CNS. The majority of CD4+ cells were found in the spinal cord (A) and to a much lesser degree, in brain regions including cerebellum (B) and thalamus (C). In the spinal cord (A), CD4+ cells are localized to the white matter (arrowheads). In the cerebellum (B) of ETX-EAE mice, markedly stained CD4+ cells are frequently found in prominent perivascular cuffs and surrounding parenchyma (area 1), indicative of active infiltration. By contrast, CD4+ cells from the cerebellum of PTX-EAE mice are either localized to perivascular space (area 1') or in a scattered manner (area 2'). A high magnification micrograph (1-s1) shows membrane localization of CD4 (brown stain, black arrow). CD4+ cells are also found in the white matter of the thalamus (C), including optic tracts (1, 1'), medial lemniscus (2, 2'), and posterior FH11871214.1} ^{19 Attorney Docket No.: CUW-02625 commissure (3, 3') in ETX-EAE but not PTX-EAE mice (1'-3') except optic tracts. In each panel, boxed regions are shown at higher magnifications below corresponding images. Sections were counter stained with hematoxylin to reveal cell I nuclei and overall morphology. (D) Image J-generated binary drawings on CD4+ distribution (black dots) in the white matter (WM) of spinal cord (SC, orange arrows)) and cerebellum (Ceb). Orange arrowheads in Ceb point to CD4+ cells that appear to be confined to a single layer in the meninges (area 1). Area 2 shows perivascular localization of CD4+ cells in the Ceb. GM, grey matter. Scale bars, 1 mm (A and B, top rows), 2 mm (C, top row), 200 p.m (A and C, bottom rows; B, middle row), 500 p.m (D, left column), 100 p.m (D, right column), 50 p.m (B, bottom left panel). (E and F) Statistical analysis of total CD4+ cell counts (E) and CD4+ perivascular cuffs in the three CNS regions. Data represent median ± range; Kruscal-Wallis test (non-parametric). ns, not significant. n = 4 and 8 mice for controls (Control: CFA/PBS>PTX; ETX: CFA/PBS>ETX-Hi) and EAE groups (PTX-EAE: CFA/MOG>PTX; ETX-EAE: CFA/MOG/ETX-Hi), respectively. Figures 7A-7E show ETX-EAE mice show increased CD68+ microglia in the cerebellum of ETX-EAE mice compared to PTX-EAE mice, despite similar activation in the spina cord and a} _{comparable profile of transcription factor NJFKB p65 in both models. (A) Representative sections from mice sacrificed at day 30 post-immunization with CFA/M0G35_55 and followed by either ETX or PTX were immunostained with anti-CD68 antibody or anti-phospho-NFB p65 (Ser 276). A rectangle-framed region in each condition in panel A is shown at a higher magnification beneath the corresponding section. Ceb, cerebellum; SC, spinal cord. Scale bars represent 500 and 50 p.m for the spinal cord and 1 mm and 20 p.m for the cerebellum at low- magnification and high magnification, respectively. (B-E) Statistical analysis of staining intensity for CD 68 (A and B) and phosphor-NFKB p65 (D and E) in the spina cord (B and D) and cerebellum (C and E), respectively. Data represent median ± range; Kruscal-Wallis test (non-parametric). ns, not significant. n = 4 and 8 mice for controls (Control: CFA/PBS>PTX; ETX: CFA/PBS>ETX-Hi) and EAE groups (PTX-EAE: CFA/MOG>PTX; ETX-EAE: CFA/MOG/ETX-Hi), respectively. Figures 8A-G show transcriptome analysis of ETX and PTX treated CNS endothelial cells from spinal cord. (A) Principal-component (PC) analysis of RNA-seq data, based on the top 1000 most variable genes. Each symbol represents a biological replicate, and each component is indicated with the amount of variation that it explains. (B) Venn diagram showing extent of overlap FH11871214.1} ^{20 Attorney Docket No.: CUW-02625 between genes differentially expressed in ETX or PTX treated samples relative to control (PBS). (C) Correlation analysis of log2 fold-changes between genes that change in both ETX and PTX displayed as a scatterplot, R2 = 0.96. (D) Heat map of DEGs of interest relevant to immune privilege (FDR < 0.10) in ETX or PTX. (E) Heat map of DEGs induced by ETX and/or PTX reported by Munji (101) in a BBB dysfunction module. (F) Heat map of all DEGs by ETX and/or PTX relative to PBS control. (G) Selected pathways predicted to be activated in ETX treated cells by Ingenuity Pathway Analysis (p < 0.05 and z-score >= 1) based on the differentially expressed genes compared to PBS cells. Figures 9A and 9B show the geographic location of participants in HITMS. Participants geographic locations were mapped using their home zip codes at the time of fecal sample donation. Individual participants are shown in red for MS (A), and purple for HC (B). The majority of} _{participants in both groups, MS and HC, were from the New York metropolitan area. Each group had one participant from the Washington DC metropolitan area. The MS group had one participant from Ithaca (not shown). Maps were created using mapline. Figures 10A-10D show cpa incidence is increased in MS. (A) PCR detection of cpa/plc (402 bp) from healthy control (HC) and MS. (B) Distribution of HC and MS subjects according to etx/cpa presence (+) and absence (-). (C-D) Statistical analysis of cpa incidence in the overall cohorts (c) and etx+/etx- subgroups (d) of HC and MS. Fisher's exact test. Figures 11A-11D show C. perfringens abundance is increased in MS. (A) TaqMan real-time PCR analysis of C. perfringens abundance by simultaneously detecting C. perfringens-specific and universal 16s rRNA genes in healthy control and MS. (B-D) Quantification of the percentage of C.} ^{perfringens over total fecal bacteria from the overall cohorts (B), or etx+ (C), and etx- (D) subgroups from HC and MS. The vertical line in b depicts the published range of C. perfringens percentage in human fecal microbiota. Mann-Whitney test (non-Gaussian distribution).} _{Figures 12A-12D show Analysis of etx abundance and composition of etx-harboring strains over C. perfringens communities from etx+ healthy control (HC) and MS participants. (A) Representative amplification plots of simultaneous detection of etx and C. perfringens (CP)- specific 16S rRNA by TaqMan real-time PCR. Mann-Whitney test (non-Gaussian distribution). FH11871214.1} ^{21 Attorney Docket No.: CUW-02625 Black lines in c indicate medians. (B) etx abundance normalized to C. perfringens (CP)-specific 16s rRNA. (C) Quantification of normalized etx abundance over type D strain culture. (D). Figures 13A-13D show etx isolated from humans carries predominantly a minor SNP variant in the receptor binding domain that results in a synonymous mutation. Reference sequences were from organisms isolated from ruminant animals with one notable exception — a recently annotated sequence from whole genome sequencing of human fecal samples (Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; [1988]. Accession No. NZ CABPRN010000010.1). Analysis identified 6 SNP sites in the etx CDS. Among the 6} _{SNPs, 4 are located in the signal peptide, which is removed upon export of the protoxin (proETX), and one is located to the C-terminal, which is removed upon activation via proteolytic cleavage (A) Single nucleotide variants (SNV/SNP) in the coding sequence (CDS) of the etx gene. Shaded line indicates the least conserved mutation among 6 SNPs. (B) The scheme shows location of mutations and key features of ETX, with numbers above indicating nucleotide position (referring to CDS) and numbers below indicating to amino acid residuals. Of note, five SNPs, including four mutations in the signal peptide and one mutation in the C-terminal, are removed from the activated toxin (ETX). (C) Alignment of etx reference sequences with complete CDS shows the region (nt 745-777) in which site 762 is centered. Of note, the only} ^{etx sequence isolated from a human source (fecal samples) carries a minor variant at 762 (G). Names of the reference sequences are organized as such: gene name, GeneBank#/NCBI Reference#, toxinotype of C. perfringens form which etx was sequenced, and followed by animal from which the organism was isolated. (D) Alignment of sequences of PCR products from HITMS samples, with the nucleotide corresponding to 762 at the center. PCR products from two reference strains were also included in the sequencing and alignment analysis. Of note, two PCR products yielded short sequences, which were sufficient for confirming etx homology} _{but failed to cover site 762, were excluded from the alignment analysis. HC, healthy control. Figures 14A-14G show ascending paralysis and ataxia behaviors are better correlated in ETX- mice than PTX-mice. Clinical behaviors of classical (A and B) and atypical (C and D) EAE. Shown are time-course (A and C) and quantification of accumulative scores (B and D). Of note, atypical EAE (C and D) was not scored after day 21. As mice experienced ascending paralysis (A and B), it became from increasingly inaccurate and uncertain to assess ataxia, the hallmark of atypical EAE. Thus, the end point of atypical EAE assessment in this experiment FH11871214.1} ^{22 Attorney Docket No.: CUW-02625 was set at day 21. Thick lines in time-course graphs (A and C) indicate mean scores of all mice within the indicated groups (PBSmean; PTXmean; ETXmean) at each daily observing time points. Thin lines depict individual mouse (PBS1-6; PTX1-12; ETX1-12). Note that one mouse from the control group, which received MOG35-55 in CFA but not subsequent injections of either toxin, developed mild EAE. Data in B and D are median ± range; Kruscal-Wallis test (non-parametric). ns, not significant; **** p<0.0001. n = 6 and 12 mice for the control (CFA/MOG>PBS) and experimental groups (CFA/MOG>PTX; CFA/MOG>ETX), respectively. (E and F) Analysis on correlation between classical EAE and atypical EAE behaviors in PTX-EAE mice (E, CFA/MOG>PTX) and ETX-EAE mice (F, CFA/MOG>ETX). Data included in E and F were from day 12/13, when at least one type of the clinical phenotypes (classical or/and atypical EAE) initiated, to day 21, when assessment of atypical EAE ended. Spearman correlation analysis; PTX-EAE, r (108) = 0.6463, p < 0.0001; ETX-EAE, r (120) = 0.7019, p < 0.0001. Orange lines indicate simple linear regression; PTX-EAE, R2 = 0.3147; ETX-EAE, R2 = 0.5352. Note that many scores are overlapping, resulting fewer data visualization, indicated by circles, in E and F. (G) Representative micrographs of Luxol fast blue (LFB)-stained spinal cord (SC) and cerebellum (Ceb) from all three groups of mice. Orange lines in SC micrographs indicate the edge of spinal cord and the border between gray} _{matter (GM) and white matter (WM). Arrows in SC point to demyelinating area in the ventral funiculus. Asterisks in Ceb indicate demyelination in the white matter. Scale bars, 500 p.m. Figures 15A-15E show ETX-EAE model is characterized by perivascular demyelination associated with lymphocyte infiltrates. (A) Representative sections from spinal cords and cerebellum from MOG35_55 immunized mice followed by ETX injections were stained with Luxol fast blue (LFB) and consecutive slides were stained with hematoxylin and eosin (HE). Note that some of the same mice are also shown in Figures 4 and 5 . In the spinal cord micrographs, dashed pink dashed lines in LFB stained sections demarcate demyelination lesion in the ventral WM, while dashed blue lines in HE stained sections indicate areas of infiltrating inflammatory cells. High magnification views boxed low-magnification micrographs showing perivascular lesions (red asterisks) in ventral funiculus (vf) and dorsal column (dc). Arrowheads in vf point to the glia limitans or their basement membranes. An arrow points to perivascular space. The cerebellum shows multiple perivascular demyelinating lesions (red asterisks). Boxed regions showing a lesion are depicted at a higher magnification in below. Black lines in le indicate the border between granular cell layer (GL) and WM. (B and C) Quantification of LFB intensity FH11871214.1} ^{23 Attorney Docket No.: CUW-02625 and lymphocyte density from the same fields within WM areas in the spinal cord (B) and cerebellum (C) shows the two variables are negatively correlated by Pearson's correlation analysis. B, r (96) = - 0.666, p < 0.0001; C, r (149) = - 0.623, p < 0.0001. Best fit curves (orange lines) suggest that LFB signal decays exponentially as the density of lymphocytes increases in the spinal cord WM (B), whereas the two variables are inversely proportional in the cerebellum (C). B, nonlinear regression based on one-phase decay model, R2 = 0.463; C, simple linear regression, R2 = 0.389. Inserts in B and C are binary images generated by thresholding. Inserts: left panel, binary images from hematoxylin-stained sections; right panel, from LFB-stained sections. (D and E) Quantification of lymphocyte density (D) and LFB intensity (E) as a function of radial distance from the center of perivascular lesions in WM tracts in the cerebellum confirms an inverse relationship between myelin content and the number of infiltrating lymphocytes. Arrows point to a distance where the perivascular cuff is located. Insert showing a superimposed image of LFB and HE stains illustrates the scheme for quantification. ML, molecular layer, GL, granular cell layer. Note that ML and GL are excluded from the Figures 16A-16C show a similar number of CD45-positive cells infiltrate lesions in the spinal} _{cord and cerebellum from ETX-EAE and PTX-EAE mice. (A) Representative sections from mice sacrificed at day 30 post-immunization with CFA/M0G35_55 and followed by either ETX or PTX were immunostained with anti-CD45 antibody. Control mice were immunized with CFA/PBS and followed by either ETX or PTX. A rectangle-framed region in each condition in panel A is shown at a higher magnification beneath the corresponding section. Ceb, cerebellum; SC, spinal cord. Scale bars represent 500 and 50 p.m for the spinal cord and 1 mm and 20 p.m for the cerebellum at low-magnification and high magnification, respectively. (B and C) Statistical analysis of staining intensity for CD 45 in the spinal cord (B) and cerebellum (C). Data represent median ± range; Kruscal-Wallis test (non-parametric). ns, not significant = 4 and 8 mice for controls (Control: CFA/PBS>PTX; ETX: CFA/PBS>ETX-Hi) and EAE groups (PTX-EAE: CFA/MOG>PTX; ETX-EAE: CFA/MOG/ETX-Hi), respectively. Figures 17A-17E show ETX-EAE model shows a stronger correlation between demyelination and lymphocyte infiltration than in the PTX-EAE model. (A and B) Shown are micrographs and binary images of spinal cords (A) and cerebella (B) from MOG35_55 immunized mice followed with PTX injections. Note that a perivascular region in the cerebellum (framed with a rectangle) is shown at a higher magnification to illustrate morphologies of infiltrating cells. Binary images FH11871214.1} ^{24 Attorney Docket No.: CUW-02625 were generated by thresholding. Red, LFB stain; blue, hematoxylin stain. GL, granular cell layer; GM, grey matter; WM, white matter. Scale bars, 1 mm (A), 500 [tm (B, lower magnification), 100 [tm (B, higher magnification). (C and D) Quantitative analyses of demyelination and lymphocyte infiltrates in the spinal cord (C) and cerebellum (D). Pearson's correlation analysis reveals a negative correlation between demyelination and lymphocyte infiltrates in both spinal cord (A) and cerebellum (B). C, r (105) = - 0.615, p < .0001; D, r (154) = - 0.406, p < .0001. Best fit curves (orange lines) suggest a much weaker correlation of the two variables in the cerebellum (D) compared to the spinal cord (C). C, nonlinear regression based on one-phase decay model, R2 = 0.395; D, simple linear regression, R2 = 0.165. (E) Slope analyses of myelin intensity versus infiltrating cell density in the spinal cord and cerebellum from ETX-EAE and PTX-EAE mice. Figures 18A-18D show ETX does not alter MOGp-specific CD4 T cell cytokine responses during active EAE immunization. (A-D) Schematic of experiment and analysis of MOGp-specific T cell responses (A). Naive MOGp-specific CD4 T cells (2D2) were pre-transferred into recipient wild- type B6 mice 24 hours prior to induction of active EAE by subcutaneous immunization with} _{complete Freund's adjuvant (CFA) and MOGp35-55, followed by intraperitoneal injection with: PBS, 10 ug/kg pertussis Toxin (PTX), or 500 ng/kg Epsilon toxin (ETX) immediately after immunization and 48 hours later. Clinical scores were tracked until onset of clinical disease in PTX and ETX treated mice (B) and at day 14 post-immunization, single cell suspensions were isolated from indicated tissues and analyzed by flow cytometry for frequency of cytokine producing 2D2 T cells (Thy1.11 at time of takedown (C) or separately re-stimulated ex vivo with MOGp35_55 for 72 hours to determine antigen-recall induced cytokine production (D). Data in B-D are pooled from two independent experiments with similar results (n = 10 mice/group pooled from N = 2). Results are shown as mean ± SD. Statistics are calculated by two-way analysis of variance (ANOVA) with Sidak's multiple comparisons test. Resultant P-values reported as ns (non-significant), *p <0.05, or **p <0.01. Figure 19 shows real-time quantitative PCR (RT-qPCR) analysis of MAL gene expression in primary human lymphocytes. MAL transcripts levels were quantified in cDNAs obtained from isolated populations of CD4+, CD8+, and B cells. Relative MAL expression in isolated CD4+, CD8+, and B cells. B-actin was used as a reference gene. ** p < 0.01 determined by One-way ANOVA with post hoc Tukey HSD Test. Results are expressed as the mean performed in triplicate. FH11871214.1} ^{25 Attorney Docket No.: CUW-02625 Figures 20A-20F show ETX binds to CD4+, CD8+, and CD19+ lymphocytes with a preference for CD4+ cells. PBMNCs were incubated with 0 nM or 50 nM pETX-647 for 2 hours, and binding to CD4+, CD8+, and CD19+ cells was examined by flow cytometry. An example of the gating strategy for examination of CD4+, CD8+, and CD19+ lymphocytes is depicted in Supplementary Figure S2. Representative scatter plots (A) and histogram analysis (B) of pETX-647 fluorescent intensity from three separate donors performed in triplicate. (C) PBMNCs were incubated with 25 nM pETX-647 for indicated time points and binding determined by flow cytometry. Results are expressed as the percent of CD4+, CD8+, or CD19+ cells positive for pETX (% pETX+). Results are the means of three separate donors performed in triplicate. (D) PBMNCs were incubated with 0 nM or 1 nM pETX-647 for 2 h. Results are expressed as the percentages of CD4+, CD8+, or CD19+ cells positive for pETX (% pETX+). Results are the means of two separate donors performed in triplicate. (E) Anti-ETX antibody inhibits binding to CD4+ cells. Media containing 50 nM pETX-647 was pretreated with or without an antibody known to block ETX binding for 30 min before treating PBMNC for 2 h and evaluated by flow cytometry. Percent of pETX+ lymphocytes when cells are incubated without pETX-647 (CT), with pETX-647 (pETX), or pETX- 647 pretreated with anti-ETX antibody (pETX + anti-ETX). (F) PBMNCs were treated with 25} _{nM of unlabeled pETX or ETX for 2 h. Untreated cells were used as controls. pETX and ETX bindings to lymphocytes was determined using an affinity-purified anti-ETX polyclonal rabbit antibody and PE-conjugated anti-rabbit IgG. Results expressed as percent CD4+ lymphocytes positive for ETX or pETX (% Positive). Data points are the mean performed in triplicate. * p < 0.05, ** p < 0.01, determine by One-way ANOVA with post hoc Tukey HSD Test. Figures 21A-21E show ETX bindings to lymphocytes are time and dose dependent. To determine if ETX bindings were dose dependent, PBMNCs were incubated with indicated doses of pETX- 647 for 15 (A) and 120 min (B), and pETX-647 binding was determined by flow cytometry. Results are expressed as percent pETX positive (% pETX+) cells for CD4+, CD8+, and CD19+ cells. * p < 0.05 and ** p < 0.001 compared to untreated controls (0 nM), as determined by One-way ANOVA with post hoc Tukey HSD Test. For a more detailed analysis of p values for all pETX doses, refer to supplementary Table S1. To determine if ETX was time dependent, PBMNCs were incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, or 50 nM pETX-647 for indicated time points (C–E). The percentages of ETX positive cells were determined by flow cytometry for CD4+ cells (C), CD8+ cells (D), and CD19+ cells (E). * p < 0.01 and ** p < 0.001 were determined by One-way ANOVA FH11871214.1} ^{26 Attorney Docket No.: CUW-02625 with post hoc Tukey HSD Test. All results are the mean results of three donors performed in triplicate. Figures 22A-22G show active ETX kills human CD4+ cells in a dose- and time-dependent manner. PI inclusion was used to evaluate cell viability via flow cytometry. PI positive cells are considered dead. Results are expressed as the number of PI positive cells out of the total specific population and expressed as percent cell death (% cell death). (A,B) Representative scatter plots of total lymphocytes stained with PI to evaluate cell death after treatment with 0 nM (A) or 50 nM (B) ETX for 4 h. (C) Total lymphocyte cell death after four hours of incubation with indicated ETX doses. (D) Media containing 50 nM ETX were pretreated with or without a neutralizing anti-ETX antibody for 30 min before treating lymphocytes for 2 h. Cell death was evaluated by PI inclusion via flow cytometry. Percent cell death when lymphocytes are treated in media alone (CT), media containing 50 nM ETX (ETX), media pretreated with anti-ETX antibody (CT + anti-ETX), and media containing 50 nM ETX pretreated with anti-ETX antibody (ETX + anti-ETX). (E) Percent cell death of different lymphocyte subsets at indicated ETX doses after 4 hours of treatment. (F) Cell death was evaluated in CD4+ cells after four hours of treatment at indicated ETX doses. These} _{data are the same data depicted in Figure 4E with different statistical analyses. ETX-induced cell death of CD4+ cells is dose dependent. (G) ETX-induced cytotoxicity in CD4+ cells over time at various time points. Data are the mean of a single donor in triplicate. Data are representative of multiple donors. * p < 0.05, ** p < 0.01, determined by One-way ANOVA with post hoc Tukey HSD Test. Figures 23A and 23B show ETX cytotoxicity is mediated by pore formation in PBMNC. (A) PBMNCs were treated with indicated doses of ETX for 2 h. Cells were extensively washed in PBS, and whole-cell lysates were examined via Western blot for detection of the 150kDa oligomerized pore complex or 27 kDa bound ETX monomer. In total, 1 ng of ETX and whole-cell lysates from rMAL-CHO cells treated with or without 50 nM ETX were used as controls. (B) PBMNCs were treated with 50 nM of ETX for the indicated time points and examined for via Western blot for detection of the 150 kDa oligomerized pore complex or 27 kDa bound monomer. Figures 24A-24F depict confirmation of MAL gene expression in primary human lymphocytes from publicly available datasets. (A) MAL gene expression in CD4+, CD8+, and CD19+ cells determined via RNAseq analysis. Data was obtained from The Human Protein Atlas (available on FH11871214.1} ^{27 Attorney Docket No.: CUW-02625 the internet) and exported into Microsoft Excel and Prism 7 software. Results are expressed as pTPM and are from six separate donors. Cells isolated via FACS sorting. CD4 cells include naïve CD4 cells (CD3+, CD4+CD45RA+), memory CD4 cells (CD3+, CD4+, CD45RA-) and t regs (CD3+, CD4+, CD35+ CD127low, CCR4+, CD25+). CD8 cells include naïve CD8 cells (CD3+ CD4- CD8a+ CD45RA+) and memory CD8 cells (CD3+ CD4- CD8a+ CD45RA-). CD19 cells include naïve B cells (CD3- CD19+ CD27-) and memory B cells (CD3- CD19+ CD27+). ** p<0.01 determine by One-way ANOVA with post-hoc Tukey HSD Test. (B) MAL gene expression in CD4+, CD8+, and CD19+ cells determined via RNAseq analysis. Data was obtained from the online data portal “Haemosphere” and exported into Microsoft Excel and Prism 7 software. Results are expressed as Log2(tpm+1) and are from 3 to 5 donors. Cells isolated via FACS sorting. CD4 cells are CD3+ CD19- CD56- CD4+. CD8 cells are CD3+ CD19- CD56- CD8+. CD19 cells include Naïve B cells (CD3- CD19+ CD27-) and memory B cells (CD3- CD19+ CD27+). ** p<0.01 determine by One-way ANOVA with post-hoc Tukey HSD Test. (C) MAL gene expression in CD4+, CD8+, and CD19+ cells determined via microarray analysis. Data was obtained from Haemosphere and exported into Microsoft Excel and Prism 7 software. Results expressed as log 2 and are from seven separate donors. CD4+, CD8+, and CD19+ cells were isolated using automated} _{magnetic labeling protocol. ** p<0.01 determine by Oneway ANOVA with post-hoc Tukey HSD Test. (D-F) MAL gene expression in CD4+, CD8+, and CD19+ cells determined via scRNAseq analysis. Five pooled healthy donor PBMNC output files in csv format were exported from single- cell-gene-expression datasets from 10xgenomics (Dataset: 6K_PBMCs from a Healthy Donor, Single Cell Immune Profiling Dataset by Cell Ranger 1.1.0, 10xGenomics). Files were imported into SeqGeq v1.6 software (BD Biosciences) for scRNA-Seq data analysis. Quality control was performed in tandem by first eliminating doublets, housekeeping genes and lowly dispersed gene parameters followed by Seurat v3 plugin eliminating genes outside desired expression for phenotyping use. The data was log normalized and adjusted to a clustering resolution of 0.3 to avoid subpopulations unnecessary for this comparison. Seurat returned eight clustered populations which were characterized and plotted on a t-Distributed Stochastic Neighbor Embedding (t-SNE) graphic (D). The output characterized t-distributed Stochastic Neighbor Embedding (t-SNE) clusters into PBMNC cell types based on previous predictive models. (E) Confirmation of unsupervised phenotyping by established marker genes were visualized by mode normalized heatmaps. In addition to canonical phenotype markers, MAL expression is included. (C) Lymphocyte clusters (CD4+, CD8+, and B-cells) were then examined for relative MAL expression FH11871214.1} ^{28 Attorney Docket No.: CUW-02625 using the Violin box plugin available from TomKellyGenetics on github. Results are presented on a Log2Expression scale evaluated by Mann-Whitney pairwise U-test. **p<0.01, **p<0.0001 determined by Mann-Whitney pairwise U-test. Figures 25A-25E show the Gating strategy for lymphocyte populations. PBMNC were isolated from peripheral blood using density gradient separation. (A) Lymphocyte and monocyte populations were identified using FSC and SSC profiles. The lymphocyte population was further characterized using cell surface markers to identify CD4+ cells (B), CD8+ cells (C), and CD19+ cells (D). Red lines indicate further analysis of gated populations. (E) Examples of scatter plots when PBMNC are incubated with 0nM or 50nM pETX-647 for 1 hour. The same data was used in Figure 20A. Results are representative from three separate donors performed in triplicate. Figure 26 shows STX binding to CD4+, CD8+, and CD19+ cells. To demonstrate pETX-647 binding to human primary lymphocytes is specific and not a result of unspecific binding due to fluorescent labeling, PBMNC were incubated with 50nM of Alexa Fluor 647 labeled Shiga Toxin (STX-647) for 2 hours at 37°C. STX was labeled with Alexa Fluor 647 Protein Labeling Kit} _{(Life Technologies) as per manufacturer's instructions. Labeled toxin was stored in a 50% glycerol stock (10uM) at -20°C until use. Binding was determined by flow cytometry. Results are expressed as the percent of CD4+, CD8+, or CD19+ cells positive for STX-647 (% STX+). ** p<0.01, determine by One-way ANOVA with post-hoc Tukey HSD Test. Results are the mean of one donor performed in quadruplet. Figure 27 shows additional time points for dose response evaluation in lymphocyte subsets. To determine if ETX binding was dose dependent, PBMNC were incubated with indicated doses of pETX-647 for 30 and 60 minutes. pETX-647 binding was evaluated by flow cytometry as previously described. Results are expressed as percent ETX positive cells for each lymphocyte population; CD4+, CD8+, and CD19+. * p<0.05 and ** p<0.001 compared to untreated controls (0nM) as determined by ANOVA. Results are the mean results of three donors performed in triplicate. Figures 28A-28F show ETX Detection on CD4+ Lymphocytes. Peripheral blood mononuclear cells were isolated from whole blood and analyzed for bound epsilon toxin (ETX) via flow cytometry. (A) Gating strategy for identification of lymphocytes (top) and CD4+ cells via flow. FH11871214.1} ^{29 Attorney Docket No.: CUW-02625 (B) Detection of bound ETX on CD4 cells when were stained with an anti-ETX monoclonal antibody (right) versus an isotype control antibody (IgG CT, left). Representative dot blots from a healthy control (HC) and three separate MS donor (MS1, MS2, and MS3). ETX binding to CD4 cells was examined in 15 HC donors and 40 MS donors. (C) The percent of CD4+ cells positive for ETX isolated from HC donors or MS donors. Results displayed as box and whiskers plot with each dot represents an individual donor. p value determined by unpaired t test. (D) The percent of HC or MS donors with ETX+ CD4 cells determined by indicated gating strategy. The p value was determined by Fisher’s exact test. (E) ETX Median fluorescent intensity of CD4 cells. Results displayed as box and whiskers plot with each dot represents an individual donor. (F) The percent} _{of HC or MS donors with ETX+ CD4 cells determined by ETX median fluorescence intensity. p value determined by Fisher’s exact test. Some of the data and descriptions provided herein are also provided in a publication by the inventors of the present disclosure, Ma et al., 2023, J. Clin. Invest. 133(9):e163239, https://doi.org/10.1172/JCI163239, which is incorporated by reference herein in its entirety, including its supplementary materials. Some of the data and descriptions provided herein are also provided in a publication by the inventors of the present disclosure, Shetty et al., 2023, Toxins 15, 423, https://doi.org/10.3390/toxins15070423, which is incorporated by reference herein in its entirety, including its supplementary materials.} DETAILED DESCRIPTION OF THE INVENTION P^{rovided herein are compositions and methods for monitoring and therapy of subjects (such as human subjects) at risk for, suffering from or diagnosed with Multiple Sclerosis (MS) based on the detection of the relative abundance of epsilon toxin (ETX) gene or ETX gene-harboring strains of C. perfringens and/or detection of epsilon toxin bound to lymphocytes. In some aspects, provided herein are compositions and methods for detection of the relative abundance of ETX gene or ETX gene-harboring strains of C. perfringens in a fecal sample of a} _{subject, e.g., for identification, monitoring (e.g., monitoring the progression of disease or treatment of disease), prevention, treatment, or assessment of responsiveness to treatment of the subject with MS. In some embodiments, after obtaining of the fecal sample and before the detection, bacteria is separated from nonmicrobial fecal matter by any method known in the art or described herein. In some embodiments, bacteria is separated from nonmicrobial fecal matter by density gradient centrifugation. In some embodiments, provided herein are specific primers and fluorogenic probes FH11871214.1} ^{30 Attorney Docket No.: CUW-02625 (such as specific primers for detection of the ETX gene, as well as for detection of one or more other, non-ETX-harboring-strains-specific, C. perfringens genes for purposes of quantifying relative abundance of ETX gene-harboring strains of C. perfringens), for use in such compositions and methods. In some embodiments, provided herein are specific quantitative methods (in particular, quantitative PCR-based methods) for determining the abundance of ETX gene (and thus, ETX gene-harboring strains of C. perfringens) relative to the abundance of another gene or genes found in, and specific to, ETX gene-harboring and non ETX C. perfringens (e.g., 16S or CPA genes). In some embodiments, the abundance of ETX gene is compared to the abundance of another gene found in and specific to C. perfringens types A, B and D (e.g., 16S or CPA genes). In some embodiments, the abundance of ETX gene is compared to the abundance of another gene found in and specific to all seven (7) toxinotypes of C. perfringens, C. perfringens A-G. In some embodiments, the abundance of ETX+CPA+ or ETX+16S rRNA+ C. perfringens strains is compared to the abundance of ETX-CPA+ or ETX-16S rRNA+ C. perfringens strains. In some embodiments, an MS patient with a percentage of ETX gene-positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 0.001% is treated for MS as described herein (e.g., using standard-of-care MS therapy, and/or using a therapy targeting ETX gene or protein, interaction of ETX with its receptor (such as MAL), or using a therapy targeting C. perfringens} _{type B and/or D strains). In some embodiments, an MS patient with a percentage of ETX gene- positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 0.01% is treated for MS as described herein. In some embodiments, an MS patient with a percentage of ETX gene- positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 0.1% is treated for MS as described herein. In some embodiments, an MS patient with a percentage of ETX gene- positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 1% is treated for MS as described herein. In some embodiments, an MS patient with a percentage of ETX gene- positive C. perfringens strains (i.e., type B or D C. perfringens strains) greater than 5%, 10%, 15%, 20%, 25%, 30%, 35% or 40% is treated for MS as described herein. In some embodiments, 2-ΔΔCt analysis, described herein and known in the art, is used to quantify the abundance of ETX gene- harboring C. perfringens strains (e.g., ETX+, CPA+ and/or ETX+, 16S+) relative to the abundance of C. perfringens strains that do not harbor ETX (e.g., ETX-, CPA+ and/or ETX-, 16S+). In some embodiments, if the 2-ΔΔCt value is more than 0.1 (which indicates presence of ETX gene-harboring strains), the MS patient is treated for MS as described herein (e.g., using standard-of-care MS therapy, and/or using a therapy targeting ETX gene or protein, interaction of ETX with its receptor (such as MAL), or using a therapy targeting C. perfringens type B and/or D strains). In some FH11871214.1} ^{31 Attorney Docket No.: CUW-02625 embodiments, if the 2-ΔΔCt value is more than 0.25 (which indicates presence of ETX gene- harboring strains), the MS patient is treated for MS as described herein. In some embodiments, if the 2-ΔΔCt value is more than 0.5% (which indicates presence of ETX-harboring strains), the MS patient is treated for MS as described herein. In some embodiments, if the 2-ΔΔCt value is more than 0.75% (which indicates presence of ETX-harboring strains), the MS patient is treated for MS as described herein. In some embodiments, if the 2-ΔΔCt value is more than 1 (which indicates dominance of ETX-harboring strains), the MS patient undergoes an MS evaluation (e.g., standard- of-care MS evaluation) and/or the MS patient is treated for MS as described herein (e.g., using standard-of-care MS therapy, and/or using a therapy targeting ETX gene or protein, interaction of ETX with its receptor (such as MAL), or using a therapy targeting C. perfringens type B and/or D strains). In some aspects, provided herein are composition and methods for detection of epsilon toxin protein bound to lymphocytes in a blood sample of a subject, e.g., for identification, monitoring (e.g., monitoring the progression of disease), prevention, treatment, or assessment of responsiveness to treatment of the subject with MS. Any methods for detection of proteins bound to cells known in the art can be used for detection of epsilon toxin protein bound to lymphocytes. In some embodiments, provided herein are specific methods (in particular, flow cytometry} _{methods) for determining the presence and/or abundance of epsilon toxin bound to lymphocytes. In some embodiments, the lymphocyte is a CD4+ lymphocyte. In some embodiments, the determining of the presence and/or abundance of epsilon toxin bound to lymphocytes comprises (i) isolating peripheral blood mononuclear cells from whole blood, and (ii) detection of bound ETX via flow cytometry. In some embodiments, the detection of cell-bound ETX via flow cytometry comprises incubating the isolated cells with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the percent of CD4+ cells positive for ETX. Such methods can be used as alternative methods for detection of ETX or together with the methods for identifying an ETX gene or ETX gene-harboring strain in a fecal sample. The blood sample detection methods can be used to verify the relevance of ETX to MS, monitor ETX bound to lymphocytes, and/or monitor the impact of treatment designed to remove ETX from blood described herein (e.g., an anti-ETX neutralizing antibody, neutralizing nanobody, or a soluble neutralizing receptor). In some embodiments, where isolated lymphocytes (e.g., CD4+ lymphocytes) positive for ETX are detected, or more than 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.75%, 1%, or 1.5% of the isolated lymphocytes are positive for ETX, the subject is treated for MS as described herein. In some embodiments, the FH11871214.1} ^{32 Attorney Docket No.: CUW-02625 initial detection of ETX gene-harboring strains (e.g., using qPCR of fecal samples), is followed by administration of ETX-specific treatment, and further followed by monitoring (e.g., by detection of lymphocyte-bound ETX in the blood) of treatment progression (e.g., in a subject afflicted with MS). In some aspects, provided herein are specific therapies for use in an MS patient after detection of either elevated abundance of the ETX gene or ETX gene-harboring C. perfirgens strains (such as in a fecal sample) or epsilon toxin bound to lymphocytes (such as in the plasma serum). In some embodiments, the specific therapy is an agent that directly or indirectly interferes with ETX, e.g., an inhibitor or antagonist of ETX. In some embodiments, the inhibitor or antagonist of ETX is an antibody against ETX or an antigen-binding portion thereof (e.g., a neutralizing antibody (NAB), a neutralizing nanobody, an antibody inhibiting or preventing oligomerization of ETX, or an antibody inhibiting or preventing the binding of ETX to an ETX-binding receptor on a cell). In some embodiments, the specific therapy is an agent that directly or indirectly interferes with an ETX-binding receptor, e.g., an inhibitor or antagonist of ETX-binding receptor (MAL or HAVcR1). In some embodiments, the inhibitor or antagonist of ETX-binding receptor is an antibody against ETX-binding receptor or an antigen-binding portion thereof (e.g., an antibody} _{inhibiting or preventing the binding of ETX to an ETX-binding receptor on a cell). In some embodiments, a soluble ETX-binding receptor protein, e.g., a soluble HAVcR1, a soluble MAL, or a fragment thereof, can also be used. In some embodiments, the specific therapy is an agent that directly or indirectly interferes with ETX gene-harboring C. perfringens strains. In some of these embodiments, C. perfringens strains can be targeted or killed with anti-microbial agents, such as antibiotics. In some embodiments, anti-microbial treatment may be followed by a fecal microbiome transfer using healthy donors with defined gut microbiome taxonomy. In some of these embodiments, C. perfringens strains can be selectively targeted or killed with a bacteriophage endolysin specific to C. perfringens Type B or D bacterial strain alone or in conjunction with another therapy (e.g., an epsilon toxin specific antibody or nanobody or soluble epsilon toxin receptor). Other ETX-specific therapies can also be used following the detection methods described herein. The therapy can be chosen based on whether ETX is detected in, and thus it is desirable to target ETX in, the gut microbiome or the blood of the subject. For example, detection of ETX gene-harboring C. perfringens in a fecal sample, may be followed by administration of an MS therapy targeting gut microbiome (e.g., C. perfringens strains can be targeted or killed with antibiotics followed by a fecal microbiome transfer). Similarly, detection of ETX bound to FH11871214.1} ^{33 Attorney Docket No.: CUW-02625 lymphocytes in a blood sample, may be followed by administration of MS therapy into systemic circulation (e.g., parenteral administration of anti-ETX neutralizing antibodies). In some aspects, any ETX-specific therapies can be used in conjunction with any standard- of-care MS therapy known in the art or described herein (e.g., an oral therapy or an injectible} _{therapy). In other embodiments, only ETX-specific therapy is administered an MS patient after detection of either elevated abundance of the ETX gene or ETX gene-harboring C. perfirgens strains (such as in a fecal sample) or epsilon toxin bound to lymphocytes (such as in the plasma serum).} ^{Terminology Unless defined otherwise, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, chemistry, biochemistry, molecular biology, pharmacology and toxicology are those well-known and commonly used in the art. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing devices, compositions, formulations and methodologies which are described in the publication and which might be used in connection with the present disclosure. Where values are described as ranges, it will be understood that such disclosure includes the disclosure of all possible sub-ranges within such ranges, as well as specific numerical values} _{that fall within such ranges irrespective of whether a specific numerical value or specific sub-range is expressly stated. The term “about,” as used herein, refers to a range of +/- 10% of the stated value. In some embodiments, the range is +/- 5%, 3%, 2%, 1%, 0.5%, or 0.1% of the stated value. A “patient,” “subject,” or “individual” are used interchangeably and refer to either a human or a non-human animal. These terms include mammals, such as humans, primates, livestock animals (including bovines, porcines, etc.), companion animals (e.g., canines, felines, etc.) and rodents (e.g., mice and rats). “Administering” or “administration of” a substance, a compound or an agent to a subject can be carried out using one of a variety of methods known to those skilled in the art. For example, a compound or an agent can be administered, intravenously, arterially, intradermally, intramuscularly, intraperitoneally, subcutaneously, ocularly, sublingually, orally (by ingestion), FH11871214.1} ^{34 Attorney Docket No.: CUW-02625 intranasally (by inhalation), intraspinally, intracerebrally, and transdermally (by absorption, e.g., through a skin duct). In some embodiments, the administration is parenteral. In some embodiments, the administration is enteral or oral. Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods. Appropriate methods of administering a substance, a compound or an agent to a subject will also depend, for example, on the age and/or the physical condition of the subject and the chemical and biological properties of the compound or agent (e.g., solubility, digestibility, bioavailability, stability and toxicity). An ”effective amount” or a “therapeutically effective amount” of a drug or agent is an amount of a drug or an agent that, when administered to a subject will have a therapeutic effect. The full therapeutic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically effective amount may be administered in one or more administrations. The precise effective amount needed for a subject will depend upon, for example, the subject’s size, health and age, and the nature and extent of the condition being treated. The phrase “pharmaceutically acceptable carrier,” as used herein, refers to any pharmaceutically acceptable material, composition or vehicle, such as a diluent, excipient, solvent,} _{dispersion media, coatings, or encapsulating material useful for formulating a drug or agent for medicinal or therapeutic use. The term “treating” a disease or condition in a subject, as used herein, refers to administering a medicament to the subject having or suspected of having a disease or condition (i.e., after the onset of the disease or condition), such that at least one symptom of the disease or condition is decreased or prevented from worsening. Desirable effects of treatment include decreasing the rate of progression, ameliorating or palliating the pathological state, and remission or improved prognosis of a particular disease, disorder, or condition. An individual is successfully “treated,” for example, if one or more symptoms associated with a particular disease, disorder, or condition are mitigated or eliminated. The term “preventing” a disease or condition in a subject, as used herein, refers to administering a medicament to the subject prior to the onset of the disease or condition, when administration of the medicament to a statistical sample prior to the onset of the disease or condition reduces the occurrence of the disease or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the occurrence or severity of one or more symptoms of the disease or condition relative to the untreated control sample. FH11871214.1} ^{35 Attorney Docket No.: CUW-02625 The terms "decrease", "reduced", "reduction", or "inhibit" are all used herein to mean a decrease by a statistically significant amount. In some embodiments, "reduce," "reduction" or "decrease" or "inhibit" typically means a decrease by at least 10% as compared to a reference level (e.g., the absence of a given ligand) and can include, for example, a decrease by at least about 10%,} _{at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more.} ^{Epsilon toxin and its detection in MS Gut dysbiosis is common in MS, but specifically causative species are unknown. To address this gap in knowledge, sensitive and quantitative PCR detection was used as} _{described herein to surprisingly demonstrate for the first time that people with MS are more likely to harbor and show a greater abundance of epsilon toxin (ETX)-producing strains of} C. perfringens within their gut microbiomes compared to healthy controls (HC). C^{. perfringens ETX is a unique candidate environmental trigger for MS because this bloodborne neurotoxin specifically targets CNS endothelial cells, leading to disruption of BBB integrity. C. perfringens is a gram-positive anaerobe categorized into 7 toxinotypes based on production of one or more of 6 major toxins. The type B and D strains carry the plasmid-encoded ETX gene (etx). In the gastrointestinal tract of mammals, C. perfringens types B and D exist in the small intestine where they produce ETX episodically during log- phase growth. Human exposure to C. perfringens strains is broad since they are present in our food chain, pets, and are found in multiple ecological niches including farm runoff, sewage, marine sediment, soil, and the gastrointestinal tracts of fish, birds, and mammals. As} _{a spore-forming anaerobe, once C. perfringens enters an environment it tends to persist due to resistance of spores to heat, chemicals, radiation, and pressure. Following environmental exposure and oral ingestion, colonization of the small intestine may be dependent on host genetics, microbiome composition, and additional factors such as prior antibiotic use. ETX is a member of the aerolysin-family of pore-forming toxins. ETX is synthesized as a 32.9 kDa inactive pro-toxin that is secreted and cleaved in the gut by host serine proteases and carboxypeptidases or occasionally by bacterially-derived lambda protease into a 27 kDa active toxin, resulting in 1000 fold increase in ETX's toxicity. The ETX monomer crosses the small intestine without causing injury or enteritis. The myelin and lymphocyte FH11871214.1} ^{36 Attorney Docket No.: CUW-02625 protein (MAL) was identified as the receptor for ETX, required for binding and for all known biologic activity. MAL is localized to lipid rafts and ETX binding to MAL brings monomers in proximity, favoring self-assembly into a heptameric pre-pore complex that then inserts into the plasma membrane of host cells. In vivo, ETX induces BBB permeability. In the bloodstream, ETX has access to all vascularized tissues, but its binding is restricted to CNS endothelial cells, since they are enriched for expression of the ETX receptor, MAL. In both natural and experimental infections, ETX preferentially accumulates in the brains and kidneys of animals. In the brain, ETX selectively binds to brain endothelial cells, myelinated structures, and mature oligodendrocytes, the myelinating cells of the CNS. In the kidney, ETX preferentially binds to distal and collecting tubules. ETX preferences for these specific cell types are most likely due to the expression of the ETX receptor MAL. Reported herein is that MS patient-derived isolates produced functional ETX and had a genetic architecture typical of highly conjugative plasmids. Thus, an association between ETX-producing strains of C. perfringens and MS in clinical samples was identified. The data} _{provided herein also discloses that people with MS have increased abundance of ETX-producing strains of C. perfringens in their gut microbiome compared to healthy controls; that ETX is sufficient to induce multifocal, inflammatory demyelination in the context of active immunization with MOG35-55; that ETX-induced inflammatory demyelination, in active EAE, more closely resembles the lesion distribution observed in MS when compared to the traditional PTX model; and that, in CNS endothelial cells, ETX induces expression of genes known to overcome CNS immune privilege. In the active immunization model of experimental autoimmune encephalomyelitis (EAE), where pertussis toxin (PTX) is used to overcome CNS immune privilege, ETX can substitute for PTX. In contrast to PTX-induced EAE, where inflammatory demyelination is largely restricted to the spinal cord, ETX-induced EAE caused demyelination in the corpus callosum, thalamus, cerebellum, brainstem, and spinal cord, more akin to the neuroanatomical lesion distribution in MS. Transcriptional profiles from CNS endothelial cells revealed ETX-induced genes that are known to play a role in overcoming CNS immune privilege. Together, the findings presented herein suggest that ETX-producing strains of C.} ^{perfringens are biologically plausible pathogens in MS that trigger inflammatory demyelination in the context of circulating myelin autoreactive lymphocytes.} A_{lso disclosed herein, is demonstration that ETX preferentially binds to human lymphocytes expressing increased levels of the myelin and lymphocyte protein MAL. Using FH11871214.1} ^{37 Attorney Docket No.: CUW-02625 flow cytometry, ETX binding was determined to be time and dose dependent and was highest for CD4+ cells, followed by CD8+ and then CD19+ cells. Similar results were seen with ETX-induced cytotoxicity. To determine if ETX preference for CD4+ cells was related to MAL expression, MAL gene expression was determined by RT-qPCR. CD4+ cells had the highest amount of Mal gene expression followed by CD8+ and CD19+ cells. The data indicate that primary human cells are susceptible to ETX binding and support the hypothesis that MAL is a main receptor for ETX. ETX bindings to human lymphocytes suggest that ETX} _{may influence immune response in multiple sclerosis. Described herein is ETX as a possible environmental cause of multiple sclerosis (MS) in humans, and methods of detection thereof. Multiple sclerosis patients are more likely to be colonized by ETX-producing C. perfringens toxinotypes versus healthy controls, and in colonized individuals, the relative abundance of ETX producing strains is significantly higher in MS patients versus HC. Histopathological, active MS lesions are characterized by overt blood- brain-barrier permeability, demyelination, and robust CNS immune infiltration. Using both in} ^{vitro and in vivo models, it is demonstrated herein that ETX specifically causes BBB permeability, demyelination, and loss of CNS-immune privilege. This specificity is mediated by the selective expression of the ETX receptor, the myelin and lymphocyte protein MAL, on CNS} _{endothelial cells, mature oligodendrocytes, and human lymphocytes. Pathogenic lymphocytes, including both T cells and B cells, play an important role in MS pathogenesis. Provided herein is data demonstrating the binding of ETX to primary human lymphocytes expressing MAL.} ^{ETX detection methods In certain aspects of the invention, provided herein are methods for identifying a subset of subjects afflicted with MS for epsilon toxin treatment. In some aspects, provided herein are methods to detect and quantify the epsilon toxin gene from fecal samples. In some embodiments, the method comprises obtaining a fecal sample from said subjects and detecting the relative} _{abundance of epsilon toxin gene (ETX)-harboring C. peifringens in the fecal sample from said subject. Such detection methods are known in the art and include quantitative PCR techniques, such as Real-Time quantitative Polymerase Chain Reaction (RT-qPCR). In some embodiments, the abundance of the ETX gene is determined relative to a control gene, such as the cpa/plc gene, common to all C. perfringens strains, and/or the 16S ribosomal RNA gene specific to C.} ^{perfringens. A subject is identified as suitable for epsilon toxin treatment when the abundance of} _{the ETX gene in the fecal sample exceeds a predetermined threshold derived from healthy control FH11871214.1} ^{38 Attorney Docket No.: CUW-02625 fecal samples. For exemplary purposes, the percentage of ETX-harboring strains based on quantitation of etx and C. perfringens-specific 16S (relative abundance) were measured in Table 1. In some embodiments, said methods may be used for identifying patients to be treated with anti-epsilon toxin strategies. Notably, it is uncommon to detect the epsilon toxin gene in healthy controls, though it is occasionally present. Thus detection of the gene alone is not sufficient to support a pathophysiologic role of this agent in MS, but may be used to identify a patient or sub- populations of patients afflicted with MS that may benefit from epsilon toxin therapy. In some embodiments, the patient subjected to detection methods described herein has already been diagnosed with MS or is suspected to have MS. In some embodiments, the patient subjected to detection methods described herein has been diagnosed with MS (e.g., using standard-of-care MS evaluation methods, such as those described herein). In some embodiments, the patient subjected to detection methods described herein is suspected to have MS (e.g., based on preliminary} _{evaluation or presence of one or more symptoms). In some embodiments, the patient subjected to detection methods described herein shows one, two, three or more symptoms of MS. In some embodiments, detection of the ETX gene alone may support evaluation of such a patient for MS (e.g., diagnostic assessment for MS) using criteria known in the art (e.g., the McDonald criteria), employing those methods known in the art (e.g., medical history, neurologic examination, magnetic resonance imaging (MRI), cerebrospinal fluid analysis, motor skills assessments, and blood tests) in case of unidentified or asymptomatic MS, or otherwise at risk of developing a form of MS. Using quantitative PCR, as disclosed herein, it was determined that the abundance of the epsilon toxin gene, and thus epsilon toxin-encoding strains of C. perfringens, was dramatically elevated in subjects with MS relative to healthy controls. In some embodiments, a threshold or “cut-off” value may be used to define patients recommended for epsilon toxin treatment. For exemplary purposes, the percentage of etx-harboring strains based on quantitation of etx and C.} ^{perfringens-specific 16S (relative abundance) were measured as provided in Table 1.} _{Table 1: Relative abundance of etx gene (etx/16s) in healthy controls and MS patients FH11871214.1} ^{39 Attorney Docket No.: CUW-02625} T^{he median percentage of healthy controls that are etx+ was determined by the inventors to be 0.001%, while the median value among multiple sclerosis patients was determined by the inventors to be 42.5%. Thus, in some embodiments, the threshold for epsilon toxin treatment of a subject is based on a predetermined value derived from healthy controls. In some such embodiments, the subject tested as a potential candidate for epsilon toxin treatment is afflicted with, suspected of being afflicted with, or is at risk of being afflicted with MS. In some such embodiments, the subject has a clinical diagnosis of MS. In some embodiments, the threshold value for administering epsilon toxin treatment is greater than 0.001%. In some embodiments, the} _{threshold value for administering epsilon toxin treatment is at least or greater than 0.01%. In some embodiments, the threshold value for administering epsilon toxin treatment is at least or greater than 0.1%. In some embodiments, the threshold value for administering epsilon toxin treatment is at least or greater than 1%. In some embodiments, the threshold value for administering epsilon toxin treatment is at least or greater than 5%. In some embodiments, the threshold value for administering epsilon toxin treatment is at least or greater than 10%. In some aspects of the invention, the presence of epsilon toxin bound to lymphocytes in blood samples is determined. Epsilon toxin bound to lymphocytes can be detected using any methods known in the art or described herein. In some embodiments, flow cytometry is used to detect epsilon toxin bound to lymphocytes, as described herein. Epsilon toxin is secreted from C.} ^{perfringens types B or D in the gut as a 32.5 kDa protoxin that is then cleaved in the gut by proteases into the active toxin, ranging from 27-29 kDa, which traverses the gut epithelium and enters the bloodstream. Once in the blood stream epsilon toxin can exist as free toxin in blood or can be bound to lymphocytes. In some embodiments, ETX is bound predominantly to CD4+ and/or} _{CD8+ T cells. Free ETX is rapidly removed from blood by binding specifically to CNS endothelial cells (e.g., luminal vascular walls) which represent a huge sink for ETX binding as the CNS microvasculature of the human brain consists of 15-25 meters2 of surface area. In addition, the kidney also removes ETX from blood, non-specifically, via glomerular filtration and then uptake FH11871214.1} ^{40 Attorney Docket No.: CUW-02625 and degradation in proximal renal tubule cells. As a consequence of these two processes, specific and non-specific removal of epsilon toxin from blood, the detection of free epsilon toxin in plasma or serum is highly unlikely (unless sampling occurred almost daily). However, the life span of lymphocytes in blood is about 60 days. Thus, as provided herein, the epsilon toxin bound to lymphocytes is relatively long lived in blood when compared to free epsilon toxin and the use of flow cytometry to detect epsilon toxin bound to lymphocytes may be used for detecting disease (MS) and monitoring treatment/progression of the disease (MS). In some aspects, such methods can be used to verify the relevance of ETX to MS or confirm an MS diagnosis. In certain embodiments, such methods may be used to monitor the progression of MS and/or the impact of treatment designed to remove epsilon toxin from blood (e.g., a neutralizing antibody, neutralizing nanobody, or a soluble neutralizing receptor) by monitoring epsilon toxin bound to lymphocytes. In some embodiments, fecal sample ETX detection methods and blood sample ETX detection methods are used together before determination to proceed with MS evaluation is made. In some embodiments, fecal sample ETX detection methods and blood sample ETX detection methods are used together before determination to proceed with MS treatment is made. In some embodiments, fecal sample ETX detection methods and blood sample ETX detection methods are} _{used together before determination to proceed with ETX-targeting MS treatment is made. In some embodiments, fecal sample ETX detection methods and blood sample ETX detection methods are used together before determination to proceed with standard-of-care MS treatment is made. In some embodiments, only fecal sample ETX detection methods or only blood sample ETX detection methods is used before determination to proceed with MS evaluation is made. In some embodiments, only fecal sample ETX detection methods or only blood sample ETX detection methods is used before determination to proceed with MS treatment is made. In some embodiments, only fecal sample ETX detection methods or only blood sample ETX detection methods is used before determination to proceed with ETX-targeting MS treatment is made. In some embodiments, only fecal sample ETX detection methods or only blood sample ETX detection methods is used before determination to proceed with standard-of-care MS treatment is made. In some embodiments, fecal sample ETX detection methods and blood sample ETX detection methods can be used sequentially or at different stages of patient care or monitoring. For example, fecal sample ETX detection methods can be used at initial diagnosis (such as confirmatory diagnosis) or at the initial instance when treatment decision is to be made, followed by use of blood sample ETX detection methods to monitor the progression of MS and/or the impact of treatment designed to remove epsilon toxin from blood. FH11871214.1} ^{41 Attorney Docket No.: CUW-02625 Methods for the prevention and treatment of MS when ETX is detected Any methods known in the art for use in decreasing or eliminating C. perfringens types B and/or D, or for use in inhibiting or antagonizing ETX or a receptor of ETX, can be used in the ETX-specific treatment methods provided herein. In some embodiments, the present disclosure provides methods and techniques for modulating the gut microbiome to limit or eliminate toxinotypes of C. perfringens, particularly types B and D. There are 7 toxinotypes of C. perfringens, i.e., types A-G. The epsilon toxin producing strains are the type B and D strains. The type A strain is a commensal in the human gut microbiome but does encode cpa/plc which is a hemolysin that functions to hydrolyze phosphatidyl choline and sphingomyelin. The type B and D strains encode and produce epsilon toxin. The type} _{A strain is the dominant strain numerically in the human gut microbiome and as a result, limits the ability of other toxinotypes, such as the B and D strains, from occupying this ecologic niche. Aspects of the disclosed invention include methods to effectively eliminate or reduce the presence of C. perfringens type B and D strains. Without being bound by theory or methodology, such methods may include killing all C. perfringens strains with antibiotics. In some such embodiments, treatment is followed by a fecal microbiome transfer from healthy donors with defined gut microbiome taxonomy. In certain embodiments, C. perfringens is selectively killed with a bacteriophage endolysin specific to C. perfringens. Such lysins are known in the art (see, e.g., Gervasi et al. Application of Lactobacillus johnsonii expressing phage endolysin for control of} Clostridium perfringens. Lett Appl Microbiol. 2014 Oct;59(4):355-61; Ha et al. Clostridium ^{perfringens Virulent Bacteriophage CPS2 and Its Thermostable Endolysin LysCPS2. Viruses 2018, 10, 251; Swift et al. A Thermophilic Phage Endolysin Fusion to a Clostridium perfringens- Specific Cell Wall Binding Domain Creates an Anti-Clostridium Antimicrobial with Improved Thermostability. Viruses 2015, 7, 3019-3034; Nariya et al. Identification and characterization of a putative endolysin encoded by episomal phage phiSM101 of Clostridium perfringens. Appl Microbiol Biotechnol 90, 1973–1979 (2011); Gervasi et al. Expression and delivery of an} _{endolysin to combat Clostridium perfringens. Appl Microbiol Biotechnol 98, 2495–2505 (2014); and Shin et al. Characterization of thermostable bacteriophage CPD2 and its endolysin LysCPD2 as biocontrol agents against Clostridium perfringens. Food Sci Biotechnol 32, 2069–2077 (2023), each of which is incorporated by reference herein, in its entirety). In some embodiments, the treatment may be performed in conjunction with (before, concomitantly, or after) administering FH11871214.1} ^{42 Attorney Docket No.: CUW-02625 another epsilon toxin specific therapy (e.g., an anti-ETX antibody or nanobody or soluble epsilon toxin receptor). In other embodiments, the subject is treated with any MS therapy known in the art (e.g., standard-of-care treatment and off-label use of therapeutics). The subject can be treated with any MS therapy before, during, and after the detection methods described herein. In some embodiments, after the detection of a clinically relevant level of relative abundance of the ETX gene-harboring strain in gut microbioma or a fecal sample of a subject, or detection of ETX bound to lymphocytes in a blood sample of a subject, the ETX-specific treatment is administered to the subject conjointly or concomitantly with a standard-of-care MS therapy. For example, and without limitation, such MS therapies may include Avonex® (interferon beta-1a), Betaseron® (interferon beta-1b), Copaxone® (glatiramer acetate), Extavia® (interferon beta-1b), Glatiramer Acetate Injection (glatiramer acetate -generic equivalent of Copaxone 20 mg and 40 mg doses), Glatopa® (glatiramer acetate - generic equivalent of Copaxone 20mg and 40mg doses), Kesimpta®} _{(ofatumumab), Plegridy® (peginterferon beta-1a), Rebif® (interferon beta-1a), Aubagio® (teriflunomide), Bafiertam™ (monomethyl fumarate), Dimethyl Fumarate (dimethyl fumarate - generic equivalent of Tecfidera), Gilenya® (fingolimod), Mavenclad® (cladribine), Mayzent® (siponimod), Ponvory™ (ponesimod), Tascenso ODT® (fingolimod), Tecfidera® (dimethyl fumarate), Vumerity® (diroximel fumarate), Zeposia® (ozanimod), Briumvi™ (ublituximab), Lemtrada® (alemtuzumab), Novantrone® (mitoxantrone), Ocrevus® (ocrelizumab), Tyruko® (natalizumab-sztn), Tysabri® (natalizumab), Rituximab, and/or Glucocorticoids (oral or IV). In some embodiments of the invention, the testing (e.g., qPCR of fecal samples), subsequent administering of epsilon toxin treatment, and optional monitoring (e.g., detection of lymphocyte- bound toxin) of treatment progression (e.g., in a subject afflicted with MS) is done conjointly or concomitantly with any MS therapy known in the art (e.g., standard-of-care MS treatment and off- label use of therapeutics for MS). Without being bound by any particular theory or methodology, a combination of therapies,} ^{e.g., the therapies disclosed herein, may be administered to the subject that meets the predetermined threshold. The combination and administration of such therapies may also be informed, at least in part, by the methods disclosed herein. In some such embodiments, the combination (e.g., MS} _{therapy and epsilon toxin treatment) may be administered in the same formulation or in separate formulations, either concomitantly or sequentially. Thus, a subject that receives such a personalized treatment may benefit from a combined effect. FH11871214.1} ^{43 Additional disclosure of ETX-specific methods for the prevention and treatment of MS In some embodiments, provided herein are ETX-specific methods and agents for preventing or treating multiple sclerosis (MS) in a human subject in need thereof, after the step of detection of the relative abundance of ETX gene-harboring C. perfringens strain or detection of epsilon toxin bound to lymphocytes. In this regard, U.S. Patent No. 9,758,573 is specifically incorporated by reference herein in its entirety. All of the methods and agents for preventing or} _{treating multiple sclerosis (MS), and in particular all agents that directly or indirectly interfere with ETX or ETX-harboring C. perfringens strains, disclosed in U.S. Patent No. 9,758,573, are specifically incorporated by reference herein in their entirety. In particular, U.S. Patent No. 9,758,573 is specifically incorporated by reference for its disclosure of various anti-ETX antibodies and antigen-binding fragments thereof. The methods for treating a subject having MS with epsilon toxin therapy contemplated herein include: a) directly or indirectly interfering with epsilon toxin (ETX) of Clostridium} ^{perfringens type B or type D; b) directly or indirectly interfering with ETX interacting receptor, such as MAL and/or a virus cellular receptor-1 (HAVcR-1); c) directly and/or indirectly interfering with the interaction of ETX with its linking receptor, as well as downstream signaling activities; and/or d) directly or indirectly interfering, inhibiting or killing Clostridium perfringens. In some embodiments, provided herein are methods for preventing or treating multiple sclerosis (MS) in a human subject in need (e.g., a human subject with MS identified by the methods disclosed herein) comprising: administering to said human subject a composition comprising an effective amount of an agent that directly or indirectly interferes with epsilon toxin (ETX) produced by Clostridium perfringens type B or type D bacterial strain, an ETX-binding receptor, or an} _{interaction of ETX with its binding receptor so as to inhibit or suppress ETX modulated receptor signaling pathway. In certain embodiments, said agent is an inhibitor of ETX or its binding receptor expressed on endothelial cells of blood brain barrier (BBB), blood retinal barrier (BRB), oligodendrocytes, or myelin for which ETX is a ligand. In certain embodiments, the ETX-binding receptor is a tetraspan integral membrane receptor MAL, which is expressed in myelin, and by CNS endothelial cells, oligodendrocytes, intestinal epithelium lymphocytes. In other embodiments, the ETX-binding receptor is HAVcR-1 receptor. In some embodiments, described herein are antibodies against ETX, or its binding receptor, such as MAL and/or HAVcR-1, or a functional fragment thereof, e.g., antigen binding fragment or antigen-binding portion. Methods of generating antibodies against ε-toxin (ETX) of C.} perfringens are well known in the art. Examples of antibodies and antibody responses against epsilon toxin of C. perfringens are described, for example, in U.S. Patent No.9,758,573, Bentancor ^{et al. (J Infect Dev Ctries 2009, 3(8):624-627); Laine et al. (Veterinary Immunology and Immunopathology 125, 2008, 198-202); Uzal et al. (Veterinary Research Communications, 23, 1999, 143-150); Percival et al. (Infection and Immunity, 1990, 2487-2492); Veschi et al. (Vet Immunol Immunopathol. 2008 Sep 15;125(1-2):198-202), and Linden et al. Antibodies ( 2018 Dec; 7(4): 37), the entire contents of each of which are incorporated by reference herein. Antigen-binding portions of anti-ETX antibodies are also provided herein. Examples of an “antigen-binding portion” of an antibody include a Fab fragment, a F(ab′)2 fragment, a Fd fragment,} _{an Fv fragment, a dAb fragment (Ward et al., (1989) Nature 341:544 546), or a single chain antibody. Antibody fragments also include single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson (2005) Nature Biotechnology 23:1126-1136). These antibody fragments can be obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies. In some embodiments, the antibody is any known neutralizing antibody against ETX protein. Examples of such ETX antibodies are described in U.S. Patent No. 9,758,573, Bentancor} ^{et al., Percival et al., Uzal et al., Veschi et al., and Linden et al. (2018), the entire content of each of which references is incorporated by reference herewith. In certain embodiments, the neutralizing antibody against ETX protein comprises an amino acid sequence at least about 71%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% 97%, 98%, 99%, 99.5%, or 99.9% or more identical to a polypeptide(s) of any known or later developed ETX antibodies. In some embodiments, provided herein for use in any of the ETX-specific treatment methods or steps is any one or more antibodies against ETX described in U.S. Patent No. 9,758,573, Bentancor et al. (J Infect Dev Ctries 2009, 3(8):624-627); Laine et al. (Veterinary Immunology and Immunopathology 125, 2008, 198-202); Uzal et al. (Veterinary Research} _{Communications, 23, 1999, 143-150); Percival et al. (Infection and Immunity, 1990, 2487-2492); Veschi et al. (Vet Immunol Immunopathol. 2008 Sep 15;125(1-2):198-202), and/or Linden et al. Antibodies ( 2018 Dec; 7(4): 37), or any antibody or antigen-binding fragment having CDRs, or light chain variable domain or heavy chain variable domain, thereof. In some embodiments, provided herein for use in any of the ETX-specific treatment methods or steps is any one or more antibodies against ETX described in U.S. Patent No.9,758,573, or any antibody or antigen-binding fragment having CDRs, or light chain variable domain or heavy chain variable domain, thereof. In some embodiments, provided herein for use in any of the ETX-specific treatment methods or steps} ^{is any one or more antibodies against ETX described in Linden et al. Antibodies ( 2018 Dec; 7(4): 37), or any antibody or antigen-binding fragment having CDRs, or light chain variable domain or heavy chain variable domain, thereof. In some embodiments, provided herein for use in any of the ETX-specific treatment methods or steps are specific neutralizing antibodies against ETX such as A5C12 described in Percival et al, 1990, mAbs 4D7 and/or 5B7 described in McClain and Cover 2007, or any antibody or antigen-binding fragment having CDRs, or light chain variable domain or heavy chain variable domain, thereof. An antibodies' activity in inhibiting binding of ETX to its binding receptor can be determined by testing the ability of the antibody from blocking the binding of ETX to its binding receptor. Without being bound by theory or methodology, a competition ELISA assay in the presence of a labeled ligand and/or the antibody may be used. In certain embodiments, the agent described herein comprises an isolated polypeptide of ETX, its binding receptor, MAL or HAvR-1, and biologically active portions thereof. In some embodiments, the polypeptides of the invention, and biologically active portions thereof comprise soluble ETX-binding receptors, e.g., a soluble MAL, which reduces the bioavailability of ETX} _{and, thus, prevents binding of ETX with the cognate receptors in the subject. In certain embodiments, the agent describe herein is an inhibitor of a receptor to which epsilon toxin (ETX) binds, such as the MAL receptor. In certain embodiments, the agent described herein is an inhibitor of the receptor on the blood brain barrier (BBB), such as HAVcR-1, which can also be therapeutic candidates for protecting and/or treating MS. Examples of such inhibitors are described in U.S. Patent No. 9,758,573 and Lewis et al. (Toxins 2010, 2, 1825-1847), the entire content of which is incorporated by reference herein. Agents that have been found to potentially inhibit ETX binding to MAL or HAVcR-1 include, but are not limited to, the mutant epsilon toxins (ETX-Y29E, ETX-Y30E, ETX-Y36E and ETX-Y196E). In certain embodiments, the agent described herein comprises a phage lytic enzyme specific for Clostridium perfringens Type B or D bacterial strain. In some embodiments, such phage lytic enzyme is a muramidase PlyCM derived from strain ATCC 13124. In certain embodiments, the agent is a probiotic supplement comprising C. perfringens type A or other bacteria type that can effectively outcompete Clostridium perfringens type B or D, with no other C. perfringens toxinotype. In certain embodiments, the probiotic supplement contains C.} perfringens type A bacterial strain since its toxinotype has been shown to outcompete C. ^{perfringens type B. Typical bacteria strains included in probiotic supplement preparations include,} _{but are not limited to, Lactobacillus acidophilus, L. bulgaricus, L. casie, L. fermentum, L.} Plantarum, Rhodoseudomonas palustris, Saccharomyces cerevisiae, and Steptococcus ^{thermophiles. In certain embodiments, the bacteriophage lytic enzyme described herein is for delivery in a probiotic organism by genetically engineering that organism to expressed enzymes specifically lytic to Clostridium perfringens. In certain embodiments, the agent is a bacteriophage therapy. C. perfringens specific bacteriophages eliminate C. perfringens in the host with little or no consequence on the healthy microbiota. C. perfringens specific bacteriophages include, but are not limited to, Siphoviridae, and with short noncontractile tails, members of the family Podoviridae.} I_{n some such embodiments, the bacteriophage is bacteriophage ΦCPV1 and multivalent bacteriophage cocktail designated. In other embodiments, the bacteriophage comprises a phage lytic enzyme, e.g., a lysin, that is specific for C. perfringens types B and/or D. One such lysin, a muramidase from strain ATCC 13124 (termed PlyCM) has been identified.32 Lysins specific for Clostridium perfringens can also be delivered to subjects through genetically engineered probiotics. Probiotic strains expressing lysin genes that specifically hydrolyze the peptidoglycan or other components of the Clostridium perfringens cell wall can be utilized to kill Clostridium} ^{perfringens. In certain embodiments, the agent is a vaccine against Clostridium perfringens type B or type D bacterial strain, or the epsilon toxin (ETX) produced therefrom. Several anti-ETX vaccines have been developed and employed to protect animals from Clostridium perfringens infections, and recombinant forms are in development. Vaccines and/or methods of making thereof, for Clostridium perfringens bacterial strains are well known in the art and/or described, for} _{example, in U.S. Patent No. 9,758,573, U.S. Pat. No. 6,403,094 to Titball et al.; Titball (Vaccine 27, 2009, D44-D47); and other literatures, for instance, Chandran et al. (Clinical and Vaccine Immunology, 2010, p. 1013-1016); and de la Rosa et al. (J ANIM Sci 1997, 75: 2328-2334), the entire contents of each of which are incorporated by reference in its entirety. In certain embodiments, the agent described herein comprises antibiotics sufficient to kill off C. perfringens type B or D bacterial strain. Antibiotics found to be effective against C.} ^{perfringens include, but are not limited to, penicillin, ampicillin, amoxicillin, metronidazole, erythromycin, and tylosin.} _{U.S. Patent No. 9,758,573 is also specifically incorporated by reference herein for its disclosure of methods of administration of relevant therapeutic agents. U.S. Patent No. 9,758,573 is also} ^{specifically incorporated by reference herein for its disclosure of pharmaceutical compositions (including excipients). Any agent described herein can be administered alone or in combination with any suitable second agent to enhance the effect for prevention and/or treatment of MS in human, and/or reduce any symptoms associated with MS. In some embodiments, administering an epsilon toxin treatment agent is done conjointly with (e.g., before, concomitantly, or after) any MS therapy known in the art (e.g., standard-of-care treatment and off-label use of therapeutics). For example, and without limitation, such MS therapies may include Avonex® (interferon beta-1a), Betaseron® (interferon beta-1b), Copaxone® (glatiramer acetate), Extavia® (interferon beta-1b), Glatiramer Acetate Injection (glatiramer acetate -generic equivalent of Copaxone 20 mg and 40 mg doses), Glatopa® (glatiramer acetate - generic equivalent of Copaxone 20mg and 40mg doses), Kesimpta® (ofatumumab), Plegridy® (peginterferon beta-1a), Rebif® (interferon beta-1a), Aubagio® (teriflunomide), Bafiertam™ (monomethyl fumarate), Dimethyl Fumarate (dimethyl fumarate - generic equivalent of Tecfidera),} _{Gilenya® (fingolimod), Mavenclad® (cladribine), Mayzent® (siponimod), Ponvory™ (ponesimod), Tascenso ODT® (fingolimod), Tecfidera® (dimethyl fumarate), Vumerity® (diroximel fumarate), Zeposia® (ozanimod), Briumvi™ (ublituximab), Lemtrada® (alemtuzumab), Novantrone® (mitoxantrone), Ocrevus® (ocrelizumab), Tyruko® (natalizumab- sztn) , Tysabri® (natalizumab), Rituximab, and/or Glucocorticoids (oral or IV). Purely for exemplary purposes, a subject afflicted with MS, or otherwise suspected of having MS, may be identified as a candidate for epsilon toxin treatment by the methods disclosed herein (e.g., detection of the ETX gene in a fecal sample from the subject as described herein). Epsilon toxin treatment with the agent(s) and methods disclosed herein may be performed in conjunction (e.g., (before, concomitantly, or after) with any MS therapy known in the art (e.g., standard of care treatment and off-label use of therapeutics for MS). In some embodiments of the invention contemplated herein, treatment (e.g., epsilon toxin treatment and/or MS treatment) may be evaluated or otherwise monitored by the methods disclosed herein (e.g., detection of lymphocyte-bound ETX in a blood sample from the subject as described herein).} ^{Subjects/Patient Populations and MS In some embodiments of any of the methods provided herein, the subject is a subject} _{suffering from or diagnosed with MS. In some embodiments, the subject is a subject having one, two, three, four, five or more symptoms of MS (e.g., any of the symptoms described} ^{herein). In some embodiments, the subject is suspected of having MS (e.g., based on preliminary evaluation or presence of one or more symptoms). In other embodiments, the subject is a subject at risk of MS. In some embodiments, the subject is a subject whose MS has relapsed. In some embodiments, the subject is a subject whose MS at risk of relapse or progression. In particular, in some embodiments, the detection methods described herein are performed after the subject is selected based on one of the above-mentioned parameters (such as diagnosis of MS, suspicion of MS, or having one or more symptoms of MS). In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. The MS of the subject may be sufficiently dramatic so as to physically impair the patient or so mild as to not cause the patient to seek medical attention. MS may be stratified into several general disease courses: (1) relapsing/remitting MS (RRMS), characterized by self-limiting attacks of neurological dysfunction manifesting acutely, over the course of days to weeks, followed by a period of recovery, sometimes incomplete, over several months; (2) secondary progressive MS (SPMS), evolving from RRMS but changing such that the clinical course becomes characterized by steady deterioration in function unrelated to acute attacks; (3) primary progressive MS (PPMS), characterized by a steady decline in function from onset, with no acute attacks; and (4) progressive/relapsing MS (PRMS), also beginning with a} _{progressive course, with occasional attacks superimposed on the progressive decline in function. Clinically isolated syndrome (CIS) is a further term that describes the first clinical onset of potential multiple sclerosis (MS), typically applied to young adults with episodes of acute or subacute onset, which reaches a peak quite rapidly within 2–3 weeks. Recovery from attacks generally occurs within weeks to several months from the peak of symptoms, although rarely some recovery may continue for 2 or more years. MS may also be described as inactive MS, characterized by fixed neurologic deficits of variable magnitude. Common symptoms of MS include, without limitation, sensory disturbances (e.g., in the limbs), an abnormal feeling of pain motor dysfunction (such as walking or gait dysfunction), muscle weakness in one or more limbs, spasticity, fatigue, optic nerve dysfunction (e.g., visual blurring due to optic neuritis), diplopia, pyramidal tract dysfunction, bladder dysfunction, bowel dysfunction, sexual dysfunction, loss of sensation, tremor, dizziness, and ataxia. In some embodiments, the detection methods described herein are practiced on MS patient who has one or more of any of the symptoms known in the art or described herein or known in the art. In some embodiments, the detection methods described herein are practiced on MS patient who has one or more of: sensory disturbances (e.g., in the limbs), motor dysfunction (such as walking or gait} ^{dysfunction), muscle weakness in one or more limbs, spasticity, fatigue, optic nerve dysfunction (e.g., visual blurring due to optic neuritis), diplopia, pyramidal tract dysfunction, bladder dysfunction, bowel dysfunction, sexual dysfunction, loss of sensation, tremor, dizziness, and ataxia Patients having MS are typically evaluated using a motor skills assessments known in the art, and with an MRI. Motor skills assessments include the Expanded Disability Status Scale (EDSS), the Scripps Neurological Rating Scale (SNRS), the Ambulatory Index, and the Multiple Sclerosis Functional Composite score (MSFC). Progression of MS may also be assessed by a determination of the attack rate, and by magnetic resonance imaging (MRI), which can detect neural lesions associated with MS (e.g., new lesions, enhancing lesions, or combined unique active lesions). In some embodiments, provided herein is a method of treating a patient having MS, e.g., an individual who has been diagnosed with MS and identified as a suitable recipient of epsilon toxin therapy by the methods disclosed herein, comprising administering to the individual an agent disclosed herein. In some such embodiments, the administering epsilon toxin therapy detectably improves or stabilizes one or more symptoms of MS in the patient. For example and without} _{limitation, epsilon toxin therapy may improve or stabilizes a motor skills assessment score and/or lesion evaluation by MRI. SPECIFIC NUMBERED EMBODIMENTS Specific embodiments of the disclosure are set forth in the following numbered paragraphs. 1. A method for diagnosis or prognosis of a human subject at risk for multiple sclerosis (MS) comprising: a) obtaining a fecal sample from said human subject; b) detecting the relative abundance of epsilon toxin gene (ETX)-harboring and alpha toxin gene (CPA)-harboring strains of C. perfringens in the fecal sample from said human subject by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) to determine a cycle threshold for the ETX and CPA genes, wherein 2–∆∆Ct analysis is used to quantify the relative abundance of ETX-harboring (CPA+, ETX+) over non- ETX strains (CPA+, ETX-) in the sample; and c) diagnosing the subject at risk of multiple sclerosis, wherein a 2–∆∆Ct value of > 1 indicates dominance of ETX-encoding strains with increased ETX-plasmid copy} ^{numbers and 2–∆∆Ct value of< 1 indicates a higher percentage of non-ETX strains} o_{f C. perfringens.} ^{2. A method for assessing the risk of a subject developing MS comprising: a) obtaining a fecal sample from said human subject; b) detecting the relative abundance of epsilon toxin gene (ETX)-harboring and alpha toxin gene (CPA)-harboring strains of C. perfringens in the fecal sample from said human subject by Real-Time quantitative Polymerase} C_{hain Reaction (RT-qPCR) to determine a cycle threshold for the ETX and CPA genes, wherein 2–∆∆Ct analysis is used to quantify the relative abundance of ETX-harboring (CPA+, ETX+) over non- ETX strains (CPA+, ETX-) in the sample, wherein a 2–∆∆Ct value of > 1 indicates dominance of ETX-encoding strains with increased ETX-plasmid copy numbers and 2–} ∆^∆Ct value of < 1 indicates a higher percentage of non-ETX strains of C. p^{erfringens; and c) performing a standard-of-care MS evaluation on the human subject if 2–∆∆Ct is >1. 3. A method for assessing the risk of worsening, relapsing, or progressing in a subject developing MS comprising: a) obtaining a fecal sample from said human subject; b) detecting the relative abundance of epsilon toxin gene (ETX)-harboring and alpha toxin gene (CPA)-harboring strains of C. perfringens in the fecal sample from said human subject by Real-Time quantitative Polymerase Chain Reaction (RT- qPCR) to determine a cycle threshold for the ETX and CPA genes, wherein 2–∆∆Ct analysis is used to quantify the relative abundance of ETX-harboring (CPA+,} E_{TX+) over non-ETX strains (CPA+, ETX-) in the sample, wherein a 2–∆∆Ct value of > 1 indicates dominance of ETX-encoding strains with increased ETX-plasmid copy numbers and 2–∆∆Ct value of< 1 indicates a higher percentage of non-ETX strains of C. perfringens; and c) performing a standard-of-care MS evaluation on the human subject if 2–∆∆Ct is > 1. 4. The method of paragraph 2 or 3, wherein a standard-of-care MS evaluation comprises magnetic resonance imaging (MRI), evoked potentials tests, cerebral spinal fluid analysis, and/or blood tests. 5. The method of paragraph 2 or 3, wherein no standard-of-care MS evaluation is performed if 2–∆∆Ct is < 1.} ^{6. A method for preventing or treating multiple sclerosis (MS) in a human subject in need thereof comprising, the method of any one of paragraphs 1 to 3 and administering to the subject a composition comprising an effective amount of an agent that directly or indirectly interferes with epsilon toxin (ETX) produced by the ETX- strains of C. perfringens if 2–∆∆Ct is > 1. 7. The method of paragraph 6, wherein said agent is an inhibitor of ETX. 8. The method of paragraph 7, wherein said inhibitor is an antibody against ETX or a functional component thereof. 9. The method of paragraph 8, wherein said antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, and a recombinant antibody. 10. The method of paragraph 8 or 9, wherein said antibody is a human or humanized antibody. 11. The method of any one of paragraphs 8 to 10, wherein said antibody is a neutralizing antibody against ETX or a functional component thereof.} _{12. The method of paragraph 6, wherein said agent is an inhibitor or antagonist of an ETX-binding receptor. 13. The method of paragraph 12, wherein said ETX-binding receptor is expressed on endothelial cells of blood brain barrier (BBB) for which ETX is a ligand. 14. The method of paragraph 12, wherein said ETX-binding receptor is a tetraspan integral membrane receptor. 15. The method of paragraph 14, wherein the tetraspan integral membrane receptor is myelin- and-lymphocyte protein (MAL) or Hepatitis A Virus Cellular Receptor I (HAVCRI). 16. The method of paragraph 6, wherein the agent is a soluble ETX-binding receptor protein. 17. The method of paragraph 16, wherein the soluble ETX-binding receptor protein is soluble HAVCRI or a fragment thereof. 18. The method of paragraph 16, wherein the soluble ETX-binding receptor protein is soluble MAL or a fragment thereof. 19. The method of paragraph 6, wherein said agent is a phage lytic enzyme specific for Clostridium perfringens Type B or D bacterial strain.} ^{20. The method of paragraph 19, wherein said phage lytic enzyme is a muramidase derived from strain ATCC 13124, such as PlyCM.} _{21. The method of paragraph 6, wherein said agent is a vaccine against} C^{lostridium perfringens type B or type D, or the ETX produced therefrom. 22. The method of paragraph 6, wherein said agent is a probiotic supplement comprising C. peifringens type A or other bacteria type that can effectively outcompete Clostridium perfringens type B or D, with no other C. perfringens toxinotype. 23. The method of paragraph 6, wherein said agent is an antibiotic sufficient to kill off C. perfringens type B and/or D. 24. The method of paragraph 6, wherein the agent is not administered to the subject if 2–∆∆Ct is <1. 25. A method for determining the relative abundance of epsilon toxin (ETX)- producing strains of C. perfringens within the gut microbiome of a subject} c_{omprising: a) obtaining a fecal sample from said human subject; b) detecting the relative abundance of epsilon toxin gene (ETX)-harboring and alpha toxin gene (CPA)-harboring strains of C. perfringens in the fecal sample from said human subject by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) to determine a cycle threshold for the ETX and CPA genes, wherein 2–∆∆Ct analysis is used to quantify the relative abundance of ETX-harboring (CPA+, ETX+) over non-ETX strains (CPA+, ETX-) in the sample; wherein a 2–∆∆Ct value of > 1 indicates dominance of ETX-encoding strains with increased ETX-plasmid copy numbers and 2–∆∆Ct value of < 1 indicates a higher percentage of non-ETX strains of C. perfringens.} ^{26. The method of any one of paragraphs 1 to 25, wherein detecting the relative abundance of ETX-harboring strains of C. perfringens comprises} R_{T-qPCR employing at least one ETX-targeting primer selected from 5'- CATACTGTGGGAACTTCGATACA-3' and 5'- TCTTGTGAAGGGACATTATGAGTAA-3'.} ^{27. The method of paragraph 26, wherein detecting the relative abundance of} E_{TX-harboring strains of C. perfringens comprises RT-qPCR employing} ^{each of ETX-targeting primers 5'-CATACTGTGGGAACTTCGATACA-} 3_{' and 5'- TCTTGTGAAGGGACATTATGAGTAA-3'.} ^{28. The method of paragraph 26 or 27, wherein detecting the relative abundance of ETX- harboring strains of C. perfringens comprises RT- qPCR employing a fluorogenic probe comprising sequence AGCAACTGCTAAGTTTACTGTTCCT. 29. The method of any one of paragraphs 1 to 28, wherein detecting the relative abundance of CPA-harboring strains of C. perfringens comprises RT-qPCR employing at least one CPA-targeting primer selected from 5'- CTTGGAGAGGCTATGCACTATTT-3' and 5'- TTGCAACCTGCTGTGTTTATTT-3'. 30. The method of any one of paragraphs 1 to 29, wherein detecting the relative} a_{bundance of CPA-harboring strains of C. perfringens comprises RT-qPCR employing each of CPA- targeting primers 5'- CTTGGAGAGGCTATGCACTATTT-3' and 5'- TTGCAACCTGCTGTGTTTATTT -3'. 31. The method of paragraph 29 or 30, wherein detecting the relative abundance of CPA- harboring strains of C. perfringens comprises RT-qPCR employing a fluorogenic probe comprising sequence TTACTGCCGTTGATAGCGCAGGAC. 32. The method of any one of paragraphs 1 to 31, wherein detecting the relative abundance of ETX-harboring and CPA-harboring strains of C. perfringens comprises RT-qPCR for C. perfringens abundance employing at least one C.} p^{erfringens-specific 16S rRNA primer selected from 5'- AGATGGCATCATCATTCAAC-3'and 5'- GCAAGGGATGTCAAGTGT-3'. 33. The method of any one of paragraphs 1 to 32, wherein detecting the relative} a_{bundance of ETX-harboring and CPA-harboring strains of C. perfringens comprises RT-qPCR for C. perfringens abundance employing each of C.} p^{erfringens-specific 16S rRNA primers 5' - AGATGGCATCATCATTCAAC- 3'and 5'-GCAAGGGATGTCAAGTGT-3'. 34. The method of paragraph 32 or 33, wherein detecting the relative abundance} o_{f ETX- harboring and CPA-harboring strains of C. perfringens comprises RT-qPCR for C. perfringens abundance employing a fluorogenic probe comprising sequence AGAGTGCAGGAGAGGAGAGTGGAA.} ^{35. The method of any one of paragraphs 1 to 34, wherein quantifying the relative abundance of ETX-harboring (CPA+, ETX+) over non-ETX strains (CPA+, ETX-) in the sample comprises RT-qPCR employing ETX-targeting primer pair: 5'-CATACTGTGGGAACTTCGATACA-3' and 5'- TCTTGTGAAGGGACATTATGAGTAA-3', and fluorogenic probe comprising sequence: AGCAACTGCTAAGTTTACTGTTCCT; and CPA-} t_{argeting primer pair: 5'- GCATGAGTCATAGTTGGGATGA-3' and 5'- CTGATGGATCATTACCCTCTGATAC -3', and fluorogenic probe comprising sequence TGGGACTATGCAGCAAAGGTAACTTTAGC. 36. The method of any one of paragraphs 1 to 35, wherein RT-qPCR comprises employing Universal 16S rRNA primers 5'-GCGAGACTGCCGGTAATAAA -3', and 5'- TCGTTGTACCAGCCATTGTAG -3', and fluorogenic probe comprising sequence CCCTTATGACCTGGGCTACACACG.} 3^{7. A composition for preventing or treating multiple sclerosis (MS) in a patient} i_{n need comprising a pharmaceutically acceptable excipient and an effective amount of the agent of any one of paragraphs 6 to 24.} EXAMPLES ^{Example 1: The MS gut microbiome harbors ETX-producing C. perfringens strains. Based on a statistical power calculation (Methods), 62 participants were recruited under the IRB protocol: Harboring the Initial Trigger of Multiple Sclerosis (HITMS), consented, and received instruction on self-collection of fecal samples. Healthy controls (HC) and MS participants were matched for age, gender, body-mass index, location of residence at time of fecal sample donation, and ancestry/ethnicity (Figure 9). Inclusion into the MS arm required a diagnosis of confirmed MS based on the 2010 revised McDonald} _{criteria (65). Participants having a 1st or 2nd degree relative with a diagnosis of MS, or a clinically isolated syndrome were excluded from the HC arm. Full inclusion and exclusion criteria are detailed herein. It was recognized that ETX-producing strains of C. perfringens would likely be in relative low abundance in human fecal samples based on the results of previous surveys and because the ecological niche of these mucosal-adherent bacteria is in the small intestine, a site known to be vastly underrepresented in fecal samples. Low abundance in fecal samples} ^{likely renders C. perfringens types B or D undetectable by metagenomics sequencing commonly utilized in MS microbiome studies. PCR was therefore utilized, a more sensitive approach for gene detection than shot-gun metagenomics, to examine whether the etx gene is present in human gut microbiota. Density gradient centrifugation, Nycodenz, was used because separation of bacteria from non-microbial fecal matter removes PCR inhibitors, provides a more accurate representation of bacterial composition, and enhances recovery of the Phylum Bacillota (Firmicutes), and in particular the Class Clostridia (Figure 1A). The initial screen detected an occurrence of etx in 61% of MS patients and 13% of controls (Figure 1B). To confirm etx-positive study participants, an independent PCR was conducted, targeting a different region of the etx gene (Figure 1C). The identities of all PCR products were verified by Sanger sequencing. The cpa/plc gene, common to all C. perfringens strains, and the 16S ribosomal RNA gene specific to C. perfringens, were also detected in those etx-} _{positive participants (Figure 1C), as anticipated, since only C. perfringens are known to naturally encode the etx gene. A Fisher's exact test of independence showed that etx is significantly associated with disease status (MS vs. HC) with p = 0.0002 (Figure 1D). The odds ratio of etx-positivity, MS vs HC, is 10.7, 95% CI: 2.9871 to 38.2381, p = 0.0003. A multivariable logistic regression with etx- or etx+ status as a binary outcome was further conducted to determine if disease status (MS vs. HC) as a whole or stratified by disease modifying treatment is associated with etx status, independent of sex. It was found that the disease status was independently associated with etx status, even when adjusting for sex. In addition, the disease status (MS vs. HC), with or without treatment, was independently associated with etx status, adjusting for sex. The prevalence of fecal etx positivity in our analysis is consistent with a previously reported frequency of ETX immunoreactivity in sera from people with clinically definite MS (43%) and age-matched controls (16%). This suggests a high translation rate of the C.} ^{perfringens type B/D virulence factor, etx, and that the human gastrointestinal tract is a suitable environment for C. perfringens types B/D growth. The relative abundance of etx in fecal microbiota harvested from people with MS and HC was next assessed. Quantitative analysis of etx abundance relative to universal 16S by} _{TaqMan real-time PCR was performed using a modified 2-ΔCt method. The 2-ΔCt method allows normalization of real-time, quantitative PCR data to an internal reference. The abundance of etx relative to universal 16S in MS and HC was assessed and it was found that} ^{etx abundance is significantly increased in fecal microbiota harvested from people with MS} _{compared to HC (Figure 2, A and B).} C^{. perfringens type A strains, defined by presence of the chromosomally encoded alpha} _{toxin gene, cpa, but none of the other major toxin genes, are human intestinal commensals. C.} ^{perfringens type B strains carry the cpa, cpb, and etx toxin genes, whereas C. perfringens type D strains carry the cpa and etx genes. PCR analysis identified cpa in 74% of MS patients compared to 45% of controls (Figure 10, A-C). When cpa prevalence was analyzed in subgroups of participants, according to the presence or absence of etx, cpa is coexistent with the etx gene in etx+ participants (Figure 10D). Notably, cpa prevalence among etx-negative} _{participants is essentially indistinguishable between people with MS and HCs (Figure 10D). These results suggest non-etx strains (cpa+, etx-) are unlikely to be involved in MS. TaqMan real-time PCR showed a significant increase in cpa abundance for MS compared to controls (Figure 2C). No statistical difference for cpa abundance was found among subgroups according to etx presence/absence (Figure 2, D and E). Neither prevalence nor abundance of} ^{cpa from etx-negative participants differed between MS and HC, ruling out a role for non-etx} _{strains in MS pathogenesis. However, an increase in cpa prevalence in the MS group (etx- and} ^{etx+ combined) compared to HC suggests that people with MS may have a more suitable} _{gastrointestinal environment for the survival and growth of C. perfringens. Quantification by TaqMan real-time PCR simultaneously targeting genes encoding} C. perfringens-specific 16S rRNA and universal 16S rRNA confirmed an increase of C. ^{perfringens abundance in MS compared to controls (Figure 11A). Using the 2-ΔΔCt method with pure reference strains as calibrators, MS participants trended toward higher percentages of C. perfringens in fecal microbiota when compared to controls but this did not achieve statistical significance (Figure 11, B-D). Of note, the estimates agree with the} _{previously reported range (0.000001 - 0.01%) of C. perfringens abundance in fecal microbiota from healthy humans, confirming the organism's low-abundance. The 2018 revised classification scheme for C. perfringens defines 7 distinct toxinotypes based on carrying one or more of six major toxin genes (plc/cpa, cpb, etx, lap and} lab, cpe, and netB). Multiplex PCR was performed for the major toxins used to characterize ^{C. perfringens toxinotypes. The majority of etx+ MS participants harbor C. perfringens type} _{D strains (etx+, cpa+) with fewer type B (etx+, cpa+, cpb+) strains detected (Figure 2F).} ^{C. perfringens enterotoxin (cpe), which is the main agent of C. perfringens-mediated human} _{food poisoning, was not detected. Notably, unlike the more sensitive singleplex PCR} ^{(Figure 1C), etx and cpa appear to be absent in some participants by multiplex PCR, likely due to issues of annealing temperature compatibility among individual primer pairs in the} _{multiplex PCR system. The apparent variations of etx/cpa band intensity ratios among participants, which differ from that of reference strains, suggest some participants likely harbor a community of combined type A strains (cpa+) and type B/D strains (cpa+, cpb+,} ^{etx+ or cpa+, etx+). The significance of etx-positivity in the healthy controls was next examined. The multiplex PCR result suggests that there is a distinctive lack of or weakened etx band in the group of four etx-positive HC participants (Figure 2F) despite etx being clearly detected in singleplex PCR (Figure 1, B and C). To understand this phenomenon, a sensitive} _{TaqMan real-time PCR was developed to simultaneously target etx and cpa genes and used the 2-ΔΔCt analysis to quantify the relative abundance of etx-producing (cpa+, etx+) over non-etx strains (cpa+, etx-) from etx+ positive MS and HC groups (Figure 2G). The 2-ΔCt value was computed to quantify fold changes of the etx/cpa ratio when a pure type D (cpa+,} ^{etx+) culture was used as a calibrator. A value of 1 was set as the 2-ΔΔCt for the type D} _{calibrator. We reasoned that 2} ^-ΔΔCt _{> 1 indicates the dominance of etx-encoding strains with increased etx-plasmid copy numbers, and that 2-ΔΔCt < 1 indicates a higher percentage of C.} ^{perfringens type A (cpa+) in the bacterial community. The results revealed significantly increased 2-ΔΔCt values for the etx/cpa ratio in people with MS compared to controls (Figure 2H). Since a 2-ΔΔCt value 1 would suggest that 100% of a participant's C. perfringens strains are etx-harboring (i.e., type B and/or type D), a maximum estimate of the average percentage of etx-harboring strains in the C. perfringens community for MS or HC was then obtained. The analysis shows that etx+ MS participants contain 32% etx-harboring strains and 68% non-etx C. perfringens strains (Figure 21). In contrast, etx+ healthy controls contain 0.002%} _{etx-harboring strains and nearly 100% non-etx C. perfringens strains. Analysis from a different perspective by quantifying the abundance of etx over C. perfringens-specific 16S rRNA yielded a higher estimate of the percentage of etx-harboring strains; 43% in MS and a lower percentage, 0.001%, in controls (Figure 12). Together, these data consistently show that people with MS are more likely to be colonized by etx+ strains of C. perfringens in their gut microbiome than are age and gender matched HCs. The data suggest that there is likely a yet-to-be-defined threshold of relative abundance of ETX-producing strains, with relative abundance beyond this threshold} ^{contributing to MS. The complex dynamic between C. perfringens type A strains and the} _{etx-encoding strains is likely important since type A strains compete with other C.} ^{perfringens strains for resources and because conjugative transfer between etx plasmid-} _{harboring type D and etx-negative type A has been previously demonstrated in vitro.} ^{Example 2: Comparison of patient-derived, laboratory, and environmental isolates. To determine if MS patient-derived isolates shared features with known environmental isolates and if they produced functional ETX, whole genome sequencing of an MS patient derived isolate (SHDS0050), several environmental isolates, including type D strains isolated from ruminants, and the laboratory type B strain was conducted. A closed 54.5 kb MS patient-derived plasmid, pSHDS0050 (Figure 3A) was successfully sequenced. This plasmid contained 63 ORFs and an etx locus flanked by mobile genetic elements. As with other etx plasmids, pSHDS0050 had a Tn3 (in the opposite orientation) and an IS1151} _{transposase upstream of etx, but had two IS256 and a mutator type transposase directly after (Figure 3C). The plasmid resembled other highly conjugative plasmids of the pCW3 family that are found in C. perfringens strains, as it contained the tcp locus and other genes associated with conjugation and the central control region containing the parMRC partitioning system. The plasmid lacked other toxin genes such as cpe or cpb. When comparing the MS patient derived type D plasmid to the other etx-containing type B and D plasmids sequenced in herein, pSHDS0050 maintained the same conserved genes such as} ^{regB, pemK, amidoligase, permease, RICIN domain containing genes, and a radical SAM gene (Figure 3C). Interestingly, pSHDS0050 had identical plasmid architecture to the sheep isolate NCTC8346 and the goat isolate FU17 (Figure 3C), which suggests ruminants may be} a potential vector for infecting humans as originally hypothesized previously. Although _{sharing much of the same genomic content, these type D plasmids were neither as large as the 64.7 kb etx plasmids sequenced herein from type B strains ATCC3626 and NCTC3110 nor the published type B strain, NCTC8533 (Figure 3C). pSHDS0050 lacked genes such as} ^{cpb2, thiF and pri present in those plasmids. The circularized chromosomes of the type D strains CN3842, NCTC8346, and FU17, and the type B strains ATCC3626 and NCTC3110 were then compared to ensure} _{that patient strain SHDS0050 was not a collection strain contamination. A GView BLAST atlas plot reveals that the patient-derived strain has multiple unique regions within its chromosome, distinguishing it from the other isolates (Figure 3B).} ^{To evaluate proETX production and pathogenicity, SHDS0050 was cultured, the ATCC type B strain, and a ATCC type F strain in TGY broth, under anaerobic conditions, and then the supernatants assessed for proETX by Western blot. The MS patient-derived strain produced an —32.9 kDa proETX protein of similar mobility to the ATCC type B strain (Figure 3D). The ATCC type F strain was negative for ETX production, as anticipated. To evaluate cytotoxicity, harvested supernatants were treated with trypsin to activate ETX. Next, CHO cells expressing the human ETX receptor, MAL (hMAL-CHO), or control CHO cells expressing GFP (GFP-CHO) were treated with trypsin-activated supernatants. Cell death was determined by propidium iodide (PI) exclusion assay. To confirm that the cytotoxic effects were ETX mediated, trypsin-activated supernatants were also treated with a neutralizing anti-ETX antibody prior to hMAL-CHO cell treatment. Only the trypsin- activated supernatants from the Lab type B and MS patient-derived type D strain, SHDS0050, induced hMAL-CHO cell death (Figure 3E). Cell death was not observed in hMAL-CHO cells treated with broth alone, and GFP-CHO cells were insensitive to all treatment conditions (Figure 3E). Anti-ETX antibody treatment inhibited hMAL-CHO cell death, indicating the supernatant cytotoxicity was ETX mediated. Collectively, these data} _{indicate that the patient-derived C. perfringens type D strain possesses typical type D plasmid architecture, is competent to produce functional ETX, and conceivably could have arisen from a ruminant source. Single nucleotide polymorphisms (SNPs) in bacteria genes have been linked to microbial fitness and the ability of pathogens to cause disease. Large-scale genomic analyses have identified abundant SNPs in the C. perfringens genome. To characterize these variants, 17 etx genes were collated with coding DNA sequences (CDS) available through the National Center for Biotechnology Information (NCBI) database and performed a comparative alignment analysis. The SNP at site 762, carries the least conserved SNP among the 6 that we identified, and is the only SNP present in the coding sequence of activated ETX. At the 762 site, G substitutes for A as the minor allele regardless of C. perfringens toxinoptype (Figure 13C). The etx genes isolated from the human fecal samples as described herein predominantly carry the minor allele at site 762 (95%, 20/21), 762G (Figure 13D). This variant results in a synonymous mutation at residue 254 (Ser, corresponding to residue 222 in activated ETX) in the receptor binding domain. Emerging evidence indicates that synonymous mutations, previously assumed to be phenotypically neutral, contribute to} ^{microbial fitness. Furthermore, synonymous mutations can impact mRNA secondary} _{structure, protein translation and protein folding.} ^{Example 3: ETX overcomes CNS immune privilege. Circulating myelin-autoreactive lymphocytes are common in the general population. Despite the prevalence of myelin autoreactive lymphocytes amongst humans, widespread autoimmunity is minimized by mechanisms of peripheral tolerance and CNS barriers to preserve immune privilege. The importance of CNS barriers in maintaining immune privilege is well-demonstrated in active immunization models of EAE. In this model system, animals are immunized with a myelin antigen, typically a myelin specific protein or peptide, in complete Freund's adjuvant (CFA). In most paradigms, immunized animals do not develop clinical or histologic CNS disease unless they also receive PTX, which targets CNS endothelial cells at the BBB. Similarly, in many myelin peptide- specific T cell receptor (TCR) transgenic models, EAE occurs infrequently unless animals receive PTX, despite the TCR repertoire being biased toward unusually high frequencies of autoreactive clones. Although PTX is extensively used in EAE to overcome immune privilege, it is clinically irrelevant to MS. Knowing that blood-borne ETX specifically targets CNS endothelial cells, whether} _{ETX was sufficient to breach CNS immune privilege in the presence of circulating myelin autoreactive lymphocytes was tested, and a widely-used immunization model of EAE using the immunodominant peptide in the myelin oligodendrocyte glycoprotein (MOG) was adapted. On day 0, female C57BL/6 mice received a subcutaneous (SC) injection of 200 µg of synthesized mouse MOG35-55, emulsified in 50 µl of CFA. On days 0 and 2, mice received either PTX at 5µg/kg body weight (`~100 ng per mouse), ETX at 50 ng/kg body weight (~1 ng per mouse), or ETX at 500 ng/kg body weight (~10 ng per mouse), all delivered intraperitoneally (IP). ETX, like PTX, was sufficient to induce clinical disease in mice immunized with MOG35-55 (Figure 4A). In the absence of either toxin, MOG35-55 immunized animals remained healthy, without an observable phenotype. Disease activity induced by ETX occurred at doses significantly lower than that of PTX (5 ng/kg or 50 ng/kg for ETX, and 5µg/kg for PTX). Onset, temporal course, and peak clinical deficits were similar for ETX- and PTX-induced EAE when using the classical EAE scoring scale (Figure 4A). The magnitude of demyelination in the spinal cord and the ultrastructural characteristics of demyelination were similar comparing ETX-induced EAE to PTX induced EAE (Figure 4,} ^{B and C). These results indicate that ETX is a potent inducer of EAE in the context of a} _{MOG35-55/CFA immunization paradigm.} ^{Example 4: ETX-EAE induces multi focal demyelination ETX-EAE groups displayed a wider array of behavioral deficits when compared to PTX-EAE, including ataxia, head tilt, imbalance, axial rotation, and left/right leaning, as captured by the atypical EAE scoring scale (Figure 5A and Figure 14). Demyelination in PTX-EAE mice was largely restricted to the spinal cord (Figures 4 and 5). In contrast, ETX-EAE mice developed multifocal demyelination more typical of MS (Figure 5B). Compared to PTX-EAE, ETX-EAE mice had nearly twice as many lesions in the cerebellum, and lesions in the corpus callosum were only observed in the ETX-EAE group (Figure 5C). ETX-induced EAE showed perivenular cuffs of mononuclear cells and mononuclear infiltrates that correlated with demyelination (Figure 15). Comparison of the immune infiltrates in brain and spinal cord between the ETX-and PTX-EAE models was made. Histologic sections in ETX-EAE, PTX-EAE, and controls were examined for infiltrating CD4+ lymphocytes. While both models induce similar demyelination in the spinal cord, PTX-EAE showed significantly more infiltrating CD4+ T cells in the spinal cord compared to ETX (Figure 6, A and E). For the cerebellum, there} _{are significantly more infiltrating CD4+ lymphocytes and more CD4+ lymphocytes in perivascular cuffs in the ETX-EAE model compared to PTX-EAE (Figure 6, B-F). In the thalamus, there was a similar trend toward more peri-venular CD4+ T cell infiltrates in ETX-EAE when compared to PTX-EAE (Figure 6, C-F). In the spinal cord, similar activation of inflammatory processes was observed in both models at peak disease, based on immunohistochemical analysis of phospo-NFKB p65, CD68, and CD45 (Figure 7 and Figure 16). In the cerebellum, however, CD68 is significantly increased in ETX-EAE but not PTX-EAE mice (Figure 7, A-C). A similar trend was also observed in the cerebellum for phospo-NFKB p65 and CD45, but this did not achieve statistical significance (Figure 7 and Figure 16). These results, collectively with data from Figures 4 and 5, indicate that ETX induces multifocal, inflammatory demyelination in a neuroanatomic distribution more consistent with MS, and with a stronger correlation between immune infiltrates and demyelination in the ETX-EAE model compared to PTX-EAE (Figure 17). Human lymphocytes, but not mouse lymphocytes, express the ETX receptor, MAL. While it seemed unlikely that ETX functions to induce active EAE by affecting peripheral} ^{immunity, this possibility was, nevertheless, tested through tracking MOGp-specific T cell cytokine responses via antigen recall experiments. To track the fate of MOGp-specific T cell responses in vivo, naïve, purified MOGp35_55-specific CD4+ T cells were transferred from 2D2 transgenic mice into recipient wild-type B6 mice 24 hours prior to induction of active EAE by subcutaneous immunization with MOGp35-55 in CFA. Immunized mice then received either PBS, 10 µg/kg PTX, or 500 ng/kg ETX immediately after immunization and 48 hours later (Figure 18A). Mice were monitored for onset of clinical disease (Figure 18B) and fourteen days following immunization, single cell suspensions were generated from inguinal lymph nodes, cervical lymph nodes and from the CNS (brain and spinal cord) and processed for either 1) direct analysis of basal cytokine production by flow cytometry (Figure 18C) or 2) for ex vivo re-stimulation with MOGp35-55 for 72 hours to determine} _{cytokine production after antigen recall (Figure 18D). For both sets of experiments intracellular cytokine production was assessed by flow cytometry. MOGp-specific 2D2 were positively defined as CD45+, CD3/5+, CD4+, and Thy1.1+. Frequencies of TNFa, IFNy, or GM-CSF positive CD4+ T cells did not significantly differ between PBS controls and ETX- treatment in cervical or inguinal lymph nodes, except for a small difference in the frequency of TNFa positive T cells from inguinal lymph nodes, following 72 hours of re-stimulation with MOG35-55 (Figure 18D). In CNS tissue, there were no differences noted in the frequencies of TNFa, IFNy, or GM-CSF positive CD4+ T cells between the ETX and PTX treatment groups. These results support the conclusion that ETX is not functioning through significant effects on peripheral immunity and does not impact MOGp-specific T cell responses during the induction of active EAE.} Example 5: ETX and PTX alter the CNS endothelial cell transcriptome to induce genes ^{involved in BBB dysfunction. To gain insight into mechanisms for how ETX and PTX might function in overcoming immune privilege at the CNS endothelial barrier, bulk RNA-seq was conducted on CNS endothelial cells isolated from animals treated with ETX, PTX, or PBS and compared transcriptional profiles.} M_{ice were treated with PBS, ETX (0.5 µg/kg b.w.), or PTX (5 µg/kg b.w) on two consecutive days followed by isolation of CNS endothelial cells from spinal cord for bulk RNA-seq. CNS endothelial cells were isolated from spinal cords, as previously described 16 hours after the second toxin dose. Bulk RNA-seq was performed and analyzed using the} ^{limma-voom workflow. Principal-component analysis (Figure 8A) revealed separation by treatment. PC1 distinguished control from both ETX and PTX, whereas PC2 distinguished ETX from PTX, indicating that the ETX and PTX transcriptomes are more like each other than PBS controls. Identification of 798 differentially expressed genes (DEGs) was made between ETX and PBS treated samples, and 905 DEGs between PTX and PBS treated samples (FDR q-values < 0.10). Of these DEGs, 595 changed in response to both ETX and PTX treatments (Figure 8B). Comparing the fold changes (FC) of the overlapping genes revealed a remarkable consistency in direction and magnitude of differential expression between ETX and PTX treatments (Figure 8C). Considering that PTX is an A-B toxin that} _{functions through ADP-ribosylation of G-proteins and that ETX is a pore forming toxin of the aerolysin family, the consistency in induced and suppressed genes was both intriguing and unexpected. A heat map displaying genes of interest revealed induction of protease, signal transduction, cytokine, and transcription factor genes potentially relevant to overcoming CNS immune privilege (Figure 8D). In Figure 8E, a heat map of genes differentially expressed by ETX and PTX that also were identified by Munji et al. as components of a core set of genes is shown to be involved in BBB dysfunction. The overall gene induction in endothelial cells isolated form PTX or ETX-treated mice shares a great degree of overlap (Figure 8F). Further analysis with of the RNA-seq data identified signaling pathways preferentially activated by ETX (Figure 8G).} ^{Example 6: Discussion of Examples 1-5 It was presumed that the factors responsible for the formation of the initial lesions in MS are the same factors responsible for new lesion formation throughout the course of the disease. That is, environmental triggers for MS likely do not occur once at disease initiation, but rather, arise repeatedly throughout the course of disease. The episodic nature of MS disease activity aligns well with the ETX hypothesis. ETX production occurs when} _{C. perfringens types B or D enter log-phase growth and is thus tied to increased abundance of these strains in the gut microbiome. Brief cycles of log-phase growth, followed by long periods of quiescence, would account for episodic ETX production. MS disease activity is linked to an increased relative abundance of Bacillota (Firmicutes), which includes the Genus Clostridium, suggesting that the MS gut microbiome episodically favors growth of this Phylum. In addition to our findings, it is notable that the species, C. perfringens, is} ^{the most highly associated bacteria with neuromyelitis optica; an immune-mediated,} _{demyelinating disorder affecting the spinal cord and optic nerve.} C^{. perfringens type D is responsible for enterotoxemia in sheep, goats, and less frequently, in cattle. The disease has worldwide distribution and can be acute, sub-acute, chronic, or fatal. Although enterotoxemia type D is an infectious disease that can occur in the form of small outbreaks via the oral-fecal route, it is not a typical contagious disease. A variable number of ruminants harbor C. perfringens type D in their small intestine, but microorganism numbers are generally small and clinical disease does not occur unless the intestinal microbial balance is disrupted. When large quantities of readily fermentable carbohydrates are fed to these animals, undigested starch passes into the small intestine and provides a substrate for C. perfringens to proliferate rapidly. This is followed by production of large amounts of ETX, which is then absorbed into the systemic circulation. The bacteria} _{are passed by feces into the environment and can survive for several months in the soil. Neonates and older animals become infected via the fecal-oral route. The Epstein Barr Virus (EBV) has been proposed as an environmental trigger for MS, potentially functioning through molecular mimicry. In humans, EBV is significantly associated with MS, but seroconversion is itself not sufficient to induce MS as ~94% of the general population is seropositive by age 24, yet MS risk remains relatively low. This suggests that while EBV may play a role in MS pathogenesis, an additional, but less widely distributed causal factor may be required, which we propose to be C. perfringens type B or D. Attorney Docket No. CUW-02661 In summary, a strong clinical association was found between a specific bacterium, its toxin, and a diagnosis of MS. In addition, the abundance of ETX-producing strains of} ^{C. perfringens was found to be significantly elevated in the MS gut microbiome. Provided} _{herein is a biologically plausible mechanism by which ETX functions in the multistep process of CNS autoimmunity.} Example 7: Materials and Methods of Examples 1-5 ^{Statistical Analysis Statistical analysis was performed using GraphPad Prism (v.9; GraphPad) and Microsoft Excel (2016; Microsoft). Data of Gaussian distribution are represented as mean} _{± SEM (standard error of the mean) or SD (standard deviation) wherever appropriate. Data of non-Gaussian distribution are represented as median ± range. Unpaired two-tailed t-test} ^{(for Gaussian distribution) or Mann-Whitney test (non-Gaussian distribution) were used to compare two datasets for statistical significance. For multiple datasets, one-way ANOVA followed by post hoc Tukey's multiple comparisons test (for Gaussian distribution), or Kruskal-Wallis test followed by post hoc Dunn's multiple comparisons test (for non- Gaussian distribution) were carried out to determine statistical significance. For EAE time} _{course analysis, non-parametric Friedman test followed by post hoc Dunn's test was performed. Pearson's correlation analysis was performed to examine whether the density of CNS infiltrating lymphocytes correlates with the extent of demyelination. One phase decay model was employed for curve fitting. Multivariable logistic regression was used to test the difference while adjusting for covariates. Statistical significance of all analyses are stated in figures or legends.} Data and materials availability C^{. perfringens chromosome and plasmid sequences were deposited into GenBank} _{under the following accession numbers (chromosome, plasmid for each strain): C.} ^{perfringens type D CN3842 (CP116428, CP116429), C. perfringens type D NCTC8346} _{(CP116430, CP116431), C. perfringens type D FU17 (CP116432, CP116433), C.} ^{perfringenstype D SHDS0050 (CP116434, CP116435), C. perfringens type B NCTC3110 (CP116436, CP116437), and C. perfringens type B ATCC3626 (CP116438, CP116439).} T_{he RNA-seq data have been deposited in NCBI's Gene Expression Omnibus (Edgar et al., 2002) and are accessible through GEO Series accession number GSE223137} Reagents and Resources Reagent Source Identifier Chemicals, peptides, and recombinant proteins E^{psilon protoxin, from Clostridium perfringens, BEI Resources* NR-856 Strain 34 (Type B)} I_{mmobilized TPCK Trypsin Thermo Scientific 20230} AnaSpec Cat# AS-60130-5 L^{yophilized rat/mouse MOG 35-55 peptide} (_Ac/Amide) L^{ist Biological Cat# 181} B_{ordetella pertussis toxin, lyophilized} ^{BD Difco Cat# BD231141} H_{eat-killed M tuberculosis H37 Ra (TB)} BD Difco Cat# 263810 M ^{butyricum-containing complete Freund's} a_djuvant 4^{% Paraformaldehyde EM fixative NYU EM Core Nycodenz Alere Technologie s Cat# 1002424 Phenol: Chloroform: Isoamyl alcohol Thermo Fisher Cat# BP1752L Proteinase K Sigma Cat# P2308 Lysozyme Thermo Fisher Cat# 89833} R_{Nase A Thermo Fisher Cat# EN0531 Rabbit anti-CD4 monoclonal antibody Abcam Ab183685 [EPR19514] Rat anti-CD45 monoclonal antibody [13/2.3] Abcam Ab10588 Rabbit anti-CD68 polyclonal antibody Abcam Ab125212} R^{abbit anti-p-NFkB p65 (Ser 276) polyclonal GeneTex GTX55113 antibody} E_{xperimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory RRID: IMSR JAX:000664} C^{lostridium perfringens type D patient isolate, Vartanian SHDS0050} L_aboratory Clostridium perfringens type B The Uzal Laboratory ATCC3626 Clostridium perfringens type B The Uzal Laboratory NCTC3110 Clostridium perfringens type D The Uzal Laboratory NCTC8346 Clostridium perfringens type D The Uzal Laboratory CN3842 C^{lostridium perfringens type D FU17 Recruitment of study participants and IRB Harboring the Initial Trigger of Multiple Sclerosis (HITMS) IRB# 1003010940: Patients were prospectively screened for eligibility for the HITMS study by Weill Cornell MS Center Research Coordinators and eligible participants were provided with the study synopsis} _{and the informed consent form to review. HC were recruited by advertising through flyers, website announcements, and recruiting friends of patients (genetically unrelated). Participants wishing to join the study completed and signed the informed consent in the presence of IRB} ^{approved personnel within the MS Center. Enrolled participants were assigned a study number, provided a fecal collection kit consisting of two biohazard bags, 6 x 50 ml sterile conical} _{polypropylene tubes, one freezer box, a blue pad, a fecal collection toilet hat, sterile tongue depressors, and instructions on self-collection of fecal samples.} ^{Criteria for inclusion/exclusion of study participants and sample size Harboring the Initial Trigger of Multiple Sclerosis (HITMS) IRB# 1003010940: Patients were prospectively screened for eligibility for the HITMS study by Weill Cornell MS Center Research Coordinators and eligible participants were provided with the study synopsis and the informed consent form to review. HC were recruited by advertising through flyers, website announcements, and recruiting friends of patients (genetically unrelated). Participants wishing to join the study completed and signed the informed consent in the presence of IRB approved personnel within the MS Center. Enrolled participants were assigned a study number, provided a fecal collection kit consisting of two biohazard bags, 6 x 50 ml sterile conical polypropylene tubes, one freezer box, a blue pad, a fecal collection toilet hat, sterile tongue depressors, and instructions on self-collection of fecal samples. Inclusion criteria: 1. Participants with clinically definite multiple sclerosis (MS) (1) — male and female participants 18 years of age or older who have been accurately diagnosed with MS based on revised McDonald criteria (1). These subjects must have the ability to provide consent} _{and be willing to participate in the study. 2. Healthy controls were enrolled for comparison. Exclusion criteria: Any participant who met the criteria below was excluded from participating in this study: 1. Inability to provide informed consent(2). 2. Any form of dementia or cognitive impairment (2). 3. Current or chronic use of anticoagulants. 4. Pregnancy. 3. Body mass index greater than or equal to 39 or less than or equal to 17.5.5. Use of the following medications within the last 6 months: a) Systemic antibiotics (intravenous, intramuscular, or oral) for greater than 3 days, b) Amylase inhibitors, c) Commercial probiotics consumed at cfu's > 108 organisms per day). 6. Chronic immunodeficiency, renal, metabolic, pancreatic, hepatic, gastrointestinal (Crohn's Disease, Ulcerative colitis), pulmonary, or cardiovascular disease requiring ongoing treatment. 7. Hematologic disease, derangements, blood dyscrasias, unrelated to standard of care MS treatments. 8. Major dietary changes (e.g., omnivore to vegan, vegan to omnivore) in the 3 months prior to fecal sample collection. 7. Chronic alcohol consumption defined as more than 5 oz (or 5 drinks) or ethanol per day. 8. Any history of fecal microbiota transfer. Many of the above criteria were based on the NIH Human Microbiome Project Core Microbiome} ^{Sampling Protocol A. Sample size: the power calculation was based on a dichotomous result of being etx- positive or negative. Estimation of the incidence of being etx-positive was 10%} _{in the HC group and 40% in the MS group. The Alpha was set at 0.05, Beta at 0.2, and a Power of 0.8. This resulted in a calculated sample size of 62 participants with 1:1 enrolment of 31 HC and 31 MS participants.} ^{Fecal microbiota separation and DNA extraction Stool samples were collected from 31 MS patients and 31 healthy donors and stored in a locked 80°C freezer. Frozen samples were thawed in a Whitley A35 HEPA workstation set at 37°C with 40% humidity for an hour. A part of each stool sample was subjected to Nycodenz density gradient for separating the microbiota from other fecal materials, and each fecal sample was sampled at minimum 3 times. Two grams of feces were aseptically transferred with a sterile tongue depressor to 18 mL of 0.9% NaCl prepared in ultrapure water, containing 16, 2 mm sterile metal beads, and homogenized by vortexing for 2 minutes. 10.5 mL of homogenized feces were added onto the top of 3.5 mL of 80% (w/v) Nycodenz in ultrapure water, and} _{centrifuged at 10,000 g for 1 hour at 4 °C. The layer corresponding to microbiota was collected, washed twice with 1 mL PBS, and resuspended in 1 mL PBS. Bacteria were digested with lysozyme, RNase A, and proteinase K, lysed with sodium sarkosyl. From lysates DNA was extracted with phenol, precipitated with 100% ethanol, and finally re-suspended in sterile ultrapure water for subsequent standard PCR and quantitative PCR analyses. C. perfringens reference strains, including ATCC 3626, ATCC 13124, ATCC12915, and FD203, were grown on Rapid Perfringens Medium (RPM) overnight. Bacteria were harvested by centrifugation at 4000 rpm for 10 min at 4 °C and followed by total DNA extraction as descried above. DNA from reference strains were included in both standard PCR and quantitative PCR analyses as controls or calibrators.} ^{Detection of the etx gene and toxinotyping of C. perfringens communities For the detection of etx and other genes indicated in the study, simplex and multiplex PCRs} _{were performed with DNAs extracted from fecal microbiota using Platinum II Hot Start OCR Master Mix kit (Thermo Fisher # 14000014) following the manufacture's instructions and using the PCR primers and parameters that follow.} Primers and parameters on PCR analysis ^{For the detection of etx and other genes indicated in the study, simplex PCR includes the} _{following primers:} e^{tx (3' terminal; 542 bp), forward: 5'-ACTGCAACTACTACTCATACTGTG-3',} _{reverse: 5'- CTGGTGCCTTAATAGAAAGACTCC-3' ;} e^{tx (3' terminal; 390bp), forward: 5'- ACTGCAACTACTACTCATACTGTG-3', reverse: 5'- CTGGTGCCTTAATAGAAAGACTCC-3' ;} e_{tx (5' terminal; 679 bp), forward: 5'-GCATCAGCGGTGATATCCATC-3', reverse: 5' -TCTCTCCCCATTCACTTCCAC-3';} c^{pa/plc, forward: 5'-GTTGATAGCGCAGGACATGTTAAG-3', reverse: 5'-} _{CATGTAGTCATCTGTTCCAGCATC-3';} U^{niversal 16S rRNA, forward (8F): 5'-AGAGTTTGATCCTGGCTCAG-3', reverse} _{(1492R): 5'-GGTTACCTTGTTACGACTT-3';} C^{. perfringens-specific 16S rRNA, forward: 5'-AGATGGCATCATCATTCAAC-3', reverse: 5'-GCAAGGGATGTCAAGTGT-3'.} T_{oxinotyping of C. perfringens in the fecal microbiota was performed using a modified multiplex protocol based on a recent report. Primers included in the multiplex PCR include the following:} e^{tx (5'-terminal): etx (5' terminal, 697 bp), forward: 5'-} _{GCATCAGCGGTGATATCCATC-3', reverse: 5'-TCTCTCCCCATTCACTTCCAC-3';} c^{pa/plc (402 bp), forward: 5'-GTTGATAGCGCAGGACATGTTAAG-3', reverse: 5'} _{- CATGTAGTCATCTGTTCCAGCATC-3' ;} c^{pb (236 bp), forward: 5'-ACTATACAGACAGATCATTCAACC-3', reverse: 5' -} _{TTAGGAGCAGTTAGAACTACAGAC-3';} i^{tx (317 bp): forward, 5' -GCGATGAAAAGCCTACACCACTAC-3', reverse, 5' -} _{GGTATATCCTCCACGCATATAGTC-3';} c^{pe (506 bp), forward: 5'-GGGGAACCCTCAGTAGTTTCA-3', reverse: 5'- ACCAGCTGGATTTGAGTTTAATG-3'. For both simplex and multiplex PCRs, C. perfringens reference strains, including ATCC 3626 for type B and FD203 for type D, were used as the positive control for etx,} _{whereas reference strains, including ATCC 13124 for type A and ATCC 12915 for type F, served as the negative controls for etx. The amplification program used for all assays started with 94 °C for 5 min and followed by 35 cycles of 45 sec at 94 °C, 1 min at 50-58 °C (for simplex PCRs: 57 °C for 5'-etx, 53 °C} for 3'-etx, 58 °C for cpa, 50 °C for universal 16S rRNA, 55 °C for C. perfringens-specific 16S ^{rRNA; for multiplex PCR: 55°C ), 1 min at 68 °C, and a final extension step of 10 min at 68} _{°C. . The PCR products were electrophoresed on 1.2% agarose gel and visualized by an Azure c200 Gel Imaging System.} Quantitative analysis of etx gene abundance and proportion of etx-harboring C. perfringens in the ^{fecal microbiota Quantitative PCR (qPCR) was performed on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher) using PerfecTa Multiplex qPCR SuperMix kit (Quanta Bio # 95108-200) following the manufacture's instruction. Custom-designed target- specific TaqMan probes labeled with FAM/VIC and quenched with TAMRA/MGBNFG were utilized. In each qPCR system, amplicons were designed to be of similar sizes, and primers for the target sequences having similar melting temperatures were elected to achieve comparable amplification efficiency. Universal 16S rRNA served as a reference gene in most cases. All measurements were performed in triplicate. The specificity of each qPCR system was tested} _{and verified by using etx-harboring or non-etx C. perfringens reference strains as positive and negative controls. Relative abundance of etx, cpa, and C. perfringens-specific 16S rRNA genes was determined by setting universal 16S rRNA as a reference gene using cycle of threshold (Ct) and a 2' algorithm (3). Further, percentage of C. perfringens among fecal microbiota was computed using lab reference strain culture (100%) as calibrators based on a 2' algorithm(3). Similarly, ratios of etx-harboring strains over non-etx strains were assessed using etx/cpa from a reference etx-harboring strain (type D). PCR primers and parameters for qPCR analysis follow.} ^{Primers and parameters on qPCR analysis} q_{PCR for ebc abundance include the following primers and fluorogenic probes:} e^{bc, forward: 5'-CATACTGTGGGAACTTCGATACA-3', reverse: 5'-} _{TCTTGTGAAGGGACATTATGAGTAA-3', probe: 6-FAM- AGCAACTGCTAAGTTTACTGTTCCT-TAMRA;} U^{niversal 16S rRNA, forward, 5'-GCGAGACTGCCGGTAATAAA -3', reverse, 5'-} _{TCGTTGTACCAGCCATTGTAG -3', probe: VIC - CCCTTATGACCTGGGCTACACACG — MGBNFQ.} ^{A PCR cycling protocol consisting of 45 sec at 94 °C, 1 min at 62 °C, and 30 sec at 68 °C for 40 cycles.} q_{PCR for cpa abundance include the following primers and fluorogenic probes:} c^{pa, forward: 5'- CTTGGAGAGGCTATGCACTATTT -3', reverse: 5'-} _{TTGCAACCTGCTGTGTTTATTT 3', probe: 6-FAM- TTACTGCCGTTGATAGCGCAGGAC-TAMRA;} U^{niversal 16S rRNA, forward, 5'- GCGAGACTGCCGGTAATAAA -3', reverse, 5'- TCGTTGTACCAGCCATTGTAG -3', probe: VIC - CCCTTATGACCTGGGCTACACACG —MGBNFQ.} A _{PCR cycling protocol consisting of 45 sec at 94 °C, 1 min at 62°C, and 30 sec at 68 °C for 40 cycles. qPCR for C. perfringens abundance include the following primers and fluorogenic probes:} C^{. perfringens-specific 16S rRNA, forward: 5'-AGATGGCATCATCATTCAAC-3',} _{reverse: 5'-GCAAGGGATGTCAAGTGT-3', probe: 6-FAM- AGAGTGCAGGAGAGGAGAGTGGAA - TAMRA;} U^{niversal 16S rRNA, forward, 5'- GCGAGACTGCCGGTAATAAA -3', reverse, 5'- TCGTTGTACCAGCCATTGTAG -3', probe: VIC - CCCTTATGACCTGGGCTACACACG —MGBNFQ.} A _{PCR cycling protocol consisting of 45 sec at 94 °C, 1 min at 58 °C, and 1 min 15 sec at 68 °C for 40 cycles. qPCR for etx/cpa ratio include the following primers and fluorogenic probes:} e^{bc, forward: 5'-CATACTGTGGGAACTTCGATACA-3', reverse: 5'-} _{TCTTGTGAAGGGACATTATGAGTAA-3', probe: 6-FAM- AGCAACTGCTAAGTTTACTGTTCCT-TAMRA;} c^{pa, forward: 5'- GCATGAGTCATAGTTGGGATGA -3', reverse: 5'- CTGATGGATCATTACCCTCTGATAC -3', probe: VIC-} _{TGGGACTATGCAGCAAAGGTAACTTTAGC -MGBNFQ. A PCR cycling protocol consisting of 45 sec at 94 °C, 1 min at 62 °C, and 30 sec at 68 °C for 40 cycles.} ^{Bacterial strains and culture Multiple C. perfringens strains were utilized in this study. The type B strain, ATCC3626, was purchased from ATCC. Four other collection strains were provided by Francisco Uzal: 3 type D strains, CN3842, NCTC8346, and FU17, and 1 type B strain NCTC3110. The type D strain FU17 was isolated from the gut of a goat with clinical enterotoxemia, including brain perivascular} _{edema (4). All strains, including the type D strain SHDS0050 isolated in this study, were grown and maintained at 37°C with 40% humidity in a Whitley A35 HEPA anaerobic workstation in rapid perfringens media (RPM) (3% fluid thioglycolate medium, 6% gelatin, 0.5% peptone, 0.5% dextrose, 0.5% potassium phosphate dibasic. 0.3% yeast extract, 0.15% sodium chloride 0.05% ferrous sulfate, 440mg/mL D-cycloserine) (5).} ^{Genome sequencing preparation and analysis} T_{o understand the etx plasmid architecture of the SHDS0050 strain and compare it to other} ^{etx-producing strains, pure cultures of C. perfringens strains ATCC 3626, CN 3842, FU17, NCTC 3310, NCTC 8346, and SHDS0050, were grown overnight in RPM, and total genomic DNA was isolated from each strain. DNA library preparations were made for both Illumina (short reads) and Oxford Nanopore sequencing (long reads) with 50X coverage for each. Illumina libraries were generated using the Nextera Flex Protocol (now renamed Illumina DNA Prep). 250ng of genomic DNA for each sample was diluted into l0ul and taken into library prep. DNA was fragmented, cleaned, and amplified using IDT indexes for multiplexing. Samples were run on a NovaSeq S4 Flow Cell at PE150 and reads were demultiplexed using Illumina BaseSpace software. Nanopore libraries were generated using the LSK-109 ligation sequencing kit from Oxford Nanopore and run on the PromethlON sequencing device. Briefly, 1µg of DNA} _{was diluted into 48µ1 and taken into library prep using the LSK-109 kit from Oxford Nanopore. Adapters were ligated to the DNA, followed by motor proteins. This library was loaded onto a PromethlON Flow Cell PRO-002 and allowed to run for 64 hours. Reads were demultiplexed using Guppy software from Oxford Nanopore built in to the PromethlON device. Nanopore reads were assembled using the Flye 2.8 assembler, with 10 iterations. Medaka 1.0.3 (Oxford Nanopore Technologies Ltd.) was used to polish the Flye assemblies with the Nanopore reads. To further clean the assemblies, Illumina reads were trimmed and quality controlled via Fastp 0.20.0 and were mapped onto the Medaka polished genome using the Burrows-Wheeler Aligner (BWA) 0.7.17. These alignments were used to further polish the genome with Pilon 1.23. Further,} ^{both Illumina and Nanopore reads were assembled in a hybrid assembly with SPAdes 3.13. Chromosomes were circularized using Circlator 3.0 or by aligning the SPAdes assemblies to the more contiguous Flye assemblies. To ensure that plasmids were circular, plasmid sequences from} _{the polished Flye assemblies were aligned to the SPAdes assemblies using Mauve, and the SPAdes assembly was used to fill in the gaps to circularize the plasmids. Chromosome assemblies were compared using the BLAST Atlas function of GView.} ^{Bacterial culture conditions for pETX production Frozen cultures stored at -80°C in 50% RPM / 50% glycerol stocks were streaked onto BBLTM Schaedler Agar with Vitamin K1 and 5% Sheep Blood (BD) and placed in BD GasPak EZ anaerobe pouch system grown at 37°C for at least 48 hours. Large inoculums were used to start 13mL RPM cultures incubated at 37°C for six hours under anerobic conditions. 3mL of the 6-hour RPM cultures were used to inoculate 10mL of TGY broth (3% tryptic soy broth, 1%} _{yeast extract, 0.1% sodium thioglycolate). TGY cultures were incubated overnight at 37°C. To harvest conditioned media, overnight TGY cultures were centrifuged at 12,000rcf for ten minutes and supernatant carefully collected without disturbing bacterial pellets. Harvested media was stored at -20°C until use. Sterile broth was used as negative controls. Note, when this protocol was used, a direct inoculation into TGY broth did not result in growth.} ^{Western blot analysis of proETX production A total of 10µl of conditioned TGY broth were loaded onto gels. 10µl of sterile TGY broth was used as a negative control.10ng of pETX in 110µl of PBS or TGY broth were used as positive controls. All samples were prepared in 2X Laemmli Sample Buffer (Bio-Rad) containing 5% 2- Mercaptoethanol (Bio-Rad) and heated at 95°C for 5 min before loading onto 4-20% Mini- PROTEAN TGX Stain-Free gels (Bio-Rad). 5u1 per lane of WesternSure Pre-stained Chemiluminescent protein ladder (Licor) were used as molecular weight standards. Gels were run} _{in Tris/Glycine SDS Buffer (Bio-Rad) at 200 V for 30 min. Semi-dry transfers were performed in transfer Tris/Glycine Buffer (Bio-Rad) using the Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell system (Bio-Rad) at 15 V for 15 min. Blots were blocked in 5% Blotting-Grade Blocker nonfat milk (Bio-Rad) in Tris Buffered Saline with Tween 20 (TBS-T, Cell Signaling Technology) for 30 minutes at room temperature. Blots were then incubated with anti-ETX antibody JL008 (16) at 0.211g/mL in blocking solution overnight at 4°C. Blots were washed with TBS-T at room temperature and incubated with secondary antibody peroxidase-} ^{conjugated Affinipure Goat Anti-Rabbit IgG H + L (Jackson ImmunoResearch) at 0.024 1.tg/mL in blocking solution for 1 hour at RT. Blots were washed again in TB S-T and developed for 5 min at room temperature in SuperSignal West Dura Extended Duration} _{Substrate (ThermoFisher Scientific). The developed blots were visualized on 5x7 CL-XPosure Films (ThermoFisher Scientific) at various exposure times using a Konica Minolta SRX-101A film processor.} ^{ETX activation Epsilon protoxin purified from culture supernatants of C. perfringens strain 34 (type B) or from culture supernatants was activated with immobilized TPCK Trypsin following the} _{manufacture's protocol. Each batch of activated ETX was normalized for activity by the assessment of cytoxicity using a CHO cell line that expresses rMAL. Epsilon Protoxin, from C. perfringens, Strain 34 (Type B), NR-856 was obtained through BEI Resources, NIAID, NIH.} ^{hMAL-CHO cell sensitivity assay Harvested TGY broth was incubated with equal amounts 0.25% Trypsin-EDTA solution (Gibco) for 2 hours at 37°C. Sterile TGY broth was used as a control. Trypsin activity was stopped by the addition of FBS to a total FBS percentage of 25% (i.e. 25uL FBS added to 100u1 of TGY/Trypsin solution). 50µl of trypsin treated TGY broth were used to treat confluent hMAL- CHO cells seeded in 200 µl of CHO cell media (Dulbecco's Modified Eagle's Medium/Ham's F12 medium (Life Technologies) with 10% heat-inactivated fetal bovine serum, Glutamax, and 50 units/ml penicillin and 50 µg/ml streptomycin) in 96 well plates. Portions of the trypsin treated TGY broths were treated with neutralizing anti-ETX antibody JL004 at 50 µg/mL for 20 minutes} _{prior to CHO cell treatment. CHO cells were treated overnight at 37°C . To access cell death, cells were treated with 50 µg/mL of propidium iodide (PI, Sigma). Live images of randomly chosen fields in each well were acquired under an inverted fluorescence microscope (Nikon, Minato, Tokyo, Japan) equipped with a Charged Coupled Device (CCD) camera (Carl Zeiss, Oberkochen, Germany) imaged with Spot software and were then imported into ImageJ64 in 8-bit gray format. For quantification of PI-positive cells, the images were converted into binary images by applying the same threshold value to all images collected from the same experiment. Analyze Particles function was selected to automatically count the particle numbers Data were exported and analyzed in Excel (Microsoft) and Prism version 9.0.2 (Graphpad).} ^{EAE induction and clinical scoring 8-10-week-old female C57BL/6 mice received subcutaneous (s.c.) injection of 200 µg synthesized mouse/rat MOG35-55 (MEVGWYRSPFSRVVHLYRNGK) emulsified in 5011.1 of complete Freund adjuvant and supplemented with 200 µg heat-inactivated M tuberculosis H37Ra (TB). On day 0 and 2, 150 ng pertussis toxin or ETX at 50 or 500 ng/kg b.w. was administered via intraperitoneal injection. Animals were weighed and scored daily. Assessment of classical EAE was based on a previously published scale and as follows: 0 refers no physical signs of disability; 0.5, loss of tail tone or distal tail limpness; 1, complete tail limpness; 2, both limp tail and weakness/dragging of hind limbs; 3, hind limb paralysis, 4, complete paralysis of hind limbs and partial paralysis of forelimbs; 5, moribund or death. Peak, average, and accumulative scores} _{were calculated to assess EAE severity. Assessment of atypical EAE was carried out separately from the classical EAE symptom described above, and based on previously published scales with modifications, Specifically: 0, no disease; 1, hunched appearance, stiff tail, slight head tilt; 2, staggered walking, scruffy coat; 3, staggering irregularly and lurching from side to side, obvious impaired balance/ambulation, slight axial rotation; 4, Severe axial rotation, spinning, severe body lean, fall; 5, moribund. As diseased mice experienced ascending paralysis, it became increasingly impossible and less certain to evaluate ataxia, the hallmark of atypical EAE. Thus, the end point of atypical EAE assessment was set at a time when classical EAE has reached the peak, which ranged from 17- 21 days.} ^{Histological analysis Mice were anesthetized with ketamine/xylene cocktail and followed by transcardiac perfusion with PBS and 4% PFA. Brains and spinal cords were removed, processed for paraffin- embedding and sectioned at 5µm thickness. Sections were stained with hematoxylin and eosin to evaluate the overall morphology and lymphocyte infiltration. The inflammatory parameters were assessed on the following scale: 0, no sign of inflammation; 1, scattered inflammatory} _{cells; 2, some inflammatory cells and karyopyknosis; 3, perivascular inflammatory cell infiltrate; and 4, marked inflammatory cell infiltration into the parenchyma. Consecutive sections were stained with Luxol Fast Blue (LFB) for myelin. The size of demyelinated area and the number of infiltrating inflammatory cells were measured using ImageJ software (National Institutes of Health, USA). A universal threshold was applied to the images across all sections in all conditions. Area of LFB staining intensity was limited to threshold, while the} ^{total area of white matter was measured without thresholding. Myelin integrity is defined by the} _{ratio of LFB-stained area within the WM (pixel with thresholding) over the total area of the WM (pixel without thresholding) and expressed as percentage.} ^{Immunohistochemical analysis Paraffin-embedded sections from EAE and control mice were submitted to Histowiz (New York NY) for immunohistochemical staining for CD4, CD45, CD68, and phosho-NFKB} _{expression. Quantification of staining signal was performed with Image J software (National Institutes of Health, USA) and integrated intensity was used for statistical analysis with Prism 9.} ^{Electron microscopy Mice were anesthetized with ketamine/xylene cocktail, transcardiacally perfused with 0.1 M PB and EM fixative 4%PFA, 2.5% glutaraldehyde, 0.1M sucrose in 0.1MP. Immediately after perfusion, brains and lumbar spinal cords were removed and cut into 2 mm-thick brain slices and spinal cord segments. The trimmed tissues were Immersed in the above fixative for two days before} _{tissue processing at the Electron Microscopy Core of New York University. Semi-thin sections at 1 µm thickness were cut and stained with toulidine to identify target regions using light microscopy. The target regions were then trimmed and reoriented and embedded in epoxy resin. Ultrathin (70 nm) cross sections were cut and stained with uranyl acetate and lead citrate, and imaged under transmission electron microscope (JEOL, MA).} ^{Structural analysis on myelin Electron microscopy analysis was performed to determine changes of myelin sheath in EAE and control mice following a standard protocol. Tissues processing, preparation of semi- thin and ultrathin sections, and imaging were performed at the Electron Microscopy Core of New York University. For quantification, 30-40 electron micrographs from 12 randomly chosen fields from each mouse were imaged at both low (4000 X) and high magnifications (40000 X),} _{among which 12 micrographs of adequate quality were used for analysis with Image J. Parameters used to evaluate demyelination included counts of unmyelinated/demyelinated axons, and morphological abnormalities of myelin sheaths and axons. Unmyelinated/demyelinated axons were defined as an axon of appropriate diameter without at least one complete wrap of an oligodendrocyte process. Demyelination was expressed as an average number of unmyelinated axons per field as well as per area unit (mm2) measured using} ^{Image J. Axon degeneration was assessed based on a previously published classification scheme(21). According to this scheme, degenerated axons are identified as a) myelin profiles that lack an axon (axolysis, either due to vacuolization or to condensation); b) swollen axons lacking organelles and neurofilaments; c) axons that contain swollen mitochondria or} _{mitochondria with disrupted cristae; d) axonal profiles with electron dense cytoplasm likely due to increased cytoskeletal or neurofilament density. Quantification of staining signal was performed with Image J software (National Institutes of Health, USA) and integrated intensity was used for statistical analysis with Prism 9.} ^{Isolation of cells from lymph nodes and CNS of mice and antigen-recall assay Mice were euthanized and lymph nodes (cervical and inguinal), central nervous system (CNS, brain and spinal cord) were immediately collected by dissection and held on complete RPMI media containing 10% FBS, Penicillin-Streptomycin, L-glu, HEPES, and P- mercaptoethanol. Lymph nodes were dissociated using a syringe plunger passed through cell strainer (70 p.m). The CNS was finely minced with a razor blade and digested for 20 minutes at} _{37°C in incubator shaker with collagenase D (2 mg/ml; Roche Diagnostics) and DNase1 (0.1 mg/ml; Sigma) in HBSS (Sigma Aldrich). Mononuclear cells were further purified by passage through cell strainer (70 p.m) and enriched by 30 over 70% Percoll gradient centrifugation (GE Healthcare). Where indicated, to determine antigen-recall response, bulk cell suspensions were cultured at 37°C for 72 hours with exogenous MOGp35-55 (50 ug/mL) prior to analysis of cytokine production by flow cytometry.} ^{CNS endothelial isolation, RNA extraction, sequencing, and RNA-sequencing analysis Mice were treated with PBS, ETX (0.51.tg/kg b.w.), or PTX (51.tg/kg b.w) on two consecutive day. 16 hours after the second dose, CNS endothelial cells were isolated from spinal cords or brains with the cerebellum removed as previously described. Brefily, CNS tissue was enzymatically dissociated with a papain solution followed by vigorous trituration and a second dissociation with collangese and dispase solution. Myelin was removed using Miltenyi Biotec} _{Myelin Removal Beads II per the manufacturer's instructions. Isolated cells were stained with anti-CD31 clone 390, anti-CD45 clone 30-F11 (, and CD1 lb clone M1/70, anti-CD13 clone R3- 242, anti-PDGFbeta clone APB%, and DAPI. Viable endothelial cells (DAPI-) positive for CD31 only (CD31+, CD45-, CD1 lb-, CD13-, and PDGFbeta -) were sorted via FACS using a BD Biosciences FACSAria II Cell Sorter. RNA was extracted from sorted endothelial cells} ^{using Qiagen's RNeasy Plus Micro Kit per the manufacturer's instructions. Total RNA integrity was checked using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). The cDNA synthesis and amplification were performed by SMART-Seq v4 ultra low input RNA kit (Takara Bio USA, Mountain View, CA, USA) starting with less than 1 ng of total RNA from each sample. 150 pg of qualified full-length double-strand cDNA was used and processed for Illumina library construction with the Nextera XT DNA Library Preparation Kits (Illumina, San Diego, CA). Then the normalized cDNA libraries were pooled and sequenced on Illumina NovaSeq6000 sequencer with pair-end 100 cycles. The raw sequencing reads in BCL format were processed through bcl2fastq 2.19 (Illumina) for FASTQ conversion and demultiplexing. Raw reads were quality checked with FastQC v0.11.7. Reads were aligned to the mouse reference genome (GRCm38.p6) using STAR v2.7.6a with default parameters. Gene abundances were calculated with featureCounts v2.0.1 using composite gene models from} _{Gencode release vM25. Differential expression analysis was performed in R using limma (v3.50.3), after removing lowly expressed genes with the filterByExpr function from edgeR (v3.36.0). In brief, linear models were fitted with treatment information to create the design matrix, followed by empirical Bayes moderation of t-statistics. Raw P-values were adjusted for multiple testing using the Benjamini & Hochberg method, and only genes with an adjusted p < 0.10 were considered differentially expressed. Differentially expressed genes for the ETX vs. PBS contrast were analyzed using Ingenuity Pathway Analysis (IPA, QIAGEN Inc., pathway- analysis, version 0121-03). Core Analysis settings included all available data sources from human, mouse, or rat species. Expression heatmaps were generated with pheatmap (R package version 1.0.12.) using log2 counts per million (CPM), with the values centered and scaled by row. All scripts and code used for generating the bulk RNA-seq based figures can be found online at github (abcwcm/Vartanian2023).} ^{Example 8: Primary Human Lymphocytes Express Mal To confirm Mal gene expression in the T cell lineage, real-time quantitative PCR (RT- qPCR) for human Mal was performed on isolated CD4+, CD8+, and B cells (Figure 19A). Mal} _{gene expression was normalized to CD4+ cells. RT-qPCR analysis confirmed that CD4+ cells had the highest amount of Mal gene expression compared to isolated CD8+ and B cells (Figure 19A). In addition, CD8+ cells showed a trend towards expressing significantly more Mal than B cells.} ^{To determine if the low Mal expression observed in our isolated B cells populations were a result of T cell contamination, Mal expression results were compared to those of other publicly available datasets using a variety of cell isolation and gene expression techniques (Supplemental Figure S1). Isolation methods included FACS sorting (Figure 24A,B), positive magnetic selection (Figure 24C), and single-cell RNAseq analysis (Figure 24D–F), whereas Mal expression was} _{evaluated using RNAseq (Figure 24A,B,D) and a microarray (Figure 24C). The examination of these four independent datasets confirmed significantly higher Mal gene expression in CD4+ cells, followed by CD8+ cells, and, finally, CD19+/B cells. These results also demonstrated a low but still detectable level of Mal transcripts in CD19/B cells, consistent with the RT-qPCR results disclosed herein. Based on these findings, it was believed the RT-qPCR results were accurate.} ^{Example 9: ETX Binds to Human Lymphocytes with a Preference for CD4+ Cells To determine if the ETX bound to human lymphocytes expressed MAL, the PBMNCs were probed with 50 nM of Alexa Fluor 647 pETX (pETX-647) for 2 h, and the binding to CD4+, CD8+, and CD19+ cells was evaluated by multicolor flow cytometry (Figure 20A–C). pETX was used to study ETX binding because pETX bound with a similar affinity as active ETX but did not oligomerize and form pores, preventing endosome recycling and the possible cell surface rearrangement of MAL. Untreated cells (0 nM) were used as negative controls. Scatter plots (Figure 20A) and histogram analyses of pETX-647 fluorescent intensities (Figure 20B) revealed that CD4+ cells bound more toxins than CD8+ and CD19+ cells. In addition, CD8+ cells bound more toxins than CD19+ cells. To quantify ETX bindings to target cells, pETX-647 binding was quantified via flow} _{cytometry after 2 h of incubation with 25 nM of pETX-647. Significantly more CD4+ cells were positive for pETX-647 compared to CD8+ and CD19+ cells; 82.3%, 60.3%, and 24.7%, respectively (Figure 20C). Even when cells were incubated with 25 nM of pETX-647 for 15 min, 50.1%, 30.0%, and 18.2% of CD4+, CD8+, and CD19+ cells were positive for pETX-647, respectively. This trend was observed for all investigated time points. Prototoxin ETX-647 could be observed binding to CD4+ cells at concentrations as low as 1 nM (Figure 20D). PBMNCs were incubated with 1 nM of pETX-647 for 2 h, and percent positive cells were evaluated by flow cytometry. Untreated cells (0 nM) were used as negative controls. No significant differences were observed in CD8+ or CD19+ when cells were treated with or without 1 nM pETX-647. In comparison, significantly more CD4+ cells were positive for pETX-647 when treated with 1 nM pETX-647 than without, 0.34% versus 0.07%, respectively.} ^{To confirm that pETX bindings to lymphocytes were pETX-specific, pETX-647 was pretreated with an anti-ETX antibody shown to block ETX binding. Binding to total lymphocytes was inhibited when media containing pETX-647 was pre-treated with the anti-ETX antibody (Figure 19E). To ensure that the fluorescent signal observed in lymphocytes was not due to excess fluorophore from the pETX-647 labeling process, PBMNCs were treated with shiga toxin (STX) fluorescently conjugated with Alexa Fluor 647 using the exact same labeling process (STX-647) (Figure 26). When PBMNCs were incubated with 50 nM of STX-647 for 2 h, only a small percentage of lymphocytes bound STX-647, less than 2%. Importantly, the percentage of CD19+ cells positive for STX-647 was significantly higher than CD4+ or CD8+ cells: 1.64%, 0.19%, and 0.01%, respectively, confirming previous results that B cells had increased affinity for STX. The low percentage of STX-647-positive cells indicated that the contamination of lymphocytes by} _{excess dye when treated with Alexa Fluor conjugated 647 toxin was minimal. Finally, we sought to confirm that probing cells with pETX was a reliable marker for ETX binding. PBMNCs were probed with 25 nM ETX or pETX for 2 h, and bindings were determined using affinity purified anti-ETX polyclonal rabbit antibody and PE-conjugated anti-rabbit IgG and examined by flow cytometry (Figure 20F). Cells treated without ETX were used as controls. No significant differences in ETX and pETX bindings were observed. Similar results were obtained when cells were probed with 5 nM, 10 nM, and 50 nM of ETX or pETX as well (data not shown). This confirmed the previously published results that pETX and ETX bound similarly to target cells. Taken together, this data indicates that ETX specifically binds to human primary lymphocytes, with a preference for CD4+ cells, followed by CD8+ and then CD19+ cells. Importantly, ETX binding positively associates with Mal gene expression.} ^{Example 10: ETX Bindings to Human Lymphocytes Is Dose and Time Dependent To determine if the ETX bindings to lymphocyte subsets were dose and time dependent, PBMNCs were incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM of pETX-647 for 15, 30, 60, and 120 min. After 15 min of incubation, pETX was observed binding to CD4+, CD8+, and CD19+ cells in a dose-dependent manner (Figure 21A). For a full breakdown of p values between} _{different doses, please refer to Supplementary Table S1. After 15 min, significantly more CD4+ cells were positive for ETX when treated with 10 nM (11%), 25 nM (50%), and 50 nM (75%) compared to untreated controls (0%) (Figure 21A). In comparison, a significant increase in ETX- positive CD8+ and CD19+ cells was not observed until treatment with 25 nM pETX-647. When PBMNCs were incubated for 120 min with pETX-647, significantly more CD4+ cells were} ^{positive for ETX at 5 nM (41%), 10 nM (62%), 25 nM (83%), and 50 nM (90%) compared to untreated controls (0%) (Figure 21B). In contrast, a significant increase in pETX-647 positive CD8+ and CD19+ cells was not observed until cells were treated with 10 nM pETX-647. A similar trend was observed when cells were incubated with pETX-647 for 30 and 60 min (Supplemental Figure 27A and 27B, respectively). These data indicated that the ETX bindings to all lymphocyte subsets were dose dependent and reaffirmed that ETX preferentially bound to CD4+ compared to CD8+ and CD19+ cells. For CD4+ cells, significant differences in ETX bindings at different time points were observed when cells were treated with 1 nM, 5 nM, 10 nM, or 25 nM pETX-647 (Figure 21C). Remarkably, after 1 nM treatment for 15 min, 0.021% of CD4+ cells were positive for ETX. After 60 and 120 min, significantly more CD4+ cells were positive for pETX: 0.060% and 0.067%,} respectively. In comparison, with 5 nM treatment, 3.2%, 8.1%, 23.8%, and 40.9% of CD4+ cells _{were positive for pETX after 15-, 30-, 60-, and 120-minute incubations, respectively. Similar trends were seen for 10 nM and 25 nM doses. At 50 nM pETX-647 treatment, pETX binding to CD4+ cells appeared to be saturated, as there were no significant differences between any of the time points. Similar results were observed in CD8+ cells (Figure 21D), with the clearest time-dependent binding occurring with 10 nM pETX-647 treatment. In total, 4.4%, 17.2%, 21.6%, and 34.2% of CD8+ cells were positive for pETX after 15-, 30-, 60-, and 120-minute incubations, respectively. Again, pETX binding appeared to be saturated for all time points at 50 nM treatment for CD8+ cells. Although ETX binding was observed on CD19+ cells, binding did not appear to be time dependent under these conditions (Figure 21E). These data indicated that the ETX bindings to CD4+ and CD8+ cells were time dependent and, again, reaffirmed that ETX preferentially bound to CD4+ cells, compared to CD8+ and CD19+ cells.} ^{Example 11: ETX Induces Cytotoxicity in Human Lymphocytes, Especially CD4+ Cells To determine if ETX bindings to human lymphocytes conferred cytotoxicity, total lymphocytes were evaluated for cell death by propidium iodide (PI) inclusion via flow cytometry (Figure 22 A & B). Cells positive for (PI+) were considered dead. After 4 hours of active ETX} _{treatment, only a small percentage of cell death was observed: 1.4% (Figure 22C). A significant increase in total lymphocyte cell death was observed at ETX doses of 25 nM and 50 nM: 11.5% and 17.8%, respectively. Importantly, pretreatment of ETX with a neutralizing antibody that blocked ETX-cytotoxicity inhibited ETX-induced cell death (Figure 22D).} ^{To determine if lymphocyte populations expressing higher levels of MAL were more susceptible to ETX-induced cytotoxicity, cell death was evaluated in CD4+, CD8+ and CD19+ cells by flow cytometry (Figure 22E). When treated with 25 nM of ETX for 4 h, cell death was significantly higher in CD4+ cells compared to CD8+ and CD19+ cells when with PBMNCs:} _{19.6%, 6.5%, and 3.0%, respectively. Similar results were seen when cells were treated with 50 nM ETX with CD4+, CD8+, and CD19+ cells, exhibiting 35.1%, 13.9%, and 1.9% cell death, respectively. In addition, CD8+ cell death was significantly higher than CD19+ cell death. Taken together, these data demonstrated that active ETX induced cell death in CD4+ and CD8+ cells and was positively associated with Mal gene expression.} ^{Example 12: ETX-Induced Cytotoxicity in Human CD4+ Cells Is Time and Dose Dependent To determine if ETX-induced cytotoxicity in CD4+ cells was dose dependent, PBMNCs were incubated with 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM of active ETX for four hours (Figure 22F). Significant increases in percent cell death compared to untreated controls (0.82%) were observed at 25 nM (19.6%) and 50 nM (35.1%) doses. Cell death at 50 nM was significantly higher than at 25 nM treatment. This indicated that ETX-induced cell death of CD4+ cells was dose dependent. To determine if ETX-induced cell death of CD4+ cells was time-dependent, PBMNCs were} _{incubated with indicated doses of ETX for 30, 60, 120, and 240 min (Figure 22G). At a dose as low as 1 nM, a significant increase in CD4+ cell death was observed between 30 min and four hours: 0.55% and 1%, respectively. At a dose of 5 nM, a significant increase in CD4+ cell death was observed between 30 min and four hours: 0.47% and 1.21%, respectively. Cell death was considerably higher at larger ETX doses. At 50 nM ETX treatment, cell death was 0.84%, 2.06%, 18.06%, and 35.07% after 30 min, 60 min, 2 h, and 4 h of treatment, respectively. This data indicated that ETX caused CD4+ cell death in a time-dependent manner.} ^{Example 13: ETX-Induced Cytotoxicity in Human Lymphocytes Is Mediated by Pore Formation ETX-induced cell death has been proposed to be mediated by pore formation in sensitive cell lines. To determine if ETX pore formation occurs in primary human lymphocytes, whole-cell lysates from PBMNC treated with 0 nM, 10 nM, 25 nM, or 50 nM ETX for two hours were} _{evaluated by Western blot (Figure 23A). Lysates from control and ETX-treated rMAL-CHO cells, known to form a 150 kDA ETX pore complex, were used as positive controls. The 150 kDA pore complex was only observed when PBMNCs were treated with 50 nM ETX (Figure 23A). In} ^{addition, a band at 27 kDA could be observed in all cell lysates treated with 50 and 25 nM ETX, indicating bound ETX monomers, as all cells were thoroughly washed in PBS prior to lysis. Pore} _{formation appeared to be time dependent when cells were treated with 50 nM of ETX for 30, 60, and 120 min (Figure 23B). This indicated that ETX-mediated cytotoxicity of PBMNCs was mediated by pore formation.} Example 14: Discussion of Examples 8-13 ^{ETX Binding and Cytotoxicity Positively Associates with Mal Expression in Human Lymphocytes Disclosed herein is demonstration that ETX binding and cytotoxicity to primary human} _{lymphocyte populations positively associate with Mal gene expression. Specifically, CD4+ cells had the highest amount of MAL gene expression, followed by CD8+ and then B cells. Accordingly, ETX preferentially binds to and kills CD4+ cells, followed by CD8+ and then CD19+ cells.} M^{al expression in CD4+, CD8+, and B cells was first confirmed using RT-qPCR. The results demonstrated that CD4+ had the highest amount of Mal gene expression, followed by CD8+ cells and then CD19+ cells. Increased Mal gene expression in CD4+ cells was also confirmed using publicly available datasets. Secondly, it was demonstrated that ETX bound to human lymphocytes with a preference that positively associated with Mal expression. When lymphocytes were incubated with 25 nM of pETX-647 for two hours, 82.8% of CD4+, 60.3% of CD8+, and 24.7%} _{of CD19+ cells were bound to pETX. In addition, pETX binding occurred in a dose- and time- dependent manner. Finally, it was demonstrated that ETX induced lymphocyte cell death. When lymphocytes were incubated with 50 nM of active ETX for four hours, 35.1% of CD4+ and 13.9% of CD8+ exhibited cell death; no significant amount of cell death was observed in CD19+ cells. ETX-induced cell death of CD4+ cells was also dose and time dependent. Taken together, this data indicated that ETX binding and cytotoxicity to human lymphocytes were positively associated with} ^{Mal expression. Alternatively, ETX’s increased binding to and activity on CD4+ cells may have also been a result of CD4 expression itself. In a single experiment, ETX was observed to bind to recombinant human CD4 immobilized on Dynabeads, raising the possibility that CD4+ affinity} _{and sensitivity to ETX may be a combination of both CD4 and MAL expression. Importantly, other ETX-sensitive cell lines, including MDCK and ACHN cells, also express MAL. Taken together, these observations supported the theory that MAL is the main receptor for ETX.} MAL Expression in Human Lymphocytes ^{MAL expression in CD4+ and CD8+ cells was consistent with previously published results, looking at both peripheral blood lymphocytes and various cell lines of the T- and B-cell lineage. By using a privately generated anti-MAL antibody, Copie-Bergman et al. demonstrated that 65– 90% of CD4+ and 22–39% of CD8+ cells were positive for MAL via flow cytometry. In comparison, the authors did not detect a significant amount of MAL expression on B cells from peripheral blood, tonsils, or spleens: 0–0.6%, 1.5–2%, and 0.6–0.7%, respectively. They did,} _{however, observe the occasional MAL-positive plasma cell via immunohistochemistry in tonsils or reactive lymph nodes. In addition, other groups have observed MAL expression in various T cell lines but not B cell lineages. Conflicting results for MAL detection in B cells may have been a result of technical differences in experimental approaches and sensitivity (for example, protein expression versus gene expression). However, results consistently indicated that B cells expressed significantly lower to no MAL compared to T cells.} ^{MAL’s Function in Different Lymphocyte Populations The reason for the differential expression of MAL in specific lymphocyte populations is unknown. MAL’s function in lymphocytes has only been extensively studied in the T cell lineage. In general, MAL appears to play an important role in lipid raft formation and stabilization and protein trafficking to the apical plasma membrane in polarized cells. In human T cells, MAL is selectively present in glycolipid-enriched membrane microdomains (also known as detergent- resistant membranes) and appears to play an important role in T cell activation, mainly through its interactions with Lck, a src-like kinase. Src-like kinases, especially Lck, play an essential role in T cell activation and maturation. Previous studies have shown that MAL and Lck co-immunoprecipitate with each other in a lipid-} _{dependent interaction in T cells. If the expression of MAL is lost, Lck targeting to the plasma membrane becomes dysfunctional. As such, the loss of MAL results in the defective polarization of the T cell receptor for antigen (TCR) and the organization of the immunological synapse (IS). MAL targets Lck to the plasma membrane via vesicle movement along microtubule tracks and requires participation of Inverted Formin2 (INF2) as well as Cdc42 and Rac1. MAL has also been shown to be necessary for proper receptor and signaling protein assembly at the IS in the supramolecular activation cluster (SMAC). The incorrect localization of MAL results in Lck being transported to the wrong part of the SMAC. In addition, more recent publications have also demonstrated that MAL plays an important role in endosome trafficking and exosome secretion from T cells.} ^{Although MAL’s function in B cells is unknown, it is possible that MAL could play a similar role in lipid raft-protein organization and signaling in B cells. Lipid rafts play a role in B cell activation and can act as platforms for B cell receptor (BCR) signaling and possibly antigen} _{trafficking. MAL may play a similar role in Lck or other src-like kinase trafficking in B cells. Interestingly, MAL is highly expressed in mediastinal large B cell lymphoma and a subset of Hodgkin lymphoma with poor prognosis.} ^{ETX-Induced Cell Death Pathways It is generally accepted that ETX causes cell death via the formation/oligomerization of a heptameric pore. ETX pore formation occurs in three sequential steps: (1) ETX binding to its receptor, (2) oligomerization of the pre-pore complex on the cell surface, and (3) the pore insertion into the cell membrane. Pore formation results in a rapid decrease in transmembrane resistance and the rapid depletion of intracellular K+ and Cl−. This is followed by a slower intracellular increase in Na+ and Ca2+. ETX also causes a rapid depletion of ATP and causes mitochondrial membrane permeabilization and translocation of an apoptotic-inducing factor to the nucleus. The ETX treatment of PBMNCs disclosed herein resulted in ETX oligomerization/pore formation, as detected by Western blot. However, the majority of the ETX detected in the PBMNC lysates was observed as bound monomers, not in the pore complex. It is interesting to note that 90% of CD4+ cells were positive when PBMNCs were probed with 50 nM of pETX-647 for 2 h.} _{However, when cells were treated with 50 nM of active ETX for 4 hours, only 35% of the CD4+ cells died, indicating a large discrepancy in ETX binding versus cell death in CD4+ cells for this dose and time point. Alternatively, in rMAL-CHO cells, a highly ETX-susceptible cell line, we saw a closer correlation of ETX binding and ETX cytotoxicity. When rMAL-CHO cells were treated with ETX, the vast majority of cells bound to ETX and also died. For example, when treated with 50 nM of ETX, cell viability decreased to almost 0%. In addition, pore formation happened rapidly (within 5 min, when cells were treated with 50 nM ETX) and at very low doses (within 30 min after cells were treated with 1 nM ETX), with the majority of ETX detected in the poor complex, not as bound monomers. This indicated that the low amount of cell death observed in CD4+ cells despite the high binding percentage may have been due to the low amount of ETX oligomerization/pore formation observed in these cells.} Possible Role of ETX-Lymphocytes Interactions in MS Pathogenesis ^{Without being bound by theory or methodology, based on the limited amount of ETX- induced cell-death observed in human lymphocytes, despite a significantly higher degree of ETX binding, ETX bindings to lymphocytes may influence other cellular behaviors in addition to cell death, including various immune functions. ETX bindings to MAL on human lymphocytes at sublethal doses may modify immune function, possibly influencing lymphocyte activity in immune-mediated diseases such as MS. CD4+, CD8+, and B cells have all been implicated in MS pathogenesis, although the exact mechanisms by which they influence MS pathogenesis is still unclear. It is believed that pathogenic lymphocytes, including autoreactive and proinflammatory lymphocytes, are stimulated in the periphery, prior to the infiltration of these cells into the CNS. Histopathological examination of active MS lesions reveals dense lymphocytic infiltration into the CNS perivascular space with more limited extravasation into the CNS parenchyma. These} _{infiltrates are heavily dominated by the presence of CD4+ and CD8+ with a much lower presence of B cells. Based on these observations, MS pathology has historically been viewed as being T cell driven; however, the wide success of B cell depleting therapies in treating MS has highlighted the importance of B cells in MS pathogenesis as well. Due to MAL’s role in T cell activation and the important role it plays at the immunological synapse, it seems possible that ETX bindings to MAL may initiate a wide array of signaling cascades. Indeed, other pore-forming toxins have been shown to induce numerous cell signaling cascades not related to membrane permeabilization. However, more examination into ETX’s impact on lymphocyte function is needed and is an area of ongoing research. ETX binding and cytotoxicity to human lymphocytes positively associates with MAL gene expression, further confirming that MAL is the main receptor for ETX.} Example 15: Materials and Methods of Examples 8-13 ^{Peripheral Blood Isolation from Healthy Controls Peripheral blood samples were collected from healthy controls via the cubital vein using BD Vacutainer K2 EDTA 7.2 mg Blood Collection tubes in accordance with Institutional Review} _{Board, protocol number 1003010940. At the time of donation, healthy controls were free of any chronic or acute disease, were both male and female, ranged in age from 18 to 59 years old, and lived in the New York City metropolitan area.} ^{Isolation of CD4+, CD8+, and B Cells from Human Peripheral Blood for RT-qPCR Analysis} P_{eripheral blood samples were collected from healthy controls via the cubital vein using BD Vacutainer K2 EDTA 7.2 mg Blood Collection tubes. Subsets were isolated using RossetteSep} ^{immunodensity negative selection cocktails (Stem Cell Technologies). CD4+, CD8+, and B cells were isolated using RosetteSep™ Human CD4+ T Cell Enrichment Cocktail, RosetteSep™} _{Human CD8+ T Cell Enrichment Cocktail, and RosetteSep™ Human B Cell Enrichment Cocktail, respectively, per manufacturer’s instructions.} ^{Real-Time Quantitative PCR (RT-qPCR) Analysis Comparative RT-qPCR was performed in an ABI Taqman 7900HT Fast Real-Time PCR machine (Applied Biosystems, CA), using the PowerUpÔ SYBRÔ Green Master Mix (Applied Biosystems, CA, #A25742). Briefly, PCR was carried out in a 10 μL volume in a final concentration of 1X SYBRÔ Green Master Mix containing 300 nM forward and reverse primers and 10 ng cDNA. The primer sequences were as follows: human MAL, F 5′- GGGTGATGTTCGTGTCTGTG-3′, R 5′-ACTGAGGCGCTGAGGTAAAA-3′; human b-actin, F} _{5′-CACCAACTGGGACGACAT-3′, R 5′-ACAGCCTGGATAGCAACG-3′. The PCR reaction steps were as follows: 50 °C for 2 min, 95 °C for 2 min, and 40 cycles of 95 °C for 15 s followed by 60 °C for 1 min. A subsequent dissociation curve measurement from 60 °C to 95 °C was carried out. All samples were run in triplicate. PCR data were analyzed using the 7900 SDS v2.4.1 software (Applied Biosystems, CA). Relative gene expression was quantified by performing double delta Ct analysis (2−ΔΔCt). B-actin Ct values were used as internal controls, and the gene of interest (GOI) expression was normalized to CD4+ cell expression.} ^{Preparation of Fluorescently Labeled pETX pETX was provided by BEI at a minimum >95% purity at 0.5 mg/mL (Epsilon Protoxin, from Clostridium perfringens, Strain 34 Type B, NR-856). pETX was labeled with Alexa Fluor} _{647 Protein Labeling Kit (Life Technologies) per manufacturer’s instructions. Labeled toxin was stored in a 50% glycerol stock (10 uM) at −20 °C until use.} ^{Activation of ETX pETX provided by BEI was activated in house using immobilized trypsin, TPCK Treated, agarose resin (Thermo Fischer Scientific). Briefly, 125 μL resin was washed three times in sodium phosphate buffer (pH 7.98). Resin was suspended in 200 μL sodium phosphate buffer and} _{combined with 500 uL of BEI pETX (0.5 mg/mL) for two hours at 37 °C with gentle agitation. The solution was centrifuged at 18,000 rcf for 10 min, and the supernatant containing the activated ETX was collected. ETX activation was confirmed by the treatment of rMAL-CHO cells to in- house controls. Activated toxin (~11 μM) was aliquoted and stored at −80 °C until use.} ^{PBMNC Isolation from Human Peripheral Blood for ETX Binding and Cytotoxicity Studies Blood samples were collected from healthy controls via the cubital vein using BD Vacutainer K2 EDTA 7.2 mg Blood Collection tubes. Samples reached room temperature and were then diluted with an equal volume of Phosphate Buffered Saline (PBS) +2% Fetal Bovine Serum (FBS). Diluted blood was layered on top of Ficoll-Paque PLUS (GE Healthcare Bio-Sciences, Uppsala, Sweden). Tubes were centrifuged at 1200 rcf for 20 min at room temperature (without brakes). Buffy coat containing peripheral blood mononuclear cells (PBMNCs) was collected using} _{a sterile transfer pipet. Buffy coat was washed with 20 mL of PBS + 2% FBS and centrifuged at 250 rcf for 10 min at 4 °C. The supernatant containing platelets was removed by aspiration. Cell pellet was washed with 20 mL of PBS + 2% FBS and centrifuged at 500 rcf for 10 min at 4 °C. The supernatant was aspirated, and cells were re-suspended in CTS™ OpTmizer™ T Cell Expansion Media (A1048501) supplemented with Glutamax and 5% FBS. Cells were enumerated using a hemocytometer and adjusted to 1.5 × 106 cells/mL. Cells were kept on ice until use.} ^{Evaluation of pETX-647 Binding to Lymphocyte Subsets To determine ETX binding, PBMNC (1.5 × 106 cells/mL) were incubated with pETX-647 at 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM for 15, 30, 60, and 120 min at 37 °C. In select experiments, media containing 50 nM pETX-647 was pretreated with or without an anti-ETX antibody (JL004) for 30 min before treating cells for 2 h. At selected time points, 100 uL of cells were transferred to round bottom plates containing PBS + 2% FBS and immediately washed with PBS to remove unbound pETX-647. Cells were centrifuged at 500 rcf for 5 min. Cells were} _{resuspended in Cell Staining buffer (Biolegend) containing 5% Human TruStain FcX™ Fc Receptor Blocking Solution (BD Bioscience) for 10 min. Cells were then probed with FITC conjugated anti-CD4 Multiclone SK3 and SK4 (Biolegend), PE-conjugated anti-CD8β Clone 2ST8.5H7 (BD Bioscience), and V450 conjugated anti-CD19 clone SJ25C1 (BD Bioscience) for 20 min at room temperature. Cells were washed and resuspended in PBS and analyzed using a BD FACSVerse Flow Cytometer. From pETX-647 treatment to analysis via flow cytometry, cells were washed a total of three times. Data were collected using FACSuite™ software and analyzed using FlowJo software.} ^{Evaluation of ETX-Induced Cytotoxicity in Lymphocyte Subsets To determine ETX-induced cytotoxicity, PBMNC (1.5 × 106 cells/mL) were treated with} _{activated ETX at 0 nM, 1 nM, 5 nM, 10 nM, 25 nM, and 50 nM for 30, 60, 120 and 240 min at 37} ^{°C. In select experiments, media containing 50 nM ETX was pretreated with or without an anti- ETX antibody (JL008) for 30 min before treating cells for 2 h. At selected time points, 100 µL of cells were transferred to round bottom plates containing ice cold PBS + 2%FBS to stop ETX activity. Cells were immediately washed to remove unbound ETX and centrifuged at 500 rcf for 5 min at 4 °C. Cells were resuspended in Cell Staining buffer (Biolegend) containing 5% Human} _{TruStain FcX™ Fc Receptor Blocking Solution (BD Bioscience) for 10 min. Cells were then probed with FITC conjugated anti-CD4 Multiclone SK3 and SK4 (Biolegend), APC anti-CD8 clone SKI (Biolegend), and V450 conjugated anti-CD19 clone SJ25C1 (BD Bioscience) for 20 min at room temperature. Cells were washed and resuspended in PBS containing 2 ug/mL of PI and analyzed using a BD FACSVerse Flow Cytometer. Data were collected using FACSuite™ software and analyzed using FlowJo software.} ^{Evalution of Pore Formation by Western Blot Analysis PBMNC (1.5 × 106 cells/mL) were incubated with activated ETX at 0 nM, 10 nM, 25 nM, and 50 nM for 120 min at 37 °C. Alternatively, cells were treated with 50 nM of ETX for 30, 60, or 120 min. As a positive control for pore formation, rMAL-CHO cells treated with or without 50 nM active ETX for 30 min were used as controls. After treatment, cells were immediately moved to ice, then washed three times with ice cold PBS. Cells were lysed in ice-cold RIPA buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl, +1% NP-40, 0.1% Sodium dodecyl sulfate, 0.5% Sodium Deoxycholate) with proteinase and phosphatase inhibitors (Cell Signaling Technologies) for 10 min. Samples were centrifuged at 5000 rcf for 5 min to pellet nuclei and DNA. Supernatants were collected and used for Western blot analysis. All samples were prepared in 2X Laemmli Sample Buffer (Bio-Rad) containing 5% 2-Mercaptoethanol (Bio-Rad) and heated at 95 °C for 5 min before} _{loading onto 4–20% Mini-PROTEAN TGX Stain-Free gels (Bio-Rad). Gels were run in Tris/Glycine SDS Buffer (Bio-Rad) at 200 V for 35 min. Semi-dry transfers were performed in transfer Tris/Glycine Buffer (Bio-Rad), using the Trans-Blot SD Semi-Dry Electrophoretic Transfer Cell system (Bio-Rad) at 15 V for 15 min. Blots were blocked in 5% Blotting-Grade Blocker nonfat milk (Bio-Rad) in Tris Buffered Saline with Tween 20 (TBS-T, Cell Signaling Technology) for one hour at room temperature. Blots were then incubated with primary antibodies anti-ETX antibody JL004 at 0.34 µg/mL in blocking solution overnight at 4 °C. Blots were washed three times for 5 min in TBS-T at room temperature and incubated with secondary antibody peroxidase-conjugated Affinipure Goat Anti-Rabbit IgG H + L (Jackson ImmunoResearch) at 0.024 µg/mL in blocking solution for 2 h at room temperature. Blots were washed three times for} ^{5 min in TBS-T and developed for 5 min at room temperature in SuperSignal West Dura Extended Duration Substrate (ThermoFisher Scientific). The developed blots were visualized on 5 × 7 CL-} _{XPosure Films (ThermoFisher Scientific) at various exposure times using a Konica Minolta SRX- 101A film processor.} ^{Statistics One-way ANOVA with post hoc Tukey HSD test was used to determine significance when comparing three or more data points. Unpaired Student’s t-tests were used to determine significance when comparing only two data points. These instances are indicated in figure legends. The disclosure is not limited to the exemplary embodiments and applications presented herein or to the manner in which the exemplary embodiments and applications operate or are described herein. It should be understood that any use of subheadings herein are for organizational purposes, and should not be read to limit the application of those subheaded features to the various embodiments herein. Each and every feature described herein is applicable and usable in all the various embodiments discussed herein and that all features described herein can be used in any contemplated combination, regardless of the specific example embodiments that are described} _{herein. It should further be noted that exemplary description of specific features are used, largely for informational purposes, and not in any way to limit the design, subfeature, and functionality of the specifically described feature. INCORPORATION BY REFERENCE The disclosures of each of the references cited herein, such as patents, patent application publications, and non-patent publications, are hereby incorporated by reference herein in their entireties. EQUIVALENTS Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.}

Claims

^{What is claimed is: 1. A method for confirmatory diagnosis of multiple sclerosis (MS), prognosis of MS, monitoring the progression of MS, monitoring responsiveness to treatment of MS, prevention of MS, and/or treatment of MS in a human subject at risk for or suffering from multiple sclerosis (MS) comprising: a) obtaining a fecal sample from the human subject; b) detecting, in the obtained fecal sample, by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin (ETX) gene-harboring C. perfringens strains relative to the abundance of non-ETX strains of C. perfringens in the human subject; and if the abundance of ETX-harboring C. perfringens strains is above the} m_{edian level for a healthy subject: (i) performing a standard-of-care MS evaluation of the human subject, (ii) administering to the human subject a standard-of-care MS therapy, and/or (iii) administering to the human subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains; and if the abundance of ETX-harboring C. perfringens strains is below or equal the median level of a healthy subject: (i) not performing a standard-of-care MS evaluation of the human subject, (ii) not administering to the subject an MS therapy, and/or (iii) not administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C.} p^{erfringens strains.} 2_{. The method of claim 1, wherein if the relative abundance of ETX-harboring C.} p^{erfringens strains is greater than 0.001%: (i) performing a standard-of-care MS evaluation of the human subject, (ii) administering to the human subject a standard-of-care MS therapy, and/or (iii) administering to the human subject a composition comprising an agent that directly or indirectly interferes with ETX or} E_{TX-harboring C. perfringens strains. 3. A method for detection of relative abundance of epsilon toxin (ETX) gene- harboring strains of C. perfringens in the gut microbiome of a subject comprising:} ^{a) obtaining a fecal sample from the human subject; b) detecting, in the obtained fecal sample, by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin gene (ETX)-harboring strains of C. perfringens relative to the abundance of non-ETX strains of C. perfringens,} w_{herein the relative abundance of ETX-harboring strains of C. perfringens is detected if the percentage of ETX-harboring C. perfringens strains is greater than 0.001%. 4. The method of claim 3, wherein the subject is a human subject at risk for or suffering from multiple sclerosis (MS), and if the abundance of ETX-harboring strains of C.} p^{erfringens is detected: (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to the subject a standard-of-care MS therapy, and/or (iii) administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. 5. The method of claim 3 or claim 4, further comprising a step of selecting the subject for treatment with standard-of-care MS therapy, wherein the subject is at risk for, or suffering from MS, and wherein the subject is selected for treatment wherein the relative abundance of ETX-harboring strains of C. perfringens is detected if the} p_{ercentage of ETX-harboring C. perfringens strains is greater than 0.001%. 6. The method of any one of claims 2-5, wherein the relative abundance of ETX- harboring strains of C. perfringens in the human subject is greater than 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%. 7. The method of any one of claims 1-6, wherein the abundance of ETX-harboring strains of C. perfringens is measured by detection of the ETX gene, and the abundance of ETX-harboring and non-ETX strains of C. perfringens is measured by detection of a gene present in ETX-harboring and non-ETX strains of C.} p^{erfringens. 8. The method of claim 7, wherein the gene present in ETX- and non-ETX harboring strains of C. perfringens is CPA gene or C. perfringens-specific 16S rRNA gene. 9. The method of any one of claims 1-8, wherein the relative abundance of ETX-harboring strains of C. perfringens (ETX+, and CPA+ and/or C. perfringens 16S rRNA+)} a_{nd non-ETX strains of C. perfringens (ETX-, and CPA+ and/or C. perfringens 16S rRNA+), in the obtained fecal sample, is measured. 10. The method of any one of claims 1-9, wherein 2–∆∆Ct analysis is used to quantify the relative abundance of ETX-harboring strains (ETX+, and CPA+ and/or C.} perfringens 16S rRNA⁺) over non-ETX strains (ETX-, and CPA⁺ and/or C. p^{erfringens 16S rRNA+) in the obtained fecal sample; optionally wherein 2–∆∆Ct value of > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9 indicates an abundance of ETX-harboring C. perfringens strains, and optionally if 2–∆∆Ct is > 0.1, 0.2, 0.25, 0.3, 0.4, 0.5, 0.6, 0.7, 0.75, 0.8, or 0.9, (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to the subject a} s_{tandard-of-care MS therapy, and/or (iii) administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. 11. The method of claim 10, wherein a 2–∆∆Ct value of > 1 indicates dominance of ETX- harboring C. perfringens strains with increased ETX-plasmid copy numbers, and 2–} ∆^{∆Ct value of < 1 indicates a higher percentage of non-ETX C. perfringen strains; and optionally if 2–∆∆Ct is > 1, (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to the subject a standard-of-care MS therapy, and/or (iii) administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains.} _{12. The method of any one of claims 1-11, wherein, between step (a) and step (b), bacteria is separated from nonmicrobial fecal matter of the obtained fecal sample. 13. The method of claim 12, wherein the bacteria is separated from the nonmicrobial fecal matter by density gradient centrifugation.} ^{14. The method of any one of claims 1-13, wherein detecting the abundance of ETX- harboring C. perfringens strains by RT-qPCR comprises use of at least one ETX- targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'-CATACTGTGGGAACTTCGATACA-3' and/or 5'- TCTTGTGAAGGGACATTATGAGTAA-3'.} _{15. The method of any one of claims 1-14, wherein detecting the abundance of ETX- harboring C. perfringens strains by RT-qPCR comprises use of at least one ETX- targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5’-ACTCATACTGTGGGAACTTCGA-3’ and/or 5’- ACTCATCTCCCATAACTGCACT-3’.} ^{16. The method of any one of claims 1-15, wherein detecting the abundance of ETX-harboring C. perfringens strains by RT-qPCR comprises use of a} f_{luorogenic probe comprising, consisting essentially of, or consisting of sequence AGCAACTGCTAAGTTTACTGTTCCT.} ^{17. The method of any one of claims 1-16, wherein detecting the abundance of ETX-harboring C. perfringens strains comprises detecting the relative abundance of CPA-harboring C. perfringens strains by RT-qPCR comprising use of at least one CPA-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'- CTTGGAGAGGCTATGCACTATTT-3' and/or 5'- TTGCAACCTGCTGTGTTTATTT-3'.} _{18. The method of claim 17, wherein detecting the relative abundance of CPA- harboring C. perfringens strains by RT-qPCR comprises use of a fluorogenic probe comprising, consisting essentially of, or consisting of sequence TTACTGCCGTTGATAGCGCAGGAC. 19. The method of any one of claims 1-18, wherein detecting the abundance of ETX- harboring C. perfringens strains comprises detecting the relative abundance of C.} perfringens-specific 16S rRNA by RT-qPCR comprising use of at least one C. ^{perfringens-specific 16S rRNA primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'-AGATGGCATCATCATTCAAC-3'} a_{nd/or 5'- GCAAGGGATGTCAAGTGT-3'. 20. The method of claim 19, wherein detecting the relative abundance of C.} p^{erfringens-specific 16S rRNA by RT-qPCR comprises use of a fluorogenic probe comprising, consisting essentially of, or consisting of sequence AGAGTGCAGGAGAGGAGAGTGGAA. 21. The method of any one of claims 1-20, wherein detecting the abundance of ETX-harboring C. perfringens strains comprises quantifying the relative abundance of ETX-harboring (ETX+, and CPA+ and/or C. perfringens 16S rRNA+) over non-ETX strains (ETX-, and CPA+ and/or C. perfringens 16S rRNA+) in the obtained fecal sample byRT-qPCR comprising use of: ETX-targeting primer pair comprising, consisting essentially of, or consisting of sequences: 5'-CATACTGTGGGAACTTCGATACA-3' and 5'- TCTTGTGAAGGGACATTATGAGTAA-3', or sequences 5’- ACTCATACTGTGGGAACTTCGA-3’ and 5’- ACTCATCTCCCATAACTGCACT-3’, and optionally a fluorogenic probe} c_{omprising, consisting essentially of, or consisting of sequence: AGCAACTGCTAAGTTTACTGTTCCT; and (i) CPA-targeting primer pair comprising, consisting essentially of, or consisting of sequences: 5'- GCATGAGTCATAGTTGGGATGA-3' and 5'- CTGATGGATCATTACCCTCTGATAC -3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of sequence TGGGACTATGCAGCAAAGGTAACTTTAGC, and/or (ii) universal 16S rRNA primers comprising, consisting essentially of, or consisting of sequences 5'-GCGAGACTGCCGGTAATAAA -3', and 5'- TCGTTGTACCAGCCATTGTAG -3', and optionally a fluorogenic probe comprising, consisting essentially of, or consisting of sequence CCCTTATGACCTGGGCTACACACG. 22. The method of any one of claims 1-21, wherein the method further comprises:} ^{(c) obtaining a blood sample from the human subject; and (d) detecting, in the obtained blood sample, by flow cytometry, the presence and/or abundance of epsilon toxin (ETX) bound to lymphocytes, optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein the detecting by flow cytometry comprises isolating lymphocytes, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the fluorescently labeled anti-ETX antibody bound to lymphocytes; optionally only if the presence and/or abundance of epsilon toxin (ETX) bound to lymphocytes is detected in the human subject, optionally wherein more than 0.2%, 0.5% or 1% of the lymphocytes are positive for ETX, proceeding to the performing and/or administering steps. 23. A method for confirmatory diagnosis of multiple sclerosis (MS), prognosis of MS, monitoring the progression of MS, monitoring responsiveness to treatment of MS, prevention of MS, and/or treatment of MS in a human subject at risk for or} s_{uffering from multiple sclerosis (MS) comprising: (a) obtaining a blood sample from the human subject; (b) detecting, in the obtained blood sample, by flow cytometry, the presence of epsilon toxin (ETX) bound to a lymphocyte, optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein the detecting comprises isolating lymphocytes from the blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the presence, and optionally percent, of lymphocytes positive for ETX. and if the presence of ETX bound to a lymphocyte is detected, optionally wherein more than 0.2%, 0.5% or 1% of the lymphocytes are positive for ETX: (i) performing a standard-of-care MS evaluation of the human subject, (ii) administering to the human subject a standard-of-care MS therapy, and/or (iii) administering to the human subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains; and if the presence of ETX bound to a lymphocyte is not detected or} ^{substantially not detected, or wherein less than 0.1% or 0.2% of the lymphocytes are positive for ETX: (i) not performing a standard-of-care MS evaluation of the human subject, (ii) not administering to the subject an MS} t_{herapy, and/or (iii) not administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C.} p^{erfringens strains. 24. A method for detection of epsilon toxin in the blood of a subject comprising: (a) obtaining a blood sample from the subject; (b) detecting, in the obtained blood sample, by flow cytometry, the presence of epsilon toxin (ETX) bound to a lymphocyte, optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein the detecting comprises isolating lymphocytes from the blood, incubating the isolated lymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the presence, and optionally percent, of lymphocytes positive for ETX. 25. The method of claim 24, wherein the subject is a human subject at risk for or suffering from multiple sclerosis (MS), and if the ETX bound to a lymphocyte is detected, optionally wherein more than 0.2%, 0.5% or 1% of the lymphocytes are positive} f_{or ETX: (i) performing a standard-of-care MS evaluation of the subject, (ii) administering to the subject a standard-of-care MS therapy, and/or (iii) administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains. 26. The method of claim 24 or claim 25, further comprising a step of selecting the subject for treatment with standard-of-care MS therapy, wherein the subject is at risk for, or suffering from MS, and wherein the subject is selected for treatment wherein the relative abundance of ETX-harboring strains of C. perfringens is detected if the percentage of ETX-harboring C. perfringens strains is greater than 0.001%. 27. The method of any one of claims 23-26, wherein the method further comprises: (c) obtaining a fecal sample from the human subject; and} ^{(d) detecting, in the obtained fecal sample, by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin (ETX) gene- harboring C. perfringens strains relative to the abundance of non-ETX strains of C. perfringens in the human subject; optionally only if the abundance of ETX-harboring C. perfringens strains in the human subject is above the median level for a healthy subject, or wherein the relative abundance of ETX-harboring strains of C. perfringens in the human} s_{ubject is greater than 0.001%, 0.01%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40%, proceeding to the performing and/or administering steps. 28. The method of any one of claims 1-27, wherein before step (a), the human subject is selected, wherein the human subject has MS or has one or more symptoms of MS. 29. The method of any one of claims 1-28, wherein, if the abundance of ETX-harboring C.} p^{erfringens strains is above the median level for a healthy subject and/or if the presence of ETX bound to a lymphocyte is detected, administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains, thereby treating MS, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and/or preventing the progression of MS in the human subject. 30. A method for treating MS, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and/or preventing the progression of MS, in a human subject, the} m_{ethod comprising: a. selecting a subject for treatment, wherein the subject is at risk for, or suffering from MS, and wherein the subject is selected for treatment wherein the relative abundance of ETX-harboring strains of C. perfringens is detected if the percentage of ETX-harboring C. perfringens strains is greater than 0.001%, b. administering to the subject a standard-of-care MS therapy, and/or administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains,} ^{thereby treating MS, reducing at least one symptom of MS, reducing the severity of MS, preventing MS, and/or preventing the progression of MS in the human subject.} _{31. The method of claim 30, wherein the relative abundance of ETX-harboring strains of C.} p^{erfringens is detected by: a. obtaining a fecal sample from the human subject; b. detecting, in the obtained fecal sample, by Real-Time quantitative Polymerase Chain Reaction (RT-qPCR), the abundance of epsilon toxin gene (ETX)-harboring strains of C. perfringens relative to the abundance of non-ETX strains of C. perfringens. 32. The method of claim 30 or 31, wherein the relative abundance of ETX-harboring strains of C. perfringers is detected by: a. obtaining a blood sample from the subject; b. detecting, in the obtained blood sample, by flow cytometry, the presence of epsilon toxin (ETX) bound to a lymphocyte, optionally wherein the lymphocyte is CD4+ lymphocyte, and optionally wherein the detecting comprises isolating lymphocytes from the blood, incubating the isolated} l_{ymphocytes with a fluorescently labeled anti-ETX antibody, washing off the unbound anti-ETX antibody, and detecting the presence, and optionally percent, of lymphocytes positive for ETX. 33. The method of any one of the preceding claims, wherein the standard-of-care MS evaluation comprises magnetic resonance imaging (MRI), evoked potentials tests, cerebral spinal fluid analysis, and/or blood tests. 34. The method of any one of the preceding claims, wherein the administering to the subject a standard-of-care MS therapy comprises administering any one or more of the following therapies: (i) an injectible medication, wherein the injectable medication is interferon beta-1a, interferon beta-1b, glatiramer acetate, ofatumumab, or peginterferon beta-1a;} ^{(ii) an oral medication, wherein the oral medication is teriflunomide, monomethyl fumarate, dimethyl fumarate, fingolimod, cladribine, Siponimod, ponesimod, fingolimod, diroximel fumarate, or ozanimod; (iii) an infused medication, wherein the infused medication is ublituximab, alemtuzumab, mitoxantrone, ocrelizumab, natalizumab-sztn, or natalizumab; and (iv) rituximab or glucocorticoids. 35. The method of any one of the preceding claims, wherein the administering to the subject a composition comprising an agent that directly or indirectly interferes with ETX or ETX-harboring C. perfringens strains comprises administering to the subject a composition comprising an effective amount of an agent that directly or indirectly interferes with ETX. 36. The method of claim 35, wherein said agent is an inhibitor of ETX.} _{37. The method of claim 36, wherein said inhibitor is an antibody against ETX or an antigen binding fragment thereof. 38. The method of claim 37, wherein said antibody against ETX or an antigen binding fragment thereof: a. prevents ETX pore formation, b. prevents cell cytotoxicity, c. clears ETX from circulation, d. targets ETX for phagocytosis or antibody-dependent cellular phagocytosis (ADCP), e. neutralizes ETX, inhibits ETX binding to ETX-binding receptor, and/or f. inhibits or prevents oligomerization of ETX. 39. The method of claim 37 or 38, wherein said antibody or antigen-binding fragment thereof is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, and a recombinant antibody; or an antigen-binding fragment thereof.} ^{40. The method of any one of claims 37-39, wherein said antibody, or antigen-binding fragment thereof, is a human or humanized antibody, or antigen-binding fragment thereof. 41. The method of any one of claims 37-40, wherein the antigen-binding fragment thereof is a nanobody, a Fab fragment, a F(ab′)2 fragment, a Fd fragment, an Fv fragment, a dAb fragment, a single chain antibody, a single domain antibody, a VHH, a maxibody, a minibody, an intrabody, a diabody, a triabody, a tetrabody, an v-NAR or a bis-scFv. 42. The method of claim 35, wherein said agent is an inhibitor or antagonist of an ETX- binding receptor.} _{43. The method of claim 42, wherein the ETX-binding receptor is expressed on endothelial cells of blood brain barrier (BBB). 44. The method of claim 42 or 43, wherein said ETX-binding receptor is a tetraspan integral membrane receptor, wherein the tetraspan integral membrane receptor is myelin- and-lymphocyte protein (MAL) or Hepatitis A Virus Cellular Receptor 1 (HAVcR1). 45. The method of claim 35, wherein said agent is a soluble ETX-binding receptor protein, wherein the soluble ETX-binding receptor protein is soluble HAVcR1, a soluble MAL, or a fragment thereof. 46. The method of claim 35, wherein said agent is a phage lytic enzyme specific for} C^{lostridium perfringens Type B or D bacterial strain. 47. The method of claim 46, wherein said phage lytic enzyme is a muramidase derived from strain ATCC 13124 (PlyCM).} _{48. The method of claim 35, wherein said agent is a probiotic strain expressing a phage lytic enzyme specific for Clostridium perfringens Type B or D bacterial strain. 49. The method of claim 35, wherein said agent is a vaccine against Clostridium} p^{erfringens type B or type D, or the ETX produced therefrom.} _{50. The method of claim 35, wherein said agent is a probiotic supplement comprising C.} peifringens type A or other bacteria type that can effectively outcompete Clostridium p^{erfringens type B or D.} _{51. The method of claim 35, wherein said agent is an antibiotic sufficient to kill C.} p^{erfringens type B and/or D. 52. A composition for preventing or treating multiple sclerosis (MS) in a patient in need thereof comprising a pharmaceutically acceptable excipient and an effective amount of the agent of any one of claim 35-51, optionally wherein the composition is for preventing or treating MS after the detecting of any one of claims 1-32. 53. A composition for PCR detection of epsilon toxin (ETX) gene-harboring strains of C. perfringens, or abundance thereof, comprising at least one ETX-targeting primer} o_{r primer pair comprising, consisting essentially of, or consisting of sequence 5'- CATACTGTGGGAACTTCGATACA-3' and/or 5'- TCTTGTGAAGGGACATTATGAGTAA-3'. 54. A composition for PCR detection of epsilon toxin (ETX) gene-harboring strains of C. perfringens, or abundance thereof, comprising at least one ETX-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5’- ACTCATACTGTGGGAACTTCGA-3’ and/or 5’-ACTCATCTCCCATAACTGCACT-} ^{55. The composition of any one of claims 53 or 54, further comprising a} f_{luorogenic probe comprising, consisting essentially of, or consisting of sequence AGCAACTGCTAAGTTTACTGTTCCT. 56. A composition for PCR detection of CPA-harboring C. perfringens strains, or} ^{abundance thereof, comprising at least one CPA-targeting primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'- CTTGGAGAGGCTATGCACTATTT-3' and/or 5'- TTGCAACCTGCTGTGTTTATTT-3'. 57. The composition of claim 56, further comprising a fluorogenic probe comprising, consisting essentially of, or consisting of sequence TTACTGCCGTTGATAGCGCAGGAC. 58. A composition for PCR detection of C. perfringens-specific 16S rRNA, or abundance thereof, comprising at least one C. perfringens-specific 16S rRNA primer or primer pair comprising, consisting essentially of, or consisting of sequence 5'-AGATGGCATCATCATTCAAC-3' and/or 5'- GCAAGGGATGTCAAGTGT-3'. 59. The composition of claim 58, further comprising a fluorogenic probe comprising, consisting essentially of, or consisting of sequence} A_{GAGTGCAGGAGAGGAGAGTGGAA. 60. A composition for PCR detection of relative abundance of epsilon toxin (ETX) gene-harboring strains of C. perfringens comprising: ETX-targeting primer pair comprising, consisting essentially of, or consisting of sequences: 5'-CATACTGTGGGAACTTCGATACA-3' and 5'- TCTTGTGAAGGGACATTATGAGTAA-3', or sequences 5’- ACTCATACTGTGGGAACTTCGA-3’ and 5’- ACTCATCTCCCATAACTGCACT-3’, and optionally comprising a fluorogenic probe comprising, consisting essentially of, or consisting of sequence: AGCAACTGCTAAGTTTACTGTTCCT; and (i) CPA-targeting primer pair comprising, consisting essentially of, or consisting of sequences: 5'- GCATGAGTCATAGTTGGGATGA-3' and 5'- CTGATGGATCATTACCCTCTGATAC -3', and optionally comprising a fluorogenic probe comprising, consisting essentially of,} ^{or consisting of sequence TGGGACTATGCAGCAAAGGTAACTTTAGC, and/or (ii) universal 16S rRNA primers comprising, consisting essentially of, or consisting of sequences 5'-GCGAGACTGCCGGTAATAAA -3', and} 5_{'- TCGTTGTACCAGCCATTGTAG -3', and optionally comprising a fluorogenic probe comprising, consisting essentially of, or consisting of sequence CCCTTATGACCTGGGCTACACACG.}