EP4665754A1 - Glycosylated polypeptides - Google Patents
Glycosylated polypeptidesInfo
- Publication number
- EP4665754A1 EP4665754A1 EP24713153.5A EP24713153A EP4665754A1 EP 4665754 A1 EP4665754 A1 EP 4665754A1 EP 24713153 A EP24713153 A EP 24713153A EP 4665754 A1 EP4665754 A1 EP 4665754A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- molecule
- antibody
- moiety
- amino acid
- glycosylation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6801—Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
- A61K47/6803—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
- A61K47/6807—Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug or compound being a sugar, nucleoside, nucleotide, nucleic acid, e.g. RNA antisense
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
- A61K47/6889—Conjugates wherein the antibody being the modifying agent and wherein the linker, binder or spacer confers particular properties to the conjugates, e.g. peptidic enzyme-labile linkers or acid-labile linkers, providing for an acid-labile immuno conjugate wherein the drug may be released from its antibody conjugated part in an acidic, e.g. tumoural or environment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2851—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the lectin superfamily, e.g. CD23, CD72
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/005—Glycopeptides, glycoproteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
- C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
- C07K2317/41—Glycosylation, sialylation, or fucosylation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/515—Complete light chain, i.e. VL + CL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
- C07K2317/53—Hinge
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention relates to molecules comprising one or more copies of a glycosylation amino acid sequence for O-glycosylation which provides a convenient way to conjugate the glycosylation amino acid sequence to a desired moiety.
- the present invention further relates to cell lines for producing such molecules.
- the present invention also relates to conjugation methods to generate molecules of the invention.
- the invention also relates to various uses of the molecules and methods employing them, including for therapy and diagnosis.
- O-glycosylation is the covalent attachment of sugars to an oxygen group of serine or threonine.
- Organisms utilize O- glycosylation of proteins for many important biological functions including protection from protease degradation, modulating serum half-life, functional modulation, intracellular trafficking, cell adhesion, and self-versus foreign recognition during an immune response.
- the most abundant form of O-linked glycosylation in higher eukaryotes, termed “mucin-type,” is characterized by a N-acetylgalactosamine (GalNAc) attached to the hydroxyl group of a serine or threonine side chain.
- GalNAc N-acetylgalactosamine
- Protein glycosylation heterogeneity is a universal feature of life. There are two codified types of variability in glycosylation, namely macroheterogeneity and site occupancy. Macroheterogeneity is the observation that a known glycosylation site in a protein may have a variable occurrence of glycans (i.e. site occupancy). Mucin-type O-linked glycans typically occur clustered together in ‘mucin domains’. (Thanka et al (2001) Biophys J., 80(2):952-960). Site occupancy is difficult to determine due to the lack of a recognized consensus sequence, as well as the lack of a universal enzyme for O-glycan removal. (Jensen et al (2010) I EBS.
- the present invention employs a glycosylation sequence to conjugate the two together in a convenient and highly versatile way. It also provides other aspects based on the glycosylation sequence of the present invention which are discussed in more detail below.
- the present invention is based on a glycosylation amino acid sequence that allows O-glycosylation of a threonine in the sequence.
- the resultant O-glycan comprises at least one sialic acid.
- the sialic acid may optionally further comprise a chemical group for conjugation to a desired moiety or which has been so conjugated to a desired moiety.
- a glycosylation amino acid sequence of the invention will be typically present in a polypeptide which is, or forms part of, a molecule of the present invention, providing a convenient and highly versatile way to join the polypeptide to a desired moiety via conjugation.
- the present invention also provides a molecule comprising one or more glycosylation amino acid sequence(s) of the invention that have yet to be glycosylated.
- the present invention further provides a molecule comprising one or more glycosylation amino acid sequence(s) of the invention that are O-glycosylated, but which do not comprise a chemical group for conjugation.
- the present invention therefore provides a molecule comprising one or more glycosylation amino acid sequence(s) of the invention with terminal sialylation of the O-glycan, where the glycan does not comprise a chemical group for conjugation.
- the present invention therefore provides a molecule comprising one or more glycosylation amino acid sequence(s) of the invention with terminal sialylation of the O-glycan, where the glycan does comprise a chemical group that allows conjugation to a desired moiety.
- the conjugation has taken place and the molecule therefore comprises the moiety.
- the conjugation has yet to take place, but the chemical group is capable of such conjugation.
- Advantages of the invention include that the glycosylation, and hence the site of any conjugation, is highly specific and can be chosen.
- the approach of the invention also may help avoid unwanted side-reactions.
- the conjugation approach of the invention also typically has the advantage of being bioorthogonal, that is the conjugation can take place under physiological conditions and is not toxic to cells.
- the conjugation is typically biologically and chemically stable under physiological conditions and is not readily reversible.
- the conjugation also typically does not require the addition of a catalyst.
- the engineered O-glycan recognition sequence of the invention typically elicits full or near to full site occupation in terms of the proportion of sites being O-glycosylated.
- the invention can be used in a wide array of different ways.
- the conjugation may be, for example, performed by a cell itself. Alternatively, it may be that a molecule of the present invention is purified from a cell that has produced it and it is then conjugated to a desired moiety.
- a particularly preferred approach for the conjugation of the present invention is to employ click chemistry.
- click chemistry allows for robust and high-yielding reactions that proceed quickly, selectively, under mild conditions, and with few to no side products.
- the sialylated O-glycan and the moiety that is the desired conjugation partner have complementary click chemistry groups that are reacted with each other to generate one product molecule.
- the moiety is, or comprises, a linker which in turn, or which is already, conjugated to a further molecule or group.
- the molecule comprising the at least one glycosylation amino acid sequence of the present invention and the desired moiety are both polypeptides, with the invention therefore providing a convenient way to join at least two polypeptides together.
- the present invention also provides a cell comprising a polypeptide with a glycosylation sequence of the present invention.
- the present invention also provides a cell which encodes a molecule of the present invention.
- the cell may be any of the cell types discussed herein.
- the cell is a CHO cell line.
- the cell is a human cell line.
- the present invention further provides a cell suitable for producing molecules of the present invention.
- the cell is used for producing the glycosylated form of a molecule of the present invention where the one or more glycosylation sequences are O-glycosylated.
- the O-glycosyl sugar chains of the molecule are sialylated.
- sialylation terminates the O-glycan sugar chain.
- the cell is one encoding a molecule comprising one or more glycosylation sequence of the present invention.
- the cell further comprises a non-functional UDP-N-acetylglucosamine 2-epimerase gene.
- the disruption of the UDP-N-acetylglucosamine 2-epimerase activity means that the cell is deficient in sugar synthesis, providing a convenient way to facilitate the incorporation of sialic acid into the O-glycosyl sugar chains at a glycosylation sequence of the present invention by providing the cell with exogenous modified sugars.
- the present invention provides a molecule which comprises one or more copies of the following glycosylation amino acid sequence:
- Xi, X 2 , and X3 are any amino acid; and the Threonine (Thr) amino acid residue is O-glycosylated with a sialylated sugar.
- the present invention provides a molecule which comprises one or more copies of the following glycosylation amino acid sequence:
- Xi, X 2 , and X3 are any amino acid; and the Threonine (Thr) amino acid residue is O-glycosylated with a sialylated sugar which optionally comprises a chemical group that either can be, or is, conjugated to a moiety.
- the sialylated sugar comprises such a chemical group.
- the chemical group is capable of being conjugated to a desired moiety but has not actually yet been so conjugated to the moiety.
- the chemical group is conjugated to a desired moiety.
- the present invention further provides a pharmaceutical composition comprising a molecule of the present invention and a pharmaceutically acceptable carrier.
- the present invention further provides a molecule of the present invention for use in therapy of the human or animal body.
- the present invention further provides molecule of the present invention for use in treating a condition selected from cancer, heart disease, obesity, an autoimmune condition, an inflammatory condition, diabetes, or a CNS disorder.
- the present invention also provides a method of treating a condition comprising administering an effective amount of a molecule of the present invention to a subject in need thereof.
- the condition may be any of those mentioned herein.
- the present invention also provides a cell which comprises:
- Xi, X 2 , and X 3 are any amino acid; and the Threonine (T) amino acid residue is O-glycosylated with a sialylated sugar.
- the present invention further provides a method of producing a glycosylated polypeptide comprising culturing a cell of the present invention in a medium supplemented with peracetylated ManNAz.
- the present invention also provides a method of introducing a glycosylation site into a polypeptide comprising modifying the sequence of the polypeptide to include the amino acid sequence:
- Xi, X 2 , and X 3 are any amino acid; and the Threonine (T) amino acid residue is O-glycosylated with a sialylated sugar.
- the present invention further provides a method of conjugating a molecule to a moiety, the method comprising:
- sialylated sugar comprises a chemical group that can be conjugated to a desired moiety with a compatible chemical group
- the present also provides a method of joining together two molecules comprising:
- sialylated sugar comprises a chemical group that can be conjugated to a desired second molecule which has a compatible chemical group allowing the conjugation
- the present invention further provides a method of generating a combinatorial library, wherein the method comprises:
- the present invention also provides a method of conjugating an antibody to a desired moiety comprising: [0024] providing a molecule of the present invention, wherein the sialylated sugar of the molecule comprises a chemical group that can be conjugated to a compatible chemical group of the desired moiety, wherein the molecule is either the antibody or is a component part of the antibody; and
- conjugating the desired moiety to the molecule via said chemical group wherein if the molecule is a component part of an antibody, rather than the antibody itself, the method further comprises assembling the whole antibody.
- the present invention further provides a method of labelling a molecule, wherein the method comprises:
- sialylated sugar of the molecule comprises a chemical group that can be conjugated to a desired label which comprises a compatible chemical group to allow conjugation;
- the present invention also provides the use of a molecule of the present invention as a capture agent for a desired moiety wherein the sialylated sugar of the molecule comprises a chemical group that can be conjugated to a desired moiety and the desired moiety comprises a compatible conjugation group for the conjugation.
- the present invention also provides a cell encoding a polypeptide which comprises one or more copies of the following glycosylation amino acid sequence:
- Xi, X 2 , and X 3 are any amino acid; and the Threonine (T) amino acid residue at the second position is O-glycosylated with a sialylated sugar.
- the present invention also provides a cell encoding a molecule of the present invention.
- Figures 1, 2(a), 2(b), and 2(c) show the structures of potential O-glycosyl sugar chains with potential sialylation and click chemistry groups.
- Figure 3 shows illustrative protein mass spectroscopy results for particular glycosylation sequences (without GNE knockout - 3(a), and with GNE knockout - 3(b)), with the peak of the antibody molecule with the O-glycosyl sugar chain with sialylation and a click chemistry group depicting the highest peak seen in each instance.
- Figure 4 gives the percentage amounts for site occupancy, clickable glycan, non-conjugatable glycan, conjugation yield with DBCO, and final conjugate homogeneity.
- Figure 5(a) shows viable cell density (VCD) for cultures with an initial viable cell density of >10 x 10 6 /mL.
- Figure 5(b) shows viable cell densities for cultures with an initial viable cell density of >10 x 106/mL in Example 4.
- Figure 6 shows productivities of molecule #1 for cultures with an initial viable cell density of >10 x 10 6 /mL in Example 4.
- Figure 7 shows in Figure 7(a) growth for cultures with an initial viable cell density of ⁇ 1 x 10 6 /mL.
- Figure 7(b) shows viabilities for cultures with an initial viable cell density of ⁇ 1 x 10 6 /mL in Example 4.
- Figure 8 shows productivities of molecule #1 for cultures with an initial viable cell density of ⁇ 1 x 10 6 /mL in Example 4.
- Figure 9 shows protein mass spectroscopy results for the sugar titration performed in Example 4.
- Figure 10 shows the product distribution obtained in the sugar titration performed in Example 4 with the proportion of molecules which were asialylated, sialylated, and sialylated with a click sugar.
- Figure 11 shows the cell growth for cultures with an initial viable cell density of ⁇ 10 x 10 6 /mL for molecule #2 in Example 5.
- Figure 12 shows the viabilities for cultures with an initial viable cell density of ⁇ 10 x 10 6 /mL for molecule #2 in Example 5.
- Figure 13 shows the productivities for cultures with an initial viable cell density of ⁇ 10 x 10 6 /mL for molecule #2 in Example 5.
- Figure 14 shows the product distribution for cultures with an initial viable cell density of ⁇ 10 x 10 6 /mL for molecule #2 in Example 5.
- Figure 15 shows CE-MS summaries for day 9 samples showing incorporation of azidosialic acid on to molecule #2 in Example 5.
- Figure 16 illustrates the basic approach of how an antibody with the glycosylation sequence provided can be conjugated to siRNA through the sialylated O-glycosyl sugar chains present using click chemistry sugars either with or without a linker.
- Figure 17 shows an illustrative chromatogram for the results for conjugation of siRNA to azidosialic acid sugar, with incorporated antibody monitored by analytical anion exchange (aAEX) over time as a function of antibody concentration at 1 mg/mL, 5 mg/mL and 10 mg/mL to assess impact of antibody concentration on conjugation.
- Drug antibody ratio (DAR) was calculated based on peak area % from the aAEX chromatogram.
- the results obtained for the conjugation kinetics are shown in Figure 18 (18(a) - 10 mg/mL, 18(b) - 5 mg/mL, and 18(c) - 1 mg/mL mAb).
- Figure 19 shows the conjugate profile obtained in Example 7 analyzed by analytical anion exchange.
- Figure 20 shows the stability of the siRNA conjugate generated in Example 7 in cynomolgus monkey plasma and mouse plasma.
- Figure 21 shows the ability of mouse TfR binding antibody-siRNA conjugates either by eCys or glyco-mAb conjugation chemistry (e.g., mTfR2- dsRNA No. 8 conjugate) to knockdown a target gene in Example 7.
- Figure 22 shows a siRNA conjugate aAEX profile as described in Example 7.
- Figures 23 (a and b), 24 (a and b), and 25 (a and b) show the impact of siRNA: antibody conjugate on gene expression as studied in Example 7.
- Figure 26 illustrates the ability of a siRNA: Ab conjugate of the invention to cross the Blood Brain Barrier (BBB) via the antibody portion of the conjugate and then knockdown the expression of a target gene via the siRNA. Results for an isotype control conjugate where the antibody does not target the TfR protein necessary for transport across the BBB are also provided.
- BBB Blood Brain Barrier
- Figure 27 illustrates the use of the conjugation method provided to generate multi-functional antibodies and combinatorial libraries.
- Figures 28 and 29 illustrate the generation and use of a preferred linker of the present invention.
- the term “specific for”, as used herein in relation to a binding domain, refers to the ability of a binding domain of a multispecific binding molecule to bind, associate with and / or modulate a particular target molecule, over background levels of non-target levels. In some embodiments, “specific for” may be demonstrated by affinity (Kd) measures for the target over non-targets. Where two antigen-binding sites have a “different” specificity they will typically bind either two different antigens or two different epitopes of the same antigen.
- treatment includes restraining, slowing, stopping, controlling, delaying, or reversing the progression or severity of an existing symptom or disorder, or ameliorating the existing symptom or disorder, but does not necessarily indicate a total elimination of the existing symptom or disorder.
- Treatment includes administration of a protein or nucleic acid or vector or composition for treatment of a symptom or disorder in a patient, particularly in a human.
- a “molecule” of the present invention will comprise at least one glycosylation amino acid sequence of the present invention.
- the glycosylation amino acid sequence is O-glycosylated.
- the glycosylation may further comprise a chemical group for conjugation. Where such a chemical group is present, it may be conjugated already, or be capable of such conjugation, to a desired moiety. In cases where such conjugation has already taken place, the molecule may be said to also comprises the conjugated desired moiety.
- a molecule may be, or may comprise, a peptide, polypeptide, or protein comprising at least one glycosylation amino acid sequence of the present invention.
- a preferred molecule is a polypeptide.
- an IgG antibody comprises four polypeptide chains and represents an IgG molecule.
- a molecule may itself comprise smaller molecules as constituent parts.
- the term “molecule” in the present application therefore encompasses higher order structures, for example where polypeptides and/or other moieties have been joined together, such as via the present invention.
- a “polypeptide” is a linear polymer of amino acids connected by amide bonds, specifically peptide bonds.
- a glycosylation amino acid sequence of the present invention is at least five amino acids in length a polypeptide of the present invention will be at least that length.
- the term “peptide” denotes a short polypeptide, for example from 5 to 50 amino acids, such as from 10 to 50 amino acids.
- the term “polypeptide” as used herein encompasses “peptide” sequences. It may though denote a longer sequence, for example one of at least 50 amino acids in length.
- a “protein” comprises one or more polypeptides that are covalently linked or noncovalently associated. Proteins typically have a more defined tertiary' and quaternary' structure and may have homogenous or heterogeneous post-translational modifications. Examples of proteins include but are not limited to antibodies, enzymes, and cy tokines.
- a molecule of the present invention may be, or comprise, a protein comprising one or more glycosylation amino acid sequences of the invention.
- binding molecule may be thought of as any molecule which binds, and preferably specifically binds, a target.
- binding molecules include antibodies, but the term is not limited to antibodies, encompassing any polypeptide, protein or nucleic acid which specifically binds a target.
- Binding molecules may be protein binding molecules. They may be nucleic acid binding molecules. Examples of the latter include anti-sense nucleic acid molecules, as well as siRNA molecules, and aptamers.
- antibody refers to an immunoglobulin molecule that binds an antigen.
- Embodiments of an antibody include a monoclonal antibody, polyclonal antibody, human antibody, humanized antibody, chimeric antibody, bispecific or multispecific antibody, or conjugated antibody.
- the antibodies can be of any class (e.g., IgG, IgE, IgM, IgD, IgA), and any subclass (e.g., IgGl, IgG2, IgG3, IgG4).
- Embodiments of the present invention also include antibody fragments or antigen-binding fragments that, as used herein, comprise at least a portion of an antibody retaining the ability to specifically interact with an antigen or an epitope of the antigen, such as Fab, Fab’, F(ab’)2, Fv fragments, scFv antibody fragments, scFab, disulfide-linked Fvs (sdFv), a Fd fragment.
- Fab fragments or antigen-binding fragments
- an antibody retaining the ability to specifically interact with an antigen or an epitope of the antigen such as Fab, Fab’, F(ab’)2, Fv fragments, scFv antibody fragments, scFab, disulfide-linked Fvs (sdFv), a Fd fragment.
- linear antibodies which may be for example, fused to a Fc region or an IgG heavy chain constant region, such as an scFv-CH3 minibody, an scFv-Fc antibody, an scFv-zipper antibody, a Fab2 bispecific, a bis-scFv, a sdAb, a tetrabody, a triabody, a diabody, or a Fabs trispecific antibody.
- a Fc region or an IgG heavy chain constant region such as an scFv-CH3 minibody, an scFv-Fc antibody, an scFv-zipper antibody, a Fab2 bispecific, a bis-scFv, a sdAb, a tetrabody, a triabody, a diabody, or a Fabs trispecific antibody.
- antibody includes single chain antibody formats. It includes heavy chain only antibodies, such as VH and VHH domain antibodies. It includes other types of antigen-binding molecules such as antibody analogues like DARPins (designed ankyrin repeat proteins). It also includes artificially constructed formats of antibody, such as naturally occurring antibody format molecules, but with further antigen-binding sites added, such as at the C-terminus of the light and/or heavy chains.
- antigen binding domain refers to a portion of a binding molecule, antibody, antibody fragment, bispecific antibody, multispecific binding protein, etc. that binds an antigen or an epitope of the antigen
- bispecific refers to a molecule that comprises two distinct antigen-binding domains.
- a bispecific binding molecule can bind two different antigens or two different epitopes of the same antigen.
- Exemplary embodiments of bispecific molecules include the bispecific antibodies disclosed herein.
- multispecific refers to a molecule that comprises two or more distinct antigen-binding domains.
- a multispecific binding molecule can bind two or more different antigens, or two or more different epitopes of the same antigen.
- Exemplary embodiments of multispecific binding molecules include bispecific, trispecific or tetraspecific binding molecules known in the field, as well as single-chain multispecific binding molecules such as diabodies, tandem scFvs, tandem VHHs, or tandem scFabs.
- agonize refers to the ability of an antibody, antibody fragment, or a binding molecule to induce or increase one or more activities or functions associated with an antigen.
- a molecule of the present invention may be, or comprise, an agonist.
- agonize refers to the ability of a molecule, antibody, antibody fragment, or a binding molecule to decrease or eliminate one or more activities or functions associated with an antigen.
- a molecule of the present invention may be, or comprise, an antagonist.
- neutralize refers to the ability of a molecule, antibody, antibody fragment or a binding molecule to counteract or render inactive or ineffective at least one activity or function of an antigen or other target.
- bind and “binds” as used herein are intended to mean, unless indicated otherwise, the ability of a protein or molecule to form a chemical bond or attractive interaction with another protein or molecule, which results in proximity of the two proteins or molecules as determined by common methods known in the art.
- conjugation entails the joining of a molecule to a desired moiety via a chemical bond.
- epitope refers to the amino acid residues, of an antigen, that are bound by an antibody.
- An epitope can be a linear epitope, a conformational epitope, or a hybrid epitope.
- structural epitope may be used to describe the region of an antigen which is covered by an antibody (e.g., an antibody’s footprint when bound to the antigen).
- a structural epitope may describe the amino acid residues of the antigen that are within a specified proximity (e.g., within a specified number of Angstroms) of an amino acid residue of the antibody.
- the term “functional epitope” may also be used to describe amino acid residues of the antigen that interact with amino acid residues of the antibody in a manner contributing to the binding energy between the antigen and the antibody.
- An epitope can be determined according to different experimental techniques, also called “epitope mapping techniques.” It is understood that the determination of an epitope may vary based on the different epitope mapping techniques used and may also vary with the different experimental conditions used, e.g., due to the conformational changes or cleavages of the antigen induced by specific experimental conditions. Epitope mapping techniques are known in the art (e.g., Rockberg and Nilvebrant, Epitope Mapping Protocols: Methods in Molecular Biology, Humana Press, 3 rd ed.
- the term “competes for binding” or “competes with”, refers to two antibodies which cross-compete (i.e., compete against each other) for binding to the same antigen.
- two antibodies may compete for binding to the same antigen where they bind to spatially overlapping regions of the same antigen.
- two antibodies may compete for binding to a same antigen where the antibodies bind to non-overlapping regions of the antigen, but the binding of one antibody blocks binding by the other antibody, for example, due to steric hindrance or conformational changes of the antigen induced by the first antibody.
- paratope refers to the amino acid residues of an antibody that bind the antigen.
- Amino acid residues of a paratope can be identified based on a specified proximity (e.g., within a specified number of Angstroms) from an amino acid residue of the antigen, for example, as may be determined by X-ray crystallography.
- Amino acid residues of a paratope may also be identified based on contributing to the binding energy between the antigen and the antibody. For example, such amino acid residues of a paratope may be determined by examining protein binding in functional binding assays of the antibody to the antigen, where the antibody is mutated at different sites of the paratope.
- “Specifically binds” indicates binding to a target in preference to the nontarget. It may be that binding is to the target, but not at any significant level to non-targets. It may be the affinity of binding is at least 5, 10, 50, 100, 1000-fold, or greater for the target than the non-target.
- a “monoclonal antibody” is an antibody produced by a single clone of cells or a cell line and consisting of identical antibody molecules.
- a “chemical group for conjugation” represents a chemical group that can be conjugated to a complementary chemical group, for instance, but not exclusively, by click chemistry.
- a “glycosylation amino acid sequence” as used herein refers to the amino acid sequence Xi Thr Pro X2 X3, wherein Xi, Xi, and Xi may be any amino acid and the sequence can be glycosylated at the Thr residue. Such a sequence is referred to as a glycosylation amino acid sequence or glycosylation sequence of the present invention.
- the introduced O-glycan typically includes a sialic acid sugar which may also include a group that allows for conjugation to a desired moiety. Particularly preferred is for the O-glycan to comprise a click chemistry group and the molecule it is desired to conjugate to also comprising a compatible click chemistry group. The two click chemistry groups can react, conjugating the polypeptide and desired moiety together.
- a “moiety” as used herein is any entity that can be conjugated so that it forms part of a molecule of the present invention.
- a moiety may itself be a molecule but can be conjugated to form a larger molecule.
- a molecule of an invention typically comprises at least one glycosylation sequence which allows conjugation to a moiety to form a molecule which is larger, but still represents a molecule of the present invention.
- the moiety that it is desired to be conjugated to comprises a complementary group for reaction with the conjugatable sialic acid analog comprising the chemical group for conjugation.
- a “molecule” encompasses a molecule which itself comprises constituent molecules which are joined or are associated together, for instance the term molecule includes molecules such an IgG molecule which typically comprises four polypeptide chains.
- the numbering of the amino acid residues in antibody sequences set out herein is based on the EU index as in Kabat. Kabat et al, Sequences of Proteins of Immunological Interest, 5th edition, Bethesda, MD: U.S. Dept, of Health and Human 20 Services, Public Health Service, National Institutes of Health (1991).
- EU Index numbering or EU numbering is used interchangeably herein. Assignment of amino acid residues to the CDRs may be done according to the well-known schemes, including those described in Kabat, Chothia, North or IMGT.
- a glycosylation sequence of the present invention comprises the amino acid sequence Xi Thr Pro X2 X3.
- the present invention provides a molecule comprising a glycosylation sequence which comprises an amino acid sequence: Xi Thr Pro X2 X3, wherein: (i) Xi, X2, and X3 are any amino acid; and (ii) the threonine (T) amino acid residue is O-glycosylated with a sialylated sugar.
- the sialylated sugar comprises a chemical group thatcan beconjugated to a desired moiety.
- the sialylated sugar comprises a chemical group that actually is conjugated to a desired moiety
- “glycosylation sequence” relates to such an amino acid sequence unless otherwise stated.
- the Threonine in the amino acid sequence Xi Thr Pro X2 X3 in a glycosylation sequence of the present invention is glycosylated.
- the molecule may be glycosylated at other sites and in other ways, but, as a minimum, will comprise one or more glycosylation sequence(s) of the present invention which are glycosylated.
- the only glycosylation of a molecule of the present invention is that involving the one or more glycosylation sequences of the present invention. In another embodiment, it is not the only glycosylation.
- the glycosylation sequence of the invention comprises the amino acid sequence Xi Thr Pro X2 X3, wherein at least one of Xi and X3 is Pro. In one embodiment, both Xi and X3 are Pro. In one preferred embodiment X2 is Ala. In one embodiment, Xi is Pro and X2 is Ala. In another embodiment, X2 is Ala and X3 is Pro. In another preferred embodiment Xi and X3 are Pro and X2 is Ala.
- the glycosylation sequence comprises the amino acid sequence Pro Thr Pro Ala Pro (SEQ ID NO: 1).
- a glycosylation sequence may be, for instance, any of the glycosylation sequences of the invention set out herein.
- the one or more glycosylation sequence(s) in any of the embodiments set out herein comprises the amino acid sequence Pro Thr Pro Ala Pro.
- any of the glycosylation sequences set out above may be flanked on the N-terminal side by an Alanine (Ala) residue. In one preferred embodiment, any of the glycosylation sequences set out above may be flanked on the C-terminal side by an Ala residue. [0095] In one preferred embodiment, any of the glycosylation sequences set out above may be flanked on the N-terminal and C-terminal sides by an Ala residue. In a preferred embodiment, the glycosylation sequence comprises, or consist of, Ala Pro Thr Pro Ala Pro Ala. In a preferred embodiment, the glycosylation sequence comprises, or consists of, Ala Ala Pro Thr Pro Ala Pro. In one preferred embodiment, the glycosylation sequence comprises, or consist of, Ala Ala Pro Thr Pro Ala Pro Ala.
- the glycosylation sequence comprises, or consists of, Ala Ala Ala Thr Pro Ala Pro (SEQ ID NO: 2).
- glycosylation amino acid sequences of the invention are typically present in one or more polypeptides forming part of the molecule of the present invention.
- a molecule of the present invention comprises a polypeptide comprising at least one glycosylation amino acid sequence of the present invention.
- a molecule of the present invention is such a polypeptide.
- a molecule of the present invention comprises, or consists of, a polypeptide comprising a glycosylation amino acid sequence which is glycosylated and comprises a chemical group for conjugation.
- a glycosylation sequence of the invention is O-glycosylated at the threonine residue of the glycosylation sequence.
- the invention also provides the molecules before they have been glycosylated and such intermediates form part of the invention.
- the O-glycan comprises a sialic acid group.
- the sialylated sugar comprises a chemical group allowing conjugation to a desired moiety.
- the sialic acid group comprises a click chemistry group allowing for conjugation of that click chemistry group with a second compatible click chemistry group on the moiety that it is desired to conjugate to.
- glycosylation sequence can be simply introduced into the amino acid sequence of a given polypeptide at the location it is desired to conjugate a moiety to. That means that the invention can be applied to any desired molecule which comprises an amino acid sequence which can be modified to be a glycosylation amino acid sequence of the present invention.
- An amino acid sequence may have been modified by changing the existing amino acid sequence to include the glycosylation sequence or by inserting the glycosylation sequence into the amino acid sequence.
- a region of the amino acid sequence may be replaced with a glycosylation sequence of the present invention, for example a region of the same length may be replaced with a glycosylation sequence of the present invention.
- a molecule of the present invention comprises at least one glycosylation sequence of the present invention. In one embodiment, a molecule of the present invention comprises only one glycosylation sequence of the present invention. In another embodiment, it comprises at least two such glycosylation sequences. In another embodiment, it comprises only two such glycosylation sequences. In one embodiment, a molecule of the present invention comprises at least four glycosylation sequences. In one embodiment, it comprises only four such glycosylation sequences. In one embodiment, a molecule of the present invention comprises one, two, three, four, five, six, seven or more glycosylation sequences of the present invention.
- the molecule comprises from one to seven, for example from two to six, such as two such glycosylation sequences.
- the molecule comprises an even number of such glycosylation sequences.
- it comprises, two, four, six, eight, or ten glycosylation sequences.
- it comprises at least such numbers or a range formed by such numbers for example from two to ten such sequences.
- the presence of a plurality of glycosylation sequences may be used to generate molecules that comprise a higher order structure, such as dimers or multimers, by using the O-glycosylation to join polypeptides.
- two glycosylation amino acid sequences of the present invention are present in a molecule of the present invention with the two conjugated to each other.
- a molecule of the present invention comprises at least one such pair of conjugated glycosylation sequences. In one embodiment, it comprises two, three, four, five, or six such pairs of conjugated amino acid sequences of the present invention. [0101] In one embodiment, there may be more than one glycosylation amino acid sequence present in a molecule of the invention. It may be that the presence of O- glycans near to a glycosylation site of the invention helps promote O- glycosylation. Hence, in one embodiment a molecule of the invention may comprise two or more glycosylation sequences of the present invention in the same polypeptide within 100 amino acids of each other, for instance within 75 amino acids of each other, preferably within 50 amino acids of each other.
- glycosylation sequences of the invention are present at regular intervals in an amino acid sequence present in a molecule of the present invention, for example to allow conjugation to a plurality of moieties or to form multiple bridges between two molecules and hence strengthen their joining to each other.
- the invention may be used to conjugate a desired moiety to a given protein to form a desired molecule of the present invention.
- the invention may be used to form a bridge between two polypeptides present in the molecule, for instance to help stabilize the overall molecule.
- the invention is used to form a molecule which is, or comprises, a “locked” polypeptide where conjugated polypeptides are covalently bonded via the O-glycosyl bridge and so do not readily disassociate.
- the invention is used to form molecules which are, or comprise, locked dimers or multimers where the individual monomers are covalently bonded via the glycosyl bridges.
- the invention may also be used to generate a ligand that becomes covalently bound to its receptor once the ligand has bound the receptor via the conjugation approach of the invention so forming a molecule of the present invention which is a complex of the ligand and receptor covalently bound together.
- a molecule of the present invention may be, or comprise, any suitable polypeptide.
- the molecule may be, or comprise, a therapeutic protein.
- a molecule of the present invention is, or comprises a cytokine.
- at least one polypeptide chain of the cytokine may comprise one or more glycosylation sequence of the present invention.
- all the polypeptide chains of the cytokine may do so.
- the cytokine is an Interleukin.
- the cytokine is an interferon. Examples of cytokines that the present invention may be applied to include TNF- a, IL-1, IL-10, IL-12, INF-a, or INF-y.
- the cytokine is IL- 2, IL-4, IL-5, TGF-P, or INF- .
- the cytokine is a colony stimulating factor (CSF).
- the cytokine is GM-CSF.
- Other preferred proteins include, for instance, growth factors, hormones, blood clotting factors, tumor necrosis factors, interferons, and cytokines.
- the protein may be, or comprise, EPO (erythropoietin) or an EPO analog.
- the protein may be an enzyme.
- the molecule of the present invention may comprise, or be, an antibody, as discussed further below.
- a molecule of the present invention may be or comprise a vertebrate protein.
- the protein may be, for instance, a mammalian protein.
- the protein may be a human protein.
- the protein may be an animal protein, for instance, a mouse, rat, or monkey protein.
- the protein may be a cow, sheep, dog, or cat protein.
- a molecule of the present invention may be secreted.
- the polypeptide with one or more glycosylation sequence of the present invention also comprises a secretion signal.
- the polypeptide comprises a signal which results in it being displayed on the cell surface.
- the invention may be applied to dimers or multimers, for instance to form covalent bridges from one subunit of the dimer or multimer to another.
- the invention may be used to form covalent bridges joining together at least two of the individual subunits of a multimer.
- the invention may be used to form locked dimers or multimers where at least two subunits are joined together via the glycosylation sequence or sequences of the present invention forming a bridge.
- cytokine dimers may be generated where the individual cytokine subunits comprise at least one glycosylation sequence of the present invention allowing addition of an O-glycan sugar chain and subsequent conjugation of one cytokine monomer to another. Such an approach may be used, for instance, to form locked cytokine dimers. The generation of such cytokine dimers may be used to generate, for instance, low affinity cytokine dimers.
- the molecule of the invention comprises one or more glycosylation sequences of the present invention which are O-glycosylated with sialylation terminating the O-glycan sugar, but where the O-glycan sugar does not comprise a group for conjugation.
- the presence of the O-glycosylation is used to modify the properties of the molecule, such as the physical properties of the molecule.
- the O-glycosylation is used to promote immunotolerance.
- the O-glycosylation is used to mask another site in the polypeptide.
- the invention further provides a molecule where the one or more glycosylation sequences of the invention are O- glycosylated, but without sialylation.
- a molecule of present invention comprises a polypeptide comprising the glycosylation sequence, wherein the polypeptide is at least 10 amino acids in length. In another preferred embodiment, the polypeptide is at least 20 amino acids in length. In another embodiment, the polypeptide is at least 50 amino acids in length. In a further preferred embodiment, the polypeptide is at least 100 amino acids in length.
- a molecule of the invention comprising a glycosylation amino acid sequence is present in a cell.
- it is expressed in a cell.
- it is present or expressed in a mammalian cell. Examples of preferred cells include human cells. They also include rodent cells, for example CHO cells are particularly preferred.
- the threonine residue of a glycosylation sequence in a molecule of the present invention is O-glycosylated.
- the threonine has a sugar chain attached to it.
- a glycosylation sequence of the present invention is O-glycosylated with a sugar chain comprising N-acetyl hexosamine and hexose.
- the O-glycan sugar chain is a glycan comprising N-acetyl hexosamine and hexose.
- the O-glycosylation comprises a sialic acid group.
- the sialylation terminates the O-glycan sugar chain, with either the group for conjugation forming part of the sialic acid group or joined to it.
- the O-glycan sugar chain comprises, or is, a glycan which has at least one sialic acid at its terminus.
- the glycan may have one or two sialic acids.
- the O-glycosylation of the Threonine comprises: Threonine - N-acetyl hexosamine - hexose - sialic acid - conjugation group.
- At least two glycosylation sequences are so glycosylated, where the conjugation groups are compatible with each other, and then conjugated together in a molecule of the present invention via the compatible conjugation groups.
- one glycosylation sequence is so glycosylated and then conjugated to a moiety with the appropriate compatible conjugation group, but without the moiety needing or having an O-glycosyl sugar chain, as the presence of a glycan on the moiety it is desired to conjugate to is unnecessary for the conjugation reaction to occur in such embodiments.
- the polypeptide and the moiety it is being conjugated to both comprise at least one glycosylation sequence of the present invention, so that both are O-glycosylated with sialylated sugar chains that have compatible groups for conjugation allowing the polypeptide and moiety to be conjugated to each other so joining them covalently together.
- the desired moiety for conjugation is, or comprises, a linker which can be conjugated to the chemical group of the sialylated sugar chain at a glycosylation amino acid sequence of the invention.
- a molecule of the invention comprises a glycosylation amino acid sequence which has been so conjugated to a linker.
- a molecule of the invention comprises a glycosylation amino acid sequence conjugated to a desired moiety comprising a linker which itself is conjugated to a second molecule forming a further part of the desired moiety.
- Advantages of the present invention may include that for a molecule comprising a glycosylation sequence of the present invention there is typically a very high proportion of the molecules which will have the glycosylation sequence glycosylated. This may be referred to as “site occupancy”.
- the proportion of the glycosylation sites of the present invention which are glycosylated will be at least 60%, at least 70%, preferably at least 80%, and more preferably at least 90%.
- the proportion which are glycosylated will be at least 95%. In another embodiment, the proportion will be at least 99%.
- a further advantage of the invention is that the sugar chain in each molecule for the O-glycosylation will be usually the same. Such consistency is an advantage for drug production.
- at least 60%, at least 70%, preferably at least 80%, and more preferably at least 90% of the molecules in a sample of a molecule of the present invention will have the same sugar chain at the glycosylation sequence or sequences of the present invention that are present in the molecule.
- at least 95% of the sugar chains will be the same.
- at least 99% will be the same.
- the present invention may be used to stabilize a molecule.
- one or more pairs of glycosylation amino acid sequences of the present invention are conjugated to each other with that stabilizing the molecule.
- the present invention may be used to prevent disassociation, for example between two polypeptides.
- the O-glycosyl sugar chain at a glycosylation sequence of the present invention comprises a chemical group which acts as a conjugation group.
- the first conjugation group can be conjugated to a second compatible conjugation group allowing a means to join a desired moiety to the polypeptide.
- the conjugation is typically covalent.
- the first and second conjugation groups are not identical but can be conjugated to each other.
- the conjugation chemistry employed is typically bioorthogonal.
- the conjugation can therefore take place under physiological conditions.
- the conjugation can take place without needing an external catalyst, for instance without needing the addition of exogenous copper.
- the conjugation can take place in a cell without needing the addition of any further reagent to bring about the conjugation.
- click chemistry An especially preferred means for conjugation is click chemistry.
- click chemistry group or “click chemistry handle” refers to a reactant or a reactive group that can partake in a click chemistry reaction.
- a click reaction group may be a moiety that is rarely, or never, found in naturally occurring biomolecules and is chemically inert towards biomolecules.
- the click chemistry groups are azide-reactive or alkyne- reactive groups. Such groups can react efficiently under biologically relevant conditions, for example in cell culture conditions, without requiring excess heat or harsh reactants.
- the click chemistry reaction takes place in a cell. In one embodiment, it takes place in vitro. In another embodiment, it takes place ex vivo.
- the conjugation takes place in vivo. In another embodiment, it may take place ex vivo.
- the invention comprises a transgenic animal that encodes and expresses a molecule of the present invention. In one embodiment, the animal is any of those mentioned herein. In one embodiment, the entities to be conjugated are simply mixed, for instance in isolated form.
- click chemistry reactions require at least two molecules comprising click reaction partners that can react with each other.
- click reaction partners that are reactive with each other are sometimes referred to as click chemistry handle pairs or click chemistry pairs.
- the click reaction partners are reactive alkenes or alkynes and suitable tetrazines.
- trans-cyclooctene, norbomene, or bicyclononyne can be paired with a suitable tetrazine as a click reaction pair.
- tetrazoles can act as latent sources of nitrile imines, which can pair with unactivated alkenes in the presence of ultraviolet light to create a click reaction pair, termed a “photo-click” reaction pair.
- the click reaction partners are an azide and an alkyne, in particular a strained alkyne, e.g. a cyclooctyne, or any other alkyne.
- Other suitable click chemistry handles are known to those of skill in the art (see, for instance Spicer et al., 2014, Nature Communications, 5: page 4740).
- the click reaction partners are Staudinger ligation components, such as phosphine and azide.
- the click reaction partners are Diels- Alder reaction components, such as dienes, such as tetrazine, and alkenes, such as trans-cyclooctene (TCO) or norbornene.
- Diels- Alder reaction components such as dienes, such as tetrazine, and alkenes, such as trans-cyclooctene (TCO) or norbornene.
- Exemplary click reaction partners are described, for instance, in US2013/0266512 and in WO2015/073746, both of which are incorporated by reference in their entirety as well as specifically in relation to the relevant description on click reaction partners in both of which are incorporated by reference herein.
- one of the first and second click reaction partners comprises an alkyne group
- the other click reaction partner comprises an azide.
- one of the first and second click reaction partners comprises an alkene group
- the other click reaction partner comprises a diene.
- alkyne refers to a functional group comprising a carbon-carbon triple bond.
- Alkyne moieties include terminal alkynes and cyclic alkynes, preferably terminal alkynes and cyclic alkynes that are reactive with azide groups.
- a terminal alkyne has at least one hydrogen atom bonded to a triple-bonded carbon atom.
- a cyclic alkyne is a cycloalkyl ring comprising one or more triple bonds.
- cyclic alkynes include, but are not limited to, cyclooctyne and cyclooctyne derivatives, such as bicyclononyne (BCN), difluorinated cyclooctyne (DIFO), dibenzocyclooctyne (DIBO/DBCO), keto- DIBO, biarylazacyclooctynone (BARAC), dibenzoazacyclooctyne (DIBAC), dimethoxyazacyclooctyne (DIMAC), difluorobenzocyclooctyne (DIFBO), monobenzocyclooctyne (MOBO), and tetramethoxy DIBO (TMDIBO).
- BCN bicyclononyne
- DIFO difluorinated cyclooctyne
- DIBO/DBCO dibenzocyclooctyne
- keto- DIBO keto- DIBO
- BARAC
- one of the first and second click reaction partners comprises a cyclic alkyne, preferably DBCO.
- DBCO is a particularly preferred conjugation group.
- the other click reaction partner comprises an azide, Hence, a particularly preferred “click pair” is DBCO with an azide.
- the term “diene” refers to a compound having two carbon- to-carbon double bonds where these double bonds are conjugated in the Imposition.
- the double bonds of the diene can be either cis or trans. Examples of dienes include, but are not limited to, a tetrazine or a tetrazole group.
- alkene refers to an unsaturated hydrocarbon molecule that includes a carbon-carbon double bond.
- an alkene can include from 2 to 100 carbon atoms.
- alkenes include, but are not limited to, norbornene and transcyclooctene (TCO).
- one of the first and second click reaction partners comprises an alkene group, preferably norbomene or TCO.
- the other click reaction partner comprises a diene, preferably a tetrazine or tetrazole group.
- proteinogenic amino acids are amino acids that are incorporated biosynthetically into proteins during translation and preferably the genetically encoded (proteinogenic) amino acids, 20 in the standard genetic code and an additional 2 (selenocysteine and pyrrolysine) that can be incorporated by special translation mechanisms.
- covalently linked means that the molecule is attached to the first click functional group via at least one covalent linkage, and that the conjugation partner is attached to the second click functional group via at least one covalent linkage.
- the linkage can be direct, i.e. without a linker, or indirect, i.e. via a linker.
- One advantage of the present invention is that it will typically allow the entities being conjugated to retain their activity or not suffer a significant reduction in activity.
- the location of the glycosylation site or sites is chosen to help avoid any loss of activity, or at least any significant loss, in the entities being conjugated to each other.
- the moiety that it is desired to conjugate to will still retain activity after the conjugation.
- the molecule is, or comprises, an antibody and is conjugated to a desired moiety using the present invention the antibody will typically retain antigenbinding activity.
- the moiety may be, or comprise, a linker, so that the O-glycosyl sugar chain is conjugated to a linker as, or as part of, the moiety.
- the linker may then be, or may already be, conjugated to a further component.
- a linker which is a bridge between the O-glycosyl sugar and a further molecule with the linker and further molecule representing the desired moiety.
- such a linker may be absent.
- a linker may be used as the bridge between an O- glycosylated amino acid sequence of the present invention and a further molecule.
- the linker may be joined to the sialylated sugar and the other end of the linker joined to the chosen molecule.
- such a linker may be used.
- An example of a preferred linker is, or one which comprises, DBCO.
- Any suitable linker may be used that is capable of forming a bond with the
- a linker comprising a polyarginine sequence may be employed, for instance a linker with from 2 to 15, preferably from 3 to 10, and more preferably from 4 to 8 consecutive arginine residues.
- the linker comprises six consecutive arginine residues.
- the polyarginine sequence is flanked on each side by a lysine residue.
- the sequence is acetylated on the N-terminus and amidated on the C-terminus.
- the linker comprises the amino acid sequence Lys-Arg-Arg-Arg-Arg-Arg-Arg-Lys with an N-terminal acetyl group and C-terminal amidation, in other words Ac-Lys-(Arg)6-Lys-NH2.
- the linker has the structure shown in Figure 28(c).
- the linker comprises a Lys-(Arg)6-Lys sequence with both lysine side chains modified by PEG5-DBCO, so Ac- Lys(PEG5-DBCO)-(Arg)6-Lys(PEG5-DBCO)-NH2.
- the linker comprises, or is, that depicted in Figure 28(c). [0133]
- two molecules of the invention are joined via their O glycosylation sites via a linker and in particular that described above to form a larger molecule of the invention.
- a molecule of the present invention comprises a glycosylation sequence of the present invention with a sialylated O-glycosyl sugar chain that is conjugated to a desired moiety.
- the desired moiety may be, or comprise, a linker.
- the present invention may be used to join any desired entities using one or more glycosylation sequences of the present invention which are O- glycosylated with a sialylated sugar chain comprising a suitable conjugation group.
- the invention may be, for instance, used to join polypeptides, which themselves represent molecules of the invention, to each other to form a larger molecule of the present invention.
- a polypeptide refers to the segment that may ultimately form part of a molecule of the invention when it is has been conjugated to the polypeptide comprising one or more glycosylation sequence(s) of the present invention.
- the ability to conjugate together two polypeptides may be used to join polypeptide chains within a larger molecule.
- the ability to readily join two molecules via the invention may be used in multiplexing to generate permutations of different molecules being joined together and then screen them for a desired property.
- the invention is therefore a highly versatile way to join-together a molecule and a desired moiety. Particular moieties are described below but reference to them should not be seen as limiting and particular moieties are identified simply as illustrative examples.
- the moiety is selected from Fc, PEG, fluorophore, radioactive tracer, a fatty acid, glycan, peptide, nucleic acid, enzyme, and steroid.
- a molecule of the present invention is conjugated to, or comprises via conjugation, a nucleic acid.
- the nucleic acid is single-stranded. In another embodiment, it is double-stranded.
- the nucleic acid is DNA.
- the nucleic acid is RNA.
- the nucleic acid is an anti-sense nucleic acid.
- the nucleic acid is an anti-sense RNA.
- the nucleic acid is an siRNA.
- a conjugate of the invention comprises an antibody which is conjugated to a nucleic acid molecule via the invention.
- the nucleic acid may inhibit expression of a target gene.
- the invention provides a conjugate which is a conjugate of an antibody and an siRNA using the conjugation approach of the present invention.
- the antibody will comprise glycosylation sequences of the present invention allowing conjugation to a nucleic acid of choice.
- the molecule may be, or may comprise, a viral or microbial polypeptide.
- a virus may be produced such that it comprises one or more glycosylation sequences of the present invention in a capsid polypeptide of the virus.
- a molecule of the invention may be one on the surface of a cell.
- the molecule is on the surface of a pathogen.
- the invention may be then used to conjugate a desired molecule onto the surface of the virus, pathogen, or cell. The invention may be used to bring together different cells where both cells have compatible conjugation groups with at least one of the cells having such groups introduced via use of glycosylation sequences of the present invention.
- the invention may also be used to help target a virus to a desired cell.
- the invention may also be used to target to cancer cells.
- a molecule of the present invention may be first targeted to a desired cell, with the molecule having a compatible conjugation group to then allow conjugation to a target on the cell.
- cells, viruses, liposomes, or other means for delivery may have a sialylated O-glycosyl sugar of the invention on their surface, with that then being used for conjugation to a desired targeting molecule.
- the targeting molecule may be chosen for its specificity, with it being possible to swap to a different targeting molecule to change the specificity.
- the targeting molecule is an antibody specific for a target cell.
- a molecule of the present invention may comprise a portion of the molecule that targets it to a specific target.
- the molecule may be, or comprise, an antigen.
- the antigen it is desired to elicit an immune response against has been modified to comprise one or more glycosylation sequence(s) of the present invention, and the invention is used to conjugate the antigen to a desired moiety.
- the moiety is a carrier.
- the invention is used to conjugate an antigen to a carrier such as diphtheria toxoid (DT), tetanus toxoid (TT), CRM197, Haemophilus protein D (PD), or the outer membrane protein complex of serogroup B meningococcus (OMPC).
- DT diphtheria toxoid
- TT tetanus toxoid
- CRM197 Haemophilus protein D
- PD Haemophilus protein D
- OMPC outer membrane protein complex of serogroup B meningococcus
- the present invention also provides a conjugate vaccine comprising an antigen and a protein carrier joined using the conjugation approach of the present invention.
- the polypeptide comprising one or more glycosylation sequences of the present invention is the carrier and the moiety conjugated to it using the invention is a glycan.
- the invention provides a convenient way to conjugate glycans to a polypeptide carrier.
- the invention may be used to conjugate alpha gal to a polypeptide to help promote an immune response to the polypeptide with one or more glycosylation sequence(s) of the present invention.
- the invention may be used to promote the efficacy of a vaccine.
- a molecule of the present invention comprises one or more glycosylation sequence(s) of the invention which is, or are, conjugated to a label.
- the molecule comprises a fluorophore conjugated to a glycosylation sequence of the present invention.
- the label is a fluorescent protein.
- the fluorescent protein is GFP.
- the polypeptide sequence is conjugated to a dye using the glycosylation sequence of the invention.
- the polypeptide is conjugated to biotin via the O-glycosylation.
- the polypeptide is conjugated to a steroid.
- the steroid is a steroid hormone.
- the molecule is conjugated to a moiety which influences the stability and/or half-life of the molecule.
- the glycosylation amino acid sequence is conjugated to BSA, for instance to alter the stability of the molecule in circulation.
- the molecule is conjugated via a glycosylation sequence of the present invention to PEG (polyethylene glycol).
- the invention may also be used to change the isoelectric point (pl) of a molecule of the invention, for instance as the addition of sialic acid should result in a lower pl. That may be, for instance, used to increase the half-life of a molecule of the present invention.
- a glycosylation amino acid sequence of the invention may be conjugated to an anti-cancer agent.
- the anti-cancer agent is Monomethyl auristatin E (MMAE).
- MMAE Monomethyl auristatin E
- the glycosylation amino acid sequence is conjugated to a chemotherapeutic agent.
- chemotherapeutic agents which may be conjugated include: Lenalidomide (REVLIMID®, Celgene), Vorinostat (ZOLINZA®, Merck), Panobinostat (FARYDAK®, Novartis), Mocetinostat (MGCD0103), Everolimus (ZORTRESS®, CERTICAN®, Novartis), Bendamustine (TREAKISYM®, RIBOMUSTIN®, LEV ACT®, TREANDA®, Mundipharma International), erlotinib (TARCEVA®, Genentech/OSI Pharm.), docetaxel (TAXOTERE®, Sanofi- Aventis), 5-FU (fluorouracil, 5 -fluorouracil, CAS No.
- gemcitabine Lilly
- PD-0325901 CAS No. 391210-10-9, Pfizer
- cisplatin cis-diamine, dichloroplatinum(ll), CAS No. 15663-27-1
- carboplatin CAS No. 41575-94-4
- paclitaxel TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N.J.
- trastuzumab HERCEPTIN®, Genentech
- temozolomide 4- methyl-5-oxo- 2,3,4,6,8-pentazabicyclo [4.3.0] nona-2,7,9- triene- 9-carboxamide, CAS No.
- the invention may be used to form a molecule of the present invention comprising a radionucleotide, for example for use in cell killing or alternatively in labelling or imaging.
- a molecule of the invention may comprise a label, for example the label may be conjugated to the molecule via a glycosylation amino acid sequence of the invention.
- labels may be useful, for instance, in diagnostics and/or imaging.
- the label is a fluorochrome. In another embodiment, it is a radiolabel.
- the moiety is a polypeptide or peptide.
- the invention may be used to bring together any suitable polypeptides.
- the conjugation helps stabilize a molecule comprising at least two polypeptides.
- it is used to help stabilize a dimeric or multimeric protein via conjugation between glycosylation sequences of the present invention location in different polypeptides.
- the conjugation joins together subunits of a protein to make it more stable.
- it is used to join a ligand to its receptor, for instance after binding of the ligand to its receptor.
- the invention is used to provide a way to recover a molecule of the invention by virtue of its ability to conjugate to a compatible conjugation group.
- the compatible conjugation group is provided by a support, for instance such as a bead or plate.
- the invention is used to localize a molecule at the site of the cell producing it, for example where the molecule is labelled and conjugation to the support provides a localized region of labelled molecule or simply a localized region of the molecule that can be detected using a secondary label.
- the invention may be used in techniques such as ELISA to immobilize a molecule of interest to a support prior to detection.
- nucleic acid sequence or sequences at least encoding a molecule of the present invention or a polypeptide part of it.
- the invention provides a nucleic acid molecule encoding a polypeptide comprising one or more glycosylation sequences of the present invention.
- the present invention provides a nucleic acid molecule or molecules encoding a molecule of the present invention which is, or comprises, an antibody of the present invention.
- the nucleic acid will typically further comprise regulatory elements for expression of the polypeptide or protein of the present invention such as, for instance, a promoter and polyadenylation addition signal.
- the present invention also provides a vector comprising such a nucleic acid or nucleic acids of the present invention.
- the vector may be, for instance, an expression vector.
- the vector may be a cloning vector.
- the invention also provides a sequence for introducing a nucleic acid sequence of the present invention into the genome of a cell via CRISPR.
- the present invention is highly versatile and may be used to join any desired molecules provided at least one of them comprises one or more glycosylation sequences of the present invention.
- the glycosylation sequence(s) may be either inserted into the amino acid sequence forming part of a molecule of the invention, such as a polypeptide, or used to replace part of the original sequence.
- the invention is applied to binding molecules and in particular antibodies.
- the present invention provides a binding molecule comprising one or more glycosylation sequences of the present invention.
- the present invention provides such a molecule where one or more glycosylation sequence is O-glycosylated at the Threonine amino acid residue, where the O-glycosylation comprises a sialylated sugar with a group allowing conjugation to a further moiety.
- An especially preferred binding molecule of the present invention is, or comprises, an antibody.
- a particularly preferred molecule of the present invention is an antibody conjugate.
- the present invention provides an antibody wherein at least one polypeptide of the antibody comprises one or more glycosylation sequences of the present invention.
- the present invention provides such an antibody comprising at least one glycosylation sequence where the Threonine residue is O- glycosylated.
- the O-glycosylated sugar comprises a sialylated sugar group.
- the O-glycan comprises a sialylated sugar with a chemical group which is functional for conjugation.
- the antibody comprises at least one glycosylation sequence of the present invention where the threonine residue is O-glycosylated, with the O-glycosyl sugar group being conjugated to another molecule.
- an antibody can be represented by the formula: Ab-O-DM, where Ab denotes the antibody, O the O-glycosyl sugar chain and DM the desired moiety conjugated to the antibody.
- a linker may be used to join an O-glycan and a chosen molecule (the linker itself may be thought of as part of the desired moiety).
- the molecule may have the format Ab-O-DM, wherein the DM comprises a linker and a second molecule.
- the molecule may have more than one glycosylation sequence of the invention. For example, it may have two such sequences and take the format DM-O-Ab-O-DM.
- the DM may, or may not, comprise a linker or be a linker.
- the binding molecule may be symmetrical, for instance it may have two glycosylation sites at the same site in the heavy chains of the antibody and/or in the same locations of the light chains of the antibody.
- the present invention may be applied to any antibody format which can comprise a glycosylation sequence of the present invention.
- a molecule of the present invention may be, or comprise, an antibody.
- the antibody is one comprising two light chains and two heavy chains.
- at least the light chain variable regions of the two light chains are identical to each other.
- at least the two heavy chain variable regions of the two heavy chains are identical to each other.
- the light chain variable regions of the two light chains are identical to each other and the heavy chain variable regions of the two heavy chains are identical to each other.
- the invention though may be used to bring together antigen binding sites of different specificities as well, such as a light and heavy chain for a first specificity and a different heavy and light chain pair for a second specificity.
- the light chains in both pairs are the same, but the heavy chains differ leading to the different specificity. That is discussed further below.
- the antibody comprises at least two glycosylation sequences of the present invention. In one embodiment, the antibody comprises at least four such sequences. In one embodiment the antibody comprises two or four glycosylation sequences of the present invention. In one embodiment, the antibody comprises at least two glycosylation sequences of the present invention where one of the sequences is present in each heavy chain. In one embodiment, the antibody comprises at least two glycosylation sequences of the present invention, where one such amino acid sequence is present in each light chain. In one embodiment, an antibody comprises a glycosylation sequence of the present invention in each of the two light chains and two heavy chains. In one embodiment, the glycosylation sequence or sequences of the present invention is, or are, present in the antibody constant region.
- the glycosylation sequences of the present invention are only present in the antibody constant regions. In another embodiment a glycosylation sequence of the present invention is present in the light or heavy chain variable regions of the antibody, but in the frame-work regions of the antibody. In one embodiment, the glycosylation sequences present are in the C-terminal half of the light chain. In another embodiment, the glycosylation sequences present are in the C-terminal half of the heavy chain. In another embodiment, the glycosylation sequences present are in the N-terminal half of the heavy chain. In another embodiment, the glycosylation sequences present are in the N-terminal half of the light chain. In one embodiment, the glycosylation sequences present are at the C-termini of the light chains.
- the glycosylation sequences present are at the C- termini of the heavy chains. In one embodiment, the glycosylation sequences present are at the C-termini of the light and heavy chains of the antibody. In one particularly preferred embodiment, the glycosylation sequence, or sequences, of the present invention are present in the hinge regions of the heavy chains of the antibody.
- An exemplary antibody is an immunoglobulin G (IgG) type antibody comprised of four polypeptide chains: two heavy chains (HC) and two light chains (LC) that are cross-linked via inter-chain disulfide bonds. The amino-terminal portion of each of the four polypeptide chains includes a variable region of about 100-125 or more amino acids primarily responsible for antigen recognition.
- each of the four polypeptide chains contains a constant region primarily responsible for effector function.
- Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region.
- the heavy chain constant region refers to a region of an antibody, which comprises the Fc region and CHI domain of the antibody heavy chain.
- Each light chain is comprised of a light chain variable region (VL) and a light chain constant region.
- the IgG isotype may be further divided into subclasses (e.g., IgGl, IgG2, IgG3, and IgG4).
- the numbering of the amino acid residues in the constant region is based on the EU index as in Kabat.
- EU Index numbering or EU numbering is used interchangeably herein.
- VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR).
- CDRs complementarity determining regions
- FR framework regions
- the CDRs are exposed on the surface of the protein and are important regions of the antibody for antigen binding specificity.
- Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- the three CDRs of the heavy chain are referred to as “HCDR1, HCDR2, and HCDR3” and the three CDRs of the light chain are referred to as “LCDR1, 30 LCDR2 and LCDR3”.
- the CDRs contain most of the residues that form specific interactions with the antigen. Assignment of amino acid residues to the CDRs may be done according to the well-known schemes, including those described in Kabat (Kabat et al., “Sequences of Proteins of Immunological Interest,” National Institutes of Health, Bethesda, Md.
- the present invention may also be applied to other antibody formats, for example the antibody may be a heavy chain only antibody.
- the antibody may be a VHH format antibody.
- the antibody may be a camelid antibody.
- the antibody may be from a cartilaginous fish, for example be an IgNAR format antibody.
- the antibody may be a heavy chain only antibody that comprises heavy chains lacking CH3 regions.
- the antibody can be in a tandem configuration with other VHH of the same or of different identity, e.g. VHH comprising of a half-life extender that binds to human serum albumin (HSA).
- the invention may be applied to antibodylike molecules, for instance DARPins and affibodies.
- the present invention may be used to join separate antigen-binding sites.
- the present invention is employed to join two antibodies together to produce an antibody with a higher valency, i.e., with a higher number of antigenbinding sites.
- the joining may be direct or it may be that two molecules each comprising antigen-binding sites are brought together with the molecules comprising other scaffold sequences as well as the antigen binding sites.
- the “valency” of a binding molecule is typically the number of binding sites present in the binding molecule. For example, in the case of an antibody the “valency” of an antibody indicates the number of antigen-binding sites that the antibody has.
- an “antibody” herein includes a structure comprising individual antibodies joined together with the “O” glycosyl groups acting as a “bridge” joining the antibodies.
- the present invention provides an antibody where a further antibody is conjugated to each of the two light chains.
- the present invention also provides an antibody where a further antibody is conjugated to each of the two heavy chains.
- the further antibody is conjugated at, or near to, the C-terminal end of the polypeptide chain they are joined to.
- the further antibodies conjugated to the antibody molecule are scFv antibodies or heavy chain only antibodies.
- the present invention provides an Ig molecule where the valency of the antibody has been increased from two to four by conjugating an antibody to each of the two light or two heavy chains.
- a molecule of the present invention is a multi-specific antibody. In a preferred embodiment, it is a bispecific antibody.
- the present invention also provides for the use of a molecule of the present invention in the generation of a multi-specific antibody, particularly a bispecific antibody.
- the invention is used to join a ligand to the antibody, so the ligand effectively represents a moiety.
- the ligand is specific for the same target as the antigen-binding sites of the antibody.
- the present invention also provides a method of joining two antigen-binding sites together by employing the glycosylation sequence of the present invention to form a bridge between the two antigen-binding sites.
- the present invention also provides a method of modifying a known antibody by introducing one or more glycosylation sequences of the present invention into the primary sequence of the antibody.
- the glycosylation sequence of the present invention can be introduced in any of the locations discussed above.
- known antibodies such as Humira®, Herceptin®, Avastin®, Keytruda®, Rituximab®, Remicade®, Stelara®, Enbrel®, Imbruvica®, Opdivo®, Cosentrx®, Ocrevus®, and other known antibodies may be modified to introduce one or more glycosylation sequences of the present invention and hence provide a convenient way to conjugate desired moieties to those antibody drugs.
- the present invention also provides a convenient way to produce antibody dimers or multimers by providing a way to join antibodies via glycosylation sequences in each.
- the present invention provides an antibody dimer where the two antibodies each have one or more glycosylation sequences of the present invention allowing for conjugation of the two individual antibodies.
- the invention is used to form antibody trimers.
- it is used to form antibody hexamers. It may be that all the individual antibodies within a dimer or multimer are identical apart from the conjugation groups. For example, it is possible to produce two batches of the same antibody only differing in the conjugation group in the O-glycosyl sugar chain at the glycosylation sequence of the present invention, with the two batches having different but compatible conjugation groups. Antibodies from the two batches can then be conjugated together to form dimers. In another embodiment, antibodies with different specificities are joined together in dimers or higher order structures using the invention.
- the antibody binds to a target that allows for transport across the blood brain barrier (BBB).
- BBB blood brain barrier
- such an antibody conjugate may be used to deliver a moiety to the CNS and in particular the brain.
- the moiety may be for inhibiting expression of a target gene.
- the moiety may be for inhibiting expression of a target gene in the brain.
- the antibody specific for a target that allows for transport across the blood brain barrier (BBB) may be conjugated using the invention to a moiety which is an siRNA.
- Antibodies may also be conjugated to a chemotherapeutic agent or other anti-cancer agent which otherwise would not be able to cross the BBB readily. Such conjugates may be, for instance, used to treat cancer.
- a binding molecule of the present invention may have, for instance, a valency of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or more. It may have a valency in the range of those values. It may have a valency of at least those values. It may have a valency up to, or including, those values.
- an antibody may have a valency of two.
- all the antigen-binding sites of the binding molecule, and in particular, antibody may have the same specificity.
- an antibody may comprise at least two different antigenbinding sites which have a different specificity. The antigen-binding sites may have a different specificity in the sense that the two bind different antigens. In another embodiment, they may have a different specificity in the sense that they bind two different epitopes on the same antigen.
- the present invention provides a bispecific antibody comprising one or more glycosylation sequences of the present invention.
- the bispecific antibody comprises at least two glycosylation sequences of the present invention which are O-glycosylated at the threonine, with the sugar chains being conjugated through the sialic acid groups of the O-glycans, forming a bridge between two different antigen-binding sites.
- the bispecific antibody comprises an Ig antibody comprising two heavy and two light chains, wherein each of the light chain constant regions comprise a glycosylation sequence of the present invention which is conjugated to a Fab comprising an antigen-binding site with different specificity to that of the antigen-binding sites of the Ig antibody.
- each of the Fab fragments conjugated to the Ig is the same and has the same antigenspecificity, but that specificity is different to that of the antigen-binding sites of the Ig.
- the Fab fragments are conjugated to the heavy chains.
- a bispecific antibody comprising two heavy and two light chains, where each heavy chain comprises a glycosylation sequence of the present invention which is O-glycosylated, with the two sugar chains conjugated to each other, with the antigen-binding site formed by the first light chain and first heavy chain having a different specificity to that formed by the second light chain and second heavy chain.
- the glycosylation sequence of the present invention is substituted for the cysteines present in the heavy chain hinge.
- a bispecific antibody of the present invention is generated via antibody arm exchange.
- bispecific antibodies A well -recognized problem with bispecific antibodies is that if a bispecific antibody is formed of two different light chains and two different heavy chains, expressing all four antibody chains in the same cell results not only in the bispecific antibody, but also in a much larger proportion of unwanted monospecific antibodies and other unwanted antibody species.
- the present invention provides a solution to promote antibody arm exchange between the two “parent” monospecific antibody species to generate bispecific antibodies.
- the present invention provides a method for the generation of a bispecific antibody, the method comprising:
- first and second antibody each comprise one or more glycosylation sequences of the present invention which is O-glycosylated with a sialylated sugar chain with a conjugation group, with the first and second antibodies comprising compatible conjugation groups that can conjugate to each other;
- the first and second antibody comprise one or more glycosylation sequences of the present invention in the heavy chain constant regions of the antibodies.
- a glycosylation sequence of the present invention is typically at a location in the heavy chains that will allow antibody arm exchange.
- the glycosylation sequences of the present invention are present in place of a section of the sequence containing the cysteines usually present at the heavy chain hinge.
- the cysteines usually present at the heavy chain hinge are replaced with serine residues and one or more glycosylation sequences of the present invention are present elsewhere, for example at the C-terminal part of the heavy chains.
- the method may further comprise purifying the bispecific antibody.
- the method may comprise the further steps of:
- the first and second antibodies differ not only in the heavy chain variable regions, but also in the heavy chain constant regions.
- the heavy chain constant regions of the first and second antibodies may comprise amino acid sequence differences that either promote the formation of bispecific antibody (heterodimer) over monospecific antibodies (monomer) or which help the purification of the bispecific antibodies from the monospecific/unwanted species of antibody.
- the heavy chains have differences in their heavy chain constant regions that promote bispecific antibody formation over monospecific antibody.
- the heavy chain constant regions may have charge and/or shape modifications that promote bispecific formation over monospecific antibody.
- An example of heavy chain modifications that promote the formation of bispecific antibody over monospecific antibody are the “knob-and-hole” amino acid modifications.
- the first or second antibody has the heavy chain constant region “knob” modification and the other of the first and second antibody has the “hole” modification.
- Another example of a modification that may be employed is one that alters affinity for a purification agent.
- one parental monospecific may have a heavy chain constant region modification that changes the affinity of the antibody for purification agent Protein A, for instance eliminating binding to Protein A.
- the other parental monospecific may have heavy chains that lack that modification and so bind Protein A normally.
- the bispecific antibody may therefore comprise one heavy chain which binds to Protein A and the other that either does not bind to Protein A or has reduced affinity for Protein A. Overall, that means the bispecific antibody has an intermediate affinity for Protein A meaning it can be separated from the parental monospecific antibodies on that basis.
- the present invention provides a cell line where the ability of the cell to produce sialic acid has been disrupted so that the cell has reduced, or no ability, to naturally produce sialic acid.
- Such cell lines may also be employed in the present invention.
- Such cell lines can be then supplemented with synthetic compounds that include a functional group for conjugation which are preferentially incorporated when the polypeptides comprising one or more glycosylation sequence of the present invention is O- glycosylated, in particular they may be supplemented with a peracetylated ManNAz compound that gets taken up, de-acetylated, and converted to sialic acid which includes a click chemistry group. This provides a convenient way to ensure that the click chemistry groups are incorporated as part of the O-glycosylation of the one or more glycosylation sequences of the present invention.
- the present invention therefore provides a cell line that is unable itself to produce sialic acid, unless supplemented, in particular where the cell line is unable to produce sialic acid unless supplemented with peracetylated ManNAz that can be taken up, de-acetylated, and converted to sialic acid. It is possible to disrupt the endogenous synthesis of sialic acid in a eukaryotic cell by mutating the UDP- GlcNAc-2-epimerase/ManAc kinase (GNE) encoding gene (SEQ ID NO: 6, NCBI accession number NM_001246709).
- GNE UDP- GlcNAc-2-epimerase/ManAc kinase
- the epimerase function of the gene can be reduced without the need to either retain the kinase function or introduce a sequence encoding a kinase to compensate for its loss.
- the sequence encoding the UDP-N-acetylglucosamine 2-epimerase portion of the GNE is mutated so that the UDP-N-acetylglucosamine 2-epimerase function is either reduced or eliminated.
- the N- acetylmannosamine kinase function is also reduced or eliminated. The finding that the N-acetylmannosamine kinase function does not need to be retained or reintroduced means that producing the cell line is simpler.
- the N- acetylmannosamine kinase encoding sequence is not modified and thus the kinase is still active.
- the cell will typically comprise a polynucleotide encoding a polypeptide comprising one or more glycosylation sequences of the present invention.
- the present invention also provides a method of producing such a cell comprising disrupting the endogenous UDP-N-acetylglucosamine 2-epimerase/N- acetylmannosamine kinase (GNE) encoding gene and either before, or afterward, introducing a sequence encoding a polypeptide with one or more glycosylation sequences of the present invention.
- GNE UDP-N-acetylglucosamine 2-epimerase/N- acetylmannosamine kinase
- the disruption of the UDP-N-acetylglucosamine 2-epimerase/N- acetylmannosamine kinase (GNE) encoding gene may be performed by any suitable means and in one embodiment is performed via CRISPR.
- the invention also provides a cell culture comprising a cell line of the present application where the cell culture medium is supplemented to allow it to produce sialic acid, in particular it is supplemented with peracetylated ManNAz that gets taken up, de-acetylated, and converted to sialic acid.
- the peracetylated ManNAz comprises a conjugation group.
- the synthetic sialic acid precursor comprises a click chemistry group.
- the synthetic precursor is mannosamine with an azide group.
- the synthetic compound is N-azidoacetylmannosamine (ManNAz).
- the cell type employed is eukaryotic.
- the cell line is mammalian.
- An especially preferred cell line is CHO.
- Further examples of mammalian cell lines include HeLa cells, HEK293 cells, WI-38 cells, MRC-5 cells, and HepG2 cells.
- the cell line is a HEK cell line. Examples of rodent cells which may be employed include 3T3, L929, and BHK-21 cells.
- the cell line is a stem cell line.
- the cell line is an Embryonic Stem (ES) cell line.
- the present invention also provides a transgenic animal that expresses a polypeptide with one or more glycosylation sequences of the present invention.
- the transgenic animal also comprises sialic acid biosynthesis engineering.
- the animal may be fed artificial sugars to lead to sialylation of the sugar chains at the glycosylation sequence of the present invention.
- the animal may be given food or water supplemented with peracetylated ManNAz that gets taken up, de-acetylated, and converted to sialic acid.
- the animal is used to produce a molecule of the invention.
- the animal is used as a model.
- the desired moiety with a compatible conjugation group is given to the animal, for instance to target the moiety to a specific location or cell type. Such animals are typically non-human.
- the use of a glycosylation sequence of the invention to bring about conjugation to a desired moiety may be combined with a different conjugation approach so that both are employed.
- the glycosylation sequence of the invention may be used to conjugate a first moiety to a molecule, with a second conjugation approach used to conjugate a second and different moiety to the molecule.
- the use of such a combined approach may be, for instance, used to introduce two different functionalities to a molecule of the present invention via conjugation of the first and second moieties to it.
- the second conjugation approach employed may be the use of cysteine amino acids present in the molecule to provide a means to conjugate to the second moiety.
- the cysteines have been engineered into the primary amino acid sequence of a polypeptide in the molecule, for instance in the same polypeptide which comprises a glycosylation sequence of the present invention (the approach can be referred to as eCys).
- the approach of introducing cysteines as a means for conjugation is described in WO 2018/232088 which is both incorporated by reference in its entirety and incorporated specifically in relation to conjugation via cysteine residues.
- an antibody of the invention comprises an IgG heavy chain constant region and light chain constant region wherein:
- At least one polypeptide of the antibody comprises at least one glycosylation sequence of the formula Xi Thr Pro X2 X3, wherein the Threonine (T) amino acid residue at the second position is O-glycosylated with a sialylated sugar which comprises a chemical group that either can be, or is, conjugated to a moiety Y; and
- said antibody comprises a cysteine at least one of the following residues: residue 124 in the CHI domain, residue 157 in the CHI domain, residue 162 in the CHI domain, residue 262 in the CH2 domain, , residue 378 in the CH3 domain, residue 397 in the CH3 domain, residue 415 in the CH3 domain, residue 156 in the Ckappa domain, residue 171 in the Ckappa domain, residue 191 in the Ckappa domain, residue 193 in the Ckappa domain, residue 202 in the Ckappa domain, or residue 208 in the Ckappa domain.
- the antibody comprises a cysteine at residue 124 in the CHI domain and further comprises a cysteine at one, but not all, of residue 157 and 162 in the CHI domain, residue 262 in the C2 domain and residues 378 and 415 in the CH3 domain.
- the antibody comprises a cysteine at residue 157 in the CHI domain.
- the antibody comprises a cysteine at residue 378 in the CH3 domain.
- the antibody comprises a cysteine at residue 415 in the CH3 domain.
- the IgG heavy chain constant region is a human, mouse, rat, or rabbit IgG constant region.
- the IgG heavy chain constant region of the antibody is a human IgGl or human lgG4 or human IgG2 isotype.
- the IgG heavy chain constant region is a human IgGl constant region.
- the IgGl heavy chain constant region of the antibody further comprises an isoleucine substituted at residue 247, a glutamine substituted at residue 339, and optionally a glutamic acid substituted at residue 332.
- the IgG heavy chain constant region is a human lgG4 constant region.
- the lgG4 heavy chain constant region of the antibody further comprises a proline substituted at residue 228, an alanine substituted at residue 234, and an alanine substituted at residue 235 and a glutamine substituted at residue 339.
- the antibody comprises a cysteine at residue 124 in the CHI domain of each heavy chain and further comprises a cysteine at one, but not all, of residues 378 and 397 in the CH3 domain, and residue 157 in the CHI domain, of each heavy chain.
- said antibody comprises a cysteine at residue 378 in the CH3 domain of each heavy chain.
- said antibody comprises a cysteine at residue 397 in the CH3 domain.
- the introduced cysteine replaces a native serine, valine, alanine, glutamine, asparagine, threonine, or glycine.
- the total number of engineered cysteines is from two to six.
- the present invention provides a method of producing a molecule of the present invention comprising: (a) culturing a cell line which expresses a polypeptide comprising one or more glycosylation sequences of the present invention under conditions that allow for the O-glycosylation of the glycosylation sequence or sequences of the present invention with an O-glycan comprising a sialic acid group and a group for conjugation; and (b) harvesting the O-glycosylated polypeptide.
- the O-glycosylated polypeptide may be harvested by any suitable means, for instance the polypeptide may also have a sequence for binding Protein A.
- step (a) is performed with the cell being cultured in a medium comprising an artificial sugar, for instance to promote incorporation of the modified sialic acid.
- the artificial sugar is N- azidoacetylmannosamine (ManNAz).
- the sugar is peracetylated ManNAz.
- the cell line used is one that cannot itself synthesize de novo sialic acid.
- the cell line is a cell line of the present invention which lacks UDP-N-acetylglucosamine 2- epimerase activity.
- the cell lacks both the UDP-N- acetylglucosamine 2-epimerase and N-acetylmannosamine kinase activities. In one embodiment, it is a cell line where the endogenous GNE gene has been disrupted. In one particularly preferred embodiment, step (a) comprises both employing such a cell line and the medium comprising such an artificial sugar.
- the method further comprises step (c) where the purified polypeptide is then conjugated to a desired moiety.
- the present invention provides a method comprising: (a) culturing a cell line which expresses a polypeptide comprising one or more glycosylation sequences of the present invention under conditions that allow for the O-glycosylation of the glycosylation sequence with an O- glycan comprising a sialic acid group and a group for conjugation, wherein the cell line has at least the UDP-N-acetylglucosamine 2-epimerase activity of the GNE gene disrupted and is cultured in a medium comprising an artificial sugar promoting incorporation of modified sialic acid, preferably wherein the sugar comprises peracetylated ManNAz that gets taken up, de-acetylated, and converted to sialic acid;
- the present invention also provides a method comprising just step (c) without the earlier steps. Hence, the present invention provides a method comprising contacting:
- One advantage of the present invention is that it allows combinatorial screening to identify combinations with a desired property.
- the present invention provides a method comprising:
- a Pool A which comprises a plurality of molecules of the present invention each comprising a one or more glycosylation sequence of the present invention which is O-glycosylated with an O-glycosyl sugar chain comprising a sialic acid sugar and a chemical group for conjugation;
- the molecules of Pool B are also glycosylated molecules of the present invention comprising a compatible chemical group for conjugation group to that of the molecules of Pool A.
- each pool has at least five, ten, twenty, one hundred, five hundred or more different molecules of the invention.
- the members of a Pool are not physically present together but are classified as a pool because they all have the same conjugation group which is compatible with the conjugation group used in the other pool.
- Such methods may be used to screen combinations of any desired molecules, provided that one of the conjugation partners comprises one or more glycosylation sequences of the present invention, which are O-glycosylated with terminal sialylation and a group allowing conjugation to a compatible conjugation group. Whilst assessing pairwise combinations of antibodies represents a particularly preferred embodiment, the invention is not limited to that. So, for instance, any combinations may be screened, such as screening possible combinations of an antibody with different drugs or different permutations of cytokines. In one embodiment, one or more molecules screened may be variants of a molecule and the screening is performed to see which variant form works best or has a particular desired property.
- the method is used to assess different combinations of antigen-binding sites.
- both the molecules of Pool A and Pool B are antibodies.
- the antibodies in Pool A target one antigen and those in Pool B target a different antigen.
- the molecules of Pool A and B are monospecific antibodies.
- the antibodies in the pools are antibodies that can undergo arm exchange via the conjugation using the glycosylation sequences of the present invention.
- the property screened for is the ability to bind both specificities, i.e. to act as a bispecific antibody.
- Pool A and Pool B both comprise antibodies with one or more glycosylation sequences of the present invention which is/are O- glycosylated with a sugar chain with sialic acid and a conjugation group, with the conjugation group for Pool A being compatible with that of Pool B, and with the antibodies of Pool A and B having different specificities, for instance against different antigens or different epitopes of the same antigen.
- a screening method of the invention may include screening for any desired property. For example, in one embodiment, the method may assess the ability of different combinations to kill cancer cells. In another embodiment, the method may assess binding ability. In another embodiment, the method may screen for the ability of combinations to bind, and optionally activate, a receptor. In another embodiment, the method may assess the ability of different combinations to stimulate a cell to release a molecule.
- the present invention also provides a library comprising of molecules of the present invention.
- the present invention further provides a combinatorial library comprising molecules of the present invention, where the library is split into at least two portions which have compatible conjugation groups to each other allowing for screening of pairwise combinations.
- compositions comprising a molecule of the present invention and a pharmaceutically acceptable carrier or pharmaceutically acceptable excipient.
- the invention also provides a pharmaceutical composition comprising a nucleic acid or vector of the present invention and a pharmaceutically acceptable carrier or pharmaceutically acceptable excipient.
- Pharmaceutically acceptable carriers in therapeutic compositions may include, or be, liquids such as water, saline, glycerol, and ethanol. Additionally, auxiliary substances, such as wetting or emulsifying agents or pH buffering substances may be present in such compositions.
- Pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxy methyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as ethylene glycol and propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol, esters, such as ethyl oleate and ethyl laurate; agar; buffering agents; water; isotonic saline; pH buffered solutions; and other non-toxic compatible substances employed in pharmaceutical formulations.
- sugars such as lactose, glucose and sucrose
- starches such as corn starch and potato starch
- the pharmaceutically acceptable carrier may also include a manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or stearic acid), a solvent, or encapsulating material. If desired, certain sweetening and/or flavoring and/or coloring agents may be added.
- a manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or stearic acid
- a solvent e.g., stearic acid
- certain sweetening and/or flavoring and/or coloring agents may be added.
- Such carriers enable the pharmaceutical compositions to be formulated in formats such as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, and suspensions, for ingestion by the patient.
- a pharmaceutical composition may be formulated to take into account the nature of the active agent.
- Compositions comprising pharmaceutically acceptable carriers are formulated by well-known conventional methods (see, for example, Remington's Pharmaceutical Sciences
- a pharmaceutical composition of the invention may be administered to a subject by any suitable route.
- Administration may be, for example, via oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, transcutaneous, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, intravaginal or rectal routes.
- Administration may be, for example, via parental administration.
- Administration may be, for example, by injection or infusion. Examples of such administration include bolus injection or continuous injection.
- a pharmaceutical composition may be provided, for instance, in a form that is suitable for such administration routes.
- a preferred route of administration is via injection, hence the pharmaceutical composition may be provided as in a format suitable for injection, for instance in a format suitable for intravenous injection.
- a pharmaceutical composition will provide a therapeutically effective dose of the active agent.
- a pharmaceutical composition may provide a dosage of about 0.01 mg/kg to about 50 mg/kg of the active agent, for example 0.05 mg/kg to 50 mg/kg, for instance about 0.10 mg/kg to about 5 mg/kg of the active agent, or about 0.10 mg/kg to about 0.50 mg/kg.
- the dosage may be, for example, adjusted depending on the molecular weight of the molecule, for example a lower mg/kg dosage may in some embodiments be given where the molecular weight of the molecule is small, such as in the case of a peptide.
- the dosage may be chosen by a physician as a suitable dose for a given condition.
- the present invention also provides a unit dosage form of the pharmaceutical composition. Further provided are various formats that facilitate administration to the subject. For example, an autoinjector or pen delivery device loaded with a pharmaceutical composition of the invention is also provided. Also provided is an intravenous drip bag loaded with a pharmaceutical composition of the present invention. Also provided is a pharmaceutical composition in lyophilized form that can be reconstituted and then administered to the subject.
- a pharmaceutical composition of the present invention may be administered to any suitable subject.
- the term "subject" refers to a mammal, including, but are not limited to, a human, chimpanzee, ape, monkey, cattle, horse, sheep, goat, swine, rabbit, dog, cat, rat, mouse, guinea pig, and the like.
- the subject is a mammalian subject. In an especially preferred embodiment, the subject is human.
- a pharmaceutical composition of the present invention may be used to treat a subject.
- the present invention provides a method of treating a condition in a subject comprising administering a therapeutically effective amount of the composition to a subject in need thereof.
- a pharmaceutical composition of the present invention for use in a method of treatment of the human or animal body.
- the present invention also provides a pharmaceutical composition of the present invention for use in a method of treating a condition.
- a pharmaceutical composition may further comprise another therapeutic agent in addition to a conjugate of the present invention to allow both to be given to a subject at the same time.
- the two though may be separately administered to a subject. For instance, where administered separately, the two may be administered simultaneously, sequentially, or separately to a subject.
- the present invention also provides any of the active molecules of the present invention for use in the manufacture of a medicament, for instance to treat any of the conditions mentioned here.
- the versatility of the present invention means that it may be used to treat any suitable condition.
- it is used to treat a condition selected from cancer, heart disease, infection, an autoimmune disorder, a respiratory disorder, diabetes, dementia, pain, neurodegeneration and liver disease.
- the cancer is selected from bladder cancer, breast cancer, colon or rectal cancer, endometrial cancer, kidney cancer, leukemia, liver cancer, lung cancer, skin cancer (e.g. melanoma), non-Hodgkin lymphoma, pancreatic cancer, prostate cancer, and thyroid cancer.
- the invention may be used to induce tolerance to treat an autoimmune disorder.
- tolerance may be elicited via SIGLEC engagement with sialic acid on an engineered O- glycan without any conjugation.
- click chemistry may be utilized to conjugate a glycan known to induce immunotolerance.
- the invention may be used to treat autoimmune diseases and to treat allergies, for example allergies to serious allergens like peanut proteins.
- Therapeutic proteins with immunogenic regions may be engineered with a nearby glycosylation sequence of the invention to promote immunotolerance.
- the invention is used to help promote targeting.
- the moiety joined to the polypeptide with a glycosylation sequence of the present invention may target the molecule of the invention to a particular location.
- the moiety that is conjugated is specific to a particular organ or cell type.
- the targeting is to the liver.
- the moiety is, or comprises a LYTAC (lysosomal targeting chimera).
- LYTACs typically bind to the ASGPR receptor and hence provide targeted delivery to the liver.
- the targeting is to a particular cell type.
- the conjugation of the moiety to the molecule leads to it being targeted to a particular compartment in the cell.
- targeting is to the CNS and in particular the brain.
- a binding molecule of the invention binds a target that means it will be transported across the blood brain barrier (BBB). In one embodiment, it binds to the transferrin receptor.
- the conjugated moiety may be a label allowing for the location of the molecule of the invention to be identified.
- the moiety may be a radiolabel which allows for the molecule to be located.
- ADME absorption, distribution, metabolism, and excretion
- Such methods may be in vivo, for example a molecule of the invention may be administered to a subject and then its location identified via the conjugated label.
- the invention may be used in imaging techniques such as MRI and PET imaging.
- the desired moiety that is conjugated to the molecule is one that results in the targeting of the molecule to a particular cell or cell receptor.
- the invention is used to modulate protection from protease degradation, modulating serum half-life, functional modulation, intracellular trafficking, cell adhesion, and self- versus foreign recognition during an immune response.
- the invention may be used for a wide variety of purposes.
- the invention is used to increase the stability of a molecule.
- the presence of glycosylation at a glycosylation amino acid sequence of the present invention may prevent, reduce, or slow down the degradation of the molecule.
- the glycosylation sequence is introduced at a site, or sites, such that its glycosylation reduces the ability of a second entity to bind to the molecule. That may be the case with the glycosylation before any conjugation or the conjugated moiety may result in protection of the molecule.
- the one or more glycosylation sequences are introduced near the cleavage site for a protease.
- the invention results in a reduction of the ability of an enzyme to bind to the molecule. In another, it results in a reduction of the ability of a molecule to bind to a receptor.
- the invention may alter the serum half-life of the molecule. Hence, the molecule may have, for instance, a longer serum half-life once it is conjugated to the desired moiety.
- the desired moiety is PEG and conjugation results in an increase in serum half-life.
- the moiety is serum albumin.
- the conjugated moiety facilitates purification of a molecule of the present invention.
- the desired moiety may be conjugated to biotin to allow for rapid purification.
- the invention may also be used to immobilize a desired molecule onto a surface via the conjugation.
- the invention may be used to produce a protein immobilized for techniques such as ELISA.
- the invention may also be used to immobilize a given protein onto beads via the conjugation.
- the invention may also be used to replace one or more natural glycosylation sites in a polypeptide with one or more glycosylation sequences of the present invention.
- the invention may be used to conjugate moi eties with a desired activity to a given protein, so, for instance, enzymes like hyaluronidase (e.g. for tumor penetration), reporters (e.g., luciferase, dyes), affinity tags (e.g. biotin, FLAG, HA), small molecules (e.g., solubilized steroids), albumin binding lipids, or membrane binding lipids.
- enzymes like hyaluronidase (e.g. for tumor penetration), reporters (e.g., luciferase, dyes), affinity tags (e.g. biotin, FLAG, HA), small molecules (e.g., solubilized steroids), albumin binding lipids, or membrane binding lipids.
- the present invention may also be used to alter the solubility of a molecule.
- that may be done by conjugating a desired moiety with a particular solubility.
- water soluble groups may be conjugated to organic groups to promote their solubility.
- cyclodextrin or HPMA loaded with a steroid, may be conjugated to an antibody for targeted delivery.
- the present invention also provides a kit comprising a molecule of the present invention.
- the kit comprises a library of the present invention.
- the kit may further comprise a cell line of the invention.
- the kit may comprise instructions for use.
- HEK 293 Human Embryonic Kidney cells (aka HEK 293) were maintained in log phase of growth in DMEM/F-12 media as a serum free suspension culture in shaking flasks. Cultures were grown at 37 °C, with 7% CO2, humidified, 160RPM, 50mm orbital. On the day of transfection, HEK 293 cells were diluted to 2xl0 6 cells per ml in DMEM-F-12. A DNA carrier complex was then prepared by mixing lOpg of the DNA expression vector into 1ml of growth media. 20pL polyethylenimine (25k MW free base, Img/mL in water) was added to ImL of the DNA solution and gently mixed by inversion.
- the mixture was allowed to incubate at room temperature for approximately 20 minutes to allow the complex to form.
- 10% volume/volume of DNA carrier complex was added to the prepared HEK culture.
- the transfected culture was incubated for 5 days at 37 °C, with 7% CO2, humidified, 160RPM, 50mm orbital.
- Product was characterized by mass spectrometry after reduction with di thioerythritol.
- An Agilent G7100A CE System was used for analysis.
- the CE capillary was a neutral coated, 60 cm long, 360 pm OD x 50 um ID capillary (Agilent, PVA coated,) with a custom tapered end.
- the running buffer was 1% formic acid.
- the sheath liquid was 12% methanol, 0.1% formic acid.
- the spray tip was pulled in house from uncoated glass rods to an ⁇ 10 pm tip opening.
- the sample was injected by pressure (50 mbar for 20 sec).
- the separation was run at 30,000 V for 15 minutes.
- Figures 1 and 2 show potential O-glycosylation sugar chain structures depending on whether the sugar chain has been sialylated and a click sugar incorporated.
- Figure 3 provides an illustration of the protein mass spectroscopy results obtained showing the different peaks for products. The overall results obtained are summarized in Table 1 below.
- CHO cells were generated where the UDP-N-acetylglucosamine 2- epimerase/N-acetylmannosamine kinase (GNE) gene was modified to disrupt both the epimerase and kinase activities.
- GNE UDP-N-acetylglucosamine 2- epimerase/N-acetylmannosamine kinase
- CRISPR technology was used to introduce a genetic modification into CHO cells to cause a translational frame shift in all GNE gene alleles of the CHO cell line.
- Lentivirus was used to deliver CRISPR genes to CHO cells, generating a stable CHO pool after puromycin selection (lOug/ml). The constitutive expression of the CRISPR genes ensured that GNE activity was abrogated.
- constructs utilized in the preparation of the cell line were hamster Gne-l-pLentiCRISPRv2(T15257), Gne-2-pLentiCRISPRv2(T15258), Gne-3- pLentiCRISPRv2(T 15259), Gne-4-pLentiCRISPRv2(T 15260) and Gne-5- pLentiCRISPRv2(T 15261), whose sequences are provided as SEQ ID Nos: 4 to 8 respectively, with the actual CRISPR sequences provided as SEQ ID Nos: 9 to 13.
- Example 3 Transient Expression: mAb with O-Link on Light chain
- a therapeutic antibody (Molecule #1) was engineered to have the optimal invented O-linked glycan recognition site (AAAPTPAPAAA) at the C-terminus of the light chain.
- a DNA vector expressing this glycan-engineered LC and the unmodified HC, was transiently transfected into CHO cells defective in de novo sialic acid synthesis, as set out below. The level of glycosylation and sialylation was then analyzed.
- CHO cells were grown at 37°C as a suspension in a perfusion bioreactor in a completely defined medium that allowed cell densities of up to 5xl0 7 cells/ml. Cells were centrifuged and then resuspended at 2xl0 7 cell/ml in fresh media in disposable shaking flasks. Expression vector DNA was added to the cells at 14.5 mg/L, immediately followed by polyethylenamine (PEI, 25k MW, linear) at 27 mg/L. The transfected culture was then temperature shifted for increased protein production in a 32°C incubator, 6% CO2, 160 RPM with a 50mm orbital. Nutrient feeding allowed a seven-day production, with average antibody titers of around lg/L.
- PEI polyethylenamine
- Recombinant stable CHO pools were generated by transfection of CHO cells with one or more DNA vectors containing transposon elements.
- a DNA vector expressing an appropriate transposase enzyme was co-transfected, eliciting recombination of the transposable DNA vector(s) with chromosomal DNA.
- CHO stable pools with one or more recombinant genes were grown in suspension at 37°C until they reached a cell density of 5X10 6 .
- the culture was centrifuged at 500Xg and resuspended at 2X10 7 cell/mL.
- the culture was immediately temperature shifted for increased protein production in a 32°C incubator, 6% CO2, 160 RPM with a 50mm orbital. Nutrient feeding allowed fourteen-day production, with average antibody titers of around 5 g/L.
- Figures 1 and 2 show the various O glycosyl chains resulting from O glycosylation, sialylation of the O-glycosyl sugar chain, and the incorporation of a click chemistry group.
- the results of the mass spectrometry showed the proportion of O-glycosylation sites O-glycosylated, (“occupancy”) as well as what proportion have been sialylated with azidosialic acid incorporated in the O glycosyl chain.
- the mass spectrometry results obtained showed that glycan occupancy was >99% with >95% azido-sialic acid. Without GNE knockout, cells incorporated natural sialic acid, reducing the content of azidosialic acid to ⁇ 90%.
- Figure 3 shows illustrative protein mass spectroscopy results for particular glycosylation sequences (without GNE knockout - 3(a), and with GNE knockout - 3(b)), with the peak of the antibody molecule with the O-glycosyl sugar chain with sialylation and a click chemistry group depicting the highest peak seen in each instance.
- the results obtained illustrated the usefulness of the GNE knockout generated and also the advantages of the glycosylation sequence provided to achieve high site occupancy.
- Example 4 Stable cell generation and protein expression of an IgGl mAb with O-Link on Light chain C-terminus
- a therapeutic IgGl monoclonal antibody (Molecule #1) was engineered to have the preferred O-linked glycan recognition sites (AAAPTPAPAAA) at the C-terminus of the light chain.
- AAAPTPAPAAA O-linked glycan recognition sites
- LC glycan engineered light chain
- HC unmodified heavy chain
- Ac4ManNAz peracetylated N-azidoacetylmannosamine
- DMSO dimethyl sulfoxide
- Ac4ManNAz was added daily at a rate of 20pM per integrated cell area (ICA) unit until a pre-determined limit was reached.
- the Ac4ManNAz was then added daily at that limit until the final day of the process.
- Ac4ManNAz addition limits were 200pM, 400pM, 600pM, and 800pM.
- Figure 5(a) Growth for cultures with an initial viable cell density of >10 x 10 6 /mL.
- Figure 5(b) Viabilities for cultures with an initial viable cell density of >10 x 10 6 /mL.
- Figure 6 Productivities of molecule #1 for cultures with an initial viable cell density of >10 x 10 6 /mL.
- Figure 7(a) Growth for cultures with an initial viable cell density of ⁇ 1 x 10 6 /mL.
- Figure 8 Productivities of molecule #1 for cultures with an initial viable cell density of ⁇ 1 x 10 6 /mL.
- Example 5 Stable cell generation and protein expression of an IgG4 mAb with O-Link on Light chain C-terminus
- a cell line for molecule #2 was generated in the same way as described in Example 4 for Molecule #1. Molecule #2 was then produced in a bulk culture. Fed-batch, shake flask cultures of lOOmL with a starting viable cell density (VCD) of ⁇ 10 x 10 6 /mL were grown under identical conditions as >10 x 10 6 /mL cultures for molecule #1.
- VCD viable cell density
- Figure 11 Growth for cultures with an initial viable cell density of ⁇ 10 x 10 6 /mL for molecule #2.
- Figure 12 Viabilities for cultures with an initial viable cell density of ⁇ 10 x 10 6 /mL for molecule #2.
- Figure 13 Productivities for cultures with an initial viable cell density of ⁇ 10 x 10 6 /mL for molecule #2.
- Figure 14 Product distribution for cultures with an initial viable cell density of ⁇ 10 x 10 6 /mL for molecule #2.
- Figure 15 CE-MS summaries for day 9 samples showing incorporation of azidosialic acid on to molecule #2 [0290] Since the Ac4ManNAz limits were reduced to lower levels for molecule #2, there was no toxicity observed on growth ( Figures 11 and 12). As with molecule #1, there was a detrimental impact on productivity at the 400 pM limit, but no impact at the lower limits ( Figure 13). When samples were analyzed by CE-MS, there was a dose response of azidosialic acid incorporation in relation to the addition limits ( Figures 14 and 15). The 400pM level was again at or near 100%, and 200pM was approximately 98% incorporation.
- Example 6 Transient mAb expression with mAb with O-Link on
- a therapeutic antibody Molecule #3, was engineered to have the optimal O-linked glycan recognition site (AAAPTPAPAAA) at the C-terminus of the light chain (LC) and the C-terminus of the heavy chain (HC). Transient expression of the antibody was studied.
- AAAPTPAPAAA O-linked glycan recognition site
- LC glycan engineered light chain
- HC glycan engineered heavy chain
- the antibodies were then used to demonstrate the ease with which the click chemistry groups could be used to conjugate a desired moiety to the antibody.
- the moiety chosen for conjugation to the antibodies was a siRNA and molecules listed in Table 5 were generated and assessed.
- Conjugation was performed in two different formats.
- siRNA was functionalized with clickable DBCO group.
- DBCO allowed direct conjugation of the siRNA duplex to antibody containing the azidosialic acid sugar either at the heavy chain or light chain.
- a DBCO- methyltetrazine bifunctional linker was used, where the linker was first conjugated to the antibody azidosialic acid site. Excess linker was removed by desalting the antibody into IX PBS pH7.2, followed by addition of siRNA duplex that was functionalized with TCO chemistry, to click onto the methyltetrazine of the linker.
- 4 to 1 molar equivalents of siRNA to antibody were used.
- Figure 16 illustrates the basic approach of how an antibody with the glycosylation sequence provided can be conjugated to siRNA through the sialylated O-glycosyl sugar chains present using click chemistry sugars either with or without a linker.
- Conjugation was monitored using analytical anion exchange chromatography.
- a ProPacTM SAX- 10 HPLC Column, lOum particle, 4mm diameter, 250mm length was utilized with the following method. Flowrate of 1 mL/min, Buffer A: 20mM TRIS pH 7.0, Buffer B: 20 mM TRIS pH 7.0 + 1.5M NaCl, at 30°C.
- the drug antibody ratio (DAR) was calculated based on peak area % from the analytical anion exchange (aAEX) chromatogram.
- An illustrative example of a chromatogram is shown in Figure 17.
- Antibody-siRNA conjugates were subjected to ex vivo plasma stability assessment to observe stability of the conjugate and any dissociation of the siRNA from the antibody.
- Antibody-siRNA conjugates were incubated in mouse and/or cynomolgus monkey plasma at 37°C at 0, 24 and 48 hours respectively with rotation at 5rpm.
- Antibody was immunoprecipitated from the plasma sample using biotinylated goat anti-human IgG. Solution was then incubated with streptavidin beads at room temperature with rotation for 30 minutes. Following multiple washing step with IX PBS, the sample was eluted with 1% formic acid with 20% acetonitrile elution buffer by mixing at 2000rpm for 15 seconds followed by 5- minute static benchtop hold. The eluted sample was then injected into LC-MS for analysis.
- Murine primary cortical neurons were isolated from wild type C57BL6 mouse embryos at El 8. Cells were plated in poly-D-lysine coated 96-well plates at a density of 40k cells/well and cultured in NbActivl (BrainBits, LLC) containing 1% Antibiotic/ Antimycotic (Corning) for 7 days at 37°C in a tissue culture incubator in a humidified chamber with 5% CO2.
- RT-qPCR was performed to quantify targeted mRNA levels using TaqMan Fast Advanced Cell-to-CT kit. Specifically, cells are lysed, cDNA was generated on Mastercycler X50a (Eppendorf), and qPCR is carried out on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). Gene expression levels of the therapeutic target were normalized by P-actin (ThermoFisher Mm02619580_gl) using respective probes.
- Results are provided Figure 26 and Table 6.
- Results provided in Table 6 demonstrate the exemplified mouse TfR binding protein-siRNA created via either eCys or glyco-mAb conjugation chemistry (e.g., mTfR2-dsRNA No. 8 conjugate) successfully targets mouse gene and provides an order of magnitude greater knockdown than Isotype Ab- siRNA.
- Table 6 Target gene knockdown potency of exemplified mTfR binding protein-siRNA conjugates.
- glyco-chemistry derived conjugation was combined with orthogonal chemistry such as lysine- or cysteine-based conjugation.
- Antibodies containing the azidosialic acid sugar were either engineered to have cysteine sites for site-selective conjugation or structural cysteine or lysine was utilized for secondary conjugation.
- cysteine conjugation the antibodies were first reduced with 20 molar equivalent reducing agent, followed by reoxidation with 10 molar equivalent dehydroascorbic acid (DHAA). That was followed by addition of DBCO-functionalized siRNAl and thiol -reactive siRNA2.
- Antibody-siRNA conjugates containing siRNAs to two targets were assessed for functional target knockdown activity in cultured cells.
- An ovary cystadenocarcinoma derived EFO-21 cell line was used as exemplary cell line to generate the knockdown data.
- EFO-21 are seeded at 10,000 per well into 96-well plates and treated with siRNAs to generate concentration response curve(CRC).
- CRC concentration response curve
- cell lysates were prepared for Cell to CT qPCR to examine target gene expression and assess efficacy of siRNAs for knockdown of target gene and compare CRC potency between lipid conjugated siRNA and antibody conjugated siRNA.
- Cell to CT kit was used to generate the mRNA expression data.
- Example of the results for target knockdown using antibody-siRNA conjugates are provided in Figures 23(a and b), 24 (a and b), and 25 (a and b).
- Example 8 Use of O-glycosylated antibody conjugated to siRNA for in vivo gene knock-down
- an antibody-siRNA conjugate of the invention to inhibit expression of a target gene in vivo was studied.
- An antibody specific for mouse Transferrin Receptor (TfR) was modified to include an O-glycosylation sequence of the present invention at the C-terminus of the light chains of the antibody.
- the O- glycosylation of the sequence allowed the introduction of a DBCO (dibenzocyclooctyne) linker which was used to generate a conjugate of the antibody and a siRNA specific for a chosen target gene expressed in the brain.
- DBCO dibenzocyclooctyne
- the O-glycosylation included an azide group on the terminal sialic acid, allowing for conjugation to the DBCO group of the functionalized siRNA.
- the antibodysiRNA conjugate (ARC-181) generated therefore includes an antibody specific for TfR to allow the conjugate to cross the blood brain barrier (BBB) and the siRNA then to reduce expression of the target gene in the CNS.
- a control conjugate, ARC-180, was also generated in the same way differing only in that the antibody used in the conjugate was an isotype control recognizing a different target to TfR meaning that the control should not be transported across the BBB via the TfR. Table 5 provides further details of the ARC-180 and ARC-181 conjugate preparations subsequently used in the study in mice.
- mice TfR binding protein (mTBP)-siRNA conjugates (ARC) utilizing glycoconjugate technology crosses the blood-brain- barrier (BBB) and delivers the siRNA cargo to the CNS to reduce target mRNA gene expression
- BBB blood-brain- barrier
- mice PBS control, Isotype Ab-siRNA conjugate, or mTBP2-siRNA were dosed in 8-week- old FVB mice at 10 mg/kg effective siRNA concentration intravenously as a single dose and sacrificed after 14, 28 and 70 days respectively (see Figure 26)
- mouse anti-CD4 antibody GK1.5 was dosed at 10 mg/kg 2 to 3 days prior to the study to ablate CD4 positive T cells to mitigate undesired pharmacokinetic consequences resulting from spurious anti-drug antibody responses to injected compounds.
- RNA quantity with A260/280 ratio with a spectrophotometer was generated on Mastercycler X50a (Eppendorf), and qPCR was carried out on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). Gene expression levels of the target gene were normalized by P-actin using respective probes (ThermoFisher).
- Example 9 Use of the conjugation method provided to generate multi-functional antibodies and combinatorial libraries
- Figure 27 illustrates how the conjugation method provided can be used to generate multi-functional binding molecules, such as multi-functional antibodies, as well as combinatorial libraries.
- the conjugation groups introduced as part of the O-glycosyl sugar chains are highly versatile and can be used to join any two molecules desired.
- the approach may also be used to generate different permutations of panels of molecules so the combination can be assessed for desired properties, such as synergy, or the ability to bind more than one desired epitope.
- a further linker was prepared and used in generating a conjugate in conjunction with glycosylation sequence of the present invention.
- NMP N-methylpyrrolidone
- a vial of 2 mg DBCO-PEG5-NHS was dissolved in 100 pL of NMP and then transferred to a new vial of DBCO-PEG5-NHS with mixing to dissolve. Once dissolved the contents of the vial were transferred to a peptide vial and 1 pL of DIEA added. The contents of the vial were mixed and the vial incubated at room temperature. [0340] 0.5 pL of the contents of the vial were diluted 1 :500. 20 pL of the dilution were placed in an Agilent micro vial and a CE/MS analysis performed to verify the completeness of the reaction. The linked obtained is shown in Figure 28(c).
- the peptide was purified by preparatory HPLC on a Shimadzu LC system (system controller CBM-20A; pump model LC-20AP; oven model CTO-20A; detector SPD-20A; fraction collector FRC-10A):
- Fab 0.5 pmol Fab was placed into a 50 mL tube and 1.37 mmol of DBCO linker peptide added. The tube was then mixed by several inversions and placed at 4°C for a weekend. CE/MS was used to assess the extent of reaction, indicating -75% conversion. The material was concentrated with a Millipore Ultracell-15 30kDa MWCO filter 50 mL tube style, then washed three times with PBS buffer. A Final recovery of 12.6 mg was expected, with about 80% conjugation obtained.
- SEQ ID NO: 1 provides the sequence of a preferred glycosylation amino acid sequence of the present invention, PTPAP.
- SEQ ID NO: 2 provides the sequence of a further preferred glycosylation amino acid sequence of the present invention, AAAPTPAPAAA.
- SEQ ID NO: 3 provides the sequence of a glycosylation test amino acid sequence employed in the Examples of the present application, AAATPAP.
- SEQ ID NO: 4 provides the sequence of a further glycosylation test amino acid sequence employed in the Examples of the present application, PTPSP.
- SEQ ID NO: 5 provides the sequence of a further glycosylation test amino acid sequence employed in the Examples of the present application, DTPPP.
- SEQ ID NO: 6 provides the sequence of the gene encoding bifunctional UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (also known as UDP-GlcNAc-2-epimerase/ManAc kinase, GNE), ATGGAGAAGAATGGGAATAACCGAAAGCTTCGGGTTTGCGTTGCTACC TGCAACCGTGCAGATTACTCCAAATTGGCCCCGATCATGTTCGGCATT AAGACAGAGCCTGCCTTCTTTGAGCTGGATGTGGTGGTGCTGGGCTCT CACCTCATAGATGACTACGGAAACACATATCGAATGATTGAGCAAGAT GACTTTGACATTAACACCAGGCTACACACGATCGTTAGAGGGGAAGAT GAAGCAGCCATGGTAGAGTCAGTAGGCCTAGCTCTAGTGAAGCTACCA GATGTCCTTAATCGCCTGAAGCCTGACATCATGATTGTTCATGGAGAC CGATTTGATGCCCTT
- SEQ ID NO: 7 provides the sequence of the hamster Gne-1- pLentiCRISPRv2(T 15257), ATGGGAATAACCGAAAGCTT.
- SEQ ID NO: 8 provides the sequence of the hamster Gne-2- pLentiCRISPRv2(T 15258), CCGTGCAGATTACTCCAAAT.
- SEQ ID NO: 9 provides the sequence of the hamster Gne-3- pLentiCRISPRv2(T 15259), CCAATTTGGAGTAATCTGCA.
- SEQ ID NO: 10 provides the sequence of the hamster Gne-4- pLentiCRISPRv2(T 15260), CTTAATGCCGAACATGATCG.
- SEQ ID NO: 11 provides the sequence of the hamster Gne-5- pLentiCRISPRv2(T 15261), AC ATCC AGCTC AA AGAAGGC .
- SEQ ID NO: 12 provides the amino acid sequence of the linker
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363485053P | 2023-02-15 | 2023-02-15 | |
| PCT/US2024/015430 WO2024173266A1 (en) | 2023-02-15 | 2024-02-12 | Glycosylated polypeptides |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4665754A1 true EP4665754A1 (en) | 2025-12-24 |
Family
ID=90368472
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24713153.5A Pending EP4665754A1 (en) | 2023-02-15 | 2024-02-12 | Glycosylated polypeptides |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP4665754A1 (en) |
| JP (1) | JP2026506046A (en) |
| CN (1) | CN121057743A (en) |
| TW (1) | TW202448924A (en) |
| WO (1) | WO2024173266A1 (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012012612A2 (en) | 2010-07-23 | 2012-01-26 | University Of Delaware | Tetrazine-trans-cyclooctene ligation for the rapid construction of radionuclide labeled probes |
| WO2015073746A2 (en) | 2013-11-13 | 2015-05-21 | Whitehead Institute For Biomedical Research | 18f labeling of proteins using sortases |
| EP3638699A1 (en) | 2017-06-16 | 2020-04-22 | Eli Lilly and Company | Engineered antibody compounds and conjugates thereof |
| CA3075446A1 (en) * | 2017-09-14 | 2019-03-21 | Vib Vzw | Means and methods for the production of glycoproteins comprising homogeneous galactosylated carbohydrates |
-
2024
- 2024-02-12 EP EP24713153.5A patent/EP4665754A1/en active Pending
- 2024-02-12 CN CN202480025369.XA patent/CN121057743A/en active Pending
- 2024-02-12 JP JP2025546879A patent/JP2026506046A/en active Pending
- 2024-02-12 WO PCT/US2024/015430 patent/WO2024173266A1/en not_active Ceased
- 2024-02-15 TW TW113105365A patent/TW202448924A/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| CN121057743A (en) | 2025-12-02 |
| WO2024173266A1 (en) | 2024-08-22 |
| TW202448924A (en) | 2024-12-16 |
| JP2026506046A (en) | 2026-02-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210309760A1 (en) | Engineered Immunoglobulin Heavy Chain-Light Chain Pairs and Uses Thereof | |
| CN105228645B (en) | Site-specific antibody-drug conjugation via glycoengineering | |
| AU2024202649A1 (en) | Modified antigen binding polypeptide constructs and uses thereof | |
| JP2025032078A (en) | Claudin 18 antibodies and methods of treating cancer | |
| CN119161491A (en) | Bispecific recombinant proteins and their applications | |
| WO2021008463A1 (en) | Cldn18.2 antibody and use thereof | |
| TW201139666A (en) | Novel antibody having modification site introduced therein, and antibody fragment | |
| JP7849340B2 (en) | Antiglyco-MUC1 antibody and its use | |
| WO2012153126A1 (en) | Therapeutic canine immunoglobulins and methods of using the same | |
| EP4174092A1 (en) | Multispecific binding protein of immune cell engager, preparation therefor and application thereof | |
| US20170158755A1 (en) | Anti-laminin4 antibodies specific for lg1-3 | |
| CN121758618A (en) | PD1 and VEGFR2 dual binding agents | |
| US20250195685A1 (en) | Humanized anti-cd8 antibodies and uses thereof | |
| CN113444180B (en) | Antibody targeting AXL protein, antigen binding fragment thereof, preparation method and application thereof | |
| EP4059963A1 (en) | Molecule capable of binding to human 4-1bb, and application of molecule | |
| WO2024173266A1 (en) | Glycosylated polypeptides | |
| CN119060184A (en) | Anti-RAGE antibodies and their applications | |
| CN118221826A (en) | A bispecific antibody that binds human CD33 and CD3 | |
| EP4406970A1 (en) | Monoclonal antibody targeting tigit | |
| JP2024546106A5 (en) | ||
| CN114163528A (en) | CD47 binding molecules and uses thereof | |
| EP4733319A1 (en) | Therapeutic molecules | |
| TWI919340B (en) | Antibodies and their applications | |
| CN114920842B (en) | Antibodies or antigen binding fragments thereof that specifically bind to PV-1 protein and uses thereof | |
| JP2026501783A (en) | SMAGP fusion molecules and methods of use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250915 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| P01 | Opt-out of the competence of the unified patent court (upc) registered |
Free format text: CASE NUMBER: UPC_APP_0001240_4665754/2026 Effective date: 20260114 |