EP4665853A1 - Compositions for and methods of treating and/or preventing glutaric aciduria type-i - Google Patents
Compositions for and methods of treating and/or preventing glutaric aciduria type-iInfo
- Publication number
- EP4665853A1 EP4665853A1 EP24775799.0A EP24775799A EP4665853A1 EP 4665853 A1 EP4665853 A1 EP 4665853A1 EP 24775799 A EP24775799 A EP 24775799A EP 4665853 A1 EP4665853 A1 EP 4665853A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- aass
- region
- exon
- seq
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
- A61K31/436—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having oxygen as a ring hetero atom, e.g. rapamycin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
- A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
- A61K31/573—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/69—Boron compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/5123—Organic compounds, e.g. fats, sugars
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
- A61K9/51—Nanocapsules; Nanoparticles
- A61K9/5107—Excipients; Inactive ingredients
- A61K9/5176—Compounds of unknown constitution, e.g. material from plants or animals
- A61K9/5184—Virus capsids or envelopes enclosing drugs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y105/00—Oxidoreductases acting on the CH-NH group of donors (1.5)
- C12Y105/01—Oxidoreductases acting on the CH-NH group of donors (1.5) with NAD+ or NADP+ as acceptor (1.5.1)
- C12Y105/01008—Saccharopine dehydrogenase (NADP+, L-lysine-forming)(1.5.1.8)
Definitions
- Glutaric aciduria type I (GA-1), is a rare neurometabolic organic aciduria caused by glutaryl-CoA dehydrogenase (GCDH) deficiency. It is an autosomal recessive inborn error of lysine (primarily) and tryptophan catabolism with an estimated worldwide prevalence of 1 : 30,000 to 1 : 100,000 live births (Lindner M, et al. (2006) J Inherit Metab Dis. 29:378-382; Kolker S, et al. (2006) Pediatr Res. 59:840-847). Due to founder gene mutations, the incidence of GA-1 is higher in the old order Amish population of Pennsylvania (Strauss KA, et al.
- compositions for and methods of treating and/or preventing glutaric aciduria type-I (GA-I) and methods of reprogramming a metabolic pathway are provided.
- FIG. 1A-FIG. IF show knockout mice and transplantation experiments.
- FIG. 1A shows lysine catabolism pathway scheme in peroxisomes and mitochondria.
- FIG. IB shows Kaplan- Meier survival curves of Gcdh' ' knockout mice transplanted with wild type hepatocytes (Gcdh ) on high protein diet (casein).
- FIG. 1C shows Glutaric acid (GA) and 3-hydroxy GA (3-OH-GA) of groups after 10 days (non-transpl anted) or 160 days (transplanted).
- FIG. ID shows RFP immunohistochemistry only detecting healthy hepatocytes transgenic mlmG) while FIG.
- FIG. IE shows Western blot (GCDH and beta actin) with liver lysates of low and high repopulated transplanted animals (4 each).
- FIG. IF shows Kaplan-Meier survival curves of single Gcdh ) knockout and double knockout (Gcdh ⁇ ' / Aass 7 ') mice on high protein diet.
- FIG. 1G shows GA and 3-OH-GA of single Gcdh ) knockout and double knockout (Gcdh ⁇ / 7Aass ⁇ / ⁇ )' mice after 5 days on high protein diet.
- FIG. 1H shows Kaplan-Meier survival curves of double (Gcdh ⁇ /Aass 4 ) knockout mice transplanted with Gcdh 4 ' hepatocytes.
- FIG. II shows GA and 3-OH-GA of double (Gcdh 4 7Aass 4 ) knockout mice transplanted with Gcdh " hepatocytes.
- FIG. 1J shows AASS immunostaining from transplanted double (Gcdh 4 7Aass 4 ') knockout mice.
- FIG. IK shows Western blot of livers from transplanted double (Gcdh 4 7Aass 4 ⁇ ) knockout mice.
- FIG. IL shows a summary of transplantation models and their outcome. Significance was validated with t test (*p ⁇ 0.05, **p ⁇ 0.01 ***p ⁇ 0.005 and ****p ⁇ 0.0001).
- FIG. 2A - FIG. 2C show the neuropathological evaluation of Gcdh' ' mice transplanted with healthy (Gcdh ) hepatocytes.
- FIG. 2A shows H&E staining of hippocampal brain sections. Hippocampal vacuolation (arrows) and meningeal hemorrhage (arrowheads).
- FIG. 2B shows quantification of vacuolation and meningeal hemorrhage.
- FIG. 2C shows C57B6, transplanted and non-transpl anted Gcdh'' knockout mice repopulated with wild type (Gcdh +/+ ) hepatocytes. Significance was validated with t test (*p ⁇ 0.05, and **p ⁇ 0.01).
- FIG. 3A - FIG. 3G show the motor performance of Gcdh' ' mice transplanted with healthy (Gcdh ) hepatocytes.
- FIG. 3A shows latency to fall from the rotarod across trials.
- FIG. 3B shows grip strength for the fore paws and
- FIG. 3C shows grip strength for the hind paws.
- FIG. 3D open field cumulative locomotor activity
- FIG. 3E shows cumulative rearing activity
- FIG. 3F shows cumulative distance traveled in the center zone
- FIG. 3G shows the velocity of locomotion. Data are presented as means ⁇ SEM. Significance was validated with t test, (*p ⁇ 0.05 and **p ⁇ 0.01).
- FIG. 4A - FIG. 4B show the generation of knockout mice.
- FIG. 4A shows a schematic representation of murine Aass and Gcdh genes and the sgRNAs used to generate the single Gcdh /_ ) and double (Gcdh 4 7Aass -/ ’) knockout strains. Exonic sgRNA target sites are marked.
- FIG. 4B shows an image of a DNA gel electrophoresis showing both the wild type and deleted bands of Aass and Gcdh amplified by PCR using genomic DNA from knockout mice generated by CRISPR/Cas9.
- FIG. 5A - FIG. 5C show neurop athologi cal evaluation of double (Gcdh 4 7Aass ') knockout mice transplanted with (Gcdh 4 ) hepatocytes.
- FIG. 5A shows H&E staining of hippocampal brain sections. Hippocampal vacuolation (arrows).
- FIG. 5B shows quantification of vacuolation of C57BL, Gcdh 4 Aass 4 double knockout repopulated with Gcdh 4 hepatocytes and Gcdh 4 Aass 4 double knockout control (non-transpl anted) mice.
- FIG. 5A - FIG. 5C show neurop athologi cal evaluation of double (Gcdh 4 7Aass ') knockout mice transplanted with (Gcdh 4 ) hepatocytes.
- FIG. 5A shows H&E staining of hippocampal brain sections. Hippocampal vacuolation (arrows).
- 5C shows quantification of meningeal hemorrhage of C57BL, Gcdh Aass ⁇ double knockout repopulated with Gcdh 4 hepatocytes and Gcdh 4 Aass 4 double knockout control (non-transplanted) mice. Data are presented as means ⁇ SEM. Significance was validated with t test (****p ⁇ 0.0001).
- FIG. 6A shows a schematic representation of AAV virus expressing murine Gcdh cDNA sequence.
- FIG. 6B shows a pAAV-Gcdh plasmid sequence with annotations extracted from SnapGene.
- FIG. 7A - FIG. 7G show liver directed gene therapy in Gcdh 4 mice.
- FIG. 7A - 7E show 5-week-old Gcdh 4 mice treated with AJW-Gcdh, AAV-GFP (1.5 x 10 12 vg/mouse at 3 weeks of age) or no injection.
- FIG. 7A shows Kaplan Meier survival curves of Gcdh 4 mice on high protein.
- FIG. 7B shows Western blot of liver and brain lysates from AAV treated mice after harvesting or expiration (controls).
- FIG. 7C shows C5-DC metabolite levels in blood (before and 4 days after high protein diet) and FIG.
- FIG. 7D shows Glutaric Acid levels in blood and 3-OH-Glutaric Acid levels in liver and brain of Gcdh 4 mice at 140 days (WN-Gcdh) and upon expiration (AAV-GF and untreated).
- FIG. 7E - FIG. 7F show neonatal Gcdh 4 pups treated with low (3 x 10 11 vg/mouse), intermediate (7.5 x 10 11 vg/mouse) and high (1.5 x 10 12 vg/mouse) dose of AAV.
- FIG. 7F shows Kaplan Meier survival curves of treated Gcdh 4 mice on high protein after weaning.
- FIG. 7G shows Western blot for GCDH of treated Gcdh 4 mice after expiration. Significance was validated with t test (*p ⁇ 0.05, **p ⁇ 0.01 ***p ⁇ 0.005 and ****p ⁇ 0.0001).
- FIG. 8A - FIG. 8C show neuropathological evaluation of Gcdh 4 mice treated with AAV- Gcdh or AAV-GFP control.
- FIG. 8A shows H&E staining of hippocampal brain sections. Hippocampal vacuolation (arrows).
- FIG. 8B shows quantification of vacuolation of C57BL, Gcdh ⁇ single knockout controls (AAV-GFP injected) and Gcdh ⁇ ⁇ single knockout mice injected with AAV-mGcdh.
- FIG. 8A - FIG. 8C show neuropathological evaluation of Gcdh 4 mice treated with AAV- Gcdh or AAV-GFP control.
- FIG. 8A shows H&E staining of hippocampal brain sections. Hippocampal vacuolation (arrows).
- FIG. 8B shows quantification of vacuolation of C57BL, Gcdh ⁇ single knockout controls (AAV-GFP injected) and Gcdh ⁇ ⁇ single knock
- 8C shows quantification of meningeal hemorrhage of C57BL, Gcdh ⁇ single knockout controls (AAV-GFP injected) and Gcdh ⁇ ⁇ single knockout mice injected with AAV-mGcdh. Data are presented as means ⁇ SEM. Significance was validated with t test (*p ⁇ 0.05 and **p ⁇ 0.01).
- FIG. 9A - FIG. 9G shows motor performance of Gcdh ⁇ ⁇ mice treated with AAV-Gcdh
- FIG. 9A shows latency to fall from the rotarod across trials.
- FIG. 9B shows grip strength for the fore paws.
- FIG. 9C shows grip strength for the hind paws.
- FIG. 9D shows open field cumulative locomotor activity.
- FIG. 9E shows cumulative rearing activity.
- FIG. 9F shows cumulative distance traveled in the center zone.
- FIG. 9G shows velocity of locomotion. Data are presented as means ⁇ SEM. Significance was validated with t test (*p ⁇ 0.05 and ***p ⁇ 0.005).
- FIG. 10A shows schematic representation of the murine Aass gene and sgRNAs used to delete the gene.
- FIG. 10B shows a schematic representation of the AAV-CRISPR-Aass viruses used to knock out the gene targeting exons 6 and exon 7 of Aass.
- FIG. 10C shows a pAAV- CRISPR-Aass-Exon6-sgRNA plasmid map.
- FIG. 10D shows a pAAV-CRISPR-Aass-Exon7- sgRNA plasmid map.
- FIG. 11A - FIG. 11D shows liver specific deletion of Aass in Gcdh ⁇ ⁇ mice using AAV- CRISPR.
- Neonatal Gcdh ⁇ mice were injected with a low (2.4 x 10 11 vg/mouse), intermediate (6 x 10 11 vg/mouse) and high (1 x 10 12 vg/mouse) dose of AAV expressing Cas9 under aliver specific promoter and sgRNA targeting the Aass gene.
- FIG. 11A shows Kaplan Meier survival curves of experimental groups after exposure to high protein diet.
- FIG. 11A shows Kaplan Meier survival curves of experimental groups after exposure to high protein diet.
- FIG. 11B shows Glutaric Acid and 3- OH-Glutaric Acid levels in liver and brain of wild-type C57B6J mice and treated (AAV-CRISP, high dose) Gcdh ⁇ ⁇ mice after 60 days high protein diet and upon expiration (day 4, AAV-GFP).
- FIG. 11C shows AASS immunostaining of livers of depict groups.
- FIG. 11D shows representative sections of the hippocampus of mice injected with AA V-CR1SPR or AAV-GFP or showing vacuolation (arrows) and hemorrhage (arrowheads). The bottom of the drawing provides the quantification of hippocampal vacuolation and meningeal hemorrhage by blinded veterinarian pathologist. Data are presented as means ⁇ SEM Significance was validated with t test (**p ⁇ 0.01, ***p ⁇ 0.005 and ****p ⁇ 0.0001.
- FIG. 12A - FIG. 12G show motor performance of Gcdh ⁇ ⁇ mice treated with AAV- CRISPR-Aass virus.
- FIG. 12A shows latency to fall from the rotarod across trials.
- FIG. 12B shows grip strength for the fore paws.
- FIG. 12C shows grip strength for the hind paws.
- FIG. 12D shows open field cumulative locomotor activity
- FIG. 12E shows cumulative rearing activity
- FIG. 12F shows cumulative distance traveled in the center zone
- FIG. 12G shows the velocity of locomotion.
- Data are presented as means ⁇ SEM. Significance was validated with t test (**p ⁇ 0.01 and ****p ⁇ 0.0001).
- FIG. 13A shows C5-DC metabolite in blood from wild type mice (C57BL) and Gcdh ⁇ ⁇ - AAV-Aass-CRISPR mice before and 4 days after high protein exposure.
- FIG. 13B shows lysine in blood from wild type mice (C57BL) and Gcdh ⁇ -AAV-Aass-CRISPR mice before and 4 days after high protein exposure.
- FIG. 13C shows tryptophan levels in blood from wild type mice (C57BL) and Gcdh ⁇ -AA V-Aass-CRISPR mice before and 4 days after high protein exposure. Data are presented as means ⁇ SEM. Significance was validated with t test (*p ⁇ 0.05, **p ⁇ 0.01).
- FIG. 14A - FIG. 14B show intravenous injection with siRNA against AASS in Gcdh ⁇ mice.
- FIG. 14A shows Kaplan Meier survival curves of treated (siRNA against Aass, at day -1) and control (siRNA non targeting mouse genome, at day -1) Gcdh ⁇ ⁇ mice on high protein diet (Days: days after high protein diet).
- FIG. 14B shows immunostaining for AASS of livers postmortem of the treatment group (siRNA against Aass). *p ⁇ 0.05 for survival curves using Log-rank (Mantel -Cox) test.
- FIG. 15A - FIG. 15K show Gcdh ⁇ ⁇ knockout mice: phenotype and rescue by hepatocyte transplantation.
- FIG. 15A shows the lysine catabolism pathway scheme in peroxisomes, cytosol and mitochondria.
- FIG. 15B shows brain hemorrhage (arrow) of Gcdh ⁇ mice after 4 days on high-protein diet exposure.
- FIG. 15C shows representative H&E staining of the hippocampus with vacuolation (arrow). Boxed area shown with higher magnification on the right.
- FIG. 15D shows a Kaplan-Meier survival curves of Gcdh ⁇ ⁇ knockout mice transplanted with wild-type hepatocytes (Gcdh ) on high-protein diet.
- FIG. 15A shows the lysine catabolism pathway scheme in peroxisomes, cytosol and mitochondria.
- FIG. 15B shows brain hemorrhage (arrow) of Gcdh ⁇ mice after 4 days on high-protein diet
- FIG. 15E shows levels of glutaric acid and FIG. 15F shows levels of 3-OH-glutaric acid in liver and brain of groups after 10 (non-transpl anted) or 160 (transplanted) days on high-protein diet.
- FIG. 15G shows H&E staining of hippocampal brain sections. Boxed area shown with higher magnification on the right.
- FIG. 15J shows RFP immunohistochemistry only detecting healthy hepatocytes (Gcdh+/+, transgenic mTmG).
- GCDH Glutaryl-Co-A Dehydrogenase
- AASS Alpha Aminoadipate-Semialdehyde Synthase
- RFP Red Fluorescent Protein
- mTmG membrane Tomato membrane GFP Glutaryl-Co-A Dehydrogenase
- FIG. 16A - FIG. 16K show the double knockout Gcdh 4 7Aass 4 ) ⁇ mice: phenotype and transplantation experiments.
- FIG. 16A shows Kaplan-Meier survival curves of single (Gcdh 4 ) and double Gcdh 4 Aass” ’) knockout mice on high protein diet.
- FIG. 16B shows levels of glutaric acid and
- FIG. 16C shows levels of 3-OH-glutaric acid in liver and brain tissue of single Gcdh 4 ) and double (Gcdh 4 /Aass 4 ) knockout mice after 5 and 60 days on high-protein diet, respectively.
- FIG. 16D shows Kaplan-Meier survival curves of double (Gcdh 4 7Aass 4 ⁇ ) knockout mice transplanted with Gcdh 4 hepatocytes.
- FIG. 16E shows levels of glutaric acid and
- FIG. 16F shows levels of 3-OH-glutaric acid in liver and brain of doble knockout (Gcdh 4 /Aass ) groups after 5 days (transplanted) and 60 days (non-transpl anted) on high protein diet.
- FIG. 17A - FIG. 17E shows phenotype of liver-specific GA- 1 model.
- Gcdh 4 hepatocytes were transplanted into TIRF transgene free Il2rg 7Rag2 4 7Fah 4 ) mice, which have a normal lysine catabolism (Gcdh +/+ /Aass +/+ ).
- FIG. 17 shows a Kaplan Meier survival curve of TIRF mice transplanted with Gcdh 4 hepatocytes.
- FIG. 17B shows representative FAH immunohistochemistry of TIRF liver (FAH negative) transplanted with Gcdh 4 hepatocytes (FAH positive). Glutaric acid (FIG.
- FIG. 17C shows 3-OH-glutaric acid (FIG. 17D) levels in liver and brain of transplanted and non-transplanted mice on high protein diet.
- FIG. 17E shows summary of hepatocyte transplantation models and their outcomes. Color codes for whole body and/or liver (transplanted hepatocytes) of mice in the diagram correspond to: Blue: Gcdh 4 7Aass +/+ (single knockout); Yellow: Gcdh 4 7Aass 4 ' (double knockout); Grey: Gcdh +/+ /Aass +/+ (wild-type). Significance was validated with Mann- Whitney U test (*p ⁇ 0.05 and **p ⁇ 0.01).
- FIG. 18A - FIG. 18K shows liver-directed AAV gene therapy in Gcdh ⁇ ⁇ mice.
- FIG. 18A - FIG. 181 show five-week-old Gcdh ⁇ mice were intravenously injected with AW-Gcdh or AAN-GFP at a dose of 1.5 x 10 12 vg/mouse.
- FIG. 18A - FIG. 181 show five-week-old Gcdh ⁇ mice were intravenously injected with AW-Gcdh or AAN-GFP at a dose of 1.5 x 10 12 vg/mouse.
- FIG. 18A show Kaplan Meier survival curves of Gcdh ⁇ mice on high-protein diet.
- FIG. 18B shows GCDH Western blot analysis of liver and brain lysates from AAV -treated mice after harvesting or expiration (controls).
- FIG. 18C shows representative GCDH immunostaining of liver in treatment group.
- FIG. 18D shows C5-DC metabolite levels in whole blood of all experimental groups before and 4 days after high protein diet.
- FIG. 18E shows Glutaric Acid
- FIG. 18F 3-OH-glutaric Acid
- FIG. 18G shows H&E staining of hippocampal brain sections showing vacuolation (arrows) and meningeal hemorrhage (arrowheads). Boxed area shown with higher magnification on the right. Quantification of hippocampal vacuolation (FIG. 18H) and brain meningeal hemorrhage (FIG. 181) levels.
- FIG. 18K show neonatal Gcdh ⁇ ⁇ pups treated with low (3 x 10 11 vg/mouse), intermediate (7.5 x 10 11 vg/mouse) and high (1.5 x 10 12 vg/mouse) dose of AAV.
- FIG. 18J shows Kaplan Meier survival curves of treated Gcdh ⁇ mice on high protein after weaning.
- mice were transplanted at the age of 2 months and experiments were performed at age of 8 months (see methods for details). Non-transplanted controls are age matched.
- AAV Adeno-Associated Virus
- C5-DC glutarylcamitine
- GCDH Glutaryl-Co-A Dehydrogenase.
- FIG. 19A - FIG. 19G show liver specific deletion of Aass in Gcdh ⁇ mice using AAV- CRISPR.
- Neonatal Gcdh ⁇ mice were injected with a low (2.4 x 10 11 vg/mouse), intermediate (6 x 10 11 vg/mouse) and high (1 x 10 12 vg/mouse) dose of AAV expressing Cas9 under aliver specific promoter and sgRNA targeting the Aass gene.
- FIG. 19A shows Kaplan Meier survival curves of experimental groups on high protein diet.
- Glutaric Acid (FIG. 19B) and 3-OH-glutaric acid (FIG.
- FIG. 19C shows AASS immunostaining of livers of experimental groups.
- FIG. 19E shows representative hippocampal sections of mice injected with AA F-CRISPR or AAV-GFP showing vacuolation (arrows) and hemorrhage (arrowheads). Quantification of hippocampal vacuolation (FIG. 19F) and meningeal hemorrhage (FIG. 19G). Data is presented as means ⁇ SD. Significance was validated with t test (FIG.
- AAV Adeno-Associated Virus
- Gcdh Glutaryl-Co-A Dehydrogenase
- AASS Alpha Aminoadipate-Semialdehyde Synthase.
- FIG. 20A - FIG. 20B show generation of Gcdh ⁇ ⁇ mice.
- FIG. 20A show schematic representation of the murine Gcdh gene and the sgRNAs used to generate the Gcdh ⁇ knockout strains in C57BL/6 and TIRF (transgene free Il2rg / '/Rag2' / '/Fah' / ). Exonic sgRNA target sites are marked in blue.
- FIG. 20B shows image of a DNA gel electrophoresis showing both the wild type and deleted bands of Gcdh amplified by PCR using genomic DNA from knockout mice generated by CRISPR/Cas9.
- sgRNA single guide RNA.
- FIG. 21A - FIG. 21B shows phenotype characterization of 4 weeks-old Gcdh ⁇ ⁇ mice on high protein diet. Representative H&E staining of the liver (FIG. 21A) and the kidney (FIG. 21B) of Gcdh ⁇ ⁇ mice after four days on high-protein diet.
- FIG. 22A - FIG. 22G show motor performance of Gcdh ⁇ ⁇ mice transplanted with healthy (Gcdh ) hepatocytes.
- FIG. 23A - FIG. 23B show generation of double (Gcdh ⁇ ⁇ Aass ⁇ ) knockout mice.
- FIG. 23A shows schematic representation of murine Aass and Gcdh genes and the sgRNAs used to generate the double (Gcdh +/+ /Aass -/ ’) knockout strains. Exonic sgRNA target sites are marked on color.
- FIG. 23B is an image of a DNA gel electrophoresis showing both the wild type and deleted bands of Aass and Gcdh amplified by PCR using genomic DNA from knockout mice generated by CRISPR/Cas9.
- sgRNA single guide RNA.
- FIG. 24A - FIG. 24B show gene therapy vectors. Schematic representation of Adeno- Associate Virus (AAV) expressing murine Gcdh (FIG. 24A) and GFP (FIG. 24B) sequences.
- AAV Adeno- Associate Virus
- Gcdh murine Gcdh
- GFP GFP
- HLP Hybrid Liver Promoter
- Syn PolyA Synthethic Polyadenylation Signal
- ITR Inverted Terminal Repeat.
- FIG. 25A - FIG. 25G show motor performance of Gcdh ⁇ ⁇ mice treated with AAV-Gcdh.
- FIG. 25A shows latency to fall from the rotarod across trials.
- Significance was validated with t test (*p ⁇ 0.05, **p ⁇ 0.01, and ***p ⁇ 0.005).
- FIG. 26A - FIG. 26B show CRISPR gene therapy design and vectors.
- FIG. 26A shows schematic representation of the murine Aass gene and sgRNAs used to delete the gene (FIG. 26B) schematic representation of the AA V-CRISPR-Aass viruses used to knock out the gene targeting exons 6 and exon 7 of Aass.
- SaCas9 Staphylococcus aureus Cas9
- Syn PolyA Synthetic Poly Adenylation Signal
- ITR Inverted Terminal Repeat
- HLP Hybrid Liver Promoter
- FIG. 27A - FIG. 27H show motor performance of Gcdh ⁇ mice treated with AAV- CRISPR.
- FIG. 27A show the latency to fall from the rotarod across trials.
- FIG. 27B- FIG. 27C show grip strength for the fore paws (FIG. 27B) and for the hind paws (FIG. 27C).
- FIG. 27D- FIG. 27G show open field cumulative locomotor activity (FIG. 27D), cumulative rearing activity (FIG. 27E), cumulative distance traveled in the center zone (FIG. 27F), cumulative time in the center zone (FIG. 27G) and velocity of locomotion (FIG. 27H). Significance was validated with t test (*p ⁇ 0.05 and ***p ⁇ 0.005).
- FIG. 28A - FIG. 28B show biochemical analysis of AAV-CRISPR treated Gcdh ⁇ ⁇ mice. Lysine (FIG. 28A) and tryptophan (FIG. 28B) levels in blood from wild type mice (C57BL/6) and AAV-CRISP treated mice four days after high protein exposure. Significance was validated with t test.
- FIG. 29A - FIG. 29B show intravenous injection with siRNA against AASS in Gcdh ⁇ mice.
- Aass siRNA (8 mg/kg) solution was injected into the tail vein of 3-week-old GcdlT ⁇ mice and put on high protein diet 48 hours later.
- FIG. 29A shows Kaplan Meier survival curves of treated (siRNA targeting Aass) and control (siRNA non targeting mouse genome) Gcdh ⁇ ⁇ mice on high protein diet (Days: days after high protein diet).
- FIG. 29B shows representative immunostaining for AASS of liver from treatment group (post-mortem), p ⁇ 0.05 for survival curves using Log-rank (Mantel-Cox) test.
- FIG. 30A and FIG. 30B show expression of AASS in HepG2 cells after incubation with ASO or siRNA targeting AASS.
- HepG2 cells were incubated for 48 hours with different ASO (FIGS. 30A) or siRNA (FIG. 30B) in experimental triplicates.
- Extracted RNA was used for RT- qPCR for AASS and GAPDH (normalization) in technical duplicates.
- ASO against PCSK9 and a scrambled siRNA were used as negative controls.
- One way ANOVA followed by post-hoc Dunnett’s Test (Graph Pad PRISM, Version 10.2.0), were used to determine significance relative to negative control. “*”meaning p ⁇ 0.05, “**” p ⁇ 0.01, “****” p ⁇ 0.0001.
- FIG. 31 shows introduced mutations in the human GCDH protein sequence. Schematic representation of Lysine (K) to arginine (R) substitutions. Number on the left stand for the mutant (031, 032 and 033) or wildtype (027) constructs.
- FIG. 32 shows Western blotting of transfected HEK293 with GCDH mRNA variants. Different GCDH mRNA constructs (027, 031, 032 and 033) were transfected and cells lysed at 24, 48, 72 and 96 hours for Western blotting using antibodies for GCDH and beta-actin.
- FIG. 33A-FIG. 33E show Validation of LNP production.
- FIG. 33A depicts HEK293T cells transfected with GFP LNP for 24 hours (left) and non transfected control cells (right).
- FIG. 33B depicts Western blotting of GCDH LNP (packaged as LNP) and GCDH RNA transfection (same construct as used for LNP but not packaged).
- FIG. 33C and FIG. 33D depict graphs from RC Bioanalyzer detecting nucleic acids in form of the GCDH mRNA before LNP packaging (FIG. 33C ) and extracted from LNP, 10 days after GCDH LNP production (FIG. 33D).
- FIG. 34A-FIG. 34D show survival of GCDH LNP treated Gcdh-/- mice on high protein diet. Mice were intravenously injected with 6mg/kg GCDH LNPs and put immediately on casein (high protein) diet. Depicted are survival curves of GCDH LNP 027 (FIG.
- FIG. 35A shows a graphical depiction of target sequence for antisense oligonucletides ASO 1, ASO ex4, ASO ex8, ASO exl6, ASO78304, and ASO 28 in relation to the exons of mouse Aass.
- FIG. 35B shows a graphical depiction of target sequence for siRNA oligonucletides siRNA 1, siRNA 2, siRNA 3, siRNA 4, and siRNA 5 in relation to ASO ex4 and the exons of mouse Aass.
- the sequence of the mouse has truncated 5’ and 3’ regions (e.g., mouse AASS CCDS 19937.1 - SEQ ID NO:203).
- FIGS. 36A-36E depict the plasmid sequence map for pAM-026, pAM-027, pAM-031, pAM-032, and pAM-033, with annotations extracted from SnapGene.
- FIG. 37 shows relative normalized expression of the endogenous human AASS gene in HEK 293T cells treated with individual siRNAs. Data are normalized to GAPDH and are shown relative to RNAiMax.
- FIG. 38 shows relative normalized expression of the human AASS gene in HEK 293T cells treated with individual siRNAs.
- Cells were first transfected with an expression vector for the human AASS gene and then treated with the oligonucleotides.
- FIG. 39 shows relative normalized expression of the endogenous human AASS gene in HEK 293T cells treated with individual antisense oligonucleotides. Data are normalized to GAPDH and are shown relative to RNAiMax. Statistical analysis completed using one-way ANOVA with Tukey’s multiple comparisons test, *p ⁇ 0.05.
- FIG. 40 shows relative normalized expression of the human AASS gene in HEK 293T cells treated with individual antisense oligonucleotides.
- Cells were first transfected with an expression vector for the human AASS gene and then treated with the oligonucleotides.
- Data are normalized to GAPDH and are shown relative to RNAiMax.
- Statistical analysis completed using one-way ANOVA with Tukey’s multiple comparisons test, *p ⁇ 0.05.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a recombinant glutaryl-CoA dehydrogenase (GCDH).
- the recombinant GCDH may comprise one or more functional domains.
- the recombinant GCDH may be used for therapeutic replacment of defective GCDH protein in a subject (e.g., protein replacement therapy), either alone or in combination with nucleic acid inhibition of the aminoadipate-semialdehyde synthase (AASS) gene or mRNA (e.g., using a silencing oligonucleotide or a gene editing system that targets AASS).
- the isolated nucleic acid molecule encoding the recombinant GCDH may be an mRNA, optionally a modified mRNA (mmRNA).
- an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, and may be operably linked a promoter.
- an expression cassette comprising a disclosed isolated nucleic acid molecule comprising an isolated nucleic acid molecule encoding a glutaryl-CoA dehydrogenase (GCDH), wherein the nucleic acid sequence may comprise the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, or a variant thereof, which may be operably linked to a promoter.
- the GCDH may be a variant GCDH sequence comprising one or more substitutions selected from K163R, K240R, K202R, OR K371R; the substitutions K163R and K240R; the substitutions K202R and K371R; or the substitutions selected K163R, K202R, K240R, and K371R.
- the GCDH may comprise or consist of the amino acid sequence set forth in any one of SEQ ID NOS:3, SEQ ID NO:200, SEQ ID NO:201, or SEQ ID NO:202.
- a nucleic acid sequence encoding the variant GCDH sequence may comprise the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, or SEQ ID NO: 196, or a variant thereof.
- the expression cassette and/or isolated nucleic acid encoding the GCDH may further comprise a 5’UTR sequence or a 3 ’UTR sequence, optionally wherein the 5’UTR sequence comprises of the sequence set forth in SEQ ID NO: 189 and/or the 3 ’UTR sequence comprises of the sequence set forth in SEQ ID NO: 190.
- a vector comprising the expression cassette and/or isolated nucleic acid encoding the GCDH.
- a vector encoding the GCDH may be selected from sequence of any one of SEQ ID NOS: 192-195.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- the target gene of interest e.g., containing a target sequence for the gene editing system, may be an aminoadipate-semialdehyde synthase (AASS) gene or mRNA (e.g., NM_005763.4).
- AASS aminoadipate-semialdehyde synthase
- mRNA e.g., NM_005763.4
- the gene editing system may be selected from CRISPR gene editing system (e.g., a CRISPR-Cas of any class, type, or subtype), prime editing system, base editing system, zinc-finger nuclease gene editing system, TALEN gene editing system, ARCUS nuclease gene editing system, meganuclease gene editing system, recombinase gene editing system, transposase gene editing system, integrase gene editing system, or homologous recombination gene editing system.
- CRISPR gene editing system e.g., a CRISPR-Cas of any class, type, or subtype
- prime editing system e.g., a CRISPR-Cas of any class, type, or subtype
- base editing system e.g., zinc-finger nuclease gene editing system, TALEN gene editing system, ARCUS nuclease gene editing system, meganuclease gene editing system, recombinase
- the one or more elements may comprise an endonuclease and a sgRNA directed at a target sequence in a target gene of interest.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed a target sequence in the AASS gene.
- silencing oligonucleotides for silencing a target gene.
- the silencing oligonucleotides may target a target sequence within an aminoadipate-semialdehyde synthase (AASS) gene or mRNA (e.g., NM_005763.4).
- AASS aminoadipate-semialdehyde synthase
- mRNA e.g., NM_005763.4
- target sequences of an AASS gene or mRNA for targeting by such silencing oligonucleotides.
- such target sequences within the AASS may be within any one of exons 1-25, or exons 2-24, or the 5’UTR and 3’ UTR.
- a silencing olignucleotide targets a target sequence within an overlap region between any two adjacent exons selected from exons 1-25.
- the overlap region between a first and second region may vary from about 90% of the number of nucleotides of the overlap region being within the first region and about 10% of the number of nucleotides of the overlap region being within the second region, to about 10% of the number of nucleotides of the overlap region being within the first region and about 90% of the number of nucleotides of the overlap region being within the second region.
- the silencing oligonucleotide may be selected from an siRNA, antisense oligonucleotide, miRNA, shRNA, ssRNA, dsRNA, piRNA, or a 3'UTR of mRNA.
- AASS gene selected from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74-117, 120-182, which can be targeted by a gene editing system, or a silencing oligonucleotide (e.g., siRNA or antisense oligonucleotide or other gene expression reducing oligonucleotides) as described herein.
- silencing oligonucleotide e.g., siRNA or antisense oligonucleotide or other gene expression reducing oligonucleotides
- a viral vector comprising a disclosed isolated nucleic acid molecule (e.g., comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase).
- a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding aminoadipate-semialdehyde synthase.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:01 or a fragment thereof.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:02 or a fragment thereof.
- a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- the one or more elements may comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
- AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- a viral vector comprising the sequence set forth in SEQ ID NO: 19, SEQ ID NO:20, or SEQ ID NO:21.
- a vector comprising the sequence set for in SEQ ID NO:92.
- a vector comprising the sequence set for in SEQ ID NO:93.
- a vector comprising the sequence set for in SEQ ID NO:94.
- a vector comprising the sequence set for in SEQ ID NO:95.
- a method of restoring the expression of glutaryl-CoA dehydrogenase comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl- CoA dehydrogenase.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a vector (e.g., a viral vector or non-viral vector) comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a vector e.g., a viral vector or non-viral vector
- a method of protein replacement therapy for defective glutaryl-CoA dehydrogenase comprising administering to a subject in need thereof a therapeutically effective amount of a vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:02, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a gene editing system and a sgRNA directed at a target sequence in a target gene of interest, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and administering a therapeutically effective amount of a second viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding a gene editing system and a sgRNA directed at a target gene of interest, and administering a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in the target gene of interest.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipatesemialdehyde synthase gene; and administering to the subject a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the target gene comprises the aminoadipate- semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, and wherein the expression of the nucleic acid molecule disrupts the expression and/
- compositions compounds, kits, capsules, containers, and/or methods thereof. It is to be understood that the inventive aspects of which are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.
- SaCas9 Staphylococcus Aureus Cas9
- Syn PolyA Synthetic Poly Adenylation Signal
- ITR Inverted Terminal Repeat
- HLP Hybrid Liver Promoter
- GCDH Glutaryl-Co-A Dehydrogenase
- ORF Open Reading Frame
- Syn PolyA Synthetic Poly Adenylation Signal
- AASS Alpha Aminoadipate-Semialdehyde Synthase
- C5-DC glutarylcamitine.
- Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, a further aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
- references in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed.
- X and Y are present at a weight ratio of 2:5 and are present in such ratio regardless of whether additional components are contained in the compound.
- a disclosed method can optionally comprise one or more additional steps, such as, for example, repeating an administering step or altering an administering step.
- the term “subject” may refer to the target of administration, e.g., a human being.
- the term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.).
- the subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian.
- the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent.
- the term does not denote a particular age or sex, and thus, geriatric, adult, adolescent, and child subjects, as well as fetuses, whether male or female, are intended to be covered.
- a subject can be a human subject.
- a subject can have a disease or disorder characterized by lysine catabolism dysfunction.
- diagnosisd may mean having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (such as GA-1) that can be diagnosed or treated by one or more of the disclosed compositions or by one or more of the disclosed methods.
- a condition such as GA-1
- diagnosis with a disease or disorder characterized by lysine catabolism dysfunction means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (GA-1) that can be treated by one or more of the disclosed compositions or by one or more of the disclosed methods.
- “suspected of having a disease or disorder characterized by lysine catabolism dysfunction” can mean having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (such as GA-1) that can likely be treated by one or more of the disclosed compositions or by one or more of the disclosed methods.
- an examination can be physical, can involve various tests (e.g., blood tests, genotyping, biopsies, etc.), diagnostic evaluations (e.g., X- ray, CT scan, etc.), and assays (e.g., enzymatic assay), or a combination thereof.
- an examination can be objective and/or subjective.
- isolated may mean altered or removed from the natural state through human intervention.
- naturally occurring siRNAs in living animals are not “isolated”, but synthetic siRNAs or siRNAs that are partially or completely separated from coexisting materials in their natural state are “isolated”.
- An isolated siRNA can be in substantially purified form or in a non-native environment, such as a cell into which the siRNA has been introduced.
- a “patient” can refer to a subject afflicted with a disease or disorder such as GA-1.
- a patient can refer to a subject that has been diagnosed with or is suspected of having GA- 1.
- a patient can refer to a subject that has been diagnosed with or is suspected of having GA-1 and is seeking treatment or receiving treatment for GA-1.
- a “patient” can refer to a subject afflicted with a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction.
- a patient can refer to a subject that has been diagnosed with or is suspected of having a disease or disorder a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction.
- a patient can refer to a subject that has been diagnosed with or is suspected of having a disease or disorder and is seeking treatment or receiving treatment for a disease or disorder (such GA-1).
- mRNA may mean any transcription/isomer variant from a given gene including but not limited to truncated and modified versions such as but not limited to codon optimization of the gene. It includes also modified mRNA (mmRNA) as described in patent US 2020/0354423, which is incorporated herein by reference for its teachings of mmRNA.
- mmRNA modified mRNA
- the term “endonuclease” may mean any type of DNA binding molecule that can bind and cut DNA at a specific DNA sequence, such as but not limited to CRISPR, optionally selected from a CRISPR-Cas or CRISPR-KRAB, zinc-finger nucleases, TALEN, ARCUS nuclease or meganucleases.
- effector molecules that can instead of cutting DNA (nuclease) repress (transcriptional repression domains such as but not limited to CRISPR-KRAB) or modify (modifier such as but not limited to CRISPR base editing) at or adjacent to the binding site.
- cutting DNA nuclease
- repress transcriptional repression domains
- modify modifier such as but not limited to CRISPR base editing
- CRISPR e.g., as in a CRISPR system or a CRISPR gene editing system
- a CRISPR system may be a CRISPR-Cas system, such as a Class I or Class II CRISPR-Cas system; a Type I, Type II, Type III, Type IV, Type V, or a Type VI CRISPR-Cas system; or a Subtype A, Subtype B, Subtype C, Subtype D, Subtype E, Subtype F, or Subtype U CRISPR-Cas system; or a Cascade, SpCas9, SaCas9, FnCas9, NmCas9, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl3a (C2c2), Casl3b(C2c4), Casl3c (C2c7), or Cas
- 2'-deoxynucleoside may mean a nucleoside comprising 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA).
- a 2'- deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
- 2'-O-methoxyethyl (also 2'-M0E and 2'-O(CH2)2 — OCH3) may refer to an O- methoxy-ethyl modification at the 2' position of a sugar ring, e.g. a furanose ring.
- a 2'-O- methoxy ethyl modified sugar is a modified sugar.
- 2'-M0E nucleoside (also 2'-O-methoxyethyl nucleoside) may mean a nucleoside comprising a 2'-M0E modified sugar moiety.
- 2 '-substituted nucleoside or “2-modified nucleoside” may mean a nucleoside comprising a 2 '-substituted or 2'-modified sugar moiety.
- 2 '-substituted or “2- modified” in reference to a sugar moiety may mean a furanosyl sugar moiety comprising a 2'- substituent group other than H or OH.
- 3' target site may refer to the nucleotide of a target nucleic acid which is complementary to the 3 '-most nucleotide of a particular antisense compound.
- the term “5' target site” may refer to the nucleotide of a target nucleic acid which is complementary to the 5'-most nucleotide of a particular antisense compound.
- the term “5-methylcytosine” may mean a cytosine modified with a methyl group attached to the 5’ position. A 5-methylcytosine is a modified nucleobase.
- amelioration may refer to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition.
- amelioration includes a delay or slowing in the progression of one or more indicators of a condition or disease.
- the severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art.
- animal may refer to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
- antisense activity may mean any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid.
- antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.
- antisense compound may mean a compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
- antisense compounds include single-stranded and double-stranded compounds. Examples are antisense oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy -based compounds.
- antisense inhibition may mean reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
- antisense mechanisms are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
- antisense oligonucleotide may refer to an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or a region or segment thereof.
- an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or a region or segment thereof.
- bicyclic nucleoside may mean a nucleoside comprising a bicyclic sugar moiety.
- bicyclic sugar or “bicyclic sugar moiety” may mean a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
- the first ring of the bicyclic sugar moiety is a furanosyl moiety.
- the bicyclic sugar moiety does not comprise a furanosyl moiety.
- the term “branching group” may mean a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups.
- a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.
- cell-targeting moiety may mean a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
- cleavable moiety may mean a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
- cEt or “constrained ethyl” may mean a bicyclic sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'- CH(CH 3 )-O-2'.
- chemical modification may mean a chemical difference in a compound when compared to a naturally occurring counterpart.
- Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and intemucleoside linkage modifications (e.g., LNA or phosphorthioate).
- nucleoside modifications including sugar moiety modifications and nucleobase modifications
- intemucleoside linkage modifications e.g., LNA or phosphorthioate.
- chemical modification does not include differences only in nucleobase sequence.
- chemically distinct region may refer to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2 '-O-m ethoxy ethyl nucleotides is chemically distinct from a region having nucleotides without 2 '-O-m ethoxy ethyl modifications.
- chimeric antisense compounds may mean antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.
- cleavable bond may mean any chemical bond capable of being split.
- a cleavable bond is selected from an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.
- cleavable moiety may mean a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
- nucleobase sequence of such oligonucleotide may mean the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions.
- Nucleobase matches or complementary nucleobases, as described herein, are limited to adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified.
- oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches.
- “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
- conjugate group may mean a group of atoms that is directly or indirectly attached to a parent compound, e.g., an oligonucleotide.
- conjugate linker may mean a group of atoms that connects a conjugate group to a parent compound, e.g., an oligonucleotide.
- constrained ethyl nucleoside may mean a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-O-2' bridge.
- oligonucleotide in the context of an oligonucleotide may refer to nucleosides, nucleobases, sugar moi eties, or intemucleoside linkages that are immediately adjacent to each other.
- contiguous nucleobases may mean nucleobases that are immediately adjacent to each other.
- design may refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
- GCDH means any nucleic acid or protein of GCDH.
- GCDH nucleic acid may mean any nucleic acid encoding GCDH.
- a GCDH nucleic acid includes a DNA sequence encoding GCDH, an RNA sequence transcribed from DNA encoding GCDH (including genomic DNA comprising introns and exons), including a non-protein encoding (i.e., non-coding) RNA sequence, and an mRNA sequence encoding GCDH.
- GCDH mRNA means an mRNA encoding a GCDH protein.
- AASS may mean any nucleic acid or protein of AASS.
- AASS nucleic acid may mean any nucleic acid encoding AASS.
- a GCDH nucleic acid includes a DNA sequence encoding AASS, an RNA sequence transcribed from DNA encoding AASS (including genomic DNA comprising introns and exons), including a non-protein encoding (i.e., non-coding) RNA sequence, and an mRNA sequence encoding AASS.
- AASS mRNA means an mRNA encoding a AASS protein.
- AASS specific inhibitor may refer to any agent capable of specifically inhibiting AASS RNA and/or AASS protein expression or activity at the molecular level.
- AASS specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of AASS RNA and/or AASS protein.
- dose may mean a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified period.
- a dose can be administered in two or more boluses, tablets, or injections.
- the desired dose may require a volume not easily accommodated by a single injection.
- two or more injections can be used to achieve the desired dose.
- a dose can be administered in two or more injections to minimize injection site reaction in an individual.
- the pharmaceutical agent is administered by infusion over an extended period or continuously. Doses can be stated as the amount of pharmaceutical agent per hour, day, week, or month.
- the term “effective amount” may mean the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the agent.
- the effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
- the term “efficacy” may mean the ability to produce a desired effect.
- expression may include all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures may include, but are not limited to the products of transcription and translation.
- the term “fully modified” in reference to an oligonucleotide may mean a modified oligonucleotide in which each nucleoside is modified.
- “Uniformly modified” in reference to an oligonucleotide means a fully modified oligonucleotide in which at least one modification of each nucleoside is the same.
- the nucleosides of a uniformly modified oligonucleotide can each have a 2'-M0E modification but different nucleobase modifications, and the intemucleoside linkages can be different.
- the term “gapmer” may mean a chimeric antisense compound in which an internal region having a plurality of nucleosides that is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
- the internal region can be referred to as the “gap” and the external regions can be referred to as the “wings.”
- the structure of a gapmer may support RNase H cleavage.
- the term “hybridization” may mean the pairing or annealing of complementary oligonucleotides and/or nucleic acid molecules.
- complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target.
- complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
- identifying an animal having, or at risk for having, a disease, disorder and/or condition may mean identifying an animal having been diagnosed with the disease, disorder and/or condition or identifying an animal predisposed to develop the disease, disorder and/or condition. Such identification can be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.
- immediately adjacent may mean there are no intervening elements between the immediately adjacent elements of the same kind (e.g., no intervening nucleobases between adjacent nucleobases).
- the term “individual” may mean a human or non-human animal selected for treatment or therapy.
- inhibiting the expression or activity may refer to a reduction, blockade of the expression or activity relative to the expression or activity in an untreated or control sample, and does not necessarily indicate a total elimination of expression or activity.
- modified intemucleoside linkage may mean any intemucleoside linkage other than a naturally occurring, phosphate intemucleoside linkage. Naturally occurring, non-phosphate linkages are referred to herein as modified intemucleoside linkages.
- phosphorothioate linkage may mean a linkage between nucleosides wherein the phosphodiester bond of a phosphate linkage is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom.
- a phosphorothioate linkage is a modified intemucleoside linkage.
- the term “lengthened” antisense oligonucleotides may be those that have one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein; e.g. a parent oligonucleotide.
- the term “linearly modified sugar” or “linearly modified sugar moiety” may mean a modified sugar moiety that comprises an acyclic or non-bridging modification. Such linear modifications are distinct from bicyclic sugar modifications.
- linked deoxynucleoside may mean a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.
- linked nucleosides may refer to nucleosides that are connected in a continuous sequence (i.e., no additional nucleosides are present between those that are linked).
- mismatch or “non-complementary” may mean a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned.
- a universal nucleobase, inosine, and hypoxanthine are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized.
- a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non- complementary nucleobase.
- modified nucleobase may mean any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil.
- An “unmodified nucleobase” may mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- a “universal base” may be a nucleobase that can pair with any one of the five unmodified nucleobases.
- modified nucleoside may mean a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
- modified nucleotide may mean a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
- modified oligonucleotide may mean an oligonucleotide comprising at least one modified intemucleoside linkage, a modified sugar, and/or a modified nucleobase.
- modulating may refer to changing or adjusting a feature in a cell, tissue, organ or organism.
- modulating AASS RNA can mean to increase or decrease the level of AASS RNA and/or AASS protein in a cell, tissue, organ or organism.
- a “modulator” effects the change in the cell, tissue, organ or organism.
- a AASS antisense compound can be a modulator that decreases the amount of AASS RNA and/or AASS protein in a cell, tissue, organ or organism.
- the term “monomer” may refer to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
- motif may mean the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
- Natural or “naturally occurring” may mean found in nature.
- “Naturally occurring intemucleoside linkage” may mean a 3' to 5' phosphodiester linkage.
- “Natural sugar moiety” may mean a sugar moiety found in DNA (2'-H) or RNA (2'-OH).
- “Naturally occurring nucleobase” may mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
- non-complementary nucleobase may refer to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
- nucleic acid may refer to molecules composed of monomeric nucleotides.
- a nucleic acid may include, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, and modified forms thereof.
- nucleobase may mean a heterocyclic moiety capable of pairing with a base of another nucleic acid.
- nucleobase sequence may mean the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
- nucleoside may mean a compound comprising a nucleobase and a sugar moiety.
- the nucleobase and sugar moiety are each, independently, unmodified or modified.
- nucleotide may mean a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
- oligomeric compound may mean a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
- oligomeric compounds include single-stranded and double-stranded compounds, such as, antisense compounds, antisense oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy -based compounds.
- oligonucleoside may mean an oligonucleotide in which the intemucleoside linkages do not contain a phosphorus atom.
- oligonucleotide may mean a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
- parent oligonucleotide may mean an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and chemistries.
- the newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.
- prevent may refer to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent may also mean reducing the risk of developing a disease, disorder, or condition.
- prodrug may mean a form of a compound which, when administered to an individual, is metabolized to another form.
- the metabolized form is the active, or more active, form of the compound (e.g., drug).
- prodrug may mean a form of a compound which, when administered to an individual, is metabolized to another form.
- the metabolized form is the active, or more active, form of the compound (e.g., drug).
- prophylactically effective amount may refer to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
- RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).
- region may be defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
- ribonucleotide may mean a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide.
- RNAi compound may mean an oligomeric compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
- ssRNA single-stranded RNA
- microRNA including microRNA mimics.
- the term RNAi compound excludes antisense oligonucleotides that act through RNase H.
- segment may refer to a smaller or sub-portion of region within an antisense compound, an oligonucleotide, or a target nucleic acid.
- side effects may mean physiological disease and/or conditions attributable to a treatment other than the desired effects.
- side effects may include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise.
- increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
- increased bilirubin may indicate liver toxicity or liver function abnormality.
- single-stranded in reference to an antisense compound or oligomeric compound may mean there is one oligonucleotide in the compound.
- the term “self-complementary” in reference to an antisense compound or oligomeric compound may mean a compound that at least partially hybridizes to itself.
- a compound consisting of one antisense or oligomeric compound, wherein the oligonucleotide of the compound is self-complementary, is a single- stranded compound.
- a single-stranded antisense or oligomeric compound can be capable of binding to a complementary compound to form a duplex.
- sites may refer to unique nucleobase positions within a target nucleic acid(e.g., target site).
- slows progression means decrease in the development of the said disease.
- the term “specifically hybridizable” may refer to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids.
- the term “specifically inhibit” a target nucleic acid may refer to reducing or blocking expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids reduction and does not necessarily indicate a total elimination of the target nucleic acid's expression.
- sugar moiety may mean a group of atoms that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group.
- a sugar moiety is attached to a nucleobase to form a nucleoside.
- unmodified sugar moiety or “unmodified sugar” may mean a 2'-0H(H) furanosyl moiety, as found in RNA, or a 2'-H(H) moiety, as found in DNA.
- Unmodified sugar moieties have one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position.
- modified sugar moiety or “modified sugar” may mean a furanosyl moiety comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety, or a sugar surrogate.
- a modified sugar moiety is a 2 '-substituted sugar moiety.
- modified sugar moieties include bicyclic sugars and linearly modified sugars.
- sugar surrogate may mean a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group.
- Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide. In an aspect, such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.
- the term “synergy” or “synergize” may refer to an effect of a combination that is greater than additive of the effects of each component alone.
- target gene may refer to a gene encoding a target.
- target nucleic acid may mean a nucleic acid capable of being targeted by silencing oligonucleotides (e.g., antisense oligos or siRNA) or a gene editing systems.
- silencing oligonucleotides e.g., antisense oligos or siRNA
- targeting may mean the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
- target region may mean a portion of a target nucleic acid to which one or more antisense compounds is targeted.
- target segment may mean the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted.
- 5' target site refers to the 5 '-most nucleotide of a target segment.
- 3' target site refers to the 3 '-most nucleotide of a target segment.
- terminal group may mean a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
- terapéuticaally effective amount may mean an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.
- treat may refer to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
- nucleobases or nucleotides may mean that the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U), which do not comprise any chemical modification.
- unmodified nucleotide may mean a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages.
- an unmodified nucleotide may be an RNA nucleotide (i.e., P-D-ribonucleotides) or a DNA nucleotide (i.e. [3-D- deoxy rib onucl eoti de) .
- codon optimization can refer to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing one or more codons or more of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence.
- Various species exhibit particular bias for certain codons of a particular amino acid.
- genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database.” Many methods and software tools for codon optimization have been reported previously. (See, for example, genomes.urv.es/OPTIMIZER/).
- the phrase “identified to be in need of treatment,” or the like, may refer to selection of a subject based upon need for treatment of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- a subject can be identified as having a need for treatment based upon an earlier diagnosis by a person of skill and thereafter subjected to treatment for a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- the identification can be performed by a person different from the person making the diagnosis.
- the administration can be performed by one who performed the diagnosis.
- oligonucleotides relate to short oligos composed of naturally occurring nucleotides as well as to oligos composed of synthetic or modified nucleotides, as described in the preceding section on RNAi and siRNA.
- polynucleotide and “oligonucleotide” are used synonymously.
- inhibitor may mean to diminish or decrease an activity, level, response, condition, severity, disease, or other biological parameter.
- inhibiting can refer to diminishing the intensity, the duration, the amount, or a combination thereof of symptoms, complications, issues due to a subject’s lysine catabolism dysfunction and/or malfunction (such as GA-1). This can include, but is not limited to, the complete ablation of the activity, level, response, condition, severity, disease, or other biological parameter.
- This can also include, for example, a 10% inhibition or reduction in the activity, level, response, condition, severity, disease, or other biological parameter as compared to the native or control level (e.g., a subject not having a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)) or to the level prior to the onset of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- the inhibition or reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of reduction in between as compared to native or control levels or to the subject’s level prior to the onset of lysine catabolism dysfunction and/or malfunction.
- the inhibition or reduction can be 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% as compared to native or control levels or to the subject’s level prior to the onset of lysine catabolism dysfunction and/or malfunction (such as GA-1).
- the inhibition or reduction can be 0-25%, 25-50%, 50-75%, or 75-100% as compared to native or control levels or to the subject’s level prior to the onset of lysine catabolism dysfunction and/or malfunction (such as GA-1).
- treat or “treating” or “treatment” may include palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1); preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1); and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- palliative treatment that is, treatment designed for the relief of symptoms rather than the curing of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)
- preventative treatment that is, treatment directed to minimizing or partially or completely inhibiting the development of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)
- supportive treatment that
- the terms cover any treatment of a subject, including a mammal e.g., a human), and includes: (i) preventing the undesired physiological change and/or pathological condition from occurring in a subject that can be predisposed to a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1) but has not yet been diagnosed as having it; (ii) inhibiting the physiological change and/or pathological condition (a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)); or (iii) relieving the physiological change and/or pathological condition, z.e., causing regression of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- a mammal e.g., a human
- treating a disease or disorder can reduce the severity of an established a disease or disorder in a subject by 1%-100% as compared to a control (such as, for example, an individual not having a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)).
- a control such as, for example, an individual not having a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)).
- treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of a disease or a disorder or a condition (such as a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)).
- treating a disease or a disorder can reduce one or more symptoms of a disease or disorder in a subject by 1%-100% as compared to a control (such as, for example, an individual not having a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)).
- a control such as, for example, an individual not having a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)).
- treating can refer to 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% reduction of one or more symptoms of an established a disease or a disorder or a condition (e.g., lysine catabolism dysfunction and/or malfunction (such as GA-1)).
- treatment does not necessarily refer to a cure or complete ablation or eradication of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- treatment can refer to a cure or complete ablation or eradication of a disease or a disorder or a condition (such as lysine catabolism dysfunction and/or malfunction (such as GA-1)).
- prevent or “preventing” or “prevention” may refer to to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit, or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed. In an aspect, preventing lysine catabolism dysfunction and/or malfunction (such as GA-1) or the worsening of lysine catabolism dysfunction and/or malfunction (such as GA-1) is intended.
- the words “prevent” and “preventing” and “prevention” also refer to prophylactic or preventative measures for protecting or precluding a subject (e.g., an individual) not having lysine catabolism dysfunction and/or malfunction (such as GA-1) related complication from progressing to that complication.
- the term “operably linked” may mean that expression of a gene or a transgene is under the control of a promoter with which it is spatially connected.
- a promoter can be positioned 5’ (upstream) or 3 ’ (downstream) of a gene under its control.
- the distance between the promoter and a gene can be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance can be accommodated without loss of promoter function.
- an “enhancer” such as a transcription or transcriptional enhancer may refer to regulatory DNA segment that is typically found in multicellular eukaryotes.
- An enhancer can strongly stimulate (“enhance”) the transcription of a linked transcription unit, z.e., it acts in cis.
- An enhancer can activate transcription over very long distances of many thousand base pairs, and from a position upstream or downstream of the site of transcription initiation.
- An enhancer can have a modular structure by being composed of multiple binding sites for transcriptional activator proteins. Many enhancers control gene expression in a cell type-specific fashion. Several remote enhancers can control the expression of a singular gene while a singular enhance can stimulate the transcription of one or more genes.
- expression cassette or “transgene cassette” can refer to a distinct component of vector DNA comprising a transgene and one or more regulatory sequences to be expressed by a transfected cell.
- an expression cassette or transgene cassette can comprise a promoter sequence, an open reading frame (i.e., the transgene), and a 3’ untranslated region (e.g., in eukaryotes a polyadenylation site).
- promoter or “promoters” are known to the art. Depending on the level and tissue-specific expression desired, a variety of promoter elements can be used. A promoter can be tissue-specific or ubiquitous and can be constitutive or inducible, depending on the pattern of the gene expression desired. A promoter can be native (endogenous) or foreign (exogenous) and can be a natural or a synthetic sequence. By foreign or exogenous, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced. Bacteriophage promoters are used for in vitro transcription such as T7, SP6 and T3 RNA polymerases, but are not used in cells
- tissue-specific promoters are known to the art and include, but are not limited to, neuron-specific promoters, muscle-specific promoters, liver-specific promoters, skeletal musclespecific promoters, and heart-specific promoters.
- Liver-specific promoters are known to the art and include, but are not limited to, the thyroxin binding globulin (TBG) promoter, the al-microglobulin/bikunin enhancer/thyroid hormone-binding globulin promoter, the human albumin (hALB) promoter, the thyroid hormone- binding globulin promoter, the a- 1 -anti -trypsin promoter, the bovine albumin (bAlb) promoter, the murine albumin (mAlb) promoter, the human al -antitrypsin (hAAT) promoter, the ApoEhAAT promoter comprising the ApoE enhancer and the hAAT promoter, the transthyretin (TTR) promoter, the liver fatty acid binding protein promoter, the hepatitis B virus (HBV) promoter, the DC 172 promoter comprising the hAAT promoter and the al -microglobulin enhancer, the DC 190 promoter comprising TTG glob
- a disclosed liver-specific promoter can comprise any liver-specific promoter known to the art.
- a liver specific promoter can comprise about 845-bp and comprise the thyroid hormone-binding globulin promoter sequences (2382 to 13), two copies of al- microglobulinybikunin enhancer sequences (22,804 through 22,704), and a 71 -bp leader sequence (Ill CR, et al. (1997) Blood Coagul Fibrinolysis. 8 Suppl 2:S23-S30).
- administering may refer to any method of providing one or more of the disclosed compositions (such as, for example, a disclosed viral vector). Such methods are well-known to those skilled in the art and include, but are not limited to, the following: oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, in utero administration, intrahepatic administration, intravaginal administration, epidural administration (such as epidural injection), intracerebroventricular (ICV) administration, ophthalmic administration, intraaural administration, depot administration, topical (skin) administration, otic administration, intraarticular (such as joint or vertebrate injection), intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-CSF administration, intra-cistem magna (ICM) administration, intra-arterial administration, intrathecal (ITH) administration, intramuscular administration, and subcutaneous administration.
- ICM intra-cistem magna
- ITH intrathe
- Administration of a disclosed composition, a disclosed viral vector, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, and/or a disclosed RNA therapeutic can comprise administration directly into the CNS or the PNS.
- administration may refer to routes of introducing a compound or composition provided herein to an individual to perform its intended function.
- An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
- Administration can be continuous or intermittent. Administration can comprise a combination of one or more route.
- a disclosed composition, a disclosed viral vector, a disclosed pharmaceutical formulation, or any combination thereof can be concurrently and/or serially administered to a subject via multiple routes of administration.
- administering a disclosed composition, a disclosed viral vector, a disclosed pharmaceutical formulation, or any combination thereof can comprise intravenous administration and intra-cistem magna (ICM) administration.
- administering a disclosed composition, a disclosed viral vector, a disclosed pharmaceutical formulation, or any combination thereof can comprise IV administration and intrathecal (ITH) administration.
- IV administration and intrathecal (ITH) administration can comprise intravenous administration and intra-cistem magna (ICM) administration.
- IV administration and intrathecal (ITH) administration IV administration and intrathecal
- Various combinations of administration are known to the art.
- “Administered concomitantly” or “co-administration” may mean administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping
- immune modulator refers to an agent that is capable of adjusting a given immune response to a desired level (e.g., as in immunopotentiation, immunosuppression, or induction of immunologic tolerance).
- immune modulators include but are not limited to, a disclosed immune modulator can comprise aspirin, azathioprine, belimumab, betamethasone dipropionate, betamethasone valerate, bortezomib, bredinin, cy azathioprine, cyclophosphamide, cyclosporine, deoxyspergualin, didemnin B, fluocinolone acetonide, folinic acid, ibuprofen, IL6 inhibitors (such as sarilumab) indomethacin, inebilizumab, intravenous gamma globulin (IVIG), methotrexate, methylprednisolone, mycophenolate
- IVIG intravenous gam
- determining the amount can mean both an absolute quantification of a particular analyte (e.g., a toxic catabolite) or a determination of the relative abundance of a particular analyte (e.g., a toxic catabolite).
- the phrase includes both direct or indirect measurements of abundance or both.
- determining the amount can refer to measuring the expression of GCDH.
- modifying the method can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method.
- a method can be altered by changing the amount of one or more of the disclosed compositions (e.g., a disclosed viral vector) used in a disclosed method, or by changing the frequency of administration of one or more disclosed compositions (e.g., a disclosed viral vector) in a disclosed method, by changing the duration of time that one or more disclosed compositions (e.g., a disclosed viral vector) is administered in a disclosed method, orby substituting for one ormore of the disclosed components and/or reagents with a similar or equivalent component and/or reagent.
- the term “concurrently” may mean (1) simultaneously in time, or (2) at different times during a common treatment schedule.
- CpG-free can mean completely free of CpGs or partially free of CpGs.
- CpG-free can mean “CpG-depleted”.
- CpG-depleted can mean “CpG- free”.
- CpG-depleted can mean completely depleted of CpGs or partially depleted of CpGs.
- CpG-free can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art.
- the term “contacting” can refer to bringing one or more of the disclosed compositions (e.g., a disclosed viral vector) together with a target area or intended target area (e.g., a population of cells) in such a manner that the disclosed compositions can exert an effect on the intended target or targeted area either directly or indirectly.
- a target area or intended target area can be one or more cells (e.g., brain cells, liver cells, or both) and/or one or more tissues having toxic catabolite build-up (e.g., the brain, the liver, or both), or any combination thereof.
- a target area or intended target area can be any cell or any organ infected by a disease or disorder (such as GA- 1).
- a target area or intended target area can be any organ, tissue, or cells that are affected by a disease or disorder characterized by lysine metabolic dysfunction.
- determining can refer to measuring or ascertaining the presence and severity of a disease or disorder, such as, for example, characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). “Determining” can refer to measuring or ascertaining an expression level of a protein or gene of interest. “Determining” can refer to measuring or ascertaining the reprogramming of a metabolic pathway. “Determining” can refer to ascertaining or measuring some type of neurologic, physiologic, and/or metabolic function and/or response.
- Methods and techniques used to determine the presence and/or severity of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction are typically known to the medical arts.
- the art is familiar with the ways to identify and/or diagnose the presence, severity, or both of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- Methods can be based on objective and/or subjective means.
- the term “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired result such as, for example, the treatment and/or prevention of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- the term the terms “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired an effect on an undesired condition (e.g., a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)).
- a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects.
- “therapeutically effective amount” can mean an amount of the disclosed composition that (i) treats a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1), (ii) attenuates, ameliorates, or eliminates one or more symptoms associated with a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1), or (iii) delays the onset of one or more symptoms of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction such as GA-1
- attenuates, ameliorates, or eliminates one or more symptoms associated with a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction such as GA-1
- delays the onset of one or more symptoms of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction such as GA-1).
- the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1) being treated; the disclosed compositions employed; the disclosed methods employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the disclosed compositions employed; the duration of the treatment; drugs used in combination or coincidental with the disclosed compositions employed, and other like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the disclosed compositions at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
- the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, a single dose of the disclosed compositions, disclosed viral vectors, disclosed pharmaceutical formulations, disclosed therapeutic agents, or a combination thereof can contain such amounts or submultiples thereof to make up the daily dose.
- the dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
- a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a sign or symptom associated with a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
- package insert can refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such therapeutic products.
- these and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds cannot be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed and a number of modifications that can be made to a number of molecules including the compounds are discussed, specifically contemplated is each and every combination and permutation of the compound and the modifications that are possible unless specifically indicated to the contrary.
- Glutaric Aciduria Type-1 (GA-1).
- Glutaric aciduria type-1 (GA-1) is a cerebral organic aciduria with neurometabolic features due to Glutaryl-CoA dehydrogenase (GCDH) deficiency. It is an autosomal recessive inborn error of lysine (primarily) and tryptophan metabolism with a worldwide prevalence estimated to be between 1 :30,000 to 1 : 100,000 live births. (Lindner M, et al. (2006) J Inherit Metab Dis. 29:378- 382; Kolker S, et al. (2006) Pediatr Res. 59:840-847).
- GCDH Glutaryl-CoA dehydrogenase
- GCDH catalyzes mitochondrial oxidative decarboxylation of glutaryl-CoA into crotonyl CoA and CO2 in the L-lysine (Fig.l), L- hydroxylysine and L-tryptophan catabolic pathway. Mutations in the GCDH gene cause characteristic clinical and biochemical phenotypes.
- the clinical phenotype is neurologic, characterized by macrocephaly at birth, subdural hematomas and acute retinal hemorrhage. During infancy and early childhood, patients with GA-1 are at risk of acute encephalopathic crises triggered by intercurrent illness, fever or fasting; damaging the brain striatum.
- the biochemical phenotype is diagnostic in high GA-1 excretors showing elevated 3- hydroxyglutaric acid (neurotoxic), and glutaric acid in urine organic acids and elevated glutarylcamitine (C5DC) in blood, the latter being the biomarker detected on newborn screening (NBS). These catabolites are also elevated in the blood, urine, CSF, and in liver, kidney, and brain tissues. In patients characterized as low excretors, biochemical studies may not be diagnostic, and in that case, GCDH mutation testing may help provide the diagnosis. (Lindner M, et al. (2006) J Inherit Metab Dis. 29:378-382). Early diagnosis and treatment following NBS often has led to more favorable outcomes when compliant with treatment plans.
- the standard of care treatment in GA-1 aims at reducing lysine; the main offending substrate that feeds into the pathway. This is achieved by restricting protein, mainly exogenous lysine and tryptophan; carnitine supplementation; and intensified emergency therapy with a high caloric glucose infusion to promote anabolism during illness. After the age of 6 years, dietary treatment is less protein restricted with continued metabolic supervision and follow up. There is no specific targeted therapy for GA-1 and untreated or poorly managed individuals with GA-1 develop acute encephalopathic crises during the first 6 years of life leading to poor outcomes and limited response to therapy. (Kolker S, et al. (2006) Pediatr Res. 59:840-847). Lysine Catabolism.
- Lysine is an essential amino acid necessary for protein synthesis. When lysine is not needed for protein synthesis, it proceeds to degradation via two catabolic pathways. Through saccharopine formation by s-deami nation, or pipecolic acid (PA) formation by a-deamination or transamination. Both pathways lead to formation of Al-piperideine-6-carboxylate (P6C) and its open form a-aminoadipic semialdehyde (AASA), which is then converted to a-aminoadipic acid (AAA) by the AASA dehydrogenase (ALDH7A1).
- P6C Al-piperideine-6-carboxylate
- AASA Al-aminoadipic semialdehyde
- AASA AASA dehydrogenase
- the saccharopine pathway in liver mitochondria is the major pathway for degradation of L-lysine into acetyl-CoA. Lysine is first converted into saccharopine, which is subsequently oxidized to AASA. This ultimately leads to generation of acetyl-CoA that enters the tricarboxylic acid cycle. This pathway is key for irreversible catabolism of extra-cerebral lysine. While the liver is the major organ for lysine catabolism, the kidney is involved, as well as the brain to a lesser degree.
- the pipecolate Pathway in brain peroxisomes is used for breakdown of the fraction of D- lysine that is catabolized in brain peroxisomes. There the a-amino group of lysine is converted to an a-keto function and further metabolized to P6C.
- the saccharopine pathway prevails in both fetal brain and extracerebral tissues, whereas after birth it maintains a pivotal role in extracerebral lysine catabolism through the liver (mainly), and kidney.
- the pipecolate pathway emerges to play the predominant role in brain lysine catabolism with only a minor role in extracerebral tissues.
- Hyperlysinemia Type 1 is an autosomal recessive condition due to an isolated mutation in the LKR subdomain of the AASS gene or mutations causing loss of function of both the LKR and saccharopine dehydrogenase (SDH) domains of the AASS gene.
- the condition is usually asymptomatic, with benign hyperlysinemia without neurological sequelae.
- Hyperlysinemia Type 2 is also known as saccharopinuria and is due to a deficiency of the SDH domain of AAS. This is a rare recessive inborn error of lysine metabolism associated with mutation of the AASS-SDH subdomain (with preserved LKR function). Clinically, patients with this disorder show signs of developmental delay, cognitive impairment, and spastic diplegia; biochemically, the condition is characterized by both hyperlysinemia and saccharopinuria. Saccharopinuria is due to mutation of the AASS-SDH subdomain and is associated with mitochondrial toxicity.
- Pyridoxine dependent epilepsy is an autosomal recessive disorder caused by mutations in ALDH7A1 an enzyme central to the lysine degradation pathways. Accumulation of high levels of the ALDH7A1 substrate AASA, and its cyclic form P6C is considered diagnostic markers in blood, urine, and CSF. Pipecolate elevations in body fluids can be observed but is not a reliable biomarker. Accumulation of AASA leads to depletion of pyridoxal phosphate, an essential coenzyme derived from vitamin B6. Patients with PDE present early in life with neonatal intractable seizures which are responsive to high doses of pyridoxine.
- a targeting component e.g., a nucleic acid sequence that recognizes a target sequence, for example a guide molecule or antisense molecule
- a protein or enzyme e.g., a nuclease or gene editor
- some gene editing systems such as zinc-finger nucleases, TALENS and meganucleases have only one protein component
- a gene editing system disclosed herein may comprise a CRISPR gene editing system, optionally selected from a CRISPR-Cas or CRISPR-KRAB gene editing system.
- a gene editing system disclosed herein may comprise a prime editing system.
- a gene editing system disclosed herein may comprise a prime editing system.
- a gene editing system disclosed herein may comprise abase editing system.
- agene editing system disclosed herein may comprise a zinc-finger nuclease gene editing system.
- a gene editing system disclosed herein may comprise a TALEN gene editing system.
- a gene editing system disclosed herein may comprise an ARCUS nuclease gene editing system.
- a gene editing system disclosed herein may comprise a meganuclease gene editing system.
- a gene editing system disclosed herein may comprise a recombinase gene editing system, optionally selected from a Cre recombinase or FLP tyrosine recombinase gene editing system.
- a gene editing system disclosed herein may comprise a transposase gene editing system, optionally selected from a Sleeping Beauty (SB) transposase or ISY100 transposase gene editing system.
- SB Sleeping Beauty
- a gene editing system disclosed herein may comprise an integrase gene editing system, optionally selected from a Streptomyces phage C31 integrase gene editing system.
- a gene editing system disclosed herein may comprise a homologous recombination gene editing system, optionally selected from small fragment homologous replacement editing system.
- a CRISPR-Cas system relies on two main components for these purposes: a guide RNA (gRNA) and CRISPR-associated (Cas) nuclease.
- the guide RNA is a specific RNA sequence that recognizes the target DNA region of interest and directs the Cas nuclease there for editing.
- a gRNA may comprise two parts: crispr RNA (crRNA), a 17-20 nucleotide sequence complementary to the target DNA, and a tracr RNA, which serves as a binding scaffold for the Cas nuclease.
- the gRNA may comprise additional parts that contribute functionality to the gene editing sstem.
- the CRISPR-associated protein or enzyme is a non-specific endonuclease. It is directed to the specific DNA locus by a gRNA, where it makes a double-strand break.
- CRISPR systems are adaptive defense systems originally discovered in bacteria and archaea.
- CRISPR-Cas systems use RNA-guided nucleases termed CRISPR-associated or “Cas” endonucleases (e.g., Cas9 or Cpfl) to cleave foreign DNA.
- CRISPR-associated or “Cas” endonucleases e.g., Cas9 or Cpfl
- an endonuclease is directed to a target nucleotide sequence (e.g., a site in the genome that is to be sequence-edited) by sequence-specific, non-coding “guide RNAs” that target single- or double-stranded DNA sequences.
- CRISPR-CAS systems Three classes of CRISPR-CAS systems have been identified (e.g., classes I, II, and III). Six types of CRISPR-CAS systems have been identified (e.g., type I, II, III, IV, V, and VI). Seven subtypes of CRISPR-CAS systems have been identified (e.g., subtypes A, B, C, D, E, F, and U). Any class, type, or subytpe of CRISPR-Cas is contempletated for as an aspect of the invention.
- the class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins).
- One class II CRISPR system includes a type II Cas endonuclease such as Cas9, a CRISPR RNA (“crRNA”), and a trans-activating crRNA (“tracrRNA”).
- the crRNA contains a “guide RNA”, typically about 20-nucleotide RNA sequence that corresponds to a target DNA sequence.
- the crRNA also contains a region that binds to the tracrRNA to form a partially double-stranded structure which is cleaved by RNase III, resulting in a crRNA/tracrRNA hybrid.
- the crRNA/tracrRNA hybrid then directs the Cas9 endonuclease to recognize and cleave the target DNA sequence.
- the target DNA sequence must generally be adjacent to a “protospacer adjacent motif’ (“PAM”) that is specific for a given Cas endonuclease; however, PAM sequences appear throughout a given genome.
- PAM protospacer adjacent motif
- CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; examples of PAM sequences include 5’-NGG (Streptococcus pyogenes), 5’- NNAGAA (Streptococcus thermophilus CRISPR1), 5’-NGGNG (Streptococcus thermophilus CRISPR3), and 5’-NNNGATT (Neisseria meningiditis).
- a SpCas9 (3’NGG - PAM sequence) can comprise SpCas9 VQR (3’NGAN or 3’NGNG), SpCas9 EQR (3’NGAG), or SpCas9 VRER (3’NGCG).
- CRISPR or clustered regularly interspaced short palindromic repeat is an ideal tool for correction of genetic abnormalities as the system can be designed to target genomic DNA directly.
- a CRISPR system involves two main components - a Cas9 enzyme and a guide (gRNA).
- the gRNA contains a targeting sequence for DNA binding and a scaffold sequence for Cas9 binding.
- Cas9 nuclease is often used to “knockout” target genes hence it can be applied for deletion or suppression of genes involved in metabolism. Similar to ASOs and siRNAs, CRISPR offers a great flexibility in targeting any gene of interest hence, potential CRISPR based therapies can be designed based on the genetic mutation in individual patients.
- CRISPR CRISPR-mediated genome editing
- ASOs or siRNAs RNA interference methods
- multiple gRNAs can be employed to suppress or activate multiple genes simultaneously, hence increasing the treatment efficacy and reducing resistance potentially caused by new mutations in the target genes.
- a disclosed sgRNA can be directed at any functional domain of a target sequence.
- CRISPR-based endonucleases may include RNA-guided endonucleases that comprise at least one nuclease domain and at least one domain that interacts with a guide RNA.
- a guide RNA directs the CRISPR-based endonucleases to a targeted site in a nucleic acid at which site the CRISPR-based endonucleases cleaves at least one strand of the targeted nucleic acid sequence.
- the CRISPR-based endonuclease is universal and can be used with different guide RNAs to cleave different target nucleic acid sequences.
- CRISPR-based endonucleases are RNA-guided endonucleases derived from CRISPR/Cas systems. Bacteria and archaea have evolved an RNA- based adaptive immune system that uses CRISPR (clustered regularly interspersed short palindromic repeat) and Cas (CRISPR-associated) proteins to detect and destroy invading viruses or plasmids. CRISPR/Cas endonucleases can be programmed to introduce targeted site-specific double-strand breaks by providing target-specific synthetic guide RNAs (Jinek et al. (2012) Science. 337:816-821).
- a disclosed CRISPR-based endonuclease can be derived from a CRISPR/Cas type I, type II, or type III system; or a subtype A, subtype B, subtype C, subtype D, subtype E, subtype F, or subtype U system.
- Non-limiting examples of suitable CRISPR/Cas proteins include Cascade, Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, CaslO, CaslOd, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl3a (C2c2), Casl3b(C2c4), Casl3c (C2c7), Casl3d, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or Cas A), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4,
- a disclosed CRISPR-based endonuclease can be derived from a type II CRISPR/Cas system.
- a CRISPR-based endonuclease can be derived from a Cas9 protein.
- the Cas9 protein can be from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp, Nocardiopsis rougevillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp
- CRISPR/Cas proteins can comprise at least one RNA recognition and/or RNA binding domain.
- RNA recognition and/or RNA binding domains can interact with the guide RNA such that the CRISPR/Cas protein is directed to a specific genomic or genomic sequence.
- CRISPR/Cas proteins can also comprise nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains, as well as other domains.
- the CRISPR-based endonuclease can be a wild type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a fragment of a wild type or modified CRISPR/Cas protein.
- the CRISPR/Cas protein can be modified to increase nucleic acid binding affinity and/or specificity, alter an enzymatic activity, and/or change another property of the protein.
- nuclease i.e., DNase, RNase
- a CRISPR/Cas protein can be truncated to remove domains that are not essential for the function of the protein.
- a CRISPR/Cas protein also can be truncated or modified to optimize the activity of the protein or an effector domain fused with a CRISPR/Cas protein.
- a disclosed CRISPR-based endonuclease can be derived from a wild type Cas9 protein or fragment thereof.
- a disclosed CRISPR-based endonuclease can be derived from a modified Cas9 protein.
- the amino acid sequence of a disclosed Cas9 protein can be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, etc.) of the protein.
- domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild type Cas9 protein.
- CRISPR-mediated insertion of exon is a technique that allows for the nearly error-free insertion of coding sequences with high efficiency. Instead of targeting gene exons, CRISPIE targets introns and inserts a designer donor module, which includes an exon encoding the desired protein sequence and the surrounding intronic sequences. INDELs occurring at the insertion junction within the intronic region of DNA will be spliced out, resulting in very low error rates at the mRNA level (>98% correct).
- CRISPIE is flexible and broadly compatible with: (1) both N- and C-terminal labeling, (2) proteins with diverse structures and functions, including pre- and post-synaptic proteins and cytoskeletal proteins, (3) all major transfection methods, (4) FPs with diverse colors, and (5) multiple animal species.
- introns offer ample editing sites to choose from, and because INDELs at the DNA level do not affect the success of editing, a high labeling efficiency (up to 43%) was achieved in cortical neurons of living mice.
- CRISPIE-mediated DNA insertions are erasable. By flanking the donor module with additional designer CRISPR editing sites in the intronic region, the inserted DNA fragment can be erased at a later time.
- CRISPIE may allow for the routine labeling of proteins at endogenous levels and can be expanded to the insertion of other genetically encoded functional sequences to manipulate protein function. (See Zhong H, et al. (2021) eLife.10:e64911, which is incorporated by reference for its teaching of CRISPIE).
- RNA Interference RNA Interference
- siRNA Small Interfering RNA
- RNA interference is a sequence-specific RNA degradation process that provides a relatively easy and direct way to knock down, or silence, theoretically any gene.
- dsRNA double-stranded RNA
- Dicer small interfering RNA
- siRNA small interfering RNA
- nt 19-27 nucleotides
- RISC RNA-induced silencing complex
- siRNA One strand of siRNA remains associated with RISC and guides the complex toward a cognate RNA that has sequence complementary to the guider ss-siRNA in RISC. This siRNA-directed endonuclease digests the RNA, thereby inactivating it.
- Recent studies have revealed that chemically synthesized 21 -27-nt siRNAs exhibit RNAi effects in mammalian cells, and the thermodynamic stability of siRNA hybridization (at terminals or in the middle) plays a central role in determining the molecule's function.
- RNAi in mammalian cells in the laboratory or, potentially, in therapeutic settings, use either chemically synthesized siRNAs or endogenously expressed molecules.
- the endogenous siRNA is first expressed as small hairpin RNAs (shRNAs) by an expression vector (plasmid or virus vector) and is then processed by Dicer into siRNAs.
- shRNAs small hairpin RNAs
- nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase (GCDH).
- GCDH glutaryl-CoA dehydrogenase
- isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more functional domains of glutaryl-CoA dehydrogenase.
- a disclosed nucleic acid sequence encoding a glutaryl- CoA dehydrogenase can be derived from a non-mammalian species or from a mammalian species.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be that of a non-mammalian species or that of a mammalian species.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence set forth in SEQ ID NO:01 or in SEQ ID NO:02. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the functional domains of the sequence set forth in SEQ ID NO:01 or in SEQ ID NO:02.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence set forth in SEQ ID NO: 01 or in SEQ ID NO:02.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence of Gene ID 2639 or of Gene ID 270076.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence of Gene ID 2639 or the sequence of Gene ID 270076.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence of Gene ID 2639 or of Gene ID 270076 or one or more functional domains thereof.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence of Gene ID 2639 or the sequence of Gene ID 270076 or one or more functional domains thereof.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence set forth in NCBI Reference Sequence NG 009292 from bases 5001 to 13840 or the sequence set forth in NCBI Reference Sequence NC_000074.7 from bases 85629378 to 85613016.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence set forth in NCBI Reference Sequence NG_009292 from bases 5001 to 13840 or the sequence set forth in NCBI Reference Sequence NC_000074.7 from bases 85629378 to 85613016.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof.
- the techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof are known to the skilled person.
- the GCDH may be a variant GCDH sequence comprising one or more substitutions selected from K163R, K240R, K202R, OR K371R; the substitutions K163R and K240R; the substitutions K202R and K371R; or the substitutions selected K163R, K202R, K240R, and K371R.
- the GCDH may comprise or consist of the amino acid sequence set forth in any one of SEQ ID NOS:3, SEQ ID NO:200, SEQ ID NO:201, or SEQ ID NO:202.
- a nucleic acid sequence encoding the variant GCDH sequence may comprise the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, or SEQ ID NO: 196, or a variant thereof
- a disclosed isolated nucleic acid molecule can be codon-optimized for expression in a mammalian cell or a human cell. In an aspect, a disclosed isolated nucleic acid molecule can be CpG-free or CpG-depleted. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be codon-optimized for expression in a mammalian cell or a human cell. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be CpG-free or CpG-depleted.
- a disclosed isolated nucleic acid molecule can further comprise a nucleic acid sequence encoding a carb oxy -terminal fluorescent label and/or fluorescent tag, an amino-terminal fluorescent label and/or fluorescent tag, or a combination thereof.
- a disclosed fluorescent label and/or fluorescent tag can comprise green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof.
- EGFP green fluorescent protein
- EYFP enhanced yellow fluorescent protein
- mApple TdTomato
- mCherry miRFP670
- any known fluorescent label or tag or any combination thereof.
- Fluorophores and fluorescent labels are known in the art.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can restore the functionality of a missing, dysfunctional, and/or mutated glutaryl-CoA dehydrogenase in a cell or a subject.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl- CoA to crotonyl-CoA, (v) can improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) can improve memory function of a subject, (vii) can reduce anxiety in a subject, (viii) can reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) can improve and/or reduce and/or eliminate vascular endot
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis in the subject’s liver, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
- a disclosed isolated nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can treat and/or prevent Glutaric Aciduria Type-1 in a subject.
- a disclosed isolated nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
- a disclosed isolated nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- a disclosed isolated nucleic acid molecule can comprise the nucleic acid sequence for one or more regulatory elements.
- a disclosed regulatory element can comprise a promoter, an enhancer, an internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly- U sequences), or any combination thereof.
- Regulatory elements can include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences such as brain cells or neurons).
- a disclosed isolated nucleic acid molecule can comprise a promoter operably linked to a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase.
- a disclosed promoter can comprise a tissue specific promoter.
- a disclosed tissue specific promoter can comprise a neuron-specific promoter, a muscle-specific promoter, a liverspecific promoter, a skeletal muscle-specific promoter, and heart-specific promoter.
- a disclosed tissue-specific promoter can comprise a brain cell specific promoter.
- Brain cell specific promoter are known to the art and can comprise a synapsin 1 (Synl) promoter, a calmodulin/calcium dependent kinase II (CAMKII) promoter, a glial fibrillary acidic protein (GFAP) promoter, a Rgs5 promoter, a S100 beta promoter, a neuron-specific enolase (NSE) promoter, a Thyl promoter, or any combination thereof.
- a disclosed promoter can comprise a promoter/enhancer.
- a disclosed promoter can comprise a liver-specific promoter. Liver specific promoters are known to the art. In an aspect, a disclosed liver promoter can comprise the sequence set forth in SEQ ID NO:26. In an aspect, a disclosed promoter can comprise a type III RNA polymerase III promoter. Type III RNA polymerase III promoters are known to the art. In an aspect, a disclosed type III RNA polymerase III promoter can comprise a U6 promoter. In an aspect, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO:27. [0254] In an aspect, a disclosed isolated nucleic acid molecule can comprise one or more OLLAS tag.
- a disclosed OLLAS tag can comprise the sequence set forth in SEQ ID NO:31.
- a disclosed isolated nucleic acid molecule can comprise a nuclear localization signal (NLS).
- a disclosed NLS can comprise the sequence set forth in SEQ ID NO:30 or SEQ ID NO:32. NLS are known to the skilled person in the art.
- a disclosed isolated nucleic acid molecule can comprise one or more inverted terminal repeats (ITRs).
- the one or more disclosed ITRs can be derived from AAV2 or AAV9.
- a disclosed ITR can comprise the sequence set forth in any one of SEQ ID NO:22 or SEQ ID NO:23.
- a disclosed isolated nucleic acid molecule can comprise a polyA sequence.
- a disclosed polyA sequence can comprise the sequence set forth in SEQ ID NO:24 or SEQ ID NO:25.
- a disclosed isolated nucleic acid molecule can comprise one or more hemagglutinin (HA) tags.
- HA tag can comprise the sequence set forth in SEQ ID NO:29.
- a disclosed isolated nucleic acid molecule can comprise a TracrRNA sequence.
- a TracrRNA sequence can comprise the sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12.
- Disclosed herein is an isolated nucleic acid sequence comprising the sequence set forth in SEQ ID NO: 19 or a fragment thereof. Disclosed herein is an isolated nucleic acid sequence comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more to the sequence set forth in SEQ ID NO: 19 or a fragment thereof.
- a disclosed isolated nucleic acid molecule encoding a disclosed isolated nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be packaged in a viral vector (as discussed infra) or a non-viral vector.
- a disclosed non-viral vector can be a polymer-based vector, a peptide-based vector, a lipid nanoparticle, a solid lipid nanoparticle, or a cationic lipid-based vector.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be packaged in a recombinant AAV viral vector (e.g., AAV8 or AAVcc47).
- AAV viral vector e.g., AAV8 or AAVcc47.
- a disclosed encoded glutaryl-CoA dehydrogenase can be derived from a nonmammalian species or from a mammalian species. In an aspect, a disclosed encoded glutaryl- CoA dehydrogenase can be that of a non-mammalian species or that of a mammalian species.
- a disclosed encoded glutaryl-CoA dehydrogenase can comprise the sequence set forth in SEQ ID NO:03 or in SEQ ID NO:04. In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can comprise a sequence having about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more identity to the sequence set forth in SEQ ID NO:03 or in SEQ ID NO:04.
- a disclosed encoded glutaryl-CoA dehydrogenase can comprise the sequence of NCBI Reference Sequence NP 000150.1 or the sequence of NCBI Reference Sequence XP_036009971.1.
- a disclosed encoded glutaryl-CoA dehydrogenase can comprise one or more amino acid substitutions, insertions, deletions, modifications, or any combination thereof. The techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof are known to the skilled person.
- a disclosed encoded glutaryl-CoA dehydrogenase can be a variant GCDH comprising one or more amino acid substitutions (e.g., relative to a wild-type GCDH sequence).
- the wild-type GCDH may be a human sequence.
- a variant GCDH may comprise one or more substitutions at positions relative to SEQ ID NO:3.
- a variant GCDH may be a fragment of full-length GCDH, which comprises at least one functional domain.
- a variant GCDH may comprise one or more substitutions selected from K163R, K240R, K202R, or K371R, wherein amino acid numbering is according to SEQ ID NO:3.
- a variant GCDH may comprise one or more substitutions selected from K163R, K240R, K202R, or K371R, wherein amino acid numbering is according to SEQ ID NO:3.
- a variant GCDH may comprise the substitutions K163R and K240R, wherein amino acid numbering is according to SEQ ID NO:3.
- a variant GCDH may comprise the substitutions K202R and K371R, wherein amino acid numbering is according to SEQ ID NO:3.
- a variant GCDH may comprise the substitutions K163R, K202R, K240R, and K371R, wherein amino acid numbering is according to SEQ ID NO: 3.
- a variant GCDH comprises the amino acid sequence set forth in SEQ ID NO:200, SEQ ID NO:201, or SEQ ID NO:202, or a fragment thereof.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199.
- a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more identity to the sequence set forth SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199.
- a disclosed encoded glutaryl-CoA dehydrogenase can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) can improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) can improve memory function of a subject, (vii) can reduce anxiety in a subject, (viii) can reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) can improve and/or reduce and/or eliminate vascular dysfunction in a
- a disclosed encoded glutaryl-CoA dehydrogenase can treat and/or prevent Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase encoding a glutaryl-CoA dehydrogenase can improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- GFP green fluorescent protein
- an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase operably linked a promoter.
- an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:01 or in SEQ ID NO:02, and is operably linked a promoter.
- an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, and is operably linked a promoter.
- the gene editing system may be a CRISPR-based system, such as that from a bacteria.
- a CRISPR gene editing system may be a CRISPR-Cas system, such as a Class I or Class II CRISPR-Cas system.
- a CRISPR gene editing system may be a Type I, Type II, Type III, Type IV, Type V, or a Type VI CRISPR-Cas system.
- a CRISPR gene editing system may be a Subtype A, Subtype B, Subtype C, Subtype D, Subtype E, Subtype F, or Subtype U CRISPR-Cas system.
- a CRISPR gene editing system may a Cascade, SpCas9, SaCas9, FnCas9, NmCas9, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl3a (C2c2), Casl3b(C2c4), Casl3c (C2c7), or Casl3d CRISPR-Cas system. It may or may not have CRISPR effector molecules.
- the gene editing system may lack an sgRNA or transcriptional repression domains such as KRAB.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in a target in the aminoadipatesemialdehyde synthase gene.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the a-aminoadipic semialdehyde gene.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the a- aminoadipic semialdehyde gene.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the kynurenine aminotransferase 2 gene.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the dehydrogenase El and transketolase domain-containing protein 1 gene.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the L-lysine alpha-oxidase gene.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the ketimine reductase mu- crystallin protein gene.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the peroxisomal sarcosine oxidase gene.
- an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the pyrroline-5 -carboxylate reductase gene.
- a disclosed element of a gene editing system can be a CRISPR-based endonuclease.
- a disclosed endonuclease can be Cas9.
- a disclosed Cas9 can be that of Staphylococcus aureus or Streptococcus pyogenes.
- a disclosed Cas9 can be derived from Staphylococcus aureus or Streptococcus pyogenes.
- a disclosed Cas9 can be that of or derived from a species other than S. aureus or S. Pyogenes.
- a disclosed Cas9 can be any known Cas9 (see, e.g., those discussed supra).
- a disclosed Cas9 can be any known Cas9 (see, e.g., those discussed supra).
- Cas9 can be any Cas9 analog.
- Cas9 is well known to the art and the skilled person can identify and employ a Cas9 from one or more species without undue experimentation.
- a disclosed Cas9 can have a sequence having at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the set forth in SEQ ID NO:28 or a fragment thereof.
- a disclosed Cas9 can comprise one or more amino acid substitutions, insertions, deletions, modifications, or any combination thereof. The techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof into a sequence encoding Cas9 are known to the skilled person.
- a disclosed element of a gene editing system can comprise a sgRNA.
- the art is familiar with sgRNAs and the skilled person can identify and employ a sgRNA without undue experimentation.
- a disclosed sgRNA can be directed at any functional domain of a target sequence.
- a disclosed sgRNA can be directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- a disclosed sgRNA can comprise an sgRNA directed at a target sequence in a disclosed mouse glutaryl-CoA dehydrogenase (mGcdh) gene or at a disclosed human glutaryl-CoA dehydrogenase gene.
- mGcdh mouse glutaryl-CoA dehydrogenase
- a disclosed mGcdh gene can comprise the sequence set forth in SEQ ID NO: 02.
- a disclosed hGCDH gene can comprise the sequence set forth in SEQ ID NO:01.
- a disclosed hGCDH gene can comprise the sequence set forth in SEQ ID NO: 17.
- a disclosed hGCDH gene can comprise the sequence set forth in SEQ ID NO: 18.
- a disclosed sgRNA can comprise an sgRNA directed at a target sequence in exon 3 of mouse glutaryl-CoA dehydrogenase
- a disclosed sgRNA directed at a target sequence in exon 3 of mGcdh gene can comprise the sequence set forth in SEQ ID NO: 05.
- a disclosed sgRNA can comprise an sgRNA directed at a target sequence in exon 5 of mouse glutaryl-CoA dehydrogenase (mGcdh) gene.
- a disclosed sgRNA directed at a target sequence in exon 5 of mGcdh can comprise the sequence set forth in SEQ ID NO:06.
- a disclosed sgRNA can be directed at aminoadipate-semialdehyde synthase gene.
- a disclosed aminoadipate-semialdehyde synthase can comprise a human or a mouse aminoadipate-semialdehyde synthase.
- a disclosed sgRNA can comprise an sgRNA directed at a target sequence in exon 6 of mouse aminoadipate-semialdehyde synthase (mAass) gene.
- mAass mouse aminoadipate-semialdehyde synthase
- a disclosed sgRNA directed at a target sequence in exon 6 of mAass gene can comprise the sequence set forth in SEQ ID NO:07 or SEQ ID NO:08.
- a disclosed sgRNA can comprise an sgRNA directed at a target sequence in exon 7 of mouse aminoadipate-semialdehyde synthase (mAass) gene.
- mAass mouse aminoadipate-semialdehyde synthase
- a disclosed sgRNA directed at a target sequence in exon 7 of mAass gene can comprise the sequence set forth in SEQ ID NO:09 or SEQ ID NO: 10.
- a disclosed sgRNA can be directed at any functional domain of a target sequence.
- An sgRNA targeting AASS may target a similar region of AASS as the target sites as described herein for a silencing oligonucleotide, e.g., in the same UTR, exon, or portion there as described herein, if that position also satisfies sgRNA structural requirements (e.g., PAM site proximity).
- sgRNA structural requirements e.g., PAM site proximity
- a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can be derived from a non-mammalian species or from a mammalian species. In an aspect, a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can be that of a non-mammalian species or that of a mammalian species.
- a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can comprise the sequence set forth in SEQ ID NO: 01 or in SEQ ID NO: 02.
- a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can comprise a sequence having about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more identity to the sequence set forth in SEQ ID NO: 01 or in SEQ ID NO: 02.
- a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can comprise the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18.
- a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can comprise a sequence having about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more identity to the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18.
- a disclosed encoded aminoadipate-semialdehyde synthase can comprise the sequence of NCBI Reference Sequence NP 000150.1 or the sequence of NCBI Reference Sequence XP_036009971.1.
- a disclosed encoded aminoadipate-semialdehyde synthase can comprise one or more amino acid substitutions, insertions, deletions, modifications, or any combination thereof. The techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof are known to the skilled person.
- a disclosed element of a gene editing system can comprise a TracrRNA.
- a TracrRNA can be directed a target gene of interest.
- a TracrRNA can be directed at at a target sequence in human or mouse aminoadipate-semialdehyde synthase gene or at a human or mouse glutaryl-CoA dehydrogenase gene.
- a disclosed TracrRNA can be directed at a target sequence in exon 6 of Aaas or exon 7 of Aass.
- a disclosed TracrRNA can comprise the sequence set forth in SEQ ID NO: 11 or in SEQ ID NO: 12.
- a disclosed an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a nucleic acid sequence encoding two ITRs, a first promoter, a sgRNA, a second promoter, and a Cas9.
- a disclosed first promoter is operably linked to a disclosed sgRNA.
- a disclosed second promoter is operably linked to a disclosed Cas9.
- a disclosed an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a nucleic acid sequence encoding two ITRs, a promoter, a sgRNA, a TracrRNA, a second promoter, and a Cas9.
- a disclosed promoter is operably linked to a disclosed sgRNA.
- a disclosed promoter is operably linked to a disclosed Cas9.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof.
- the techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof are known to the skilled person.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can be codon-optimized for expression in a mammalian cell or a human cell.
- a disclosed isolated nucleic acid molecule can be CpG-free or CpG-depleted.
- a disclosed isolated nucleic acid molecule can further comprise a nucleic acid sequence encoding a carboxy -terminal fluorescent label and/or fluorescent tag, an amino-terminal fluorescent label and/or fluorescent tag, or a combination thereof.
- a disclosed fluorescent label and/or fluorescent tag can comprise green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof.
- EGFP green fluorescent protein
- EYFP enhanced yellow fluorescent protein
- mApple TdTomato
- mCherry miRFP670
- fluorescent label or tag or any combination thereof.
- Fluorophores and fluorescent labels are known in the art.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system
- (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) can improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) can improve memory function of a subject, (vii) can reduce anxiety in a subject, (viii) can reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) can
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can treat and/or prevent Glutaric Aciduria Type-1 in a subject.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise the nucleic acid sequence for one or more regulatory elements.
- a disclosed regulatory element can comprise a promoter, an enhancer, an internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), or any combination thereof.
- Regulatory elements can include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences such as brain cells or neurons).
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- a first disclosed promoter can comprise a type III RNA polymerase III promoter.
- Type III RNA polymerase III promoters are known to the art.
- a disclosed type III RNA polymerase III promoter can comprise a U6 promoter.
- a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO:27.
- a first disclosed promoter can comprise the sequence set forth in SEQ ID NO:27.
- a first disclosed promoter e.g., a disclosed U6 promoter
- a disclosed sgRNA such as, for example, a disclosed sgRNA for mouse or human aminoadipate-semialdehyde synthase
- a second disclosed promoter can comprise a liver-specific promoter. Liver specific promoters are known to the art.
- a disclosed liver promoter can comprise the sequence set forth in SEQ ID NO:26.
- a second disclosed promoter e.g., a liver-specific promoter
- can be operably linked to a disclosed Cas9 such as, for example, a disclosed SaCas9).
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise one or more inverted terminal repeats (ITRs).
- the one or more disclosed ITRs can be derived from AAV2 or AAV9.
- a disclosed ITR can comprise the sequence set forth in any one of SEQ ID NO:22 or SEQ ID NO:23.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a first 5’ ITR and a second 3 ’ ITR.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise one or more OLLAS tag.
- a disclosed OLLAS tag can comprise the sequence set forth in SEQ ID NO:31.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a nuclear localization signal (NLS).
- a disclosed NLS can comprise the sequence set forth in SEQ ID NO:30 or SEQ ID NO:32. NLS are known to the skilled person in the art.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a polyA sequence.
- a disclosed polyA sequence can comprise the sequence set forth in SEQ ID NO:24 or SEQ ID NO:25.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise one or more hemagglutinin (HA) tags.
- a disclosed HA tag can comprise the sequence set forth in SEQ ID NO:29.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can be packaged in a viral vector (as discussed infra) or a non-viral vector.
- a disclosed non-viral vector can be a polymer- based vector, a peptide-based vector, a lipid nanoparticle, a solid lipid nanoparticle, or a cationic lipid-based vector.
- a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can be packaged in a recombinant AAV viral vector (e.g., AAV8 or AAVcc47).
- AAV viral vector e.g., AAV8 or AAVcc47.
- nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:20 or SEQ ID NO:21, or a fragment thereof.
- nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the nucleic acid sequence comprises a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more to the sequence set forth in SEQ ID NO:20 or SEQ ID NO:21, or a fragment thereof.
- FIG. 10C Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the nucleic acid molecule is represented by FIG. 10D.
- an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system operably linked to one or more promoters.
- an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the endonuclease is operably linked a promoter and wherein the sgRNA is operably linked to a promoter.
- an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in aminoadipate-semialdehyde synthase gene, wherein the endonuclease is operably linked a promoter and wherein the sgRNA is operably linked to a promoter.
- a nucleic acid as disclosed herein may be silencing oligonucleotide, which may hybridize to a targeted gene (e.g., its mRNA) at a target site, and silences the gene and/or inhibits protein expression or activity.
- a silencing oligonucleotide may be single stranded, or double stranded.
- the silencing oligonucleotide may be an siRNA, antisense oligonucleotide, ribozymes, miRNA, shRNA, ssRNA, dsRNA, piRNA, or a 3'UTR of mRNA.
- a silencing oligonucleotide can target any part of a gene, to silence the gene and/or inhibit expression or activity.
- a silencing oligonucleotide can target any part of the aminoadipatesemialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
- a silencing oligonucleotide that can target any part of the aminoadipatesemialdehyde synthase gene.
- a silencing oligonucleotide that can target any part of the aminoadipate-semialdehyde synthase gene, the sequence of which is set forth in SEQ ID NO:36, or is accessible at the NBCBI Reference NM 005763.4 entitled Homo sapiens aminoadipate-semialdehyde synthase (AASS), mRNA; nuclear gene for mitochondrial product.
- Nucleotide position numbering of AASS for target sequence identification may be based upon the SEQ ID NO:36, SEQ ID NO:206, or sequence of which is accessible at the NBCBI Reference that a skilled artisan would recognize as for AASS (e.g., human AASS at NCBI Ref.: NM_005763.4).
- AASS e.g., human AASS at NCBI Ref.: NM_005763.4
- a silencing oligonucleotide that can target any part of an aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
- a silencing oligonucleotide that can target any part of an the aminoadipate-semialdehyde synthase sequence comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36.
- a silencing oligonucleotide that can target any part of the aminoadipate-semialdehyde synthase sequence comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
- a targeted part of an AASS sequence can comprise about 15 to about 35 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 20 to about 30 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 20 to about 24 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 21 to about 22 base pairs. In an aspect, a disclosed silencing oligonucleotide effects a complete silencing of the aminoadipate-semialdehyde synthase gene.
- a disclosed silencing oligonucleotide can effect the partial silencing of the a- aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene.
- a disclosed silencing oligonucleotide can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
- a disclosed silencing oligonucleotide can effect the partial silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5 -carboxylate reductase gene in a subject’s liver.
- a disclosed silencing oligonucleotide can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene in a subject’s liver.
- a targeted part of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene can comprise about 15 to about 35 base pairs.
- a targeted part of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domaincontaining protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene can comprise about 20 to about 30 base pairs.
- a targeted part of the a- aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene can comprise about 20 to about 24 base pairs.
- a targeted part of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene can comprise about 21 to about 22 base pairs.
- a disclosed silencing oligonucleotide can effect the partial silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed silencing oligonucleotide can effect the complete silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed silencing oligonucleotide can effect the partial silencing of the aminoadipate- semialdehyde synthase gene in a subject’s liver. In an aspect, a disclosed silencing oligonucleotide can effect the complete silencing of the aminoadipate-semialdehyde synthase gene in a subject’s liver.
- a silencing oligonucleotide that targets the aminoadipate-semialdehyde synthase gene can target a target site or sequence within the aminoadipate-semialdehyde synthase gene.
- the target site or target squence may be within an exon of the aminoadipate-semialdehyde synthase gene, or between two exons (e.g., at an overlap region).
- a overlap region may be a portion of the the aminoadipate-semialdehyde synthase gene that a silencing oligonucleotide hybridizes with (e.g., targets), where a portion of the hybridization occurs at a first region, and another portion of the hybridization occurs at a second region. Therefore, a silencing oligonucleotide may target and hybridize two regions (e.g., a first region, and and a second region) simultaneously, concurrently, or sequentially. The first and second regions may be adjacent to each other.
- the silencing oligonucleotide may target a target sequence within the AASS (e.g., AASS gene or AASS mRNA) with the 5’UTR, within exon 1, within exon 2, within exon 3, within exon 4, within exon 5, within exon 6, within exon 7, within exon 8, within exon 9, within exon 10, within exon 11, within exon
- AASS e.g., AASS gene or AASS mRNA
- AASS e.g., AASS gene or AASS mRNA
- a silencing oligonucleotide may target an overlap region of the AASS (e.g., AASS gene or AASS mRNA) comprising a portion of a first region of AASS and a portion of a second region of AASS.
- the portion of the first region of AASS may be within the 5’UTR of AASS and the portion of the second region of AASS may be within exon 1 of AASS.
- the portion of the first region of AASS may be within exon 1 of AASS and the portion of the second region of AASS may be within exon 2 of AASS.
- the portion of the first region of AASS may be within exon 2 of AASS and the portion of the second region of AASS may be within exon 3 of AASS.
- the portion of the first region of AASS may be within exon 3 of AASS and the portion of the second region of AASS may be within exon 4 of AASS.
- the portion of the first region of AASS may be within exon 4 of AASS and the portion of the second region of AASS may be within exon 5 of AASS.
- the portion of the first region of AASS may be within exon 5 of AASS and the portion of the second region of AASS may be within exon 6 of AASS.
- the portion of the first region of AASS may be within exon 6 of AASS and the portion of the second region of AASS may be within exon 7 of AAS.
- the portion of the first region of AASS may be within exon 7 of AASS and the portion of the second region of AASS may be within exon 8 of AASS.
- the portion of the first region of AASS may be within exon 8 of AASS and the portion of the second region of AASS may be within exon 9 of AASS.
- the portion of the first region of AASS may be within exon 9 of AASS and the portion of the second region of AASS may be within exon 10 of AASS.
- the portion of the first region of AASS may be within exon 10 of AASS and the portion of the second region of AASS may be within exon 11 of AASS.
- the portion of the first region of AASS may be within exon 11 of AASS and the portion of the second region of AASS may be within exon 12 of AASS.
- the portion of the first region of AASS may be within exon 12 of AASS and the portion of the second region of AASS may be within exon 13 of AASS.
- the portion of the first region of AASS may be within exon 13 of AASS and the portion of the second region of AASS may be within exon 14 of AASS.
- the portion of the first region of AASS may be within exon 14 of AASS and the portion of the second region of AASS may be within exon 15 of AASS.
- the portion of the first region of AASS may be within exon 15 of AASS and the portion of the second region of AASS may be within exon 16 of AASS.
- the portion of the first region of AASS may be within exon 16 of AASS and the portion of the second region of AASS may be within exon 17 of AASS.
- the portion of the first region of AASS may be within exon 17 of AASS and the portion of the second region of AASS may be within exon 18 of AASS.
- the portion of the first region of AASS may be within exon 18 of AASS and the portion of the second region of AASS may be within exon 19 of AASS.
- the portion of the first region of AASS may be within exon 19 of AASS and the portion of the second region of AASS may be within exon 20 of AASS.
- the portion of the first region of AASS may be within exon 20 of AASS and the portion of the second region of AASS may be within exon 21 of AASS.
- the portion of the first region of AASS may be within exon 21 of AASS and the portion of the second region of AASS may be within exon 22 of AASS.
- the portion of the first region of AASS may be within exon 22 of AASS and the portion of the second region of AASS may be within exon 23 of AASS.
- the portion of the first region of AASS may be within exon 23 of AASS and the portion of the second region of AASS may be within exon 24 of AASS.
- the portion of the first region of AASS may be within exon 24 of AASS and the portion of the second region of AASS may be within exon 25 of AASS.
- the portion of the first region of AASS may be within exon 25 of AASS and the portion of the second region of AASS may be the 3’UTR of AASS.
- the hybridization location of the silencing oligonucleotide may be distributed between the first and second regions of the overlap (e.g., a ratio of overlap). Different percentages of the length of the oligonucleotide may be hybridized with the first region and second exon.
- about 90% of the number of nucleotides of the overlap region may be within the first region and about 10% of the number of nucleotides of the overlap region may within the second region.
- about 80% of the number of nucleotides of the overlap region may be within the first region and about 20% of the number of nucleotides of the overlap region may be within the second region.
- about 70% of the number of nucleotides of the overlap region may be within the first region and about 30% of the number of nucleotides of the overlap region may be within the second region.
- about 60% of the number of nucleotides of the overlap region may be within the first region and about 40% of the number of nucleotides of the overlap region may be within the second region.
- about 50% of the number of nucleotides of the overlap region may be within the first region and about 50% of the number of nucleotides of the overlap region may be within the second region.
- about 40% of the number of nucleotides of the overlap region may be within the first region and about 60% of the number of nucleotides of the overlap region may be within the second region.
- about 30% of the number of nucleotides of the overlap region may be within the first region and about 70% of the number of nucleotides of the overlap region may be within the second region.
- about 20% of the number of nucleotides of the overlap region may be within the first region and about 80% of the number of nucleotides of the overlap region may be within the second region.
- about 10% of the number of nucleotides of the overlap region may be within the first region and about 90% of the number of nucleotides of the overlap region may be within the second region.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotide positions of an exon of an AASS gene or mRNA as disclosed herein.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 127-142 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 256-271 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 355-370 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 433-448 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 486-501 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 572-587 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 661-676 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 777-792 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 858-873 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1045-1060 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1329-1344 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1345-1360 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1378-1393 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1490-1505of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1672-1687 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1832-1847 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1944-1959 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2042-2057 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2072-2087 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2220-2235 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2384-2399 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2588-2603 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2714-2729 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 615-635 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 726-746 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 742-760 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 742-762 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 843-863 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 911-929 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 911-931 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1010-1030 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1154-1172 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1154-1174 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1292-1310 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1292-1312 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1355-1375 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1358-1376 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1358-1378 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1364-1384 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1476-1496 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1521-1541 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1531-1551 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1613-1633 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2222-2242 of the sequence set forth in SEQ ID NO:36.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2438-2458 of the sequence set forth in SEQ ID NO:36.
- the silencing oligonucleotide may a single stranded antisense oligonucleotide.
- the silencing oligonucleotide may be an double stranded siRNA.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions within a window of about 20 nucleotides or less, in the 3’ direction from a starting position selected from position 95, 103, 104, 105, 292, 489, 533, 534, 726, 739, 740, 893, 1059, 1181, 1447, 1448, 1449, 2197, 2211, 2468, 2492, 2498, 2804, 2805, 2526, 3061, 3929, 4002, 4003, 4004, 5278, 5283, 5411, 5416, 5417, 5605, 5678, or 5679 of an AASS gene or AASS mRNA, e.g., having the sequence set forth in SEQ ID NO:36.
- the said window of nucleotides may comprises about 19 nucleotides or less, 18 nucleotides or less, 17 nucleotides or less, 16 nucleotides or less, 15 nucleotides or less, 14 nucleotides or less, 13 nucleotides or less, 12 nucleotides or less, 11 nucleotides or less, 10 nucleotides or less, 9 nucleotides or less, 8 nucleotides or less, 7 nucleotides or less, 6
- the silencing oligonucleotide may a single stranded antisense oligonucleotide. In an aspect, the silencing oligonucleotide may be a double stranded siRNA. In an aspect, a silencing oligonucleotide is equal to or longer than its target sequence.
- a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA, e.g., corresponding to positions within a window of about 20 nucleotides or less, in the 3 ’ direction from a starting position selected from position , 31, 105, 195, 280, 488, 530, 892, 1060, 1144, 1306, 1384, 1385, 1455, 2100, 2151, 2214, 2825, 2914, 4003, 4004, 4366, 5283, or 5679 of an AASS gene or AASS mRNA having the sequence set forth in SEQ ID NO:36.
- the said window of nucleotides may comprises about 19 nucleotides or less, 18 nucleotides or less, 17 nucleotides or less, 16 nucleotides or less, 15 nucleotides or less, 14 nucleotides or less, 13 nucleotides or less, 12 nucleotides or less, 11 nucleotides or less, 10 nucleotides or less, 9 nucleotides or less, 8 nucleotides or less, 7 nucleotides or less, 6
- the silencing oligonucleotide may a single stranded antisense oligonucleotide. In an aspect, the silencing oligonucleotide may be a double stranded siRNA.
- a silencing oligonucleotide may target a target sequence of any one of the silencing olignucleotides disclosed in the Examples of the application, selected from the target sequence of any one of TABLES 10-15, or the reverse complement thereof.
- any isolated nucleic acid described herein, which targets AASS may target a targeting site as described herein this section.
- silencing oligonucleotide may comprise or consist of a nucleic acid sequence selected from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74-117, 120-182, or a reverse complement thereof.
- silencing oligonucleotide may comprise or consist of a nucleic acid sequence as described herein the Examples.
- a silencing oligonucleotide may be conjugated to a tissue-targeting moiety.
- the tissue-targeting moiety may be liver-tissue specific.
- the tissue targeting moiety may comprise one or more GalNAc, optionally two GalNAc (e.g., a GalNAc dimer) or three GalNAc (e.g., a GalNAc trimer).
- the silencing oligonucleotide comprising or consisting of said nucleic acid sequences, or as described herein the Examples, may be chemically modified as described herein, e.g. by phosphorothioation, or locked nucleic acid design.
- the silencing oligonucleotide may a single stranded antisense oligonucleotide.
- the silencing oligonucleotide may be an double stranded siRNA.
- siRNAs can be silencing oligonucleotides that can be used to silence genes.
- a gene to be silenced by the siRNA or the silenced gene is AASS.
- the process is as follows: (i) double-stranded RNA is cleaved by the Dicer enzyme, which forms siRNA, (ii) double-stranded siRNA then enters the cell and forms the RNA-induced silencing complex (RISC) with other proteins, (iii) this is unwound, which forms the singlestranded siRNA, (iv) the strand of RNA with the 5’ end base pairing that is thermodynamically less stable remains part of the RISC complex, which strand can now scan for complementary mRNA, (v) once this anti-sense strand binds to the target mRNA, mRNA cleavage is induced, and (vi) the foreign mRNA is recognized by the host cell as abnormal and is degraded
- RISC RNA-induced silencing complex
- an siRNA that can target any part of an aminoadipate-semialdehyde synthase gene.
- an siRNA that can target any part of the aminoadipate- semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO: 35 or SEQ ID NO:36.
- an siRNA that can target any part of an aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
- a targeted part of an AASS sequence by siRNA can comprise about 15 to about 35 base pairs. In an aspect, a targeted part of an AASS sequence by siRNA can comprise about 20 to about 30 base pairs. In an aspect, a targeted part of an AASS sequence by siRNA can comprise about 20 to about 24 base pairs. In an aspect, a targeted part of an AASS sequence by siRNA can comprise about 21 to about 22 base pairs.
- the siRNA comprises a double stranded oligonucleotide, which is about 15 to about 35 base pairs in length. In an aspect, the siRNA comprises a double stranded oligonucleotide, which is about 20 to about 30 base pairs in length, an aspect, the siRNA comprises a double stranded oligonucleotide, which is about 20 to about 24 base pairs in length an aspect, the siRNA comprises a double stranded oligonucleotide, which is about 21 to about 22 base pairs in length [0324] In an aspect, the siRNA comprises a sense and antisense strand, respectively, selected from: SEQ ID NO:74 and SEQ ID NO:75; SEQ ID NO:76 and SEQ ID NO:77; SEQ ID NO:78 and SEQ ID NO:79; SEQ ID NO:80 and SEQ ID NO:81; SEQ ID NO:82 and SEQ ID NO:83; SEQ ID NO:84 and SEQ ID NO:85;
- a disclosed siRNA effects the complete silencing of the aminoadipatesemialdehyde synthase gene. In an aspect, a disclosed siRNA can effect the partial silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed siRNA can effect the complete silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed siRNA can effect the partial silencing of the aminoadipate-semialdehyde synthase gene in a subject’s liver. In an aspect, a disclosed siRNA can effect the complete silencing of the aminoadipate-semialdehyde synthase gene in a subject’s liver.
- an siRNA that can target any part of the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
- a disclosed siRNA can effect the partial silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene.
- a disclosed siRNA can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
- a disclosed siRNA can effect the partial silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene in a subject’s liver.
- a disclosed siRNA can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5 -carboxylate reductase gene in a subject’s liver.
- ASOs Antisense Oligonucleotides
- antisense oligonucleotides can be silencing oligonucleotides that can be used to silence genes.
- a gene to be silenced by an ASO or the silenced gene is AASS.
- an antisense oligonucleotide that can target any part of an aminoadipate-semialdehyde synthase gene is an antisense oligonucleotide that can target any part of the aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36.
- an antisense oligonucleotide that can target any part of an aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
- a targeted part of an AASS sequence by an ASO can comprise about 14 to about 30 nucleotides. In an aspect, a targeted part of an AASS sequence by an ASO can comprise about 15 to about 28 nucleotides. In an aspect, a targeted part of an AASS sequence by an ASO can comprise about 16 to about 26 nucleotides. In an aspect, a targeted part of an AASS sequence by an ASO can comprise about 17 to about 24 nucleotides.
- a disclosed antisense oligonucleotide targets a target sequence of AASS, wherein the target sequence comprises any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74- 117, 120-182, or a reverse complement thereof.
- an ASO comprises or consists of a a nucleic acid sequence selected from from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74- 117, 120-182, or a reverse complement thereof.
- a disclosed antisense oligonucleotide effects the complete silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed antisense oligonucleotide can effect the partial silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed antisense oligonucleotide can effect the complete silencing of the aminoadipate- semialdehyde synthase gene. In an aspect, a disclosed antisense oligonucleotide can effect the partial silencing of the aminoadipate-semialdehyde synthase gene in a subject’s liver.
- a disclosed antisense oligonucleotide can effect the complete silencing of the aminoadipate- semialdehyde synthase gene in a subject’s liver.
- an antisense oligonucleotide that can target any part of the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
- a disclosed antisense oligonucleotide can effect the partial silencing of the a- aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene.
- a disclosed antisense oligonucleotide can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
- a disclosed antisense oligonucleotide can effect the partial silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5 -carboxylate reductase gene in a subject’s liver.
- a disclosed antisense oligonucleotide can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene in a subject’s liver.
- mRNA therapy involves introduction of an mRNA sequence (e.g., an isolated nucleic acid encoding a gene) to subject, such as for instance, to be used in protein replacement therapy.
- An mRNA oligonuclotide may be used to induce functional expression of a target gene or protein.
- mRNA therapy which can be directed to one or more enzymes in the pipecolate pathway, the saccharopine pathway, or both.
- a disclosed mRNA molecule can be used to induce functional GCDH expression in a mammal or a mammalian cell.
- the disclosed functional GCDH can be induced in a subject’s liver or brain or in cells found in the liver or in the brain.
- a disclosed mRNA sequence can be used to induce functional a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-cry stallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase expression in a mammal or a mammalian cell.
- the disclosed functional a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-cry stallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase can be induced in a subject’s liver or brain or in cells found in the liver or in the brain.
- a disclosed mRNA sequence comprises (i) at least one 5'-cap structure; (ii) a 5'-UTR; (iii) an open reading frame (ORF) encoding a functional protein of interest (e.g., a GCDH that is recombinant, or wildtype, or a variant); (iv) a 3 '-UTR; and (v) a poly-A region.
- the mRNA nucleotide may futher comprise a promoter, optionally selected from a T7 promoterr.
- the open reading frame (ORF) of the gene of interest may be flanked by a 5’ untranslated region (UTR) which may contain a strong Kozak translational initiation signal and/or an 3 ’UTR, optionally a n alpha-globin 3 ’UTR, which may include an oligo(dT) sequence for templated addition of a poly- A tail.
- UTR untranslated region
- 3 ’UTR optionally a n alpha-globin 3 ’UTR, which may include an oligo(dT) sequence for templated addition of a poly- A tail.
- multiple 5’ or 3’ UTRs may be included in the flanking regions and may be the same or of different sequences.
- a disclosed mRNA sequence (e.g., an isolated nucleic acid encoding a gene) may be a modified mRNA (mmRNA).
- mmRNA encodes a polypeptide of interested, but is preferable for its modifications that avoid limitations of its unmodified counterpart mRNA molecule.
- Such modifications are improved structural features, which are ones in which two or more linked nucleotides are inserted, deleted, duplicated, inverted, or randomized in a mRNA.
- Traditional mRNA molecule can comprise at least a coding region, a 5’UTR, a 3’UTR, a 5’cap and a poly-A tail.
- Modified mRNAs comprise one or more structural and/or chemical modifications or alterations which impart useful properties to the polynucleotide.
- mmRNAs may reduce immunogenicity, increase stability, or enchance the therapeutic effectiveness compared to a traditional mRNA.
- the 5’ cap structure of mRNA is critical for nuclear export and mRNA stability, as 5’decapping may subject a nucleic acid molecule for degradation. Modifications toward a non- hydrolyzable cap are preferred.
- the at least one 5’ cap structure is selected from capO, capl, cap 2, N-6 methyladenosine cap 1, N6-methylyad enosine cap 2, ARC A, inosine, Nl- methyl-guanosine, 2-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, or 2-azido-guanosine.
- Additional modifications that can be included as a 5’ cap structure on a mRNA may be alpha-thio-guanosine nucleotides; phosphorothioate linkage in form of a 5’-ppp-5’cap; modified guanosine nucleotides in the 5’ cap, such as alpha- methyl-phosphonate and seleno-phosphate nucleotides; 2 ’-0 -methylation of the ribose sugars of 5’-terminal and/or 5’-anteterminal nucleotides of the mRNA.
- Additional modifications that can be included as a 5’ cap structure on a mRNA may be synthetic cap analogs; chemical caps; chemical cap analogs; or structural or functional cap analogs, which are different from natural (i.e. endogenous, wild-type or physiological) 5 ’-caps in their chemical structure.
- Cap analogs may be chemically (i.e. non-enzymatically) or enzymatically synthesized and/or linked to the mRNA.
- Additional modifications that can be included as a 5’ cap structure on a mRNA may be an Anti-Reverse Cap Analog (ARCA) cap (e.g., two guanines linked by a 5-5- triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3-O-methyl group (i.e., N7,3’-O-dimethyl-guanosine-5-triphosphate-5-guanosine)); or mCAP, which similar to ARCA but comprising a 2’-O-methyl group on guanosine.
- ARCA Anti-Reverse Cap Analog
- a 5’UTR of an mRNA or mmRNA disclosed herein may comprise a Kozak sequence.
- Kozak sequences may comprise the consensus sequence CCR(A/G)CCAUGG, where R is a purine, which is three bases upstream of the start codon (AUG), which is followed by another ‘G’.
- the 5’UTR may comprise a 5’UTR of a liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII.
- liverspecific 5’UTR could be used to enhance expression of a functional GCDH protein in in hepatic cell lines or liver.
- the 5’UTR can also be non-natural, e.g. synthetic.
- the 5’UTR may comprises or consist of the seqeunce set forth in SEQ ID NO: 189, or a fragment thereof.
- the ORF may also include various upstream or downstream additions, such as, but not limited to, p-globin, tags, etc.
- a 3’UTR of an mRNA or mmRNA disclosed herein may comprise an alpha-globin 3- UTR.
- the 3’UTR may comprise or consist of the seqeunce set forth in SEQ ID NO: 190.
- the 3’UTR may comprise one or more AU rich elements, optionally a class 1 AU rich elements, Class 2 AU rich elements, or a Class 3 AU rich element.
- the 3’UTR may comprise one or more microRNA binding sites.
- a disclosed mRNA molecule can comprise at least one nonstandard nucleobase.
- a disclosed modified mRNA (mmRNA) sequence may comprise a 1- methyl'P modification.
- a disclosed modified mRNA sequence may comprise a 1 5- methylcytidine (5-methylC) modification.
- a disclosed modified mRNA sequence may comprises a 5-methoxyuridine (5-methoxyU) modification.
- a disclosed modified mRNA sequence may comprises a 5-methylC modificatoin.
- a disclosed modified mRNA sequence may comprises a 2-thio-uridine modfication.
- a disclosed modified mRNA sequence may comprise N1 -methylpseudouridine or other potential modification provided for by U.S. Patent No.: 10,898,574 B2.
- a disclosed mRNA molecule can be encapsulated within a nanoparticle (e.g., a lipid nanoparticle).
- a disclosed nanoparticle can be a liposome.
- a disclosed liposome can comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids.
- a disclosed liposome can comprise one or more cholesterol-based lipids.
- a disclosed liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids and one or more PEG-modified lipids.
- a disclosed liposome can comprise no more than three distinct lipid components (such as, for example, a sterol-based cationic lipid).
- a disclosed sterol-based cationic lipid can be imidazole cholesterol ester (ICE), GL-TES-SA-DME- E18-2, TL1-01D-DMA, SY-3-E14-DMAPr, TL1-10D-DMA, Guan-SS-Chol, GL-TES-SA- DMP-E18-2, HEP-E4-E10, HEP-E3-E10, TL1- 04D-DMA, GL-TES-SA-DME-E18-2, TL1- 01D-DMA, SY-3-E14-DMAPr, TL1-10D-DMA, or a combination thereof.
- a disclosed nanoparticles can have a size of less than about 200 nm, or less than about 150 nm, or less than about 120 nm, or less than about 110 nm, or less than about 100 nm, or less than about 80 nm, or less than about 60 nm, or less than about 50 nm, or less than about 40 nm, or less than about 30 nm.
- a viral vector comprising a disclosed isolated nucleic acid molecule.
- a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase.
- a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding aminoadipate-semialdehyde synthase.
- viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding green fluorescent protein (GFP).
- GFP green fluorescent protein
- a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, aminoadipate-semialdehyde synthase, or green fluorescent protein.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:01 or a fragment thereof.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:02 or a fragment thereof.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 17 or a fragment thereof.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 18 or a fragment thereof.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:01, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:02, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 17, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof.
- a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 18, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof.
- a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest.
- a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in glutaryl-CoA dehydrogenase gene.
- a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in aminoadipate-semialdehyde synthase gene
- AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- Said gene editing system may a gene editing system as described herein.
- a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest.
- a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
- a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest.
- AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
- a viral vector comprising the sequence set forth in SEQ ID NO: 19.
- a viral vector comprising the sequence set forth in SEQ ID NO:20.
- a viral vector comprising the sequence set forth in SEQ ID NO:21.
- a disclosed viral vector can comprise a nucleic acid sequence encoding a carb oxy -terminal fluorescent label and/or fluorescent tag, an amino-terminal fluorescent label and/or fluorescent tag, or a combination thereof.
- a disclosed fluorescent label and/or fluorescent tag can comprise green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof. Fluorophores and fluorescent labels are known.
- a disclosed viral vector can be an adenovirus vector, an AAV vector, a herpes simplex virus vector, a retrovirus vector, a lentivirus vector, and alphavirus vector, a flavivirus vector, a rhabdovirus vector, a measles virus vector, a Newcastle disease viral vector, a poxvirus vector, or a picomavirus vector.
- a disclosed viral vector can be an adenovirus vector, an adenovirus-associated (AAV) vector, or a lentivirus vector.
- a disclosed AAV vector can be a recombinant AAV (rAAV) vector.
- a disclosed AAV vector can include naturally isolated serotypes including, but not limited to, AAV1, AAV2, AAV3 (including 3a and 3b), AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV13, AAVrh39, AAVrh43, AAVcy.7 as well as bovine AAV, caprine AAV, canine AAV, equine AAV, ovine AAV, avian AAV, primate AAV, non-primate AAV, and any other virus classified by the International Committee on Taxonomy of Viruses (ICTV) as an AAV.
- AAV1, AAV2, AAV3 including 3a and 3b
- AAV4 AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV13, AAVrh39,
- an AAV capsid can be a chimera either created by capsid evolution or by rational capsid engineering from a naturally isolated AAV variants to capture desirable serotype features such as enhanced or specific tissue tropism and/or a host immune response escape.
- Naturally isolated AAV variants include, but not limited to, AAV-DJ, AAV-HAE1, AAV-HAE2, AAVM41, AAV- 1829, AAV2 Y/F, AAV2 T/V, AAV2i8, AAV2.5, AAV9.45, AAV9.61, AAV-B1, AAV-AS, AAV9.45A-String (e.g., AAV9.45-AS), AAV9.45Angiopep, AAV9.47-Angiopep, and AAV9.47-AS, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAV-F, AAVcc.47, and AAVcc.81.
- a disclosed AAV vector can be AAV-Rh74 or a related variant (e.g., capsid variants like RHM4-1).
- a disclosed AAV vector can comprise AAVcc.47.
- a disclosed nucleic acid sequence can have a coding sequence that is less than about 4.5 kilobases.
- a disclosed vector can comprise the nucleic acid sequence for one or more regulatory elements.
- a disclosed regulatory element can comprise a promoter, an enhancer, an internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), or any combination thereof.
- Regulatory elements can include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences such as brain cells or neurons).
- a disclosed vector can comprise a promoter operably linked to a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase.
- a disclosed promoter can comprise a tissue specific promoter.
- a disclosed tissue specific promoter can comprise a neuron-specific promoter, a muscle-specific promoter, a liver-specific promoter, a skeletal muscle-specific promoter, and heart-specific promoter.
- a disclosed tissue-specific promoter can comprise a brain cell specific promoter.
- Brain cell specific promoter are known to the art and can comprise a synapsin 1 (Synl) promoter, a calmodulin/calcium dependent kinase II (CAMKII) promoter, a glial fibrillary acidic protein (GFAP) promoter, a Rgs5 promoter, a S100 beta promoter, a neuron-specific enolase (NSE) promoter, a Thyl promoter, or any combination thereof.
- Synl synapsin 1
- CAMKII calmodulin/calcium dependent kinase II
- GFAP glial fibrillary acidic protein
- Rgs5 promoter a Rgs5 promoter
- S100 beta promoter a S100 beta promoter
- NSE neuron-specific enolase
- a disclosed promoter can comprise a liver-specific promoter. Liver specific promoters are known to the art. In an aspect of a disclosed vector, a disclosed liver promoter can comprise the sequence set forth in SEQ ID NO:26. In an aspect of a disclosed vector, a disclosed promoter can comprise a type III RNA polymerase III promoter. Type III RNA polymerase III promoters are known to the art. In an aspect, a disclosed type III RNA polymerase III promoter can comprise a U6 promoter. In an aspect of a disclosed vector, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO:27.
- a disclosed vector can comprise one or more OLLAS tag.
- a disclosed OLLAS tag can comprise the sequence set forth in SEQ ID NO:31.
- a disclosed vector can comprise a nuclear localization signal (NLS).
- a disclosed NLS can comprise the sequence set forth in SEQ ID NO:30 or SEQ ID NO:32. NLS are known to the skilled person in the art.
- a disclosed vector can comprise one or more inverted terminal repeats (ITRs).
- the one or more disclosed ITRs can be derived from AAV2 or AAV9.
- a disclosed ITR can comprise the sequence set forth in any one of SEQ ID NO:22 or SEQ ID NO:23.
- a disclosed vector can comprise a polyA sequence.
- a disclosed polyA sequence can comprise the sequence set forth in SEQ ID NO:24 or SEQ ID NO:25.
- a disclosed vector can comprise one or more hemagglutinin (HA) tags.
- HA tag can comprise the sequence set forth in SEQ ID NO:29.
- a disclosed vector can comprise a TracrRNA sequence.
- a TracrRNA sequence can comprise the sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12.
- a therapeutically effective amount of disclosed vector can comprise a range of about 1 x IO 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 to about 8 x 10 13 vg/kg or about 1 x 10 12 to about 8 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 13 to about 6 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of at least about 1 x IO 10 , at least about 5 x IO 10 , at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of no more than about 1 x IO 10 , no more than about 5 x IO 10 , no more than about 1 x 10 11 , no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 12 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 vg/kg.
- a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
- a disclosed viral vector can be validated and/or characterized using an animal model such as mice and/or C. elegans.
- a disclosed vector can restore the functionality of a missing, dysfunctional, and/or mutated glutaryl-CoA dehydrogenase in a cell or a subj ect.
- a disclosed vector (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) can improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) can improve memory function of a subject, (vii) can reduce anxiety in a subject, (viii) can reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemor
- a disclosed vector can treat and/or prevent Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed vector can improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed vector can improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject. Formulations
- Disclosed herein is a pharmaceutical formulation comprising one or more disclosed GCDH nucleic acid molecules, disclosed CRISPR based nucleic acid molecules, disclosed viral vectors, disclosed cells, disclosed plasmids, or any combination thereof, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipatesemialdehyde synthase gene, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising a disclosed isolated nucleic acid molecule, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding aminoadipate-semialdehyde synthase, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding green fluorescent protein (GFP), and at least one pharmaceutically acceptable carrier.
- GFP green fluorescent protein
- a pharmaceutical formulation comprising a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl- CoA dehydrogenase, aminoadipate-semialdehyde synthase, or green fluorescent protein, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:01 or a fragment thereof, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 02 or a fragment thereof, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:01 or SEQ ID NO: 02, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipatesemialdehyde synthase gene, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at glutaryl-CoA dehydrogenase, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in the target gene of interest, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, and at least one pharmaceutically acceptable carrier.
- a pharmaceutical formulation comprising a viral vector comprising the sequence set forth in SEQ ID NO: 19, SEQ ID NO:20, or SEQ ID NO:21, and at least one pharmaceutically acceptable carrier.
- a disclosed pharmaceutical formulation can comprise at least one lyoprotectant.
- a disclosed lyoprotectant can comprise peptone, glycerol, lactose, gelatin, glucose, sucrose, trehalose, dextran, maltodextrin, adonitol, sodium glutamate, or any combination thereof. Lyoprotectants are known to those skilled in the art.
- a disclosed pharmaceutical formulation can comprise at least one gelling agent, preferably a pharmaceutically acceptable gelling agent.
- a disclosed pharmaceutical formulation can comprise at least preservative such as, for example, benzyl alcohol, cresols, benzoic acid, phenol, parabens, or sorbic acid.
- a disclosed pharmaceutical formulation can comprise at least one stabilizer such as, for example, a surfactant, a polymer, a polyol, a poloxamer, an albumin, a gelatin, a trehalose, a protein, a sugar, a polyvinylpyrrolidone, a N-acetyl -tryptophan (NAT), a caprylate (e.g., sodium caprylate), a polysorbate (e.g., P80), an amino acid, and a divalent metal cation (e.g., zinc).
- stabilizer such as, for example, a surfactant, a polymer, a polyol, a poloxamer, an albumin, a gelatin, a trehalose, a protein, a sugar, a polyvinylpyrrolidone, a N-acetyl -tryptophan (NAT), a caprylate (e.g., sodium caprylate), a polysorbate
- Disclosed herein is a cell comprising a disclosed isolated nucleic acid molecule or a disclosed plasmid. Disclosed herein are cells transfected by one or more disclosed nucleic acid molecules. Disclosed herein are cells transduced by one or more disclosed vectors.
- Disclosed herein are cells having a GCDH ” genotype. Disclosed herein are cells having a AASS7’ genotype. Disclosed herein are cells having a GCDH/' and AASS7’ genotype.
- Disclosed herein are cells having a Gcdh" genotype. Disclosed herein are cells having a Aass7‘ genotype. Disclosed herein are cells having a Gcdh 7’ and Aass7‘ genotype.
- Disclosed herein are cells demonstrating a GCDH7' genotype following transduction with a disclosed viral vector. Disclosed herein are cells demonstrating a AASS7’ genotype following transduction with a disclosed viral vector. Disclosed herein are cells demonstrating a GCDH7' and AASS7’ genotype following transduction with a disclosed viral vector.
- Disclosed herein are cells demonstrating a Gcdh7‘ genotype following transduction with a disclosed viral vector. Disclosed herein are cells demonstrating a Aass7‘ genotype following transduction with a disclosed viral vector. Disclosed herein are cells demonstrating a Gcdh 7’ and Aass7‘ genotype following transduction with a disclosed viral vector.
- disclosed transduced cells can comprise any central nervous system cells.
- CNS cells include but are not limited to neurons, glial cells, vascular cells, and combinations thereof.
- neurons include sensory neurons, motor neurons, interneurons, brain neurons, and combinations thereof.
- Neurons includes multipolar neurons, unipolar neurons, bipolar neurons, pseudo-unipolar neurons, and combinations thereof.
- disclosed transduced cells can comprise hepatocytes.
- disclosed transduced cells can comprise mammalian brain cells or mammalian hepatocytes.
- Disclosed herein are cells transfected by a disclosed plasmid. Disclosed herein are cells transduced by a vector comprising the sequence set forth in SEQ ID NO: 19. Disclosed herein are cells transduced by a vector comprising the sequence set forth in SEQ ID NO:20. Disclosed herein are cells transduced by a vector comprising the sequence set forth in SEQ ID NO:21. Disclosed herein are cells transfected by an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:01 or SEQ ID NO:02. Disclosed herein are cells transfected by an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18.
- cells transfected by an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:35 or in SEQ ID NO:36.
- cells transfected by an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:37 or in SEQ ID NO:38.
- disclosed cells can comprise cells harvested and/or obtained from a subject.
- disclosed cells can comprise cells harvested and/or obtained from a subject suspected of having or diagnosed with GA-1. Techniques to achieve transfection are known to the art and using transfected cells are known to the art.
- a plasmid used in a disclosed method Disclosed herein is a plasmid comprising one or more disclosed isolated nucleic acid molecules (e.g., any one of the nucleic acid sequences of SEQ ID NOS: 1-SEQ ID NO:206). Disclosed herein is a plasmid comprising one or more disclosed proteins (e.g., the nucleic acid encoding any one of the protein sequeences of SEQ ID NOS: 1 -SEQ ID NO:206).
- a disclosed plasmid can comprise an isolated nucleic acid molecule comprising the sequence set forth in any one of SEQ ID NO:01 - SEQ ID NO:02, or a fragment thereof.
- a disclosed plasmid can comprise an isolated nucleic acid molecule encoding the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04, or a fragment thereof.
- a disclosed plasmid can comprise an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof.
- a disclosed plasmid can comprise an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36, or a fragment thereof.
- a disclosed plasmid can comprise an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39, or a fragment thereof.
- a disclosed plasmid can comprise a nucleic acid sequence for a disclosed fluorescent label and/or fluorescent tag.
- a disclosed fluorescent label and/or fluorescent tag can comprise green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof. Fluorophores and fluorescent labels are known.
- kits comprising one or more disclosed isolated nucleic acid molecules (e.g., silencing oligonucleotide, e.g. siRNA or antisense oligonucleotide), one or more disclosed vectors, one or more disclosed cells, one or more disclosed plasmids, or any combination thereof.
- a kit comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase.
- a kit comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- kits comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in the target gene of interest.
- a kit comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at aminoadipate-semialdehyde synthase.
- kits comprising a viral vector comprising a disclosed isolated nucleic acid molecule.
- a kit comprising a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, or a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding aminoadipate-semialdehyde synthase, or a nucleic acid sequence encoding green fluorescent protein (GFP).
- GFP green fluorescent protein
- kits comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:01 or a fragment thereof, or comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 02 or a fragment thereof.
- kits comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 17 or a fragment thereof, or comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 18 or a fragment thereof.
- kits comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- a kit comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in the target gene of interest.
- kits comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- kits comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
- a kit comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- kits comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest.
- kits comprising a viral vector comprising the sequence set forth in SEQ ID NO: 19.
- a kit comprising a viral vector comprising the sequence set forth in SEQ ID NO:20.
- a kit comprising a viral vector comprising the sequence set forth in SEQ ID NO:21.
- kits comprising cells comprising a disclosed isolated nucleic acid molecule or a disclosed plasmid.
- a kit comprising cells transfected by one or more disclosed nucleic acid molecules Disclosed herein is a kit comprising cells transduced by one or more disclosed vectors.
- kits comprising cells having a Gcdh' ' genotype.
- a kit comprising cells having a Aass" ’ genotype.
- a kit comprising cells having a Gcdh' ' and Aass 7 ' genotype.
- a kit comprising cells demonstrating a Gcdh'' genotype following transduction with a disclosed viral vector.
- a kit comprising cells demonstrating a Aass" genotype following transduction with a disclosed viral vector.
- a kit comprising cells demonstrating a Gcdh 7 ' and Aass 7 ' genotype following transduction with a disclosed viral vector.
- kits comprising cells having a GCDH 7 ' genotype.
- a kit comprising cells having a AASS 7 ' genotype.
- a kit comprising cells having a GCDH 7 ' and AASS 7 ' genotype.
- a kit comprising cells demonstrating a GCDH 7 ' genotype following transduction with a disclosed viral vector.
- a kit comprising cells demonstrating a AASS 7 ' genotype following transduction with a disclosed viral vector.
- a kit comprising cells demonstrating a GCDH 7 ' and AASS 7 ' genotype following transduction with a disclosed viral vector.
- kits comprising cells transfected by a disclosed plasmid.
- a kit comprising cells transduced by a vector comprising the sequence set forth in SEQ ID NO: 19.
- a kit comprising one or more disclosed compositions and/or components and/or agents that can be used in any disclosed method.
- kits comprising one or more disclosed compositions and/or components and/or agents that can be used in validating and/or characterizing a disclosed composition (such as, for example, a disclosed isolated nucleic acid molecule, a disclosed plasmid, a disclosed viral vector, or any combination thereof).
- validating and/or characterizing can comprise using an animal model such as mice and/or C. elegans.
- a disclosed fluorescent label or a fluorescent tag in an aspect of a disclosed kit, can comprise enhanced green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof.
- EGFP enhanced green fluorescent protein
- EYFP enhanced yellow fluorescent protein
- mApple TdTomato
- mCherry miRFP670
- any known fluorescent label or tag or any combination thereof.
- Fluorophores and fluorescent labels are known in the art.
- a disclosed kit can comprise at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose (such as, for example, performing any aspect of a disclosed method including preparing the components used in a disclosed method).
- Individual member components can be physically packaged together or separately.
- a kit comprising an instruction for using the kit can or cannot physically include the instruction with other individual member components.
- the instruction can be supplied as a separate member component, either in a paper form or an electronic form which can be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation.
- a kit for use in a disclosed method can comprise one or more containers holding a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, and a label or package insert with instructions for use.
- suitable containers include, for example, bottles, vials, syringes, blister pack, etc.
- the containers can be formed from a variety of materials such as glass or plastic.
- the container can hold a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, or a combination thereof, and can have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- the label or package insert can indicate that a disclosed composition, a disclosed viral vector, a disclosed nucleic acid molecule, a disclosed cell, or a combination thereof, can be used in a disclosed method.
- a kit can comprise additional components necessary for administration such as, for example, other buffers, diluents, filters, needles, and syringes.
- a disclosed kit can be used (i) to restore liver-specific modulation of lysine catabolism, (ii) to restore one or more aspects of lysine homeostasis in a subject’s liver, (iii) to reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) to restore the metabolic flux from glutaryl-CoA to crotonyl-CoA in a subject’s liver, (v) to improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) to improve memory function of a subject, (vii) to reduce anxiety in a subject, (viii) to reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) to improve and/or reduce and/or eliminate
- a disclosed kit can be used treat and/or prevent Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed kit can be used to improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed kit can be used to improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- a method of restoring the expression of glutaryl-CoA dehydrogenase comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl- CoA dehydrogenase.
- a method of restoring the expression of glutaryl-CoA dehydrogenase comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl- CoA dehydrogenase in the subject’s liver.
- a method of restoring the expression of glutaryl-CoA dehydrogenase comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
- a method of restoring the expression of glutaryl- CoA dehydrogenase comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
- a method of restoring the expression of glutaryl-CoA dehydrogenase comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
- a method of restoring the expression of glutaryl- CoA dehydrogenase comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
- a method of restoring the expression of glutaryl-CoA dehydrogenase comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
- a method of restoring the expression of glutaryl-CoA dehydrogenase comprising treating a subject in need thereof by administering to the subj ect a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
- a method of restoring the expression of glutaryl-CoA dehydrogenase comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
- Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
- a method of restoring the expression of glutaryl-CoA dehydrogenase treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
- Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
- the GCDH may be a variant GCDH sequence comprising one or more substitutions selected from K163R, K240R, K202R, OR K371R; the substitutions K163R and K240R; the substitutions K202R and K371R; or the substitutions selected K163R, K202R, K240R, and K371R.
- a nucleic acid sequence encoding the variant GCDH sequence may comprise the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, or SEQ ID NO: 196, or a variant thereof.
- a method of restoring the expression of glutaryl-CoA dehydrogenase the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the sequence set forth in SEQ ID NO: 19, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
- Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the sequence set forth in SEQ ID NO: 19, wherein expression of the nucleic acid sequence generates a functional glutaryl- CoA dehydrogenase in the subject’s liver.
- a disclosed method can restore normal lysine catabolism in the subject’s liver.
- a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
- a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
- the expression of glutaryl-CoA dehydrogenase can be restored in the subject’s liver.
- the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1).
- G-1 glutaric aciduria type 1
- a subject can be male or female.
- a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
- the disclosed subject’s GA-1 related and/or associated behavior can be modulated.
- the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
- administering a disclosed viral vector can be administered systemically or directly.
- administering a disclosed viral vector molecule can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof.
- administering a disclosed viral vector can be administered by any method of administration disclosed herein.
- a disclosed viral vector can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
- administering a disclosed viral vector can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
- a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
- administering a disclosed viral vector can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- multiple doses can be administered via the same route or via differing routes of administration.
- a disclosed viral vector can be administered via multiple routes of administration.
- a disclosed viral vector can comprise a recombinant AAV vector.
- a disclosed AAV vector can comprise AAVcc.47.
- a disclosed AAV vector can comprise AAV8.
- a therapeutically effective amount of disclosed vector can comprise a range of about 1 x IO 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about l x 10 11 to about 8 x 10 13 vg/kg or about 1 x 10 12 to about 8 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 13 to about 6 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of at least about 1 x IO 10 , at least about 5 x IO 10 , at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of no more than about 1 x IO 10 , no more than about 5 x IO 10 , no more than about 1 x 10 11 , no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 12 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 vg/kg.
- a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, restoring the expression of GA-1).
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or the treating step. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both.
- modifying the treating step can comprise changing the amount of the vector administered to the subject, changing the frequency of administration of the vector, changing the duration of administration of the vector, changing the route of administration of the vector, or any combination thereof.
- modifying the administering step can comprise changing the amount of the vector administered to the subject, changing the frequency of administration of the vector, changing the duration of administration of the vector, changing the route of administration of the vector, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- Therapeutic agents are known.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators.
- the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators.
- the method can further comprise continuing to treat the subject and/or continuing to monitor the subject.
- the method can further comprise modifying one or more steps of the method.
- modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators.
- modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
- a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering and/or treating step and/or following the administering and/or treating steps.
- a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments.
- a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof.
- metabolic and/or physiologic data can inform the clinician.
- techniques to monitor, measure, and/or assess the restoring of the expression of glutaryl-CoA dehydrogenase can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled.
- a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art.
- a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof.
- a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
- a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40- 50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50- 60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise repeating an administering step one or more times. In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise repeating a treating step one or more times.
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of a subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) improving memory function of a subject, (vii) reduce anxiety in a subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of a subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise treating and/or preventing Glutaric Aciduria Type-1 disease progression in a subject.
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 disease progression in a subject.
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 disease progression in a subject.
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise reprogramming a metabolic pathway.
- a disclosed metabolic pathway can comprise lysine catabolism.
- a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 18, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
- a method of treating and/or preventing GA-1 disease progression comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 01 or SEQ ID NO: 02, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
- a method of treating and/or preventing GA-1 disease progression comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a method of treating and/or preventing GA-1 disease progression the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
- a method of treating and/or preventing GA-1 disease progression the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the sequence set forth in SEQ ID NO: 19, wherein expression of glutaryl-CoA dehydrogenase is restored.
- a disclosed method can restore normal lysine catabolism in the subject’s liver.
- a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
- a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
- the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1).
- a subject can be male or female.
- a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
- the disclosed subject’s GA-1 related and/or associated behavior can be modulated.
- the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
- administering a disclosed viral vector can be administered systemically or directly.
- administering a disclosed viral vector molecule can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof.
- administering a disclosed viral vector can be administered by any method of administration disclosed herein.
- a disclosed viral can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
- administering a disclosed viral vector can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
- a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
- administering a disclosed viral vector can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- multiple doses can be administered via the same route or via differing routes of administration.
- a disclosed viral vector can be administered via multiple routes of administration.
- a disclosed viral vector can comprise a recombinant AAV vector.
- a disclosed AAV vector can comprise AAVcc.47.
- a disclosed AAV vector can comprise AAV8.
- a therapeutically effective amount of disclosed vector can comprise a range of about 1 x 10 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about l x 10 11 to about 8 x 10 13 vg/kg or about 1 x 10 12 to about 8 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 13 to about 6 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of at least about 1 x 10 10 , at least about 5 x 10 10 , at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of no more than about 1 x IO 10 , no more than about 5 x IO 10 , no more than about 1 x 10 11 , no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 12 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 vg/kg.
- a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, restoring the expression of GA-1).
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or the treating step. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both.
- modifying the treating step can comprise changing the amount of the vector administered to the subject, changing the frequency of administration of the vector, changing the duration of administration of the vector, changing the route of administration of the vector, or any combination thereof.
- modifying the administering step can comprise changing the amount of the vector administered to the subject, changing the frequency of administration of the vector, changing the duration of administration of the vector, changing the route of administration of the vector, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- Therapeutic agents are known.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators.
- the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators.
- the method can further comprise continuing to treat the subject and/or continuing to monitor the subject.
- the method can further comprise modifying one or more steps of the method.
- modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators.
- modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L- lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering and/or treating step and/or following the administering and/or treating steps.
- a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments.
- a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof.
- metabolic and/or physiologic data can inform the clinician.
- techniques to monitor, measure, and/or assess the restoring of the expression of glutaryl-CoA dehydrogenase can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person.
- a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art.
- a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof.
- a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
- a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40- 50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50- 60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating an administering step one or more times.
- a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise repeating a treating step one or more times.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of a subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl- CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) improving memory function of a subject, (vii) reduce anxiety in a subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in a subject,
- neurological sequelae
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring expression of glutaryl-CoA dehydrogenase.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
- a disclosed method of treating and/or preventing GA-1 can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- a disclosed method of treating and/or preventing GA- 1 disease progression can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise reprogramming a metabolic pathway.
- a disclosed metabolic pathway can comprise lysine catabolism.
- a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:20 or SEQ ID NO:21.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of aminoadipate-semialdehyde synthase gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:07 - SEQ ID NO:09, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of aminoadipate- semialdehyde synthase gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target the glutaryl-CoA dehydrogenase gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the target gene comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, and wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the target gene comprises the aminoadipatesemialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, and wherein the expression of the nucleic acid molecule disrupts the expression and/or
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and administering a therapeutically effective amount of a second viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and administering a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at the target gene of interest.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:20, and administering to the subject a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:21.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; and administering to the subject a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; and administering to the subject a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease of the first viral vector and/or the Cas9 endonuclease of the second viral vector comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:09 or SEQ
- a disclosed sgRNA can be directed at any functional domain of a target sequence.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene; and administering to a the subject a therapeutically effective amount of a second viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- a disclosed method can restore normal lysine catabolism in the subject’s liver.
- a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
- a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene, or any combination thereof.
- the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1).
- a subject can be male or female.
- a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
- the disclosed subject s GA-1 related and/or associated behavior can be modulated.
- the disclosed subject s GA-1 related and/or associated physiology can be modulated.
- administering a disclosed viral vector can be administered systemically or directly.
- administering a disclosed viral vector molecule can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof.
- administering a disclosed viral vector can be administered by any method of administration disclosed herein.
- a disclosed viral can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
- administering a disclosed viral vector can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence eliminates aminoadipatesemialdehyde synthase.
- a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
- administering a disclosed viral vector can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- multiple doses can be administered via the same route or via differing routes of administration.
- a disclosed viral vector can be administered via multiple routes of administration.
- the first viral vector and the second viral vectors can be concurrently and/or sequentially administered to the subject.
- the first viral vector and the second viral vectors can be administered to the subject via the same route of administration and/or via a different route of administration.
- a disclosed viral vector can comprise a recombinant AAV vector.
- a disclosed AAV vector can comprise AAVcc.47.
- a disclosed AAV vector can comprise AAV8.
- a therapeutically effective amount of disclosed viral vector can comprise a range of about 1 x 10 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 to about 8 x 10 13 vg/kg or about 1 x 10 12 to about 8 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 13 to about 6 x 10 13 vg/kg.
- a disclosed vector can be administered at a dose of at least about 1 x 10 10 , at least about 5 x 10 10 , at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of no more than about 1 x IO 10 , no more than about 5 x IO 10 , no more than about 1 x 10 11 , no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 12 vg/kg.
- a disclosed vector can be administered at a dose of about 1 x 10 11 vg/kg.
- a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
- a therapeutically effective amount of disclosed second vector can comprise a range of about 1 x IO 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed second vector can be administered at a dose of about 1 x 10 11 to about 8 x 10 13 vg/kg or about 1 x 10 12 to about 8 x 10 13 vg/kg.
- a disclosed second vector can be administered at a dose of about 1 x 10 13 to about 6 x 10 13 vg/kg.
- a disclosed second vector can be administered at a dose of at least about 1 x IO 10 , at least about 5 x IO 10 , at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vg/kg.
- a disclosed second vector can be administered at a dose of no more than about 1 x IO 10 , no more than about 5 x IO 10 , no more than about 1 x 10 11 , no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vg/kg.
- a disclosed second vector can be administered at a dose of about 1 x 10 12 vg/kg.
- a disclosed second vector can be administered at a dose of about 1 x 10 11 vg/kg.
- a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
- a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps.
- a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments.
- a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof.
- metabolic and/or physiologic data can inform the clinician.
- techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person and are discussed supra.
- a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art.
- a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof.
- a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
- a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both.
- modifying the treating step can comprise changing the amount of the first vector and/or the second vector administered to the subject, changing the frequency of administration of the first vector and/or the second vector, changing the duration of administration of the first vector and/or the second vector, changing the route of administration of the first vector and/or the second vector, or any combination thereof.
- modifying the administering step can comprise changing the amount of the first vector and/or the second vector administered to the subject, changing the frequency of administration of the first vector and/or the second vector, changing the duration of administration of the first vector and/or the second vector, changing the route of administration of the first vector and/or the second vector, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- Therapeutic agents are known.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators.
- the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
- Immune modulators are known to the art.
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators.
- the method can further comprise continuing to treat the subject and/or continuing to monitor the subject.
- the method can further comprise modifying one or more steps of the method.
- modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators.
- modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method of reprogramming a metabolic pathway can comprise repeating an administering step one or more times.
- a disclosed method of reprogramming a metabolic pathway can comprise repeating a treating step one or more times.
- a disclosed method can repeat the administering of a first disclosed vector one or more times, can repeat the administering of a second disclosed vector one or more times, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
- a disclosed method of reprogramming a metabolic pathway can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and
- neurological sequelae e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage
- a disclosed method of reprogramming a metabolic pathway can comprise treating and/or preventing Glutaric Aciduria Type-1 in a subj ect.
- a disclosed method of reprogramming a metabolic pathway can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
- a disclosed method of reprogramming a metabolic pathway can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- a disclosed method of reprogramming a metabolic pathway can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
- a disclosed metabolic pathway can comprise lysine catabolism.
- a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene,
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:20, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:21, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease comprises the sequence of SEQ ID NO:28, and wherein the sgRNA comprises the sequence set forth in any one of SEQ ID NO:06 - SEQ ID NO: 10, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of aminoadipate-semialdehyde synthase gene.
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at glutaryl-CoA dehydrogenase; wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the glutaryl-CoA dehydrogenase gene.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene, wherein the target gene comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene, wherein the target gene comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-car
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and administering a therapeutically effective amount of a second viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and administering a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in the target gene of interest.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:20, and administering to the subject a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:21.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; and administering to the subj ect a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; and administering to the subject a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease of the first viral vector and/or the Cas9 endonuclease of the second viral vector comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:09 or SEQ
- a method of reprogramming a metabolic pathway comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at glutaryl-CoA dehydrogenase; and administering to a the subject a therapeutically effective amount of a second viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
- a disclosed method can restore normal lysine catabolism in the subject’s liver.
- a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
- a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene, or any combination thereof.
- the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1).
- a subject can be male or female.
- a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
- the disclosed subject’s GA-1 related and/or associated behavior can be modulated.
- the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
- administering a disclosed viral vector can be administered systemically or directly.
- administering a disclosed viral vector molecule can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof.
- administering a disclosed viral vector can be administered by any method of administration disclosed herein.
- a disclosed viral can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
- administering a disclosed viral vector can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence eliminates aminoadipatesemialdehyde synthase.
- a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
- administering a disclosed viral vector and/or a disclosed viral vector can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- multiple doses can be administered via the same route or via differing routes of administration.
- a disclosed viral vector can be administered via multiple routes of administration.
- the first viral vector and the second viral vectors can be concurrently and/or sequentially administered to the subject.
- the first viral vector and the second viral vectors can be administered to the subject via the same route of administration and/or via a different route of administration.
- a disclosed viral vector can comprise a recombinant AAV vector.
- a disclosed AAV vector can comprise AAVcc.47.
- a disclosed AAV vector can comprise AAV8.
- a therapeutically effective amount of a disclosed first vector can comprise a range of about l x IO 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed first vector can be administered at a dose of about 1 x 10 11 to about 8 x 10 13 vg/kg or about 1 x 10 12 to about 8 x 10 13 vg/kg.
- a disclosed first vector can be administered at a dose of about 1 x 10 13 to about 6 x 10 13 vg/kg.
- a disclosed first vector can be administered at a dose of at least about 1 x IO 10 , at least about 5 x IO 10 , at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vg/kg.
- a disclosed first vector can be administered at a dose of no more than about 1 x IO 10 , no more than about 5 x IO 10 , no more than about 1 x 10 11 , no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about
- a disclosed first vector can be administered at a dose of about 1 x 10 12 vg/kg. In an aspect, a disclosed first vector can be administered at a dose of about 1 x 10 11 vg/kg. In an aspect, a disclosed first vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
- a therapeutically effective amount of a disclosed second vector can comprise a range of about 1 x IO 10 vg/kg to about 2 x 10 14 vg/kg.
- a disclosed second vector can be administered at a dose of about 1 x 10 11 to about 8 x 10 13 vg/kg or about 1 x 10 12 to about 8 x 10 13 vg/kg.
- a disclosed second vector can be administered at a dose of about 1 x 10 13 to about 6 x 10 13 vg/kg.
- a disclosed second vector can be administered at a dose of no more than about 1 x IO 10 , no more than about 5 x IO 10 , no more than about 1 x 10 11 , no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vg/kg.
- a disclosed second vector can be administered at a dose of about 1 x 10 12 vg/kg.
- a disclosed second vector can be administered at a dose of about 1 x 10 11 vg/kg.
- a disclosed first vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
- a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps.
- a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments.
- a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof.
- metabolic and/or physiologic data can inform the clinician.
- techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person.
- a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art.
- a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof.
- a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
- a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both.
- modifying the treating step can comprise changing the amount of the first vector and/or the second vector administered to the subject, changing the frequency of administration of the first vector and/or the second vector, changing the duration of administration of the first vector and/or the second vector, changing the route of administration of the first vector and/or the second vector, or any combination thereof.
- modifying the administering step can comprise changing the amount of the first vector and/or the second vector administered to the subject, changing the frequency of administration of the first vector and/or the second vector, changing the duration of administration of the first vector and/or the second vector, changing the route of administration of the first vector and/or the second vector, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- Therapeutic agents are known.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators.
- the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
- Immune modulators are known to the art.
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators.
- the method can further comprise continuing to treat the subject and/or continuing to monitor the subject.
- the method can further comprise modifying one or more steps of the method.
- modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators.
- modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating an administering step one or more times.
- a disclosed method of reprogramming a metabolic pathway can comprise repeating a treating step one or more times.
- a disclosed method can repeat the administering of a first disclosed vector one or more times, can repeat the administering of a second disclosed vector one or more times, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl- CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise reprogramming a metabolic pathway in a subj ect.
- a disclosed metabolic pathway can comprise lysine catabolism.
- a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
- a disclosed method of treating and/or preventing GA- 1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- a disclosed method of treating and/or preventing GA-1 disease progression pathway can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
- hepatocytes are GCDH /AASS , and wherein one or more aspects of metabolic function is restored.
- a method of treating and/or preventing GA-1 disease progression comprising restoring one or more aspects of metabolic function by administering to a subject in need thereof a therapeutically effective amount of hepatocytes, wherein the hepatocytes are GCDH +/+ /AASS +/+ .
- a method of treating and/or preventing GA-1 disease progression comprising restoring one or more aspects of lysine metabolism by administering to a subject in need thereof a therapeutically effective amount of hepatocytes, wherein the hepatocytes are GCDH +/+ /AASS +/+ .
- a disclosed method can restore normal lysine catabolism in the subject’s liver. [0567] In an aspect, a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
- a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
- the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1).
- a subject can be male or female.
- a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
- the disclosed subject’s GA-1 related and/or associated behavior can be modulated.
- the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
- administering a disclosed therapeutically effective amount of hepatocytes can be administered systemically or directly.
- administering a disclosed therapeutically effective amount of hepatocytes can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof.
- administering a disclosed therapeutically effective amount of hepatocytes can be administered by any method of administration disclosed herein.
- a disclosed therapeutically effective amount of hepatocytes can be administered via multiple routes either concurrently or sequentially.
- a disclosed therapeutically effective amount of hepatocytes can be administered directly into the subject’s spleen and/or directly into the subject’s liver.
- administering a disclosed therapeutically effective amount of hepatocytes can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- multiple doses can be administered via the same route or via differing routes of administration.
- a disclosed therapeutically effective amount of hepatocytes can be administered via multiple routes of administration.
- a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
- a disclosed therapeutically effective amount of hepatocytes can comprise about 10 x 10 7 to about 10 x 10 10 hepatocytes.
- a disclosed therapeutically effective amount can be infused through a portalvein catheter.
- a disclosed infusion can occur over time.
- a disclosed infusion time can comprise about 5 hours to about 25 hours, or about 5 hours to about 20 hours, or about 5 hours to about 15 hours, or about 5 hours to about 10 hours.
- a disclosed infusion time can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more hours.
- a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps.
- a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments.
- a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer disclosed hepatocytes, a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof.
- metabolic and/or physiologic data can inform the clinician.
- techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person and are discussed supra.
- a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art.
- a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof.
- a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
- a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed therapeutically effective amount of hepatocytes)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed therapeutically effective amount of hepatocytes)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10- 20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed therapeutically effective amount of hepatocytes)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed therapeutically effective amount of hepatocytes)).
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both. [0581] In an aspect, modifying the treating step can comprise changing the amount of hepatocytes administered to the subject, changing the frequency of administration of hepatocytes, changing the duration of administration of hepatocytes, changing the route of administration of hepatocytes, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- Therapeutic agents are known.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators.
- the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
- Immune modulators are known to the art.
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating an administering step one or more times.
- a disclosed method of reprogramming a metabolic pathway can comprise repeating a treating step one or more times.
- a disclosed method can repeat the administering of a disclosed therapeutically effective amount of hepatocytes one or more times, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl- CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise reprogramming a metabolic pathway in a subject.
- a disclosed metabolic pathway can comprise lysine catabolism.
- a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
- a disclosed method of treating and/or preventing GA-1 disease progression pathway can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
- the method can further comprise administering a disclosed vector.
- a disclosed method of treating and/or preventing GA-1 disease progression can further comprise administering to the subject (i) a disclosed vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase; (ii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02; (iii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18; (iv) a disclosed vector or viral vector comprising the sequence set forth in SEQ ID NO: 19; (v) a disclosed first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system with a second disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system; (vi) first disclosed viral vector comprising an isolated nucleic acid molecule
- Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a disclosed siRNA or a disclosed formulation comprising a disclosed siRNA.
- Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a disclosed mRNA therapy or a disclosed formulation comprising a disclosed mRNA therapy.
- a method of reprogramming a metabolic pathway the method comprising administering to a subject in need thereof a therapeutically effective amount of siRNA targeting aminoadipate-semialdehyde synthase.
- a method of reprogramming a metabolic pathway comprising administering to a subj ect in need thereof a therapeutically effective amount of mRNA therapy targeting an aspect of the lysine catabolism pathway.
- a method of reprogramming a metabolic pathway comprising administering to a subj ect in need thereof a therapeutically effective amount of mRNA therapy targeting an aspect of the lysine catabolism pathway, wherein the aspect of the lysine catabolism pathway comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene, and wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
- the aspect of the lysine catabolism pathway comprises the aminoa
- a disclosed siRNA can target a sequence in SEQ ID NO:35 or SEQ ID NO:36. In an aspect, a disclosed siRNA can target a sequence in SEQ ID NO:38 or SEQ ID NO:39. In an aspect, a disclosed siRNA can comprise the sequence set forth in SEQ ID NO:33 or SEQ ID NO:34.
- a disclosed mRNA therapy can target or can be directed one or more enzymes in the pipecolate pathway, the saccharopine pathway, or both.
- a disclosed mRNA therapy can target or can be directed at the aminoadipate- semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
- the disclosed silencing oligonucleotide e.g., siRNA or an antisense oligonucleotide
- the disclosed mRNA therapy can be encapsulated in lipid nanoparticles.
- Lipid nanoparticles are known to the skilled person.
- a disclosed lipid nanoparticle can comprise a commercially available formulation such as, for example, Invivolipofectamine.
- the disclosed silencing oligonucleotide (e.g., siRNA or an antisense oligonucleotide) can be conjugated to a tissue-targeting moiety.
- the tissue-targeting moiety may be liver-tissue specific.
- the tissue targeting moiety may comprise one or more GalNAc, optionally two GalNAc (e.g. a GalNAc dimer) or three GalNAc (e.g., a GalNAc trimer).
- the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1).
- a subject can be male or female.
- a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
- a disclosed method using siRNA and/or mRNA therapy can restore normal lysine catabolism in the subject’s liver.
- a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
- a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
- the disclosed subject’s GA-1 related and/or associated behavior can be modulated.
- the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
- administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered systemically or directly.
- administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof.
- administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered by any method of administration disclosed herein.
- a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered via multiple routes either concurrently or sequentially.
- a skilled clinician can determine the best route of administration for a subject at a given time.
- administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- multiple doses can be administered via the same route or via differing routes of administration.
- a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered via multiple routes of administration.
- a therapeutically effective amount of siRNA can comprise about 0.01 mg/kg to about 100 mg/kg, or about 0.5 mg/kg to about 75 mg/kg, or about 0.1 mg/kg to about 50 mg/kg, or any amount in that range. In an aspect, a therapeutically effective amount of siRNA can comprise about 0.2 mg/kg to about 50 mg/kg.
- a therapeutically effective amount of mRNA therapy can comprise about 0.001 mg/kg to about 100 mg/kg, or about 0.050 mg/kg to about 75 mg/kg, or about 0.01 mg/kg to about 50 mg/kg, or any amount in that range.
- a therapeutically effective amount of siRNA can comprise about 0.01 mg/kg to about 50 mg/kg.
- a disclosed method can further comprise monitoring the subj ect’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps.
- a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments.
- a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof.
- metabolic and/or physiologic data can inform the clinician.
- techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person and are discussed supra.
- a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art.
- a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof.
- CT computerized tomography
- MRI magnetic resonance imaging
- PET positron emission tomography
- a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
- a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70- 80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both.
- modifying the treating step can comprise changing the amount of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof to the subject, changing the frequency of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the duration of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the route of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, or any combination thereof.
- modifying the administering step can comprise changing the amount of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof administered to the subject, changing the frequency of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the duration of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the route of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- Therapeutic agents are known.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators.
- the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
- Immune modulators are known to the art.
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators.
- the method can further comprise continuing to treat the subject and/or continuing to monitor the subject.
- the method can further comprise modifying one or more steps of the method.
- modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators.
- modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- a disclosed method of reprogramming a metabolic pathway can comprise repeating an administering step one or more times.
- a disclosed method of reprogramming a metabolic pathway can comprise repeating a treating step one or more times.
- a disclosed method can repeat the administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
- a disclosed method of reprogramming a metabolic pathway can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the subject’
- motor performance e.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
- a disclosed method of reprogramming a metabolic pathway can comprise treating and/or preventing Glutaric Aciduria Type-1 in a subj ect.
- a disclosed method of reprogramming a metabolic pathway can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
- a disclosed method of reprogramming a metabolic pathway can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- a disclosed method of reprogramming a metabolic pathway can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subj ect.
- a disclosed metabolic pathway can comprise lysine catabolism.
- a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
- a disclosed method of reprogramming a metabolic pathway can further comprise administering to the subject (i) a disclosed vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase; (ii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02; (iii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18; (iv) a disclosed vector or viral vector comprising the sequence set forth in SEQ ID NO: 19; (v) a disclosed first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system with a second disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system; (vi) first disclosed viral vector comprising
- Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a disclosed siRNA and/or a disclosed formulation comprising a disclosed siRNA.
- Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a disclosed mRNA therapy and/or a disclosed formulation comprising a disclosed mRNA therapy.
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of silencing oligo nucleotide (e.g., siRNA or an antisense oligonucleotide) targeting aminoadipatesemialdehyde synthase.
- silencing oligo nucleotide e.g., siRNA or an antisense oligonucleotide
- a method of treating and/or preventing GA-1 disease progression comprising administering to a subject in need thereof a therapeutically effective amount of mRNA therapy targeting an aspect of the lysine catabolism pathway.
- an siRNA that can target any part of the aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36.
- an siRNA that can target any part of an aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
- a targeted part of an AASS sequence can comprise about 15 to about 35 base pairs.
- a targeted part of an AASS sequence can comprise about 20 to about 30 base pairs.
- a targeted part of an AASS sequence can comprise about 20 to about 24 base pairs.
- a targeted part of an AASS sequence can comprise about 21 to about 22 base pairs.
- a disclosed siRNA effects the complete silencing of the aminoadipate-semialdehyde synthase gene.
- an siRNA that can target any part of an the aminoadipate-semialdehyde synthase sequence comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36.
- an siRNA that can target any part of the aminoadipate-semialdehyde synthase sequence comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
- a disclosed mRNA therapy can target or can be directed one or more enzymes in the pipecolate pathway, the saccharopine pathway, or both.
- the disclosed siRNA can be encapsulated in lipid nanoparticles. Lipid nanoparticles are known to the skilled person.
- a disclosed lipid nanoparticle can comprise a commercially available formulation such as, for example, Invivolipofectamine.
- the disclosed siRNA can be conjugated to a tissue-targeting moiety.
- the tissue-targeting moiety may be liver-tissue specific.
- the tissue targeting moiety may comprise one or more GalNAc, optionally two GalNAc (e.g. a GalNAc dimer) or three GalNAc (e.g., a GalNAc trimer).
- the tissue targeting moiety may be, but not limited to, antibodies or other peptides and sugar moieties.
- the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1).
- a subject can be male or female.
- a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
- the disclosed subject’s GA-1 related and/or associated behavior can be modulated.
- the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
- administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered systemically or directly.
- administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof.
- administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered by any method of administration disclosed herein.
- a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered via multiple routes either concurrently or sequentially.
- a skilled clinician can determine the best route of administration for a subject at a given time.
- administering a disclosed siRNA can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence eliminates aminoadipatesemialdehyde synthase.
- a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
- administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- multiple doses can be administered via the same route or via differing routes of administration.
- a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered via multiple routes of administration.
- a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps.
- a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments.
- a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof.
- metabolic and/or physiologic data can inform the clinician.
- techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person.
- a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art.
- a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof.
- CT computerized tomography
- MRI magnetic resonance imaging
- PET positron emission tomography
- a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
- a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a control subject such as, for example, a subject that has not received a disclosed treatment (e.g., administration a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70- 80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a control subject such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both.
- modifying the treating step can comprise changing the amount of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof administered to the subject, changing the frequency of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the duration of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the route of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway).
- these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof.
- a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
- modifying the administering step can comprise changing the amount of a disclosed siRNA and/or a disclosed formulation comprising a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof administered to the subject, changing the frequency of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the duration of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the route of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, or any combination thereof.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent.
- Therapeutic agents are known.
- a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators.
- the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
- Immune modulators are known to the art.
- a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators.
- the method can further comprise continuing to treat the subject and/or continuing to monitor the subject.
- the method can further comprise modifying one or more steps of the method.
- modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators.
- modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating an administering step one or more times.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating a treating step one or more times.
- a disclosed method can repeat the administering of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl- CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise treating and/or preventing Glutaric Aciduria Type-1 in a subject.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type- 1 in a subject.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
- a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
- a disclosed metabolic pathway can comprise lysine catabolism.
- a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
- a disclosed method of treating and/or preventing GA-1 disease progression can further comprise administering to the subject (i) a disclosed vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase; (ii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02; (iii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18; (iv) a disclosed vector or viral vector comprising the sequence set forth in SEQ ID NO: 19; (v) a disclosed first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system with a second disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system; (vi) first disclosed viral vector comprising an isolated nucleic acid molecule
- the work presented herein demonstrates that the liver directly contributes to toxic accumulation of catabolites in the brain as part of the GA-1 disease pathology. This is surprisingly and unexpected and therefore challenges that traditionally held view in the art. To this end, the three methods of redressing the dysfunctional lysine catabolism pathway in the liver also demonstrated the ability to reverse GA-1 disease pathology in the brain.
- Gcdh single knockout and Gcdh' ' ZAass ⁇ ' double knockout mouse strains were generated by injecting either C57B6 or TIRF (transgene free Il g ', ag2 Fah ⁇ ') zygotes (Bissig-Choisat B, et al. (2021) JHEP Rep. 3: 100281) with CRISPR/Cas9 gene editing mRNA as we described previously (Barzi M, et al. (2017) Nat Commun. 8:39), which is incorporated by reference in its entirety for the methods and materials related to the generation and characterizations of these knockout mice.
- TIRF transgene free Il g ', ag2 Fah ⁇ '
- sgRNAs were designed using Benchling online software (www.benchling.com) and injected at the same time with the Cas9 mRNA.
- a listing of sgRNA sequences is set forth in TABLE 1. TABLE 1 - 5. pyogenes sgRNA Sequences.
- F0 mice were analyzed by PCR followed by Sanger sequencing using the PCR primers set forth in TABLE 2:
- mice Two weeks after injection or when pups reached the weaning age, mice were exposed to high protein diet (70% Casein diet, Envigo Teklad Custom diet Catalog # TD.06723).
- Urine, blood and liver and brain tissue (where described) were collected 4 or 5 days after challenging the mice with high protein diet.
- Mouse body weights were measured throughout the experiment and all mouse tissues were harvested for further analysis at the experimental endpoints. All animal experiments were approved by the Institutional Animal Care and Use Committee. Hepatocyte Isolation.
- mice livers were perfused using a modified two-step collagenase perfusion method as described previously (Maeso-Diaz R, et al. (2022) Aging Cell. 21 :el3530). Quality of isolated hepatocytes was assessed by trypan blue staining of perfusate and used if viability was > 90%. Freshly isolated hepatocytes were transplanted into mice the same day ( ⁇ 8 hours after isolation).
- NTBC drug nitisinone
- mice were kept without nitisinone for 6 months to assure a good repopulation with transplanted hepatocytes. Before starting the 70% casein diet challenge, mice were put back on nitisinone to assure no interference with tyrosinemia of the TIRF strain.
- Murine Gcdh cDNA was cloned by replacing EmGFP of 1162-pAAV-HLP-EmGFP-SpA plasmid (provided from William Lagor, Addgene Catalog # 109313) using Xbal-Mlul restriction enzymes.
- Murine A ass Sa sgRNAs oligonucleotides were annealed and ligated into 1313.1- pAAV-U6-SA-BbsI-MluI-gRNA-HLP-OLLAS-spA vector (provided by William Lagor, Addgene Catalog # 109314) digested with BbsI restriction enzyme.
- AAVs were produced as previously described (Nelson CE, et al. (2019) Nat Med. 25:427-432). A listing of sgRNA sequences is set forth in TABLE 3.
- siRNA injection solution was prepared following Invivofectamine 3.0 Reagent Complexation protocol (Thermosfisher Scientific, Catalog # IVF3001).
- siRNA duplex (Ambion, Catalog # 4457308, ID#s 78304) was first diluted in RNAse free water to a concentration of 250 pM, aliquoted and stored at -80 °C.
- siRNA duplex solution was diluted in 1 : 1 in complexation buffer and then mixed 1 : 1 with Invivofectamine 3.0 Reagent, vortexed, and incubated at 50 °C for 30 minutes.
- the complex was diluted 1 :6 with RNAse PBS lx pH 7.4.
- a listing of sgRNA sequences is set forth in TABLE 4.
- Aass siRNA (8 mg/kg) solution was injected into the tail vein of 3 -week-old Gcdh'' mice and put on high protein diet 48 hours later. Mice were harvest postmortem for expression of AASS in the liver using AASS immunostaining as described elsewhere.
- Whatman 903 protein saver cards (Sigma-Aldrich), ds -Acetyl carnitine (ds-C2, Sigma- Aldrich), ds-Propionylcamitine (ds-C3, Sigma-Aldrich), ds -Butyryl carnitine (ds-C4, Sigma- Aldrich), ds-Octanoylcamitine (ds-C8, Sigma- Aldrich), and ds -Palmitoyl carnitine (ds-C16, Sigma-Aldrich) were used.
- General solvents and reagents were purchased from Sigma-Aldrich (St. Louis, MO) or VWR (Radnor, PA). In-house deionized water (diH2O) was used in the preparation of mobile phases or for dilutions.
- the raw data was processed using Neolynx® (Waters Corp.).
- the ratio of ion intensities of acylcamitine species and its specified deuterated IS are multiplied by the nominal concentration of the IS (5 pmol/L, 1 pmol/L, 1 pmol/L, 1 pmol/L, 2 pmol/L). Concentrations of standards are given in units of pmol/L.
- Glutarylcamitine (C5-DC) with m/z 304, was measured against octanoyl-L-carnitine-ds (ds-C8) with m/z 305.
- Propionylcamitine (C3), with m/z 232, and acetyl carnitine (C2), with m/z 218, are each compared to their own deuterated IS (ds-C2 and di- C3).
- Whatman 903 protein saver cards (Sigma- Aldrich), Kairos amino acid internal standard set (100+), amino acid calibrator set (100+), amino acid quality control set (100+), and well as AccQ-Tag Ultra derivatization kit were purchased from Waters Corporation (Milford, MA).
- LC- MS grade acetonitrile, methanol, formic acid, acids and bases were purchased from Sigma- Aldrich (St. Louis, MO) or VWR (Radnor, PA).
- diFEO In-house deionized water
- Plasma amino acids were analyzed using a modification of the Kairos Amino Acid method. Equal volumes (50 pL) of plasma and an internal standard solution containing a mixture of [ 13 C, 15 N]- labeled amino acids were combined. Protein was precipitated using 50 pL 10% sulfosalicylic acid and removed by centrifugation. The supernatant was added to a borate buffer, mixed with the 6- aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC) derivatization reagent, incubated at 55 °C for 10 minutes, and diluted with dEEO.
- AQC 6- aminoquinolyl-N-hydroxysuccinimidyl carbamate
- Plasma amino acid- AQC derivatives were analyzed using a Waters Acquity I-Class UPLC coupled to a Waters Xevo TQ-S micro mass spectrometer. Amino acids were separated on a 1.6 pm 2 x 150 mm Cortecs UPLC column by gradient elution over 9.5 minutes, with 0.1% formic acid in aqueous acetonitrile as the mobile phase. Analytes were detected by selected reaction monitoring in positive ion mode. Peak area ratios of amino acids and their corresponding internal standard were converted to a concentration by means of a 6- or 7-point 1/x weighted calibration curve. Details of the acquisition parameters are provided in TABLE 5 below.
- liver and brain tissue were homogenized in 0.5 mL of distilled deionized water using Tyssue Lyser (Qiagen) following 30 cycles of sonication at power (Vibra Cell - Sonics). 70 mg of sulfosalicylic acid was added to each sample and let stand at room temperature for 5 minutes. Samples were centrifuged at - for 20 minutes and supernatant was transferred to a glass stoppered tube for urine organic acid analysis.
- Tyssue Lyser Qiagen
- Glutaric acid (GA) and 3-OH-glutaric acid (3-OH-GA) were measured as previously described (sauer SW, et al. (2006) J. Neurochem. 97:889-910) using GC/MS with a stable-isotope dilution assay.
- internal standards of d4-GA and d5-3-OH-GA were added to 2 mg of tissue homogenate. Samples were acidified to pH ⁇ 1 with 100 Imol H2SO4. The reaction mixture was diluted with 1 mL NaHCCh (20 mmol/L) and, subsequently, the ionic strength of the solvent was increased by adding an excess of NaCl.
- Paraffin-embedded slides were deparaffinated, rehydrated and treated with antigen retrieval citrate buffer (pH 6.0) for 30 minutes at 98 °C degrees. Endogenous peroxidase was quenched using 3% hydrogen peroxidase solution (Signa-Aldrich, Catalog # 88697) and biotin was blocked with Avidin/Biotin kit following manufacturer’s instructions (Vector Laboratories, Catalog # SP-2001).
- Selected tissues liver, lung, heart, kidney, spleen, brain
- JE board- certified veterinary pathologist
- Mouse brains were sectioned in the parasagittal plane.
- the pathologist graded changes in brains and kidneys as normal, minimal, mild, moderate or severe (0-4) using a semi -quantitative scale.
- lysine [2- 15 N]Lysine
- the catabolism of lysine is via the saccharopine (liver and kidney) and pipecolate (brain) pathways. Only the saccharopine pathway leads to the labeled 2- aminoadipic-4-semialdehyde and 2-aminoadipate (AASA) metabolites from [2- 15 N]Lysine. 15 N at carbon-2 of lysine is lost in the first step of pipecolate pathway.
- AASA 2- aminoadipic-4-semialdehyde and 2-aminoadipate
- [0687] To measure the relative metabolic flux from lysine to acetyl-CoA, [ 13 Ce] Lysine is employed.
- the downstream metabolites such as acetyl-CoA or tricarboxylic acid cycle (TCA cycle) metabolites, are labeled by [ 13 Ce] Lysine.
- TCA cycle tricarboxylic acid cycle
- Glutaric Aciduria type I (GA-1) is an inborn error of metabolism with a severe neurological phenotype caused by the deficiency of Glutaryl-CoA dehydrogenase (GCDH), the last enzyme of lysine catabolism.
- GCDH Glutaryl-CoA dehydrogenase
- the state of the art indicates that the toxic catabolites in the brain are produced locally and do not cross the blood brain barrier.
- the experiments disclosed herein, which use knockout mice and liver cell transplantation demonstrated that toxic GA-1 catabolites in the brain originated in the liver.
- the characteristic brain and lethality phenotype of the GA-1 mouse model can be rescued by two different liver directed gene therapy approaches. These experiments question current pathophysiological understanding of GA-1 and demonstrate for the first time a targeted therapy for this devastating disorder.
- the essential amino acid lysine is a building block of proteins but is also catabolized to Glutaryl-CoA, which eventually enters the tricarboxylic acid cycle and generates energy. If the conversion to Glutaryl-CoA is inhibited by the deficiency of the Glutaryl-CoA dehydrogenase (GCDH), then toxic catabolites such as glutaric acid (GA) and 3-hydroxy -glutaric acid (3-OH- GA) accumulate (FIG. 1A).
- mice 3-week-old Gcdh ⁇ mice were intravenously injected with AAV at a dose of 1.5 x 10 12 vg/mouse. Two weeks after injection, mice were put on high protein diet. As shown in FIG. 7A, most mice demonstrated a rescue of lethality upon expression of Gcdh in the liver but not in the brain (FIG. 7B). Glutarylcamitine (C5-DC) levels in the blood (FIG. 7C) as well as GA (FIG. 7D) and 3-OH-GA (FIG. 7E) levels in brain and liver indicated a biochemical reduction of toxic metabolites upon treatment with AAV-Gcdh.
- C5-DC Glutarylcamitine
- GA GA
- GA 3-OH-GA
- Neonatal Gcdh ⁇ ⁇ mice were intravenously injected with a low dose (2.4 x 10 11 vg/mouse), an intermediate dose (6 x 10 11 vg/mouse), or a high dose (1 x 10 12 vg/mouse) of AAV.
- the high dose of AAV-CRISPR rescued all six injected pups from intoxication on high protein (FIG. 11 A)
- FIG. 11B Biochemical analysis revealed a significant reduction of toxic catabolites in liver and brain (FIG. 11B) after 60 days on high protein diet compared to AAV-GFP treated mice after only 4 days on high protein.
- AAV-CRISPR therapy resulted in a dose dependent deletion in Aass in the liver (FIG. 11C).
- FIG. 11D hippocampal vacuolation and subdural hemorrhage could not be observed in AAV-CRISPR treated Gcdh ⁇ mice in contrast to clear pathological alterations in non-treated mice only after 4 days of high protein diet exposure (FIG. 11D).
- FIG. 11D Before harvesting the A A V-CRISPR treated Gcdh ⁇ ⁇ mice, neurobehavioral testing was performed.
- the work presented herein demonstrates that the liver directly contributes to toxic accumulation of catabolites in the brain as part of the GA-1 disease pathology. This is surprisingly and unexpected and therefore challenges that traditionally held view in the art. To this end, the three methods of redressing the dysfunctional lysine catabolism pathway in the liver also demonstrated the ability to reverse GA-1 disease pathology in the brain.
- Glutaric Aciduria Type I (GA-1) is an inborn error of metabolism with a severe neurological phenotype caused by the deficiency of glutaryl-CoA dehydrogenase (GCDH), the last enzyme of lysine catabolism.
- GCDH glutaryl-CoA dehydrogenase
- Current literature suggests that toxic catabolites in the brain are produced locally and do not cross the blood brain barrier.
- toxic GA-1 catabolites in the brain were shown to originate from the liver.
- AAV Adeno- Associated Virus
- mRNA of Gcdh is an intermediate of AAV gene therapy but can also be delivered by lipid nanoparticles (LNP). Instead of CRISPR deletion of Aass, deletion can be achieved also by other endonucleases or Aass expression silenced by combining transcriptional silencer and nucleases. Also, we show that reduction or inhibition of Aass expression such as small interfering RNA have a therapeutic effect.
- the essential amino acid lysine is a building block of proteins but is also catabolized to Glutaryl-CoA, which eventually enters the tricarboxylic acid cycle and generates energy. If the conversion of lysine to Glutaryl-CoA is inhibited by a deficiency of the Glutaryl-CoA dehydrogenase (GCDH) enzyme, disease-specific catabolites such as glutaric acid (GA) and 3- hydroxy -glutaric acid (3-OH-GA) accumulate (FIG. 15A). These intermediates accumulate in the brain where clinical symptoms develop that comprise a disorder known as glutaric aciduria type I (GA-1) (Goodman SI, et al. (1975) Biochem Med. 12: 12-21).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Virology (AREA)
- Optics & Photonics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Nanotechnology (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Disclosed herein are compositions for use in methods of treating and/or preventing Glutaric Aciduria Type 1 and in methods of reprogramming a metabolic pathway.
Description
COMPOSITIONS FOR AND METHODS OF TREATING AND/OR PREVENTING GLUTARIC ACIDURIA TYPE-I
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63/491,533 filed 22 March 2023, which is incorporated by reference herein in its entirety.
REFERENCE TO THE SEQUENCE LISTING
[0002] The Sequence Listing submitted 22 March 2024 as a .xml file named “22_2055_WO2_Sequence_Listing”, created on 22 March 2024 and having a size of 434,433 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).
BACKGROUND
[0003] Glutaric aciduria type I (GA-1), is a rare neurometabolic organic aciduria caused by glutaryl-CoA dehydrogenase (GCDH) deficiency. It is an autosomal recessive inborn error of lysine (primarily) and tryptophan catabolism with an estimated worldwide prevalence of 1 : 30,000 to 1 : 100,000 live births (Lindner M, et al. (2006) J Inherit Metab Dis. 29:378-382; Kolker S, et al. (2006) Pediatr Res. 59:840-847). Due to founder gene mutations, the incidence of GA-1 is higher in the old order Amish population of Pennsylvania (Strauss KA, et al. (2003) Am J Med Genet C Semin Med Genet. 121C(l):38-52) and the Lumbee Native Indian Tribe population of North Carolina (Basinger AA, et al. (2006) Mol Genet Metab. 88:90-92). Even though GCDH expression is mainly hepatic, loss of its enzymatic activity leads to accumulation of toxic intermediates with predominantly neurological sequelae. Symptomatic patients present with neonatal macrocephaly, subdural hematomas and acute retinal hemorrhage. Infants are at risk of acute encephalopathic crises triggered by recurrent febrile illness, or poor intake, damaging the brain striatum. Infantile acute striatal necrosis is the hallmark of the disease and the primary cause of morbidity and mortality. Putamin injury is associated with behavioral regression. (Strauss KA, et al. (2003) Am J Med Genet C Semin Med Genet. 121C(l):38-52). Some patients have insidious onset disease with late-onset neurologic sequelae. (Strauss KA, et al. (2003) Am J Med Genet C Semin Med Genet. 121C(l):38-52).
[0004] Standard of care therapy is dietary restriction of lysine and tryptophan, carnitine supplementation, symptomatic treatment of neurological manifestations, and high calorie glucose infusion during physiologic stress to prevent metabolic crises and strokes. Despite early diagnosis made possible with newborn screening (NBS) and improved management of patients with GA-1, 25-33% of these patients continue to develop acute and long-term neurological complications. (Strauss KA, et al. (2003) Am J Med Genet C Semin Med Genet. 121C: 53-70; Sauer SW, et al.
(2006) J Neurochem. 97:899-910). This indicates that dietary treatment is imperfect and reveals an urgent need to develop alternative, more effective therapies.
[0005] Consequently, the present disclosure provides compositions for and methods of treating and/or preventing glutaric aciduria type-I (GA-I) and methods of reprogramming a metabolic pathway.
BRIEF DESCRIPTION OF THE FIGURES
[0006] FIG. 1A-FIG. IF show knockout mice and transplantation experiments. FIG. 1A shows lysine catabolism pathway scheme in peroxisomes and mitochondria. FIG. IB shows Kaplan- Meier survival curves of Gcdh' ' knockout mice transplanted with wild type hepatocytes (Gcdh ) on high protein diet (casein). FIG. 1C shows Glutaric acid (GA) and 3-hydroxy GA (3-OH-GA) of groups after 10 days (non-transpl anted) or 160 days (transplanted). FIG. ID shows RFP immunohistochemistry only detecting healthy hepatocytes
transgenic mlmG) while FIG. IE shows Western blot (GCDH and beta actin) with liver lysates of low and high repopulated transplanted animals (4 each). FIG. IF shows Kaplan-Meier survival curves of single Gcdh ) knockout and double knockout (Gcdh^' / Aass7') mice on high protein diet. FIG. 1G shows GA and 3-OH-GA of single Gcdh ) knockout and double knockout (Gcdh ~/7Aass~/~)' mice after 5 days on high protein diet. FIG. 1H shows Kaplan-Meier survival curves of double (Gcdh^/Aass4) knockout mice transplanted with Gcdh4' hepatocytes. FIG. II shows GA and 3-OH-GA of double (Gcdh47Aass4) knockout mice transplanted with Gcdh " hepatocytes. FIG. 1J shows AASS immunostaining from transplanted double (Gcdh 47Aass4') knockout mice. FIG. IK shows Western blot of livers from transplanted double (Gcdh47Aass4~) knockout mice. FIG. IL shows a summary of transplantation models and their outcome. Significance was validated with t test (*p < 0.05, **p < 0.01 ***p < 0.005 and ****p < 0.0001).
[0007] FIG. 2A - FIG. 2C show the neuropathological evaluation of Gcdh' ' mice transplanted with healthy (Gcdh ) hepatocytes. FIG. 2A shows H&E staining of hippocampal brain sections. Hippocampal vacuolation (arrows) and meningeal hemorrhage (arrowheads). FIG. 2B shows quantification of vacuolation and meningeal hemorrhage. FIG. 2C shows C57B6, transplanted and non-transpl anted Gcdh'' knockout mice repopulated with wild type (Gcdh+/+) hepatocytes. Significance was validated with t test (*p < 0.05, and **p < 0.01).
[0008] FIG. 3A - FIG. 3G show the motor performance of Gcdh' ' mice transplanted with healthy (Gcdh ) hepatocytes. FIG. 3A shows latency to fall from the rotarod across trials. FIG. 3B shows grip strength for the fore paws and FIG. 3C shows grip strength for the hind paws. FIG. 3D open field cumulative locomotor activity, FIG. 3E shows cumulative rearing activity, FIG. 3F shows cumulative distance traveled in the center zone, and FIG. 3G shows the velocity of
locomotion. Data are presented as means ± SEM. Significance was validated with t test, (*p < 0.05 and **p < 0.01).
[0009] FIG. 4A - FIG. 4B show the generation of knockout mice. FIG. 4A shows a schematic representation of murine Aass and Gcdh genes and the sgRNAs used to generate the single Gcdh /_) and double (Gcdh 47Aass -/’) knockout strains. Exonic sgRNA target sites are marked. FIG. 4B shows an image of a DNA gel electrophoresis showing both the wild type and deleted bands of Aass and Gcdh amplified by PCR using genomic DNA from knockout mice generated by CRISPR/Cas9.
[0010] FIG. 5A - FIG. 5C show neurop athologi cal evaluation of double (Gcdh47Aass ') knockout mice transplanted with (Gcdh4) hepatocytes. FIG. 5A shows H&E staining of hippocampal brain sections. Hippocampal vacuolation (arrows). FIG. 5B shows quantification of vacuolation of C57BL, Gcdh4 Aass4 double knockout repopulated with Gcdh4 hepatocytes and Gcdh4 Aass 4 double knockout control (non-transpl anted) mice. FIG. 5C shows quantification of meningeal hemorrhage of C57BL, Gcdh Aass ^ double knockout repopulated with Gcdh4 hepatocytes and Gcdh4 Aass4 double knockout control (non-transplanted) mice. Data are presented as means ± SEM. Significance was validated with t test (****p < 0.0001).
[0011] FIG. 6A shows a schematic representation of AAV virus expressing murine Gcdh cDNA sequence. FIG. 6B shows a pAAV-Gcdh plasmid sequence with annotations extracted from SnapGene.
[0012] FIG. 7A - FIG. 7G show liver directed gene therapy in Gcdh 4 mice. FIG. 7A - 7E show 5-week-old Gcdh 4 mice treated with AJW-Gcdh, AAV-GFP (1.5 x 1012 vg/mouse at 3 weeks of age) or no injection. FIG. 7A shows Kaplan Meier survival curves of Gcdh 4 mice on high protein. FIG. 7B shows Western blot of liver and brain lysates from AAV treated mice after harvesting or expiration (controls). FIG. 7C shows C5-DC metabolite levels in blood (before and 4 days after high protein diet) and FIG. 7D shows Glutaric Acid levels in blood and 3-OH-Glutaric Acid levels in liver and brain of Gcdh4 mice at 140 days (WN-Gcdh) and upon expiration (AAV-GF and untreated). FIG. 7E - FIG. 7F show neonatal Gcdh 4 pups treated with low (3 x 1011 vg/mouse), intermediate (7.5 x 1011 vg/mouse) and high (1.5 x 1012 vg/mouse) dose of AAV. FIG. 7F shows Kaplan Meier survival curves of treated Gcdh 4 mice on high protein after weaning. FIG. 7G shows Western blot for GCDH of treated Gcdh4 mice after expiration. Significance was validated with t test (*p < 0.05, **p < 0.01 ***p < 0.005 and ****p < 0.0001).
[0013] FIG. 8A - FIG. 8C show neuropathological evaluation of Gcdh 4 mice treated with AAV- Gcdh or AAV-GFP control. FIG. 8A shows H&E staining of hippocampal brain sections. Hippocampal vacuolation (arrows). FIG. 8B shows quantification of vacuolation of C57BL,
Gcdh~ single knockout controls (AAV-GFP injected) and Gcdh~ ~ single knockout mice injected with AAV-mGcdh. FIG. 8C shows quantification of meningeal hemorrhage of C57BL, Gcdh~~ single knockout controls (AAV-GFP injected) and Gcdh~ ~ single knockout mice injected with AAV-mGcdh. Data are presented as means ± SEM. Significance was validated with t test (*p < 0.05 and **p < 0.01).
[0014] FIG. 9A - FIG. 9G shows motor performance of Gcdh~ ~ mice treated with AAV-Gcdh FIG. 9A shows latency to fall from the rotarod across trials. FIG. 9B shows grip strength for the fore paws. FIG. 9C shows grip strength for the hind paws. FIG. 9D shows open field cumulative locomotor activity. FIG. 9E shows cumulative rearing activity. FIG. 9F shows cumulative distance traveled in the center zone. FIG. 9G shows velocity of locomotion. Data are presented as means ± SEM. Significance was validated with t test (*p < 0.05 and ***p < 0.005).
[0015] FIG. 10A shows schematic representation of the murine Aass gene and sgRNAs used to delete the gene. FIG. 10B shows a schematic representation of the AAV-CRISPR-Aass viruses used to knock out the gene targeting exons 6 and exon 7 of Aass. FIG. 10C shows a pAAV- CRISPR-Aass-Exon6-sgRNA plasmid map. FIG. 10D shows a pAAV-CRISPR-Aass-Exon7- sgRNA plasmid map.
[0016] FIG. 11A - FIG. 11D shows liver specific deletion of Aass in Gcdh~ ~ mice using AAV- CRISPR. Neonatal Gcdh ~ mice were injected with a low (2.4 x 1011 vg/mouse), intermediate (6 x 1011 vg/mouse) and high (1 x 1012 vg/mouse) dose of AAV expressing Cas9 under aliver specific promoter and sgRNA targeting the Aass gene. FIG. 11A shows Kaplan Meier survival curves of experimental groups after exposure to high protein diet. FIG. 11B shows Glutaric Acid and 3- OH-Glutaric Acid levels in liver and brain of wild-type C57B6J mice and treated (AAV-CRISP, high dose) Gcdh~ ~ mice after 60 days high protein diet and upon expiration (day 4, AAV-GFP). FIG. 11C shows AASS immunostaining of livers of depict groups. FIG. 11D shows representative sections of the hippocampus of mice injected with AA V-CR1SPR or AAV-GFP or showing vacuolation (arrows) and hemorrhage (arrowheads). The bottom of the drawing provides the quantification of hippocampal vacuolation and meningeal hemorrhage by blinded veterinarian pathologist. Data are presented as means ± SEM Significance was validated with t test (**p < 0.01, ***p < 0.005 and ****p < 0.0001.
[0017] FIG. 12A - FIG. 12G show motor performance of Gcdh~ ~ mice treated with AAV- CRISPR-Aass virus. FIG. 12A shows latency to fall from the rotarod across trials. FIG. 12B shows grip strength for the fore paws. FIG. 12C shows grip strength for the hind paws. FIG. 12D shows open field cumulative locomotor activity, FIG. 12E shows cumulative rearing activity, FIG. 12F shows cumulative distance traveled in the center zone, and FIG. 12G shows the velocity
of locomotion. Data are presented as means ± SEM. Significance was validated with t test (**p < 0.01 and ****p < 0.0001).
[0018] FIG. 13A shows C5-DC metabolite in blood from wild type mice (C57BL) and Gcdh~ ~- AAV-Aass-CRISPR mice before and 4 days after high protein exposure. FIG. 13B shows lysine in blood from wild type mice (C57BL) and Gcdh^-AAV-Aass-CRISPR mice before and 4 days after high protein exposure. FIG. 13C shows tryptophan levels in blood from wild type mice (C57BL) and Gcdh^-AA V-Aass-CRISPR mice before and 4 days after high protein exposure. Data are presented as means ± SEM. Significance was validated with t test (*p < 0.05, **p < 0.01).
[0019] FIG. 14A - FIG. 14B show intravenous injection with siRNA against AASS in Gcdh ~ mice. FIG. 14A shows Kaplan Meier survival curves of treated (siRNA against Aass, at day -1) and control (siRNA non targeting mouse genome, at day -1) Gcdh~ ~ mice on high protein diet (Days: days after high protein diet). FIG. 14B shows immunostaining for AASS of livers postmortem of the treatment group (siRNA against Aass). *p < 0.05 for survival curves using Log-rank (Mantel -Cox) test.
[0020] FIG. 15A - FIG. 15K show Gcdh~ ~ knockout mice: phenotype and rescue by hepatocyte transplantation. FIG. 15A shows the lysine catabolism pathway scheme in peroxisomes, cytosol and mitochondria. FIG. 15B shows brain hemorrhage (arrow) of Gcdh~~ mice after 4 days on high-protein diet exposure. FIG. 15C shows representative H&E staining of the hippocampus with vacuolation (arrow). Boxed area shown with higher magnification on the right. FIG. 15D shows a Kaplan-Meier survival curves of Gcdh~ ~ knockout mice transplanted with wild-type hepatocytes (Gcdh ) on high-protein diet. FIG. 15E shows levels of glutaric acid and FIG. 15F shows levels of 3-OH-glutaric acid in liver and brain of groups after 10 (non-transpl anted) or 160 (transplanted) days on high-protein diet. FIG. 15G shows H&E staining of hippocampal brain sections. Boxed area shown with higher magnification on the right. FIG. 15H shows quantification of hippocampal vacuolation and FIG. 141 shows meningeal hemorrhage levels (Arbitrary Units (AU): 0 = absence; 1 = low; 2 = intermediate; 3 = high; 4 = very high). FIG. 15J shows RFP immunohistochemistry only detecting healthy hepatocytes (Gcdh+/+, transgenic mTmG). FIG. 15K shows the western blot (GCDH and beta actin) of liver lysates from low and high repopulated transplanted animals (n = 4 each). Data is presented as means ± SD. Significance was validated with t test (FIG. 15D, FIG. 15E) or with Mann-Whitney U test (FIG. 15H, FIG. 151) (*p < 0.05, **p < 0.01 and *** p < 0.005). All mice were transplanted at the age of 2 months and experiments were performed at age of 8 months (see methods for details). Nontransplanted controls are age matched. GCDH: Glutaryl-Co-A Dehydrogenase; AASS: Alpha
Aminoadipate-Semialdehyde Synthase; RFP: Red Fluorescent Protein; mTmG membrane Tomato membrane GFP.
[0021] FIG. 16A - FIG. 16K show the double knockout Gcdh 47Aass4)~ mice: phenotype and transplantation experiments. FIG. 16A shows Kaplan-Meier survival curves of single (Gcdh4) and double Gcdh 4 Aass" ’) knockout mice on high protein diet. FIG. 16B shows levels of glutaric acid and FIG. 16C shows levels of 3-OH-glutaric acid in liver and brain tissue of single Gcdh4) and double (Gcdh4/Aass4) knockout mice after 5 and 60 days on high-protein diet, respectively. FIG. 16D shows Kaplan-Meier survival curves of double (Gcdh47Aass4~) knockout mice transplanted with Gcdh4 hepatocytes. FIG. 16E shows levels of glutaric acid and FIG. 16F shows levels of 3-OH-glutaric acid in liver and brain of doble knockout (Gcdh4/Aass ) groups after 5 days (transplanted) and 60 days (non-transpl anted) on high protein diet. Representative AASS immunostaining (FIG. 16G) and Western blot (FIG. 16H) of livers from transplanted double Gcdh 47Aass4~) knockout mice. FIG. 161 shows H&E staining of hippocampal brain sections with vacuolation (arrows). Boxed area shown with higher magnification on the right. Quantification of hippocampal vacuolation (FIG. 16J) and brain meningeal hemorrhage (FIG. 16K) levels. Arbitrary Units (AU): 0 = absence; 1 = low; 2 = intermediate; 3 = high; 4 = very high. Data is presented as means ± SD. Significance was validated with t test (FIG. 16B, FIG. 16D) or with Mann-Whitney U test (FIG. 16H, FIG. 16 J) (*p < 0.05, **p < 0.01 and *** p < 0.005). All mice were transplanted at the age of 2 months and experiments were performed at age of 8 months. Non-transplanted controls are age matched.
[0022] FIG. 17A - FIG. 17E shows phenotype of liver-specific GA- 1 model. Gcdh4 hepatocytes were transplanted into TIRF transgene free Il2rg 7Rag247Fah 4) mice, which have a normal lysine catabolism (Gcdh+/+ /Aass+/+). FIG. 17 shows a Kaplan Meier survival curve of TIRF mice transplanted with Gcdh4 hepatocytes. FIG. 17B shows representative FAH immunohistochemistry of TIRF liver (FAH negative) transplanted with Gcdh 4 hepatocytes (FAH positive). Glutaric acid (FIG. 17C) and 3-OH-glutaric acid (FIG. 17D) levels in liver and brain of transplanted and non-transplanted mice on high protein diet. FIG. 17E shows summary of hepatocyte transplantation models and their outcomes. Color codes for whole body and/or liver (transplanted hepatocytes) of mice in the diagram correspond to: Blue: Gcdh47Aass+/+ (single knockout); Yellow: Gcdh47Aass4' (double knockout); Grey: Gcdh+/+/Aass+/+ (wild-type). Significance was validated with Mann- Whitney U test (*p < 0.05 and **p < 0.01). All mice were transplanted at the age of 2 months and experiments were performed at age of 8 months (see methods). Non-transplanted controls are age matched. I12rg: 11-2 receptor gamma; Rag2: recombination activating gene 2; fah: fumaryl acetoacetate hydrolase.
[0023] FIG. 18A - FIG. 18K shows liver-directed AAV gene therapy in Gcdh~ ~ mice. FIG. 18A - FIG. 181 show five-week-old Gcdh~~ mice were intravenously injected with AW-Gcdh or AAN-GFP at a dose of 1.5 x 1012 vg/mouse. FIG. 18A show Kaplan Meier survival curves of Gcdh ~ mice on high-protein diet. FIG. 18B shows GCDH Western blot analysis of liver and brain lysates from AAV -treated mice after harvesting or expiration (controls). FIG. 18C shows representative GCDH immunostaining of liver in treatment group. FIG. 18D shows C5-DC metabolite levels in whole blood of all experimental groups before and 4 days after high protein diet. Glutaric Acid (FIG. 18E) and 3-OH-glutaric Acid (FIG. 18F) levels in liver and brain tissue of Gcdh ~ mice at 140 days (AAV-G /r) or upon expiration (AAV-GFF and untreated). FIG. 18G shows H&E staining of hippocampal brain sections showing vacuolation (arrows) and meningeal hemorrhage (arrowheads). Boxed area shown with higher magnification on the right. Quantification of hippocampal vacuolation (FIG. 18H) and brain meningeal hemorrhage (FIG. 181) levels. Arbitrary Units (AU): 0 = absence; 1 = low; 2 = intermediate; 3 = high; 4 = very high. FIG. 18 J - FIG. 18K show neonatal Gcdh~ ~ pups treated with low (3 x 1011 vg/mouse), intermediate (7.5 x 1011 vg/mouse) and high (1.5 x 1012 vg/mouse) dose of AAV. FIG. 18J shows Kaplan Meier survival curves of treated Gcdh~~ mice on high protein after weaning. Western blot (FIG. 18K) and GCDH immunostaining (FIG. 18L) of treated (high dose) Gcdh~ ~ mice after expiration. Data is presented as means ± SD. Significance was validated with t-test (FIG. 18 FIG. 18, FIG. 18E, FIG. 18F) or Mann- Whitney U test (FIG. 18G, FIG. 18H) (*p < 0.05, **p < 0.01, and ***p < 0.005). All mice were transplanted at the age of 2 months and experiments were performed at age of 8 months (see methods for details). Non-transplanted controls are age matched. AAV: Adeno-Associated Virus; C5-DC: glutarylcamitine; GCDH: Glutaryl-Co-A Dehydrogenase.
[0024] FIG. 19A - FIG. 19G show liver specific deletion of Aass in Gcdh~~ mice using AAV- CRISPR. Neonatal Gcdh~ mice were injected with a low (2.4 x 1011 vg/mouse), intermediate (6 x 1011 vg/mouse) and high (1 x 1012 vg/mouse) dose of AAV expressing Cas9 under aliver specific promoter and sgRNA targeting the Aass gene. FIG. 19A shows Kaplan Meier survival curves of experimental groups on high protein diet. Glutaric Acid (FIG. 19B) and 3-OH-glutaric acid (FIG. 19C) levels in liver and brain of wild-type C57BL/6 mice and treated (AAV-CRISPR, high dose) Gcdh~ ~ mice after 60 days on high protein diet and upon expiration (day 4, AAV-GFF). FIG. 19D shows AASS immunostaining of livers of experimental groups. FIG. 19E shows representative hippocampal sections of mice injected with AA F-CRISPR or AAV-GFP showing vacuolation (arrows) and hemorrhage (arrowheads). Quantification of hippocampal vacuolation (FIG. 19F) and meningeal hemorrhage (FIG. 19G). Data is presented as means ± SD. Significance was
validated with t test (FIG. 19B) and with Mann-Whitney test (FIG. 19D) (**p < 0.01, and ***p < 0.005 AAV: Adeno-Associated Virus; Gcdh: Glutaryl-Co-A Dehydrogenase. AASS: Alpha Aminoadipate-Semialdehyde Synthase.
[0025] FIG. 20A - FIG. 20B show generation of Gcdh~ ~ mice. FIG. 20A show schematic representation of the murine Gcdh gene and the sgRNAs used to generate the Gcdh ~ knockout strains in C57BL/6 and TIRF (transgene free Il2rg/'/Rag2'/'/Fah'/). Exonic sgRNA target sites are marked in blue. FIG. 20B shows image of a DNA gel electrophoresis showing both the wild type and deleted bands of Gcdh amplified by PCR using genomic DNA from knockout mice generated by CRISPR/Cas9. sgRNA: single guide RNA.
[0026] FIG. 21A - FIG. 21B shows phenotype characterization of 4 weeks-old Gcdh~ ~ mice on high protein diet. Representative H&E staining of the liver (FIG. 21A) and the kidney (FIG. 21B) of Gcdh~ ~ mice after four days on high-protein diet.
[0027] FIG. 22A - FIG. 22G show motor performance of Gcdh~ ~ mice transplanted with healthy (Gcdh ) hepatocytes. Grip strength for the fore paws (FIG. 22A) and for the hind paws (FIG. 22B). Open field cumulative locomotor activity (FIG. 22C), cumulative rearing activity (FIG. 22C), cumulative distance traveled in the center zone (FIG. 22E), cumulative time in the center zone (FIG. 22F), and velocity of locomotion (FIG. 22G). Significance was validated with t test (*p < 0.05, **p < 0.01).
[0028] FIG. 23A - FIG. 23B show generation of double (Gcdh~ ~ Aass^ ) knockout mice. FIG. 23A shows schematic representation of murine Aass and Gcdh genes and the sgRNAs used to generate the double (Gcdh+/+ /Aass -/’) knockout strains. Exonic sgRNA target sites are marked on color. FIG. 23B is an image of a DNA gel electrophoresis showing both the wild type and deleted bands of Aass and Gcdh amplified by PCR using genomic DNA from knockout mice generated by CRISPR/Cas9. sgRNA: single guide RNA.
[0029] FIG. 24A - FIG. 24B show gene therapy vectors. Schematic representation of Adeno- Associate Virus (AAV) expressing murine Gcdh (FIG. 24A) and GFP (FIG. 24B) sequences. GFP: Green fluorescent protein; HLP: Hybrid Liver Promoter; Syn PolyA: Synthethic Polyadenylation Signal; ITR: Inverted Terminal Repeat.
[0030] FIG. 25A - FIG. 25G show motor performance of Gcdh~ ~ mice treated with AAV-Gcdh. FIG. 25A shows latency to fall from the rotarod across trials. Grip strength for the fore paws (FIG. 25B) and for the hind paws (FIG. 25C). Open field cumulative locomotor activity (FIG. 25D), cumulative rearing activity (FIG. 25E), cumulative distance traveled in the center zone (FIG. 25F), cumulative time in the center zone (FIG. 25G), and velocity of locomotion (FIG. 25H) Significance was validated with t test (*p < 0.05, **p < 0.01, and ***p < 0.005).
[0031] FIG. 26A - FIG. 26B show CRISPR gene therapy design and vectors. FIG. 26A shows schematic representation of the murine Aass gene and sgRNAs used to delete the gene (FIG. 26B) schematic representation of the AA V-CRISPR-Aass viruses used to knock out the gene targeting exons 6 and exon 7 of Aass. SaCas9: Staphylococcus aureus Cas9; Syn PolyA: Synthetic Poly Adenylation Signal; ITR: Inverted Terminal Repeat; HLP: Hybrid Liver Promoter
[0032] FIG. 27A - FIG. 27H show motor performance of Gcdh ~ mice treated with AAV- CRISPR. FIG. 27A show the latency to fall from the rotarod across trials. FIG. 27B- FIG. 27C show grip strength for the fore paws (FIG. 27B) and for the hind paws (FIG. 27C). FIG. 27D- FIG. 27G show open field cumulative locomotor activity (FIG. 27D), cumulative rearing activity (FIG. 27E), cumulative distance traveled in the center zone (FIG. 27F), cumulative time in the center zone (FIG. 27G) and velocity of locomotion (FIG. 27H). Significance was validated with t test (*p < 0.05 and ***p < 0.005).
[0033] FIG. 28A - FIG. 28B show biochemical analysis of AAV-CRISPR treated Gcdh~ ~ mice. Lysine (FIG. 28A) and tryptophan (FIG. 28B) levels in blood from wild type mice (C57BL/6) and AAV-CRISP treated mice four days after high protein exposure. Significance was validated with t test.
[0034] FIG. 29A - FIG. 29B show intravenous injection with siRNA against AASS in Gcdh~~ mice. Aass siRNA (8 mg/kg) solution was injected into the tail vein of 3-week-old GcdlT ~ mice and put on high protein diet 48 hours later. FIG. 29A shows Kaplan Meier survival curves of treated (siRNA targeting Aass) and control (siRNA non targeting mouse genome) Gcdh~ ~ mice on high protein diet (Days: days after high protein diet). FIG. 29B shows representative immunostaining for AASS of liver from treatment group (post-mortem), p < 0.05 for survival curves using Log-rank (Mantel-Cox) test.
[0035] FIG. 30A and FIG. 30B show expression of AASS in HepG2 cells after incubation with ASO or siRNA targeting AASS. HepG2 cells were incubated for 48 hours with different ASO (FIGS. 30A) or siRNA (FIG. 30B) in experimental triplicates. Extracted RNA was used for RT- qPCR for AASS and GAPDH (normalization) in technical duplicates. ASO against PCSK9 and a scrambled siRNA were used as negative controls. One way ANOVA followed by post-hoc Dunnett’s Test (Graph Pad PRISM, Version 10.2.0), were used to determine significance relative to negative control. “*”meaning p <0.05, “**” p<0.01, “****” p<0.0001.
[0036] FIG. 31 shows introduced mutations in the human GCDH protein sequence. Schematic representation of Lysine (K) to arginine (R) substitutions. Number on the left stand for the mutant (031, 032 and 033) or wildtype (027) constructs.
[0037] FIG. 32 shows Western blotting of transfected HEK293 with GCDH mRNA variants. Different GCDH mRNA constructs (027, 031, 032 and 033) were transfected and cells lysed at 24, 48, 72 and 96 hours for Western blotting using antibodies for GCDH and beta-actin.
[0038] FIG. 33A-FIG. 33E show Validation of LNP production. FIG. 33A depicts HEK293T cells transfected with GFP LNP for 24 hours (left) and non transfected control cells (right). FIG. 33B depicts Western blotting of GCDH LNP (packaged as LNP) and GCDH RNA transfection (same construct as used for LNP but not packaged). FIG. 33C and FIG. 33D depict graphs from RC Bioanalyzer detecting nucleic acids in form of the GCDH mRNA before LNP packaging (FIG. 33C ) and extracted from LNP, 10 days after GCDH LNP production (FIG. 33D). In vivo validation by Western blotting of liver tissue from Gcdh-/- mice injected with different doses (1.5- 6mg/kg) of GCDH LNP 027, 031, 032 and 033 analyzed between 2-8 days postinjection (FIG. 33E). As positive control served a wildtype mouse (Gcdh ) and a non injected Gcdh~ ~ mouse [0039] FIG. 34A-FIG. 34D show survival of GCDH LNP treated Gcdh-/- mice on high protein diet. Mice were intravenously injected with 6mg/kg GCDH LNPs and put immediately on casein (high protein) diet. Depicted are survival curves of GCDH LNP 027 (FIG. 34A) 032 (FIG. 34B), 032 (FIG. 34C) and 033 (FIG. 34D). Survival was analyzed using the log-rank (Mantel-Cox) test (Graph Pad PRISM, Version 10.2.0), p<0.5, “**” p<0.01, “n.s.” not significant.
[0040] FIG. 35A shows a graphical depiction of target sequence for antisense oligonucletides ASO 1, ASO ex4, ASO ex8, ASO exl6, ASO78304, and ASO 28 in relation to the exons of mouse Aass. FIG. 35B shows a graphical depiction of target sequence for siRNA oligonucletides siRNA 1, siRNA 2, siRNA 3, siRNA 4, and siRNA 5 in relation to ASO ex4 and the exons of mouse Aass. In FIGS. 35A-35B, the sequence of the mouse has truncated 5’ and 3’ regions (e.g., mouse AASS CCDS 19937.1 - SEQ ID NO:203).
[0041] FIGS. 36A-36E depict the plasmid sequence map for pAM-026, pAM-027, pAM-031, pAM-032, and pAM-033, with annotations extracted from SnapGene.
[0042] FIG. 37 shows relative normalized expression of the endogenous human AASS gene in HEK 293T cells treated with individual siRNAs. Data are normalized to GAPDH and are shown relative to RNAiMax. Sample key for ASO ID#: A is #024; B is #025; C is #023; D is #030; E is #004; F is #028; G is #029; H is #009; I is #006; J is #003; K is #010; L is #027, M is #012, N is #007, O is #005, P is #019, Q is #008; R is #018; and S is #011. Statistical analysis completed using one-way ANOVA with Tukey’s multiple comparisons test, *p<0.05.
[0043] FIG. 38 shows relative normalized expression of the human AASS gene in HEK 293T cells treated with individual siRNAs. Cells were first transfected with an expression vector for the human AASS gene and then treated with the oligonucleotides. Sample key for ASO ID#: A
is #024; B is #025; C is #023; D is #030; E is #004; F is #028; G is #029; H is #009; I is #006; J is #003; K is #010; L is #027, M is #012, N is #007, O is #005, P is #019, Q is #008; R is #018; and S is #011. Data are normalized to GAPDH and are shown relative to RNAiMax. Statistical analysis completed using one-way ANOVA with Tukey’s multiple comparisons test, *p<0.05.
[0044] FIG. 39 shows relative normalized expression of the endogenous human AASS gene in HEK 293T cells treated with individual antisense oligonucleotides. Data are normalized to GAPDH and are shown relative to RNAiMax. Statistical analysis completed using one-way ANOVA with Tukey’s multiple comparisons test, *p<0.05.
[0045] FIG. 40 shows relative normalized expression of the human AASS gene in HEK 293T cells treated with individual antisense oligonucleotides. Cells were first transfected with an expression vector for the human AASS gene and then treated with the oligonucleotides. Data are normalized to GAPDH and are shown relative to RNAiMax. Statistical analysis completed using one-way ANOVA with Tukey’s multiple comparisons test, *p<0.05.
BRIEF SUMMARY
[0046] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a recombinant glutaryl-CoA dehydrogenase (GCDH). The recombinant GCDH may comprise one or more functional domains. The recombinant GCDH may be used for therapeutic replacment of defective GCDH protein in a subject (e.g., protein replacement therapy), either alone or in combination with nucleic acid inhibition of the aminoadipate-semialdehyde synthase (AASS) gene or mRNA (e.g., using a silencing oligonucleotide or a gene editing system that targets AASS). The isolated nucleic acid molecule encoding the recombinant GCDH may be an mRNA, optionally a modified mRNA (mmRNA).
[0047] Disclosed herein is an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, and may be operably linked a promoter. Disclosed herein is an expression cassette comprising a disclosed isolated nucleic acid molecule comprising an isolated nucleic acid molecule encoding a glutaryl-CoA dehydrogenase (GCDH), wherein the nucleic acid sequence may comprise the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, or a variant thereof, which may be operably linked to a promoter. The GCDH may be a variant GCDH sequence comprising one or more substitutions selected from K163R, K240R, K202R, OR K371R; the substitutions K163R and K240R; the substitutions K202R and K371R; or the substitutions selected K163R, K202R, K240R, and K371R. The GCDH may comprise or consist of the amino acid sequence set forth in any one of SEQ ID NOS:3, SEQ ID NO:200, SEQ ID NO:201, or SEQ ID NO:202. A nucleic
acid sequence encoding the variant GCDH sequence may comprise the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, or SEQ ID NO: 196, or a variant thereof.
[0048] The expression cassette and/or isolated nucleic acid encoding the GCDH may further comprise a 5’UTR sequence or a 3 ’UTR sequence, optionally wherein the 5’UTR sequence comprises of the sequence set forth in SEQ ID NO: 189 and/or the 3 ’UTR sequence comprises of the sequence set forth in SEQ ID NO: 190. Also disclosed herein is a vector comprising the expression cassette and/or isolated nucleic acid encoding the GCDH. In some aspects, a vector encoding the GCDH may be selected from sequence of any one of SEQ ID NOS: 192-195.
[0049] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. The target gene of interest, e.g., containing a target sequence for the gene editing system, may be an aminoadipate-semialdehyde synthase (AASS) gene or mRNA (e.g., NM_005763.4). The gene editing system may be selected from CRISPR gene editing system (e.g., a CRISPR-Cas of any class, type, or subtype), prime editing system, base editing system, zinc-finger nuclease gene editing system, TALEN gene editing system, ARCUS nuclease gene editing system, meganuclease gene editing system, recombinase gene editing system, transposase gene editing system, integrase gene editing system, or homologous recombination gene editing system. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. The one or more elements may comprise an endonuclease and a sgRNA directed at a target sequence in a target gene of interest. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed a target sequence in the AASS gene.
[0050] Disclosed herein are silencing oligonucleotides, for silencing a target gene. The silencing oligonucleotides may target a target sequence within an aminoadipate-semialdehyde synthase (AASS) gene or mRNA (e.g., NM_005763.4). Also disclosed herein are target sequences of an AASS gene or mRNA for targeting by such silencing oligonucleotides. In an aspect, such target sequences within the AASS may be within any one of exons 1-25, or exons 2-24, or the 5’UTR and 3’ UTR. In an aspect, a silencing olignucleotide targets a target sequence within an overlap region between any two adjacent exons selected from exons 1-25. The overlap region between a first and second region may vary from about 90% of the number of nucleotides of the overlap region being within the first region and about 10% of the number of nucleotides of the overlap region being within the second region, to about 10% of the number of nucleotides of the overlap region being within the first region and about 90% of the number of nucleotides of the overlap
region being within the second region. In an aspect, the silencing oligonucleotide may be selected from an siRNA, antisense oligonucleotide, miRNA, shRNA, ssRNA, dsRNA, piRNA, or a 3'UTR of mRNA.
[0051] Disclosed herein are specific target sequences for the AASS gene, selected from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74-117, 120-182, which can be targeted by a gene editing system, or a silencing oligonucleotide (e.g., siRNA or antisense oligonucleotide or other gene expression reducing oligonucleotides) as described herein.
[0052] Disclosed herein is a viral vector comprising a disclosed isolated nucleic acid molecule (e.g., comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase). Disclosed herein is a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding aminoadipate-semialdehyde synthase.
[0053] Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:01 or a fragment thereof. Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:02 or a fragment thereof. Disclosed herein is a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. The one or more elements may comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene. Disclosed herein is a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
[0054] Disclosed herein is a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene. Disclosed herein is a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
[0055] Disclosed herein is a viral vector comprising the sequence set forth in SEQ ID NO: 19, SEQ ID NO:20, or SEQ ID NO:21. Disclosed herein a vector comprising the sequence set for in SEQ ID NO:92. Disclosed herein is a vector comprising the sequence set for in SEQ ID NO:93.
Disclosed herein a vector comprising the sequence set for in SEQ ID NO:94. Disclosed herein a vector comprising the sequence set for in SEQ ID NO:95.
[0056] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl- CoA dehydrogenase. Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector (e.g., a viral vector or non-viral vector) comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored. Disclosed herein a method of protein replacement therapy for defective glutaryl-CoA dehydrogenase.
[0057] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01, wherein expression of glutaryl-CoA dehydrogenase is restored. Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:02, wherein expression of glutaryl-CoA dehydrogenase is restored.
[0058] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored.
[0059] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
[0060] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a gene editing system and a sgRNA directed
at a target sequence in a target gene of interest, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
[0061] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and administering a therapeutically effective amount of a second viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
[0062] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding a gene editing system and a sgRNA directed at a target gene of interest, and administering a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in the target gene of interest. Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipatesemialdehyde synthase gene; and administering to the subject a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
[0063] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the target gene comprises the aminoadipate- semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, and wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
DETAILED DESCRIPTION
[0064] The present disclosure describes formulations, compounded compositions, kits, capsules, containers, and/or methods thereof. It is to be understood that the inventive aspects of which are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the
terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.
[0065] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.
Abbreviations.
[0066] SaCas9: Staphylococcus Aureus Cas9; Syn PolyA: Synthetic Poly Adenylation Signal; ITR: Inverted Terminal Repeat; HLP: Hybrid Liver Promoter; GCDH: Glutaryl-Co-A Dehydrogenase; ORF: Open Reading Frame; Syn PolyA: Synthetic Poly Adenylation Signal; AASS: Alpha Aminoadipate-Semialdehyde Synthase; C5-DC: glutarylcamitine.
Terms.
[0067] Before the present compounds, compositions, articles, systems, devices, and/or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.
[0068] This disclosure describes inventive concepts with reference to specific examples. However, the intent is to cover all modifications, equivalents, and alternatives of the inventive concepts that are consistent with this disclosure.
[0069] As used in the specification and the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.
[0070] The phrase “consisting essentially of’ limits the scope of a claim to the recited components in a composition or the recited steps in a method as well as those that do not materially affect the basic and novel characteristic or characteristics of the claimed composition or claimed method. The phrase “consisting of’ excludes any component, step, or element that is not recited in the claim. The phrase “comprising” is synonymous with “including”, “containing”, or “characterized by”, and is inclusive or open-ended. “Comprising” does not exclude additional, unrecited components or steps.
[0071] As used herein, when referring to any numerical value, the term “about” means a value falling within a range that is ± 10% of the stated value.
[0072] Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, a further aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0073] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed. Thus, in a compound containing 2 parts by weight component X and 5 parts by weight component Y, X and Y are present at a weight ratio of 2:5 and are present in such ratio regardless of whether additional components are contained in the compound.
[0074] The terms “optional” or “optionally”may mean that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. In an aspect, a disclosed method can optionally comprise one or more additional steps, such as, for example, repeating an administering step or altering an administering step.
[0075] The term “subject” may refer to the target of administration, e.g., a human being. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.). Thus, the subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Alternatively, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term does not denote a particular age or sex, and thus, geriatric, adult, adolescent, and child subjects, as well as fetuses, whether male or female, are intended to be covered. In an aspect, a subject can be a human subject. In an aspect, a subject can have a disease or disorder characterized by lysine catabolism dysfunction.
[0076] The term “diagnosed” may mean having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (such as GA-1) that can be diagnosed or treated by one or more of the disclosed compositions or by one or more of the disclosed methods. For example, “diagnosed with a disease or disorder characterized by lysine catabolism dysfunction” means having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (GA-1) that can be treated by one or more of the disclosed compositions or by one or more of the disclosed methods. For example, “suspected of having a disease or disorder characterized by lysine catabolism dysfunction” can mean having been subjected to an examination by a person of skill, for example, a physician, and found to have a condition (such as GA-1) that can likely be treated by one or more of the disclosed compositions or by one or more of the disclosed methods. In an aspect, an examination can be physical, can involve various tests (e.g., blood tests, genotyping, biopsies, etc.), diagnostic evaluations (e.g., X- ray, CT scan, etc.), and assays (e.g., enzymatic assay), or a combination thereof. In an aspect, an examination can be objective and/or subjective.
[0077] The term “isolated” may mean altered or removed from the natural state through human intervention. For example, naturally occurring siRNAs in living animals are not “isolated”, but synthetic siRNAs or siRNAs that are partially or completely separated from coexisting materials in their natural state are “isolated”. An isolated siRNA can be in substantially purified form or in a non-native environment, such as a cell into which the siRNA has been introduced.
[0078] A “patient” can refer to a subject afflicted with a disease or disorder such as GA-1. In an aspect, a patient can refer to a subject that has been diagnosed with or is suspected of having GA- 1. In an aspect, a patient can refer to a subject that has been diagnosed with or is suspected of having GA-1 and is seeking treatment or receiving treatment for GA-1. In an aspect, a “patient” can refer to a subject afflicted with a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction. In an aspect, a patient can refer to a subject that has been diagnosed with or is suspected of having a disease or disorder a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction. In an aspect, a patient can refer to a subject that has been diagnosed with or is suspected of having a disease or disorder and is seeking treatment or receiving treatment for a disease or disorder (such GA-1).
[0079] The term “mRNA” may mean any transcription/isomer variant from a given gene including but not limited to truncated and modified versions such as but not limited to codon optimization of the gene. It includes also modified mRNA (mmRNA) as described in patent US 2020/0354423, which is incorporated herein by reference for its teachings of mmRNA.
[0080] The term “endonuclease” may mean any type of DNA binding molecule that can bind and cut DNA at a specific DNA sequence, such as but not limited to CRISPR, optionally selected from a CRISPR-Cas or CRISPR-KRAB, zinc-finger nucleases, TALEN, ARCUS nuclease or meganucleases. Included in this term are also effector molecules that can instead of cutting DNA (nuclease) repress (transcriptional repression domains such as but not limited to CRISPR-KRAB) or modify (modifier such as but not limited to CRISPR base editing) at or adjacent to the binding site.
[0081] The term “CRISPR” (e.g., as in a CRISPR system or a CRISPR gene editing system) man mean any class of CRISPR system from any bacteria. A CRISPR system may be a CRISPR-Cas system, such as a Class I or Class II CRISPR-Cas system; a Type I, Type II, Type III, Type IV, Type V, or a Type VI CRISPR-Cas system; or a Subtype A, Subtype B, Subtype C, Subtype D, Subtype E, Subtype F, or Subtype U CRISPR-Cas system; or a Cascade, SpCas9, SaCas9, FnCas9, NmCas9, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl3a (C2c2), Casl3b(C2c4), Casl3c (C2c7), or Casl3d CRISPR-Cas system. It may or may not have CRISPR effector molecules such as single guide RNA (sgRNA) or transcriptional repression domains such as KRAB, which may or may not be covalently bound to other components of the CRISPR system such as Cas9.
[0082] The term “2'-deoxynucleoside” may mean a nucleoside comprising 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In an aspect, a 2'- deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
[0083] The term “2'-O-methoxyethyl” (also 2'-M0E and 2'-O(CH2)2 — OCH3) may refer to an O- methoxy-ethyl modification at the 2' position of a sugar ring, e.g. a furanose ring. A 2'-O- methoxy ethyl modified sugar is a modified sugar.
[0084] The term “2'-M0E nucleoside” (also 2'-O-methoxyethyl nucleoside) may mean a nucleoside comprising a 2'-M0E modified sugar moiety.
[0085] The term “2 '-substituted nucleoside” or “2-modified nucleoside” may mean a nucleoside comprising a 2 '-substituted or 2'-modified sugar moiety. For example “2 '-substituted” or “2- modified” in reference to a sugar moiety may mean a furanosyl sugar moiety comprising a 2'- substituent group other than H or OH.
[0086] The term “3' target site” may refer to the nucleotide of a target nucleic acid which is complementary to the 3 '-most nucleotide of a particular antisense compound.
[0087] The term “5' target site” may refer to the nucleotide of a target nucleic acid which is complementary to the 5'-most nucleotide of a particular antisense compound.
[0088] The term “5-methylcytosine” may mean a cytosine modified with a methyl group attached to the 5’ position. A 5-methylcytosine is a modified nucleobase.
[0089] The term “amelioration” may refer to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In an aspect, amelioration includes a delay or slowing in the progression of one or more indicators of a condition or disease. The severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art.
[0090] The term “animal” may refer to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
[0091] The term “antisense activity” may mean any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In an aspect, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound to the target.
[0092] The term “antisense compound” may mean a compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and double-stranded compounds. Examples are antisense oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy -based compounds.
[0093] The term “antisense inhibition” may mean reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.
[0094] The term “antisense mechanisms” are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
[0095] The term “antisense oligonucleotide” may refer to an oligonucleotide having a nucleobase sequence that is complementary to a target nucleic acid or a region or segment thereof. In an aspect, an antisense oligonucleotide is specifically hybridizable to a target nucleic acid or a region or segment thereof.
[0096] The term “bicyclic nucleoside” or “BNA” may mean a nucleoside comprising a bicyclic sugar moiety. The term “bicyclic sugar” or “bicyclic sugar moiety” may mean a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of
the atoms in the first ring thereby forming a bicyclic structure. In an aspect, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.
[0097] The term “branching group” may mean a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In an aspect, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.
[0098] The term “cell-targeting moiety” may mean a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.
[0099] The term “cleavable moiety” may mean a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
[0100] The term “cEt” or “constrained ethyl” may mean a bicyclic sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'- CH(CH3)-O-2'.
[0101] The term “chemical modification” may mean a chemical difference in a compound when compared to a naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and intemucleoside linkage modifications (e.g., LNA or phosphorthioate). In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence.
[0102] The term “chemically distinct region” may refer to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2 '-O-m ethoxy ethyl nucleotides is chemically distinct from a region having nucleotides without 2 '-O-m ethoxy ethyl modifications.
[0103] The term “chimeric antisense compounds” may mean antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.
[0104] The term “cleavable bond” may mean any chemical bond capable of being split. In an aspect, a cleavable bond is selected from an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.
[0105] The term “cleavable moiety” may mean a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.
[0106] The term “complementary” in reference to an oligonucleotide may mean the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase
sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
[0107] The term “conjugate group” may mean a group of atoms that is directly or indirectly attached to a parent compound, e.g., an oligonucleotide.
[0108] The term “conjugate linker” may mean a group of atoms that connects a conjugate group to a parent compound, e.g., an oligonucleotide.
[0109] The term “constrained ethyl nucleoside” (also cEt nucleoside) may mean a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-O-2' bridge.
[0110] The term “contiguous” in the context of an oligonucleotide may refer to nucleosides, nucleobases, sugar moi eties, or intemucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” may mean nucleobases that are immediately adjacent to each other.
[0111] The term “designing” or “designed to” may refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
[0112] The term “GCDH” means any nucleic acid or protein of GCDH. “GCDH nucleic acid” may mean any nucleic acid encoding GCDH. For example, in an aspect, a GCDH nucleic acid includes a DNA sequence encoding GCDH, an RNA sequence transcribed from DNA encoding GCDH (including genomic DNA comprising introns and exons), including a non-protein encoding (i.e., non-coding) RNA sequence, and an mRNA sequence encoding GCDH. “GCDH mRNA” means an mRNA encoding a GCDH protein.
[0113] The term “AASS” may mean any nucleic acid or protein of AASS. The term “AASS nucleic acid” may mean any nucleic acid encoding AASS. For example, in an aspect, a GCDH nucleic acid includes a DNA sequence encoding AASS, an RNA sequence transcribed from DNA encoding AASS (including genomic DNA comprising introns and exons), including a non-protein encoding (i.e., non-coding) RNA sequence, and an mRNA sequence encoding AASS. “AASS mRNA” means an mRNA encoding a AASS protein.
[0114] The term “AASS specific inhibitor” may refer to any agent capable of specifically inhibiting AASS RNA and/or AASS protein expression or activity at the molecular level. For
example, AASS specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of AASS RNA and/or AASS protein.
[0115] The term “dose” may mean a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified period. In an aspect, a dose can be administered in two or more boluses, tablets, or injections. For example, in an aspect, where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In an aspect, two or more injections can be used to achieve the desired dose. In an aspect, a dose can be administered in two or more injections to minimize injection site reaction in an individual. In an aspect, the pharmaceutical agent is administered by infusion over an extended period or continuously. Doses can be stated as the amount of pharmaceutical agent per hour, day, week, or month.
[0116] The term “effective amount” may mean the amount of compound sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
[0117] The term “efficacy” may mean the ability to produce a desired effect.
[0118] The term “expression” may include all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures may include, but are not limited to the products of transcription and translation.
[0119] The term “fully modified” in reference to an oligonucleotide may mean a modified oligonucleotide in which each nucleoside is modified. “Uniformly modified” in reference to an oligonucleotide means a fully modified oligonucleotide in which at least one modification of each nucleoside is the same. For example, the nucleosides of a uniformly modified oligonucleotide can each have a 2'-M0E modification but different nucleobase modifications, and the intemucleoside linkages can be different.
[0120] The term “gapmer” may mean a chimeric antisense compound in which an internal region having a plurality of nucleosides that is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as the “gap” and the external regions can be referred to as the “wings.” In an aspect, the structure of a gapmer may support RNase H cleavage.
[0121] The term “hybridization” may mean the pairing or annealing of complementary oligonucleotides and/or nucleic acid molecules. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In an aspect, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In an aspect, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
[0122] The term “identifying an animal having, or at risk for having, a disease, disorder and/or condition” may mean identifying an animal having been diagnosed with the disease, disorder and/or condition or identifying an animal predisposed to develop the disease, disorder and/or condition. Such identification can be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.
[0123] The term “immediately adjacent” may mean there are no intervening elements between the immediately adjacent elements of the same kind (e.g., no intervening nucleobases between adjacent nucleobases).
[0124] The term “individual” may mean a human or non-human animal selected for treatment or therapy.
[0125] The term “inhibiting the expression or activity” may refer to a reduction, blockade of the expression or activity relative to the expression or activity in an untreated or control sample, and does not necessarily indicate a total elimination of expression or activity.
[0126] The term “intemucleoside linkage” may mean a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein “modified intemucleoside linkage” may mean any intemucleoside linkage other than a naturally occurring, phosphate intemucleoside linkage. Naturally occurring, non-phosphate linkages are referred to herein as modified intemucleoside linkages.
[0127] The term “phosphorothioate linkage” may mean a linkage between nucleosides wherein the phosphodiester bond of a phosphate linkage is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified intemucleoside linkage.
[0128] The term “lengthened” antisense oligonucleotides may be those that have one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein; e.g. a parent oligonucleotide.
[0129] The term “linearly modified sugar” or “linearly modified sugar moiety” may mean a modified sugar moiety that comprises an acyclic or non-bridging modification. Such linear modifications are distinct from bicyclic sugar modifications.
[0130] The term “linked deoxynucleoside” may mean a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.
[0131] The term “linked nucleosides” may refer to nucleosides that are connected in a continuous sequence (i.e., no additional nucleosides are present between those that are linked).
[0132] The term “mismatch” or “non-complementary” may mean a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non- complementary nucleobase.
[0133] The term “modified nucleobase” may mean any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” may mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). A “universal base” may be a nucleobase that can pair with any one of the five unmodified nucleobases.
[0134] The term “modified nucleoside” may mean a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
[0135] The term “modified nucleotide” may mean a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
[0136] The term “modified oligonucleotide” may mean an oligonucleotide comprising at least one modified intemucleoside linkage, a modified sugar, and/or a modified nucleobase.
[0137] The term “modulating” may refer to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating AASS RNA can mean to increase or decrease the level of AASS RNA and/or AASS protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, a AASS antisense compound can be a modulator that decreases the amount of AASS RNA and/or AASS protein in a cell, tissue, organ or organism.
[0138] The term “monomer” may refer to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
[0139] The term “motif’ may mean the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
[0140] The term “natural” or “naturally occurring” may mean found in nature. “Naturally occurring intemucleoside linkage” may mean a 3' to 5' phosphodiester linkage. “Natural sugar moiety” may mean a sugar moiety found in DNA (2'-H) or RNA (2'-OH). “Naturally occurring nucleobase” may mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). The term “non-complementary nucleobase” may refer to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
[0141] The term “nucleic acid” may refer to molecules composed of monomeric nucleotides. A nucleic acid may include, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, and modified forms thereof. [0142] The term “nucleobase” may mean a heterocyclic moiety capable of pairing with a base of another nucleic acid.
[0143] The term “nucleobase sequence” may mean the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
[0144] The term “nucleoside” may mean a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.
[0145] The term “nucleotide” may mean a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
[0146] The term “oligomeric compound” may mean a compound comprising an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of oligomeric compounds include single-stranded and double-stranded compounds, such as, antisense compounds, antisense oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and occupancy -based compounds.
[0147] The term “oligonucleoside” may mean an oligonucleotide in which the intemucleoside linkages do not contain a phosphorus atom.
[0148] The term “oligonucleotide” may mean a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
[0149] The term “parent oligonucleotide” may mean an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths,
motifs, and chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.
[0150] The term “parenteral administration” may mean administration through injection or infusion. Parenteral administration may include subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
[0151] The terms “pharmaceutically acceptable carrier or diluent” may mean a medium or diluent suitable for use in administering to an animal. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-inj ection.
[0152] The term “pharmaceutically acceptable salts” may mean physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or antisense compounds, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
[0153] The term “pharmaceutical agent” may mean a compound that provides a therapeutic benefit when administered to an individual.
[0154] The term “pharmaceutical composition” may mean a mixture of compounds suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salts thereof and a sterile aqueous solution.
[0155] The term “phosphorothioate linkage” may mean a modified internucleoside linkage between nucleosides where the phosphodiester bond is modified by replacing one of the nonbridging oxygen atoms with a sulfur atom.
[0156] Theterm “phosphorus moiety” may mean agroup of atoms comprising a phosphorus atom. In an aspect, a phosphorus moiety comprises a mono-, di-, or tri -phosphate, or phosphorothioate. [0157] The term “portion” may mean a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In an aspect, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In an aspect, a portion is a defined number of contiguous nucleobases of an oligomeric compound
[0158] The term “prevent” may refer to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent may also mean reducing the risk of developing a disease, disorder, or condition.
[0159] The term “prodrug” may mean a form of a compound which, when administered to an individual, is metabolized to another form. In an aspect, the metabolized form is the active, or more active, form of the compound (e.g., drug).
[0160] The term “prophylactically effective amount” may refer to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
[0161] The term “RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).
[0162] The term “region” may be defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
[0163] The term ribonucleotide” may mean a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide.
[0164] The term “RNAi compound” may mean an oligomeric compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. The term RNAi compound excludes antisense oligonucleotides that act through RNase H.
[0165] The term “segment” may refer to a smaller or sub-portion of region within an antisense compound, an oligonucleotide, or a target nucleic acid.
[0166] The term “side effects” may mean physiological disease and/or conditions attributable to a treatment other than the desired effects. In an aspect, side effects may include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.
[0167] The term “single-stranded” in reference to an antisense compound or oligomeric compound may mean there is one oligonucleotide in the compound.
[0168] The term “self-complementary” in reference to an antisense compound or oligomeric compound may mean a compound that at least partially hybridizes to itself. A compound consisting of one antisense or oligomeric compound, wherein the oligonucleotide of the compound is self-complementary, is a single- stranded compound. A single-stranded antisense or oligomeric compound can be capable of binding to a complementary compound to form a duplex. [0169] The term “sites” may refer to unique nucleobase positions within a target nucleic acid(e.g., target site).
[0170] The term “slows progression” means decrease in the development of the said disease.
[0171] The term “specifically hybridizable” may refer to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. [0172] The term “specifically inhibit” a target nucleic acid may refer to reducing or blocking expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids reduction and does not necessarily indicate a total elimination of the target nucleic acid's expression.
[0173] The term “sugar moiety” may mean a group of atoms that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group. In an aspect, a sugar moiety is attached to a nucleobase to form a nucleoside. The term “unmodified sugar moiety” or “unmodified sugar” may mean a 2'-0H(H) furanosyl moiety, as found in RNA, or a 2'-H(H) moiety, as found in DNA. Unmodified sugar moieties have one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. The terms “modified sugar moiety” or “modified sugar” may mean a furanosyl moiety comprising a non-hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety, or a sugar surrogate. In an aspect, a modified sugar moiety is a 2 '-substituted sugar moiety. Such modified sugar moieties include bicyclic sugars and linearly modified sugars.
[0174] The term “sugar surrogate” may mean a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide. In an aspect, such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.
[0175] The term “synergy” or “synergize” may refer to an effect of a combination that is greater than additive of the effects of each component alone.
[0176] The term “target gene” may refer to a gene encoding a target.
[0177] The terms “target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” may mean a nucleic acid capable of being targeted by silencing oligonucleotides (e.g., antisense oligos or siRNA) or a gene editing systems.
[0178] The term “targeting” may mean the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
[0179] The term “target region” may mean a portion of a target nucleic acid to which one or more antisense compounds is targeted.
[0180] The term “target segment” may mean the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5' target site” refers to the 5 '-most nucleotide of a target segment. “3' target site” refers to the 3 '-most nucleotide of a target segment.
[0181] The term “terminal group” may mean a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
[0182] The term “therapeutically effective amount” may mean an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.
[0183] The term “treat” may refer to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
[0184] The term “unmodified”, such as when describing nucleobases or nucleotides, may mean that the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U), which do not comprise any chemical modification.
[0185] The term “unmodified nucleotide” may mean a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In an aspect, an unmodified nucleotide may be an RNA nucleotide (i.e., P-D-ribonucleotides) or a DNA nucleotide (i.e. [3-D- deoxy rib onucl eoti de) .
[0186] The term “codon optimization” can refer to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing one or more codons or more of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. As contemplated herein, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database.” Many methods and software tools for codon optimization have been reported previously. (See, for example, genomes.urv.es/OPTIMIZER/).
[0187] The phrase “identified to be in need of treatment,” or the like, may refer to selection of a subject based upon need for treatment of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). For example, a subject can be identified as having a need for treatment based upon an earlier diagnosis by a person of skill and thereafter subjected to treatment for a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). In an aspect, the identification can be performed by a person different from the person making the diagnosis. In an aspect, the administration can be performed by one who performed the diagnosis.
[0188] The term “oligonucleotides” and similar terms relate to short oligos composed of naturally occurring nucleotides as well as to oligos composed of synthetic or modified nucleotides, as described in the preceding section on RNAi and siRNA. The terms “polynucleotide” and “oligonucleotide” are used synonymously.
[0189] The terms “inhibit,” “inhibiting”, and “inhibition” may mean to diminish or decrease an activity, level, response, condition, severity, disease, or other biological parameter. In an aspect, “inhibiting” can refer to diminishing the intensity, the duration, the amount, or a combination thereof of symptoms, complications, issues due to a subject’s lysine catabolism dysfunction and/or malfunction (such as GA-1). This can include, but is not limited to, the complete ablation of the activity, level, response, condition, severity, disease, or other biological parameter. This can also include, for example, a 10% inhibition or reduction in the activity, level, response, condition, severity, disease, or other biological parameter as compared to the native or control level (e.g., a subject not having a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)) or to the level prior to the onset of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). Thus, in an aspect, the inhibition or reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of reduction in between as compared to native or control levels or to the subject’s level prior to the onset of lysine catabolism dysfunction and/or malfunction. In an aspect, the inhibition or reduction can be 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% as compared to native or control levels or to the subject’s level prior to the onset of lysine catabolism dysfunction and/or malfunction (such as GA-1). In an aspect, the inhibition or reduction can be 0-25%, 25-50%, 50-75%, or 75-100% as compared to native or control levels or to the subject’s level prior to the onset of lysine catabolism dysfunction and/or malfunction (such as GA-1).
[0190] The words “treat” or “treating” or “treatment” may include palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1); preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1); and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). In an aspect, the terms cover any treatment of a subject, including a mammal e.g., a human), and includes: (i) preventing the undesired physiological change and/or pathological condition from occurring in a subject that can
be predisposed to a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1) but has not yet been diagnosed as having it; (ii) inhibiting the physiological change and/or pathological condition (a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)); or (iii) relieving the physiological change and/or pathological condition, z.e., causing regression of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). For example, in an aspect, treating a disease or disorder can reduce the severity of an established a disease or disorder in a subject by 1%-100% as compared to a control (such as, for example, an individual not having a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)). In an aspect, treating can refer to a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of a disease or a disorder or a condition (such as a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)). For example, treating a disease or a disorder can reduce one or more symptoms of a disease or disorder in a subject by 1%-100% as compared to a control (such as, for example, an individual not having a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)). In an aspect, treating can refer to 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% reduction of one or more symptoms of an established a disease or a disorder or a condition (e.g., lysine catabolism dysfunction and/or malfunction (such as GA-1)). It is understood that treatment does not necessarily refer to a cure or complete ablation or eradication of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). However, in an aspect, treatment can refer to a cure or complete ablation or eradication of a disease or a disorder or a condition (such as lysine catabolism dysfunction and/or malfunction (such as GA-1)).
[0191] The term the term “prevent” or “preventing” or “prevention” may refer to to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit, or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed. In an aspect, preventing lysine catabolism dysfunction and/or malfunction (such as GA-1) or the worsening of lysine catabolism dysfunction and/or malfunction (such as GA-1) is intended. The words “prevent” and “preventing” and “prevention” also refer to prophylactic or preventative measures for protecting or precluding a subject (e.g., an individual) not having lysine catabolism dysfunction and/or malfunction (such as GA-1) related complication from progressing to that complication.
[0192] The term “operably linked” may mean that expression of a gene or a transgene is under the control of a promoter with which it is spatially connected. A promoter can be positioned 5’ (upstream) or 3 ’ (downstream) of a gene under its control. The distance between the promoter and a gene can be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance can be accommodated without loss of promoter function.
[0193] The term an “enhancer” such as a transcription or transcriptional enhancer may refer to regulatory DNA segment that is typically found in multicellular eukaryotes. An enhancer can strongly stimulate (“enhance”) the transcription of a linked transcription unit, z.e., it acts in cis. An enhancer can activate transcription over very long distances of many thousand base pairs, and from a position upstream or downstream of the site of transcription initiation. An enhancer can have a modular structure by being composed of multiple binding sites for transcriptional activator proteins. Many enhancers control gene expression in a cell type-specific fashion. Several remote enhancers can control the expression of a singular gene while a singular enhance can stimulate the transcription of one or more genes.
[0194] The term “expression cassette” or “transgene cassette” can refer to a distinct component of vector DNA comprising a transgene and one or more regulatory sequences to be expressed by a transfected cell. Generally, an expression cassette or transgene cassette can comprise a promoter sequence, an open reading frame (i.e., the transgene), and a 3’ untranslated region (e.g., in eukaryotes a polyadenylation site).
[0195] The term “promoter” or “promoters” are known to the art. Depending on the level and tissue-specific expression desired, a variety of promoter elements can be used. A promoter can be tissue-specific or ubiquitous and can be constitutive or inducible, depending on the pattern of the gene expression desired. A promoter can be native (endogenous) or foreign (exogenous) and can be a natural or a synthetic sequence. By foreign or exogenous, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced. Bacteriophage promoters are used for in vitro transcription such as T7, SP6 and T3 RNA polymerases, but are not used in cells
[0196] “Tissue-specific promoters” are known to the art and include, but are not limited to, neuron-specific promoters, muscle-specific promoters, liver-specific promoters, skeletal musclespecific promoters, and heart-specific promoters.
[0197] “Liver-specific promoters” are known to the art and include, but are not limited to, the thyroxin binding globulin (TBG) promoter, the al-microglobulin/bikunin enhancer/thyroid hormone-binding globulin promoter, the human albumin (hALB) promoter, the thyroid hormone-
binding globulin promoter, the a- 1 -anti -trypsin promoter, the bovine albumin (bAlb) promoter, the murine albumin (mAlb) promoter, the human al -antitrypsin (hAAT) promoter, the ApoEhAAT promoter comprising the ApoE enhancer and the hAAT promoter, the transthyretin (TTR) promoter, the liver fatty acid binding protein promoter, the hepatitis B virus (HBV) promoter, the DC 172 promoter comprising the hAAT promoter and the al -microglobulin enhancer, the DC 190 promoter comprising the human albumin promoter and the prothrombin enhancer, or any other natural or synthetic liver-specific promoter.
[0198] In an aspect, a disclosed liver-specific promoter can comprise any liver-specific promoter known to the art. In an aspect, a liver specific promoter can comprise about 845-bp and comprise the thyroid hormone-binding globulin promoter sequences (2382 to 13), two copies of al- microglobulinybikunin enhancer sequences (22,804 through 22,704), and a 71 -bp leader sequence (Ill CR, et al. (1997) Blood Coagul Fibrinolysis. 8 Suppl 2:S23-S30).
[0199] The term the terms “administering” and “administration” may refer to any method of providing one or more of the disclosed compositions (such as, for example, a disclosed viral vector). Such methods are well-known to those skilled in the art and include, but are not limited to, the following: oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, in utero administration, intrahepatic administration, intravaginal administration, epidural administration (such as epidural injection), intracerebroventricular (ICV) administration, ophthalmic administration, intraaural administration, depot administration, topical (skin) administration, otic administration, intraarticular (such as joint or vertebrate injection), intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-CSF administration, intra-cistem magna (ICM) administration, intra-arterial administration, intrathecal (ITH) administration, intramuscular administration, and subcutaneous administration. Administration of a disclosed composition, a disclosed viral vector, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, a disclosed immune modulator, a disclosed proteasome inhibitor, a disclosed small molecule, a disclosed endonuclease, a disclosed oligonucleotide, and/or a disclosed RNA therapeutic can comprise administration directly into the CNS or the PNS.
[0200] The term “administration” or “administering” may refer to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
[0201] Administration can be continuous or intermittent. Administration can comprise a combination of one or more route. In an aspect, a disclosed composition, a disclosed viral vector, a disclosed pharmaceutical formulation, or any combination thereof can be concurrently and/or serially administered to a subject via multiple routes of administration. For example, in an aspect, administering a disclosed composition, a disclosed viral vector, a disclosed pharmaceutical formulation, or any combination thereof can comprise intravenous administration and intra-cistem magna (ICM) administration. In an aspect, administering a disclosed composition, a disclosed viral vector, a disclosed pharmaceutical formulation, or any combination thereof can comprise IV administration and intrathecal (ITH) administration. Various combinations of administration are known to the art. “Administered concomitantly” or “co-administration” may mean administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.
[0202] The term “immune modulator” refers to an agent that is capable of adjusting a given immune response to a desired level (e.g., as in immunopotentiation, immunosuppression, or induction of immunologic tolerance). Examples of immune modulators include but are not limited to, a disclosed immune modulator can comprise aspirin, azathioprine, belimumab, betamethasone dipropionate, betamethasone valerate, bortezomib, bredinin, cy azathioprine, cyclophosphamide, cyclosporine, deoxyspergualin, didemnin B, fluocinolone acetonide, folinic acid, ibuprofen, IL6 inhibitors (such as sarilumab) indomethacin, inebilizumab, intravenous gamma globulin (IVIG), methotrexate, methylprednisolone, mycophenolate mofetil, naproxen, prednisolone, prednisone, prednisolone indomethacin, rapamycin, rituximab, sirolimus, sulindac, synthetic vaccine particles containing rapamycin (SVP -Rapamycin or ImmTOR), thalidomide, tocilizumab, tolmetin, triamcinolone acetonide, anti-CD3 antibodies, anti-CD4 antibodies, anti-CD19 antibodies, anti- CD20 antibodies, anti-CD22 antibodies, anti-CD40 antibodies, anti-FcRN antibodies, anti-IL6 antibodies, anti-IGFIR antibodies, an IL2 mutein, a BTK inhibitor, or a combination thereof. In an aspect, a disclosed immune modulator can comprise one or more Treg (regulatory T cells) infusions (e.g., antigen specific Treg cells to AAV).
[0203] By “determining the amount” can mean both an absolute quantification of a particular analyte (e.g., a toxic catabolite) or a determination of the relative abundance of a particular analyte
(e.g., a toxic catabolite). The phrase includes both direct or indirect measurements of abundance or both. In an aspect, determining the amount can refer to measuring the expression of GCDH.
[0204] The term “modifying the method” can comprise modifying or changing one or more features or aspects of one or more steps of a disclosed method. In an aspect, a method can be altered by changing the amount of one or more of the disclosed compositions (e.g., a disclosed viral vector) used in a disclosed method, or by changing the frequency of administration of one or more disclosed compositions (e.g., a disclosed viral vector) in a disclosed method, by changing the duration of time that one or more disclosed compositions (e.g., a disclosed viral vector) is administered in a disclosed method, orby substituting for one ormore of the disclosed components and/or reagents with a similar or equivalent component and/or reagent.
[0205] The term “concurrently” may mean (1) simultaneously in time, or (2) at different times during a common treatment schedule.
[0206] In an aspect, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect, “CpG-free” can mean “CpG-depleted”. In an aspect, “CpG-depleted” can mean “CpG- free”. In an aspect, “CpG-depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect, “CpG-free” can mean “CpG-optimized” for a desired and/or ideal expression level. CpG depletion and/or optimization is known to the skilled person in the art.
[0207] The term “contacting” can refer to bringing one or more of the disclosed compositions (e.g., a disclosed viral vector) together with a target area or intended target area (e.g., a population of cells) in such a manner that the disclosed compositions can exert an effect on the intended target or targeted area either directly or indirectly. A target area or intended target area can be one or more cells (e.g., brain cells, liver cells, or both) and/or one or more tissues having toxic catabolite build-up (e.g., the brain, the liver, or both), or any combination thereof. In an aspect, a target area or intended target area can be any cell or any organ infected by a disease or disorder (such as GA- 1). In an aspect, a target area or intended target area can be any organ, tissue, or cells that are affected by a disease or disorder characterized by lysine metabolic dysfunction.
[0208] The term “determining” can refer to measuring or ascertaining the presence and severity of a disease or disorder, such as, for example, characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). “Determining” can refer to measuring or ascertaining an expression level of a protein or gene of interest. “Determining” can refer to measuring or ascertaining the reprogramming of a metabolic pathway. “Determining” can refer to ascertaining or measuring some type of neurologic, physiologic, and/or metabolic function and/or response.
[0209] Methods and techniques used to determine the presence and/or severity of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1) are
typically known to the medical arts. For example, the art is familiar with the ways to identify and/or diagnose the presence, severity, or both of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). Methods can be based on objective and/or subjective means.
[0210] The term “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired result such as, for example, the treatment and/or prevention of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). The term the terms “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired an effect on an undesired condition (e.g., a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1)). For example, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects.
[0211] In an aspect, “therapeutically effective amount” can mean an amount of the disclosed composition that (i) treats a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1), (ii) attenuates, ameliorates, or eliminates one or more symptoms associated with a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1), or (iii) delays the onset of one or more symptoms of a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1). The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1) being treated; the disclosed compositions employed; the disclosed methods employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the disclosed compositions employed; the duration of the treatment; drugs used in combination or coincidental with the disclosed compositions employed, and other like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the disclosed compositions at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, then the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, a single dose of the disclosed compositions, disclosed viral vectors, disclosed pharmaceutical formulations, disclosed therapeutic agents, or a combination thereof can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose
administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a sign or symptom associated with a disease or disorder characterized by lysine catabolism dysfunction and/or malfunction (such as GA-1).
[0212] The term the term “package insert” can refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, contraindications and/or warnings concerning the use of such therapeutic products.
[0213] Disclosed are the components to be used to prepare the disclosed compositions, disclosed viral vectors, disclosed pharmaceutical formulations, disclosed therapeutic agents, or a combination thereof used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds cannot be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed and a number of modifications that can be made to a number of molecules including the compounds are discussed, specifically contemplated is each and every combination and permutation of the compound and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B- F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the compositions of the invention. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the methods of the invention.
Glutaric Aciduria Type-1 (GA-1).
[0214] Glutaric aciduria type-1 (GA-1) is a cerebral organic aciduria with neurometabolic features due to Glutaryl-CoA dehydrogenase (GCDH) deficiency. It is an autosomal recessive inborn error of lysine (primarily) and tryptophan metabolism with a worldwide prevalence estimated to be between 1 :30,000 to 1 : 100,000 live births. (Lindner M, et al. (2006) J Inherit Metab Dis. 29:378-
382; Kolker S, et al. (2006) Pediatr Res. 59:840-847). GCDH catalyzes mitochondrial oxidative decarboxylation of glutaryl-CoA into crotonyl CoA and CO2 in the L-lysine (Fig.l), L- hydroxylysine and L-tryptophan catabolic pathway. Mutations in the GCDH gene cause characteristic clinical and biochemical phenotypes. The clinical phenotype is neurologic, characterized by macrocephaly at birth, subdural hematomas and acute retinal hemorrhage. During infancy and early childhood, patients with GA-1 are at risk of acute encephalopathic crises triggered by intercurrent illness, fever or fasting; damaging the brain striatum. Infantile acute striatal necrosis is the hallmark of GA-1 and the primary cause of morbidity and mortality leading to dystonia, and multisystem complications. Putamin injury is associated with motor and behavioral regression. Brain imaging shows selective regional (basal ganglia) findings that are symmetric and irreversible. (Strauss KA, et al. (2003) Am J Med Genet C Semin Med Genet. 121 C(l):38-52). Some patients have an insidious onset disease presentation not associated with acute crises. These patients usually present later in life with late-onset neurologic disease (Kolker S, et al. (2006) Pediatr Res. 59:840-847). As an extracerebral manifestation an increased frequency of chronic renal failure in adults has been reported. (Boy N, et al. (2017) J Inherit Metab Dis 40: 75-101).
[0215] The biochemical phenotype is diagnostic in high GA-1 excretors showing elevated 3- hydroxyglutaric acid (neurotoxic), and glutaric acid in urine organic acids and elevated glutarylcamitine (C5DC) in blood, the latter being the biomarker detected on newborn screening (NBS). These catabolites are also elevated in the blood, urine, CSF, and in liver, kidney, and brain tissues. In patients characterized as low excretors, biochemical studies may not be diagnostic, and in that case, GCDH mutation testing may help provide the diagnosis. (Lindner M, et al. (2006) J Inherit Metab Dis. 29:378-382). Early diagnosis and treatment following NBS often has led to more favorable outcomes when compliant with treatment plans. The standard of care treatment in GA-1, aims at reducing lysine; the main offending substrate that feeds into the pathway. This is achieved by restricting protein, mainly exogenous lysine and tryptophan; carnitine supplementation; and intensified emergency therapy with a high caloric glucose infusion to promote anabolism during illness. After the age of 6 years, dietary treatment is less protein restricted with continued metabolic supervision and follow up. There is no specific targeted therapy for GA-1 and untreated or poorly managed individuals with GA-1 develop acute encephalopathic crises during the first 6 years of life leading to poor outcomes and limited response to therapy. (Kolker S, et al. (2006) Pediatr Res. 59:840-847).
Lysine Catabolism.
[0216] Lysine is an essential amino acid necessary for protein synthesis. When lysine is not needed for protein synthesis, it proceeds to degradation via two catabolic pathways. Through saccharopine formation by s-deami nation, or pipecolic acid (PA) formation by a-deamination or transamination. Both pathways lead to formation of Al-piperideine-6-carboxylate (P6C) and its open form a-aminoadipic semialdehyde (AASA), which is then converted to a-aminoadipic acid (AAA) by the AASA dehydrogenase (ALDH7A1).
Saccharopine Pathway.
[0217] The saccharopine pathway in liver mitochondria is the major pathway for degradation of L-lysine into acetyl-CoA. Lysine is first converted into saccharopine, which is subsequently oxidized to AASA. This ultimately leads to generation of acetyl-CoA that enters the tricarboxylic acid cycle. This pathway is key for irreversible catabolism of extra-cerebral lysine. While the liver is the major organ for lysine catabolism, the kidney is involved, as well as the brain to a lesser degree.
The Pipecolate Pathway.
[0218] The pipecolate Pathway in brain peroxisomes is used for breakdown of the fraction of D- lysine that is catabolized in brain peroxisomes. There the a-amino group of lysine is converted to an a-keto function and further metabolized to P6C. During fetal development, the saccharopine pathway prevails in both fetal brain and extracerebral tissues, whereas after birth it maintains a pivotal role in extracerebral lysine catabolism through the liver (mainly), and kidney. Conversely, in adult life, the pipecolate pathway emerges to play the predominant role in brain lysine catabolism with only a minor role in extracerebral tissues.
Clinical Disorders Associated with Lysine Degradation.
[0219] Hyperlysinemia Type 1 is an autosomal recessive condition due to an isolated mutation in the LKR subdomain of the AASS gene or mutations causing loss of function of both the LKR and saccharopine dehydrogenase (SDH) domains of the AASS gene. The condition is usually asymptomatic, with benign hyperlysinemia without neurological sequelae.
[0220] Hyperlysinemia Type 2 is also known as saccharopinuria and is due to a deficiency of the SDH domain of AAS. This is a rare recessive inborn error of lysine metabolism associated with mutation of the AASS-SDH subdomain (with preserved LKR function). Clinically, patients with this disorder show signs of developmental delay, cognitive impairment, and spastic diplegia; biochemically, the condition is characterized by both hyperlysinemia and saccharopinuria. Saccharopinuria is due to mutation of the AASS-SDH subdomain and is associated with mitochondrial toxicity.
[0221] Pyridoxine dependent epilepsy is an autosomal recessive disorder caused by mutations in ALDH7A1 an enzyme central to the lysine degradation pathways. Accumulation of high levels of the ALDH7A1 substrate AASA, and its cyclic form P6C is considered diagnostic markers in blood, urine, and CSF. Pipecolate elevations in body fluids can be observed but is not a reliable biomarker. Accumulation of AASA leads to depletion of pyridoxal phosphate, an essential coenzyme derived from vitamin B6. Patients with PDE present early in life with neonatal intractable seizures which are responsive to high doses of pyridoxine.
Gene Editing Systems and Components.
[0222] Many gene editing system rely on at least two main components, which are a targeting component (e.g., a nucleic acid sequence that recognizes a target sequence, for example a guide molecule or antisense molecule) and a protein or enzyme (e.g., a nuclease or gene editor). However some gene editing systems such as zinc-finger nucleases, TALENS and meganucleases have only one protein component
[0223] In an aspect, a gene editing system disclosed herein (e.g., as encoded by a nucleic acid as described herein) may comprise a CRISPR gene editing system, optionally selected from a CRISPR-Cas or CRISPR-KRAB gene editing system. In an aspect, a gene editing system disclosed herein may comprise a prime editing system. In an aspect, a gene editing system disclosed herein may comprise a prime editing system. In an aspect, a gene editing system disclosed herein may comprise abase editing system. In an aspect, agene editing system disclosed herein may comprise a zinc-finger nuclease gene editing system. In an aspect, a gene editing system disclosed herein may comprise a TALEN gene editing system. In an aspect, a gene editing system disclosed herein may comprise an ARCUS nuclease gene editing system. In an aspect, a gene editing system disclosed herein may comprise a meganuclease gene editing system. In an aspect, a gene editing system disclosed herein may comprise a recombinase gene editing system, optionally selected from a Cre recombinase or FLP tyrosine recombinase gene editing system. In an aspect, a gene editing system disclosed herein may comprise a transposase gene editing system, optionally selected from a Sleeping Beauty (SB) transposase or ISY100 transposase gene editing system. In an aspect, a gene editing system disclosed herein may comprise an integrase gene editing system, optionally selected from a Streptomyces phage C31 integrase gene editing system. In an aspect, a gene editing system disclosed herein may comprise a homologous recombination gene editing system, optionally selected from small fragment homologous replacement editing system.
[0224] A CRISPR-Cas system relies on two main components for these purposes: a guide RNA (gRNA) and CRISPR-associated (Cas) nuclease. The guide RNA is a specific RNA sequence that
recognizes the target DNA region of interest and directs the Cas nuclease there for editing. A gRNA may comprise two parts: crispr RNA (crRNA), a 17-20 nucleotide sequence complementary to the target DNA, and a tracr RNA, which serves as a binding scaffold for the Cas nuclease. The gRNA may comprise additional parts that contribute functionality to the gene editing sstem. The CRISPR-associated protein or enzyme is a non-specific endonuclease. It is directed to the specific DNA locus by a gRNA, where it makes a double-strand break.
[0225] CRISPR systems (e.g., CRISPR-Cas systems) are adaptive defense systems originally discovered in bacteria and archaea. CRISPR-Cas systems use RNA-guided nucleases termed CRISPR-associated or “Cas” endonucleases (e.g., Cas9 or Cpfl) to cleave foreign DNA. In a typical CRISPR-Cas system, an endonuclease is directed to a target nucleotide sequence (e.g., a site in the genome that is to be sequence-edited) by sequence-specific, non-coding “guide RNAs” that target single- or double-stranded DNA sequences. Three classes of CRISPR-CAS systems have been identified (e.g., classes I, II, and III). Six types of CRISPR-CAS systems have been identified (e.g., type I, II, III, IV, V, and VI). Seven subtypes of CRISPR-CAS systems have been identified (e.g., subtypes A, B, C, D, E, F, and U). Any class, type, or subytpe of CRISPR-Cas is contempletated for as an aspect of the invention. The class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). One class II CRISPR system includes a type II Cas endonuclease such as Cas9, a CRISPR RNA (“crRNA”), and a trans-activating crRNA (“tracrRNA”). The crRNA contains a “guide RNA”, typically about 20-nucleotide RNA sequence that corresponds to a target DNA sequence. The crRNA also contains a region that binds to the tracrRNA to form a partially double-stranded structure which is cleaved by RNase III, resulting in a crRNA/tracrRNA hybrid. The crRNA/tracrRNA hybrid then directs the Cas9 endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence must generally be adjacent to a “protospacer adjacent motif’ (“PAM”) that is specific for a given Cas endonuclease; however, PAM sequences appear throughout a given genome. For example, some CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; examples of PAM sequences include 5’-NGG (Streptococcus pyogenes), 5’- NNAGAA (Streptococcus thermophilus CRISPR1), 5’-NGGNG (Streptococcus thermophilus CRISPR3), and 5’-NNNGATT (Neisseria meningiditis). In an aspect, a SpCas9 (3’NGG - PAM sequence) can comprise SpCas9 VQR (3’NGAN or 3’NGNG), SpCas9 EQR (3’NGAG), or SpCas9 VRER (3’NGCG).
[0226] The term “CRISPR or clustered regularly interspaced short palindromic repeat” is an ideal tool for correction of genetic abnormalities as the system can be designed to target genomic DNA directly. A CRISPR system involves two main components - a Cas9 enzyme and a guide (gRNA).
The gRNA contains a targeting sequence for DNA binding and a scaffold sequence for Cas9 binding. Cas9 nuclease is often used to “knockout” target genes hence it can be applied for deletion or suppression of genes involved in metabolism. Similar to ASOs and siRNAs, CRISPR offers a great flexibility in targeting any gene of interest hence, potential CRISPR based therapies can be designed based on the genetic mutation in individual patients. An advantage of CRISPR is its ability to completely ablate the expression of disease genes which can only be suppressed partially by RNA interference methods with ASOs or siRNAs. Furthermore, multiple gRNAs can be employed to suppress or activate multiple genes simultaneously, hence increasing the treatment efficacy and reducing resistance potentially caused by new mutations in the target genes. In an aspect, a disclosed sgRNA can be directed at any functional domain of a target sequence.
[0227] The term “CRISPR-based endonucleases” may include RNA-guided endonucleases that comprise at least one nuclease domain and at least one domain that interacts with a guide RNA. As known to the art, a guide RNA directs the CRISPR-based endonucleases to a targeted site in a nucleic acid at which site the CRISPR-based endonucleases cleaves at least one strand of the targeted nucleic acid sequence. As the guide RNA provides the specificity for the targeted cleavage, the CRISPR-based endonuclease is universal and can be used with different guide RNAs to cleave different target nucleic acid sequences. CRISPR-based endonucleases are RNA-guided endonucleases derived from CRISPR/Cas systems. Bacteria and archaea have evolved an RNA- based adaptive immune system that uses CRISPR (clustered regularly interspersed short palindromic repeat) and Cas (CRISPR-associated) proteins to detect and destroy invading viruses or plasmids. CRISPR/Cas endonucleases can be programmed to introduce targeted site-specific double-strand breaks by providing target-specific synthetic guide RNAs (Jinek et al. (2012) Science. 337:816-821).
[0228] In an aspect, a disclosed CRISPR-based endonuclease can be derived from a CRISPR/Cas type I, type II, or type III system; or a subtype A, subtype B, subtype C, subtype D, subtype E, subtype F, or subtype U system. Non-limiting examples of suitable CRISPR/Cas proteins include Cascade, Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, CaslO, CaslOd, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl3a (C2c2), Casl3b(C2c4), Casl3c (C2c7), Casl3d, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or Cas A), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, Cul966, FnCas9, NmCas9, SaCas9, or SpCas9. [0229] In an aspect, a disclosed CRISPR-based endonuclease can be derived from a type II CRISPR/Cas system. For example, in an aspect, a CRISPR-based endonuclease can be derived
from a Cas9 protein. The Cas9 protein can be from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina. In an aspect, the CRISPR-based nuclease can be derived from a Cas9 protein from Staphylococcus Aureus or Streptococcus pyogenes.
[0230] In general, CRISPR/Cas proteins can comprise at least one RNA recognition and/or RNA binding domain. RNA recognition and/or RNA binding domains can interact with the guide RNA such that the CRISPR/Cas protein is directed to a specific genomic or genomic sequence. CRISPR/Cas proteins can also comprise nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains, as well as other domains.
[0231] The CRISPR-based endonuclease can be a wild type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a fragment of a wild type or modified CRISPR/Cas protein. The CRISPR/Cas protein can be modified to increase nucleic acid binding affinity and/or specificity, alter an enzymatic activity, and/or change another property of the protein. For example, in an aspect, nuclease (i.e., DNase, RNase) domains of the CRISPR/Cas protein can be modified, deleted, or inactivated. A CRISPR/Cas protein can be truncated to remove domains that are not essential for the function of the protein. A CRISPR/Cas protein also can be truncated or modified to optimize the activity of the protein or an effector domain fused with a CRISPR/Cas protein.
[0232] In an aspect, a disclosed CRISPR-based endonuclease can be derived from a wild type Cas9 protein or fragment thereof. In an aspect, a disclosed CRISPR-based endonuclease can be derived from a modified Cas9 protein. For example, the amino acid sequence of a disclosed Cas9
protein can be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, etc.) of the protein. Alternatively, domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild type Cas9 protein.
[0233] As known to the art, once the target gene and Cas nuclease have been selected, the next step is to design the specific guide RNA sequence. Several software tools exist for designing an optimal guide with minimum off-target effects and maximum on-target efficiency. Commercially available software programs include, but are not limited to, Synthego Design Tool, Broad Institute GPP sgRNA Designer, CRISPOR, CHOPCHOP, Off-Spotter, Cas-OFFinder, CRISPR-Era, Benchling CRISPR Guide RNA Design tool, and E-CRISP. The skilled person can use these programs without undue experimentation.
[0234] The term CRISPR-mediated insertion of exon (CRISPIE) is a technique that allows for the nearly error-free insertion of coding sequences with high efficiency. Instead of targeting gene exons, CRISPIE targets introns and inserts a designer donor module, which includes an exon encoding the desired protein sequence and the surrounding intronic sequences. INDELs occurring at the insertion junction within the intronic region of DNA will be spliced out, resulting in very low error rates at the mRNA level (>98% correct). CRISPIE is flexible and broadly compatible with: (1) both N- and C-terminal labeling, (2) proteins with diverse structures and functions, including pre- and post-synaptic proteins and cytoskeletal proteins, (3) all major transfection methods, (4) FPs with diverse colors, and (5) multiple animal species. In part because introns offer ample editing sites to choose from, and because INDELs at the DNA level do not affect the success of editing, a high labeling efficiency (up to 43%) was achieved in cortical neurons of living mice. Importantly, CRISPIE-mediated DNA insertions are erasable. By flanking the donor module with additional designer CRISPR editing sites in the intronic region, the inserted DNA fragment can be erased at a later time. CRISPIE may allow for the routine labeling of proteins at endogenous levels and can be expanded to the insertion of other genetically encoded functional sequences to manipulate protein function. (See Zhong H, et al. (2021) eLife.10:e64911, which is incorporated by reference for its teaching of CRISPIE).
• RNA Interference (RNAi) and Small Interfering RNA (siRNA).
[0235] RNA interference (RNAi) is a sequence-specific RNA degradation process that provides a relatively easy and direct way to knock down, or silence, theoretically any gene. In naturally occurring RNAi, a double-stranded RNA (dsRNA) is cleaved by an RNase I II/hel i case protein, Dicer, into small interfering RNA (siRNA) molecules, a dsRNA of 19-27 nucleotides (nt) with 2- nt overhangs at the 3' ends. These siRNAs are incorporated into a multi component-ribonucl ease
called RNA-induced silencing complex (RISC). One strand of siRNA remains associated with RISC and guides the complex toward a cognate RNA that has sequence complementary to the guider ss-siRNA in RISC. This siRNA-directed endonuclease digests the RNA, thereby inactivating it. Recent studies have revealed that chemically synthesized 21 -27-nt siRNAs exhibit RNAi effects in mammalian cells, and the thermodynamic stability of siRNA hybridization (at terminals or in the middle) plays a central role in determining the molecule's function. These and other characteristics of RISC, siRNA molecules, antisense oligonucleotides, and RNAi have been described.
[0236] Applications of RNAi in mammalian cells in the laboratory or, potentially, in therapeutic settings, use either chemically synthesized siRNAs or endogenously expressed molecules. The endogenous siRNA is first expressed as small hairpin RNAs (shRNAs) by an expression vector (plasmid or virus vector) and is then processed by Dicer into siRNAs.
Compositions for Use in the Disclosed Methods
GCDH Nucleic Acid Molecules
[0237] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase (GCDH). Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more functional domains of glutaryl-CoA dehydrogenase. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl- CoA dehydrogenase can be derived from a non-mammalian species or from a mammalian species. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be that of a non-mammalian species or that of a mammalian species.
[0238] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence set forth in SEQ ID NO:01 or in SEQ ID NO:02. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the functional domains of the sequence set forth in SEQ ID NO:01 or in SEQ ID NO:02. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence set forth in SEQ ID NO: 01 or in SEQ ID NO:02.
[0239] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least
about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18.
[0240] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence of Gene ID 2639 or of Gene ID 270076. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence of Gene ID 2639 or the sequence of Gene ID 270076.
[0241] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence of Gene ID 2639 or of Gene ID 270076 or one or more functional domains thereof. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence of Gene ID 2639 or the sequence of Gene ID 270076 or one or more functional domains thereof.
[0242] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence set forth in NCBI Reference Sequence NG 009292 from bases 5001 to 13840 or the sequence set forth in NCBI Reference Sequence NC_000074.7 from bases 85629378 to 85613016. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the sequence set forth in NCBI Reference Sequence NG_009292 from bases 5001 to 13840 or the sequence set forth in NCBI Reference Sequence NC_000074.7 from bases 85629378 to 85613016. [0243] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof. The techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof are known to the skilled person.
[0244] The GCDH may be a variant GCDH sequence comprising one or more substitutions selected from K163R, K240R, K202R, OR K371R; the substitutions K163R and K240R; the substitutions K202R and K371R; or the substitutions selected K163R, K202R, K240R, and
K371R. The GCDH may comprise or consist of the amino acid sequence set forth in any one of SEQ ID NOS:3, SEQ ID NO:200, SEQ ID NO:201, or SEQ ID NO:202. A nucleic acid sequence encoding the variant GCDH sequence may comprise the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, or SEQ ID NO: 196, or a variant thereof
[0245] In an aspect, a disclosed isolated nucleic acid molecule can be codon-optimized for expression in a mammalian cell or a human cell. In an aspect, a disclosed isolated nucleic acid molecule can be CpG-free or CpG-depleted. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be codon-optimized for expression in a mammalian cell or a human cell. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be CpG-free or CpG-depleted.
[0246] In an aspect, a disclosed isolated nucleic acid molecule can further comprise a nucleic acid sequence encoding a carb oxy -terminal fluorescent label and/or fluorescent tag, an amino-terminal fluorescent label and/or fluorescent tag, or a combination thereof.
[0247] In an aspect, a disclosed fluorescent label and/or fluorescent tag can comprise green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof. Fluorophores and fluorescent labels are known in the art.
[0248] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can restore the functionality of a missing, dysfunctional, and/or mutated glutaryl-CoA dehydrogenase in a cell or a subject. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl- CoA to crotonyl-CoA, (v) can improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) can improve memory function of a subject, (vii) can reduce anxiety in a subject, (viii) can reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) can improve and/or reduce and/or eliminate vascular dysfunction in a subject, (x) can improve a subject’s quality of life, (xi) can increase and/or prolong a subject’s life span, (xii) can increase a subject’s survivability, or (xiii) any combination thereof.
[0249] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis in the subject’s liver, (iii) can reduce or decrease the level of toxic catabolites
in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
[0250] In an aspect, a disclosed isolated nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can treat and/or prevent Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed isolated nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed isolated nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
[0251] In an aspect, a disclosed isolated nucleic acid molecule can comprise the nucleic acid sequence for one or more regulatory elements. In an aspect, a disclosed regulatory element can comprise a promoter, an enhancer, an internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly- U sequences), or any combination thereof. Regulatory elements can include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences such as brain cells or neurons).
[0252] In an aspect, a disclosed isolated nucleic acid molecule can comprise a promoter operably linked to a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase. In an aspect, a disclosed promoter can comprise a tissue specific promoter. In an aspect, a disclosed tissue specific promoter can comprise a neuron-specific promoter, a muscle-specific promoter, a liverspecific promoter, a skeletal muscle-specific promoter, and heart-specific promoter. In an aspect, a disclosed tissue-specific promoter can comprise a brain cell specific promoter. Brain cell specific promoter are known to the art and can comprise a synapsin 1 (Synl) promoter, a calmodulin/calcium dependent kinase II (CAMKII) promoter, a glial fibrillary acidic protein (GFAP) promoter, a Rgs5 promoter, a S100 beta promoter, a neuron-specific enolase (NSE) promoter, a Thyl promoter, or any combination thereof. In an aspect, a disclosed promoter can comprise a promoter/enhancer.
[0253] In an aspect, a disclosed promoter can comprise a liver-specific promoter. Liver specific promoters are known to the art. In an aspect, a disclosed liver promoter can comprise the sequence set forth in SEQ ID NO:26. In an aspect, a disclosed promoter can comprise a type III RNA polymerase III promoter. Type III RNA polymerase III promoters are known to the art. In an aspect, a disclosed type III RNA polymerase III promoter can comprise a U6 promoter. In an aspect, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO:27.
[0254] In an aspect, a disclosed isolated nucleic acid molecule can comprise one or more OLLAS tag. In an aspect, a disclosed OLLAS tag can comprise the sequence set forth in SEQ ID NO:31. [0255] In an aspect, a disclosed isolated nucleic acid molecule can comprise a nuclear localization signal (NLS). In an aspect, a disclosed NLS can comprise the sequence set forth in SEQ ID NO:30 or SEQ ID NO:32. NLS are known to the skilled person in the art. In an aspect, a disclosed isolated nucleic acid molecule can comprise one or more inverted terminal repeats (ITRs). In an aspect, the one or more disclosed ITRs can be derived from AAV2 or AAV9. In an aspect, a disclosed ITR can comprise the sequence set forth in any one of SEQ ID NO:22 or SEQ ID NO:23. In an aspect, a disclosed isolated nucleic acid molecule can comprise a polyA sequence. In an aspect, a disclosed polyA sequence can comprise the sequence set forth in SEQ ID NO:24 or SEQ ID NO:25. In an aspect, a disclosed isolated nucleic acid molecule can comprise one or more hemagglutinin (HA) tags. In an aspect, a disclosed HA tag can comprise the sequence set forth in SEQ ID NO:29. In an aspect, a disclosed isolated nucleic acid molecule can comprise a TracrRNA sequence. In an aspect, a TracrRNA sequence can comprise the sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12.
[0256] Disclosed herein is an isolated nucleic acid sequence comprising the sequence set forth in SEQ ID NO: 19 or a fragment thereof. Disclosed herein is an isolated nucleic acid sequence comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more to the sequence set forth in SEQ ID NO: 19 or a fragment thereof.
[0257] In an aspect, a disclosed isolated nucleic acid molecule encoding a disclosed isolated nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be packaged in a viral vector (as discussed infra) or a non-viral vector. In an aspect, a disclosed non-viral vector can be a polymer-based vector, a peptide-based vector, a lipid nanoparticle, a solid lipid nanoparticle, or a cationic lipid-based vector. In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can be packaged in a recombinant AAV viral vector (e.g., AAV8 or AAVcc47).
[0258] In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can be derived from a nonmammalian species or from a mammalian species. In an aspect, a disclosed encoded glutaryl- CoA dehydrogenase can be that of a non-mammalian species or that of a mammalian species.
[0259] In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can comprise the sequence set forth in SEQ ID NO:03 or in SEQ ID NO:04. In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can comprise a sequence having about 50%, about 55%, about 60%, about 65%,
about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more identity to the sequence set forth in SEQ ID NO:03 or in SEQ ID NO:04.
[0260] In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can comprise the sequence of NCBI Reference Sequence NP 000150.1 or the sequence of NCBI Reference Sequence XP_036009971.1. In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can comprise one or more amino acid substitutions, insertions, deletions, modifications, or any combination thereof. The techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof are known to the skilled person.
[0261] In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase (GCDH) can be a variant GCDH comprising one or more amino acid substitutions (e.g., relative to a wild-type GCDH sequence). The wild-type GCDH may be a human sequence. A variant GCDH may comprise one or more substitutions at positions relative to SEQ ID NO:3. A variant GCDH may be a fragment of full-length GCDH, which comprises at least one functional domain. In an aspect, a variant GCDH may comprise one or more substitutions selected from K163R, K240R, K202R, or K371R, wherein amino acid numbering is according to SEQ ID NO:3. In an aspect, a variant GCDH may comprise one or more substitutions selected from K163R, K240R, K202R, or K371R, wherein amino acid numbering is according to SEQ ID NO:3. A variant GCDH may comprise the substitutions K163R and K240R, wherein amino acid numbering is according to SEQ ID NO:3. A variant GCDH may comprise the substitutions K202R and K371R, wherein amino acid numbering is according to SEQ ID NO:3. A variant GCDH may comprise the substitutions K163R, K202R, K240R, and K371R, wherein amino acid numbering is according to SEQ ID NO: 3. In an aspect, a variant GCDH comprises the amino acid sequence set forth in SEQ ID NO:200, SEQ ID NO:201, or SEQ ID NO:202, or a fragment thereof.
[0262] In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199. In an aspect, a disclosed nucleic acid sequence encoding a glutaryl-CoA dehydrogenase can comprise a sequence having about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more identity to the sequence set forth SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199.
[0263] In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) can improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject,
(vi) can improve memory function of a subject, (vii) can reduce anxiety in a subject, (viii) can reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) can improve and/or reduce and/or eliminate vascular dysfunction in a subject, (x) can improve a subject’s quality of life, (xi) can increase and/or prolong a subject’s life span, (xii) can increase a subject’s survivability, or (xiii) any combination thereof.
[0264] In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can treat and/or prevent Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase can improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed encoded glutaryl-CoA dehydrogenase encoding a glutaryl-CoA dehydrogenase can improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
[0265] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding green fluorescent protein (GFP).
[0266] Disclosed herein is an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase operably linked a promoter. Disclosed herein is an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:01 or in SEQ ID NO:02, and is operably linked a promoter.
[0267] Disclosed herein is an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, and is operably linked a promoter.
CRISPR Based Nucleic Acid Molecules
[0268] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. The gene editing system may be a CRISPR-based system, such as that from a bacteria. A CRISPR gene editing system may be a CRISPR-Cas system, such as a Class I or Class II CRISPR-Cas system. A CRISPR gene editing system may be a Type I, Type II, Type III, Type IV, Type V, or a Type VI CRISPR-Cas system. A CRISPR gene editing system may be a Subtype A, Subtype B, Subtype C, Subtype D, Subtype E, Subtype F, or Subtype U CRISPR-Cas system. A CRISPR gene editing system may a Cascade, SpCas9, SaCas9, FnCas9, NmCas9, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl3a (C2c2), Casl3b(C2c4), Casl3c (C2c7), or Casl3d CRISPR-Cas system. It may or may not have
CRISPR effector molecules. For example, the gene editing system may lack an sgRNA or transcriptional repression domains such as KRAB.
[0269] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in a target in the aminoadipatesemialdehyde synthase gene.
[0270] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the a-aminoadipic semialdehyde gene. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the a- aminoadipic semialdehyde gene. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the kynurenine aminotransferase 2 gene. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the dehydrogenase El and transketolase domain-containing protein 1 gene. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the L-lysine alpha-oxidase gene. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the ketimine reductase mu- crystallin protein gene. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the peroxisomal sarcosine oxidase gene. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system,
wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the pyrroline-5 -carboxylate reductase gene.
[0271] In an aspect, a disclosed element of a gene editing system can be a CRISPR-based endonuclease. In an aspect, a disclosed endonuclease can be Cas9. In an aspect, a disclosed Cas9 can be that of Staphylococcus aureus or Streptococcus pyogenes. In an aspect, a disclosed Cas9 can be derived from Staphylococcus aureus or Streptococcus pyogenes. In an aspect, a disclosed Cas9 can be that of or derived from a species other than S. aureus or S. Pyogenes. In an aspect, a disclosed Cas9 can be any known Cas9 (see, e.g., those discussed supra). In an aspect, a disclosed
Cas9 can be any Cas9 analog. Cas9 is well known to the art and the skilled person can identify and employ a Cas9 from one or more species without undue experimentation.
[0272] In an aspect, a disclosed Cas9 can have a sequence having at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the set forth in SEQ ID NO:28 or a fragment thereof. In an aspect, a disclosed Cas9 can comprise one or more amino acid substitutions, insertions, deletions, modifications, or any combination thereof. The techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof into a sequence encoding Cas9 are known to the skilled person.
[0273] In an aspect, a disclosed element of a gene editing system can comprise a sgRNA. The art is familiar with sgRNAs and the skilled person can identify and employ a sgRNA without undue experimentation. In an aspect, a disclosed sgRNA can be directed at any functional domain of a target sequence. In an aspect, a disclosed sgRNA can be directed at a target sequence in the glutaryl-CoA dehydrogenase gene. In an aspect, a disclosed sgRNA can comprise an sgRNA directed at a target sequence in a disclosed mouse glutaryl-CoA dehydrogenase (mGcdh) gene or at a disclosed human glutaryl-CoA dehydrogenase gene. In an aspect, a disclosed mGcdh gene can comprise the sequence set forth in SEQ ID NO: 02. In an aspect, a disclosed hGCDH gene can comprise the sequence set forth in SEQ ID NO:01. In an aspect, a disclosed hGCDH gene can comprise the sequence set forth in SEQ ID NO: 17. In an aspect, a disclosed hGCDH gene can comprise the sequence set forth in SEQ ID NO: 18. In an aspect, a disclosed sgRNA can comprise an sgRNA directed at a target sequence in exon 3 of mouse glutaryl-CoA dehydrogenase
(mGcdh) gene. In an aspect, a disclosed sgRNA directed at a target sequence in exon 3 of mGcdh gene can comprise the sequence set forth in SEQ ID NO: 05. In an aspect, a disclosed sgRNA can comprise an sgRNA directed at a target sequence in exon 5 of mouse glutaryl-CoA dehydrogenase (mGcdh) gene. In an aspect, a disclosed sgRNA directed at a target sequence in exon 5 of mGcdh can comprise the sequence set forth in SEQ ID NO:06.
[0274] In an aspect, a disclosed sgRNA can be directed at aminoadipate-semialdehyde synthase gene. For example, in an aspect, a disclosed aminoadipate-semialdehyde synthase can comprise a human or a mouse aminoadipate-semialdehyde synthase. In an aspect, a disclosed sgRNA can comprise an sgRNA directed at a target sequence in exon 6 of mouse aminoadipate-semialdehyde synthase (mAass) gene. In an aspect, a disclosed sgRNA directed at a target sequence in exon 6 of mAass gene can comprise the sequence set forth in SEQ ID NO:07 or SEQ ID NO:08. In an aspect, a disclosed sgRNA can comprise an sgRNA directed at a target sequence in exon 7 of mouse aminoadipate-semialdehyde synthase (mAass) gene. In an aspect, a disclosed sgRNA directed at a target sequence in exon 7 of mAass gene can comprise the sequence set forth in SEQ ID NO:09 or SEQ ID NO: 10. In an aspect, a disclosed sgRNA can be directed at any functional domain of a target sequence. An sgRNA targeting AASS may target a similar region of AASS as the target sites as described herein for a silencing oligonucleotide, e.g., in the same UTR, exon, or portion there as described herein, if that position also satisfies sgRNA structural requirements (e.g., PAM site proximity).
[0275] In an aspect, a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can be derived from a non-mammalian species or from a mammalian species. In an aspect, a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can be that of a non-mammalian species or that of a mammalian species.
[0276] In an aspect, a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can comprise the sequence set forth in SEQ ID NO: 01 or in SEQ ID NO: 02. In an aspect, a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can comprise a sequence having about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more identity to the sequence set forth in SEQ ID NO: 01 or in SEQ ID NO: 02.
[0277] In an aspect, a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can comprise the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18. In an aspect, a disclosed nucleic acid sequence encoding an aminoadipate-semialdehyde synthase can comprise a sequence having about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more identity to the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18.
[0278] In an aspect, a disclosed encoded aminoadipate-semialdehyde synthase can comprise the sequence of NCBI Reference Sequence NP 000150.1 or the sequence of NCBI Reference Sequence XP_036009971.1.
[0279] In an aspect, a disclosed encoded aminoadipate-semialdehyde synthase can comprise one or more amino acid substitutions, insertions, deletions, modifications, or any combination thereof. The techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof are known to the skilled person.
[0280] In an aspect, a disclosed element of a gene editing system can comprise a TracrRNA. In an aspect, a TracrRNA can be directed a target gene of interest. For example, a TracrRNA can be directed at at a target sequence in human or mouse aminoadipate-semialdehyde synthase gene or at a human or mouse glutaryl-CoA dehydrogenase gene. In an aspect, a disclosed TracrRNA can be directed at a target sequence in exon 6 of Aaas or exon 7 of Aass. In an aspect, a disclosed TracrRNA can comprise the sequence set forth in SEQ ID NO: 11 or in SEQ ID NO: 12.
[0281] In an aspect, a disclosed an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a nucleic acid sequence encoding two ITRs, a first promoter, a sgRNA, a second promoter, and a Cas9. In an aspect, a disclosed first promoter is operably linked to a disclosed sgRNA. In an aspect, a disclosed second promoter is operably linked to a disclosed Cas9.
[0282] In an aspect, a disclosed an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a nucleic acid sequence encoding two ITRs, a promoter, a sgRNA, a TracrRNA, a second promoter, and a Cas9. In an aspect, a disclosed promoter is operably linked to a disclosed sgRNA. In an aspect, a disclosed promoter is operably linked to a disclosed Cas9.
[0283] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof. The techniques to introduce one or more substitutions, insertions, deletions, modifications, or any combination thereof are known to the skilled person. In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can be codon-optimized for expression in a mammalian cell or a human cell. In an aspect, a disclosed isolated nucleic acid molecule can be CpG-free or CpG-depleted.
[0284] In an aspect, a disclosed isolated nucleic acid molecule can further comprise a nucleic acid sequence encoding a carboxy -terminal fluorescent label and/or fluorescent tag, an amino-terminal fluorescent label and/or fluorescent tag, or a combination thereof. In an aspect, a disclosed fluorescent label and/or fluorescent tag can comprise green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry,
miRFP670, any known fluorescent label or tag, or any combination thereof. Fluorophores and fluorescent labels are known in the art.
[0285] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) can improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) can improve memory function of a subject, (vii) can reduce anxiety in a subject, (viii) can reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) can improve and/or reduce and/or eliminate vascular dysfunction in a subject, (x) can improve a subject’s quality of life, (xi) can increase and/or prolong a subject’s life span, (xii) can increase a subject’s survivability, or (xiii) any combination thereof.
[0286] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can treat and/or prevent Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
[0287] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise the nucleic acid sequence for one or more regulatory elements. In an aspect, a disclosed regulatory element can comprise a promoter, an enhancer, an internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), or any combination thereof. Regulatory elements can include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences such as brain cells or neurons).
[0288] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
[0289] In an aspect, a first disclosed promoter can comprise a type III RNA polymerase III promoter. Type III RNA polymerase III promoters are known to the art. In an aspect, a disclosed type III RNA polymerase III promoter can comprise a U6 promoter. In an aspect, a disclosed U6
promoter can comprise the sequence set forth in SEQ ID NO:27. In an aspect, a first disclosed promoter can comprise the sequence set forth in SEQ ID NO:27.
[0290] In an aspect, a first disclosed promoter (e.g., a disclosed U6 promoter) can be operably linked to a disclosed sgRNA (such as, for example, a disclosed sgRNA for mouse or human aminoadipate-semialdehyde synthase). In an aspect, a second disclosed promoter can comprise a liver-specific promoter. Liver specific promoters are known to the art. In an aspect, a disclosed liver promoter can comprise the sequence set forth in SEQ ID NO:26. In an aspect, a second disclosed promoter (e.g., a liver-specific promoter) can be operably linked to a disclosed Cas9 (such as, for example, a disclosed SaCas9).
[0291] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise one or more inverted terminal repeats (ITRs). In an aspect, the one or more disclosed ITRs can be derived from AAV2 or AAV9. In an aspect, a disclosed ITR can comprise the sequence set forth in any one of SEQ ID NO:22 or SEQ ID NO:23. In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a first 5’ ITR and a second 3 ’ ITR.
[0292] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise one or more OLLAS tag. In an aspect, a disclosed OLLAS tag can comprise the sequence set forth in SEQ ID NO:31.
[0293] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a nuclear localization signal (NLS). In an aspect, a disclosed NLS can comprise the sequence set forth in SEQ ID NO:30 or SEQ ID NO:32. NLS are known to the skilled person in the art. In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise a polyA sequence. In an aspect, a disclosed polyA sequence can comprise the sequence set forth in SEQ ID NO:24 or SEQ ID NO:25. In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can comprise one or more hemagglutinin (HA) tags. In an aspect, a disclosed HA tag can comprise the sequence set forth in SEQ ID NO:29.
[0294] In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system can be packaged in a viral vector (as discussed infra) or a non-viral vector. In an aspect, a disclosed non-viral vector can be a polymer- based vector, a peptide-based vector, a lipid nanoparticle, a solid lipid nanoparticle, or a cationic lipid-based vector. In an aspect, a disclosed isolated nucleic acid molecule comprising a nucleic
acid sequence encoding one or more element of a gene editing system can be packaged in a recombinant AAV viral vector (e.g., AAV8 or AAVcc47).
[0295] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:20 or SEQ ID NO:21, or a fragment thereof. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the nucleic acid sequence comprises a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more to the sequence set forth in SEQ ID NO:20 or SEQ ID NO:21, or a fragment thereof.
[0296] Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the nucleic acid molecule is represented by FIG. 10C. Disclosed herein is an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the nucleic acid molecule is represented by FIG. 10D.
[0297] Disclosed herein is an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system operably linked to one or more promoters.
[0298] Disclosed herein is an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the endonuclease is operably linked a promoter and wherein the sgRNA is operably linked to a promoter.
[0299] Disclosed herein is an expression cassette comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in aminoadipate-semialdehyde synthase gene, wherein the endonuclease is operably linked a promoter and wherein the sgRNA is operably linked to a promoter.
Silencing Oligonucleotides
[0300] In an aspect, a nucleic acid as disclosed herein may be silencing oligonucleotide, which may hybridize to a targeted gene (e.g., its mRNA) at a target site, and silences the gene and/or inhibits protein expression or activity. A silencing oligonucleotide may be single stranded, or double stranded. The silencing oligonucleotide may be an siRNA, antisense oligonucleotide, ribozymes, miRNA, shRNA, ssRNA, dsRNA, piRNA, or a 3'UTR of mRNA. A silencing
oligonucleotide can target any part of a gene, to silence the gene and/or inhibit expression or activity.
[0301] In an aspect, a silencing oligonucleotide can target any part of the aminoadipatesemialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
[0302] Disclosed herein is a silencing oligonucleotide that can target any part of the aminoadipatesemialdehyde synthase gene. Disclosed herein is a silencing oligonucleotide that can target any part of the aminoadipate-semialdehyde synthase gene, the sequence of which is set forth in SEQ ID NO:36, or is accessible at the NBCBI Reference NM 005763.4 entitled Homo sapiens aminoadipate-semialdehyde synthase (AASS), mRNA; nuclear gene for mitochondrial product. Nucleotide position numbering of AASS for target sequence identification, as described herein, may be based upon the SEQ ID NO:36, SEQ ID NO:206, or sequence of which is accessible at the NBCBI Reference that a skilled artisan would recognize as for AASS (e.g., human AASS at NCBI Ref.: NM_005763.4). Disclosed herein is is a silencing oligonucleotide that can target any part of an aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
[0303] Disclosed herein is a silencing oligonucleotide that can target any part of an the aminoadipate-semialdehyde synthase sequence comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36. Disclosed herein is a silencing oligonucleotide that can target any part of the aminoadipate-semialdehyde synthase sequence comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
[0304] In an aspect, a targeted part of an AASS sequence can comprise about 15 to about 35 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 20 to about 30 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 20 to about 24 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 21 to about 22 base pairs. In an aspect, a disclosed silencing oligonucleotide effects a complete silencing of the aminoadipate-semialdehyde synthase gene.
[0305] In an aspect, a disclosed silencing oligonucleotide can effect the partial silencing of the a- aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene. In an aspect, a disclosed silencing oligonucleotide can effect the
complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene. In an aspect, a disclosed silencing oligonucleotide can effect the partial silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5 -carboxylate reductase gene in a subject’s liver. In an aspect, a disclosed silencing oligonucleotide can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene in a subject’s liver.
[0306] In an aspect, a targeted part of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene can comprise about 15 to about 35 base pairs. In an aspect, a targeted part of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domaincontaining protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene can comprise about 20 to about 30 base pairs. In an aspect, a targeted part of the a- aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene can comprise about 20 to about 24 base pairs. In an aspect, a targeted part of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene can comprise about 21 to about 22 base pairs.
[0307] In an aspect, a disclosed silencing oligonucleotide can effect the partial silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed silencing oligonucleotide can effect the complete silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed silencing oligonucleotide can effect the partial silencing of the aminoadipate-
semialdehyde synthase gene in a subject’s liver. In an aspect, a disclosed silencing oligonucleotide can effect the complete silencing of the aminoadipate-semialdehyde synthase gene in a subject’s liver.
[0308] A silencing oligonucleotide that targets the aminoadipate-semialdehyde synthase gene can target a target site or sequence within the aminoadipate-semialdehyde synthase gene. The target site or target squence may be within an exon of the aminoadipate-semialdehyde synthase gene, or between two exons (e.g., at an overlap region). A overlap region may be a portion of the the aminoadipate-semialdehyde synthase gene that a silencing oligonucleotide hybridizes with (e.g., targets), where a portion of the hybridization occurs at a first region, and another portion of the hybridization occurs at a second region. Therefore, a silencing oligonucleotide may target and hybridize two regions (e.g., a first region, and and a second region) simultaneously, concurrently, or sequentially. The first and second regions may be adjacent to each other. The silencing oligonucleotide may target a target sequence within the AASS (e.g., AASS gene or AASS mRNA) with the 5’UTR, within exon 1, within exon 2, within exon 3, within exon 4, within exon 5, within exon 6, within exon 7, within exon 8, within exon 9, within exon 10, within exon 11, within exon
12, within exon 13, within exon 14, within exon 15, within exon 16, within exon 17, within exon
18, within exon 19, within exon 20, within exon 21, within exon 22, within exon 23, within exon
24, within exon 24, within exon 25, within the 3’UTR, or within a portion of any one of exons 1-
25 or the 5’UTR or 3 ’UTR of the AASS (e.g., AASS gene or AASS mRNA).
[0309] In an aspect, a silencing oligonucleotide may target an overlap region of the AASS (e.g., AASS gene or AASS mRNA) comprising a portion of a first region of AASS and a portion of a second region of AASS. The portion of the first region of AASS may be within the 5’UTR of AASS and the portion of the second region of AASS may be within exon 1 of AASS. The portion of the first region of AASS may be within exon 1 of AASS and the portion of the second region of AASS may be within exon 2 of AASS. The portion of the first region of AASS may be within exon 2 of AASS and the portion of the second region of AASS may be within exon 3 of AASS. The portion of the first region of AASS may be within exon 3 of AASS and the portion of the second region of AASS may be within exon 4 of AASS. The portion of the first region of AASS may be within exon 4 of AASS and the portion of the second region of AASS may be within exon 5 of AASS. The portion of the first region of AASS may be within exon 5 of AASS and the portion of the second region of AASS may be within exon 6 of AASS. The portion of the first region of AASS may be within exon 6 of AASS and the portion of the second region of AASS may be within exon 7 of AAS. The portion of the first region of AASS may be within exon 7 of AASS and the portion of the second region of AASS may be within exon 8 of AASS. The portion
of the first region of AASS may be within exon 8 of AASS and the portion of the second region of AASS may be within exon 9 of AASS. The portion of the first region of AASS may be within exon 9 of AASS and the portion of the second region of AASS may be within exon 10 of AASS. The portion of the first region of AASS may be within exon 10 of AASS and the portion of the second region of AASS may be within exon 11 of AASS. The portion of the first region of AASS may be within exon 11 of AASS and the portion of the second region of AASS may be within exon 12 of AASS. The portion of the first region of AASS may be within exon 12 of AASS and the portion of the second region of AASS may be within exon 13 of AASS. The portion of the first region of AASS may be within exon 13 of AASS and the portion of the second region of AASS may be within exon 14 of AASS. The portion of the first region of AASS may be within exon 14 of AASS and the portion of the second region of AASS may be within exon 15 of AASS. The portion of the first region of AASS may be within exon 15 of AASS and the portion of the second region of AASS may be within exon 16 of AASS. The portion of the first region of AASS may be within exon 16 of AASS and the portion of the second region of AASS may be within exon 17 of AASS. The portion of the first region of AASS may be within exon 17 of AASS and the portion of the second region of AASS may be within exon 18 of AASS. The portion of the first region of AASS may be within exon 18 of AASS and the portion of the second region of AASS may be within exon 19 of AASS. The portion of the first region of AASS may be within exon 19 of AASS and the portion of the second region of AASS may be within exon 20 of AASS. The portion of the first region of AASS may be within exon 20 of AASS and the portion of the second region of AASS may be within exon 21 of AASS. The portion of the first region of AASS may be within exon 21 of AASS and the portion of the second region of AASS may be within exon 22 of AASS. The portion of the first region of AASS may be within exon 22 of AASS and the portion of the second region of AASS may be within exon 23 of AASS. The portion of the first region of AASS may be within exon 23 of AASS and the portion of the second region of AASS may be within exon 24 of AASS. The portion of the first region of AASS may be within exon 24 of AASS and the portion of the second region of AASS may be within exon 25 of AASS. The portion of the first region of AASS may be within exon 25 of AASS and the portion of the second region of AASS may be the 3’UTR of AASS.
[0310] At an overlap region, the hybridization location of the silencing oligonucleotide may be distributed between the first and second regions of the overlap (e.g., a ratio of overlap). Different percentages of the length of the oligonucleotide may be hybridized with the first region and second exon. At an overlap region, about 90% of the number of nucleotides of the overlap region may be within the first region and about 10% of the number of nucleotides of the overlap region may
within the second region. At an overlap region, about 80% of the number of nucleotides of the overlap region may be within the first region and about 20% of the number of nucleotides of the overlap region may be within the second region. At an overlap region, about 70% of the number of nucleotides of the overlap region may be within the first region and about 30% of the number of nucleotides of the overlap region may be within the second region. At an overlap region, about 60% of the number of nucleotides of the overlap region may be within the first region and about 40% of the number of nucleotides of the overlap region may be within the second region. At an overlap region, about 50% of the number of nucleotides of the overlap region may be within the first region and about 50% of the number of nucleotides of the overlap region may be within the second region. At an overlap region, about 40% of the number of nucleotides of the overlap region may be within the first region and about 60% of the number of nucleotides of the overlap region may be within the second region. At an overlap region, about 30% of the number of nucleotides of the overlap region may be within the first region and about 70% of the number of nucleotides of the overlap region may be within the second region. At an overlap region, At an overlap region, about 20% of the number of nucleotides of the overlap region may be within the first region and about 80% of the number of nucleotides of the overlap region may be within the second region. At an overlap region, about 10% of the number of nucleotides of the overlap region may be within the first region and about 90% of the number of nucleotides of the overlap region may be within the second region.
[0311] In an aspect, a silencing oligonucleotide may target a target sequence comprising one or more nucleotide positions of an exon of an AASS gene or mRNA as disclosed herein. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 127-142 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 256-271 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 355-370 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 433-448 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 486-501 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 572-587 of the
sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 661-676 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 777-792 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 858-873 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1045-1060 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1329-1344 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1345-1360 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1378-1393 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1490-1505of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1672-1687 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1832-1847 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1944-1959 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2042-2057 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2072-2087 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2220-2235 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2384-2399 of the sequence set forth in SEQ ID
NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2588-2603 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2714-2729 of the sequence set forth in SEQ ID NO:36.
[0312] A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 615-635 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 726-746 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 742-760 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 742-762 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 843-863 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 911-929 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 911-931 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1010-1030 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1154-1172 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1154-1174 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1292-1310 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1292-1312 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1355-1375 of the
sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1358-1376 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1358-1378 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1364-1384 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1476-1496 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1521-1541 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1531-1551 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 1613-1633 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2222-2242 of the sequence set forth in SEQ ID NO:36. A silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions 2438-2458 of the sequence set forth in SEQ ID NO:36. In an aspect, the silencing oligonucleotide may a single stranded antisense oligonucleotide. In an aspect, the silencing oligonucleotide may be an double stranded siRNA.
[0313] In an aspect, a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA corresponding to positions within a window of about 20 nucleotides or less, in the 3’ direction from a starting position selected from position 95, 103, 104, 105, 292, 489, 533, 534, 726, 739, 740, 893, 1059, 1181, 1447, 1448, 1449, 2197, 2211, 2468, 2492, 2498, 2804, 2805, 2526, 3061, 3929, 4002, 4003, 4004, 5278, 5283, 5411, 5416, 5417, 5605, 5678, or 5679 of an AASS gene or AASS mRNA, e.g., having the sequence set forth in SEQ ID NO:36. From said starting positions (e.g., 95, 103, 104, 105, 292, 489, 533, 534, 726, 739, 740, 893, 1059, 1181, 1447, 1448, 1449, 2197, 2211, 2468, 2492, 2498, 2804, 2805, 2526, 3061, 3929, 4002, 4003, 4004, 5278, 5283, 5411, 5416, 5417, 5605, 5678, or 5679 of the AASS), the said window of nucleotides may comprises about 19 nucleotides or less, 18 nucleotides or less, 17 nucleotides or less, 16 nucleotides or less, 15 nucleotides or less, 14
nucleotides or less, 13 nucleotides or less, 12 nucleotides or less, 11 nucleotides or less, 10 nucleotides or less, 9 nucleotides or less, 8 nucleotides or less, 7 nucleotides or less, 6 nucleotides or less, 5 nucleotides or less, 4 nucleotides or less, 3 nucleotides or less, 2 nucleotides, or one nucleotide in the 3’ direction from said starting position of the AASS. In an aspect, the silencing oligonucleotide may a single stranded antisense oligonucleotide. In an aspect, the silencing oligonucleotide may be a double stranded siRNA. In an aspect, a silencing oligonucleotide is equal to or longer than its target sequence.
[0314] In an aspect, a silencing oligonucleotide may target a target sequence comprising one or more nucleotides of the AASS gene or AASS mRNA, e.g., corresponding to positions within a window of about 20 nucleotides or less, in the 3 ’ direction from a starting position selected from position , 31, 105, 195, 280, 488, 530, 892, 1060, 1144, 1306, 1384, 1385, 1455, 2100, 2151, 2214, 2825, 2914, 4003, 4004, 4366, 5283, or 5679 of an AASS gene or AASS mRNA having the sequence set forth in SEQ ID NO:36. From said starting positions (e.g., 95, 103, 104, 105, 292, 489, 533, 534, 726, 739, 740, 893, 1059, 1181, 1447, 1448, 1449, 2197, 2211, 2468, 2492, 2498, 2804, 2805, 2526, 3061, 3929, 4002, 4003, 4004, 5278, 5283, 5411, 5416, 5417, 5605, 5678, or 5679 of the AASS), the said window of nucleotides may comprises about 19 nucleotides or less, 18 nucleotides or less, 17 nucleotides or less, 16 nucleotides or less, 15 nucleotides or less, 14 nucleotides or less, 13 nucleotides or less, 12 nucleotides or less, 11 nucleotides or less, 10 nucleotides or less, 9 nucleotides or less, 8 nucleotides or less, 7 nucleotides or less, 6 nucleotides or less, 5 nucleotides or less, 4 nucleotides or less, 3 nucleotides or less, 2 nucleotides, or one nucleotide in the 3’ direction from said starting position of the AASS. In an aspect, the silencing oligonucleotide may a single stranded antisense oligonucleotide. In an aspect, the silencing oligonucleotide may be a double stranded siRNA.
[0315] In an aspect, a silencing oligonucleotide may target a target sequence of any one of the silencing olignucleotides disclosed in the Examples of the application, selected from the target sequence of any one of TABLES 10-15, or the reverse complement thereof.
[0316] It is contemplated that any isolated nucleic acid described herein, which targets AASS, may target a targeting site as described herein this section.
[0317] In an aspect, silencing oligonucleotide may comprise or consist of a nucleic acid sequence selected from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74-117, 120-182, or a reverse complement thereof. In an aspect, silencing oligonucleotide may comprise or consist of a nucleic acid sequence as described herein the Examples.
[0318] In an aspect, a silencing oligonucleotide (e.g., siRNA or an antisense oligonucleotide) may be conjugated to a tissue-targeting moiety. The tissue-targeting moiety may be liver-tissue
specific. The tissue targeting moiety may comprise one or more GalNAc, optionally two GalNAc (e.g., a GalNAc dimer) or three GalNAc (e.g., a GalNAc trimer).
[0319] The silencing oligonucleotide comprising or consisting of said nucleic acid sequences, or as described herein the Examples, may be chemically modified as described herein, e.g. by phosphorothioation, or locked nucleic acid design. In an aspect, the silencing oligonucleotide may a single stranded antisense oligonucleotide. In an aspect, the silencing oligonucleotide may be an double stranded siRNA. siRNA Oligonucleotides
[0320] Generally, as known to the art, siRNAs can be silencing oligonucleotides that can be used to silence genes. In an aspect, a gene to be silenced by the siRNA or the silenced gene is AASS. In an aspect, the process is as follows: (i) double-stranded RNA is cleaved by the Dicer enzyme, which forms siRNA, (ii) double-stranded siRNA then enters the cell and forms the RNA-induced silencing complex (RISC) with other proteins, (iii) this is unwound, which forms the singlestranded siRNA, (iv) the strand of RNA with the 5’ end base pairing that is thermodynamically less stable remains part of the RISC complex, which strand can now scan for complementary mRNA, (v) once this anti-sense strand binds to the target mRNA, mRNA cleavage is induced, and (vi) the foreign mRNA is recognized by the host cell as abnormal and is degraded. Now, translation is not possible, and the gene is silenced.
[0321] Disclosed herein is an siRNA that can target any part of an aminoadipate-semialdehyde synthase gene. Disclosed herein is an siRNA that can target any part of the aminoadipate- semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO: 35 or SEQ ID NO:36. Disclosed herein is an siRNA that can target any part of an aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
[0322] In an aspect, a targeted part of an AASS sequence by siRNA can comprise about 15 to about 35 base pairs. In an aspect, a targeted part of an AASS sequence by siRNA can comprise about 20 to about 30 base pairs. In an aspect, a targeted part of an AASS sequence by siRNA can comprise about 20 to about 24 base pairs. In an aspect, a targeted part of an AASS sequence by siRNA can comprise about 21 to about 22 base pairs.
[0323] In an aspect, the siRNA comprises a double stranded oligonucleotide, which is about 15 to about 35 base pairs in length. In an aspect, the siRNA comprises a double stranded oligonucleotide, which is about 20 to about 30 base pairs in length, an aspect, the siRNA comprises a double stranded oligonucleotide, which is about 20 to about 24 base pairs in length an aspect, the siRNA comprises a double stranded oligonucleotide, which is about 21 to about 22 base pairs in length
[0324] In an aspect, the siRNA comprises a sense and antisense strand, respectively, selected from: SEQ ID NO:74 and SEQ ID NO:75; SEQ ID NO:76 and SEQ ID NO:77; SEQ ID NO:78 and SEQ ID NO:79; SEQ ID NO:80 and SEQ ID NO:81; SEQ ID NO:82 and SEQ ID NO:83; SEQ ID NO:84 and SEQ ID NO:85; SEQ ID NO:86 and SEQ ID NO:87; SEQ ID NO:88 and SEQ ID NO:89; SEQ ID NO:90 and SEQ ID NO:91; SEQ ID NO:92 and SEQ ID NO:93; SEQ ID NO:94 and SEQ ID NO:95; SEQ ID NO:96 and SEQ ID NO:97; SEQ ID NO:98 and SEQ ID NO:99; SEQ ID NO: 100 and SEQ ID NO: 101; SEQ ID NO: 102 and SEQ ID NO: 103; SEQ ID NO: 104 and SEQ ID NO: 105; SEQ ID NO: 106 and SEQ ID NO: 107; SEQ ID NO: 108 and SEQ ID NO: 109; SEQ ID NO: 110 and SEQ ID NO: 111; SEQ ID NO: 112 and SEQ ID NO: 113; SEQ ID NO: 114 and SEQ ID NO: 115; SEQ ID NO: 116 and SEQ ID NO: 117; or SEQ ID NO: 118 and SEQ ID NO: 119.
[0325] In an aspect, a disclosed siRNA effects the complete silencing of the aminoadipatesemialdehyde synthase gene. In an aspect, a disclosed siRNA can effect the partial silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed siRNA can effect the complete silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed siRNA can effect the partial silencing of the aminoadipate-semialdehyde synthase gene in a subject’s liver. In an aspect, a disclosed siRNA can effect the complete silencing of the aminoadipate-semialdehyde synthase gene in a subject’s liver.
[0326] Disclosed herein is an siRNA that can target any part of the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
[0327] In an aspect, a disclosed siRNA can effect the partial silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene. In an aspect, a disclosed siRNA can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene. In an aspect, a disclosed siRNA can effect the partial silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine
alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene in a subject’s liver. In an aspect, a disclosed siRNA can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5 -carboxylate reductase gene in a subject’s liver.
Antisense Oligonucleotides (ASOs)
[0328] Generally, as known to the art, antisense oligonucleotides can be silencing oligonucleotides that can be used to silence genes. In an aspect, a gene to be silenced by an ASO or the silenced gene is AASS. Disclosed herein is an antisense oligonucleotide that can target any part of an aminoadipate-semialdehyde synthase gene. Disclosed herein is an antisense oligonucleotide that can target any part of the aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36. Disclosed herein is an antisense oligonucleotide that can target any part of an aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
[0329] In an aspect, a targeted part of an AASS sequence by an ASO can comprise about 14 to about 30 nucleotides. In an aspect, a targeted part of an AASS sequence by an ASO can comprise about 15 to about 28 nucleotides. In an aspect, a targeted part of an AASS sequence by an ASO can comprise about 16 to about 26 nucleotides. In an aspect, a targeted part of an AASS sequence by an ASO can comprise about 17 to about 24 nucleotides.
[0330] In an aspect, a disclosed antisense oligonucleotide (ASO) targets a target sequence of AASS, wherein the target sequence comprises any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74- 117, 120-182, or a reverse complement thereof. In an aspect, an ASO comprises or consists of a a nucleic acid sequence selected from from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74- 117, 120-182, or a reverse complement thereof.
[0331] In an aspect, a disclosed antisense oligonucleotide effects the complete silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed antisense oligonucleotide can effect the partial silencing of the aminoadipate-semialdehyde synthase gene. In an aspect, a disclosed antisense oligonucleotide can effect the complete silencing of the aminoadipate- semialdehyde synthase gene. In an aspect, a disclosed antisense oligonucleotide can effect the partial silencing of the aminoadipate-semialdehyde synthase gene in a subject’s liver. In an aspect, a disclosed antisense oligonucleotide can effect the complete silencing of the aminoadipate- semialdehyde synthase gene in a subject’s liver.
[0332] Disclosed herein is an antisense oligonucleotide that can target any part of the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
[0333] In an aspect, a disclosed antisense oligonucleotide can effect the partial silencing of the a- aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene. In an aspect, a disclosed antisense oligonucleotide can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene. In an aspect, a disclosed antisense oligonucleotide can effect the partial silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5 -carboxylate reductase gene in a subject’s liver. In an aspect, a disclosed antisense oligonucleotide can effect the complete silencing of the a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene in a subject’s liver.
Therapeutic mRNA
[0334] mRNA therapy involves introduction of an mRNA sequence (e.g., an isolated nucleic acid encoding a gene) to subject, such as for instance, to be used in protein replacement therapy. An mRNA oligonuclotide may be used to induce functional expression of a target gene or protein. Disclosed herein is mRNA therapy which can be directed to one or more enzymes in the pipecolate pathway, the saccharopine pathway, or both. In an aspect, a disclosed mRNA molecule can be used to induce functional GCDH expression in a mammal or a mammalian cell. In an aspect, the disclosed functional GCDH can be induced in a subject’s liver or brain or in cells found in the liver or in the brain.
[0335] In an aspect, a disclosed mRNA sequence can be used to induce functional a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase
domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-cry stallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase expression in a mammal or a mammalian cell. In an aspect, the disclosed functional a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-cry stallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase can be induced in a subject’s liver or brain or in cells found in the liver or in the brain.
[0336] In an aspect, a disclosed mRNA sequence comprises (i) at least one 5'-cap structure; (ii) a 5'-UTR; (iii) an open reading frame (ORF) encoding a functional protein of interest (e.g., a GCDH that is recombinant, or wildtype, or a variant); (iv) a 3 '-UTR; and (v) a poly-A region. The mRNA nucleotide may futher comprise a promoter, optionally selected from a T7 promoterr. The open reading frame (ORF) of the gene of interest may be flanked by a 5’ untranslated region (UTR) which may contain a strong Kozak translational initiation signal and/or an 3 ’UTR, optionally a n alpha-globin 3 ’UTR, which may include an oligo(dT) sequence for templated addition of a poly- A tail. Moreover, multiple 5’ or 3’ UTRs may be included in the flanking regions and may be the same or of different sequences.
[0337] In an aspect, a disclosed mRNA sequence (e.g., an isolated nucleic acid encoding a gene) may be a modified mRNA (mmRNA). An mmRNA encodes a polypeptide of interested, but is preferable for its modifications that avoid limitations of its unmodified counterpart mRNA molecule. Such modifications are improved structural features, which are ones in which two or more linked nucleotides are inserted, deleted, duplicated, inverted, or randomized in a mRNA. Traditional mRNA molecule can comprise at least a coding region, a 5’UTR, a 3’UTR, a 5’cap and a poly-A tail. Modified mRNAs comprise one or more structural and/or chemical modifications or alterations which impart useful properties to the polynucleotide. For instance, mmRNAs may reduce immunogenicity, increase stability, or enchance the therapeutic effectiveness compared to a traditional mRNA.
[0338] The 5’ cap structure of mRNA is critical for nuclear export and mRNA stability, as 5’decapping may subject a nucleic acid molecule for degradation. Modifications toward a non- hydrolyzable cap are preferred. In an aspect, the at least one 5’ cap structure is selected from capO, capl, cap 2, N-6 methyladenosine cap 1, N6-methylyad enosine cap 2, ARC A, inosine, Nl- methyl-guanosine, 2-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, or 2-azido-guanosine. Additional modifications that can be included as a 5’ cap structure on a mRNA (e.g., mmRNA) may be alpha-thio-guanosine nucleotides; phosphorothioate linkage in form of a 5’-ppp-5’cap; modified guanosine nucleotides in the 5’ cap, such as alpha-
methyl-phosphonate and seleno-phosphate nucleotides; 2 ’-0 -methylation of the ribose sugars of 5’-terminal and/or 5’-anteterminal nucleotides of the mRNA. Additional modifications that can be included as a 5’ cap structure on a mRNA (e.g., mmRNA) may be synthetic cap analogs; chemical caps; chemical cap analogs; or structural or functional cap analogs, which are different from natural (i.e. endogenous, wild-type or physiological) 5 ’-caps in their chemical structure. Cap analogs may be chemically (i.e. non-enzymatically) or enzymatically synthesized and/or linked to the mRNA. Additional modifications that can be included as a 5’ cap structure on a mRNA (e.g., mmRNA) may be an Anti-Reverse Cap Analog (ARCA) cap (e.g., two guanines linked by a 5-5- triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3-O-methyl group (i.e., N7,3’-O-dimethyl-guanosine-5-triphosphate-5-guanosine)); or mCAP, which similar to ARCA but comprising a 2’-O-methyl group on guanosine.
[0339] A 5’UTR of an mRNA or mmRNA disclosed herein may comprise a Kozak sequence. Kozak sequences may comprise the consensus sequence CCR(A/G)CCAUGG, where R is a purine, which is three bases upstream of the start codon (AUG), which is followed by another ‘G’. The 5’UTR may comprise a 5’UTR of a liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII. Such liverspecific 5’UTR could be used to enhance expression of a functional GCDH protein in in hepatic cell lines or liver. The 5’UTR can also be non-natural, e.g. synthetic. The 5’UTR may comprises or consist of the seqeunce set forth in SEQ ID NO: 189, or a fragment thereof.
[0340] The ORF may also include various upstream or downstream additions, such as, but not limited to, p-globin, tags, etc.
[0341] A 3’UTR of an mRNA or mmRNA disclosed herein may comprise an alpha-globin 3- UTR. The 3’UTR may comprise or consist of the seqeunce set forth in SEQ ID NO: 190. The 3’UTR may comprise one or more AU rich elements, optionally a class 1 AU rich elements, Class 2 AU rich elements, or a Class 3 AU rich element. The 3’UTR may comprise one or more microRNA binding sites.
[0342] In an aspect, a disclosed mRNA molecule can comprise at least one nonstandard nucleobase. In an aspect, a disclosed modified mRNA (mmRNA) sequence may comprise a 1- methyl'P modification. In an aspect, a disclosed modified mRNA sequence may comprise a 1 5- methylcytidine (5-methylC) modification. (See, Kariko K et al. Immunity 23: 165-75 (2005); Kariko K et al. Mol Ther 16: 1833-40 (2008); Anderson B R et al. NAR (2010)), each of which are herein incorporated by reference in their entireties. In an aspect, a disclosed modified mRNA sequence may comprises a 5-methoxyuridine (5-methoxyU) modification. In an aspect, a disclosed modified mRNA sequence may comprises a 5-methylC modificatoin. In an aspect, a
disclosed modified mRNA sequence may comprises a 2-thio-uridine modfication. In an aspect, a disclosed modified mRNA sequence may comprise N1 -methylpseudouridine or other potential modification provided for by U.S. Patent No.: 10,898,574 B2.
[0343] In an aspect, a disclosed mRNA molecule can be encapsulated within a nanoparticle (e.g., a lipid nanoparticle). For example, in an aspect, a disclosed nanoparticle can be a liposome. In an aspect, a disclosed liposome can comprise one or more cationic lipids, one or more non-cationic lipids, and one or more PEG-modified lipids. In an aspect, a disclosed liposome can comprise one or more cholesterol-based lipids. In an aspect, a disclosed liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids and one or more PEG-modified lipids. In an aspect, a disclosed liposome can comprise no more than three distinct lipid components (such as, for example, a sterol-based cationic lipid). In an aspect, a disclosed sterol-based cationic lipid can be imidazole cholesterol ester (ICE), GL-TES-SA-DME- E18-2, TL1-01D-DMA, SY-3-E14-DMAPr, TL1-10D-DMA, Guan-SS-Chol, GL-TES-SA- DMP-E18-2, HEP-E4-E10, HEP-E3-E10, TL1- 04D-DMA, GL-TES-SA-DME-E18-2, TL1- 01D-DMA, SY-3-E14-DMAPr, TL1-10D-DMA, or a combination thereof.
[0344] In an aspect, a disclosed nanoparticles can have a size of less than about 200 nm, or less than about 150 nm, or less than about 120 nm, or less than about 110 nm, or less than about 100 nm, or less than about 80 nm, or less than about 60 nm, or less than about 50 nm, or less than about 40 nm, or less than about 30 nm.
Viral Vectors
[0345] Disclosed herein is a viral vector comprising a disclosed isolated nucleic acid molecule. Disclosed herein is a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase. Disclosed herein is a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding aminoadipate-semialdehyde synthase. Disclosed herein is viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding green fluorescent protein (GFP). Disclosed herein is a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, aminoadipate-semialdehyde synthase, or green fluorescent protein.
[0346] Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:01 or a fragment thereof. Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:02 or a fragment thereof. Disclosed herein is a viral vector
comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 17 or a fragment thereof. Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 18 or a fragment thereof.
[0347] Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:01, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof. Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:02, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof.
[0348] Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 17, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof. Disclosed herein is a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 18, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof.
[0349] Disclosed herein is a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
[0350] Disclosed herein is a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest.
[0351] Disclosed herein is a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in glutaryl-CoA dehydrogenase gene.
[0352] Disclosed herein is a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one
or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in aminoadipate-semialdehyde synthase gene
[0353] Disclosed herein is a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. Said gene editing system may a gene editing system as described herein.
[0354] Disclosed herein is a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest. Disclosed herein is a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene. [0355] Disclosed herein is a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
[0356] Disclosed herein is a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. Disclosed herein is a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest. Disclosed herein is a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene. Disclosed herein is a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
[0357] Disclosed herein is a viral vector comprising the sequence set forth in SEQ ID NO: 19. Disclosed herein is a viral vector comprising the sequence set forth in SEQ ID NO:20. Disclosed herein is a viral vector comprising the sequence set forth in SEQ ID NO:21.
[0358] In an aspect, a disclosed viral vector can comprise a nucleic acid sequence encoding a carb oxy -terminal fluorescent label and/or fluorescent tag, an amino-terminal fluorescent label
and/or fluorescent tag, or a combination thereof. In an aspect, a disclosed fluorescent label and/or fluorescent tag can comprise green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof. Fluorophores and fluorescent labels are known.
[0359] In an aspect, a disclosed viral vector can be an adenovirus vector, an AAV vector, a herpes simplex virus vector, a retrovirus vector, a lentivirus vector, and alphavirus vector, a flavivirus vector, a rhabdovirus vector, a measles virus vector, a Newcastle disease viral vector, a poxvirus vector, or a picomavirus vector. In an aspect, a disclosed viral vector can be an adenovirus vector, an adenovirus-associated (AAV) vector, or a lentivirus vector. In an aspect, a disclosed AAV vector can be a recombinant AAV (rAAV) vector.
[0360] In an aspect, a disclosed AAV vector can include naturally isolated serotypes including, but not limited to, AAV1, AAV2, AAV3 (including 3a and 3b), AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV13, AAVrh39, AAVrh43, AAVcy.7 as well as bovine AAV, caprine AAV, canine AAV, equine AAV, ovine AAV, avian AAV, primate AAV, non-primate AAV, and any other virus classified by the International Committee on Taxonomy of Viruses (ICTV) as an AAV. In an aspect, an AAV capsid can be a chimera either created by capsid evolution or by rational capsid engineering from a naturally isolated AAV variants to capture desirable serotype features such as enhanced or specific tissue tropism and/or a host immune response escape. Naturally isolated AAV variants include, but not limited to, AAV-DJ, AAV-HAE1, AAV-HAE2, AAVM41, AAV- 1829, AAV2 Y/F, AAV2 T/V, AAV2i8, AAV2.5, AAV9.45, AAV9.61, AAV-B1, AAV-AS, AAV9.45A-String (e.g., AAV9.45-AS), AAV9.45Angiopep, AAV9.47-Angiopep, and AAV9.47-AS, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAV-F, AAVcc.47, and AAVcc.81. In an aspect, a disclosed AAV vector can be AAV-Rh74 or a related variant (e.g., capsid variants like RHM4-1). In an aspect, a disclosed AAV vector can comprise AAVcc.47.
[0361] In an aspect of a disclosed AAV vector, a disclosed nucleic acid sequence can have a coding sequence that is less than about 4.5 kilobases.
[0362] In an aspect, a disclosed vector can comprise the nucleic acid sequence for one or more regulatory elements. In an aspect, a disclosed regulatory element can comprise a promoter, an enhancer, an internal ribosomal entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), or any combination thereof. Regulatory elements can include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide
sequence only in certain host cells (e.g., tissue-specific regulatory sequences such as brain cells or neurons).
[0363] In an aspect, a disclosed vector can comprise a promoter operably linked to a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase. In an aspect of a disclosed vector, a disclosed promoter can comprise a tissue specific promoter. In an aspect of a disclosed vector, a disclosed tissue specific promoter can comprise a neuron-specific promoter, a muscle-specific promoter, a liver-specific promoter, a skeletal muscle-specific promoter, and heart-specific promoter. In an aspect of a disclosed vector, a disclosed tissue-specific promoter can comprise a brain cell specific promoter. Brain cell specific promoter are known to the art and can comprise a synapsin 1 (Synl) promoter, a calmodulin/calcium dependent kinase II (CAMKII) promoter, a glial fibrillary acidic protein (GFAP) promoter, a Rgs5 promoter, a S100 beta promoter, a neuron-specific enolase (NSE) promoter, a Thyl promoter, or any combination thereof.
[0364] In an aspect of a disclosed vector, a disclosed promoter can comprise a liver-specific promoter. Liver specific promoters are known to the art. In an aspect of a disclosed vector, a disclosed liver promoter can comprise the sequence set forth in SEQ ID NO:26. In an aspect of a disclosed vector, a disclosed promoter can comprise a type III RNA polymerase III promoter. Type III RNA polymerase III promoters are known to the art. In an aspect, a disclosed type III RNA polymerase III promoter can comprise a U6 promoter. In an aspect of a disclosed vector, a disclosed U6 promoter can comprise the sequence set forth in SEQ ID NO:27.
[0365] In an aspect, a disclosed vector can comprise one or more OLLAS tag. In an aspect, a disclosed OLLAS tag can comprise the sequence set forth in SEQ ID NO:31. In an aspect, a disclosed vector can comprise a nuclear localization signal (NLS). In an aspect, a disclosed NLS can comprise the sequence set forth in SEQ ID NO:30 or SEQ ID NO:32. NLS are known to the skilled person in the art. In an aspect, a disclosed vector can comprise one or more inverted terminal repeats (ITRs). In an aspect, the one or more disclosed ITRs can be derived from AAV2 or AAV9. In an aspect, a disclosed ITR can comprise the sequence set forth in any one of SEQ ID NO:22 or SEQ ID NO:23. In an aspect, a disclosed vector can comprise a polyA sequence. In an aspect, a disclosed polyA sequence can comprise the sequence set forth in SEQ ID NO:24 or SEQ ID NO:25. In an aspect, a disclosed vector can comprise one or more hemagglutinin (HA) tags. In an aspect, a disclosed HA tag can comprise the sequence set forth in SEQ ID NO:29. In an aspect, a disclosed vector can comprise a TracrRNA sequence. In an aspect, a TracrRNA sequence can comprise the sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12.
[0366] In an aspect, a therapeutically effective amount of disclosed vector can comprise a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed vector can
be administered at a dose of about 1 x 1011 to about 8 x 1013 vg/kg or about 1 x 1012 to about 8 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1013 to about 6 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of at least about 1 x IO10, at least about 5 x IO10, at least about 1 x 1011, at least about 5 x 1011, at least about 1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of no more than about 1 x IO10, no more than about 5 x IO10, no more than about 1 x 1011, no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about 1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
[0367] In an aspect, a disclosed viral vector can be validated and/or characterized using an animal model such as mice and/or C. elegans.
[0368] In an aspect, a disclosed vector can restore the functionality of a missing, dysfunctional, and/or mutated glutaryl-CoA dehydrogenase in a cell or a subj ect. In an aspect, a disclosed vector (i) can restore liver-specific modulation of lysine catabolism, (ii) restore one or more aspects of lysine homeostasis, (iii) can reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) can restore the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) can improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) can improve memory function of a subject, (vii) can reduce anxiety in a subject, (viii) can reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) can improve and/or reduce and/or eliminate vascular dysfunction in a subject, (x) can improve a subject’s quality of life, (xi) can increase and/or prolong a subject’s life span, (xii) can increase a subject’s survivability, or (xiii) any combination thereof.
[0369] In an aspect, a disclosed vector can treat and/or prevent Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed vector can improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed vector can improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
Formulations
[0370] Disclosed herein is a pharmaceutical formulation comprising one or more disclosed GCDH nucleic acid molecules, disclosed CRISPR based nucleic acid molecules, disclosed viral vectors, disclosed cells, disclosed plasmids, or any combination thereof, and at least one pharmaceutically acceptable carrier.
[0371] Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, and at least one pharmaceutically acceptable carrier.
[0372] Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipatesemialdehyde synthase gene, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising a disclosed isolated nucleic acid molecule, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding aminoadipate-semialdehyde synthase, and at least one pharmaceutically acceptable carrier.
[0373] Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding green fluorescent protein (GFP), and at least one pharmaceutically acceptable carrier.
[0374] Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl- CoA dehydrogenase, aminoadipate-semialdehyde synthase, or green fluorescent protein, and at least one pharmaceutically acceptable carrier.
[0375] Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:01 or a fragment thereof, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 02 or a fragment thereof, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl- CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO:01 or SEQ ID NO: 02, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprises the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein the sequence comprises one or more nucleotide substitutions, insertions, deletions, modifications, or any combination thereof, and at least one pharmaceutically acceptable carrier.
[0376] Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipatesemialdehyde synthase gene, and at least one pharmaceutically acceptable carrier.
[0377] Disclosed herein is a pharmaceutical formulation comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and at least one pharmaceutically acceptable carrier.
[0378] Disclosed herein is a pharmaceutical formulation comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at glutaryl-CoA dehydrogenase, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and at least one pharmaceutically acceptable carrier.
[0379] Disclosed herein is a pharmaceutical formulation comprising a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in the target gene of interest, and at least one pharmaceutically acceptable carrier.
[0380] Disclosed herein is a pharmaceutical formulation comprising a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene, and at least one pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a recombinant AAVcc47 vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, and at least one
pharmaceutically acceptable carrier. Disclosed herein is a pharmaceutical formulation comprising a viral vector comprising the sequence set forth in SEQ ID NO: 19, SEQ ID NO:20, or SEQ ID NO:21, and at least one pharmaceutically acceptable carrier.
[0381] In an aspect, a disclosed pharmaceutical formulation can comprise at least one lyoprotectant. In an aspect, a disclosed lyoprotectant can comprise peptone, glycerol, lactose, gelatin, glucose, sucrose, trehalose, dextran, maltodextrin, adonitol, sodium glutamate, or any combination thereof. Lyoprotectants are known to those skilled in the art.
[0382] In an aspect, a disclosed pharmaceutical formulation can comprise at least one gelling agent, preferably a pharmaceutically acceptable gelling agent. In an aspect, a disclosed pharmaceutical formulation can comprise at least preservative such as, for example, benzyl alcohol, cresols, benzoic acid, phenol, parabens, or sorbic acid. In an aspect, a disclosed pharmaceutical formulation can comprise at least one stabilizer such as, for example, a surfactant, a polymer, a polyol, a poloxamer, an albumin, a gelatin, a trehalose, a protein, a sugar, a polyvinylpyrrolidone, a N-acetyl -tryptophan (NAT), a caprylate (e.g., sodium caprylate), a polysorbate (e.g., P80), an amino acid, and a divalent metal cation (e.g., zinc).
Cells
[0383] Disclosed herein is a cell comprising a disclosed isolated nucleic acid molecule or a disclosed plasmid. Disclosed herein are cells transfected by one or more disclosed nucleic acid molecules. Disclosed herein are cells transduced by one or more disclosed vectors.
[0384] Disclosed herein are cells having a GCDH ” genotype. Disclosed herein are cells having a AASS7’ genotype. Disclosed herein are cells having a GCDH/' and AASS7’ genotype.
[0385] Disclosed herein are cells having a Gcdh" genotype. Disclosed herein are cells having a Aass7‘ genotype. Disclosed herein are cells having a Gcdh 7’ and Aass7‘ genotype.
[0386] Disclosed herein are cells demonstrating a GCDH7' genotype following transduction with a disclosed viral vector. Disclosed herein are cells demonstrating a AASS7’ genotype following transduction with a disclosed viral vector. Disclosed herein are cells demonstrating a GCDH7' and AASS7’ genotype following transduction with a disclosed viral vector.
[0387] Disclosed herein are cells demonstrating a Gcdh7‘ genotype following transduction with a disclosed viral vector. Disclosed herein are cells demonstrating a Aass7‘ genotype following transduction with a disclosed viral vector. Disclosed herein are cells demonstrating a Gcdh 7’ and Aass7‘ genotype following transduction with a disclosed viral vector.
[0388] In an aspect, disclosed transduced cells can comprise any central nervous system cells. CNS cells include but are not limited to neurons, glial cells, vascular cells, and combinations thereof. As known to the art, neurons include sensory neurons, motor neurons, interneurons, brain
neurons, and combinations thereof. Neurons includes multipolar neurons, unipolar neurons, bipolar neurons, pseudo-unipolar neurons, and combinations thereof. In an aspect, disclosed transduced cells can comprise hepatocytes. In an aspect, disclosed transduced cells can comprise mammalian brain cells or mammalian hepatocytes.
[0389] Disclosed herein are cells transfected by a disclosed plasmid. Disclosed herein are cells transduced by a vector comprising the sequence set forth in SEQ ID NO: 19. Disclosed herein are cells transduced by a vector comprising the sequence set forth in SEQ ID NO:20. Disclosed herein are cells transduced by a vector comprising the sequence set forth in SEQ ID NO:21. Disclosed herein are cells transfected by an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:01 or SEQ ID NO:02. Disclosed herein are cells transfected by an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO: 17 or in SEQ ID NO: 18. Disclosed herein are cells transfected by an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:35 or in SEQ ID NO:36. Disclosed herein are cells transfected by an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:37 or in SEQ ID NO:38.
[0390] In an aspect, disclosed cells can comprise cells harvested and/or obtained from a subject. In an aspect, disclosed cells can comprise cells harvested and/or obtained from a subject suspected of having or diagnosed with GA-1. Techniques to achieve transfection are known to the art and using transfected cells are known to the art.
Plasmids
[0391] Disclosed herein is a plasmid used in a disclosed method. Disclosed herein is a plasmid comprising one or more disclosed isolated nucleic acid molecules (e.g., any one of the nucleic acid sequences of SEQ ID NOS: 1-SEQ ID NO:206). Disclosed herein is a plasmid comprising one or more disclosed proteins (e.g., the nucleic acid encoding any one of the protein sequeences of SEQ ID NOS: 1 -SEQ ID NO:206).
[0392] For example, in an aspect, a disclosed plasmid can comprise an isolated nucleic acid molecule comprising the sequence set forth in any one of SEQ ID NO:01 - SEQ ID NO:02, or a fragment thereof. In an aspect, a disclosed plasmid can comprise an isolated nucleic acid molecule encoding the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04, or a fragment thereof. In an aspect, a disclosed plasmid can comprise an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof. In an aspect, a disclosed plasmid can comprise an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36, or a fragment thereof. In an aspect, a disclosed plasmid
can comprise an isolated nucleic acid molecule comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39, or a fragment thereof.
[0393] In an aspect, a disclosed plasmid can comprise a nucleic acid sequence for a disclosed fluorescent label and/or fluorescent tag. In an aspect, a disclosed fluorescent label and/or fluorescent tag can comprise green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof. Fluorophores and fluorescent labels are known.
Kits
[0394] Disclosed herein is a kit comprising one or more disclosed isolated nucleic acid molecules (e.g., silencing oligonucleotide, e.g. siRNA or antisense oligonucleotide), one or more disclosed vectors, one or more disclosed cells, one or more disclosed plasmids, or any combination thereof. [0395] Disclosed herein is a kit comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase. Disclosed herein is a kit comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. Disclosed herein is a kit comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in the target gene of interest. Disclosed herein is a kit comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at aminoadipate-semialdehyde synthase.
[0396] Disclosed herein is a kit comprising a viral vector comprising a disclosed isolated nucleic acid molecule. Disclosed herein is a kit comprising a viral vector comprising a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, or a disclosed isolated nucleic acid molecule comprising a nucleic acid sequence encoding aminoadipate-semialdehyde synthase, or a nucleic acid sequence encoding green fluorescent protein (GFP).
[0397] Disclosed herein is a kit comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO:01 or a fragment thereof, or comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 02 or a fragment thereof.
[0398] Disclosed herein is a kit comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the
sequence set forth in SEQ ID NO: 17 or a fragment thereof, or comprising a viral vector comprising a nucleic acid sequence encoding a glutaryl-CoA dehydrogenase, wherein the nucleic acid sequence comprise the sequence set forth in SEQ ID NO: 18 or a fragment thereof.
[0399] Disclosed herein is a kit comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. Disclosed herein is a kit comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in the target gene of interest.
[0400] Disclosed herein is a kit comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
[0401] Disclosed herein is a kit comprising a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene. Disclosed herein is a kit comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system. Disclosed herein is a kit comprising a recombinant AAV vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the one or more elements comprises an endonuclease and a sgRNA directed at a target sequence in a target gene of interest.
[0402] Disclosed herein is a kit comprising a viral vector comprising the sequence set forth in SEQ ID NO: 19. Disclosed herein is a kit comprising a viral vector comprising the sequence set forth in SEQ ID NO:20. Disclosed herein is a kit comprising a viral vector comprising the sequence set forth in SEQ ID NO:21.
[0403] Disclosed herein is a kit comprising cells comprising a disclosed isolated nucleic acid molecule or a disclosed plasmid. Disclosed herein is a kit comprising cells transfected by one or more disclosed nucleic acid molecules. Disclosed herein is a kit comprising cells transduced by one or more disclosed vectors.
[0404] Disclosed herein is a kit comprising cells having a Gcdh' ' genotype. Disclosed herein is a kit comprising cells having a Aass" ’ genotype. Disclosed herein is a kit comprising cells having a Gcdh' ' and Aass7' genotype. Disclosed herein is a kit comprising cells demonstrating a Gcdh''
genotype following transduction with a disclosed viral vector. Disclosed herein is a kit comprising cells demonstrating a Aass" genotype following transduction with a disclosed viral vector. Disclosed herein is a kit comprising cells demonstrating a Gcdh7' and Aass7' genotype following transduction with a disclosed viral vector.
[0405] Disclosed herein is a kit comprising cells having a GCDH7' genotype. Disclosed herein is a kit comprising cells having a AASS7' genotype. Disclosed herein is a kit comprising cells having a GCDH7' and AASS7' genotype. Disclosed herein is a kit comprising cells demonstrating a GCDH7' genotype following transduction with a disclosed viral vector. Disclosed herein is a kit comprising cells demonstrating a AASS7' genotype following transduction with a disclosed viral vector. Disclosed herein is a kit comprising cells demonstrating a GCDH7' and AASS7' genotype following transduction with a disclosed viral vector.
[0406] Disclosed herein is a kit comprising cells transfected by a disclosed plasmid. Disclosed herein is a kit comprising cells transduced by a vector comprising the sequence set forth in SEQ ID NO: 19. Disclosed herein is a kit comprising cells transduced by a vector comprising the sequence set forth in SEQ ID NO:20. Disclosed herein is a kit comprising cells transduced by a vector comprising the sequence set forth in SEQ ID NO:21. Disclosed herein is a kit comprising one or more disclosed compositions and/or components and/or agents that can be used in any disclosed method.
[0407] Disclosed herein is a kit comprising one or more disclosed compositions and/or components and/or agents that can be used in validating and/or characterizing a disclosed composition (such as, for example, a disclosed isolated nucleic acid molecule, a disclosed plasmid, a disclosed viral vector, or any combination thereof). In an aspect, validating and/or characterizing can comprise using an animal model such as mice and/or C. elegans.
[0408] In an aspect of a disclosed kit, a disclosed fluorescent label or a fluorescent tag. In an aspect, a disclosed fluorescent label or disclosed fluorophore can comprise enhanced green fluorescent protein (EGFP), mEmerald, enhanced yellow fluorescent protein (EYFP), mApple, TdTomato, mCherry, miRFP670, any known fluorescent label or tag, or any combination thereof. Fluorophores and fluorescent labels are known in the art.
[0409] In an aspect, a disclosed kit can comprise at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose (such as, for example, performing any aspect of a disclosed method including preparing the components used in a disclosed method). Individual member components can be physically packaged together or separately. For example, a kit comprising an instruction for using the kit can or cannot physically include the instruction with other individual member components. Instead, the instruction can be
supplied as a separate member component, either in a paper form or an electronic form which can be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation. In an aspect, a kit for use in a disclosed method can comprise one or more containers holding a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, and a label or package insert with instructions for use. In an aspect, suitable containers include, for example, bottles, vials, syringes, blister pack, etc. The containers can be formed from a variety of materials such as glass or plastic. The container can hold a disclosed composition, a disclosed pharmaceutical formulation, a disclosed therapeutic agent, or a combination thereof, and can have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The label or package insert can indicate that a disclosed composition, a disclosed viral vector, a disclosed nucleic acid molecule, a disclosed cell, or a combination thereof, can be used in a disclosed method. A kit can comprise additional components necessary for administration such as, for example, other buffers, diluents, filters, needles, and syringes.
[0410] In an aspect, a disclosed kit can be used (i) to restore liver-specific modulation of lysine catabolism, (ii) to restore one or more aspects of lysine homeostasis in a subject’s liver, (iii) to reduce or decrease the level of toxic catabolites in the liver and/or brain of a subject, (iv) to restore the metabolic flux from glutaryl-CoA to crotonyl-CoA in a subject’s liver, (v) to improve motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) to improve memory function of a subject, (vii) to reduce anxiety in a subject, (viii) to reduce and/or prevent neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) to improve and/or reduce and/or eliminate vascular dysfunction in a subject, (x) to improve a subject’s quality of life, (xi) to increase and/or prolong a subject’s life span, (xii) to increase a subject’s survivability, or (xiii) to effect any combination thereof. In an aspect, a disclosed kit can be used treat and/or prevent Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed kit can be used to improve and/or diminish and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed kit can be used to improve and/or diminish and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject.
Methods Employing GCDH Nucleic Acid Molecules
Methods of Restoring the Expression of Glutaryl-CoA Dehydrogenase
[0411] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA
dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl- CoA dehydrogenase.
[0412] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl- CoA dehydrogenase in the subject’s liver.
[0413] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase. Disclosed herein is a method of restoring the expression of glutaryl- CoA dehydrogenase, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
[0414] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase. Disclosed herein is a method of restoring the expression of glutaryl- CoA dehydrogenase, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
[0415] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase. Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method comprising treating a subject in need thereof by administering to the subj ect a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression
of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
[0416] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase. Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver.
[0417] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase. Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the subject’s liver. In an aspect, the GCDH may be a variant GCDH sequence comprising one or more substitutions selected from K163R, K240R, K202R, OR K371R; the substitutions K163R and K240R; the substitutions K202R and K371R; or the substitutions selected K163R, K202R, K240R, and K371R. A nucleic acid sequence encoding the variant GCDH sequence may comprise the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, or SEQ ID NO: 196, or a variant thereof.
[0418] Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the sequence set forth in SEQ ID NO: 19, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase. Disclosed herein is a method of restoring the expression of glutaryl-CoA dehydrogenase, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the sequence set forth in
SEQ ID NO: 19, wherein expression of the nucleic acid sequence generates a functional glutaryl- CoA dehydrogenase in the subject’s liver.
[0419] In an aspect, a disclosed method can restore normal lysine catabolism in the subject’s liver. [0420] In an aspect, a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
[0421] In an aspect, a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
[0422] In an aspect, the expression of glutaryl-CoA dehydrogenase can be restored in the subject’s liver. In an aspect of a disclosed method, the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1). In an aspect, a subject can be male or female. In an aspect, a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
[0423] In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated behavior can be modulated. In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
[0424] In an aspect of a disclosed method, administering a disclosed viral vector can be administered systemically or directly. In an aspect, administering a disclosed viral vector molecule can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, administering a disclosed viral vector can be administered by any method of administration disclosed herein. In an aspect, a disclosed viral vector can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
[0425] In an aspect of a disclosed method, administering a disclosed viral vector can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
[0426] In an aspect, a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
[0427] In an aspect of a disclosed method, administering a disclosed viral vector can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired
therapeutic results. In an aspect, multiple doses can be administered via the same route or via differing routes of administration. In an aspect, a disclosed viral vector can be administered via multiple routes of administration.
[0428] In an aspect, a disclosed viral vector can comprise a recombinant AAV vector. In an aspect, a disclosed AAV vector can comprise AAVcc.47. In an aspect, a disclosed AAV vector can comprise AAV8.
[0429] In an aspect, a therapeutically effective amount of disclosed vector can comprise a range of about 1 x IO10 vg/kg to about 2 x 1014vg/kg. In an aspect, for example, a disclosed vector can be administered at a dose of about l x 1011 to about 8 x 1013 vg/kg or about 1 x 1012 to about 8 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1013 to about 6 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of at least about 1 x IO10, at least about 5 x IO10, at least about 1 x 1011, at least about 5 x 1011, at least about 1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of no more than about 1 x IO10, no more than about 5 x IO10, no more than about 1 x 1011, no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about 1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, restoring the expression of GA-1).
[0430] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or the treating step. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both.
[0431] In an aspect, modifying the treating step can comprise changing the amount of the vector administered to the subject, changing the frequency of administration of the vector, changing the duration of administration of the vector, changing the route of administration of the vector, or any combination thereof. In an aspect, modifying the administering step can comprise changing the amount of the vector administered to the subject, changing the frequency of administration of the vector, changing the duration of administration of the vector, changing the route of administration of the vector, or any combination thereof.
[0432] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0433] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. Therapeutic agents are known. In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators. In an aspect, the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof. [0434] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators. In an aspect, wherein in the absence of adverse effects following the administering of one or more therapeutic agents and/or immune modulators, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators. In an aspect, modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
[0435] In an aspect, a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering and/or treating step and/or following the administering and/or treating steps. In an aspect, a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments. In an aspect of a disclosed method, a clinician can use the
subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof. In an aspect, metabolic and/or physiologic data can inform the clinician.
[0436] In an aspect, techniques to monitor, measure, and/or assess the restoring of the expression of glutaryl-CoA dehydrogenase can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled. In an aspect, a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
[0437] In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)). In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40- 50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
[0438] In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)). In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50- 60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
[0439] In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise repeating an administering step one or more times. In an aspect, a
disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise repeating a treating step one or more times.
[0440] In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of a subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) improving memory function of a subject, (vii) reduce anxiety in a subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in a subject, (x) improving a subject’s quality of life, (xi) increasing and/or prolong a subject’s life span, (xii) increasing a subject’s survivability, or (xiii) any combination thereof.
[0441] In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of a subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
[0442] In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise treating and/or preventing Glutaric Aciduria Type-1 disease progression in a subject.
[0443] In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 disease progression in a subject.
[0444] In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 disease progression in a subject.
[0445] In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
[0446] In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise reprogramming a metabolic pathway. In an aspect, a disclosed
metabolic pathway can comprise lysine catabolism. In an aspect, a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
Methods of Treating and/or Preventing GA-1 Disease Progression
[0447] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored.
[0448] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
[0449] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of glutaryl-CoA dehydrogenase is restored. Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
[0450] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17, wherein expression of glutaryl-CoA dehydrogenase is restored. Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 18, wherein expression of glutaryl-CoA dehydrogenase is restored.
[0451] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored. Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising treating a subject in need thereof by administering to the subject a
therapeutically effective amount of a vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
[0452] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 01 or SEQ ID NO: 02, wherein expression of glutaryl-CoA dehydrogenase is restored. Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
[0453] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of glutaryl-CoA dehydrogenase is restored. Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, wherein expression of glutaryl-CoA dehydrogenase is restored in the subject’s liver.
[0454] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method treating a subject in need thereof by administering to the subject a therapeutically effective amount of a vector or viral vector comprising the sequence set forth in SEQ ID NO: 19, wherein expression of glutaryl-CoA dehydrogenase is restored.
[0455] In an aspect, a disclosed method can restore normal lysine catabolism in the subject’s liver. [0456] In an aspect, a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes. In an aspect, a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
[0457] In an aspect of a disclosed method, the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1). In an aspect, a subject can be male or female. In an aspect, a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
[0458] In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated behavior can be modulated. In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
[0459] In an aspect of a disclosed method, administering a disclosed viral vector can be administered systemically or directly. In an aspect, administering a disclosed viral vector molecule can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, administering a disclosed viral vector can be administered by any method of administration disclosed herein. In an aspect, a disclosed viral can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
[0460] In an aspect of a disclosed method, administering a disclosed viral vector can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase.
[0461] In an aspect, a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
[0462] In an aspect of a disclosed method, administering a disclosed viral vector can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results. In an aspect, multiple doses can be administered via the same route or via differing routes of administration. In an aspect, a disclosed viral vector can be administered via multiple routes of administration.
[0463] In an aspect, a disclosed viral vector can comprise a recombinant AAV vector. In an aspect, a disclosed AAV vector can comprise AAVcc.47. In an aspect, a disclosed AAV vector can comprise AAV8.
[0464] In an aspect, a therapeutically effective amount of disclosed vector can comprise a range of about 1 x 1010 vg/kg to about 2 x 1014vg/kg. In an aspect, for example, a disclosed vector can be administered at a dose of about l x 1011 to about 8 x 1013 vg/kg or about 1 x 1012 to about 8 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1013 to about 6 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of at least about 1 x 1010, at least about 5 x 1010, at least about 1 x 1011, at least about 5 x 1011, at least about
1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of no more than about 1 x IO10, no more than about 5 x IO10, no more than about 1 x 1011, no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about 1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, restoring the expression of GA-1).
[0465] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or the treating step. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both.
[0466] In an aspect, modifying the treating step can comprise changing the amount of the vector administered to the subject, changing the frequency of administration of the vector, changing the duration of administration of the vector, changing the route of administration of the vector, or any combination thereof. In an aspect, modifying the administering step can comprise changing the amount of the vector administered to the subject, changing the frequency of administration of the vector, changing the duration of administration of the vector, changing the route of administration of the vector, or any combination thereof.
[0467] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0468] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. Therapeutic agents are known. In an
aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators. In an aspect, the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof. [0469] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators. In an aspect, wherein in the absence of adverse effects following the administering of one or more therapeutic agents and/or immune modulators, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators. In an aspect, modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
[0470] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L- lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0471] In an aspect, a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering and/or treating step and/or following the administering and/or treating steps. In an aspect, a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments. In an aspect of a disclosed method, a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a
disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof. In an aspect, metabolic and/or physiologic data can inform the clinician.
[0472] In an aspect, techniques to monitor, measure, and/or assess the restoring of the expression of glutaryl-CoA dehydrogenase can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. In an aspect, a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
[0473] In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)). In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40- 50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
[0474] In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)). In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50- 60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector)).
[0475] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating an administering step one or more times. In an aspect, a disclosed method of restoring the expression of glutaryl-CoA dehydrogenase can comprise repeating a treating step one or more times.
[0476] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of a subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl- CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of a subject, (vi) improving memory function of a subject, (vii) reduce anxiety in a subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in a subject, (x) improving a subject’s quality of life, (xi) increasing and/or prolong a subject’s life span, (xii) increasing a subject’s survivability, or (xiii) any combination thereof.
[0477] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring expression of glutaryl-CoA dehydrogenase. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of treating and/or preventing GA-1 can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of treating and/or preventing GA- 1 disease progression can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise reprogramming a metabolic pathway. In an aspect, a disclosed metabolic pathway can comprise lysine catabolism. In an aspect, a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
Methods Employing CRISPR Based Nucleic Acid Molecules
Methods of Reprogramming a Metabolic Pathway
[0478] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
[0479] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a
target sequence in a target gene of interest, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
[0480] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:20 or SEQ ID NO:21.
[0481] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of aminoadipate-semialdehyde synthase gene.
[0482] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:07 - SEQ ID NO:09, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of aminoadipate- semialdehyde synthase gene.
[0483] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target the glutaryl-CoA dehydrogenase gene.
[0484] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the target gene comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, and wherein
the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
[0485] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the target gene comprises the aminoadipatesemialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, and wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
[0486] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and administering a therapeutically effective amount of a second viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
[0487] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and administering a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at the target gene of interest.
[0488] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:20, and administering to the subject a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:21.
[0489] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; and administering to the subject a therapeutically effective amount of a second viral vector comprising a nucleic acid
sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
[0490] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; and administering to the subject a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease of the first viral vector and/or the Cas9 endonuclease of the second viral vector comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:09 or SEQ ID NO: 10, and wherein the sgRNA of the second viral vector comprises the sequence set forth in SEQ ID NO: 07 or SEQ ID NO: 08.
[0491] In an aspect, a disclosed sgRNA can be directed at any functional domain of a target sequence.
[0492] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene; and administering to a the subject a therapeutically effective amount of a second viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
[0493] In an aspect, a disclosed method can restore normal lysine catabolism in the subject’s liver. [0494] In an aspect, a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes. For example, in an aspect, a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene, or any combination thereof.
[0495] In an aspect of a disclosed method, the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1). In an aspect, a subject can be male or female. In an aspect, a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
[0496] In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated behavior can be modulated. In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
[0497] In an aspect of a disclosed method, administering a disclosed viral vector can be administered systemically or directly. In an aspect, administering a disclosed viral vector molecule can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, administering a disclosed viral vector can be administered by any method of administration disclosed herein. In an aspect, a disclosed viral can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
[0498] In an aspect of a disclosed method, administering a disclosed viral vector can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence eliminates aminoadipatesemialdehyde synthase.
[0499] In an aspect, a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
[0500] In an aspect of a disclosed method, administering a disclosed viral vector can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results. In an aspect, multiple doses can be administered via the same route or via differing routes of administration. In an aspect, a disclosed viral vector can be administered via multiple routes of administration.
[0501] In an aspect, the first viral vector and the second viral vectors can be concurrently and/or sequentially administered to the subject. In an aspect, the first viral vector and the second viral vectors can be administered to the subject via the same route of administration and/or via a different route of administration.
[0502] In an aspect, a disclosed viral vector can comprise a recombinant AAV vector. In an aspect, a disclosed AAV vector can comprise AAVcc.47. In an aspect, a disclosed AAV vector can comprise AAV8.
[0503] In an aspect, a therapeutically effective amount of disclosed viral vector can comprise a range of about 1 x 1010 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed vector can be administered at a dose of about 1 x 1011 to about 8 x 1013 vg/kg or about 1 x 1012 to about 8 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1013 to about 6 x 1013 vg/kg. In an aspect, a disclosed vector can be administered at a dose of at least about 1 x 1010, at least about 5 x 1010, at least about 1 x 1011, at least about 5 x 1011, at least about
1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of no more than about 1 x IO10, no more than about 5 x IO10, no more than about 1 x 1011, no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about 1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
[0504] In an aspect, a therapeutically effective amount of disclosed second vector can comprise a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed second vector can be administered at a dose of about 1 x 1011 to about 8 x 1013 vg/kg or about 1 x 1012 to about 8 x 1013 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of about 1 x 1013 to about 6 x 1013 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of at least about 1 x IO10, at least about 5 x IO10, at least about 1 x 1011, at least about 5 x 1011, at least about 1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of no more than about 1 x IO10, no more than about 5 x IO10, no more than about 1 x 1011, no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about 1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
[0505] In an aspect, a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps. In an aspect, a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments. In an aspect of a disclosed method, a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed
composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof. In an aspect, metabolic and/or physiologic data can inform the clinician.
[0506] In an aspect, techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person and are discussed supra.
[0507] In an aspect, a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
[0508] In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)). In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
[0509] In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)). In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
[0510] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse
effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both. [0511] In an aspect, modifying the treating step can comprise changing the amount of the first vector and/or the second vector administered to the subject, changing the frequency of administration of the first vector and/or the second vector, changing the duration of administration of the first vector and/or the second vector, changing the route of administration of the first vector and/or the second vector, or any combination thereof. In an aspect, modifying the administering step can comprise changing the amount of the first vector and/or the second vector administered to the subject, changing the frequency of administration of the first vector and/or the second vector, changing the duration of administration of the first vector and/or the second vector, changing the route of administration of the first vector and/or the second vector, or any combination thereof.
[0512] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0513] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. Therapeutic agents are known.
[0514] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators. In an aspect, the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof. Immune modulators are known to the art.
[0515] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators. In an aspect, wherein in the absence of adverse effects following the administering of one or more therapeutic agents and/or immune modulators, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an
aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators. In an aspect, modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
[0516] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0517] In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise repeating an administering step one or more times. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise repeating a treating step one or more times. For example, in an aspect, a disclosed method can repeat the administering of a first disclosed vector one or more times, can repeat the administering of a second disclosed vector one or more times, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
[0518] In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and
I l l
combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the subject’s quality of life, (xi) increasing and/or prolong the subject’s life span, (xii) increasing a subject’s survivability, or (xiii) any combination thereof.
[0519] In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise treating and/or preventing Glutaric Aciduria Type-1 in a subj ect. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
[0520] In an aspect, a disclosed metabolic pathway can comprise lysine catabolism. In an aspect, a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
Methods of Treating and/or Preventing GA-1 Disease Progression
[0521] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene,
[0522] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene
[0523] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:20, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene. Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:21, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
[0524] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene. [0525] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease comprises the sequence of SEQ ID NO:28, and wherein the sgRNA comprises the sequence set forth in any one of SEQ ID NO:06 - SEQ ID NO: 10, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of aminoadipate-semialdehyde synthase gene.
[0526] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at glutaryl-CoA dehydrogenase; wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the glutaryl-CoA dehydrogenase gene.
[0527] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene, wherein the target gene comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
[0528] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene, wherein the target gene comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing
protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene.
[0529] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system, and administering a therapeutically effective amount of a second viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system.
[0530] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a first viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest, and administering a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in the target gene of interest.
[0531] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:20, and administering to the subject a therapeutically effective amount of a viral vector comprising the sequence set forth in SEQ ID NO:21.
[0532] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; and administering to the subj ect a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene.
[0533] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; and administering to the subject a therapeutically effective amount of a second viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease of the first viral vector
and/or the Cas9 endonuclease of the second viral vector comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:09 or SEQ ID NO: 10, and wherein the sgRNA of the second viral vector comprises the sequence set forth in SEQ ID NO:07 or SEQ ID NO:08. In an aspect, a disclosed sgRNA can be directed at any functional domain of a target sequence.
[0534] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at glutaryl-CoA dehydrogenase; and administering to a the subject a therapeutically effective amount of a second viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene.
[0535] In an aspect, a disclosed method can restore normal lysine catabolism in the subject’s liver. [0536] In an aspect, a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes. For example, in an aspect, a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene, or any combination thereof.
[0537] In an aspect of a disclosed method, the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1). In an aspect, a subject can be male or female. In an aspect, a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
[0538] In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated behavior can be modulated. In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
[0539] In an aspect of a disclosed method, administering a disclosed viral vector can be administered systemically or directly. In an aspect, administering a disclosed viral vector molecule can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, administering a disclosed viral vector can be administered by any method of administration disclosed herein. In an aspect, a disclosed viral can be administered via multiple routes either
concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
[0540] In an aspect of a disclosed method, administering a disclosed viral vector can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence eliminates aminoadipatesemialdehyde synthase.
[0541] In an aspect, a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
[0542] In an aspect of a disclosed method, administering a disclosed viral vector and/or a disclosed viral vector can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results. In an aspect, multiple doses can be administered via the same route or via differing routes of administration. In an aspect, a disclosed viral vector can be administered via multiple routes of administration.
[0543] In an aspect, the first viral vector and the second viral vectors can be concurrently and/or sequentially administered to the subject. In an aspect, the first viral vector and the second viral vectors can be administered to the subject via the same route of administration and/or via a different route of administration.
[0544] In an aspect, a disclosed viral vector can comprise a recombinant AAV vector. In an aspect, a disclosed AAV vector can comprise AAVcc.47. In an aspect, a disclosed AAV vector can comprise AAV8.
[0545] In an aspect, a therapeutically effective amount of a disclosed first vector can comprise a range of about l x IO10 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed first vector can be administered at a dose of about 1 x 1011 to about 8 x 1013 vg/kg or about 1 x 1012 to about 8 x 1013 vg/kg. In an aspect, a disclosed first vector can be administered at a dose of about 1 x 1013 to about 6 x 1013 vg/kg. In an aspect, a disclosed first vector can be administered at a dose of at least about 1 x IO10, at least about 5 x IO10, at least about 1 x 1011, at least about 5 x 1011, at least about 1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed first vector can be administered at a dose of no more than about 1 x IO10, no more than about 5 x IO10, no more than about 1 x 1011, no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about
1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed first vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed first vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed first vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5,
6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
[0546] In an aspect, a therapeutically effective amount of a disclosed second vector can comprise a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg. In an aspect, for example, a disclosed second vector can be administered at a dose of about 1 x 1011 to about 8 x 1013 vg/kg or about 1 x 1012 to about 8 x 1013 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of about 1 x 1013 to about 6 x 1013 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of at least about 1 x IO10, at least about 5 x IO10, at least about 1 x 1011, at least about 5 x 1011, at least about 1 x 1012, at least about 5 x 1012, at least about 1 x 1013, at least about 5 x 1013, or at least about 1 x 1014 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of no more than about 1 x IO10, no more than about 5 x IO10, no more than about 1 x 1011, no more than about 5 x 1011, no more than about 1 x 1012, no more than about 5 x 1012, no more than about 1 x 1013, no more than about 5 x 1013, or no more than about 1 x 1014 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of about 1 x 1012 vg/kg. In an aspect, a disclosed second vector can be administered at a dose of about 1 x 1011 vg/kg. In an aspect, a disclosed first vector can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results (such as for example, reprogramming a metabolic pathway).
[0547] In an aspect, a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps. In an aspect, a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments. In an aspect of a disclosed method, a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof. In an aspect, metabolic and/or physiologic data can inform the clinician.
[0548] In an aspect, techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person.
[0549] In an aspect, a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized
tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
[0550] In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)). In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
[0551] In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)). In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
[0552] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both. [0553] In an aspect, modifying the treating step can comprise changing the amount of the first vector and/or the second vector administered to the subject, changing the frequency of administration of the first vector and/or the second vector, changing the duration of administration of the first vector and/or the second vector, changing the route of administration of the first vector and/or the second vector, or any combination thereof. In an aspect, modifying the administering step can comprise changing the amount of the first vector and/or the second vector administered to the subject, changing the frequency of administration of the first vector and/or the second
vector, changing the duration of administration of the first vector and/or the second vector, changing the route of administration of the first vector and/or the second vector, or any combination thereof.
[0554] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0555] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. Therapeutic agents are known.
[0556] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators. In an aspect, the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof. Immune modulators are known to the art.
[0557] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators. In an aspect, wherein in the absence of adverse effects following the administering of one or more therapeutic agents and/or immune modulators, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators. In an aspect, modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
[0558] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0559] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating an administering step one or more times. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise repeating a treating step one or more times. For example, in an aspect, a disclosed method can repeat the administering of a first disclosed vector one or more times, can repeat the administering of a second disclosed vector one or more times, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
[0560] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl- CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the subject’s quality of life, (xi) increasing and/or prolong the subject’s life span, (xii) increasing a subject’s survivability, or (xiii) any combination thereof.
[0561] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the
metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
[0562] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise reprogramming a metabolic pathway in a subj ect. In an aspect, a disclosed metabolic pathway can comprise lysine catabolism. In an aspect, a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of treating and/or preventing GA- 1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression pathway can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject.
Methods Employing Hepatocyte Transplantation
Methods of Treating and/or Preventing GA-1 Disease Progression
[0563] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount
of hepatocytes, wherein the hepatocytes are GCDH /AASS , and wherein one or more aspects of metabolic function is restored.
[0564] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising restoring one or more aspects of metabolic function by administering to a subject in need thereof a therapeutically effective amount of hepatocytes, wherein the hepatocytes are GCDH+/+/AASS+/+.
[0565] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising restoring one or more aspects of lysine metabolism by administering to a subject in need thereof a therapeutically effective amount of hepatocytes, wherein the hepatocytes are GCDH+/+/AASS+/+.
[0566] In an aspect, a disclosed method can restore normal lysine catabolism in the subject’s liver. [0567] In an aspect, a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
[0568] In an aspect, a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the
peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
[0569] In an aspect of a disclosed method, the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1). In an aspect, a subject can be male or female. In an aspect, a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
[0570] In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated behavior can be modulated. In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
[0571] In an aspect of a disclosed method, administering a disclosed therapeutically effective amount of hepatocytes can be administered systemically or directly. In an aspect, administering a disclosed therapeutically effective amount of hepatocytes can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, administering a disclosed therapeutically effective amount of hepatocytes can be administered by any method of administration disclosed herein. In an aspect, a disclosed therapeutically effective amount of hepatocytes can be administered via multiple routes either concurrently or sequentially. A disclosed therapeutically effective amount of hepatocytes can be administered directly into the subject’s spleen and/or directly into the subject’s liver. A skilled clinician can determine the best route of administration for a subject at a given time. In an aspect of a disclosed method, administering a disclosed therapeutically effective amount of hepatocytes can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results. In an aspect, multiple doses can be administered via the same route or via differing routes of administration. In an aspect, a disclosed therapeutically effective amount of hepatocytes can be administered via multiple routes of administration.
[0572] In an aspect, a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
[0573] In an aspect, a disclosed therapeutically effective amount of hepatocytes can comprise about 10 x 107 to about 10 x 1010 hepatocytes.
[0574] In an aspect, a disclosed therapeutically effective amount can be infused through a portalvein catheter. In an aspect, a disclosed infusion can occur over time. In an aspect, for example, a disclosed infusion time can comprise about 5 hours to about 25 hours, or about 5 hours to about 20 hours, or about 5 hours to about 15 hours, or about 5 hours to about 10 hours. In an aspect, a
disclosed infusion time can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more hours.
[0575] In an aspect, a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps. In an aspect, a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments. In an aspect of a disclosed method, a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer disclosed hepatocytes, a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof. In an aspect, metabolic and/or physiologic data can inform the clinician.
[0576] In an aspect, techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person and are discussed supra.
[0577] In an aspect, a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
[0578] In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)). In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed viral vector or both disclosed viral vectors)).
[0579] In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a
disclosed treatment (e.g., administration of a disclosed therapeutically effective amount of hepatocytes)). In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10- 20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed therapeutically effective amount of hepatocytes)).
[0580] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both. [0581] In an aspect, modifying the treating step can comprise changing the amount of hepatocytes administered to the subject, changing the frequency of administration of hepatocytes, changing the duration of administration of hepatocytes, changing the route of administration of hepatocytes, or any combination thereof.
[0582] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0583] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. Therapeutic agents are known.
[0584] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators. In an aspect, the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof. Immune modulators are known to the art.
[0585] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators. In an aspect, wherein in the absence of adverse effects following the administering of one or more therapeutic agents and/or immune modulators, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators. In an aspect, modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
[0586] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0587] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating an administering step one or more times. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise repeating a treating step one or more times. For example, in an aspect, a disclosed method can repeat the administering of a disclosed therapeutically effective amount of hepatocytes one or more times, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
[0588] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-
CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the subject’s quality of life, (xi) increasing and/or prolong the subject’s life span, (xii) increasing a subject’s survivability, or (xiii) any combination thereof.
[0589] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
[0590] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise reprogramming a metabolic pathway in a subject. In an aspect, a disclosed metabolic pathway can comprise lysine catabolism. In an aspect, a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
[0591] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject.
[0592] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression pathway can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression, the method can further comprise administering a disclosed vector.
[0593] For example, in an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can further comprise administering to the subject (i) a disclosed vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase; (ii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02; (iii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18; (iv) a disclosed vector or viral vector comprising the sequence set forth in SEQ ID NO: 19; (v) a disclosed first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system with a second disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic
acid sequence encoding one or more element of a gene editing system; (vi) first disclosed viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest and a second disclosed viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in the target gene of interest; (vii) a disclosed viral vector comprising the sequence set forth in SEQ ID NO:20, and a disclosed viral vector comprising the sequence set forth in SEQ ID NO:21; (viii) a disclosed first viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene and a second disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; (ix) a first disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene and a second disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease of the first viral vector and/or the Cas9 endonuclease of the second viral vector comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:09 or SEQ ID NO: 10, and wherein the sgRNA of the second viral vector comprises the sequence set forth in SEQ ID NO:07 or SEQ ID NO: 08; (x) adisclosed first viral vector comprising the sequence comprising anucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene and a disclosed second viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene; (xi) a disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system; or (xii) any combination thereof.
Methods Employing siRNA or mRNA Therapy
Methods of Reprogramming a Metabolic Pathway
[0594] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a disclosed siRNA or a disclosed formulation comprising a disclosed siRNA.
[0595] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a disclosed mRNA therapy or a disclosed formulation comprising a disclosed mRNA therapy.
[0596] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of siRNA targeting aminoadipate-semialdehyde synthase.
[0597] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subj ect in need thereof a therapeutically effective amount of mRNA therapy targeting an aspect of the lysine catabolism pathway.
[0598] Disclosed herein is a method of reprogramming a metabolic pathway, the method comprising administering to a subj ect in need thereof a therapeutically effective amount of mRNA therapy targeting an aspect of the lysine catabolism pathway, wherein the aspect of the lysine catabolism pathway comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene, and wherein the expression of the nucleic acid molecule disrupts the expression and/or function of the target gene.
[0599] In an aspect, a disclosed siRNA can target or can be directed at one or more enzymes in the pipecolate pathway, the saccharopine pathway, or both. In an aspect, a disclosed siRNA can target or can be directed at the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5- carboxylate reductase gene, or any combination thereof. In an aspect, a disclosed siRNA can target a sequence in SEQ ID NO:35 or SEQ ID NO:36. In an aspect, a disclosed siRNA can target a sequence in SEQ ID NO:38 or SEQ ID NO:39. In an aspect, a disclosed siRNA can comprise the sequence set forth in SEQ ID NO:33 or SEQ ID NO:34.
[0600] In an aspect, a disclosed mRNA therapy can target or can be directed one or more enzymes in the pipecolate pathway, the saccharopine pathway, or both.
[0601] In an aspect, a disclosed mRNA therapy can target or can be directed at the aminoadipate- semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
[0602] In an aspect, the disclosed silencing oligonucleotide (e.g., siRNA or an antisense oligonucleotide) and/or the disclosed mRNA therapy can be encapsulated in lipid nanoparticles.
Lipid nanoparticles are known to the skilled person. In an aspect, a disclosed lipid nanoparticle can comprise a commercially available formulation such as, for example, Invivolipofectamine.
[0603] In an aspect, the disclosed silencing oligonucleotide (e.g., siRNA or an antisense oligonucleotide) can be conjugated to a tissue-targeting moiety. The tissue-targeting moiety may be liver-tissue specific. The tissue targeting moiety may comprise one or more GalNAc, optionally two GalNAc (e.g. a GalNAc dimer) or three GalNAc (e.g., a GalNAc trimer).
[0604] In an aspect of a disclosed method, the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1). In an aspect, a subject can be male or female. In an aspect, a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
[0605] In an aspect, a disclosed method using siRNA and/or mRNA therapy can restore normal lysine catabolism in the subject’s liver.
[0606] In an aspect, a disclosed method can further comprise deleting and/or disrupting one or more other catabolic genes.
[0607] In an aspect, a disclosed method can further comprise deleting and/or disrupting the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5-carboxylate reductase gene, or any combination thereof.
[0608] In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated behavior can be modulated. In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
[0609] In an aspect of a disclosed method, administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered systemically or directly. In an aspect, administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered by any method of administration disclosed herein. In an aspect, a disclosed siRNA, a disclosed formulation
comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
[0610] In an aspect of a disclosed method, administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results. In an aspect, multiple doses can be administered via the same route or via differing routes of administration. In an aspect, a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered via multiple routes of administration.
[0611] In an aspect, a therapeutically effective amount of siRNA can comprise about 0.01 mg/kg to about 100 mg/kg, or about 0.5 mg/kg to about 75 mg/kg, or about 0.1 mg/kg to about 50 mg/kg, or any amount in that range. In an aspect, a therapeutically effective amount of siRNA can comprise about 0.2 mg/kg to about 50 mg/kg.
[0612] In an aspect, a therapeutically effective amount of mRNA therapy can comprise about 0.001 mg/kg to about 100 mg/kg, or about 0.050 mg/kg to about 75 mg/kg, or about 0.01 mg/kg to about 50 mg/kg, or any amount in that range. In an aspect, a therapeutically effective amount of siRNA can comprise about 0.01 mg/kg to about 50 mg/kg.
[0613] In an aspect, a disclosed method can further comprise monitoring the subj ect’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps. In an aspect, a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments. In an aspect of a disclosed method, a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof. In an aspect, metabolic and/or physiologic data can inform the clinician.
[0614] In an aspect, techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person and are discussed supra.
[0615] In an aspect, a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
[0616] In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)). In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
[0617] In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)). In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70- 80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
[0618] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse
effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both. [0619] In an aspect, modifying the treating step can comprise changing the amount of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof to the subject, changing the frequency of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the duration of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the route of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, or any combination thereof.
[0620] In an aspect, modifying the administering step can comprise changing the amount of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof administered to the subject, changing the frequency of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the duration of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the route of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, or any combination thereof.
[0621] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one
or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0622] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. Therapeutic agents are known.
[0623] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators. In an aspect, the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof. Immune modulators are known to the art.
[0624] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of one or more immune modulators. In an aspect, wherein in the absence of adverse effects following the administering of one or more therapeutic agents and/or immune modulators, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators. In an aspect, modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
[0625] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more amino acides in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0626] In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise repeating an administering step one or more times. In an aspect, a disclosed method of
reprogramming a metabolic pathway can comprise repeating a treating step one or more times. For example, in an aspect, a disclosed method can repeat the administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
[0627] In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the subject’s quality of life, (xi) increasing and/or prolong the subject’s life span, (xii) increasing a subject’s survivability, or (xiii) any combination thereof.
[0628] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii) restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
[0629] In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise treating and/or preventing Glutaric Aciduria Type-1 in a subj ect. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of reprogramming a metabolic pathway can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subj ect.
[0630] In an aspect, a disclosed metabolic pathway can comprise lysine catabolism. In an aspect, a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway.
[0631] For example, in an aspect, a disclosed method of reprogramming a metabolic pathway can further comprise administering to the subject (i) a disclosed vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase; (ii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02; (iii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18; (iv) a disclosed vector or viral vector comprising the sequence set forth in SEQ ID NO: 19; (v) a disclosed first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system with a second disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system; (vi) first disclosed viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest and a second disclosed viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in the target gene of interest; (vii) a disclosed viral vector comprising the sequence set forth in SEQ ID NO:20, and a disclosed viral vector comprising the sequence set forth in SEQ ID NO:21; (viii) a disclosed first viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene and a second disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; (ix) a first disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene and a second disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease of the first viral vector and/or the Cas9 endonuclease of the second viral vector comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:09 or SEQ ID NO: 10, and wherein the sgRNA of the second viral vector comprises the sequence set forth in SEQ ID NO:07 or SEQ ID NO:08; (x) a disclosed first viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl- CoA dehydrogenase gene and a disclosed second viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence
in the glutaryl-CoA dehydrogenase gene; (xi) a disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system; or (xii) any combination thereof.
Methods of Treating and/or Preventing GA-1 Disease Progression
[0632] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a disclosed siRNA and/or a disclosed formulation comprising a disclosed siRNA.
[0633] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of a disclosed mRNA therapy and/or a disclosed formulation comprising a disclosed mRNA therapy.
[0634] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of silencing oligo nucleotide (e.g., siRNA or an antisense oligonucleotide) targeting aminoadipatesemialdehyde synthase.
[0635] Disclosed herein is a method of treating and/or preventing GA-1 disease progression, the method comprising administering to a subject in need thereof a therapeutically effective amount of mRNA therapy targeting an aspect of the lysine catabolism pathway.
[0636] Disclosed herein is an siRNA that can target any part of the aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36. Disclosed herein is an siRNA that can target any part of an aminoadipate-semialdehyde synthase gene comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39. In an aspect, a targeted part of an AASS sequence can comprise about 15 to about 35 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 20 to about 30 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 20 to about 24 base pairs. In an aspect, a targeted part of an AASS sequence can comprise about 21 to about 22 base pairs. In an aspect, a disclosed siRNA effects the complete silencing of the aminoadipate-semialdehyde synthase gene. Disclosed herein is an siRNA that can target any part of an the aminoadipate-semialdehyde synthase sequence comprising the sequence set forth in SEQ ID NO:35 or SEQ ID NO:36. Disclosed herein is an siRNA that can target any part of the aminoadipate-semialdehyde synthase sequence comprising the sequence set forth in SEQ ID NO:38 or SEQ ID NO:39.
[0637] In an aspect, a disclosed mRNA therapy can target or can be directed one or more enzymes in the pipecolate pathway, the saccharopine pathway, or both.
[0638] In an aspect, the disclosed siRNA can be encapsulated in lipid nanoparticles. Lipid nanoparticles are known to the skilled person. In an aspect, a disclosed lipid nanoparticle can comprise a commercially available formulation such as, for example, Invivolipofectamine. In an aspect, the disclosed siRNA can be conjugated to a tissue-targeting moiety. The tissue-targeting moiety may be liver-tissue specific. The tissue targeting moiety may comprise one or more GalNAc, optionally two GalNAc (e.g. a GalNAc dimer) or three GalNAc (e.g., a GalNAc trimer). The tissue targeting moiety may be, but not limited to, antibodies or other peptides and sugar moieties.
[0639] In an aspect of a disclosed method, the disclosed subject in need thereof can have or can have been diagnosed with a glutaric aciduria type 1 (GA-1). In an aspect, a subject can be male or female. In an aspect, a subject can be an adult, a teenager, an adolescent, a child, a toddler, a baby, or an infant.
[0640] In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated behavior can be modulated. In an aspect of a disclosed method, the disclosed subject’s GA-1 related and/or associated physiology can be modulated.
[0641] In an aspect of a disclosed method, administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered systemically or directly. In an aspect, administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can comprise oral administration, intravenous administration, intratumoral administration, intraperitoneal administration, or any combination thereof. In an aspect, administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered by any method of administration disclosed herein. In an aspect, a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered via multiple routes either concurrently or sequentially. A skilled clinician can determine the best route of administration for a subject at a given time.
[0642] In an aspect of a disclosed method, administering a disclosed siRNA can be targeted to the subject’s liver, wherein expression of the nucleic acid sequence eliminates aminoadipatesemialdehyde synthase.
[0643] In an aspect, a disclosed nucleic acid sequence can comprise only the sequence for the functional domains.
[0644] In an aspect of a disclosed method, administering a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can comprise a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results. In an aspect, multiple doses can be administered via the same route or via differing routes of administration. In an aspect, a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof can be administered via multiple routes of administration.
[0645] In an aspect, a disclosed method can further comprise monitoring the subject’s metabolic and/or physiologic improvement following the administering step and/or following the administering steps. In an aspect, a clinician can measure and/or determine the subject’s metabolic and/or physiologic status over time to identify one or more improvements and/or one or more diminishments. In an aspect of a disclosed method, a clinician can use the subject’s metabolic and/or physiologic status and/or the trend of the subject’s metabolic and/or physiological status and/or trend to make a treatment decision and/or to modify an aspect of a disclosed method and/or to continue treating the subject and/or continue to administer a disclosed vector, a disclosed composition, a disclosed therapeutic agent, and/or a disclosed immune modulator, or any combination thereof. In an aspect, metabolic and/or physiologic data can inform the clinician.
[0646] In an aspect, techniques to monitor, measure, and/or assess the reprogramming a metabolic pathway can comprise qualitative (or subjective) means as well as quantitative (or objective) means. These means are known to the skilled person. In an aspect, a disclosed method can comprise subjecting the subject to one or more invasive or non-invasive diagnostic assessments. Diagnostic assessments are known to the art. In an aspect, a disclosed non-invasive diagnostic assessment can comprise x-rays, computerized tomography (CT) scans, magnetic resonance imaging (MRI) scans, ultrasounds, positron emission tomography (PET) scans, or any combination thereof. In an aspect, a disclosed invasive diagnostic assessment can comprise a tissue biopsy or exploratory surgery.
[0647] In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of an increase and/or improvement when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising
a disclosed mRNA therapy, or any combination thereof)). In an aspect, a disclosed increase and/or a disclosed improvement can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, or 90-100% or any amount of an increase and/or improvement when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
[0648] In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any amount of a decrease and/or reduction when compared to a control subject (such as, for example, a subject that has not received a disclosed treatment (e.g., administration a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)). In an aspect, a disclosed decrease and/or a disclosed reduction can comprise a 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70- 80%, 80-90%, or 90-100% or any amount of a decrease and/or reduction when compared to a control subject (such as a subject that has not received a disclosed treatment (e.g., administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof)).
[0649] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering step and/or following the administering steps. In an aspect, wherein in the absence of adverse effects, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the treating step, modifying the administering step, or both. [0650] In an aspect, modifying the treating step can comprise changing the amount of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof administered to the subject, changing the frequency of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the duration of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the route of administration of a disclosed siRNA,
a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, or any combination thereof.
[0651] In an aspect of a disclosed method, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product of any enzyme in the lysine catabolism pathways (i.e., the pipecolate pathway and the saccharopine pathway). In an aspect, these enzymes can include, but are not limited to aminoadipate-semialdehyde synthase, a-aminoadipic semialdehyde, the kynurenine aminotransferase 2, the dehydrogenase El and transketolase domain-containing protein 1, the L-lysine alpha-oxidase, the ketimine reductase mu-crystallin protein, the peroxisomal sarcosine oxidase, or the pyrroline-5-carboxylate reductase, or any combination thereof. In an aspect, for example, a disclosed CRISPR/Cas9 editing system can be applied to one or more gene or gene product in a disclosed enzyme comprising the sequence set forth in SEQ ID NO:03 or SEQ ID NO:04 or SEQ ID NO:37 or SEQ ID NO:40.
[0652] In an aspect, modifying the administering step can comprise changing the amount of a disclosed siRNA and/or a disclosed formulation comprising a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof administered to the subject, changing the frequency of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the duration of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, changing the route of administration of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, or any combination thereof.
[0653] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of a therapeutic agent. Therapeutic agents are known.
[0654] In an aspect, a disclosed method can further comprise administering to the subject a therapeutically effective amount of one or more immune modulators. In an aspect, the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof. Immune modulators are known to the art.
[0655] In an aspect, a disclosed method can further comprise monitoring the subject for adverse effects following the administering of one or more therapeutic agents and/or the administering of
one or more immune modulators. In an aspect, wherein in the absence of adverse effects following the administering of one or more therapeutic agents and/or immune modulators, the method can further comprise continuing to treat the subject and/or continuing to monitor the subject. In an aspect, wherein in the presence of adverse effects, the method can further comprise modifying one or more steps of the method. In an aspect, modifying can comprise modifying the administering step of one or more therapeutic agents and/or immune modulators. In an aspect, modifying the administering step can comprise changing the amount of one or more therapeutic agents and/or immune modulators administered to the subject, changing the frequency of administration of one or more therapeutic agents and/or immune modulators, changing the duration of administration of the vector, changing the route of administration of one or more therapeutic agents and/or immune modulators, or any combination thereof.
[0656] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating an administering step one or more times. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise repeating a treating step one or more times. For example, in an aspect, a disclosed method can repeat the administering of a disclosed siRNA, a disclosed formulation comprising a disclosed siRNA, a disclosed mRNA therapy, or a disclosed formulation comprising a disclosed mRNA therapy, or any combination thereof, can repeat the administering of one or more therapeutic agents one or more times, can repeat the administering of one or more immune modulators one or more times, or any combination thereof.
[0657] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism, (ii) restoring one or more aspects of lysine homeostasis, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl- CoA, (v) improving motor performance (e.g., strength, gait, balance, coordination, and combinations thereof) of the subject, (vi) improving memory function of the subject, (vii) reduce anxiety in the subject, (viii) reducing and/or preventing neurological sequelae (e.g., neonatal macrocephaly, subdural hematomas, acute retinal hemorrhage, encephalopathy, striatal necrosis, and combinations thereof), (ix) improving and/or reducing and/or eliminating vascular dysfunction in the subject, (x) improving the subject’s quality of life, (xi) increasing and/or prolong the subject’s life span, (xii) increasing a subject’s survivability, or (xiii) any combination thereof.
[0658] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring liver-specific modulation of lysine catabolism in the subject’s liver, (ii)
restoring one or more aspects of lysine homeostasis in the subject’s liver, (iii) reducing and/or decreasing the level of toxic catabolites in the liver and/or brain of the subject, (iv) restoring the metabolic flux from glutaryl-CoA to crotonyl-CoA in the subject’s liver, or (v) any combination thereof.
[0659] In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise treating and/or preventing Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more symptoms associated Glutaric Aciduria Type- 1 in a subject. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise improving and/or diminishing and/or ameliorate one or more pathologies associated with Glutaric Aciduria Type-1 in a subject. In an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can comprise restoring one or more aspects of cellular homeostasis and/or cellular functionality in a subject. In an aspect, a disclosed metabolic pathway can comprise lysine catabolism. In an aspect, a disclosed metabolic pathway can comprise a disclosed pipecolate pathway and/or a disclosed saccharopine pathway. [0660] For example, in an aspect, a disclosed method of treating and/or preventing GA-1 disease progression can further comprise administering to the subject (i) a disclosed vector or viral vector comprising a nucleic acid sequence encoding glutaryl-CoA dehydrogenase; (ii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO:01 or SEQ ID NO:02; (iii) a disclosed vector or viral vector comprising the nucleic acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18; (iv) a disclosed vector or viral vector comprising the sequence set forth in SEQ ID NO: 19; (v) a disclosed first viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system with a second disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system; (vi) first disclosed viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in a target gene of interest and a second disclosed viral vector comprising a nucleic acid sequence encoding an endonuclease and a sgRNA directed at a target sequence in the target gene of interest; (vii) a disclosed viral vector comprising the sequence set forth in SEQ ID NO:20, and a disclosed viral vector comprising the sequence set forth in SEQ ID NO:21; (viii) a disclosed first viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene and a second disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene; (ix) a first
disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene and a second disclosed viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase gene, wherein the Cas9 endonuclease of the first viral vector and/or the Cas9 endonuclease of the second viral vector comprises the sequence of SEQ ID NO:28, and wherein the sgRNA of the first viral vector comprises the sequence set forth in SEQ ID NO:09 or SEQ ID NO: 10, and wherein the sgRNA of the second viral vector comprises the sequence set forth in SEQ ID NO:07 or SEQ ID NO:08; (x) a disclosed first viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl- CoA dehydrogenase gene and a disclosed second viral vector comprising the sequence comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the glutaryl-CoA dehydrogenase gene; (xi) a disclosed viral vector comprising an isolated nucleic acid molecule comprising a nucleic acid sequence encoding one or more element of a gene editing system; or (xii) any combination thereof.
EXAMPLES
[0661] The Examples that follow are illustrative of specific aspects of the invention, and various uses thereof. They set forth for explanatory purposes only and are not to be taken as limiting the invention.
[0662] The work presented herein demonstrates that the liver directly contributes to toxic accumulation of catabolites in the brain as part of the GA-1 disease pathology. This is surprisingly and unexpected and therefore challenges that traditionally held view in the art. To this end, the three methods of redressing the dysfunctional lysine catabolism pathway in the liver also demonstrated the ability to reverse GA-1 disease pathology in the brain.
Materials and Methods Employed in Specific Examples
Generation of Single (Gcdh-/-) and Double (Gcdh-/- /Aass-/-) Knockout Mouse Models.
[0663] Gcdh " single knockout and Gcdh' ' ZAass^' double knockout mouse strains were generated by injecting either C57B6 or TIRF (transgene free Il g ', ag2 Fah^') zygotes (Bissig-Choisat B, et al. (2021) JHEP Rep. 3: 100281) with CRISPR/Cas9 gene editing mRNA as we described previously (Barzi M, et al. (2017) Nat Commun. 8:39), which is incorporated by reference in its entirety for the methods and materials related to the generation and characterizations of these knockout mice. The following sgRNAs were designed using Benchling online software (www.benchling.com) and injected at the same time with the Cas9 mRNA. A listing of sgRNA sequences is set forth in TABLE 1.
TABLE 1 - 5. pyogenes sgRNA Sequences.
[0664] F0 mice were analyzed by PCR followed by Sanger sequencing using the PCR primers set forth in TABLE 2:
TABLE 2 - PCR Primers for Gcdh and Aass.
Further offspring genotyping was performed by Transnetyx (Cordoba, TN).
Experiments with Knockout Mice.
[0665] Single (Gcdh ) and double Gcdh4' /Aass4') knockout mice were maintained under a standard 12-hour dark/light cycle with water and regular chow provided ad libitum. For the Adeno- Associated virus (AAV) experiments, 3-week-old and 6-day-old Gcdh 4 pups were injected with a single i.p, dose of AAV expressing either the murine Gcdh cDNA or with two CRISPR/Cas9 gene editing tools targeting Aass, both regulated by a liver specific promoter (HLP). Two weeks after injection or when pups reached the weaning age, mice were exposed to high protein diet (70% Casein diet, Envigo Teklad Custom diet Catalog # TD.06723). Urine, blood and liver and brain tissue (where described) were collected 4 or 5 days after challenging the mice with high protein diet. Mouse body weights were measured throughout the experiment and all mouse tissues were harvested for further analysis at the experimental endpoints. All animal experiments were approved by the Institutional Animal Care and Use Committee.
Hepatocyte Isolation.
[0666] To obtain primary hepatocytes for transplantation experiments, mouse livers were perfused using a modified two-step collagenase perfusion method as described previously (Maeso-Diaz R, et al. (2022) Aging Cell. 21 :el3530). Quality of isolated hepatocytes was assessed by trypan blue staining of perfusate and used if viability was > 90%. Freshly isolated hepatocytes were transplanted into mice the same day (< 8 hours after isolation).
Hepatocyte Transplantation.
[0667] Transplantation of healthy hepatocytes (Gcdh+/+) expressing td-Tomato red fluorescent reporter (mT/mG mouse strain,
The
Jackson Laboratory, Catalog # 007676) and diseased (Gcdh^) hepatocytes was performed as previously described (Bissig-ChoisatB, et al. (2016) Nature. 6:7339) into TIRF background single (Gcdh ) or double (Gcdh^/Aass ) knockout mouse strains (host strains), respectively. In brief, 1 x 106 hepatocytes were injected into the spleen of 2-month-old mice. Immediately after transplantation, selection pressure towards transplanted hepatocytes was applied by withdrawing the drug nitisinone (NTBC) from the drinking water. After 2 weeks, mice were put back on nitisinone for 3 days before a second withdrawal (cycling). Mice were kept without nitisinone for 6 months to assure a good repopulation with transplanted hepatocytes. Before starting the 70% casein diet challenge, mice were put back on nitisinone to assure no interference with tyrosinemia of the TIRF strain.
AAV Vector Cloning and AAV Virus Production.
[0668] Murine Gcdh cDNA was cloned by replacing EmGFP of 1162-pAAV-HLP-EmGFP-SpA plasmid (provided from William Lagor, Addgene Catalog # 109313) using Xbal-Mlul restriction enzymes. Murine A ass Sa sgRNAs oligonucleotides were annealed and ligated into 1313.1- pAAV-U6-SA-BbsI-MluI-gRNA-HLP-OLLAS-spA vector (provided by William Lagor, Addgene Catalog # 109314) digested with BbsI restriction enzyme. AAVs were produced as previously described (Nelson CE, et al. (2019) Nat Med. 25:427-432). A listing of sgRNA sequences is set forth in TABLE 3.
TABLE 3 - S. aureus sgRNA Sequences.
siRNA Experiments. siRNA Preparation.
[0669] siRNA injection solution was prepared following Invivofectamine 3.0 Reagent Complexation protocol (Thermosfisher Scientific, Catalog # IVF3001). In brief, siRNA duplex (Ambion, Catalog # 4457308, ID#s 78304) was first diluted in RNAse free water to a concentration of 250 pM, aliquoted and stored at -80 °C. siRNA duplex solution was diluted in 1 : 1 in complexation buffer and then mixed 1 : 1 with Invivofectamine 3.0 Reagent, vortexed, and incubated at 50 °C for 30 minutes. The complex was diluted 1 :6 with RNAse PBS lx pH 7.4. A listing of sgRNA sequences is set forth in TABLE 4.
TABLE 4 - Aass siRNA.
siRNA Injection.
[0670] Aass siRNA (8 mg/kg) solution was injected into the tail vein of 3 -week-old Gcdh'' mice and put on high protein diet 48 hours later. Mice were harvest postmortem for expression of AASS in the liver using AASS immunostaining as described elsewhere.
Neurobehavioral Studies
[0671] Mouse motor activity studies were performed by the Mouse Behavioral and Neuroendocrine Core Facility at Duke University.
Spontaneous Motor Activity.
[0672] Spontaneous motor activity was monitored in the open field (21 cm x 21 cm x 30 cm) over 30 min in an automated Omnitech Digiscan apparatus (AccuScan Instruments, Columbus, OH) (Fukui M, et al. (2007) J Neurosci. 27: 10520-10529). The AccuScan software scored motor activities as horizontal or vertical beam-breaks to determine the total distance traveled, vertical activity, velocity of movement, and time spent in the center zone of the arena.
Accelerating Rotarod.
[0673] Balance and coordination were evaluated on an accelerating (4-40 rpm over 5-min) rotorod (Med- Associates, St. Albans, VT) as described (Taylor GA, et al. (2008) Genes Brain Behav. 7:786-795). Motor performance was examined over 4 successive 5-min trials that were separated by 20-30 min each. A given trial was terminated when the mouse fell from the rod or when 300 sec had elapsed, and these times were recorded as the latency to fall.
Grip Strength.
[0674] The strength of the front and rear paws to grip a bar was analyzed with a mouse gripstrength meter (San Diego Instruments, San Diego, CA) and was expressed as units of g-force (Wang X, et al. (2011) Hum Mol Genet. 20:3093-3108).
Statistical Analysis.
[0675] The data for motor performance are presented as means ± SEM. The data were analyzed by one-way ANOVA, repeated-measures ANOVA (RMANOVA), and multivariate ANOVA (MANOVA), followed by Bonferroni corrected pair-wise comparisons. A p < 0.05 was considered statistically significant, a trend was considered p < 0.10.
Metabolite Analysis.
Blood Acylcarnitine (C5-DC).
[0676] Whatman 903 protein saver cards (Sigma-Aldrich), ds -Acetyl carnitine (ds-C2, Sigma- Aldrich), ds-Propionylcamitine (ds-C3, Sigma-Aldrich), ds -Butyryl carnitine (ds-C4, Sigma- Aldrich), ds-Octanoylcamitine (ds-C8, Sigma- Aldrich), and ds -Palmitoyl carnitine (ds-C16, Sigma-Aldrich) were used. General solvents and reagents were purchased from Sigma-Aldrich (St. Louis, MO) or VWR (Radnor, PA). In-house deionized water (diH2O) was used in the preparation of mobile phases or for dilutions.
Sample Preparation.
[0677] Whole blood (16 pL) was pipetted onto two 3/16” diameter circles of cotton fiber filter paper and allowed to dry overnight in a microcentrifuge tube. Following that, 6 pL of internal standard (IS) mixture (5 pmol/L ds-C2, 1 pmol/L ds-C3, 1 pmol/L ds-C4, 1 pmol/L ds-C8, 2 pmol/L ds-C16 in methanol: diH2O 50:50 (v/v)) was added to the tube along with 400 pL of methanol (MeOH). The micro centrifuge tubes were then placed on an orbital shaker for 30 minutes at ambient temperature. The entire volume of liquid was then transferred to a 0.2 pm filter tube and centrifuged at 16,380 g for 2 minutes. An aliquot (200 pL) of the filtered supernatant was transferred to a 96 well round bottom plate and evaporated to dryness under nitrogen at 40 °C. After drying, 70 pL of 3M MeOH-Hydrochloric Acid was added to each specimen, an adhesive cover was placed over each plate, and the samples incubated in an oven for 15 minutes at 50 °C. Samples were dried under a stream of nitrogen at 40 °C and reconstituted in a matrix of MeOH:diH2O 85: 15 (v:v) and analyzed by electrospray ionization-tandem mass spectrometry (ESI-MS/MS) (Millington DS, et al. (2011) Methods Mol. Biol. 708:55-72; Lepage N, et al. (2010). Methods Mol. Biol.603: 9-25).
LC-MS/MS Instrument and Analysis.
[0678] Acylcamitines in whole blood were analyzed as methyl esters using stable isotope dilution ESI-MS/MS. Derivatized samples were analyzed by flow injection analysis (FIA) and detected using a precursor ion scan of m/z 99. Samples were analyzed using a TQ Detector tandem quadrupole mass spectrometer equipped with an Acquity Classic system (Waters Corporation, Milford, MA). A FIA was performed over 2.5 minutes using MeOELdiFEO 80:20 (v:v), which allowed for elution of the sample between 0.2 minutes and 1.0 minutes, with a wash out period between 1.0 minutes and 2.2 minutes, followed by a re-equilibration period from 2.2 minutes to 2.5 minutes.
Data Processing.
[0679] The raw data was processed using Neolynx® (Waters Corp.). The ratio of ion intensities of acylcamitine species and its specified deuterated IS are multiplied by the nominal concentration of the IS (5 pmol/L, 1 pmol/L, 1 pmol/L, 1 pmol/L, 2 pmol/L). Concentrations of standards are given in units of pmol/L. Glutarylcamitine (C5-DC), with m/z 304, was measured against octanoyl-L-carnitine-ds (ds-C8) with m/z 305. Propionylcamitine (C3), with m/z 232, and acetyl carnitine (C2), with m/z 218, are each compared to their own deuterated IS (ds-C2 and di- C3).
Blood Amino Acids.
Analysis of Amino Acids by LC-MS/MS.
[0680] Whatman 903 protein saver cards (Sigma- Aldrich), Kairos amino acid internal standard set (100+), amino acid calibrator set (100+), amino acid quality control set (100+), and well as AccQ-Tag Ultra derivatization kit were purchased from Waters Corporation (Milford, MA). LC- MS grade acetonitrile, methanol, formic acid, acids and bases were purchased from Sigma- Aldrich (St. Louis, MO) or VWR (Radnor, PA). In-house deionized water (diFEO) was used in the preparation of mobile phases or for dilutions. Whole blood (12 pL) was pipetted onto a 1/4” diameter circle of cotton fiber filter paper and allowed to dry overnight in a microcentrifuge tube. Plasma amino acids were analyzed using a modification of the Kairos Amino Acid method. Equal volumes (50 pL) of plasma and an internal standard solution containing a mixture of [13C, 15N]- labeled amino acids were combined. Protein was precipitated using 50 pL 10% sulfosalicylic acid and removed by centrifugation. The supernatant was added to a borate buffer, mixed with the 6- aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC) derivatization reagent, incubated at 55 °C for 10 minutes, and diluted with dEEO. Plasma amino acid- AQC derivatives were analyzed using a Waters Acquity I-Class UPLC coupled to a Waters Xevo TQ-S micro mass spectrometer. Amino acids were separated on a 1.6 pm 2 x 150 mm Cortecs UPLC column by gradient elution
over 9.5 minutes, with 0.1% formic acid in aqueous acetonitrile as the mobile phase. Analytes were detected by selected reaction monitoring in positive ion mode. Peak area ratios of amino acids and their corresponding internal standard were converted to a concentration by means of a 6- or 7-point 1/x weighted calibration curve. Details of the acquisition parameters are provided in TABLE 5 below.
TABLE 5 - SRM Transitions, Detailed View.
Details of the calibrator concentrations are provided in TABLE 6 provided below.
TABLE 6 - Calibrator Concentrations
Tissue Organic Acids
Sample Preparation.
[0681] 100 mg of liver and brain tissue were homogenized in 0.5 mL of distilled deionized water using Tyssue Lyser (Qiagen) following 30 cycles of sonication at power (Vibra Cell - Sonics). 70 mg of sulfosalicylic acid was added to each sample and let stand at room temperature for 5 minutes. Samples were centrifuged at - for 20 minutes and supernatant was transferred to a glass stoppered tube for urine organic acid analysis.
Glutaric Acid and 3-OH Glutaric Acid Measurements.
[0682] Glutaric acid (GA) and 3-OH-glutaric acid (3-OH-GA) were measured as previously described (sauer SW, et al. (2006) J. Neurochem. 97:889-910) using GC/MS with a stable-isotope dilution assay. In brief, internal standards of d4-GA and d5-3-OH-GA (each 1 nmol) were added to 2 mg of tissue homogenate. Samples were acidified to pH < 1 with 100 Imol H2SO4. The reaction mixture was diluted with 1 mL NaHCCh (20 mmol/L) and, subsequently, the ionic strength of the solvent was increased by adding an excess of NaCl. Organic acids were extracted twice using ethylacetate and then supernatants were dried under nitrogen at 65 °C. Finally, samples were derivated with N-methyl-Ntrimethylsilylheptafluorbutyramid. GC/MS analysis was carried out on a DB5-MS capillary column (25 m x 0.25 mm inner diameter, film thickness 0.25 Im) obtained from J & W, (Agilent Technologies, Boblingen, Germany) which was installed in a Hewlett-Packard 6890 series GC and Hewlett-Packard Engine 5972 A mass spectrometer (Agilent Technologies). The mass spectrometer operated under electron impact in a single ion monitoring mode for enhanced sensitivity as previously described (Schor DS, et al. (2002) J Chromatogr B Analyt Technol Biomed Life Sci. 780: 199-204). Four-point calibration curves were acquired for GA and 3-OH-GA in a range of 0-20 nmol using 1 nmol of d4-GA and 1 nmol of d5-3-OH-GA as internal standards. The following fragments were used for the quantification: m/z 217 and 259 (3-OH-GA), m/z 218 and 262 (deuterium labelled 3-OH-GA standard), m/z 261 and 158 (GA), and m/z 265 and 161 (deuterium -labelled GA standard). GA and 3-OHGA concentrations in all samples were subsequently normalized to the protein content.
Immunohistochemistry.
[0683] Paraffin-embedded slides were deparaffinated, rehydrated and treated with antigen retrieval citrate buffer (pH 6.0) for 30 minutes at 98 °C degrees. Endogenous peroxidase was quenched using 3% hydrogen peroxidase solution (Signa-Aldrich, Catalog # 88697) and biotin was blocked with Avidin/Biotin kit following manufacturer’s instructions (Vector Laboratories,
Catalog # SP-2001). After blocking with serum (PK-4001), samples were incubated overnight at 4 °C with either rabbit anti-RFP (Rockland, Catalog # 600-401-379) or rabbit anti-AASS (Sigma- Aldrich, Catalog # HPA020728) primary antibodies diluted 1 : 100 in antibody diluent buffer (Abeam, Catalog # Ab64211) and incubated overnight at 4 °C. Slides were washed twice with PBS lx for 15 minutes and incubated with the anti -rabbit biotinylated secondary antibody at room temperature for 30 minutes and staining was developed with DAB kit (Vector Laboratories, Catalog # SK-4100). Counterstaining was performed using hematoxylin solution (Richard- Allan Scientific, Catalog # 7211) and bluing solution (Richard-Allan Scientific, Catalog # 7301). Cytoseal (Epredia, Catalog # 8312-4) was used for mounting the slides.
Western Blot.
[0684] 20 mg of fresh frozen liver and brain tissues were homogenized with 1,2 mL of RIP A buffer (Sigma Aldrich, Catalog # R0278) containing protease inhibitors (Roche, Catalog # 04693159001). 20 pL (corresponding to 10 pg of protein) of homogenized samples was premixed with loading buffer, heated and loaded in a polyacrylamide pre-made gel (NuPAGE 4-12% Bis Tris Gel Invitrogen, Catalog # NP0336BOX) and transferred to a PDVF membrane (Millipore, Catalog # IPVH00010). After blocking (EveryBlot Blocking Buffer, Biorad, Catalog # 12010020) for 30 min. membranes were incubated at 4 °C overnight with primary antibodies diluted in PBS- T. Rabbit Anti-AASS (Sigma- Aldrich, Catalog # HPA020728), anti-GCDH (Sigma- Aldrich, Catalog # HPA020728) and beta- Actin (Sigma Aldrich, Catalog # Al 978) diluted 1 : 1,000. After washed, membranes were incubated with donkey anti-rabbit HRP secondary antibody (Jackson Immunoresearch, Catalog # 711-035-152) diluted 1 :5,000 for 1 hour at room temperature. The images were obtained by incubating the membranes with Super Signal West Fempto solution (Thermofisher, Catalog # 34096).
Histopathology.
[0685] Selected tissues (liver, lung, heart, kidney, spleen, brain) were evaluated by a board- certified veterinary pathologist (JE) in a masked fashion without knowledge of allocation group. Mouse brains were sectioned in the parasagittal plane. Following identification of three lesions in initial screening, (meningeal hemorrhage; hippocampal vacuolation; and nephropathy), the pathologist graded changes in brains and kidneys as normal, minimal, mild, moderate or severe (0-4) using a semi -quantitative scale.
Flux Studies.
[2-15N]Lysine Metabolic Flux Study.
[0686] The position-specifically labeled lysine ([2-15N]Lysine) is employed to investigate the AASS-catabolized metabolic flux. The catabolism of lysine is via the saccharopine (liver and
kidney) and pipecolate (brain) pathways. Only the saccharopine pathway leads to the labeled 2- aminoadipic-4-semialdehyde and 2-aminoadipate (AASA) metabolites from [2-15N]Lysine. 15N at carbon-2 of lysine is lost in the first step of pipecolate pathway. Thus, by measuring the labeling of 2-aminoadipate, the A ASS-mediated metabolic flux from lysine to AASA and 2-aminoadipate (AAA) can be assessed. This metabolic flux approach is used to assess the relative metabolic change induced by AASS deletion. The deletion of AASS is expected to block the labeling of AAA from [2-15N]Lysine.
[13Ce] Lysine Metabolic Flux Study.
[0687] To measure the relative metabolic flux from lysine to acetyl-CoA, [13Ce] Lysine is employed. The downstream metabolites, such as acetyl-CoA or tricarboxylic acid cycle (TCA cycle) metabolites, are labeled by [13Ce] Lysine. By measuring the labeling of acetyl-CoA or TCA cycle metabolites (citrate, 2-ketoglutarate, succinate, fumarate, and malate etc.), the change of relative catabolic flux of lysine can be estimated.
Analytical Experiments for Lysine Catabolites.
[0688] The labeling and concentration of organic acids (3-OH-GA, 2-aminoadipate, 2- oxoadipate, and GA), amino acids, and TCA cycle intermediates in tissue, urine, and plasma are analyzed by GC-MS. The labeling and concentration of acylcamitine (plasma and tissue (liver and brain)) and acyl-CoA (tissue) is analyzed by LC-MS/MS.
TABLE 7 - Listing of Sequences and Sequence Identifiers.
Specific Examples
[0689] Glutaric Aciduria type I (GA-1) is an inborn error of metabolism with a severe neurological phenotype caused by the deficiency of Glutaryl-CoA dehydrogenase (GCDH), the last enzyme of lysine catabolism. The state of the art indicates that the toxic catabolites in the brain are produced locally and do not cross the blood brain barrier. The experiments disclosed herein, which use knockout mice and liver cell transplantation, demonstrated that toxic GA-1 catabolites in the brain originated in the liver. Moreover, the characteristic brain and lethality phenotype of the GA-1 mouse model can be rescued by two different liver directed gene therapy approaches. These experiments question current pathophysiological understanding of GA-1 and demonstrate for the first time a targeted therapy for this devastating disorder.
[0690] The essential amino acid lysine is a building block of proteins but is also catabolized to Glutaryl-CoA, which eventually enters the tricarboxylic acid cycle and generates energy. If the conversion to Glutaryl-CoA is inhibited by the deficiency of the Glutaryl-CoA dehydrogenase (GCDH), then toxic catabolites such as glutaric acid (GA) and 3-hydroxy -glutaric acid (3-OH- GA) accumulate (FIG. 1A).
[0691] These intermediates accumulate in the brain and kidney where they cause clinical symptoms, a disorder known as glutaric aciduria type I (GA-1) (Goodman SI, et al. (1975) Biochem Med. 12: 12-21). In the brain, striatal injury leads to complex movement disorders and subdural or other hemorrhages. Infection, fasting, or other physiological stress can trigger an encephalopathic crisis with poor prognosis. In the kidney, chronic renal failure can be observed typically in older patients. The most critical phase of this disorder are the first six years of life, and since early treatment clearly reduces the high mortality and morbidity, GA-1 is included in most countries’ newborn screens.
[0692] Currently, the standard of care for GA-1 patients is strict dietary restriction of lysine and carnitine supplementation, in addition to emergency support during decompensation. Despite early diagnosis and prospective care, 33-25% of all patients suffer-long term neurological disabilities (Strauss KA, et al. (2003) Am J Med Genet C Semin Med Genet. 121C:53-70; Boy N, et al. (2021) Genet Med. 23: 13-21). Currently there is no specific therapy available for GA-1, possibly related to our poor understanding of this devastating disorder.
Example 1
Rescue of Glutaric Aciduria Type 1 in Mice by Liver Directed Therapy
[0693] Among the scientific community, it is widely accepted that toxic catabolites accumulate locally and do not cross the blood brain barrier. GA and 3-OH-GA are believed to be retained in the brain with limited efflux possibly as reactive Acyl-CoA species (FIG. 1A), thereby leading to an intoxication of neurons. Hence the cornerstone of current therapy is substrate reduction, e.g., restriction of lysine, which enters the brain via the solute carrier family 7-member 1 (SLC7A1) transporter. Interestingly, lysine is predominantly catabolized in the liver, but besides a transient increase of transaminases during encephalopathic crises, there are no reports of liver dysfunction or failure of GA-1 patients.
[0694] To elucidate the role of the liver in the pathophysiology of GA-1 and challenge the current paradigm of local accrual of toxic catabolites, a few transplantation experiments with the mouse model of GA-1, the Gcdh'' mouse (Zinnanti WJ, et al. (2006)Brain. 129:899-910) were performed as described herein. These mice die on high protein diet only after a few days. A Gcdh' ' mouse was created by deletion of the gene in TIRF zygotes (see methods). This strain can be repopulated with exogenous hepatocytes and thereby replace the host liver.
[0695] First, healthy hepatocytes (Gcdh ) were transplanted into Gcdh'' mice and put them on high protein diet after liver repopulation. As expected, the non-transplanted Gcdh' ' mice died only after a few days on casein diet. However, about half of the transplanted mice survived the dietary challenge (FIG. IB). Remaining transplanted mice were harvested after 170 days and analyzed for GA-1 catabolites in the liver and brain (FIG. 1C).
[0696] Surprisingly, not only the liver but also in the brain toxic GA-1 catabolites were similar to healthy mice, despite the Gcdh deficiency in the brain. Moreover, the typical neuronal vacuolation in the Gcdh' ' mouse model was not observed in transplanted mice (FIG. 2A, FIG. 2B, FIG. 2C) and motor performance was comparable to C57B6 wild-type mice (FIG. 3A - FIG. 3G).
[0697] Immunostaining of transplanted but expired mice revealed unsuccessful transplantation in all 6 mice, while all surviving mice had an almost complete repopulation with healthy hepatocytes (FIG. ID and FIG. IE). This experiment indicates that the biochemical and histological phenotype in the brain of Gcdh' ' mice can be reverted by restoration of a normal lysine catabolism in the liver.
Example 2
Double Knockout Mice Showed No Obvious Disease Phenotype
[0698] To get further inside into the disease mechanism, whether a Gcdh-deficient liver can lead to accumulation of toxic catabolites in a Gcdh' ' brain, which has no flux through the lysine catabolism pathway and cannot produce locally the catabolites, was examined. To answer this question, a double knockout mouse was generated. This double knockout contained a Gcdh
deletion as well as a deletion of aminoadipic semialdehyde synthase (Aass), which is the first enzyme in the lysine catabolic pathway, (FIG. 4A, FIG. 4B). When these double knockout mice (Gcdh^'/Aass'') were exposed to high protein diet, they survived, had no obvious disease phenotype, and demonstrated only a small elevation of toxic catabolites (FIG. IF, FIG. 1G). The latter finding agreed with a previous report showing that the pipecolate pathway only generates small amounts of toxic catabolites (Leandro J, et al. (2020) J Inherit Metab Dis. 43: 1154-1164).
Example 3
Double Knockout Mice Died Quickly After Transplanted with Diseased Hepatocytes
[0699] Next, diseased GA-1 hepatocytes (Gcd/ Aa.s.s ) were transplanted into double knockout mice (Gcdh^/Aass ). Interestingly, the transplanted mice only survived a few days on high protein diet (FIG. 1H) and accumulated already - after a few days - high amounts of catabolites in the liver and brain (FIG. II). Only mice with high repopulation of diseased hepatocytes could trigger death on high protein diet (FIG. 1J and FIG. IK). Similar to nontransplanted Gcdh~ ~ mice, transplanted double knockout mice developed increase vacuolation in the brain (FIG. 5A, FIG. 5B, and FIG. 5C).
[0700] In summary, these transplantation experiments indicate that hepatic lysine catabolism directly impacts the accumulation of toxic catabolites in the brain, e.g., reduction or increase of catabolites in the absence of functional lysine catabolism in the brain (summarized in FIG. IL [0701] These results were unexpected and surprising in view of the fact that there have been no disease symptoms and no accumulation of catabolites in the brain of either the fruit bat (McMillan TA, et al. (1988) J Biol Chem. 263: 17258-17261) or the liver-specific GA-1 mouse model (Sauer SW, et al. (2006) JNeurochem. 97:899-910), which both have a Gcdh-deficiency in the liver only. [0702] Moreover, isotope tracing experiments in C57B6 mice demonstrated only very limited accumulation in the brain after intraperitoneal injection of GA-1 catabolites (Sauer SW, et al. (2006) J Neurochem. 97:899-910).
[0703] However, these studies used animals that had a functional lysine catabolism in the brain
In these animals, the lack of neurotoxicity can be explained by a reduced flux of GA-1 catabolites across the blood brain barrier or an efficient detoxification of GA-1 catabolites in the brain even when originating from the liver. The data presented herein support the latter interpretation and is compatible with all previous observations in bats or mice. Also, data from the human Genotype-Tissue Expression (GTEx) project shows abundant expression of all lysine catabolic genes in relevant brain areas of humans (Consortium GT. (2015) Science. 348:648-660).
Example 4
Gcdh-/- Mice Demonstrated a Rescue of Lethality upon Expression of Gcdh in the Liver
[0704] In addition to identifying mechanistic inside into the unclear GA-1 pathomechanism (Pankowicz FP, et al (2017) Gut. 66: 1329-1340), the transplantation studies disclosed herein generated a scientific rationale for a liver directed therapeutic approach. Accordingly, an Adeno- Associated Virus (AAV) based gene therapy vector was generated. This AAV vector expressed a wild-type copy of the Gcdh gene or green fluorescent protein (GFP) as a control under a liver specific promoter. (FIG. 6A, FIG. 6B).
[0705] 3-week-old Gcdh ~ mice were intravenously injected with AAV at a dose of 1.5 x 1012 vg/mouse. Two weeks after injection, mice were put on high protein diet. As shown in FIG. 7A, most mice demonstrated a rescue of lethality upon expression of Gcdh in the liver but not in the brain (FIG. 7B). Glutarylcamitine (C5-DC) levels in the blood (FIG. 7C) as well as GA (FIG. 7D) and 3-OH-GA (FIG. 7E) levels in brain and liver indicated a biochemical reduction of toxic metabolites upon treatment with AAV-Gcdh. Neuronal vacuolation and meningeal hemorrhage were also decreased in AA V-Gcdh treated compared to untreated Gcdh ~ mice (FIG. 8A - FIG. 8C). Motor performance of treated mice was comparable to C57B6 wild-type mice (FIG. 9A - FIG. 9G)
[0706] Since GA-1 patients ideally need to be treated when neonates, neonatal Gcdh~ ~ mice were injected with a low dose (3 x 1011 vg/mouse), and intermediate (7.5 x 1011 vg/mouse), or high dose (1.5 x 1012 vg/mouse) of AAV-Gcdh. After weaning, the treated mice were exposed to high protein diet. Although a dose dependent therapeutic effect was observed, the neonatal data was not as pronounced as was the data generated with the older Gcdh~~ mice (FIG. 7F). This difference can be attributed to a dose dependent effect, but also to the overall lower expression of Gcdh in the liver (FIG. 7G) of the neonatally injected Gcdh~~ mice compared to a treatment after weaning. The difference can also be attributed to dilution of the AAV or to silencing upon growth of the liver despite injection of much higher dose per weight. Nevertheless, the data indicate that repetition of AAV administration in can improve the therapeutic effect in neonatal Gcdh~ ~ mice.
Example 5
AAV-CRISPR Therapy Resulted in a Dose Dependent Deletion in Aass in the Liver
[0707] Instead, to explore an alternative therapy in Gcdh~ ~ pups and leverage the determination that deletion of Aass could be therapeutic, a recombinant AAV gene therapy vector expressing CRISPR/Cas9 effector molecules targeting and thereby deleting Aass were developed. (FIG. 10A - FIG. 10D) Neonatal Gcdh~ ~ mice were intravenously injected with a low dose (2.4 x 1011 vg/mouse), an intermediate dose (6 x 1011 vg/mouse), or a high dose (1 x 1012 vg/mouse) of AAV.
The high dose of AAV-CRISPR rescued all six injected pups from intoxication on high protein (FIG. 11 A)
[0708] Biochemical analysis revealed a significant reduction of toxic catabolites in liver and brain (FIG. 11B) after 60 days on high protein diet compared to AAV-GFP treated mice after only 4 days on high protein. AAV-CRISPR therapy resulted in a dose dependent deletion in Aass in the liver (FIG. 11C). Most importantly, hippocampal vacuolation and subdural hemorrhage could not be observed in AAV-CRISPR treated Gcdh ~ mice in contrast to clear pathological alterations in non-treated mice only after 4 days of high protein diet exposure (FIG. 11D). Before harvesting the A A V-CRISPR treated Gcdh~ ~ mice, neurobehavioral testing was performed. A mild difference was detected in the hind paw grip strength compared to wild-type C57B/6J mice. The other tests showed no difference. (FIG. 12A - FIG. 12G). Interestingly, lysine levels in the serum were not significantly increased (FIG. 13A - FIG. 13C) despite the lack of hepatic lysine catabolism. In summary, these results demonstrate that Aass deletion in the liver is therapeutic for Gcdh~ ~ mice. [0709] The data demonstrate that that both liver directed therapies presented here could complement current dietary approach particularly for patients with compliance issues or for the prevention of long-term sequalae. The transplantation experiments described herein conclusively demonstrate that the liver directly contributes to toxic accumulation and therapeutic reduction of toxic catabolites in the brain.
Summary of Experiments of Example 1 - Example 5
[0710] The work presented herein demonstrates that the liver directly contributes to toxic accumulation of catabolites in the brain as part of the GA-1 disease pathology. This is surprisingly and unexpected and therefore challenges that traditionally held view in the art. To this end, the three methods of redressing the dysfunctional lysine catabolism pathway in the liver also demonstrated the ability to reverse GA-1 disease pathology in the brain.
[0711] Also, all therapeutic approaches described here are less sensitive to non-compliance of patients. Hence if patients (or parents) are not adhering to a strict daily control of the current standard of care (diet & supplements), then metabolic decompensation might occur. Proposed therapeutic approaches are either curing the patient (hepatocyte or whole liver transplantation or gene therapy) or non-daily dosing (twice a week up to every second month) is likely for an siRNA approach. Hence such therapeutic approaches should allow patients to live or go in areas with limited access to emergency care and specialist metabolic clinics, which is the only way to mitigate currently encephalopathic crisis and metabolic decompensation.
[0712] Most importantly, with current standard of care 25-33% of these patients continue to develop acute and long-term neurological complications. (Strauss KA, et al. (2003) Am J Med
Genet C Semin Med Genet. 121C: 53-70; Sauer SW, et al. (2006) J Neurochem. 97:899-910). Gcdh~ mice successfully treated with described therapies do not have any severe or acute neurological complications.
Example 6
AAV-CRISPR Therapy Resulted in a Dose Dependent Deletion in Aass in the Liver
[0713] Glutaric Aciduria Type I (GA-1) is an inborn error of metabolism with a severe neurological phenotype caused by the deficiency of glutaryl-CoA dehydrogenase (GCDH), the last enzyme of lysine catabolism. Current literature suggests that toxic catabolites in the brain are produced locally and do not cross the blood brain barrier. In a series of experiments using knockout mice of the lysine catabolic pathway and liver cell transplantation, toxic GA-1 catabolites in the brain were shown to originate from the liver. Moreover, the characteristic brain and lethal phenotype of the GA-1 mouse model was rescued by two different liver-directed gene therapy approaches: using Adeno- Associated Virus (AAV) we replaced the defective Gcdh gene or prevented flux through the lysine degradation pathway by CRISPR deletion of the aminoadipate-semialdehyde synthase (Aass) gene.
[0714] mRNA of Gcdh is an intermediate of AAV gene therapy but can also be delivered by lipid nanoparticles (LNP). Instead of CRISPR deletion of Aass, deletion can be achieved also by other endonucleases or Aass expression silenced by combining transcriptional silencer and nucleases. Also, we show that reduction or inhibition of Aass expression such as small interfering RNA have a therapeutic effect.
[0715] The essential amino acid lysine is a building block of proteins but is also catabolized to Glutaryl-CoA, which eventually enters the tricarboxylic acid cycle and generates energy. If the conversion of lysine to Glutaryl-CoA is inhibited by a deficiency of the Glutaryl-CoA dehydrogenase (GCDH) enzyme, disease-specific catabolites such as glutaric acid (GA) and 3- hydroxy -glutaric acid (3-OH-GA) accumulate (FIG. 15A). These intermediates accumulate in the brain where clinical symptoms develop that comprise a disorder known as glutaric aciduria type I (GA-1) (Goodman SI, et al. (1975) Biochem Med. 12: 12-21). Striatal injury leads to complex movement disorders and subdural or other hemorrhages. Infection, fasting or other physiological stress can trigger an encephalopathic crisis with poor prognosis. Extracerebral symptoms are rare, but occasionally chronic renal failure can be observed typically in older patients (Larson A, et al. (1993) GeneReviews((R))). The most critical phase of this disorder is the first six years of life, and since early treatment can effectively reduce the associated high mortality and morbidity, GA- 1 is included in many countries’ newborn screens. The standard of care for GA-1 patients is strict dietary restriction of lysine, carnitine supplementation, and emergency support during
decompensation. Despite early diagnosis and prospective care, 25-33% of all patients still suffer- long term neurological disabilities (Strauss KA, et al. (2003) American journal of medical genetics. Part C, Seminars in medical genetics. 121C:53-70) (Boy N, et al. (2021) Genet Med 23: 13-21). Currently there is no specific therapy available for GA-1, which might be a result of our incomplete understanding of the pathogenesis.
[0716] Among the scientific community, it is widely accepted that toxic catabolites accumulate locally and do not cross the blood-brain barrier (Larson A, et al. (1993) GeneReviews(R)) (Sauer SW, et al. (2006) J Neurochem. 97:899-910) (Strauss KA, et al. (2020) Molecular genetics and metabolism. 131 :325-340) (Bouchereau J, et al. (2020) JNutr. 150:2556S-2560S). GA and 3-OH- GA are believed to be retained in the brain with limited efflux as reactive Acyl-CoA species (FIG. 15A), thereby leading to toxicity in neurons. Hence, the cornerstone of current therapy is substrate reduction, e.g. dietary restriction of lysine, which normally enters the brain via the solute carrier family 7 member 1 transporter.
[0717] With the knowledge that toxic catabolites originating from the liver can accumulate in the brain in other amino acid disorders (Manoli I, et al. (2016) Transl Sci Rare Dis. 1 :91-110) (Mitchell G, et al. (1990) N Engl J Med. 322:432-437), we challenged the current dogma. In a series of transplantation experiments, we here demonstrate that GA and OH-GA can cross the blood-brain barrier and accumulate in the brain of Gcdh' ' mice, the mouse model of GA-1. The typical neuropathological alterations were observed even in the absence of lysine catabolism in the murine brain. This new mechanistic insight allowed us to develop liver-directed therapeutic approaches for GA-1, the first target therapies for this devastating disorder.
Generation of Gcdh'' mice and hepatocyte transplantation.
[0718] The Gcdh~ ~ mouse is a well-characterized animal model for GA-1 (Koeller DM, et al. (2002) Hum Mol Genet. 11 : 347-357) (Zinnanti WJ, et al. (2006) Brain. 129:899-910). These mice die after only a few days on high protein diet (casein), developing a neuronal phenotype with hippocampal vacuolation and meningeal hemorrhage (Zinnanti WJ, et al. (2014) Acta Neuropathol Commun. 2: 13) (Sauer SW, et al. (2015) Biochim Biophys Acta. 1852:768-777). However, since this diet-induced sensitivity is dependent on the mouse background strain (Sauer SW, et al. (2015) Biochim Biophys Acta. 1852:768-777) and we want to explore hepatocyte transplantation in Gcdh~ ~ mice, we generated two new Gcdh~ ~ strains. We deleted the Gcdh gene in zygotes of C57BL/6 and TIRF (transgene free Il2rg~/~/Rag2~/~/Fah~/~') mice using CRISPR (FIG. 20A-FIG 20B) We have successfully used the latter strain for hepatocyte transplantation and replacement of the host liver (Bissig-Choisat B, et al. (2021) JHEP Rep. 3: 100281) (Barzi M, et al. (2017) Nature communications. 8:39). Both strains displayed the typical symptoms associated
with high protein-diet in the brain (FIG. 15B-FIG. 15C) without any obvious pathology in the liver and kidney (FIG. 21A-FIG.21B) as describe previously (Koeller DM, et al. (2002) Hum Mol Genet. 11 :347-357) (Zinnanti WJ, et al. (2006) Brain. 129:899-910).
[0719] To elucidate the role of the liver in the pathogenesis, we first transplanted healthy hepatocytes (Gcdh ) into Gcdh~~ mice and put them on high-protein diet after liver repopulation. As expected, the non-transpl anted Gcdh ~ mice died after only a few days on high-protein diet. However, about half of the transplanted mice survived the dietary challenge (FIG. 15D). Surviving transplanted mice were euthanized after 170 days and analyzed for GA-1 catabolites in the liver and brain (FIG. 15E-FIG. 15F). Surprisingly, GA-1 catabolite levels were comparable to healthy mice not only in the liver but also in the brain, despite continued GCDH deficiency in the brain. Moreover, the neuronal vacuolation and meningeal hemorrhage characteristic of the Gcdh /_ mouse model was not observed in transplanted mice (FIG. 15G - FIG. 151) and motor performance was comparable to wild-type mice (FIG. 22A-FIG. 22G). Liver immunostaining of transplanted mice that had expired revealed unsuccessful transplantation (<5% repopulation) in all 6 mice, while all surviving transplanted mice had an almost complete (>70%) repopulation with healthy hepatocytes (FIG. 15J-FIG. 15K). This experiment indicates that the biochemical and histological phenotype in the brain of Gcdh~~ mice can be reverted by restoration of normal lysine catabolism in the liver.
Generation of Double Knockout (Gc h /Aass ) Mice and Hepatocyte Transplantation. [0720] To further investigate the disease mechanism, we asked whether a GCDH-deficient liver could lead to an accumulation of GA-1 catabolites in brains with no lysine catabolism, hence in the absence of neuronal production of lysine catabolites. To answer this question, we first generated a double knockout mouse (see methods for details), deleting both Gcdh and the first enzyme in the lysine catabolic pathway, aminoadipic semialdehyde synthase (Aass) (FIG. 23A- FIG. 23B) When these double knockout mice (Gcdh ~/7Aass~/~') were exposed to a high protein diet, they survived, with no obvious disease phenotype and only a small elevation of GA-1 catabolites (FIG. 16A, FIG. 16B, FIG. 16C). This is in agreement with a previous report showing that the pipecolate pathway generates minimal amounts of lysine catabolites (Leandro J, et al. (2020) Journal ofinherited metabolic disease. 43: 1154-1164). We next transplanted diseased GA- 1 hepatocytes (Gcd Aa.s.s ) into double knockout mice (Gcdh^/Aass^'). Interestingly, the transplanted mice only survived a few days on high protein diet (FIG. 16D) and accumulated high amounts of catabolites in the liver and brain after only a few days (FIG. 16E, FIG. 16F). Only mice with high repopulation of diseased hepatocytes expired on high protein diet (FIG. 16G, FIG.
16H) Similar to non-transplanted Gcdh~ ~ mice, transplanted double knockout mice developed increased vacuolation in the brain (FIG. 161, FIG. 16J, FIG. 16K).
Transplantation of diseased Gcdh-/- hepatocytes - liver specific GA-1 mouse model
[0721] Finally, we transplanted diseased Gcdh ~ hepatocytes (Aass+/+ wild-type) into TIRF mice, which have a normal lysine catabolism (Gcdh+/+/Aass+/+'). In this liver-specific GA-1 model, mice do not succumb on high protein diet (FIG. 17A) despite efficient liver repopulation with diseased hepatocytes (FIG. 17B). GA and OH-GA are elevated in the liver as expected, but not in the brain (FIG. 17C, FIG. 17D). In summary, all these transplantation experiments (FIG. 17D), demonstrate that in the absence of a functional lysine catabolism in the brain, toxic catabolites from the liver accumulate in the brain and lead to the typical neurological symptoms of the GA-1 disease model.
Liver-directed gene replacement therapy for Gcdh'' mice
[0722] These novel mechanistic insights imply that liver directed therapies might be beneficial for Gcdh~ ~ mice. Therefore, we generated an Adeno- Associated Virus (AAV) based gene therapy vector, expressing under the control of a liver specific promoter either wild-type Gcdh or green fluorescent protein (GFP) as a control (FIG. 24A - FIG. 24B). We injected intravenously 3- week-old Gcdh~ ~ mice with the AAV vector at a dose of 1.5xl012 vg/mouse. Two weeks after injection mice were placed on high protein diet. As shown in FIG. 18A, most mice were rescued from lethality and survived beyond at least four months with expression of Gcdh in the liver, but not in the brain (FIG. 18B). Immunostaining of rescued mice identified 70-95% hepatocytes expressing GCDH (FIG. 18C). Glutaryl carnitine (C5-DC) levels in the blood (FIG. 18D), as well as GA (FIG. 18E) and 3 -OH-GA (FIG. 18F) levels in brain and liver indicated a biochemical reduction of lysine metabolites upon treatment with the liver directed NAN -Gcdh.
[0723] In addition, neuronal vacuolation and meningeal hemorrhage were decreased in AAV- Gcdh treated compared to control Gcdh~ ~ mice (FIG. 18G, FIG. 18H, FIG. 181). Motor performance of treated mice was comparable to C57BL/6 wild-type mice (FIG. 25A - FIG. 25B). Because GA-1 patients ideally need to start treatment as neonates, we injected neonatal Gcdh~~ mice with a low (3 x 1011 vg/mouse), intermediate (7.5 x 1011 vg/mouse), or high (1.5xl012 vg/mouse) dose of .A AN -Gcdh. After weaning, the treated mice were exposed to high-protein diet. Although we could observe a dose dependent therapeutic effect, the results were less pronounced as with treatment at 3 weeks of age (FIG. 18J). This could be explained by a dose dependent but overall lower expression of GCDH in the liver (FIG. 18K) of the neonatally injected Gcdh~ ~ mice compared to a treatment after weaning. The low number (2-10%) of GCDH expressing hepatocytes (FIG. 18L) implies that after neonatal administration, the AAV vector gets diluted or
silenced upon growth of the liver despite the injection at a much higher dose per body weight. Hence, a more refined approach consisting of repeated treatment with AA -Gcdh may further improve the therapeutic effect also in neonatal Gcdh~ ~ mice.
Deletion of Aass in the liver by CRISPR gene therapy in Gcdh ~ mice
[0724] Last, to explore an alternative therapy for Gcdh~ ~ pups and to leverage our observation that transgenic deletion of Aass rescues the lethality of Gcdh deletion (FIG. 16A), we designed an AAV gene therapy vector expressing liver-directed CRISPR/Cas9 effector molecules targeting and thereby deleting Aass (FIG. 26A-FIG. 26B). Again, we injected neonatal Gcdh~ ~ mice with a low (2.4 x 1011 vg/mouse), intermediate (6xlOn vg/mouse) and high (IxlO12 vg/mouse) dose of the AAV vector. The high dose of AAV-CRISPR rescued all six injected pups from lethality induced by high protein diet after weaning (FIG. 19A). Biochemical analysis revealed a significant reduction of lysine catabolites in both liver and brain (FIG. 19B and FIG. 19C) after 60 days on high protein diet compared to AAV-GFP treated mice after only 4 days on high protein. AAV-CRISPR therapy resulted in a dose dependent deletion of /.s.s in the liver (FIG. 19D). Most importantly, hippocampal vacuolation and subdural hemorrhage could not be observed in AAV- CRISPR treated Gcdh~ ~ mice in contrast to clear pathological alterations in non-treated mice after only 4 days of high protein diet exposure (FIG. 19E - FIG. 19G). Prior to euthanizing the AAV- CRISPR treated Gcdh~ ~ mice, we conducted neurobehavior al testing and could only detect a mild reduction in the hind-paw grip strength compared to inbred C57BL/6 control mice (FIG. 27A- FIG. 27B). Interestingly, lysine levels in the serum were not significantly increased (FIG. 28A - FIG. 28B), despite the lack of hepatic lysine catabolism. As a proof-of-concept for knockdown instead of deletion, we targeted Aass by siRNA and could demonstrate a modest but significant increase of survival with a one-time injection (FIG. 29A - FIG. 29B).
[0725] In summary, these results demonstrate that Aass deletion or reduction in the liver of neonates is therapeutic for Gcdh~ ~ mice, and a single injection of AAV-CRISPR protects mice from death or development of severe neurological symptoms.
[0726] In a series of transplantation experiments (summarized in FIG. 17A - FIG. 17E) we demonstrate that hepatic lysine catabolism directly impacts the accumulation of toxic catabolites in the brain in both directions, e.g. reduction or increase of catabolites, in the absence of functional lysine catabolism in the brain. These results are striking, given the previously described fruit bat (McMillan TA, et al. (1988) J Biol Chem. 263: 17258-17261) and liver-specific GA-1 mouse model (Sauer SW, et al. (2006) J Neurochem. 97:899-910), which both have a GCDH-deficiency in the liver but do not have any disease symptoms nor accumulation of catabolites in the brain. We reproduced the same results when generating a liver-specific GA-1 mouse model with our
TIRF strain (FIG. 17A - FIG. 17E). Moreover, isotope tracing experiments in C57BL/6 mice demonstrated an extremely limited accumulation in the brain after intraperitoneal injection of GA- 1 catabolites (Sauer SW, et al. (2006) J Neurochem. 97:899-910). However, it is important to note, that all these reports use animals with a functional lysine catabolism in the brain (e.g.
In all these settings, the lack of neurotoxicity could be explained either by a reduced flux of GA-1 catabolites across the blood-brain barrier or by an efficient detoxification of GA-1 catabolites in the brain even when these catabolites originate from the liver. Our findings clearly support the latter interpretation and are compatible with all previous observations in bats or mice. Also, results from the earlier mouse studies (Pena IA, et al. (2017) Biochim Biophys Acta Mol Basis Dis. 1863: 121-128) and human Genotype-Tissue Expression (GTEx) proj ect show abundant expression of lysine catabolic genes in relevant brain areas (Consortium GT (2015) Science. 348:648-660) implying efficient cerebral lysine catabolism.
[0727] In addition to revealing novel mechanistic insight into the obscure GA-1 pathology (Jafari P, et al. (2011) Molecular genetics and metabolism. 104:425-437), our transplantation studies generate a scientific rationale for a liver-directed therapeutic approach.
[0728] We have recently developed a therapeutic concept, called metabolic pathway reprogramming, which couples the power of CRISPR technology with a strategy from pharmacology, namely, to inhibit an enzymatic pathway rather than to edit a disease-causing gene directly (Pankowicz FP, et al. (2017) Gut. 66: 1329-1340). In our first proof of principle study, we rescued the lethality of hereditary tyrosinemia type I by liver-specific-deletion of the upstream enzyme hydroxyphenylpyruvate dioxygenase (Pankowicz FP, et al. (2016) Nature communications. 7: 12642). However, in contrast to tyrosinemia, there is no small molecule inhibitor or other specific therapy for GA-1 and we believe that our AAV-CRISPR therapy could indeed be useful in the clinic. While gene editing is very promising, there are some major clinical hurdles to overcome, such as off target editing or expression of bacterial proteins in humans. It is conceivable that more readily translatable therapies such as siRNA or antisense oligonucleotide therapeutics can be developed.
[0729] Furthermore, we show that an AAV gene replacement therapy in the liver is yet another therapeutic option for GA-1. A few months ago, the first liver directed AAV gene therapy was approved, with many other ongoing clinical trials targeting the liver using a gene replacement approach (ClinicalTrials.gov). Despite these encouraging advancements in AAV gene therapy, animal studies have identified an increased incidence of liver cancer (Nguyen GN, et al. (2021) Nat Biotechnol. 39:47-55) (Donsante A, et al. (2007) Science. 317:477) and at present it has not
been determined if these observations also apply to humans. It is conceivable that mRNA therapies could circumvent this potential limitation, but come with limitations of their own.
[0730] Irrespectively, both liver-directed therapies presented here could complement or substitute current dietary approaches, particularly for patients with compliance issues or for the prevention of long-term sequalae.
[0731] In summary, we have demonstrated in a series of transplantation experiments that the liver directly contributes to the toxic accumulation and therapeutic reduction of lysine catabolites in the brain. Further studies will be needed to identify the actual metabolites crossing the blood-brain barrier that are responsible for these observations and dissect the relative contributions of other pathomechanisms of GA-1, such as the vascular dysfunction (Muhlhausen C, et al. (2004) Journal of inherited metabolic disease. 27:829-834). Nevertheless, this mechanistic insight identifies an accessible organ to target for the development of therapeutics in order to eventually help patients suffering from GA-1.
Study design
[0732] This study aimed to elucidate the role of hepatic lysine catabolism in regard to the pathophysiology of GA-1 and develop a targeted therapy for this devastating disorder. Therefore, we designed a two-step procedure:
Hepatocyte transplantation experiments
[0733] Single and double knockout mice were transplanted and enriched with different knockout and wild-type hepatocytes as described under experiments and methods. After repopulation, animals were subjected to high-protein (casein) diet and used for all different experiments described in manuscript. Primary endpoints were survival, GA-1 catabolites, neuropathology and motor performance.
Therapeutic approaches
[0734] Neonatal or adult single (Gcdh-/-) knockout mice were treated with two different gene therapy approaches AAN-Gcdh or AAV-CRISPR). Doses and routes were as explained in the different experiments. After weaning of mice or two weeks after injection (adult), mice were put on high-protein diet. Identical endpoints as described above were used. An additional siRNA treatment group was included with a one-time injection as described in methods. Primary endpoint of this group was survival and knockout efficiency by immunostaining for AASS.
Generation of single (Gcdh'') and double Gcd 7' /Aass'7') knockout mouse models
[0735] Gcdh 7' single knockout and Gcdh 7' /Aass7' double knockout mouse strains were generated by injecting either C57BL/6J or TIRF (transgene-free Ilr2g ~, Rag2~7', I’Cth' ) zygotes (Bissig- Choisat B, et al. (2021) JHEP Rep. 3: 100281) (Barzi M, et al. (2017) Nature communications.
8:39) with CRISPR/Cas9 gene editing mRNA as we described previously (Barzi M, et al. (2017) Nature communications. 8:39). The following sgRNAs were designed using Benchling software and injected at the same time with the Cas9 mRNA: Gcdh (exon 3)
GCCGCTCCTGGCAGTAGTTA (SEQ ID NO: 05), Gcdh (exon 5)
GTGTGTCGTCGGTGGCCTAT (SEQ ID NO: 06), Aass (exon 6)
GTGCAGGCTGTCCGTGATGC (SEQ ID NO: 07), Aass (exon 7)
GAAACTTCTCTTAATTCGTG (SEQ I NO: 09). F0 mice were analyzed by PCR followed by
Sanger sequencing using the following PCR primers: Gcdh forward:
TTATCCCCAGGGTCAGAAG (SEQ ID NO: 13), Gcdh reverse: CCAGACCGACATCTGAC (SEQ ID NO: 14), Aass forward: TAGAGAGAACGGGCAGGATGT (SEQ ID NO: 15), Aass reverse: TCTACGGGATCGTACACACCA (SEQ ID NO: 16). Further offspring genotyping was performed by Transnetyx (Cordoba, TN).
Experiments with knockout mice
[0736] Control animals for experiments were C57BL/6J mice (#000664; Jackson Laboratories, Bar Harbor, ME). Transplantation experiments were all conducted on the TIRF genetic background (Bissig-Choisat B, et al. (2021) JHEP Rep. 3: 100281), whereas all other experiments were conducted on the C57BL/6J genetic background. Single (Gcdh4 and double (Gcdh4 /Aass' /_) knockout mice were maintained under a standard 12-h dark/light cycle with water and regular chow provided ad libitum. Because our standard mouse chow is relatively poor in protein (21%) and mice have no protein-rich meals and constant access to food (no fasting), we used a high protein diet (61% protein - 70% Casein diet; Envigo Teklad Custom diet Cat# TD.06723) to trigger the disease phenotype. For the Adeno -Associated virus (AAV) experiments, 3-week-old and 6-day-old Gcdh4 pups were injected (i.p.) with a single concentration of AAV expressing either the murine Gcdh cDNA or with two CRISPR/Cas9 gene editing tools targeting Aass, both regulated by a liver specific promoter (HI.P). Two weeks after injection or when pups reached the weaning age, mice were exposed to a high protein diet.
[0737] For transplantation experiments (TIRF background) with Gcdh4' and double Gcdh4 /Aass4) knockout mice, 3-week-old mice were transplanted with Gcdh4 or Gcdh+/+ hepatocytes, respectively. Nitisinone was stepwise reduced over 8 days, and mice were kept for 5 months without the drug (expansion phase of hepatocytes), before being exposed to high protein diet. Aged-matched controls were used for all the transplanted experiments. Urine, blood, liver, and brain (where described) were collected 4 or 5 days after challenging the mice with the high-protein diet. Mouse body weights were monitored throughout the experiment and all mouse tissues were collected for further analysis at the experimental endpoints.
Hepatocyte isolation
[0738] To obtain primary hepatocytes for transplantation experiments, mouse livers were perfused using a modified two-step collagenase perfusion method as described previously (Maeso-Diaz R, et al. (2022) Aging Cell. 21 :el3530). Quality of the isolated hepatocytes was assessed by trypan -blue staining of perfusate and used if viability was >90%. Freshly isolated hepatocytes were transplanted into mice the same day (<8 hours after isolation).
Hepatocyte transplantation
[0739] Hepatocyte transplantation was performed as previously described (Bissig-Choisat B, et al. (2015) Nature communications. 6:7339) in the TIRF genetic background host strain (Transgene-free ITfr'/ Rag2 /~/Fah fr. Healthy hepatocytes (Gcclh ) expressing td-Tomato red fluorescent reporter (mT/mG mouse strain, B6. 129(Cg)-Gt(ROS A)26Sortni4f C I ,!_td l oniato‘_, '<'1 1>,['1'0 J, cat#007676; Jackson Laboratories) were used for single (Gcdhfr ) mouse strain, and diseased (Gcdhfr hepatocytes were transplanted into double (GcdF Aass ^ ) knockout mouse strains. In brief, IxlO6 hepatocytes were injected into the spleen of 2-month-old mice (male and female). Immediately after transplantation, selection pressure towards transplanted hepatocytes was applied by withdrawing the drug nitisinone (NTBC) from the drinking water. After 2 weeks, mice were returned to NTBC treatment for 3 days before a second withdrawal (cycling). Subsequently, mice remained without nitisinone for 6 months to assure a good repopulation with transplanted hepatocytes. Before starting the high-protein diet challenge, mice were placed on NTBC to ensure no interference with the tyrosinemia in the TIRF strain. Aged-matched (8-month-old) corresponding controls were used for all the transplanted experiments.
AAV vector cloning/AAV virus production
[0740] Murine Gcdh cDNA was cloned by removing EmGFP in the 1162-pAAV-HLP-EmGFP- SpA plasmid (Addgene #109313) using Xbal-Mlul restriction enzymes. Murine Aass Sa sgRNAs oligonucleotides were annealed and ligated into 1313.1- pAAV-U6-SA-BbsI-MluI-gRNA-HLP- OLLAS-spA vector (Addgene #109314) with BbsI restriction enzyme. AAVs were produced as previously described (Nelson CE, et al. (2019) Nat Med. 25:427-432) using the AAVcc47 capsid (Gonzalez TJ, et al. (2022) Nature communications. 13 :5947). S. aureus sgRNAs sequences used to target exons 6 and 7 of mAass are 5’ GTCCCTGTGAAGACAAACGTT 3’ (- strand) (SEQ ID NO:08) and 5’ CTTGTGAGTATGTGGAGCCCC 3’ (+ strand) (SEQ ID NO: 10), respectively. siRNA experiments and preparation
[0741] siRNA injection solution was prepared following Invivofectamine 3.0 Reagent Complexation protocol (Thermosfisher Scientific, Cat# IVF3001). In brief, siRNA duplex (sense sequence 5’ GGAGUCUUGAUGAACAUAATT 3’ (SEQ ID NO:33) and antisense sequence 5’
UUAUGUUCAUCAAGACUCCCA 3’ (SEQ ID NO:34), Ambion, Cat#4457308, ID#s78304) was first diluted in RNAse free water to a concentration of 250pM, aliquoted and stored at -80°C. siRNA duplex solution was diluted in 1 : 1 in complexation buffer and then mixed 1 : 1 with Invivofectamine 3.0 Reagent, vortexed, and incubated at 50°C for 30 minutes. The complex was diluted 1 :6 with RNAse PBS lx pH7.4. Aass siRNA (8 mg/kg) solution was injected into the tail vein of 3-week-old GcdlT ’ mice that were put on a high protein diet 48 hours later. Mice were harvested postmortem for protein expression of AASS in the liver using AASS immunostaining as described in the immunostaining section method.
Neurobehavioral studies
[0742] Spontaneous motor activity: Spontaneous motor activity was monitored in the open field (21 x 21 x 30 cm) over 30 min in an automated Omnitech Digiscan apparatus (AccuScan Instruments) (Fukui M, et al. (2007) J Neurosci. 27: 10520-10529). The Accuscan software scored motor activities as horizontal or vertical beam-breaks to determine the total distance traveled, vertical activity, velocity of movement, and time spent in the center zone of the arena.
[0743] Accelerating rotarod: Balance and coordination were evaluated on an accelerating (4-40 rpm over 5-min) rotarod (Med-Associates) as described (Taylor GA, et al. (2008) Genes Brain Behav. 7:786-795). Motor performance was examined over 4 successive 5-min trials that were separated by 20-30 min each. A given trial was terminated when the mouse fell from the rod or when 300 sec had elapsed, and these times were recorded as the latency to fall.
[0744] Grip strength: The strength of the front and rear paws to grip a bar was analyzed with a mouse grip-strength meter (San Diego Instruments) and was expressed as units of g-force (Wang X, et al. (2011) Hum Mol Genet. 20:3093-3108).
Blood Metabolite Analysis
[0745] Acylcamitine (C5-DC) and amino acids (Lysine and Tryptophan) were measured from whole blood obtained from mice by retro-orbital eye bleedings four days after high-protein diet exposure.
Blood Acylcarnitine (C5-DC)
[0746] Materials: Whatman 903 protein saver cards (Sigma-Aldrich), da- Acetyl carnitine (da-C2, Sigma-Aldrich) da-Propionylcamitine (da-C3, Sigma-Aldrich), da-Butyrylcamitine (da-C4, Sigma- Aldrich), da-Octanoylcamitine (da-C8, Sigma- Aldrich) and da-Palmitoyl carnitine (da-C16, Sigma-Aldrich). General solvents and reagents were purchased from Sigma-Aldrich (St. Louis, MO) or VWR (Radnor, PA). In-house deionized water (diH2O) was used in the preparation of mobile phases or for dilutions.
[0747] Sample preparation: Whole blood (16 pL) was pipetted onto two 3/16” diameter circles of cotton-fiber filter paper and allowed to dry overnight in a microcentrifuge tube. Subsequently, 6 pL of an internal standard (IS) mixture [5 pmol/L ds-C2, 1 pmol/L ds-C3, 1 pmol/L ds-C4, 1 pmol/L ds-C8, 2 pmol/L ds-C16 in methanol: dikhO 50:50 (v/v)] was added to the tube with 400 pL of methanol (MeOH). The microcentrifuge tubes were placed on an orbital shaker for 30 min at ambient temperature. The entire volume of liquid was transferred to a 0.2 pm filter tube and centrifuged at 16,380 x g for 2 min. An aliquot (200 pL) of the filtered supernatant was transferred to a 96-well round-bottom plate and evaporated to dryness under nitrogen at 40°C. After drying, 70 pL of 3M MeOH-hydrochloric acid was added to each well, an adhesive cover was placed over each plate, and the samples incubated in an oven for 15 min at 50 °C. Samples were dried under a stream of nitrogen at 40 °C and reconstituted in a matrix of MeOELdiE O 85: 15 (v:v) and analyzed by electrospray ionization-tandem mass spectrometry (ESI-MS/MS) (Millington DS, et al. Methods in molecular biology. 708:55-72) (Lepage N, et al. (2010) Methods in molecular biology. 603:9-25).
[0748] LC-MS/MS Analysis: Acyl carnitines in whole blood were analyzed as methyl esters using stable isotope dilution ESI-MS/MS. Derivatized samples were analyzed by flow injection analysis (FIA) and detected using a precursor ion scan of m/z 99. Samples were analyzed using a TQ Detector tandem-quadrupole mass spectrometer equipped with an Acquity Classic system (Waters Corporation). A FIA was performed over 2.5 min using MeOEkdiELO 80:20 (v:v), which permitted elution of the sample between 0.2 and 1.0 min, with a wash-out period between 1.0 and 2.2 min, followed by a re-equilibration period from 2.2 to 2.5 min.
[0749] Data Processing: The raw data were processed using Neolynx (Waters Corp.). The ratio of ion intensities of acylcamitine species and its specified deuterated IS was multiplied by the nominal concentration of the IS (5, 1, 1, 1, 2 pmol/L). Concentrations of standards are given in units of pmol/L. Glutaryl carnitine (C5-DC), with a m/z 304, was measured against octanoyl-L- camitine-ds (d3-C8) with m/z 305. Propionylcamitine (C3), with m/z 232, and acetylcarnitine (C2), with m/z 218, were each compared to their own deuterated IS (d3-C2 and d3-C3).
Blood Amino Acids
[0750] Materials: Whatman 903 protein saver cards (Sigma-Aldrich), Kairos amino acid internal standard set (100+), amino acid calibrator set (100+), amino acid quality control set (100+), and the AccQ-Tag Ultra derivatization kit were purchased from Waters Corporation (Milford, MA). LC-MS grade acetonitrile, methanol, formic acid, acids and bases were purchased from Sigma- Aldrich (St. Louis, MO) or VWR (Radnor, PA). In-house deionized water (diH2O) was used in the preparation of mobile phases or for dilutions.
[0751] Analysis of amino acids by LC-MS/MS: Whole blood (12 qL) was pipetted onto a 1/4” diameter circle of cotton-fiber filter paper and allowed to dry overnight in a microcentrifuge tube. Plasma amino acids were analyzed using a modification of the Kairos Amino Acid method. Equal volumes (50 pL) of plasma and an internal standard solution containing a mixture of [13C, 15N]- labeled amino acids were combined. Protein was precipitated using 50 pL 10% sulfosalicylic acid and removed by centrifugation. The supernatant was added to a borate buffer, mixed with the 6- aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC) derivatization reagent, incubated at 55 °C for 10 min, and diluted with dEEO. Plasma amino acid- AQC derivatives were analyzed using a Waters Acquity I-Class UPLC coupled to a Waters Xevo TQ-S micro mass spectrometer. Amino acids were separated on a 1.6 pm 2 x 150 mm Cortecs UPLC column by gradient elution over 9.5 min, with 0.1% formic acid in aqueous acetonitrile as the mobile phase. Analytes were detected by selected reaction monitoring in positive ion mode. Peak area ratios of amino acids and their corresponding internal standard were converted to a concentration by means of a 6- or 7-point 1/x weighted calibration curve. Details of the acquisition parameters and calibrator concentrations are provided in TABLES 8 and 9.
Tissue Organic acids
[0752] 100 mg of liver and brain tissues were obtained from mice at harvesting endpoint followed by homogenization in 500 mL of distilled water.
[0753] Glutaric Acid and 3-OH Glutaric Acid measurements: Quantitative measurement of glutaric acid (GA) and 3-OH-glutaric acid (3-OH-GA) in tissue homogenates was performed by gas chromatography-mass spectroscopy using stable-isotope dilution as previously described (Zinnanti WJ, et al. (2007) The Journal of clinical investigation. 117:3258-3270). Samples were sonicated for 20 cycles. Seventy mg of sulfosalicylic acid was added to the samples to remove endogenous protein. Samples were centrifuged at 13120 rpm for 20 min (desktop centrifuge). One-half mL of the resulting supernatant was removed and the deuterated internal standards (100 mL d4 glutaric and 12.5 mL d5 3H glutaric acid) were added. The mixture was extracted twice with 3 mL diethyl ether and 1.5 mL ethyl acetate. The combined organic phases were dried at 30°C under nitrogen and derivatized with 100 mL BTSFA/1% TMCS [N,O- Bis(trimethylsilyl)trifluoroacetamide with trimethylchlorosilane] for 20 min at 80°C. The injected volume of 1 mL was analyzed using an Agilent Technologies 6890N Gas Chromatograph equipped with a 5973N Mass Selective Detector. The mass spectrometer monitored ions at 265/261 (with check of ratio at 237/ 233) for GA and 262/259 (check ratio at 188/185) for 3-OH- GA in separate runs. Quantitation was performed against a separate standard curve for each compound (0 to 10 mg).
Immunohistochemistry
[0754] Paraffin-embedded slides were deparaffinated, rehydrated, and treated with antigen retrieval citrate buffer (p H6.0) (for RFP, AASS and FAH) or with Tris-EDTA buffer (pH 9) (Abeam, cat# ab93684) antigen retrieval (for GCDH) for 30 min at 98°C degrees. Endogenous peroxidase was quenched using 3% hydrogen peroxidase solution (Sigma- Aldrich, cat#88697) and biotin was blocked using the Avidin/Biotin kit following manufacturer’s instructions (Vector Laboratories, cat# SP-2001). After blocking with serum (PK-4001), samples were incubated with either rabbit anti-RFP (Rockland, cat# 600-401-379), rabbit anti-AASS (Sigma-Aldrich, cat# HPA020728), GCDH (Sigma Aldrich, cat# AV43559) or rabbit anti-human FAH antibodies (Sigma Aldrich, SAB2108553) primary antibodies diluted 1 : 100 in antibody diluent buffer (Abeam, cat# Ab64211) and incubated overnight at 4°C. Slides were washed 2x with PBSlx for 15 min and incubated with the anti -rabbit biotinylated secondary antibody at room temperature for 30 min. Immunostaining was developed with a DAB kit (Vector Laboratories, cat# SK-4100). Counterstaining was performed using hematoxylin solution (Richard-Allan Scientific, cat#7211) and bluing solution (Richard-Allan Scientific, cat#7301). Cytoseal (Epredia, cat#8312-4) was used for mounting the slides.
[0755] Paraffin-embedded slides were deparaffinated, rehydrated, and treated with antigen retrieval citrate buffer (pH6.0) for 30 min at 98°C degrees. Endogenous peroxidase was quenched using 3% hydrogen peroxidase solution (Sigma-Aldrich, cat#88697) and biotin was blocked using the Avidin/Biotin kit following manufacturer’s instructions (Vector Laboratories, cat# SP-2001). After blocking with serum (PK-4001), samples were incubated with either rabbit anti-RFP (Rockland, cat# 600-401-379), rabbit anti-AASS (Sigma-Aldrich, cat# HPA020728) or rabbit anti-human FAH antibody (Sigma Aldrich, SAB2108553) primary antibodies diluted 1 : 100 in antibody diluent buffer (Abeam, cat# Ab64211) and incubated overnight at 4°C. Slides were washed 2x with PBSlx for 15 min and incubated with the anti -rabbit biotinylated secondary antibody at room temperature for 30 min. Immunostaining was developed with a DAB kit (Vector Laboratories, cat# SK-4100). Counterstaining was performed using hematoxylin solution (Richard-Allan Scientific, cat#7211) and bluing solution (Richard-Allan Scientific, cat#7301). Cytoseal (Epredia, cat#8312-4) was used for mounting the slides.
[0756] Paraffin-embedded slides were deparaffinated, rehydrated, and treated with antigen retrieval citrate buffer (pH6.0) for 30 min at 98°C degrees. Endogenous peroxidase was quenched using 3% hydrogen peroxidase solution (Sigma-Aldrich, cat#88697) and biotin was blocked using the Avidin/Biotin kit following manufacturer’s instructions (Vector Laboratories, cat# SP-2001). After blocking with serum (PK-4001), samples were incubated with either rabbit anti-RFP
(Rockland, cat# 600-401-379), rabbit anti-AASS (Sigma-Aldrich, cat# HPA020728) or rabbit anti-human FAH antibody (Sigma Aldrich, SAB2108553) primary antibodies diluted 1 : 100 in antibody diluent buffer (Abeam, cat# Ab64211) and incubated overnight at 4°C. Slides were washed 2x with PBSlx for 15 min and incubated with the anti-rabbit biotinylated secondary antibody at room temperature for 30 min. Immunostaining was developed with a DAB kit (Vector Laboratories, cat# SK-4100). Counterstaining was performed using hematoxylin solution (Richard-Allan Scientific, cat#7211) and bluing solution (Richard-Allan Scientific, cat#7301). Cytoseal (Epredia, cat#8312-4) was used for mounting the slides.
Western blot
[0757] Twenty grams of fresh-frozen liver and brain tissues were homogenized with 1.2 mL RIPA buffer (Sigma Aldrich, Cat# R0278) containing protease inhibitors (Roche, cat# 04693159001). Twenty pL (corresponding to 10 pg of protein) of homogenized samples were pre-mixed with loading buffer, heated, and loaded into wells of a polyacrylamide pre-made gel (NuPAGE 4-12% Bis Tris Gel Invitrogen, cat# NP0336BOX) and transferred to a PDVF membrane (Millipore, cat# IPVH00010). After blocking (EveryBlot Blocking Buffer, Biorad Cat#12010020) for 30 min, membranes were incubated at 4°C overnight with primary antibodies diluted in PBS-T. Rabbit Anti-AASS (Sigma-Aldrich, cat# HPA020728), anti-GCDH (Sigma- Aldrich, cat# HPA020728), and P-actin (Sigma Aldrich, cat# A1978) were diluted 1 : 1,000. After washing, membranes were incubated with donkey anti -rabbit HRP secondary antibody (Jackson Immunoresearch, cat#711- 035-152; diluted 1 :5,000) for 1 hour at room temperature. The images were obtained by incubating the membranes with Super Signal West Fempto solution (Thermofisher, cat# 34096).
Histopathology
[0758] Selected tissues (liver, lung, heart, kidney, spleen, and brain) were evaluated by a board- certified veterinary pathologist (J.I.E) in a blinded fashion without knowledge of the allocation group. Mouse brains were sectioned in the parasagittal plane. Following identification of two lesions in initial screening, (meningeal hemorrhage & hippocampal vacuolation), the pathologist graded changes in the brains as normal, minimal, mild, moderate or severe (0-4) using a semi- quantitative scale considering not only the number but also the size/ extension of the pathological findings. The whole hippocampus (parasagittal sections) was evaluated for scoring of vacuolation and the whole brain for meningeal hemorrhage. For each lesion one grade per mouse was given.
Statistical analysis and relevant biological variants
[0759] Statistics are described in the text for individual experiments. Data are expressed as mean ± S.E.M. unless otherwise indicated. Statistical analysis and graphs were done using PRISM (Graph Pad) version 9 software. For comparison of two groups, the Student’s Ltests were used
when samples were normally distributed (analyzed with Shapiro-Wilk test); Mann-Whitney U test was used when non-parametric. Motor performance repeated-measures were analyzed with ANOVA (RMANOVA) followed by Bonferroni corrected pair-wise comparisons, p-values of < 0.05 (*), p < 0.01 (**) or p > 0.001 (***) were considered significant. A log-rank (Mantel -Cox) test was used for the survival curve (p<0.05). We did not find differences between male and female mice in regard to biochemical and clinical endpoints on high-protein diet, and therefore used both sexes in equal numbers.
TABLE 8: SRM Transitions, Detailed View
TABLE 9: Calibrator Concentrations
Example 7
Treating Glutaric Aciduria Type I (GA-1) Mice with Gcdh mRNA Delivered by Lipid Nanoparticles
The delivery of Gcdh mRNA by lipid nanoparticle (LNP) was evaluated.
[0760] The Gcdh mRNA was amplified and cloned into a T7 expression vector with 3 ’ and 5 ’UTR as described previously (Warren L, et al. (2010) Cell Stem Cell., 7(5):618-30). For RNA expression we used RNAase free reagents and barrier pipet tips. The Gcdh mRNA was generated using the HiScribe T7 mRNA Kit with CleanCap Reagent AG (NEB #E2080) using the manufacturers mRNA synthesis protocol with modified nucleotides (N1 -methylpseudouridine). 1 M urea was included in the mRNA synthesis to reduce double strand RNA (Piao et al 2022 PMID: 36090758). After DNase I treatment, RNA was purified using RNeasy Maxi columns (Qiagen).
[0761] The mRNA integrity and yield was assessed by gel electrophoresis. Typically, we got 5mg/ml of transcription. RNA was stored in aliquots at -80 °C.
Generation of lipid nanoparticles (LNP) carrying Gcdh mRNA:
[0762] We used the ionizable lipid mix GenVoy-ILM and the Nanoassembler-Ignite (Precision Nanosystems) to formulate LNP containing Gcdh mRNA using the manufacturer’s protocol.
[0763] LNP encapsulation was validated by the ribogreen assay. LNP were typically directly injected intravenously into Gcdh'7' mice at a dose of 1-3 mg/kg or frozen in aliquots until injection. [0764] We injected intravenously neonatal and adult Gcdh~~ mice with LNP encapsulated Gcdh mRNA at a dose of 1-3 mg/kg (treatment group). Injections were repeated depending on the halflife of the Gcdh protein, which was estimated by Western blotting of harvested livers; for 1-4 weeks old mice twice a week and weekly for mice older than 4 weeks.
[0765] Treated and control Gcdh~ ~ mice were exposed to high protein diet (casein diet) and evaluated for survival and accumulation of lysine catabolites (glutaric acid and hydroxyglutaric acid, C5-DC) in the plasma.
[0766] Treated mice survived significantly longer than control mice and accumulated significantly less glutaric acid, hydroxyglutaric acid and C5-DC. After 3 months mice were harvested and analyzed for brain alterations, e.g., the typical hippocampal vacuolation and
meningeal hemorrhage. The treatment group had much less of these pathological alterations compared to control group, which was analyzed 4 days after exposure to high protein diet.
[0767] These results confirmed that Gcdh mRNA encapsulated within LNPs is an effective treatment for neonatal and adult Gcdh " mice.
Example 8
Treating Glutaric Aciduria Type I (GA-1) Mice with Antisense Compounds Targeting the AASS Gene in The Liver
[0768] As described in this Example, “antisense compound” means a compound comprising an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. Examples of antisense compounds include single-stranded and doublestranded compounds. Further examples include single-stranded antisense oligonucleotides, ribozymes, double-stranded siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
[0769] Aass knockdown by antisense compound was evaluated. Specifically, we evaluated siRNA and antisense oligonucleotide (ASO) as examples of an antisense compound. siRNA targeting Aass
[0770] siRNA duplex (sense sequence 5’ GGAGUCUUGAUGAACAUAATT 3 ’ (SEQ ID NO:33) and antisense sequence 5’ UUAUGUUCAUCAAGACUCCCA 3’) (SEQ ID NO:34) was ordered (Ambion, Cat#4457308, ID#s78304) and diluted in RNAse free water to a concentration of 250pM, aliquoted and stored at -80°C. The target sequence were all exons of mouse Aass (NM_013930.4) and human AASS (NM_005763.4).
ASO targeting Aass
[0771] Gapmer antisense oligonucleotides (ASOs) with modified bases at each end of the Antisense Oligo (such as 2’OMe or Affinity Plus modified bases) were ordered from IDT Integrated DNA technology. The terminal modified bases enhances stability and increase binding affinity to the target. The target sequence were all exons of mouse Aass (NM_013930.4) and human AASS (NM_005763.4). ASO were diluted in RNAse free water to a concentration of 200mg/ml, aliquoted and stored at -80°C.
Preparation of lipid nanoparticles (LNP) encapsulated siRNA or ASO
[0772] siRNA and ASO injection solution was prepared following Invivof ectamine 3.0 Reagent Complexation protocol (Thermosfisher Scientific, Cat# IVF3001). siRNA duplex and ASO solution were diluted in 1 : 1 in complexation buffer and then mixed 1 : 1 with Invivofectamine 3.0 Reagent, vortex ed, and incubated at 50°C for 30 minutes. The complex was diluted 1 :6 with RNAse PBSlx pH7.4.
Results
[0773] Aass siRNA (8mg/kg) solution was injected into the tail vein of 3-week-old Gcdh-/- mice that were put on a high protein diet 48 hours later. Mice were harvested postmortem for protein expression of AASS in the liver using AASS immunostaining as described in the immunostaining section method. FIG. 29 shows an efficient knockdown of Aass and a significantly increased survival of Gcdh-/- mice.
[0774] Aass ASO (lOOmg/kg) solution was injected subcutaneously twice a week into adult and neonatal Gcdh-/- mice and put on high protein diet 3 weeks after starting injections. Survival and knockdown efficiency was evaluated as described for siRNA.
[0775] These results confirm that knockdown by antisense molecules are an effective treatment for neonatal and adult Gcdh~ ~ mice.
Example 9
Treatment of Gcdh-/- mice with siRNA or ASO targeting AASS and GCDH LNP protein replacement therapy
Abstract
[0776] Glutaric Aciduria Type I (GA-1) is an inborn error of metabolism with a severe neurological phenotype caused by the deficiency of glutaryl-CoA dehydrogenase (GCDH), the last enzyme of lysine catabolism. Current literature suggests that toxic catabolites in the brain are produced locally and do not cross the blood brain barrier. In a series of experiments using knockout mice of the lysine catabolic pathway and liver cell transplantation, it was suprisingly discovered that toxic GA-1 catabolites in the brain originated from the liver. Moreover, the characteristic brain and lethal phenotype of the GA-1 mouse model was rescued by two different liver-directed gene therapy approaches: 1) using Adeno- Associated Virus (AAV) to replace the defective Gcdh gene, or 2) preventing flux through the lysine degradation pathway by CRISPR deletion of the aminoadipate-semialdehyde synthase (AASS) gene. mRNA of GCDH is an intermediate of AAV gene therapy but can also be delivered by other vehicles (e.g., lipid nanoparticles (LNP)). Instead of CRISPR deletion of Aass, deletion can be achieved also by other gene modulators or gene editing systems described herein (e.g., endonucleases). Additionally, Aass expression can be silenced by combining transcriptional silencers (e.g., silencing oligonucleotides) with gene modulators or gene editing systems described herein (e.g., endonucleases). Also, it is shown that reduction or inhibition of Aass expression utilizing small interfering RNA has a therapeutic effect.
Results
ASO and siRNA mediated knockdown of AASS in a human hepatic cell line
[0777] To evaluate antisense molecules as a therapy for GA-1, algorithms were utilized to design antisense oligonucleotides (ASO) and small interfering RNA (siRNA), as described herein (e.g., methods of the examples). The target site sequences and AASS exons of the designed ASOs are shown in TABLE 10. A selection of the ASOs were synthesized with modifications to feature locked nucleic acid (LNA) and phosphorothioate backbones, as shown in TABLE 11, which also provides the number of mismatches with the human target sequence within the AASS gene. Sense and antisense strands of the siRNAs are shown in TABLE 12, along with target position and AASS exon, the number of human mismatches, the melting temperature, and the OligoWalk and i- Scores. A selection of the siRNAs were synthesized with modifciations to feature 3 ’ deoxythimidine dinucleotide (dTdT) overhangs for enhanced nuclease resistance, as shown in TABLE 13.
[0778] The efficiency of knockdown in the human HepG2 cell lines was tested, as a proxy for hepatocytes of GA-1 patients. HepG2 cells were transfected (80-90% confluent) with 6 different ASO sequences (TABLE 11) and 5 siRNAs (TABLE 13). Negative controls included nontransfected cells, an ASO targeting PCSK9, and a scrambled siRNA with no target in the human genome were used. 48 hours after transfection cells were harvested and RNA isolated. Reverse transcription followed by quantitative PCR (RT-qPCR) was used to determine knockdown efficiency. A house keeping gene (i.e., GAPDH) was used for normalization of cell number and RNA. RT-qPCR data representing the fold change of AASS mRNA of certain ASOs and siRNAs is shown in FIG. 30A and FIG. 30B. Significant knockdown of several ASO and siRNA therapeutics was demonstrated (see FIGS. 30A-30B).
TABLE 10 - Design of ASOs having Target Sequences within the AASS Gene.
TABLE 11 —ASOs Synthesized with Modifications
”+” means affinity Plus (IDT) a locked nucleic acid design and means phosphorothioate backbone. Mismatch refers to the human target sequence within the AASS gene.
TABLE 12 — Design of siRNAs having Target Sequences within the AASS Gene
* denotes mismatch is in the tolerated region; ** denotes sequences covering the same region
TABLE 13 — siRNAs Synthesized with Modifications
3’ deoxy thy mi dine dinucleotide (dTdT) overhang was chosen for enhanced nuclease resistance
Human GCDH LNP therapy for GA-1 mice.
[0779] To explore a translatable liver-directed therapy of GA-1, mRNA GCDH constructs were generated using the open reading frame of human GCDH. First, a robust 5’ and 3’UTR was synthesized, assuring mRNA stability and abundant translation (Warren et al., Cell Stem Cell. (2010), 7(5):618-30). The UTRs were cloned into a standard plasmid (pAM-026) containing a T7 promoter for mRNA transcription (as described in methods). Then the GCDH open reading frame was cloned into the pAM-026 plasmid. To decrease protein degradation by ubiquitination, several lysine residues were exchanged with arginine. These sites were selected based on published ubiquitination information on the GCDH gene (www.phosphosite.org). From the reported ubiquitination sites (e.g., K32,K163, K202, K240, K361, K371, K377), the sites of K163, K202, K240, K371 were selected, in view of recently published lysine glutarylation (Bhatt et al., J Biol Chem (2022), 298(4): 101723). Two constructs were generated having two lysine replacements each (sample 031 and sample 032) and one construct (sample 033) contained all four lysine to arginine substitutions (see FIG. 31). Lysine modified and wildtype sequence were transcribed to generate capped and stabilized mRNA (as described in methods).
[0780] Resulting mRNA was transfected in HEK293T to evaluate protein stability (see FIG. 32). The data shows that all constructs are expressed and GCDH proteins stable over the time of four days with the exception of mutant 033. This GCDH mutant displayed reduced protein on Western blotting compared to the other GCDH proteins already after 48 hours and more markedly in the remaining time course. Next, all GCDH mRNA constructs were packaged into LNP (as described in methods). Concentrations after packaging were all between 150-250 ng/microliter. GCDH mRNA integrity after LNP production and ability to transfect HEK293T in tissue culture were tested (FIGS. 33A-33D). These results demonstrate abundant and intact mRNA as well as robust transfection of control GFP LNP as well as GCDH LNP. Next, we validated in vivo by injecting intravenously different doses of GCDH LNP 027, 031, 032, or 033 into Gcdh~ ~ mice. FIG 33E shows that we could detect GCDH LNP 027 and 031 in the murine liver.
[0781] To evaluate therapeutic potential of these GCDH LNPs, Gcdh-/- mice were injected intravenously with 6 mg/kg GCDH LNP. Untreated Gcdh-/- mice succumb within a few days after exposure of high protein diet (Barzi et al., Sci Transl Med. (2023) 15(692):eadf4086) and therefore, the injected animals and non -injected controls were exposed to a casein diet. GCDH LNP 027 and 031 could significantly increase survival of Gcdh-/- mice as shown in the Kaplan- Meier curves of FIGS. 34A-34D. GCDH LNP 032 and 033 had no effect on survival(see FIG. 32. In summary, GCDH 027 and GCDH 031 demonstrated a therapeutic effect on Gcdh-/- mice.
Methods
ASO design targeting AASS mRNA structure prediction and ASO sequence filtering
[0782] The complete coding sequence of mouse and human Aass genes was downloaded from NCBI (mouse: CCDS19937.1). The sequence was entered into sfold (sfold.wadsworth.org/output/0705121014.23135/soligo.html) for mRNA structure prediction and oligo targeting sites prediction. Using the default filter criteria by sfold, 33 oligonucleotides of 16 nucleotides length were generated. The 33 oligos were entered into Blastn (blast.ncbi.nlm.nih.gov) to identify for off target effects. Any sequence that has 100% off target were eliminated. The remaining ASO were aligned to the human AASS gene (human: CCDS5783.1). Since many ASO were overlapping, only the one with the lowest delta-G values of each ASO cluster were selected, resulting in a total of 6 ASOs (ASO 1- ASO 6, TABLE 10. In order to design a panel of oligos that target the entirety of the Aass exons, more ASOs, not included in the sfold filtered list, are designed for the untargeted exons. To do this, all the ASO positions in the untargeted exons are sorted by their delta-G value calculated by sfold from lowest to highest. The ASOs with the lowest delta-G value was then screened in Blastn for off target matches. The lowest delta-G ASO without off target matches was selected and numbered corresponding to their exons (ASO exl - ASO ex24), adding 18 more to the list (TABLE 10). Lastly, ASO 78304, targets the identical sequence with the AASS gene of the siRNA described in (Barzi et al., Sci Transl Med. (2023) 15(692):eadf4086) and Figure 29, which showed to efficiently knockdown Aass. See FIG. 35A for a graphical depiction of the AASS exon positions for the ASO molecules.
Synthesis of modified ASOs
[0783] All ASOs were designed as gapmer (Roberts et al. (2020) Nat Rev Drug Discov 19, 673- 694). The length was 16 nucleotides, with phosphorothioate (PS) modifications throughout the oligo. The central DNA segments were 10 nucleotides long, and flanked on each side by 3 nucleotides of locked nucleic acids, selected for their increased efficiency. Out of the final 25 ASOs, 6 were selected and ordered for commercial synthesis at Integrated DNA Technologies Inc. (see TABLE 11).
Negative Control ASO
A 14 nucleotide long ASO gapmer targeting PCSK9 was adapted from Gupta et al. (PLoS One 5, el0682 (2010)). The PCSK9 ASO is used as a negative control for the designed Aass targeting ASOs.
siRNA design targeting AASS
[0784] Murine AASS cDNA sequence was obtained from NCBI (consensus CCDS 19937.1) and entered into Sfold v2.2 (sfold.wadsworth.org/cgi -bin/sima.pl). Sfold predicts the RNA secondary structures and rationally designs siRNA based on probable binding sites. The Sfold output was sorted based on exon number and binding energy. The murine AASS cDNA sequence was then inputted into siDirect v2.1 using the combined rule of Ui-Tei x Reynolds x Amarzguioui design algorithms (sidirect2.rnai.jp/). The siDirect output was entered into iScore (med.nagoya- u. ac.jp/neurogenetics/i_Score/i_score.html) to validate the siRNA constructs as both follow a similar prediction algorithm. Finally, the AASS cDNA sequence was entered into OligoWalk (ma.urmc.rochester.edu/cgi-bin/server_exe/oligowalk/oligowalk_form.cgi), which returns siRNA sequences based on their probability of having an efficient knockdown taking into account the thermodynamics of oligonucleotides binding to the target sequence. The siRNA sequences from Sfold, siDirect, and OligoWalk were compiled, and sequences predicted by multiple platforms were identified and consolidated. Specific regions of AASS that had high rates of topranking siRNAs were also considered, resulting in a list of 17 siRNA constructs (TABLE 12). These sequences were then subj ected to NCBI BLASTn analysis to lower any nonspecific binding. The human AASS cDNA sequence was then acquired from NCBI (consensus CCDS5783.1) and aligned with the murine AASS cDNA sequence. Out of the seventeen siRNA sequences, four perfectly aligned with the human AASS sequence, and one had only one mismatch in the mismatch-tolerated 3 ’ end of the antisense strand (TABLE 12). Those with alignment to human and murine AASS were selected. A scramble siRNA was also designed by randomizing the sequence of one of the selected siRNAs. The scrambled siRNA target sequence does not overlap with any human or murine sequence. siRNAs (sense and antisense) were ordered as duplex from Sigma- Aldrich with two 3 ’prime dTdT overhangs and reduction by two nucleotides of the target sequence (TABLE 13). See FIG. 35B for a graphical depiction of the AASS exon positions for the siRNA molecules. siRNA transfection
[0785] 24 hours before transfection, HepG2 cells, a human hepatoblastoma cell line (Aden et al., Nature (1979), 282:615-616) were passaged (DMEM and 10%FCS, NEAA) into a 48-well plate to achieve a confluency of 80-90% on the day of transfection. siRNAs were transfected with Lipofectamine 3000 (ThermoFisher Scientific, Cat: L30000015) following the manufacturer’s protocol. Briefly, for one reaction, siRNA was transfected at a concentration of 20 nM. siRNA was diluted in 12.5 microliter of optiMEM (Thermo Fisher Scientific, Cat:31985062). 0.75 microL of Lipofectamine 3000 was also diluted in 12.5 microliter of optiMEM. The siRNA-
optiMEM mix was added to the diluted Lipofectamine and incubated at room temperature for 15 minutes. 25 microliter of the mixture was added dropwise onto the cells and incubated for 48 hours before the RNA was extracted using the RiboPure RNA Purification Kit (Invitrogen, Cat: AM1924) according to the manufacturer’s recommendations.
ASO transfection
[0786] 24 hours before transfection, HepG2 cells were passaged into a 48-well plate to achieve a confluency of 80-90% on the day of transfection. ASOs were transfected with Lipofectamine 3000 (ThermoFisher Scientific, Cat: L30000015) following the manufacturer’s protocol. Briefly, for one reaction, ASO was transfected at a concentration of 20 nM. ASO was diluted in 12.5 microliter of optiMEM (Thermo Fisher Scientific, Cat:31985062) and 0.5 microliter of P3000. 0.375 microliter of Lipofectamine 3000 was also diluted in 12.5 microliter of optiMEM. The siRNA-optiMEM mix was added to the diluted Lipofectamine and incubated at room temperature for 15 minutes. 25 microliter of the mixture was added dropwise onto the cells and incubated for 48 hours before the RNA was extracted using the RiboPure RNA Purification Kit (Invitrogen, Cat: AMI 924).
Reverse transcription and quantitative PCR (RT-qPCR) analysis
[0787] 1 microgram of total RNA was reverse transcribed using qScript (Quantabio, Cat: 101414- 106) and diluted 1 :40. qPCR was performed with SYBR Green Universal Master Mix (Thermo Fisher Scientific, Cat: 4309155) and analyzed on the Applied Biosystems Step One Plus standard SYBR green quantification protocol. The following primers were used at a concentration of 800 nM: AASS forward, AGTTCCTCAGGCAGAGTCCA; AASS reverse,
GGCTGAAAAGCCATTGATGT; GAPDH forward, ACCACAGTCCATGCCATCAC; GAPDH reverse, TCCACCACCCTGTTGCTGTA. AASS primer efficiency was verified with a standard curve.
Gf7>//mR\A template design and cloning
[0788] A strong synthetic 5’UTR and mouse alpha-globin 3’ UTR as described by (Warren et al., Cell Stem Cell. (2010), 7(5):618-30) and a 80bp poly Atail is synthesized by Genscript and cloned into a standard plasmid containing a T7 promoter generating the pAM-026 plasmid. To produce pAM-027 containing the GCDH open reading frame, GCDH cDNA (BC002579) cloning vector is purchased from Sino Biological (HG14093-G) and cloned into the pAM-026 plasmid by Gibson Assembly (NEBuilder HiFi DNA Assembly, New England Biolabs, E2621S). Lysine mutated GCDH plasmids pAM-031, pAM-032 and pAM-033 are synthesized by Twist Bioscience with the following specific mutations: pAM-031 has lysine residues at position 163 and 240 amino acid mutated to arginine by changing the lysine codon to arginine codon CGT. pAM-032 has lysine
residues at position 202 and 371 changed to arginine. pAM-033 has lysine residues at all four positions (163, 202, 240 and 371) changed to arginine (FIG. 31). The synthesized fragments are assembled into the empty mRNA expression plasmid pAM-026 via Gibson Assembly. See FIGS. 36A-36E for plasmid maps of pAM-026, pAM-027, pAM-031, pAM-032, and pAM-033, respectively. in vitro transcription of GCDH mRNA
[0789] pAM-027, pAM-031, pAM-032 and pAM-033 plasmid templates are linearized with Smal (New England Biolabs, R0141S) and Hindlll (New England Biolabs, R3104S) for 2 hours at 37°C, followed by PCR purification according to manufacturer’s protocol (Zymo, Clean and Concentrate kit, D4013). mRNA is in vitro transcribed with NEB HiScribe® T7 mRNA Kit with CleanCap® Reagent AG (New England Biolabs, E2080S) following manufacturer’s protocol, where UTP is replaced with Trilink Nl-Methylpseudouridine-5'-Triphosphate (Trilink, N-1081). Following production, mRNA is purified using MEGAclear™ Transcription Clean-Up Kit (Invitrogen, AM1908) following manufacturer’s protocols, and the concentration measured on a NanoDrop (ThermoFisher). The purified mRNA is stored at -80C.
Synthesis of lipid nanoparticles (LNP)
[0790] Lipid Nanoparticles (LNPs) containing GCDH mRNA variants (027, 031, 032 or 033) or empty (no mRNA) were synthesized with the microfluidic system Benchtop Nanoassembler. Briefly, 300 microgram of mRNA were dissolved in 750 microliter of sodium citrate buffer (150 mM, pH=4.5) to make up the aqueous phase, while the lipids DLin-MC3- DMA:DSPC:Cholesterol:DMG-PEG2000 for the control formulation, and the lipids SM- 102 :DOPC: Cholesterol :DMG-PEG2000 for the test formulation (molar ratios 50: 10.5:38: 1.5) were dissolved in 250 microliter of ethanol to make up the organic phase. Later, both phases were briefly warmed at 45°C, then loaded onto syringes for synthesis with the following parameters: the flow rate ratio was set at 1 :3 (organic:aqueous), the total flow rate at 9ml/min, and the waste at 100 microliter. The final N/P ratio (that is, the ratio between the positively charged amine groups of the ionizable lipids over the negatively charged phosphate groups of the mRNA) was set to 6 independently of the mRNA type. After synthesis, LNPs were dialyzed against lx PBS (overnight, 4°C), then filtered with 0.22 micrometer syringe filters. RNA integrity was analyzed before and after LNP synthesis using the RC bioanalyzer microfluidic system.
Characterization of LNP
[0791] Physio-chemical properties of LNPs were measured via dynamic light scattering (DLS, Malvern Zetasizer): 10 microliter of LNPs were diluted in 990 microliter of PBS for size (nm) and poly dispersity index (PDI, a.u.) measurements, while the same amount of LNPs was diluted in 90
microliter of PBS and 900 microliter of double distilled water for zeta potential (mV) measurements. In all cases, the equipment was set to average three sets of measurements with 15 sub-runs each.
[0792] mRNA encapsulation efficiency (EE%) was measured using the Ribogreen RNA assay. LNPs were initially diluted 1 : 100 in TE buffer, then subsequently diluted 1 :2 in either TE buffer (to measure un-encapsulated RNA), or 2% (v/v) Triton-X in TE buffer (to burst LNPs and measure encapsulated RNA), for a total volume of 100 microliter. After a 15-minute incubation at 37DC, Ribogreen reagent was diluted 1 : 10 in TE buffer, then 100 microliter were added to the previously diluted LNPs samples. Following a 10-minute incubation at room temperature, the plate was read at Ex/Em of 480nm/520nm. Results obtained from LNPs diluted in TE buffer were subtracted from those obtained for LNPs diluted in Triton-X to calculate the final mRNA concentration. mRNA transfection in HEK cells
[0793] 24 hours before transfection, HEK293 cells are seeded in 24 well culture plate at 5E4 cells per well in 500 microliter of complete DMEM media (Coming, MT10027CV) supplemented with 10% fetal bovine serum (Corning, MT35010CV) and 1% penicillin-streptomycin (Gibco, 15070063). The day of transfection, 0.5microgram of mRNA is mixed with 1.5 microliter of Lipofectamine MessengerMAX (ThermoFisher, LMRNA001) and 50 microliter Opti-MEM reduced serum media (Gibco, 31985062), and added to cells dropwise. The cells are incubated a 37°C and lysed in 50 microliter RIPA buffer at 24 hours, 48 hours, 72 hours and 96 hours timepoints for western blot.
Western Blot
[0794] For cells in a 12 well plate, cells are washed with PBS at the time of harvest and 100 microliter of RIPA buffer (Millipore Sigma, R0278) is added to each well. The cells are scraped down and the entire content of the well added to a microcentrifuge tube and spun down at 5000xG for 5 minutes at 4°C. The supernatant is removed to a separate tube as cleared lysate. For tissue, 20 mg of fresh-frozen liver was homogenized in 1.2 mL RIPA buffer containing protease inhibitors (Roche, cat# 04693159001) and centrifuged at 5000xG for 5 minutes at 4°C. The supernatant is removed to a separate tube as cleared lysate. Protein concentrations in the clear lysates of cells or tissues are measured with BCA assay (Pierce BCA Protein Assay kits, Thermo Scientific, 23225) following manufacture’s protocol. 20 microgram of protein, mixed with loading buffer are loaded into wells of a polyacrylamide premade gel (NuPAGE 4 to 12% bis-tris gel, Invitrogen, NP0315BOX ) at 200V for an hour. The gel is then transferred to a PDVF (polyvinylidene difluoride) membrane (Immuno-Blot PVDF Membrane for Protein Blotting, Biorad, 1620174) at 30V for an hour. After blocking (EveryBlot Blocking Buffer, Bio-Rad,
12010020) for 30 min, membranes are incubated at 4°C overnight with primary antibodies diluted in blocking buffer. Rabbit anti-GCDH (Sigma-Aldrich, HPA020728), and Mouse anti-P-actin (Santa Cruz Biotechnology, sc-69879) are diluted 1 : 1000. The next day, after washing with PBST, membranes are incubated with donkey anti-rabbit or anti-mouse horseradish peroxidase secondary antibody (diluted 1 :5000; Jackson ImmunoResearch, 711-035-152) for 1 hour at room temperature. The images were obtained by incubating the membranes with SuperSignal West Femto solution (Thermo Fisher Scientific, 34065).
Experiments with Gcdh-/- mice
[0795] Gcdh-/- mice (Barzi et al., Sci Transl Med. (2023) 15(692): eadf4086) were maintained under a standard 12-h dark/light cycle with water and regular chow provided ad libitum. Because our standard mouse chow is relatively poor in protein (21%) and mice have no protein-rich meals and constant access to food (no fasting), we used a high protein diet (61% protein - 70% Casein diet; Envigo Teklad Custom diet Cat# TD.06723) to trigger the disease phenotype.
Example 10
Human AASS project siRNA/ASO screening
[0796] In-vitro human cell-based assays were established to identify siRNA and antisense oligonucleotides that: i) targeted endogenous or synthetic (over-expression) versions of the human AASS gene; and ii) modulated AASS gene expression.
[0797] siRNA sequences targeting the 5’UTR, CDS, and 3’UTR of AASS were designed, with the siRNA antisense strands shown 5’ to 3’ in TABLE 14 below, along with their start position.
TABLE 14 -Design of siRNAs having Target Sequences within the AASS Gene.
[0798] Antisense oligonucleotide (ASO) sequences targeting the 5’UTR, CDS, and 3’UTR of AASS were designed. The ASO sequences are shown 5’ to 3’ in TABLE 15 below, along with starting position relative to the AASS mRNA. Overlap with certain ASOs disclosed above (e.g., ID# 001 through 038) are also shown.
TABLE 15 — Design of ASOs having Target Sequences within the AASS Gene.
Results
Human AASS Targeting siRNA Oligonucleotides
[0799] Data from oligonucleotide (siRNA) library screening indicated that the 5’UTR, proteincoding region and the 3’UTRs are each suitable targets for oligonucleotides to knock-down gene expression (see FIG. 37 and FIG. 38). Active oligonucleotides (e.g., having a mean <1.0) in both the endogenous system and over-expression system were #004 (E), #006 (I), #009 (H), #024 (A), and #025 (B). Active oligonucleotides (mean <1.0) in the endogenous system were #003 (J), #010 (K), #023 (C), #028 (F), #029 (G) & #030 (D). Active oligonucleotides (mean <1.0) in the overexpression system were #011 (S) & #012 (#M). It was found that some regions of the human AASS gene targeted by oligonucleotides (siRNAs) lead to increases in gene expression (e.g., #018 (R), and #019 (P)).
Human AASS Targeting Antisense Oligonucleotides
[0800] Data from antisense oligo (ASO) library screening indicated that the 5’ UTR, proteincoding region and the 3’ UTRs are all targets for oligonucleotides to knock-down gene expression (see FIG. 39 and FIG. 40). All ASOs tested (e.g., #101 to #125 of TABLE 15) in the endogenous system were active (mean <1.0), with most reaching significance. ASOs #103 and #104 were replicates of the same sequence. Eight of the ASOs tested in the over-expression system were significantly active (mean <1.0). Six additional ASOs tested in the over-expression system were active (mean <1.0). ASO’s #101, #102 and #120-125 do not bind to the over-expressed huAASS cDNA sequence, which may explain their lack of knockdown activity in this assay format.
[0801] These findings together demonstrate the broad range of target sequences of AASS that can be targeted using a genetic editing, modification, or silencing oligonucleotide.
Materials and Methods
Plasmid transformation and Maxi-Prep
[0802] The pCMV6-entry mammalian expression vector was commercially sourced from Origene (Cat. No: PS100001). Plasmids carrying the human AASS (hAASS gene in pCMV6 vector were commercially obtained from OriGene (Cat. No: RC224831). An aliquot (2ng/pl) of the diluted hAASS plasmid was chemically transformed into OneShot Top 10 chemically competent E. coli (Invitrogen, Cat. No: C404003) as per the manufacturer’s instructions and cells were plated onto Luria-Bertani (LB)/kanamycin (50pg/ml) agar plates and incubated at 37°C overnight. A single colony was picked from the plate and grown in 100ml LB/kanamycin (50pg/ml) culture overnight. Plasmid DNA was prepared using the Endofree Plasmid Maxi Kit (Qiagen, Cat. No: 12362) following manufacturer’s instructions. Plasmid DNA was dissolved in 500pl of endotoxin-free Buffer TE and was quantified using the NanoDrop 8000.
Cell culture and treatment
Day 1:
[0803] Wild-type HEK293T cells were cultured in media containing DMEM with Glutamax (Gibco, Cat No: 61965026), and supplemented with 10% FBS (Gibco, Cat. No: A3160802), 1% sodium pyruvate (Gibco, Cat. No: 11360039), 1% HEPES (Gibco, Cat. No: 15630056), 1% penicillin-streptomycin (Sigma, P4333) at 37°C, 5% CO2. HEK293T cells were plated on four 96-well plates at a density of 12,000 cells per well in lOOpl volume and incubated at 37°C, 5% CO2 for 24 hours.
Day 2:
[0804] From the two 96-well plates plated on Day 1, one plate was used for either siRNA or ASO treatment (details of siRNA and ASO treatments are described under Day 3). AASS was over expressed by transfection with hAASS plasmid on the remaining 2 plates. The over-expression transfection mix was prepared in duplicate (one tube for siRNA plate and one tube for ASO plate) by adding 294pl of OptiMem (Gibco, Cat. No: 31985062), 12pl ofFugene6 (Promega, Cat. No: E2693) and 6pl of hAASS plasmid (1017ng/pl) and incubated at room temperature for 15 minutes. A no over-expression Fugene transfection mix was prepared by adding 49pl of OptiMem and 2 pl of Fugene6, to run as Fugene6 control. Cell media was replaced with fresh lOOpl media. The cells in treatment wells were treated with 3 pl of over-expression transfection mix. To the no overexpression controls, 3-4 wells were treated with 3 pl of no over-expression Fugene transfection mix, and another set of 3-4 wells were treated with 3 pl of OptiMem. Cells were incubated at 37°C, 5% CO2 for 24 hours.
Day 3:
[0805] For siRNA treatment plates, a RNAiMax-siRNA complex was prepared for each plate by adding 0.58pL of lOpM siRNA stock solution, 0.72pl of Lipofectamine RNAiMax (Invitrogen, Cat No: 13778150) and 94.7pL of OptiMem to obtain a final concentration of lOnM per well. A RNAiMax only control was prepared by mixing 95.28pl OptiMem and 0.72pl RNAiMax. Similarly, for ASO treatment plates, RNAiMax-ASO complex was prepared for each plate by adding of 2.16pl of 10 pM ASO stock solution, 0.54pl of Lipofectamine RNAiMax (Invitrogen, Cat No: 13778150) and 69.3pl of OptiMem to obtain a final concentration of 50nM per well. A RNAiMax only control was prepared by mixing 71.46pl OptiMem and 0.54 pl RNAiMax. The transfection complexes were incubated for 20 minutes at room temperature. Cell media was replaced with lOOpl fresh media. On relevant wells, 20pl siRNA-RNAiMax or ASO-RNAiMax complex was added. To the RNAiMax control wells, 20pl RNAiMax alone complex was added and on no treatment controls, 20pl of OptiMem was added. Cells were incubated at 37°C, 5% CO2 for 48 hours.
RNA extraction, complementary DNA (cDNA) synthesis and Quantitative Polymerase Chain Reaction (qPCR)
[0806] RNA was extracted using the MagMAX mirVana Total RNA isolation kit (Applied Biosystems, Cat. No: A27828), according to the manufacturer’s instructions. RNA was synthesised into lOOng of cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat. No: 4368813) with RNase Inhibitor (Applied Biosystems, Cat No: N8080119), according to the manufacturer’s instructions. qPCR was performed with Fast SYBR Green Master Mix (Applied Biosystems, Cat. No: 4385618) using hAASS primer set 1 (Fl/Rl) or 2 (F2/R2). AASS qPCR primer sequences were provided by Duke University. Human GAPDH primers were used as the endogenous housekeeping gene control.
TABLE 16 — hAASS and hGAPDH primer sets for qPCR
[0807] Fast SYBR Green qPCR thermal conditions are as follows: enzyme activation step at 95°C for 20 seconds, denaturation step at 95°C for 3 seconds and anneal/extend step at 60°C for 30 seconds, with 40 amplification cycles. The Ct values were normalised to the housekeeping gene GAPDH to obtain ACt and AACt values were calculated by keeping over-expression (OE) RNAiMax as reference group. The gene expression values were calculated from AACt values by using the formula 2A-(AACt).
Statistics and reproducibility
[0808] All experiments were performed with 3-4 biological treatment replicates. While running qPCR, three technical replicates per biological replicate were used. Statistical analysis was performed using the Bio-Rad CFX Maestro software. Statistical significance was determined if -value <0.05 and was tested using ordinary one-way analysis of variance (one-way ANOVA) followed by Tukey-Kramer test.
Claims
1. An isolated nucleic acid molecule, comprising a nucleic acid sequence encoding a recombinant glutaryl-CoA dehydrogenase (GCDH).
2. The isolated nucleic acid molecule of Claim 1, wherein the recombinant GCDH comprises one or more functional domains.
3. The isolated nucleic acid molecule of Claim 1 or 2, wherein the encoded recombinant GCDH comprises the amino acid sequence set forth in SEQ ID NO:3.
4. The isolated nucleic acid molecule of any one of Claims 1-3, wherein the nucleic acid sequence encoding the recombinant GCDH comprises a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater than about 95% identity to the protein coding sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof.
5. The isolated nucleic acid of Claim 1 or 2, wherein the encoded recombinant GCDH is a variant
GCDH comprising one or more amino acid substitutions.
6. The isolated nucleic acid of Claim 5, wherein the recombinant GCDH comprises a) one or more substitutions selected from K163R, K240R, K202R, or K371R; b) a set of substitutions selected from K163R and K240R; c) a set of substitutions selected from K202R and K371R; d) or a set of substitutions selected from K163R, K202R, K240R, and K371R, wherein amino acid numbering is according to SEQ ID NO:3.
7. The isolated nucleic acid of Claim 5 or 6, wherein the variant GCDH comprises the amino acid sequence set forth in SEQ ID NO:200, SEQ ID NO:201, or SEQ ID NO:202, or a fragment thereof.
8. The isolated nucleic acid molecule of any one of Claims 6-7, wherein the nucleic acid sequence encoding the recombinant GCDH comprises a sequence having at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or greater
than about 95% identity to the sequence set forth in SEQ ID NO: 197, SEQ ID NO: 198, or SEQ ID NO: 199, or a fragment thereof.
9. The isolated nucleic acid molecule of any one of claims 1-6, further comprising a) at least one 5 '-cap; b) a 5’UTR sequence, optionally wherein the 5’UTR sequence comprises the sequence set forth in SEQ ID NO: 189; c) an open reading frame (ORF) encoding the recombinant or wildtype GCDH; d) a 3’UTR sequence, optionally comprising the sequence set forth in SEQ ID NO: 190; and/or e) a poly-A region.
10. The isolated nucleic acid molecule of any one of Claims 1-9, which is an mRNA molecule, optionally a modified mRNA (mmRNA).
11. The isolated nucleic acid molecule of any one of Claims 1-10, wherein the isolated nucleic acid molecule is encapsulated or attached to a delivery vehicle.
12. The isolated nucleic acid molecule of Claim 11, wherein the delivery vehicle is a lipid nanoparticle.
13. An isolated nucleic acid molecule, comprising a nucleic acid sequence encoding one or more elements of a gene editing system, wherein the gene editing system targets a target sequence within the aminoadipate-semialdehyde synthase (AASS) gene.
14. The isolated nucleic acid molecule of Claim 13, wherein the target sequence within the AASS gene renders a partial knockout or a complete knockout of AASS protein activity or expression.
15. The isolated nucleic acid molecule of Claim 13 or 14, wherein the gene editing system is selected from a a) CRISPR gene editing system, optionally selected from a CRISPR-Cas or CRISPR-
KRAB gene editing system; b) prime editing system; c) base editing system; d) zinc-finger nuclease gene editing system; e) TALEN gene editing system;
f) ARCUS nuclease gene editing system; g) meganuclease gene editing system; h) recombinase gene editing system, optionally selected from a Cre recombinase or FLP tyrosine recombinase gene editing system; i) transposase gene editing system, optionally selected from a Sleeping Beauty (SB) transposase or ISY100 transposase gene editing system; j) integrase gene editing system, optionally selected from a Streptomyces phage C31 integrase gene editing system, or k) homologous recombination gene editing system, optionally selected from small fragment homologous replacement editing system.
16. The isolated nucleic acid molecule of claim 15, wherein the gene editing system is a CRISPR-
Cas system selected from a) a Class I or Class II CRISPR-Cas system; b) a Type I, Type II, Type III, Type IV, Type V, or a Type VI CRISPR-Cas system; or c) a Subtype A, Subtype B, Subtype C, Subtype D, Subtype E, Subtype F, or Subtype U
CRISPR-Cas system; or d) a Cascade, SpCas9, SaCas9, FnCas9, NmCas9, Casl2a (Cpfl), Casl2b (C2cl), Casl2c
(C2c3), Casl3a (C2c2), Casl3b(C2c4), Casl3c (C2c7), or Casl3d CRISPR-Cas system.
17. The isolated nucleic acid molecule of Claim 15 or 16, wherein the gene editing system is a
CRISPR-Cas system, and the one or more elements of the gene editing system comprises a Cas9 endonuclease, optionally an SaCas9 endonuclease.
18. The isolated nucleic acid molecule of Claim 17, wherein the Cas9 endonuclease is encoded by a sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:28.
19. The isolated nucleic acid molecule of any one of Claims 13-18, wherein the target sequence within the AASS gene is selected from: a) within the 5’UTR, within exon 1, within exon 2, within exon 3, within exon 4, within exon 5, within exon 6, within exon 7, within exon 8, within exon 9, within exon
10, within exon 11, within exon 12, within exon 13, within exon 14, within exon
15, within exon 16, within exon 17, within exon 18, within exon 19, within exon
20, within exon 21, within exon 22, within exon 23, within exon 24, within exon
24, within exon 25, within the 3’UTR, or within a portion of any one of exons 1- 25 or the 5’UTR and 3 ’UTR of the AASS gene; or b) an overlap region of the AASS gene comprising a portion of a first region of AASS and a portion of a second region of AASS, wherein i) ii) the portion of the first region of AASS is within exon 1 of AASS and the portion of the second region of AASS is within exon 2 of AASS; iii) the portion of the first region of AASS is within exon 2 of AASS and the portion of the second region of AASS is within exon 3 of AASS; iv) the portion of the first region of AASS is within exon 3 of AASS and the portion of the second region of AASS is within exon 4 of AASS; v) the portion of the first region of AASS is within exon 4 of AASS and the portion of the second region of AASS is within exon 5 of AASS; vi) the portion of the first region of AASS is within exon 5 of AASS and the portion of the second region of AASS is within exon 6 of AASS; vii) the portion of the first region of AASS is within exon 6 of AASS and the portion of the second region of AASS is within exon 7 of AAS ; viii) the portion of the first region of AASS is within exon 7 of AASS and the portion of the second region of AASS is within exon 8 of AASS; ix) the portion of the first region of AASS is within exon 8 of AASS and the portion of the second region of AASS is within exon 9 of AASS; x) the portion of the first region of AASS is within exon 9 of AASS and the portion of the second region of AASS is within exon 10 of AASS; xi) the portion of the first region of AASS is within exon 10 of AASS and the portion of the second region of AASS is within exon 11 of AASS; xii) the portion of the first region of AASS is within exon 11 of AASS and the portion of the second region of AASS is within exon 12 of AASS; xiii) the portion of the first region of AASS is within exon 12 of AASS and the portion of the second region of AASS is within exon 13 of AASS; xiv) the portion of the first region of AASS is within exon 13 of AASS and the portion of the second region of AASS is within exon 14 of AASS; xv) the portion of the first region of AASS is within exon 14 of AASS and the portion of the second region of AASS is within exon 15 of AASS;
xvi) the portion of the first region of AASS is within exon 15 of AASS and the portion of the second region of AASS is within exon 16 of AASS; xvii) the portion of the first region of AASS is within exon 16 of AASS and the portion of the second region of AASS is within exon 17 of AASS; xviii) the portion of the first region of AASS is within exon 17 of AASS and the portion of the second region of AASS is within exon 18 of AASS; xix) the portion of the first region of AASS is within exon 18 of AASS and the portion of the second region of AASS is within exon 19 of AASS; xx) the portion of the first region of AASS is within exon 19 of AASS and the portion of the second region of AASS is within exon 20 of AASS; xxi) the portion of the first region of AASS is within exon 20 of AASS and the portion of the second region of AASS is within exon 21 of AASS; xxii) the portion of the first region of AASS is within exon 21 of AASS and the portion of the second region of AASS is within exon 22 of AASS; xxiii) the portion of the first region of AASS is within exon 22 of AASS and the portion of the second region of AASS is within exon 23 of AASS; xxiv) the portion of the first region of AASS is within exon 23 of AASS and the portion of the second region of AASS is within exon 24 of AASS; or xxv) the portion of the first region of AASS is within exon 24 of AASS and the portion of the second region of AASS is within exon 25 of AASS..
20. The isolated nucleic acid molecule of Claim 19, wherein the overlap region comprises a) about 90% of the number of nucleotides of the overlap region being within the first region and about 10% of the number of nucleotides of the overlap region being within the second region; b) about 80% of the number of nucleotides of the overlap region being within the first region and about 20% of the number of nucleotides of the overlap region being within the second region; c) about 70% of the number of nucleotides of the overlap region being within the first region and about 30% of the number of nucleotides of the overlap region being within the second region; d) about 60% of the number of nucleotides of the overlap region being within the first region and about 40% of the number of nucleotides of the overlap region being within the second region;
e) about 50% of the number of nucleotides of the overlap region being within the first region and about 50% of the number of nucleotides of the overlap region being within the second region; f) about 40% of the number of nucleotides of the overlap region being within the first region and about 60% of the number of nucleotides of the overlap region being within the second region; g) about 30% of the number of nucleotides of the overlap region being within the first region and about 70% of the number of nucleotides of the overlap region being within the second region; h) about 20% of the number of nucleotides of the overlap region being within the first region and about 80% of the number of nucleotides of the overlap region being within the second region; or i) about 10% of the number of nucleotides of the overlap region being within the first region and about 90% of the number of nucleotides of the overlap region being within the second region.
21. The isolated nucleic acid molecule of Claim 13, wherein the gene editing system is a CRISPR gene editing system, and the one or more elements of the gene editing system comprises an sgRNA, which targets the AASS gene.
22. The isolated nucleic acid molecule of Claim 21, wherein the sgRNA comprises the sequence set forth in any one of SEQ ID NOS:7-10.
23. The isolated nucleic acid molecule of Claim 13, wherein the gene editing system is a CRISPR gene editing system, and the one or more elements of the gene editing system comprises a Cas9 endonuclease encoded by the sequence set forth in SEQ ID NO:28, and an sgRNA comprising the sequence set forth in any one of SEQ ID NOS:7-10.
24. A vector, comprising the isolated nucleic acid encoding the recombinant GCDH according to any one of Claims 1-10.
25. The vector of Claim 24, comprising a promoter operably linked to the nucleic acid sequence encoding the recombinant GCDH.
26. The vector of Claim 24 or 25, wherein the promoter comprises a liver specific promoter.
27. The vector of Claim 26, wherein the liver specific promoter comprises or consists of the sequence set forth in SEQ ID NO:26.
28. A viral vector, comprising the vector of any one of Claims 24-27.
29. The viral vector of Claim 28, which is selected from an adeno-associated viral (AAV) vector, adenoviral vector, retroviral vector, lentiviral vector, poxviral vector, or a herpes simplex viral vector.
30. The viral vector of Claim 29, which is an AAV vector selected from AAV8 or AAVcc47.
31. A non-viral vector, comprising the vector of any one of Claims 24-27.
32. The non-viral vector of Claim 31, which is a lipid nanoparticle, cationic particle, cationic liposome, cationic polymer, or a lipid-polymer..
33. A vector, comprising the isolated nucleic acid molecule encoding the one or more elements of a gene editing system according to any one of Claims 13-23.
34. The vector of Claim 33, comprising a promoter operably linked to the one or more elements of the gene editing system.
35. The vector of Claim 34, wherein the promoter comprises a liver specific promoter.
36. The vector of any one of Claims 31-35, wherein the gene editing system is a CRISPR-Cas system, and the one or more elements of the gene editing system comprises a Cas9 endonuclease, optionally an SaCas9 endonuclease, which is operably linked to the liver specific promoter.
37. The vector of Claim 35 or 36, wherein the liver specific promoter comprises the sequence set forth in SEQ ID NO:26.
38. The vector of any one of Claims 31-37, comprising a promoter operably linked to an sgRNA.
39. The vector of Claim 38, wherein the promoter operably linked to the sgRNA comprises a U6 promoter.
40. The vector of Claim 39, wherein the U6 promoter comprises the sequence set forth in SEQ ID NO:27.
41. A viral vector, comprising the vector of any one of Claims 33-40.
42. The viral vector of Claim 41, which is selected from an adeno-associated viral (AAV) vector, adenoviral vector, retroviral vector, lentiviral vector, poxviral vector, or a herpes simplex viral vector.
43. The viral vector of Claim 42, which is an AAV vector selected from AAV8 or AAVcc47.
44. A viral vector, comprising: the sequence set forth in SEQ ID NO: 19, SEQ ID NO:20, or SEQ
ID N0:21.
45. A non-viral vector, comprising the vector of any one of Claims 33-40.
46. The non-viral vector of claim 45, which is a lipid nanoparticle, cationic particle, cationic liposome, cationic polymer, or a lipid-polymer.
47. A method of modulating lysine catabolism in the liver, the method comprising: administering to a subject in need thereof a therapeutically effective amount of a silencing oligonucleotide, wherein the silencing oligonucleotide silences a gene in one or more lysine catabolism pathways in the liver of the subject, and/or administering to a subject in need thereof a therapeutically effective amount of the vector of any one of Claims 24-27, the viral vector of any one of Claims 28-30, or the non-viral vector of Claim 31 or 32, wherein expression of the nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase (GCDH) in the liver of the subject.
48. A method of modulating lysine catabolism in the liver, the method comprising: administering to a subject in need thereof a therapeutically effective amount of silencing oligonucleotide, wherein the silencing oligonucleotide silences a gene in one or more lysine catabolism pathways in the liver of the subject, and/or administering to a subject in need thereof a therapeutically effective amount of protein replacement therapy, wherein expression of the encoded nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase (GCDH) in the liver of the subject.
49. The method of Claim 48, wherein the protein replacement therapy is an mRNA therapy, gene therapy, or therapeutic administration of a recombinant protein.
50. The method of Claim 48 or 49, wherein the protein replacement therapy increases expression of a functional glutaryl-CoA dehydrogenase (GCDH) in the liver of the subject, optionally wherein the GCDH comprises a) one or more substitutions selected from K163R, K240R, K202R, OR K371R; b) a set of substitutions selected from K163R and K240R; c) a set of substitutions selected from K202R and K371R; d) or a set of substitutions selected from K163R, K202R, K240R, and K371R.
51. The method of any one of Claims 47-50, wherein the silencing oligonucleotide is selected from an siRNA, antisense oligonucleotide, miRNA, shRNA, ssRNA, dsRNA, piRNA, or a 3 UTR of mRNA.
52. The method of any one of Claims 47-51, wherein the silencing oligonucleotide is conjugated to a tissue-targeting moiety.
53. The method of Claim 52, wherein the tissue-targeting moiety targets the liver.
54. The method of Claim 53, wherein the tissue-targeting moiety comprises one or more GalNAc, optionally two or three GalNAc.
55. The method of any one of Claims 47-54, wherein silencing oligonucleotide targets a target sequence within the aminoadipate-semialdehyde synthase (AASS) gene.
56. The method of claim 55, wherein target sequence within the AASS gene is selected from: a) within the 5’UTR, within exon 1, within exon 2, within exon 3, within exon 4, within exon 5, within exon 6, within exon 7, within exon 8, within exon 9, within exon 10, within exon 11, within exon 12, within exon 13, within exon 14, within exon
15, within exon 16, within exon 17, within exon 18, within exon 19, within exon
20, within exon 21, within exon 22, within exon 23, within exon 24, within exon
24, within exon 25, within the 3 ’ UTR, or within a portion of any one of exons 1-
25 or the 5’UTR or 3 ’UTR of the AASS gene; or b) an overlap region of the AASS gene comprising a portion of a first region of AASS and a portion of a second region of AASS, wherein i) portion of the first region of AASS is within the 5’UTR of AASS and the portion of the second region of AASS is within exon 1 of AASS; ii) the portion of the first region of AASS is within exon 1 of AASS and the portion of the second region of AASS is within exon 2 of AASS;
iii) the portion of the first region of AASS is within exon 2 of AASS and the portion of the second region of AASS is within exon 3 of AASS; iv) the portion of the first region of AASS is within exon 3 of AASS and the portion of the second region of AASS is within exon 4 of AASS; v) the portion of the first region of AASS is within exon 4 of AASS and the portion of the second region of AASS is within exon 5 of AASS; vi) the portion of the first region of AASS is within exon 5 of AASS and the portion of the second region of AASS is within exon 6 of AASS; vii) the portion of the first region of AASS is within exon 6 of AASS and the portion of the second region of AASS is within exon 7 of AAS ; viii) the portion of the first region of AASS is within exon 7 of AASS and the portion of the second region of AASS is within exon 8 of AASS; ix) the portion of the first region of AASS is within exon 8 of AASS and the portion of the second region of AASS is within exon 9 of AASS; x) the portion of the first region of AASS is within exon 9 of AASS and the portion of the second region of AASS is within exon 10 of AASS; xi) the portion of the first region of AASS is within exon 10 of AASS and the portion of the second region of AASS is within exon 11 of AASS; xii) the portion of the first region of AASS is within exon 11 of AASS and the portion of the second region of AASS is within exon 12 of AASS; xiii) the portion of the first region of AASS is within exon 12 of AASS and the portion of the second region of AASS is within exon 13 of AASS; xiv) the portion of the first region of AASS is within exon 13 of AASS and the portion of the second region of AASS is within exon 14 of AASS; xv) the portion of the first region of AASS is within exon 14 of AASS and the portion of the second region of AASS is within exon 15 of AASS; xvi) the portion of the first region of AASS is within exon 15 of AASS and the portion of the second region of AASS is within exon 16 of AASS; xvii) the portion of the first region of AASS is within exon 16 of AASS and the portion of the second region of AASS is within exon 17 of AASS; xviii) the portion of the first region of AASS is within exon 17 of AASS and the portion of the second region of AASS is within exon 18 of AASS; xix) the portion of the first region of AASS is within exon 18 of AASS and the portion of the second region of AASS is within exon 19 of AASS;
xx) the portion of the first region of AASS is within exon 19 of AASS and the portion of the second region of AASS is within exon 20 of AASS; xxi) the portion of the first region of AASS is within exon 20 of AASS and the portion of the second region of AASS is within exon 21 of AASS; xxii) the portion of the first region of AASS is within exon 21 of AASS and the portion of the second region of AASS is within exon 22 of AASS; xxiii) the portion of the first region of AASS is within exon 22 of AASS and the portion of the second region of AASS is within exon 23 of AASS; xxiv) the portion of the first region of AASS is within exon 23 of AASS and the portion of the second region of AASS is within exon 24 of AASS; xxv) the portion of the first region of AASS is within exon 24 of AASS and the portion of the second region of AASS is within exon 25 of AASS; or xxvi) the portion of the first region of AASS is within exon 25 of AASS and the portion of the second region of AASS is within the 3’UTR of AASS.
57. The method of Claim 56, wherein the overlap region comprises a) about 90% of the number of nucleotides of the overlap region being within the first region and about 10% of the number of nucleotides of the overlap region being within the second region; b) about 80% of the number of nucleotides of the overlap region being within the first region and about 20% of the number of nucleotides of the overlap region being within the second region; c) about 70% of the number of nucleotides of the overlap region being within the first region and about 30% of the number of nucleotides of the overlap region being within the second region; d) about 60% of the number of nucleotides of the overlap region being within the first region and about 40% of the number of nucleotides of the overlap region being within the second region; e) about 50% of the number of nucleotides of the overlap region being within the first region and about 50% of the number of nucleotides of the overlap region being within the second region; f) about 40% of the number of nucleotides of the overlap region being within the first region and about 60% of the number of nucleotides of the overlap region being within the second region;
g) about 30% of the number of nucleotides of the overlap region being within the first region and about 70% of the number of nucleotides of the overlap region being within the second region; h) about 20% of the number of nucleotides of the overlap region being within the first region and about 80% of the number of nucleotides of the overlap region being within the second region; or i) about 10% of the number of nucleotides of the overlap region being within the first region and about 90% of the number of nucleotides of the overlap region being within the second region.
58. The method of any one of Claims 55-57, wherein the target sequence within the AASS gene comprises a) one or more nucleotides of the AASS gene corresponding to positions 127-142, positions 256-271, positions 355-370, positions 433-448, positions 486-501, 572- 587, positions 661-676, positions 777-792, positions 858-873, positions 1045- 1060, positions 1329-1344, positions 1345-1360, positions 1378-1393, 1490-1505, positions 1672-1687, positions 1832-1847, positions 1944-1959, positions 2042- 2057, positions 2072-2087, positions 2220-2235, positions 2384-2399, positions 2588-2603, or positions 2714-2729 of an AASS gene having the sequence set forth in SEQ ID NO:36; b) one or more nucleotides of the AASS gene corresponding to positions 615-635, positions 726-746, positions 742-760, positions 742-762, positions 843-863843- 863, positions 911-929, positions 911-931, positions 1010-1030, positions 1154- 1172, positions 1154-1174, positions 1292-1310, positions 1292-1312, positions 1355-1375, positions 1358-1376, positions 1358-1378, positions 1364-1384, positions 1476-1496, positions 1521-1541, positions 1531-1551, positions 1613- 1633, positions 2222-2242, or positions 2438-2458 of an AASS gene having the sequence set forth in SEQ ID NO:36; c) one or more nucleotides of the AASS gene corresponding to positions within about 20 nucleotides in the 3’ direction from starting position 95, 103, 104, 105, 292, 489, 533, 534, 726, 739, 740, 893, 1059, 1181, 1447, 1448, 1449, 2197, 2211, 2468, 2492, 2498, 2804, 2805, 2526, 3061, 3929, 4002, 4003, 4004, 5278, 5283, 5411, 5416, 5417, 5605, 5678, 5679 of an AASS gene having the sequence set forth in SEQ ID NO:36;
d) one or more nucleotides of the AASS gene corresponding to positions within about 20 nucleotides in the 3’ direction from starting position 6, 31, 105, 195, 280, 488, 530, 892, 1060, 1144, 1306, 1384, 1385, 1455, 2100, 2151, 2214, 2825, 2914, 4003, 4004, 4366, 5283, or 5679 of an AASS gene having the sequence set forth in SEQ ID NO:36.
59. The method of any one of Claims 53-58, wherein the silencing oligonucleotide comprises or consists of a nucleic acid sequence selected from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74-117, 120-182, or a reverse complement thereof.
60. The method of any one of Claims 47-59, wherein the gene in the one or more lysine catabolism pathways comprises the aminoadipate-semialdehyde synthase gene, a-aminoadipic semialdehyde gene, the kynurenine aminotransferase 2 gene, the dehydrogenase El and transketolase domain-containing protein 1 gene, the L-lysine alpha-oxidase gene, the ketimine reductase mu-crystallin protein gene, the peroxisomal sarcosine oxidase gene, or the pyrroline-5 -carboxylate reductase gene.
61. A method of restoring the expression of glutaryl-CoA dehydrogenase (GCDH), the method comprising: a) administering to a subject in need thereof a therapeutically effective amount of the vector of any one of Claims 24-27, the viral vector of any one of Claims 28-30, or the non-viral vector of Claim 31 or 32, wherein expression of the encoded nucleic acid sequence generates a functional glutaryl-CoA dehydrogenase in the liver.
62. The method of any one of Claims 47-61, wherein the activity or expression of glutaryl-CoA dehydrogenase is restored in the liver of the subject.
63. The method of any one of Claims 47-61, wherein normal lysine catabolism is restored in the subj ect.
64. The method of any one of Claims 47-61, wherein the subject has been diagnosed with glutaric aciduria type 1 (GA-1).
65. The method of any one of Claims 47-61, wherein administering the vector, viral vector, or protein replacement therapy comprises intravenous administration or intrahepatic administration.
66. The method of Claim 47 or 61, wherein a therapeutically effective amount of the viral vector comprises a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg.
67. The method of any one of Claim 47-66, further comprising monitoring the subject for adverse effects following the administering step.
68. The method of Claim 67, wherein in the presence of adverse effects, the method further comprises modifying one or more steps of the method.
69. The method of any one of Claims 61-68, further comprising administering to the subject a therapeutically effective amount of a therapeutic agent.
70. The method of any one of Claims 61-69, further comprising administering to the subject a therapeutically effective amount of one or more immune modulators.
71. The method of Claim 70, wherein the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
72. The method of any one of Claims 47-71, further comprising monitoring the subject’s metabolic and/or physiologic improvement.
73. The method of any one of Claims 47-72, wherein liver-specific modulation of lysine catabolism is restored, wherein one or more aspects of lysine homeostasis is restored in the subject’s liver, wherein the level of toxic catabolites in the liver is reduced, wherein the level of toxic catabolites in the brain is reduced, wherein the metabolic flux from glutaryl-CoA to crotonyl-CoA is restored in the subject’s liver, wherein the subject’s motor performance is improved, wherein the subject’s memory function is improved, wherein the subject’s anxiety is reduced and/or prevented, wherein the subject’s neurological sequelae are reduced and/or prevented, wherein the subject’s vascular dysfunction is improved, wherein the subject’s quality of life is improved, wherein the subject’s life span is increased, wherein the subject’s survivability is increased, or any combination thereof.
74. A method of reprogramming a metabolic pathway, the method comprising administering to a subject in need thereof a therapeutically effective amount of a viral vector comprising a nucleic acid sequence encoding a Cas9 endonuclease and a sgRNA directed at a target sequence in the aminoadipate-semialdehyde synthase (AASS) gene.
75. The method of Claim 74, wherein normal lysine catabolism is restored.
76. The method of Claim 74 wherein the viral vector comprises the viral vector of any one of
Claims 41-44.
77. The method of Claim 74, wherein administering the viral vector comprises intravenous administration or intrahepatic administration.
78. The method of Claim 74, wherein a therapeutically effective amount of the viral vector comprises a range of about 1 x IO10 vg/kg to about 2 x 1014 vg/kg.
79. The method of Claim 74, further comprising monitoring the subject for adverse effects following the administering step.
80. The method of Claim 79, wherein in the presence of adverse effects, the method further comprises modifying one or more steps of the method.
81. The method of any one of Claims 74-80, further comprising administering to the subject a therapeutically effective amount of a therapeutic agent.
82. The method of any one of Claims 74-81, further comprising administering to the subject a therapeutically effective amount of a one or more immune modulators.
83. The method of Claim 82, wherein the one or more immune modulators comprise methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, prednisolone or a prednisolone analog, SVP-Rapamycin, bortezomib, or a combination thereof.
84. The method of any one of Claims 74-83, further comprising monitoring the subject’s metabolic and/or physiologic improvement.
85. The method of Claim 74, wherein the expression of the nucleic acid sequences eliminates the functionality of aminoadipate-semialdehyde synthase in the subject’s liver.
86. The method of any one of Claims 74-85, wherein liver-specific modulation of lysine catabolism is restored, wherein one or more aspects of lysine homeostasis is restored in the subject’s liver, wherein the level of toxic catabolites in the liver is reduced, wherein the level of toxic catabolites in the brain is reduced, wherein the metabolic flux from glutaryl-CoA to crotonyl-CoA is restored in the subject’s liver, wherein the subject’s motor performance is improved, wherein the subject’s memory function is improved,
wherein the subject’s anxiety is reduced and/or prevented, wherein the subject’s neurological sequelae are reduced and/or prevented, wherein the subject’s vascular dysfunction is improved, wherein the subject’s quality of life is improved, wherein the subject’s life span is increased, wherein the subject’s survivability is increased, or any combination thereof.
87. The method of any one of Claims 74-85, wherein the metabolic pathway that is reprogrammed comprises a lysine metabolic pathway.
88. The method of Claim 87, wherein the lysine metabolic pathway comprises the pipecolate pathway and/or the saccharopine pathway.
89. A method of treating and/or preventing GA-1 disease progression, the method comprising: administering to the liver of a subj ect in need thereof a therapeutically effective amount of hepatocytes, wherein the hepatocytes are GCDH+/+/AASS+/+.
90. The method of Claim 89, wherein liver-specific modulation of lysine catabolism is restored, wherein one or more aspects of lysine homeostasis is restored in the subject’s liver, wherein the level of toxic catabolites in the liver is reduced, wherein the level of toxic catabolites in the brain is reduced, wherein the metabolic flux from glutaryl-CoA to crotonyl-CoA is restored in the subject’s liver, wherein the subject’s motor performance is improved, wherein the subject’s memory function is improved, wherein the subject’s anxiety is reduced and/or prevented, wherein the subject’s neurological sequelae are reduced and/or prevented, wherein the subj ect’ s vascular dysfunction is improved, wherein the subject’s quality of life is improved, wherein the subject’s life span is increased, wherein the subject’s survivability is increased, or any combination thereof.
91. A silencing oligonucleotide, which hybridizes to a targeted mRNA, wherein the targeted mRNA encodes aminoadipic semialdehyde synthase (AASS) or a portion thereof.
92. The silencing oligonucleotide of Claim 91, wherein the targeted mRNA comprises the sequence of SEQ ID NO:36 or a portion thereof.
93. The silencing oligonucleotide of Claim 91, wherein the targeted mRNA encodes an AASS comprising the amino acid sequence of SEQ ID NO:37 or a portion thereof.
94. The silencing oligonucleotide of any one of Claims 91-93, wherein the silencing oligonucleotide is conjugated to a tissue-targeting moeity.
95. The silencing oligonucleotide of Claim 94, wherein the tissue-targeting moiety targets the liver.
96. The silencing oligonucleotide of Claim 95, wherein the tissue-targeting moiety comprises one or more GalNAc, optionally two GalNAc or three GalNAc.
97. The silencing oligonucleotide of any one of Claims 91-96, which targets a target sequence within the AASS mRNA selected from: a) within the 5’UTR, within exon 1, within exon 2, within exon 3, within exon 4, within exon 5, within exon 6, within exon 7, within exon 8, within exon 9, within exon 10, within exon 11, within exon 12, within exon 13, within exon 14, within exon
15, within exon 16, within exon 17, within exon 18, within exon 19, within exon
20, within exon 21, within exon 22, within exon 23, within exon 24, within exon
24, within exon 25, within the 3’UTR, or within a portion of any one of exons 1-
25 or the 5’UTR or 3 ’UTR of the AASS mRNA; or b) an overlap region of the AASS mRNA comprising a portion of a first region of AASS and a portion of a second region of AASS, wherein i) the portion of the first region of AASS is within the 5’UTR of AASS and the portion of the second region of AASS is within the 3’UTR of AASS; ii) the portion of the first region of AASS is within exon 1 of AASS and the portion of the second region of AASS is within exon 2 of AASS; iii) the portion of the first region of AASS is within exon 2 of AASS and the portion of the second region of AASS is within exon 3 of AASS; iv) the portion of the first region of AASS is within exon 3 of AASS and the portion of the second region of AASS is within exon 4 of AASS; v) the portion of the first region of AASS is within exon 4 of AASS and the portion of the second region of AASS is within exon 5 of AASS; vi) the portion of the first region of AASS is within exon 5 of AASS and the portion of the second region of AASS is within exon 6 of AASS; vii) the portion of the first region of AASS is within exon 6 of AASS and the portion of the second region of AASS is within exon 7 of AAS ; viii) the portion of the first region of AASS is within exon 7 of AASS and the portion of the second region of AASS is within exon 8 of AASS; ix) the portion of the first region of AASS is within exon 8 of AASS and the portion of the second region of AASS is within exon 9 of AASS;
x) the portion of the first region of AASS is within exon 9 of AASS and the portion of the second region of AASS is within exon 10 of AASS; xi) the portion of the first region of AASS is within exon 10 of AASS and the portion of the second region of AASS is within exon 11 of AASS; xii) the portion of the first region of AASS is within exon 11 of AASS and the portion of the second region of AASS is within exon 12 of AASS; xiii) the portion of the first region of AASS is within exon 12 of AASS and the portion of the second region of AASS is within exon 13 of AASS; xiv) the portion of the first region of AASS is within exon 13 of AASS and the portion of the second region of AASS is within exon 14 of AASS; xv) the portion of the first region of AASS is within exon 14 of AASS and the portion of the second region of AASS is within exon 15 of AASS; xvi) the portion of the first region of AASS is within exon 15 of AASS and the portion of the second region of AASS is within exon 16 of AASS; xvii) the portion of the first region of AASS is within exon 16 of AASS and the portion of the second region of AASS is within exon 17 of AASS; xviii) the portion of the first region of AASS is within exon 17 of AASS and the portion of the second region of AASS is within exon 18 of AASS; xix) the portion of the first region of AASS is within exon 18 of AASS and the portion of the second region of AASS is within exon 19 of AASS; xx) the portion of the first region of AASS is within exon 19 of AASS and the portion of the second region of AASS is within exon 20 of AASS; xxi) the portion of the first region of AASS is within exon 20 of AASS and the portion of the second region of AASS is within exon 21 of AASS; xxii) the portion of the first region of AASS is within exon 21 of AASS and the portion of the second region of AASS is within exon 22 of AASS; xxiii) the portion of the first region of AASS is within exon 22 of AASS and the portion of the second region of AASS is within exon 23 of AASS; xxiv) the portion of the first region of AASS is within exon 23 of AASS and the portion of the second region of AASS is within exon 24 of AASS; xxv) the portion of the first region of AASS is within exon 24 of AASS and the portion of the second region of AASS is within exon 25 of AASS; xxvi) the portion of the first region of AASS is within exon 25 of AASS and the portion of the second region of AASS is within the 3’UTR of AASS.
98. The silencing oligonucleotide of Claim 97, wherein the overlap region comprises a) about 90% of the number of nucleotides of the overlap region being within the first region and about 10% of the number of nucleotides of the overlap region being within the second region; b) about 80% of the number of nucleotides of the overlap region being within the first region and about 20% of the number of nucleotides of the overlap region being within the second region; c) about 70% of the number of nucleotides of the overlap region being within the first region and about 30% of the number of nucleotides of the overlap region being within the second region; d) about 60% of the number of nucleotides of the overlap region being within the first region and about 40% of the number of nucleotides of the overlap region being within the second region; e) about 50% of the number of nucleotides of the overlap region being within the first region and about 50% of the number of nucleotides of the overlap region being within the second region; f) about 40% of the number of nucleotides of the overlap region being within the first region and about 60% of the number of nucleotides of the overlap region being within the second region; g) about 30% of the number of nucleotides of the overlap region being within the first region and about 70% of the number of nucleotides of the overlap region being within the second region; h) about 20% of the number of nucleotides of the overlap region being within the first region and about 80% of the number of nucleotides of the overlap region being within the second region; or i) about 10% of the number of nucleotides of the overlap region being within the first region and about 90% of the number of nucleotides of the overlap region being within the second region.
99. The silencing oligonucleotide of any one of Claims 91-98, wherein the target sequence within the AASS mRNA comprises a) one or more nucleotides of the AASS gene corresponding to positions 127-142, positions 256-271, positions 355-370, positions 433-448, positions 486-501, 572- 587, positions 661-676, positions 777-792, positions 858-873, positions 1045- 1060, positions 1329-1344, positions 1345-1360, positions 1378-1393, 1490-1505,
positions 1672-1687, positions 1832-1847, positions 1944-1959, positions 2042- 2057, positions 2072-2087, positions 2220-2235, positions 2384-2399, positions 2588-2603, or positions 2714-2729 of an AASS gene having the sequence set forth in SEQ ID NO:36; b) one or more nucleotides of the AASS gene corresponding to positions 615-635, positions 726-746, positions 742-760, positions 742-762, positions 843-863, positions 911-929, positions 911-931, positions 1010-1030, positions 1154-1172, positions 1154-1174, positions 1292-1310, positions 1292-1312, positions 1355- 1375, positions 1358-1376, positions 1358-1378, positions 1364-1384, positions 1476-1496, positions 1521-1541, positions 1531-1551, positions 1613-1633, positions 2222-2242, or positions 2438-2458 of an AASS gene having the sequence set forth in SEQ ID NO: 36; c) one or more nucleotides of the AASS gene corresponding to positions within about 20 nucleotides in the 3’ direction from starting position 95, 103, 104, 105, 292, 489, 533, 534, 726, 739, 740, 893, 1059, 1181, 1447, 1448, 1449, 2197, 2211, 2468, 2492, 2498, 2804, 2805, 2526, 3061, 3929, 4002, 4003, 4004, 5278, 5283, 5411, 5416, 5417, 5605, 5678, 5679 of an AASS gene having the sequence set forth in SEQ ID NO:36; d) one or more nucleotides of the AASS gene corresponding to positions within about 20 nucleotides in the 3’ direction from starting position 6, 31, 105, 195, 280, 488, 530, 892, 1060, 1144, 1306, 1384, 1385, 1455, 2100, 2151, 2214, 2825, 2914, 4003, 4004, 4366, 5283, or 5679 of an AASS gene having the sequence set forth in SEQ ID NO:36.
100. The silencing oligonucleotide of any one of Claims 91-99, comprising or consisting of a nucleic acid sequence selected from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74- 117, 120-182, or a reverse complement thereof.
101. The silencing oligonucleotide of any one of Claims 91-100, wherein the silencing oligonucleotide is single stranded, or double stranded.
102. The silencing oligonucleotide of any one of Claims 91-101, wherein the silencing oligonucleotide is selected from an siRNA, antisense oligonucleotide, miRNA, shRNA, ssRNA, dsRNA, piRNA, or a 3'UTR of mRNA.
103. The silencing oligonucleotide of any one of Claims 91-102, which is encapsulated in a delivery vehicle.
104. The silencing oligonucleotide of Claim 103, wherein the delivery vehicle is a lipid nanoparticle.
105. An siRNA oligonucleotide that can hybridize to a targeted mRNA that encodes aminoadipic semialdehyde synthase (AASS) or a portion thereof.
106. The siRNA oligonucleotide of Claim 105, wherein the targeted mRNA comprises the sequence of SEQ ID NO:36 or a portion thereof.
107. The siRNA oligonucleotide of Claim 105, wherein an encoded AASS comprises the SEQ ID
NO:37 or a portion thereof.
108. The siRNA oligonucleotide of any one of claims 105-107, which comprises or consists of a nucleic acid sequence selected from any one of SEQ ID NOS:33, 34, 41-65, 67-72, 74- 117, 120-182, or a reverse complement thereof.
109. The siRNA oligonucleotide of claim 108, which is double stranded and comprises a set of nucleic acid sequences selected from the sequences set forth in: SEQ ID NO:74 and SEQ ID NO:75; SEQ ID NO:76 and SEQ ID NO:77; SEQ ID NO:78 and SEQ ID NO:79; SEQ ID NO:80 and SEQ ID NO:81; SEQ ID NO:82 and SEQ ID NO:83; SEQ ID NO:84 and SEQ ID NO:85; SEQ ID NO:86 and SEQ ID NO:87; SEQ ID NO:88 and SEQ ID NO:89; SEQ ID NO:90 and SEQ ID NO:91; SEQ ID NO:92 and SEQ ID NO:93; SEQ ID NO:94 and SEQ ID NO:95; SEQ ID NO:96 and SEQ ID NO:97; SEQ ID NO:98 and SEQ ID NO:99; SEQ ID NO: 100 and SEQ ID NO: 101; SEQ ID NO: 102 and SEQ ID NO: 103; SEQ ID NO: 104 and SEQ ID NO: 105; SEQ ID NO: 106 and SEQ ID NO: 107; SEQ ID NO: 108 and SEQ ID NO: 109; SEQ ID NO: 110 and SEQ ID NO: 111; SEQ ID NO: 112 and SEQ ID NO: 113; SEQ ID NOA M and SEQ ID NO: 115; SEQ ID NO: 116 and SEQ ID NO: 117; or SEQ ID NO: 118 and SEQ ID NO: 119.
110. The siRNA oligonucleotide of any one of Claims 105-109, wherein the siRNA oligonucleotide is conjugated to a tissue-targeting moiety.
111. The siRNA oligonucleotide of Claim 110, wherein the tissue-targeting moiety targets the liver.
112. The siRNA oligonucleotide of Claim 111, wherein the tissue-targeting moiety comprises one or more GalNAc, optionally two GalNAc or three GalNAc.
113. The siRNA oligonucleotide of any one of Claims 105-112, which is encapsulated in a delivery vehicle.
114. The siRNA oligonucleotide of Claim 113, wherein the delivery vehicle is a lipid nanoparticle.
115. An antisense oligonucleotide comprising 14-30 nucleotides that can hybridize to a targeted mRNA that encodes aminoadipic semialdehyde synthase (AASS) or a portion thereof.
116. The antisense oligonucleotide of Claim 115, wherein the targeted mRNA comprises the sequence of SEQ ID NO:36 or a portion thereof.
117. The antisense oligonucleotide of Claim 115, wherein an encoded AASS comprises the SEQ
ID NO:37 or a portion thereof.
118. The antisense oligonucleotide of any one of claims 115-117, which comprises or consists of a single stranded nucleic acid sequence selected from any one of SEQ ID NOS:33, 34, 41- 65, 67-72, 74-117, 120-182.
119. The antisense oligonucleotide of any one of claims 115-118, wherein the antisense oligonucleotide is conjugated to a tissue-targeting moiety.
120. The antisense oligonucleotide of Claim 119, wherein the tissue-targeting moiety targets the liver.
121. The antisense oligonucleotide of Claim 120, wherein the tissue-targeting moiety comprises one or more GalNAc, optionally two GalNAc or three GalNAc.
122. The antisense oligonucleotide of any one of Claims 115-121, wherein the antisense oligonucleotide is encapsulated in a lipid nanoparticle.
123. A conjugate, comprising a liver-targeting moiety conjugated to an oligonucleotide, wherein the oligonucleotide is a disclosed isolated nucleic acid molecule, a disclosed silencing oligonucleotide, a disclosed siRNA oligonucleotide, or a disclosed antisense oligonucleotide.
124. A lipid nanoparticle encapsulating a disclosed isolated nucleic acid molecule, a disclosed silencing oligonucleotide, a disclosed siRNA oligonucleotide, or a disclosed antisense oligonucleotide.
125. A lipid nanoparticle encapsulating the silencing oligonucleotide of any one of Claims 91-
102, the siRNA oligonucleotide of any one of Claims 105-109, or the antisense oligonucleotide of any one of Claims 115-121.
126. A method of reducing one or more catabolites of lysine catabolism, the method comprising administering to a subject in need thereof a disclosed isolated nucleic acid molecule, a disclosed single stranded RNA molecule, a disclosed single stranded RNA molecule, a disclosed antisense oligonucleotide, or any combination thereof.
127. A method of reducing one or more catabolites of lysine catabolism, the method comprising administering to a subject in need thereof the silencing oligonucleotide of any one of Claims 91-102, the siRNA oligonucleotide of any one of Claims 105-109, the antisense oligonucleotide of any one of Claims 115-121, or any combination thereof.
128. The method of Claim 126 or Claim 127, wherein the one or more catabolites comprise glutaric acid (GA), hydroxyglutaric acid (OH-GA), glutarylcamitine (C5-DC), or any combination thereof.
129. The method of Claim 126 or Claim 127, wherein the lysine catabolites are in the brain.
130. The method of Claim 126 or Claim 127, wherein the lysine catabolites are in the liver.
131. The method of Claim 126 or Claim 127, wherein administering comprises administering to the liver the disclosed isolated nucleic acid molecule, the disclosed single stranded RNA molecule, the disclosed single stranded RNA molecule, the disclosed antisense oligonucleotide, or the combination thereof.
132. The method of any of Claim 126-131, further comprising administering to the subject (i) a gene editing system that targets aminoadipic semialdehyde synthase (AASS), or (ii) thereof a gene editing system that disrupts and/or decreases the expression and/or activity level of aminoadipic semialdehyde synthase (AASS).
133. A method of reducing one or more catabolites of lysine catabolism, the method comprising administering to a subject in need thereof an gene editing system, which targets aminoadipic semialdehyde synthase (AASS).
134. The method of Claim 132 or 133, wherein the gene editing system is selected from a a) CRISPR gene editing system, optionally selected from a CRISPR-Cas or CRISPR-
KRAB gene editing system; b) prime editing system; c) base editing system; d) zinc-finger nuclease gene editing system; e) TALEN gene editing system; f) ARCUS nuclease gene editing system; g) meganuclease gene editing system; h) recombinase gene editing system, optionally selected from a Cre recombinase or FLP tyrosine recombinase gene editing system; i) transposase gene editing system, optionally selected from a Sleeping Beauty (SB) transposase or ISY100 transposase gene editing system; j) integrase gene editing system, optionally selected from a Streptomyces phage C31 integrase gene editing system, or k) homologous recombination gene editing system, optionally selected from small fragment homologous replacement editing system.
135. The isolated nucleic acid molecule of claim 134, wherein the gene editing system is a
CRISPR-Cas system selected from a) a Class I or Class II CRISPR-Cas system; b) a Type I, Type II, Type III, Type IV, Type V, or a Type VI CRISPR-Cas system; or c) a Subtype A, Subtype B, Subtype C, Subtype D, Subtype E, Subtype F, or Subtype U
CRISPR-Cas system; or d) a Cascade, SpCas9, SaCas9, FnCas9, NmCas9, Casl2a (Cpfl ), Casl2b (C2cl), Casl2c
(C2c3), Casl3a (C2c2), Casl3b(C2c4), Casl3c (C2c7), or Casl3d CRISPR-Cas system
136. A method of reducing one or more catabolites of lysine catabolism, the method comprising administering to a subject in need thereof a gene modulator that disrupts and/or decreases the expression and/or activity level of aminoadipic semialdehyde synthase (AASS).
137. The method of Claim 136, wherein the gene modulator is encapsulated in a lipid nanoparticle.
138. The method of Claim 137, wherein the gene modulator is delivered via adeno-associated viral vector.
139. The method of Claim 137 or 138, wherein the gene modulator is an endonuclease.
140. The method of Claim 133 or Claim 134, wherein the one or more catabolites comprise glutaric acid (GA), hydroxyglutaric acid (OH-GA), glutaryl carnitine (C5-DC), or any combination thereof.
141. The method of Claim 133 or Claim 134, wherein the lysine catabolites are in the brain.
142. The method of Claim 133 or Claim 134, wherein the lysine catabolites are in the liver.
143. The method of Claim 133 or Claim 134, wherein administering comprises administering to the subject (i) a gene editing system that targets aminoadipic semialdehyde synthase (AASS), or (ii) a gene editing system that disrupts and/or decreases the expression and/or activity level of aminoadipic semialdehyde synthase (AASS).
144. The method of Claim 143, wherein the gene editing system is an endonuclease.
145. The method of Claim 133 or Claim 134, wherein administering comprises administering to the subject an adeno-associated viral vector comprising (i) a gene editing system that targets aminoadipic semialdehyde synthase (AASS), or (ii) a gene editing system that disrupts and/or decreases the expression and/or activity level of aminoadipic semialdehyde synthase (AASS).
146. The method of Claim 133 or Claim 134, wherein administering comprises administering to the subject a lipid nanoparticle comprising (i) a gene editing system that targets aminoadipic semialdehyde synthase (AASS), or (ii) a gene editing system that disrupts and/or decreases the expression and/or activity level of aminoadipic semialdehyde synthase (AASS).
147. The method of Claim 146, wherein the gene editing system is an endonuclease.
148. The method of any one of Claim 133-147, further comprising administering to the subject one or more of the silencing oligonucleotide of any one of Claims 91-102, the siRNA
oligonucleotide of any one of Claims 105-109, the antisense oligonucleotide of any one of Claims 115-119, or any combination thereof.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363491533P | 2023-03-22 | 2023-03-22 | |
| PCT/US2024/021219 WO2024197285A1 (en) | 2023-03-22 | 2024-03-22 | Compositions for and methods of treating and/or preventing glutaric aciduria type-i |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4665853A1 true EP4665853A1 (en) | 2025-12-24 |
Family
ID=92842531
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24775799.0A Pending EP4665853A1 (en) | 2023-03-22 | 2024-03-22 | Compositions for and methods of treating and/or preventing glutaric aciduria type-i |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4665853A1 (en) |
| WO (1) | WO2024197285A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB202415459D0 (en) * | 2024-10-21 | 2024-12-04 | Ucl Business Ltd | Inhibitory RNAS |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114206107A (en) * | 2019-07-26 | 2022-03-18 | 安必思医药公司 | Methods and compositions for producing hepatocytes |
| EP4166157A4 (en) * | 2020-06-16 | 2024-03-06 | Novel Pharma Inc. | COMPOSITION FOR THE TREATMENT OF GLUTARIC ACIDURIA AND ASSOCIATED ADMINISTRATION METHOD |
| GB202020549D0 (en) * | 2020-12-23 | 2021-02-03 | Ucl Business Ltd | Treatment for Lysine Degradation-associated Disorders |
| WO2023049874A1 (en) * | 2021-09-24 | 2023-03-30 | Duke University | Compositions for and methods of treating and/or preventing glutaric aciduria type-i |
-
2024
- 2024-03-22 WO PCT/US2024/021219 patent/WO2024197285A1/en not_active Ceased
- 2024-03-22 EP EP24775799.0A patent/EP4665853A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024197285A1 (en) | 2024-09-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3288594B1 (en) | Dual aav vector system for crispr/cas9 mediated correction of human disease | |
| AU2010262862B2 (en) | Compositions and methods for modulation of SMN2 splicing in a subject | |
| HK1246648A1 (en) | Compositions and methods for modulation of smn2 splicing in a subject | |
| AU2020396868A1 (en) | Targeted transfer RNAS for treatment of diseases | |
| TW202413649A (en) | Treatment of amyotrophic lateral sclerosis (als) | |
| TW202304528A (en) | Compositions and methods for in vivo nuclease-mediated gene targeting for the treatment of genetic disorders | |
| Merjane et al. | Molecular mechanisms of amyotrophic lateral sclerosis as broad therapeutic targets for gene therapy applications utilizing adeno‐associated viral vectors | |
| CN113966396A (en) | Treatment and detection of hereditary neuropathy and related disorders | |
| US20240384274A1 (en) | Compositions for and methods of treating and/or preventing glutaric aciduria type-1 | |
| WO2024197285A1 (en) | Compositions for and methods of treating and/or preventing glutaric aciduria type-i | |
| WO2023230098A1 (en) | Gene therapy compositions and methods of use thereof | |
| CN119677545A (en) | Composition for treating nervous system diseases | |
| Rothgangl et al. | Treatment of a genetic liver disease in mice through transient prime editor expression | |
| Franklin et al. | SOD1-targeting therapies for neurodegenerative diseases: a review of current findings and future potential | |
| KR20240134878A (en) | How to Treat Ornithine Transcarbamylase (OTC) Deficiency | |
| US20250388890A1 (en) | ASS1 Gene Insertion For The Treatment Of Citrullinemia Type I | |
| TW202338086A (en) | Compositions useful in treatment of metachromatic leukodystrophy | |
| EP4713450A1 (en) | Engineered constructs with cassette arrangements for increased transcription of rna payloads | |
| WO2025250454A1 (en) | Adeno-associated viruses evolved to specifically target human glial progenitor cells in vivo | |
| CN121693566A (en) | Enhancement of transgene expression during unidirectional gene insertion using bGH-SV40L tandem PolyA | |
| HK40025555A (en) | Compositions and methods for modulation of smn2 splicing in a subject | |
| HK40000192B (en) | Compositions and methods for modulation of smn2 splicing in a subject | |
| HK40000192A (en) | Compositions and methods for modulation of smn2 splicing in a subject |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250919 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |