EP4665337A1 - Prmt5 inhibitor for use in cancer therapy - Google Patents

Prmt5 inhibitor for use in cancer therapy

Info

Publication number
EP4665337A1
EP4665337A1 EP24705395.2A EP24705395A EP4665337A1 EP 4665337 A1 EP4665337 A1 EP 4665337A1 EP 24705395 A EP24705395 A EP 24705395A EP 4665337 A1 EP4665337 A1 EP 4665337A1
Authority
EP
European Patent Office
Prior art keywords
cancer
caap1
prmt5 inhibitor
inhibitor
prmt5
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24705395.2A
Other languages
German (de)
French (fr)
Inventor
James Thomas LYNCH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AstraZeneca AB
Original Assignee
AstraZeneca AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by AstraZeneca AB filed Critical AstraZeneca AB
Priority claimed from PCT/EP2024/053460 external-priority patent/WO2024170488A1/en
Publication of EP4665337A1 publication Critical patent/EP4665337A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/10Spiro-condensed systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50Pyridazines; Hydrogenated pyridazines
    • A61K31/502Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with carbocyclic ring systems, e.g. cinnoline, phthalazine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • BACKGROUND Protein arginine methyltransferase 5 is a member of the PRMT family of arginine 15 methyltransferase enzymes that catalyse the addition of methyl groups to the guanidine motif of arginine residues, using S-adenosyl-L-methionine (SAM) as methyl donor.
  • SAM S-adenosyl-L-methionine
  • PRMT5 is a type II arginine methyltransferase that symmetrically dimethylates the guanidine group of arginine residues thus converting a guanidine NH2 group of arginine to a NMe2 group.
  • PRMT5 methylates a number of diverse substrates including histone and non-histone proteins, and in so doing 20 regulates processes such as RNA splicing, DNA repair and cellular proliferation.
  • PRMT5 is overexpressed in various cancer types and has been identified as a candidate for therapeutic intervention through the development of small molecules that inhibit PRMT5 methyltransferase activity (see e.g. Kim et al., (2020) Cell Stress 4(8) 199-2151).
  • a number of first generation (non-MTA selective) PRMT5 inhibitors have entered clinical trial 25 including Johnson & Johnson’s onametostat (JNJ-64619178), GSK’s pemrametostat (GSK3326595, EPZ015938), Pfizer’s PF-06939999, and Prelude Therapeutics’ PRT811 and PRT543.
  • Cyclin dependent kinase inhibitor 2A (CDKN2A) is a tumour suppressor gene that is homozygously deleted in approximately 15% of cancers.
  • Loss of the 9p21 chromosome locus 30 results in the co-deletion of additional genes including the gene MTAP encoding methylthioadenosine phosphorylase (MTAP).
  • MTAP is a metabolic enzyme involved in methionine salvage.
  • Loss of MTAP results in increased concentrations of the MTAP substrate methylthioadenosine (MTA) in CDKN2A/MTAP deleted cancer cells.
  • MTA methylthioadenosine
  • Compromised PRMT5 activity renders CDKN2A/MTAP deleted cancer cells susceptible to further targeting of PRMT5, for example using short hairpin RNA (shRNA).
  • short hairpin RNA shRNA
  • a “collateral vulnerability” in cancer, where CDKN2A/MTAP deleted tumours may be selectively targeted through PRMT5 inhibition, has been identified (see Marjon et al., (2016) Cell Reports 15, 574-587; Mavrakis et al., (2016) Science 11;351(6278):1208-13; 5 Kryukov et al., (2016) Science 11;351(6278):1214-8).
  • MTA-synergistic PRMT5 inhibitors i.e.
  • PRMT5 inhibitors that bind to PRMT5 preferentially in the presence of MTA, have emerged (see e.g. WO2022026892A1, WO2022115377 and WO2021163344). These MTA-synergistic PRMT5 inhibitors are designed to exploit the “collateral vulnerability” arising from CDKN2A/MTAP gene deletion described in the10 literature.
  • MTA-synergistic PRMT5 inhibitors have entered clinical trials, such as MRTX- 1719 (NCT05245500); TNG-908 (NCT05275478); TNG-462 (NCT05732831); AMG-193 (NCT05094336, NCT05094336); and AZD3470 (NCT06130553; NCT06137144).
  • MTA-synergistic PRMT5 inhibitors exert a greater inhibitory effect on PRMT5, in environments where relatively high concentrations of MTA are present, such as that found in 15 CDKN2A/MTAP deleted tumour cells, but not in healthy tissues where elevated concentrations of MTA are not present and where inhibition of PRMT5 would otherwise result in toxic side effects.
  • MTA-synergistic PRMT5 inhibitors should possess a high therapeutic index, with greatly reduced on-target toxicity in healthy cells relative to first generation PRMT5 inhibitors, as their anti-proliferative activity will selectively manifest in the targeted, MTA rich, environment of 20 CDKN2A/MTAP deleted tumour cells.
  • novel biomarkers that will allow the stratification of patients with tumours that are sensitive to PRMT5 inhibitors, enabling precision anti-cancer treatment and improved therapeutic efficacy and clinical outcomes.
  • Reference to tumours herein and above will be understood to be references to malignant tumours 25 (i.e. cancers) that require therapeutic intervention.
  • reference to cancers herein and above encompass solid and haematological cancers.
  • CAAP1-null tumours or cancers refers to cells in which the CAAP1 gene has been homozygously deleted and in which the CAAP1 gene is not present, and therefore the tumour cells do not express any CAAP1 protein.
  • MTAP-null tumours or cancers refers to those tumours or cancers in which the MTAP gene has been homozygously deleted and in which the MTAP gene is not present, and therefore the tumour cells do not express any MTAP protein.
  • the specification provides a PRMT5 inhibitor for use in the treatment 35 of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient.
  • the specification provides a method for identifying a cancer patient having a cancer that is sensitive to treatment with a PRMT5 inhibitor, comprising the step(s) of: i. detecting the presence or absence of CAAP1 protein in a sample obtained from the patient, and/or 5 ii. determining that the cancer is CAAP1-null, by analysing a sample obtained from the patient, wherein if the detection of step i) reveals there is no, or significantly reduced, CAAP1 protein present in the sample; and/or if the determination of step ii) reveals that the cancer is CAAP1- null; then the patient is identified as having a tumour that is sensitive treatment with a PRMT5 10 inhibitor.
  • a third aspect of the specification is directed to an in vitro diagnostic test for detecting CAAP1 protein in a tumour sample obtained from a cancer patient or for establishing the CAAP1-null status of a tumour from a sample obtained from a cancer patient.
  • a fourth aspect of the specification is directed to the use of CAAP1 protein or the polynucleotide 15 encoding the CAAP1 gene as a biomarker for identifying a cancer that will be sensitive to treatment with a PRMT5 inhibitor.
  • a fifth aspect of the specification provides a method of treatment of cancer, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s tumour has been characterised as being CAAP1-deficient or the patient’s 20 cancer has been characterised as being CAAP1-null.
  • the specification provides a method of treatment of cancer, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient has a cancer that has been determined to be CAAP1-deficient or CAAP1-null.
  • a sixth aspect of the specification provides a method of treating a cancer patient comprising the 25 steps of: i. obtaining a biological sample from the patient; ii.
  • a seventh aspect of the specification is directed to the use of a PRMT5 inhibitor for the manufacture of a medicament for the treatment of cancer, wherein the medicament is for use in the treatment of cancers that have been identified as being CAAP1-null or CAAP1-deficient.
  • An eighth aspect of the specification provides a pharmaceutical composition comprising a PRMT5 5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient.
  • a ninth aspect of the specification provides a MAT2A inhibitor for use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient.
  • a tenth aspect of the specification provides a kit comprising a PRMT5 inhibitor or a MAT2A 10 inhibitor and instructions for their use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient.
  • DESCRIPTION OF THE FIGURES Figure 1 is a bar graph showing the efficiency of Caspase 9 (Cas9) activity in NCI-H838, LU99, SW1573, HCC-15, NCI-H1650 and NCI-H2126 human lung cancer cell lines transduced with a 15 Caspase 9 lentivirus.
  • Figure 2 is a bar chart demonstrating the percentage of BFP-positive (BFP+) cells following transduction with a genome-wide gRNA lentiviral library, with vectors including BFP. Puromycin (Puro) was used to select for transduced cells. By 8 days post-transduction over 50% of puromycin treated cell populations express BFP in all cell lines tested.
  • Figure 3 is a heatmap highlighting PRMT5 inhibitor sensitizer hits, following a CRISPR/Cas9 genome-wide screen. Black boxes indicate a significant difference in sgRNA count between cell populations treated with PRMT5 inhibitor 1 and untreated controls. PRMT5 inhibition correlates with significantly lower CAAP1 sgRNA counts in NCI-H838, HCC-15 and NCI-H2126 cell populations.
  • Figure 4 is a collection of violin plots showing the normalised CAAP1 sgRNA counts at baseline and following treatment with either vehicle (DMSO) or PRMT5 inhibitor 1 in A) NCI-H838, B) LU99, C) SW1573, D) HCC-15, E) NCI-H1650 and F) NCI-H2126 cell cultures.
  • Figures 4A, 4D and 4F show significantly (indicated by *) lower CAAP1 sgRNA counts in PRMT5 inhibitor treated NCI-H838, HCC-15 and NCI-H2126 cells, respectively, when compared to sgRNA counts in 30 vehicle (DMSO) treated cultures.
  • Figure 5 is a series of line graphs showing the time taken for A) NCI-H383, B) LU99, C) SW1573, D) HCC-15, E) NCI-H1650, F) NCI-H2126 cell cultures, to reach 10 doublings when treated with (X) or without (•) PRMT5 inhibitor 1. No cultures administered with PRMT5 inhibitor 1 reached 10 doublings within 14-34 days of treatment.
  • Figure 6 is a representation of Western Blot results showing the levels of CAAP1 protein in HCC15 and NCI-H838 cell lines upon CRISPR-Cas9 genetic modification using gRNAs against non targeting control (NTC) and against CAAP1 (KO). Actin was used as a loading control.
  • Figure 7 is a series of line graphs showing cellular confluency of NTC and CAAP1 KO cells upon 5 treatment with DMSO ( ⁇ , ⁇ ), 0.1 ⁇ M ( , ), 0.3 ⁇ M PRMT5 inhibitor 2 ( ⁇ , ⁇ ) and 1 ⁇ M PRMT5 inhibitor 2 ( ⁇ , ⁇ ) respectively.
  • Figure 7A represents confluency of HCC15 cell lines and Figure 7B confluency of NCI-H838 cell lines.
  • Figure 8 is a series of bar charts representing A) percentage of apoptotic cells (mean of 3 experiments , error bars represent SEM), measured by AnexinV assay, and B) total cell counts 10 (mean of three experiments, error bars represent SEM) upon treatment of HCC15 NTC (solid bars) and HCC15 CAAP1 KO (dashed bars) cells with DMSO and indicated doses of PRMT5 inhibitor 2.
  • Figure 9 is a series of line graphs showing cellular confluency of HCC15 NTC and HCC15 CAAP1 KO cells upon treatment with DMSO ( ⁇ , ⁇ ), 0.1 ⁇ M ( , ), 0.3 ⁇ M ( ⁇ , ⁇ ) and 1 ⁇ M ( ⁇ , ⁇ )
  • Figure 10 is a waterfall plot showing tumour growth, stasis or regression following the treatment of PDX (patient derived xenograft models) obtained from human lung (LU), gastric (GA, STO), oesophageal (ES), head and neck (HN), pancreatic (PA) and bladder (BL) tumour tissue.
  • PDX patient derived xenograft models
  • Figure 11 is a waterfall plot showing the growth of CAAP1 null human cancer tissue, transplanted into mice (PDX), after treatment with PRMT5 inhibitor 2.
  • Tumour volume is relative to tumour 30 growth in vehicle treated control mice or the initial grafted tumour volume (where 100% represents lack of tumour growth inhibition and negative values represents regression).
  • 14/26 PDX models show regression in response to PRMT5 inhibitor 2 treatment
  • the remaining 12 tumour graft show an extent of tumour growth inhibition after treatment with PRMT5 inhibitor 2 with 6 models in which this treatment is inducing stasis in response to PRMT5 inhibitor 2 treatment.
  • 35 Figure 12 is a series of line graphs demonstrating mean relative tumour volume ( ⁇ SEM) of human CAAP1 null PDX models in vehicle treated control ( ⁇ ) and PRMT5 inhibitor 2 ( ⁇ ) treated mice.
  • Figures 12A-C, Figures 12D/E and Figure 12F represent the growth of tumours derived from lung (LU), oesophageal (ES) and gastric (GA) cancers, respectively.5/6 PDX models show regression in response to PRMT5 inhibitor 2 treatment, as shown in Figures 12B-F.
  • Figure 12A shows the stasis of tumour LU5165 in response to PRMT5 inhibitor 2 treatment. All vehicle treated 5 control animals show tumour growth.
  • Figure 13 is a series of line graphs demonstrating mean relative tumour volume ( ⁇ SEM) of human CAAP1 null PDX models in vehicle treated control ( ⁇ ) and PRMT5 inhibitor 2 ( ⁇ ) treated mice.
  • Figures 13A-B, and Figure 13C represent the growth of tumours derived from lung (LU) and oesophageal (ES) cancers, respectively.
  • Figure 13A-B show the duration of regression upon 10 PRMT5 inhibitor 2 treatment cessation.
  • Figure 13C shows the response of the PDX model upon re-challenging with PRMT5 inhibitor 2. All vehicle treated control animals show tumour growth. Grey shaded area represents treatment duration.
  • Figure 14 is a series of line graphs demonstrating mean relative tumour volume ( ⁇ SEM) of human CAAP1 null PDX models.
  • Figures 14A and 14B represent the growth of tumours derived 15 from lung (LU) and oesophageal (ES) cancers, respectively, in vehicle treated control ( ) and AG-270 (a MAT2A inhibitor) treated mice ( ), as described in Kalev et al., 2021, Cancer Cell, 39, 209-224.
  • Figures 14C and 14D represent the growth of tumours derived from the same lung (LU) and oesophageal (ES) cancers, respectively, in vehicle controlled ( ) and PRMT5 inhibitor 2 ( ) treated mice. Both PDX models show regression following either PRMT5 inhibitor 20 2 treatment or MAT2A treatment, as shown in Figures 14A-D.
  • Figure 15 is a line graph representing mean tumour volume ( ⁇ SEM) of GA2254 CAAP1 null PDX model in a vehicle treated control ( ), mice treated with 100mg/kg BID of GSK3326595 ( ), 10mg/kg BID GSK3326595 ( ), 1mg/kg BID GSK3326595 ( ), 50mg/kg BID PRMT5 inhibitor 1 BID inhibitor 1 ( ), 1mg/kg BID PRMT5 inhibitor 1 ( ) and 10mg/kg 25 .
  • the top dose of all three compounds induce tumour regression.
  • N 10 mice per treatment arm.
  • Figure 16 is a series of line graphs demonstrating tumour volume of vehicle ) and MRTX-1719 treated ( ) PDX models (PA0372, LU6408 and GA2254).
  • Figure 17 shows the proximity of MTAP, CDKN2a and CAAP1 on chromosome 9.
  • CAAP1-null tumours those tumours in which the CAAP1 gene is not present (i.e. where there is a homozygous loss/deletion of CAAP1-gene), or CAAP1-deficient tumours, those tumours in which CAAP1 protein is significantly reduced or is absent, are sensitive to treatment with a PRMT5 inhibitor.
  • CAAP1-deficient Absence or significant reduction of functional CAAP1 protein may result from a deletion of the CAAP1 gene, a loss of function-related alteration in the CAAP1 gene, or in its regulatory or promoter sequences, or through epigenetic silencing of the CAAP1 gene. Tumours in which CAAP1 protein is absent or significantly reduced can be termed CAAP1-deficient.
  • CAAP1-deletion and 5 CAAP1-null herein collectively or individually relate to those tumours sensitised to PRMT5 inhibition as a result of the homozygous deletion of CAAP1, whilst references to CAAP1-deficient or CAAP1-deficiency herein relate to tumours that are characterised by having significantly reduced expression or absence of CAAP1-protein in the tumour. It is therefore an object of the present specification to utilise CAAP1 protein or CAAP1 gene status as a novel biomarker, to 10 allow for the stratification of cancer patients having tumours that are sensitive to PRMT5 inhibitors, enabling precision anti-cancer treatment, improved therapeutic efficacy and clinical outcomes.
  • the present specification provides new approaches for treating cancer that exploit this hitherto unrealised sensitisation of CAAP1-deficient tumours to PRMT5 inhibitor treatment.
  • monotherapy with PRMT5 inhibitors has been identified as a potentially effective 15 option for the treatment of CAAP1-null tumours.
  • a monotherapy approach i.e. treatment of a cancer with a PRMT5 inhibitor in the absence of any other anti-cancer drugs, can be beneficial for patients as it decreases the risk of harmful side-effects of multiple cancer therapies, the complications of potential drug-drug interactions, avoids the need to multiple drugs to be administered including administration on different dosing schedules and is more cost-effective for 20 healthcare providers.
  • patient and “subject” are used interchangeably herein and refer to any animal (e.g. mammal), including, but not limited to, humans, non-human primates, canines, felines, rodents and the like.
  • patient is used herein in reference to a human subject, and in 25 particular, a subject who has been diagnosed as having a cancer.
  • cancer and “cancerous” refer to or describe the physiological condition in mammals in which a population of cells are characterised by unregulated cell growth and tumour formation. As noted above, the term “cancer” encompasses solid and haematological cancers.
  • cancer cell refers to the total population of cells derived from a tumour or a pre-cancerous lesion.
  • treat refers to an action that reduces the severity of a disease, disorder or condition, or slows the progression of the disease, disorder or condition.
  • sample or “biological sample” can refer to tumour tissue or tumour cells obtained from biopsy, blood or blood components (e.g. plasma), and circulating tumour DNA (ctDNA) isolated from blood or blood components.
  • PRMT5 refers to the gene or protein known as Protein Arginine Methyltransferase 5, also known as HRMT1L5; IBP72; JBP1; SKB1; or SKB1Hs External IDs: OMIM: 604045, MGI: 1351645, HomoloGene: 4454, ChEMBL: 1795116, GeneCards: PRMT5 10 Gene; EC number 2.1.1.125.
  • PRMT5 inhibitor refers to any compound capable of inhibiting the production, level, activity, expression or presence of PRMT5. These include, as non-limiting examples, any compound inhibiting the transcription of the gene, inhibiting the maturation of RNA, inhibiting the 15 translation of mRNA, inhibiting the posttranslational modification of the protein, inhibiting the enzymatic activity of the protein, or inhibiting the interaction of same with a substrate, etc.
  • the term also refers to any agent that inhibits the cellular function of the PRMT5 protein, either by ATP-competitive inhibition of the active site, allosteric modulation of the protein structure, disruption of protein-protein interactions, or by inhibiting the transcription, translation, post- 20 translational modification, or stability of PRMT5 protein.
  • the PRMT5 inhibitor may, or may not, compete with another compound, protein or other molecule which interacts with PRMT5 and is necessary for PRMT5 function.
  • a PRMT5 inhibitor may compete with the co-factor S-adenosylmethionine (also known as SAM or AdoMet).
  • a PRMT5 inhibitor is uncompetitive with 25 methylthioadenosine (MTA).
  • the PRMT5 inhibitor is uncompetitive with MTA and competitive with SAM. In some embodiments, the PRMT5 inhibitor is uncompetitive with MTA and uncompetitive with SAM but binds with a higher degree of potency for the MTA complex relative to the SAM complex. In some embodiments, the PRMT5 inhibitor’s potency as an inhibitor of PRMT5 is enhanced when the inhibitor binds to PRMT5 in conjunction with MTA.
  • the inhibitory activity of the PRMT5 inhibitor when it is bound to PRMT5 in conjunction with MTA is 10-fold greater, for example 20-fold greater, 30-fold greater or more, than that observed when the PRMT5 inhibitor binds to PRMT5 without MTA, such PRMT5 inhibitors are referred to as MTA-synergistic inhibitors herein.
  • the inhibitory activity of the PRMT5 inhibitor can be measured 35 using the MTase-Glo enzymatic assay protocol, which is described below, and also in WO2020205660 (incorporated herein by reference).
  • Mtase-Glo enzymatic assay protocol Inhibitor compounds are serial diluted by 5-fold to the desired concentrations in DMSO. Inhibitors 5 are added into reaction buffer (30 mM Tris-HCl at pH 7.4, 500 mM NaCl, 2 mM MgC12, 2 mM TCEP, 0.1% (wt/vol) BSA and 0.01% (vol/vol) Tween-20) with final DMSO concentration at 2% (vol/vol).
  • the enzymatic inhibition assay is performed in a solid white low-volume 384-well plate (Greiner, #7784075) with total reaction volume of 16 pi and in the presence of 100 nM PRMT5:MEP50 enzymes, 10 mM SAM (Sigma- Aldrich, A4377), 2 mM substrate histone H4 (1- 10 21) (ANASPEC, #AS-62499) and test compounds at indicated concentrations. Reactions without enzyme are conducted as negative control and reactions without compound are performed as positive control in every experiment. Methyltransferase reaction was started by adding 4 uL of SAM/H4 substrate mixture to each well that contains 8 uL enzyme and 4 uL test compound which are pre-mixed and incubated for 10 min.
  • the reaction is performed at room temperature for 60 15 min followed by the addition of 4 uL 5X Mtase-Glo Reagent to produce SAH and concomitantly convert it to ADP. Mix the plate by shaking for 2 min, and incubate at room temperature for 30 min. Then, 20 uL room-temperature Mtase-Glo Detection Solution is added and mixed well before incubating for another 30 min and recording luminescence. Luminescence can be measured using the Synergy Neo2 HTS multimode microplate reader (BioTek).
  • PRMT5 inhibitors were non-MTA selective and their clinical utility was impaired due to their limited therapeutic window resulting from the adverse events observed in patients in clinical trials believed to result from on-target activity (i.e. PRMT5 inhibition) in healthy tissue.
  • PRMT5 inhibition on-target activity
  • the present specification provides a means of using these 1 st generation drugs in a more targeted way, by using them to treat tumours that have been specifically characterised 25 as being sensitive to PRMT5 inhibitors, thereby increasing the chance of successful treatment outcomes and decreasing the risk of adverse effects.
  • Examples of so-called 1 st generation PRMT5 inhibitors include, but are not limited to, onametostat JNJ-64619178); pemrametostat (GSK3326595, EPZ015938); PF-06939999; PRT811; PRT543; and GSK2303591 (EPZ015866).
  • Onametostat also known as JNJ-64619178
  • Pemrametostat also known as GSK3326595 or EPZ015938
  • PF-06939999 is the codename for the compound with the following structure: 5 .
  • GSK2303591 (also known as EPZ015866) is the codename for the compound with the following structure: .
  • the second generation of PRMT5 inhibitor drugs are MTA-synergistic inhibitors, which bind to 10 PRMT5 preferentially in the presence of MTA. These MTA-synergistic PRMT5 inhibitors are designed to exploit the “collateral vulnerability” arising from CDKN2A/MTAP gene deletion, as described above. Examples of so-called 2 nd generation PRMT5 inhibitors include, but are not limited to, PRMT5 inhibitor 1, PRMT5 inhibitor 2 and compounds disclosed in WO2022026892, WO2022115377 and 15 WO2021163344 (the content of these patent publications is incorporated by reference herein).
  • 2 nd generation PRMT5 inhibitors include, but are not limited to CN202310191381, WO2021086879, WO2021050915, WO2022192745, WO2023278564, WO2022132914, WO2022169948, WO2023081367, WO2023098439, WO2023098439, WO2023143210, WO2023125540, WO2023174250 and WO2023207556 (the content of these 20 patent publications is incorporated by reference herein).
  • the PRMT5 inhibitor is selected from a PRMT5 inhibitor disclosed in CN202310191381, WO2021086879, WO2021050915, WO2022192745, WO2023278564, WO2022132914, WO2022169948, WO2023081367, WO2023098439, WO2023098439, WO2023143210, WO2023125540, WO2023174250 or WO2023207556.
  • the PRMT5 inhibitor is selected from the following: onametostat JNJ-64619178); pemrametostat (GSK3326595, EPZ015938); PF-06939999; PRT811; PRT543; GSK2303591 (EPZ015866); PRMT5 inhibitor 1; PRMT5 inhibitor 2; or any of the PRMT5 inhibitors disclosed in WO2022026892, WO2022115377 and WO2021163344 (the content of these patent publications is incorporated by reference herein).
  • the PRMT5 inhibitor is a PRMT5 inhibitor as disclosed in WO2023/036974 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is a compound of formula (I): wherein: the ring containing X and Y is a pyrrole and X is NH and Y is CH or X is CH and Y is NH; Z is selected from CH, CF, CCl or, if Q is not N, N; Q is selected from CH, CF, CCl or, if Z is not N, N; m is 0, 1 or 2; n is 0, 1 or 2; p is 1 or 2; R 1 is in each occurrence independently selected from F, Cl, CN, Me, CF 3 , C 1 -C 3 alkyl, cyclopropyl, C 1 -C 3 fluoroalkyl, OMe or C 1 -C 3 alkoxy; R 2 is in each occurrence independently selected from F, Cl, Me, MeO and CF 3 ; R 3 is H, Me, C 1 -C 3 alkyl or C 1 -C 3 fluoroalkyl; R 4
  • the PRMT5 inhibitor is a compound of formula (I). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I). In embodiments, the PRMT5 inhibitor is selected from the group consisting of: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-
  • PRMT5 inhibitor 1 has the following structure and is described as Example 1 in PCT/EP2022/075248, filed 12 September 2022 and published as International Publication 10 Pamphlet WO2023/036974: PRMT5 inhibitor 1: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4- fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): .
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1), or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- 20 yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): 5 inhibitor 1).
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6- fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’- pyrrolidine]-2’,3-dione): 5 inhibitor 1).
  • PRMT5 inhibitor 2 has the following structure and is described as Example 2 in PCT/EP2022/075248, filed 12 September 2022 and published as International Publication Pamphlet WO2023/036974.
  • PRMT5 inhibitor 2 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1- 10 yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: .
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: (PRMT5 inhibitor 2), 15 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: inhibitor 2).
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6- fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’- pyrrolidine]-2’,3-dione: inhibitor 2).
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022169948, WO2022192745, WO2022132914, WO2021086879, WO2021050915, WO2021055797, WO2020249663, WO2020206308, WO2020206289, WO2020206299, WO2020152557, WO2018085818, US20190284193, WO2019178368, WO2018085833, WO2018085818, WO2018075601, WO2017212385, WO2017218802, WO2017153186, WO2017032840, 15 WO2016135582, or WO2015198229.
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2021/050915 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is (P)-2-[4- [4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- fluoro-benzonitrile: 20 , or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl- pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (P)-2-[4-[4-(aminomethyl)- 5 1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: .
  • the PRMT5 inhibitor is a hydrochloride salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H- phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . 10
  • the PRMT5 inhibitor is a PRMT5 inhibitor disclosed in WO2022/132914 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is (4-amino- 1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: , 15 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- (trifluoromethyl)phenyl]morpholin-4-yl]methanone: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: 5 .
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022/026892 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is N-(6-amino- 5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2- oxoacetamide: 10 , or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is N-(6-amino-5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol- 5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: .
  • the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: , 5 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5-ethylpyridin-10 3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2- oxoacetamide: .
  • CAAP1 refers to the gene (“CAAP1”) or protein (“CAAP1”) Caspase Activity and Apoptosis Inhibitor 1, also known as conserveed Anti-Apoptotic Protein (CAAP); C9orf82; or 15 FLJ13657.
  • HGNC 25834, NCBI Entrez Gene ID: 79886, Ensembl: ENSG00000120159, UniProt/Swiss-Prot: Q9H8G2.
  • wild-type CAAP1 is meant that encoded by NM_ 024828 or having the same amino acid sequence (NP_ 001161047.1). There are two isoforms of CAAP1.
  • Isoform 1 of the CAAP1 mRNA polynucleotide is referred to 5 herein as SEQ ID NO.1 and isoform 2 of the CAAP1 mRNA polynucleotide is referred to herein as SEQ ID NO.2.
  • Isoform 1 of the CAAP1 polypeptide is referred to herein as SEQ ID NO.3 and isoform 2 of the CAAP1 polypeptide is referred to herein as SEQ ID NO.4.
  • this specification provides a PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient.
  • the patient’s tumour has previously been characterised as being CAAP1-null or CAAP1-deficient, and therefore sensitive to a PRMT5 inhibitor drug. Therefore, in this aspect of the specification, CAAP1 (and, in particular, CAAP1-deficiency) is used as a novel biomarker for the stratification of cancer patients having tumours that are sensitive to PRMT5 inhibitors.
  • CAAP1 and, in particular, CAAP1-deficiency
  • the cancer is identified as being CAAP1-null.
  • the cancer is identified as being CAAP1-deficient.
  • CAAP1-deficient and CAAP1-deficiency refer to tumour cells that do not express any CAAP1 protein, or functional CAAP1 protein, or have a significant reduction in post-translational modification, production, expression, level, stability and/or activity of CAAP1 relative to that in a control, e.g., reference or corresponding normal or non-cancerous cells.
  • the 20 reduction can be a decrease in production, expression, level, stability and/or activity compared to a control, or in which the CAAP1 gene carries a loss of function alteration and therefore the tumour cells have an absence or significant reduction in functional CAAP1 protein expression.
  • a tumour may, for example, be rendered CAAP1-deficient by virtue of epigenetic silencing of CAAP1 gene expression, such tumours can be termed CAAP1 gene silenced tumours.
  • the CAAP1-deficiency 25 status can be determined by interpretation of an immunohistochemistry assay by a skilled pathologist.
  • PRMT5 inhibitor sensitive and the like refers to a tumour cell that is sensitised to, and therefore can be treated with, a PRMT5 inhibitor, due to the CAAP1-deficient character of the tumour cells.
  • CDKN2A refers to cyclin dependent kinase inhibitor 2A, also known as ARF; MLM; P14; P16; P19; CMM2; INK4; MTS1; TP16; CDK4I; CDKN2; INK4A; MTS-1; P14ARF; P19ARF; P16INK4; P16INK4A; and P16-INK4A.
  • CDKN2A is a tumour suppressor gene that is homozygously deleted in approximately 15% of cancers. Loss of the 9p21 chromosome locus (where CDKN2A resides) results in the co-deletion of additional genes including the gene MTAP encoding methylthioadenosine phosphorylase (MTAP).
  • Figure 17 shows the proximity of MTAP, CDKN2A 5 and CAAP1 on chromosome 9.
  • the patient’s tumour has previously been further characterised as being MTAP-null or MTAP-deficient.
  • the patient’s tumour has previously been further characterised as being MTAP-null.
  • the patient’s tumour has previously been further characterised as being MTAP-deficient.
  • the patient’s tumour has previously been further 10 characterised as being CAAP1-null and MTAP-null.
  • MTAP refers to methylthioadenosine phosphorylase, also known as S-methyl-5'-thioadenosine phosphorylase, BDMF; DMSFH; DMSMFH; LGMBF; MSAP; and c86fus.
  • OMIM 156540 MGI: 1914152 HomoloGene:1838 chEMBL: 4941 GeneCards: MTAP Gene; Entrez 4507; RefSeq (mRNA): NM_002451; location: Chr 9: 21.8–21.93 Mb.
  • wild-type MTAP is meant that 15 encoded by NM_002451 or having the same amino acid sequence (NP_002442). (Schmid et al. Oncogene 2000, 19, pp 5747-54).
  • MTAP-deficient and MTAP-deficiency refer to tumour cells that do not express any MTAP protein, or have a significant reduction in post-translational modification, production, expression, level, stability and/or activity of MTAP relative to that in a control, e.g., 20 reference or normal or non-cancerous cells.
  • the reduction can be a decrease in production, expression, level, stability and/or activity of the protein compared to a control.
  • a tumour may, for example, be rendered MTAP-deficient by virtue of epigenetic silencing of MTAP gene expression, such tumours can be termed MTAP gene silenced tumours.
  • the MTAP-deficiency status can be determined by interpretation of an immunohistochemistry assay by a skilled pathologist.
  • 25 Loss of MTAP results in increased concentrations (or accumulation) of the MTAP substrate methylthioadenosine (MTA, also known as, S-methyl-5’-thioadenosine, 5'-(methylthio)adenosine and 5′-deoxy, 5′-methylthioadenosine) in CDKN2A/MTAP null cancer cells.
  • MTA methylthioadenosine
  • MTA selectively inhibits PRMT5 methyltransferase activity, and therefore acts as a weak PRMT5 inhibitor.
  • MTA accumulation in CDKN2A/MTAP-null cancer cell lines leads to a partial inhibition 30 of PRMT5 activity.
  • Compromised PRMT5 activity renders CDKN2A/MTAP null cancer cells susceptible to further targeting of PRMT5.
  • Methods for detecting MTA include, but are not limited to, liquid chromatography–electrospray ionization–tandem mass spectrometry (LC-ESI-MS/MS), as described in Stevens et al. J. Chromatogr. A.2010, 1217, pp 3282-3288.
  • CAAP1-deficiency and MTAP-deficiency may be due to the presence of a loss of function-related alteration in the CAAP1 and MTAP genes, respectively.
  • a loss of function-related alteration can refer to any genetic alteration, compared to the wild-type gene, resulting in loss of transcriptional activity and/or failure to express functional protein, or resulting in a significant reduction in post- 5 translational modification, production, expression, level, stability and/or activity of expressed protein relative to that in a control, e.g., reference or corresponding normal or non-cancerous cells.
  • Loss of function-related alterations may encompass the entire gene locus or may be located within the gene sequence or in regulatory or promoter sequences.
  • Loss of function-related alterations include, but are not limited to, point mutations, insertions, deletions, frame-shift 10 mutations, translocation, loss of heterozygosity and/or DNA methylation, which can result in gene deletion or a null allele genotype.
  • the loss of function-related alteration in the CAAP1 or MTAP genes may be due to epigenic silencing of the gene.
  • epigenic silencing of the gene is generally defined as an epigenetic modification of gene expression (i.e. genetic control by factors other 15 than an individual’s DNA sequence) leading to inactivation of previously active individual genes or larger chromosome regions.
  • Mechanisms responsible for silencing include changes in levels of DNA methylation and alterations in covalent modifications of histone proteins, which lead to chromatin compaction, making genes inaccessible to the transcription machinery. Gene silencing can also occur post-transcriptionally due to mRNA degradation and/or repression of its 20 translation. These effects are often mediated by small RNA regulators such as small interfering RNAs (siRNAs), microRNAs (miRNAs), or Piwi-associated RNAs (piRNAs), which are generated from different forms of double-stranded RNA (dsRNA) accumulating in cells.
  • siRNAs small interfering RNAs
  • miRNAs microRNAs
  • piRNAs Piwi-associated RNAs
  • RNAs can also participate in silencing of genes at the level of transcription (Filipowicz et al., 25 Brenner’s Encyclopedia of Genetics (2 nd Edition) 2013). While modification at the genetic level may cause reduced (or no) expression of the gene product, it may also be that modification at the genetic level results in expression of protein with reduced or no functional activity. Accordingly, CAAP1 protein activity levels in tumour cells can be used identify tumours that are sensitive to treatment with a PRMT5 inhibitor. 30 Alternatively, the presence of a loss of function-related alteration in the CAAP1 gene and/or the MTAP gene may be established by analysis of circulating tumour DNA (ctDNA) in a liquid biopsy sample obtained from a subject.
  • ctDNA circulating tumour DNA
  • CAAP1 and/or MTAP genes can be similarly detected in a liquid biopsy sample obtained from a subject.
  • the use of ctDNA is advantageous as it is a sensitive and specific non-invasive method for detecting, analysing and monitoring 35 tumours. Many tumour release DNA fragments into the bloodstream, which can be identified and analysis via liquid biopsy in the form of a simple blood test.
  • a methodology for detection of ctDNA in human malignancies is described by Chetan Bettegowda et al., Sci. Transl Med.2014 February 19; 6(224). The entire content of this publication is incorporated by reference herein.
  • the CAAP1 status of the tumour is characterised by determining the status of a gene or genes adjacent to CAAP1 e.g.
  • CAAP1 for example a gene close but to the left hand side of 5 CAAP1 (i.e. between CDKN2A and CAAP1) such as TEK or a gene adjacent to, but on the right hand side of, CAAP1. It is expected that deletion (such as homozygous deletion) of certain adjacent genes (e.g. TEK) may result in co-deletion of CAAP1, enabling indirect determination of CAAP1 status.
  • the CAAP1 status of the tumour is characterised by determining the status of a gene or genes located on chromosome 9, such as DMRTA1, ELAVL2, IZUMO3, 10 TUSC1, PLAA, IFT74, LRRC19, MOB3B, C90rf72, IFNK, EQTN and/or LINGO2. It is also expected that deletion (e.g. homozygous deletion) of such genes may also result in co-deletion of CAAP1. Accordingly, in embodiments CAAP1-null status may be assigned by establishing the deletion of a surrogate gene (e.g. a gene or genes located on chromosome 9, such as a gene or genes adjacent to CAAP1, for example TEK).
  • a surrogate gene e.g. a gene or genes located on chromosome 9, such as a gene or genes adjacent to CAAP1, for example TEK.
  • therapies can be administered in a more targeted and personalised manner, leading to improved outcomes, a reduction in unnecessary or ineffective therapeutic interventions and fewer adverse events.
  • the term “status” refers to the condition or state of a gene or its products.
  • the status of a biomarker i.e. CAAP1, and optionally MTAP
  • CAAP1, and optionally MTAP can be evaluated by a number of parameters known in the art.
  • an alteration in the status of a biomarker includes an increase or, importantly in the context of the present specification, a decrease in biomarker mRNA and/or protein expression.
  • the CAAP1 status of the tumour can be 25 determined by detecting the presence or quantity of the respective biomarker gene polynucleotides in a biological sample (e.g. tumour biopsy tissue or cells, blood or blood products (e.g. plasma)).
  • the biological sample is a blood sample containing ctDNA.
  • Detectable biomarker polynucleotides include, for example, mRNA, and recombinant DNA or RNA molecules containing a biomarker polynucleotide.
  • NGS next generation sequencing
  • CAAP1 (and MTAP) deficiency status i.e. CAAP1 (and MTAP) protein levels can be established by immunohistochemistry (IHC) using a tumour tissue sample.
  • IHC immunohistochemistry
  • a method for detecting a biomarker gene mRNA in a biological sample 5 includes obtaining a sample, producing cDNA from the sample by reverse transcription using at least one primer that binds the biomarker polynucleotide; amplifying the cDNA so produced using biomarker oligonucleotides as sense and antisense primers to amplifying cDNAs therein; and detecting the presence of the amplified cDNA.
  • Such assays can be qualitative or quantitative.
  • point mutations may be responsible for loss of gene function or loss of 10 protein functional activity.
  • RNASE A cleavage method, chemical/enzyme mismatch cleavage, allele specific oligonucleotide hybridisation on DNA chips, allele specific PCR with a 15 blocking reagent (to suppress amplification of wild-type allele) followed by real time PCR, direct sequencing of PCR products, pyrosequencing and next generation sequencing systems.
  • gene loss and/or loss of protein functional activity may be due to insertions, deletions and frame-shift mutations, relative to the wild-type polynucleotide sequence. Deletion may be of part or all the gene. In an embodiment, the loss of function-related alternation is 20 homozygous deletion of the gene.
  • suitable techniques for detection of insertions, deletions, frame-shift mutations include pyrosequencing, big dye terminator sequencing, next generation sequencing systems and heteroduplex analysis using capillary/microchip-based electrophoresis.
  • a translocation occurs when a chromosome breaks and the fragmented pieces re-attach to 25 different chromosomes, which can result in loss of the gene(s) located at the affected chromosomal locus.
  • DNA methylation caused primarily by covalent addition of methyl groups to cytosine within CpG dinucleotides, occurs primarily in promoter regions of genes due to the large proportion of CpG islands found there. Hypermethylation results in transcriptional silencing.
  • Methods for determining the methylation state of specific genes include, for example, methylation-specific PCR (also known as MethyLight; as described in Eads et al, Nucleic Acids Res.2000; 28(8), and Widschwendler et al, Cancer Res., 2004; 64:3807-3813), combined bisulphate restriction analyses, bisulphite sequencing, methylation-sensitive single nucleotide primer extension and the use of CpG island microarrays.
  • kits 35 for the study of DNA methylation are available.
  • Loss of heterozygosity (LOH) refers to loss of the entire gene locus in one allele.
  • LOH can be measured using various techniques, including semi quantitative RT-PCR analysis, high- resolution PCR based fluorescence quantitation using capillary electrophoresis systems, amplification of microsatellites by PCR using radiolabeled nucleotides followed by 5 autoradiography and next generation sequencing (Ion TorrentTM, Life Technologies).
  • null refers to a non-functional allele caused by a genetic mutation, such as those described above. As previously mentioned, such mutations can cause a complete lack of production of the associated gene product (protein) or a product that does not function properly; in either case, the allele may be considered non-functional. 10 A mutant allele that produces no RNA transcript is called an RNA null (shown by e.g.
  • a genetic null or amorphic allele has the same phenotype when homozygous as when heterozygous with a deficiency that disrupts the locus in question.
  • a genetic null allele may be both a protein null and an RNA null, but may also express 15 normal levels of a gene product that is non-functional due to mutation.
  • Methods for identifying the presence (or absence) of protein, or the level of protein in a sample include determining protein levels or studying the expression level of the gene.
  • the sample is a tumour tissue or tumour cell sample.
  • the term "expression level" refers to the amount of the specified protein (or mRNA coding for the protein) in the tumour 20 sample. The expression level is then compared to that of a control.
  • the control may be a tumour sample that is known to have a functioning wild-type gene or may be a reference value or normal, non-tumour, cells. It will be apparent to the skilled person that comparing expression levels of a control and the test sample will allow a decision to be made as to whether the expression level in the test sample and 25 control are similar or different, and therefore whether the patient has a tumour that is sensitive to treatment with a PRMT5 inhibitor.
  • a biomarker protein from a biological sample such as a tumour tissue, tumour cell or blood sample
  • a biological sample such as a tumour tissue, tumour cell or blood sample
  • proteins or nucleic acid from the sample may be analysed to determine the 30 expression level
  • suitable methods include semi-quantitative methods such as in situ hybridisation (ISH) and fluorescence in situ hybridisation (FISH), and variants of these methods for detecting mRNA levels in tissue or cell preparations, Northern blotting, and quantitative PCR reactions.
  • ISH in situ hybridisation
  • FISH fluorescence in situ hybridisation
  • kits for quantitative PCR-based gene expression 35 analysis are commercially available, for example the Quantitect system manufactured by Qiagen.
  • Such methods and assays generally include one or more biomarker-specific antibodies 5 capable of recognizing and binding a biomarker protein, as appropriate, and can be performed within various immunological assay / immunohistochemical assay formats well-known in the art, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), immunohistochemistry and the like.
  • ELISA enzyme-linked immunosorbent assays
  • ELIFA enzyme-linked immunofluorescent assays
  • Antibodies may also be used in methods for purifying biomarker proteins and for isolating biomarker protein homologues and related molecules. Various methods for the preparation of antibodies are well-known in the art.
  • antibodies may be prepared by immunizing a suitable mammalian host using a biomarker protein, peptide, or fragment, in isolated or immunoconjugated form (Harlow & Lane, eds. (1988) Antibodies: A Laboratory Manual, CSH 15 Press).
  • the term "antibody” has its usual meaning in the art and refers to an immunoglobulin which specifically recognises an epitope on a target as determined by the binding characteristics of the immunoglobulin variable domains of the heavy and light chains (VH S and VL S), more specifically the complementarity-determining regions (CDRs).
  • antibody forms are known in 20 the art, which may include, but are not limited to, a plurality of intact monoclonal antibodies or polyclonal mixtures comprising intact monoclonal antibodies, antibody fragments (for example Fab and Fr fragments, linear antibodies, single chain antibodies, and multispecific antibodies comprising antibody fragments), single chain variable fragments (scFv S), multispecific antibodies, chimeric antibodies, humanised antibodies and fusion proteins comprising the 25 domains necessary for the recognition of a given epitope on a target.
  • Antibodies may also be conjugated to various moieties for a diagnostic effect, including but not limited to radionuclides, fluorophores or dyes.
  • binding means specific recognition.
  • Methods of measuring the level of expression of a biomarker protein in a biological sample also include the use of primers and primer pairs, which bind to biomarker genes and allow the specific 35 amplification of the polynucleotides of the specification or of any specific parts thereof, and probes that selectively or specifically bind or hybridize to polynucleotide molecules of the specification or to any part thereof.
  • Probes can be labelled with a detectable biomarker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
  • a detectable biomarker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
  • Such probes and primers are agents which can be used to detect the presence or quantity of a biomarker polynucleotide in a sample and as a means for detecting a 5 cell expressing a biomarker protein.
  • methods for identifying a cancer patient having a tumour that is sensitive to treatment with a PRMT5 inhibitor are provided.
  • the sample may be tumour biopsy tissue or cells, or a blood sample.
  • the sample is a blood sample.
  • the sample is a tumour biopsy sample.
  • the sample type used for detection of the presence or absence of protein may be the same or different to the sample type used for detection of the presence of a loss of function-related alteration in a gene, or in its regulatory or promoter sequences.
  • a tumour biopsy (tissue or 20 cell) sample is used for detection of the presence or absence of CAAP1 protein.
  • a tumour biopsy (tissue or cells) sample or a blood sample is used for detection of the presence of a loss of function-related alteration in the CAAP1 gene, or in its regulatory or promoter sequences.
  • CAAP1-deficiency status can be determined by interpretation of an immunohistochemistry assay 25 by a skilled pathologist.
  • the patient is identified as having a tumour that is CAAP1- deficient and therefore sensitive treatment with a PRMT5 inhibitor.
  • a control e.g., reference or normal or non-cancerous cells
  • the patient is identified as having a tumour that is CAAP1- deficient and therefore sensitive treatment with a PRMT5 inhibitor.
  • the presence of a loss of a function-related alteration in the CAAP1 30 gene, or in its regulatory or promoter sequences is detected in the sample obtained from the patient then the patient is identified as having a tumour that is CAAP1-deficient and therefore sensitive treatment with a PRMT5 inhibitor.
  • This method enables the stratification of patients who have a tumour that is likely to respond to treatment with a PRMT5 inhibitor from those patients whose tumour is unlikely or less likely to 35 respond to treatment with a PRMT5 inhibitor.
  • therapies can be administered in a more targeted and personalised way, leading to more positive outcomes, a reduction in unnecessary or ineffective therapeutic interventions and fewer adverse events. All steps of this method are carried out in vitro.
  • the term "in vitro" has its usual meaning in the art, referring to methods that are carried out in or on a tissue or blood 5 sample in an artificial environment outside the body of the patient from whom the tissue or blood sample has been obtained.
  • Biopsy methods for obtaining a biological sample (such as a tumour sample) for analysis are well- known in the art.
  • obtaining a blood sample from a patient and analysing the blood sample for the presence of circulating tumour DNA (ctDNA) and elucidating the genetic profile of a tumour 10 are well known in the art.
  • ctDNA circulating tumour DNA
  • Suitable methods for analysing gene expression and protein levels and detecting genetic alterations in a biological sample such as a tumour biopsy or a blood sample are known in the art and described in detail above.
  • the method of the specification comprises detecting the presence of 15 MTAP protein in a sample obtained from the patient and/or detecting the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, in a sample obtained from the patient.
  • a tumour that is identified as CAAP1/MTAP-deficient is characterised as being sensitised to, and suitable for treatment with, a PRMT5 inhibitor, for example a second generation MTA-synergistic PRMT5 inhibitor.
  • a tumour biopsy (tissue or cell) sample is used for detection of the presence or absence of MTAP protein.
  • a tumour biopsy (tissue or cells) sample or a blood sample is used for detection of the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences.
  • a tumour cell that is characterised as accumulating MTA or having 25 “MTA accumulation” (i.e.
  • a cell that through the lack of MTAP protein is unable to phosphorylate MTA to generate adenine and 5-methylthioribose-1-phosphate, and thus characteristically has concentrations of MTA, greater than that found in normal or non-cancerous cells) in combination with CAAP1-null or CAAP1-deficiency is characterised as being sensitised to, and suitable for treatment with, a PRMT5 inhibitor, for example and advantageously for treatment with a second 30 generation MTA-synergistic PRMT5 inhibitor.
  • a PRMT5 inhibitor for example and advantageously for treatment with a second 30 generation MTA-synergistic PRMT5 inhibitor.
  • Methods for detecting the presence or absence of CAAP1 protein in the biological sample include using a CAAP1-specific antibody, or a probe for the CAAP1 gene, mRNA or specific CAAP1 gene 35 mutations.
  • the specification provides an in vitro diagnostic test for detecting CAAP1 protein in a sample obtained from a cancer patient, or for detecting the CAAP1 gene deletion status of a tumour from a sample obtained from a cancer patient.
  • the sample obtained from the patient is a tumour tissue sample or a blood sample containing ctDNA.
  • Non-limiting examples of technologies suitable for analysing CAAP1-gene status or CAAP1 protein status include next generation sequencing using either a tumour tissue sample or a blood sample; immunohistochemistry (IHC) using a tumour tissue sample.
  • IHC immunohistochemistry
  • a skilled pathologist will be able to identify that a tumour is CAAP1-deficient by analysing the results of an IHC test for CAAP1.
  • the specification provides the use of CAAP1 protein or the polynucleotide 10 encoding the CAAP1 gene as a biomarker for identifying a tumour that will be sensitive to treatment with a PRMT5 inhibitor.
  • the CAAP1 polypeptide (protein) or CAAP1 polynucleotide (gene) biomarkers can be used in in vitro diagnostic and patient stratification methods and methods of treating cancer patients, as disclosed herein.
  • the biomarkers may also be used in non-clinical research settings, for example 15 for characterising tumour cell lines, or for use in drug development studies (including, but not limited to the development of PRMT5 inhibitor drugs).
  • the specification provides methods of treatment of cancer, for example a malignant tumour, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s cancer or tumour has been 20 characterised as being CAAP1-deficient.
  • the specification provides methods of treatment of cancer, for example a malignant tumour, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s cancer has been characterised as being CAAP1-null.
  • a “therapeutically effective amount” of a compound is an amount sufficient to 25 provide a therapeutic benefit in the treatment of a disease, disorder or condition, or to delay or minimize one or more symptoms associated with the disease, disorder or condition.
  • a therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapies, which provides a therapeutic benefit in the treatment of the disease, disorder or condition.
  • therapeutically effective amount can encompass an 30 amount that improves overall therapy, reduces or avoids symptoms or causes of disease or condition, or enhances the therapeutic efficacy of another therapeutic agent.
  • the therapeutically effective amount can vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject to be treated. Analysis of the literature and other resources has revealed that significant numbers of cancer 35 patients have tumours that are CAAP1 deficient.
  • Exemplary cancers in which CAAP1-null status has been confirmed, often in conjunction with MTAP deficiency include pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) 5 mesothelioma.
  • HNSCC head and neck cancer
  • lung cancer such as non-small cell lung cancer (NSCLC)
  • gastric cancer gastric cancer
  • glioblastoma ovarian
  • cancer liver cancer
  • colorectal cancer colorectal cancer
  • MPNST Malignant Peripheral Nerve Sheath Tumour
  • the use of a PRMT5 inhibitor for treatment or in a method of treatment as identification by the identification of its CAAP1-null or CAAP1 deficient status is for the treatment of a cancer selected from pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver 10 cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) and mesothelioma, such as selected from pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, chol
  • the cancer is 15 lung cancer (such as NSCLC).
  • the cancer is gastric cancer.
  • the cancer is pancreatic cancer.
  • the cancer is oesophageal cancer.
  • the cancer is bladder cancer.
  • the cancer is head and neck cancer (such as HNSCC).
  • a PRMT5 inhibitor is administered as a monotherapy, meaning that no 20 additional or further therapeutic agents are required to treat the tumour.
  • a monotherapy approach is beneficial for patients as it decreases the risk of harmful side-effects of multiple cancer therapies, avoids the need to multiple drugs to be administered and is more cost-effective for healthcare providers.
  • the PRMT5 inhibitor may be formulated, or administered, in combination with one 25 or more other therapeutic agents (e.g. anti-cancer agents) in a combination therapy approach.
  • the PRMT5 inhibitor for administration to a patient is selected from onametostat (JNJ-64619178); pemrametostat (GSK3326595, EPZ015938); PF-06939999; PRT811; PRT543; PRMT5 inhibitor 1, PRMT5 inhibitor 2 and GSK2303591 (EPZ015866).
  • the PRMT5 inhibitor for administration to the patient is selected from a PRMT5 30 inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344.
  • the PRMT5 inhibitor is selected from a PRMT5 inhibitor disclosed in CN202310191381, WO2021086879, WO2021050915, WO2022192745, WO2023278564, WO2022132914, WO2022169948, WO2023081367, WO2023098439, WO2023098439, WO2023143210, WO2023125540, WO2023174250 or WO2023207556.
  • the PRMT5 inhibitor is a PRMT5 inhibitor as disclosed in WO2023/036974 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is a compound of formula (I): wherein: the ring containing X and Y is a pyrrole and X is NH and Y is CH or X is CH and Y is NH; Z is selected from CH, CF, CCl or, if Q is not N, N; Q is selected from CH, CF, CCl or, if Z is not N, N; m is 0, 1 or 2; n is 0, 1 or 2; p is 1 or 2; R 1 is in each occurrence independently selected from F, Cl, CN, Me, CF 3 , C 1 -C 3 alkyl, cyclopropyl, C1-C3 fluoroalkyl, OMe or C1-C3 alkoxy; R 2 is in each occurrence independently selected from F, Cl, Me, MeO and CF3; R 3 is H, Me, C1-C3 alkyl or C1-C3 fluoroalkyl; R 4 is H, Me or
  • the PRMT5 inhibitor is a compound of formula (I). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I). 5 In embodiments, the PRMT5 inhibitor is selected from the group consisting of: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(4-fluorobenzyl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; 10 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1), 5 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1).
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6-10 fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’- pyrrolidine]-2’,3-dione): inhibitor 1).
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: 15 (PRMT5 inhibitor 2). or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione: inhibitor 2).
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6- fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'- pyrrolidine]-2',3-dione: inhibitor 2).
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022169948, 10 WO2022192745, WO2022132914, WO2021086879, WO2021050915, WO2021055797, WO2020249663, WO2020206308, WO2020206289, WO2020206299, WO2020152557, WO2018085818, US20190284193, WO2019178368, WO2018085833, WO2018085818, WO2018075601, WO2017212385, WO2017218802, WO2017153186, WO2017032840, WO2016135582, or WO2015198229.
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2021/050915 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is (P)-2-[4- [4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- fluoro-benzonitrile: , 20 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl- pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (P)-2-[4-[4-(aminomethyl)- 5 1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: .
  • the PRMT5 inhibitor is a hydrochloride salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H- phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . 10
  • the PRMT5 inhibitor is a PRMT5 inhibitor disclosed in WO2022/132914(the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- (trifluoromethyl)phenyl]morpholin-4-yl]methanone: , 15 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- (trifluoromethyl)phenyl]morpholin-4-yl]methanone: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: 5 .
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022/026892 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is N-(6-amino- 5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2- oxoacetamide: 10 , or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is N-(6-amino-5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol- 5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: .
  • the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: , 5 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5-ethylpyridin-10 3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2- oxoacetamide: .
  • the PRMT5 inhibitor for administration to the patient is selected from PRMT5 inhibitor 1 and PRMT5 inhibitor 2, as shown above.
  • the patient’s tumour has been characterised as being CAAP1-deficient or CAAP1-null (e.g. CAAP1-null) according to the methods described herein above.
  • the tumour has also been characterised as being MTAP-deficient or MTAP-null (e.g. MTAP-null). Determination of the MTAP protein or MTAP-gene status of a tumour can be 5 made using according to the methods disclosed herein above.
  • the tumour cells have been characterised as being CAAP1/ MTAP-deficient or CAAP1/ MTAP-null.
  • the tumour cells have been characterised as being CAAP1-null and MTAP-null.
  • the specification provides a method of treating a cancer patient 10 comprising the steps of: i. obtaining a biological sample from the patient; ii.
  • CAAP1-deficiency status can be determined by interpretation of an immunohistochemistry assay by a skilled pathologist.
  • the biological sample may be a tumour biopsy sample (tumour tissue or tumour cells) or a blood sample.
  • the presence (or absence) of CAAP1 protein is detected in a tumour tissue sample obtained from the patient.
  • the CAAP1-null status is determined 25 on the basis of CAAP1-gene deletion in the tumour.
  • the CAAP1-deficiency is determined by the presence of a loss of function-related alteration in the tumour’s CAAP1 gene, or in its regulatory or promoter sequences, as detected in a tumour tissue sample, or in a blood sample.
  • the method of the specification further comprises detecting the presence of 30 MTAP protein in a sample of tumour cells obtained from the patient and/or detecting the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, in a sample obtained from the patient.
  • the presence (or absence) of MTAP protein is detected in a tumour tissue sample.
  • the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences is detected in a tumour tissue sample or in a blood sample.
  • a tumour that is identified as CAAP1/MTAP-deficient or CAAP1/MTAP-null is characterised as being sensitised to, and suitable for treatment with, a therapeutically effective amount of a PRMT5 inhibitor.
  • the PRMT5 inhibitor is an MTA-synergistic PRMT5 inhibitor.
  • the PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 inhibitor 2, or a PRMT inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344.
  • the PRMT5 inhibitor is selected from a PRMT5 inhibitor disclosed in CN202310191381, WO2021086879, WO2021050915, WO2022192745, WO2023278564, WO2022132914, WO2022169948, WO2023081367, WO2023098439, WO2023098439, WO2023143210, WO2023125540, WO2023174250 or WO2023207556.
  • the PRMT5 inhibitor is a PRMT5 inhibitor as disclosed in WO2023/036974 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is a compound of formula (I): wherein: the ring containing X and Y is a pyrrole and X is NH and Y is CH or X is CH and Y is NH; Z is selected from CH, CF, CCl or, if Q is not N, N; Q is selected from CH, CF, CCl or, if Z is not N, N; m is 0, 1 or 2; n is 0, 1 or 2; p is 1 or 2; R 1 is in each occurrence independently selected from F, Cl, CN, Me, CF3, C1-C3 alkyl, cyclopropyl, C 1 -C 3 fluoroalkyl, OMe or C 1 -C 3 alkoxy; R 2 is in each occurrence independently selected from F, Cl, Me, MeO and CF 3 ; R 3 is H, Me, C 1 -C 3 alkyl or C 1 -C 3 fluoroalkyl; R 4 is H,
  • the PRMT5 inhibitor is a compound of formula (I). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I). In embodiments, the PRMT5 inhibitor is selected from the group consisting of: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(4-fluorobenzyl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- 15 yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1), or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): 20 (PRMT5 inhibitor 1).
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6- fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’- pyrrolidine]-2’,3-dione): 5 inhibitor 1).
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: inhibitor 2). 5 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione: inhibitor 2).
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6-10 fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'- pyrrolidine]-2',3-dione: (PRMT5 inhibitor 2).
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022169948, 15 WO2022192745, WO2022132914, WO2021086879, WO2021050915, WO2021055797, WO2020249663, WO2020206308, WO2020206289, WO2020206299, WO2020152557, WO2018085818, US20190284193, WO2019178368, WO2018085833, WO2018085818, WO2018075601, WO2017212385, WO2017218802, WO2017153186, WO2017032840, WO2016135582, or WO2015198229.
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2021/050915 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is (P)-2-[4- [4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- fluoro-benzonitrile: , 10 or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl- pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (P)-2-[4-[4-(aminomethyl)- 15 1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: .
  • the PRMT5 inhibitor is a hydrochloride salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H- phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: .
  • the PRMT5 inhibitor is a PRMT5 inhibitor disclosed in WO2022/132914 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- 5 (trifluoromethyl)phenyl]morpholin-4-yl]methanone: , or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- (trifluoromethyl)phenyl]morpholin-4-yl]methanone: 10 .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: . 15
  • the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022/026892 (the content of which is incorporated by reference herein).
  • the PRMT5 inhibitor is N-(6-amino- 5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2- oxoacetamide: , or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is N-(6-amino-5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol- 5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: 10 .
  • the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: , or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: .
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5-ethylpyridin- 5 3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2- oxoacetamide: .
  • the specification provides the use of a PRMT5 inhibitor for the manufacture of a medicament for the treatment of cancer, wherein the cancer has been identified 10 as being CAAP1-null or CAAP1-deficient.
  • the cancer has been identified as being CAAP1-null.
  • the cancer has been identified as being CAAP1-deficient.
  • MAT2A methionine adenosyltransferase 2a
  • MTAP-deleted cancers Kalev et al., 2021, Cancer Cell, 39, 209-224.
  • SAM universal methyl donor S-adenosylmethionine
  • SAM levels can be reduced by MAT2A inhibitors.
  • the high-MTA environments of MTAP-null cancers, in which MTA inhibits PRMT5 activity is sensitive to reduction in SAM levels, for example as dictated by MAT2A inhibition.
  • the paper of Kalev et al. reports the increased sensitivity of two xenograft models to MAT2A inhibitor treatment and attributes this to mutations in the FANCI gene.
  • the two xenograft models in the Kalev paper are both MTAP-null CAAP1-null and these PDX models respond in a similar manner to MAT2A inhibitor treatment and PRMT5 inhibitor treatment in a MTAP-null and CAAP1-null PDX study.
  • deletion of CAAP1 is implicated in increased sensitivity of tumours to MAT2A inhibitor treatment and, accordingly the specification provides methods for identifying cancer patients that 25 will respond to MAT2A inhibitor treatment and methods of treatment of cancer patients that have been identified as having CAAP1-null or CAAP1-deficient tumours. Therefore, in one embodiment the specification provides a MAT2A inhibitor for use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient.
  • the cancer is identified as being CAAP1-null.
  • the cancer is identified as being CAAP1-deficient.
  • the specification also provides the use of a MAT2A inhibitor for the manufacture of a medicament 5 for the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient.
  • the cancer has been identified as being CAAP1-null.
  • the cancer has been identified as being CAAP1-deficient.
  • the specification also provides methods of treatment of cancer, comprising administering a therapeutically effective amount of a MAT2A inhibitor to a patient in need thereof, wherein the 10 patient’s cancer or tumour has been characterised as being CAAP1-deficient.
  • the specification provides methods of treatment of cancer comprising administering a therapeutically effective amount of a MAT2A inhibitor to a patient in need thereof, wherein the patient’s cancer has been characterised as being CAAP1-null.
  • the specification also provides a method for identifying a cancer patient having a cancer that is 15 sensitive to treatment with a MAT2A inhibitor, comprising the step(s) of: i. detecting the presence or absence of CAAP1 protein in a sample obtained from the patient, and/or ii.
  • step i) determining that the cancer is CAAP1-null, by analysing a sample obtained from the patient, 20 wherein if the detection of step i) reveals there is no, or significantly reduced, CAAP1 protein present in the sample; and/or if the determination of step ii) reveals that the cancer is CAAP1- null; then the patient is identified as having a tumour that is sensitive treatment with a MAT2A inhibitor.
  • the specification also provides a method of treating a cancer patient comprising the steps of: 25 i. obtaining a biological sample from the patient; ii. detecting the expression of CAAP1 protein in the sample and/or determining that the patient has a cancer that is CAAP1-null by analysing the sample ; iii.
  • the cancer is selected from pancreatic cancer, oesophageal cancer, bladder cancer, 35 head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) and mesothelioma.
  • HNSCC head and neck squamous cell carcinomas
  • NSCLC non-small cell lung cancer
  • gastric cancer gastric cancer
  • glioblastoma ovarian
  • cancer liver cancer
  • colorectal cancer colorectal cancer
  • MPNST Malignant Peripheral Nerve Sheath Tumour
  • mesothelioma mesothelioma.
  • the cancer is selected from pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, 5 glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) and mesothelioma.
  • the cancer is lung cancer (such as NSCLC).
  • the cancer is gastric cancer.
  • the cancer is pancreatic cancer.
  • the cancer is oesophageal cancer.
  • the cancer is bladder cancer.
  • the cancer is head and neck cancer (such as HNSCC).
  • a PRMT5 or MAT2A inhibitor can be formulated into a pharmaceutical composition including a carrier suitable for the desired delivery method. Therefore, in embodiments the specification provides a pharmaceutical composition comprising a PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient.
  • the specification also provides a pharmaceutical composition comprising a MAT2A inhibitor for use 15 in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient.
  • the cancer has been identified as being CAAP1-null.
  • the cancer has been identified as being CAAP1-deficient.
  • the pharmaceutical composition is administered as a monotherapy.
  • Pharmaceutical compositions may be for human or animal usage in human and veterinary 20 medicine and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier, or excipient.
  • Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit.1985).
  • the choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard 25 pharmaceutical practice.
  • the pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).
  • Preservatives, stabilizers, dyes and even flavouring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid 30 and esters of hydroxybenzoic acid. Antioxidants and suspending agents may be also used.
  • the pharmaceutical compositions can be injected parenterally, for example intravenously, intramuscularly or subcutaneously.
  • compositions 35 may be used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
  • Dosages and administration protocols for the treatment of cancers will vary with the method and the target cancer and will generally depend on a number of other factors appreciated in the art.
  • the specification also provides a kit comprising a PRMT5 inhibitor or a MAT2A inhibitor and instructions for their use in the treatment of cancer, wherein the cancer is identified as being 5 CAAP1-null or CAAP1-deficient.
  • the specification may be further defined by the following clauses: CLAUSES Clause 1.
  • a PRMT5 inhibitor for use in the treatment of cancer wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient. 10 Clause 2. A PRMT5 inhibitor for use according to clause 1, wherein the cancer has a loss of function-related alteration in the CAAP1 gene. Clause 3. A PRMT5 inhibitor for use according to clause 1 or 2, wherein the cancer has a homozygous deletion of the CAAP1 gene. Clause 4. A PRMT5 inhibitor for use according to clause 1 or 2, wherein the loss of 15 function-related alteration in the CAAP1 gene is due to epigenic silencing of the gene. Clause 5.
  • a PRMT5 inhibitor for use according to clause 5 or 6, wherein the loss of function-related alteration in the MTAP gene is due to epigenic silencing of the gene.
  • step i) determining that the cancer is CAAP1-null, by analysing a sample obtained from the 10 patient, wherein if the detection of step i) reveals there is no, or significantly reduced, CAAP1 protein present in the sample; and/or if the determination of step ii) reveals that the cancer is CAAP1- null; then the patient is identified as having a tumour that is sensitive treatment with a PRMT5 inhibitor. 15 Clause 13.
  • a tumour that is identified as CAAP1/MTAP-deficient is characterised as being sensitive to treatment with a PRMT5 20 inhibitor.
  • the cancer is 30 pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma.
  • Clause 18 An in vitro diagnostic test for detecting CAAP1 protein in a sample obtained from 5 a cancer patient, or for detecting the CAAP1 gene deleted status of a tumour from a sample obtained from a cancer patient. Clause 19. An vitro diagnostic test according to clause 18, wherein sample obtained from the patient is a tumour tissue sample or a blood sample. Clause 20. Use of CAAP1 protein or the polynucleotide encoding the CAAP1 gene as a 10 biomarker for identifying a tumour that will be sensitive to treatment with a PRMT5 inhibitor. Clause 21.
  • a method of treatment of a tumour comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s tumour has been characterised as being CAAP1-deficient or CAAP1-null.
  • Clause 22 A method according to clause 21, wherein the cancer has a loss of function- 15 related alteration in the CAAP1 gene.
  • Clause 23 A method according to clause 21 or 22, wherein the cancer has a homozygous deletion of the CAAP1 gene.
  • Clause 24. A PRMT5 inhibitor for use according to clause 21 or 22, wherein the loss of function-related alteration in the CAAP1 gene is due to epigenic silencing of the gene. 20 Clause 25.
  • tumour cells are MTAP-deficient or MTAP-null.
  • Clause 26 A method according to clause 25, wherein the cancer has a loss of function- related alteration in the MTAP gene.
  • Clause 27 A method according to clause 25 or 26, wherein the tumour cells have a 25 homozygous deletion of the MTAP gene.
  • Clause 28 A method according to clause 25 or 26, wherein the loss of function-related alteration in the MTAP gene is due to epigenic silencing of the gene.
  • PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 inhibitor 2, or a PRMT5 inhibitor disclosed in 30 WO2022026892, WO2022115377 and WO2021163344. Clause 30.
  • the cancer is pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, 5 prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma.
  • HNSCC head and neck cancer
  • NSCLC non
  • Clause 31 A method of treatment of a tumour according to any of clauses 21 to 30, wherein the PRMT5 inhibitor is administered as monotherapy.
  • Clause 32 A method of treating a cancer patient comprising the steps of: 10 i. obtaining a biological sample from the patient; ii. detecting the expression of CAAP1 protein in the sample and/or determining that the patient has a cancer that is CAAP1-null by analysing the sample ; iii. characterising the patient’s cancer as being sensitive to treatment with a PRMT5 inhibitor if a) reduced levels of, or no, CAAP1 protein is detected in the sample or 15 b) if the cancer is determined to be CAAP1-null; and iv.
  • Clause 35. A method of treating a cancer patient according to any of clauses 32 to 34, wherein the presence of a loss of function-related alteration in the CAAP1 gene, or in its 30 regulatory or promoter sequences, and optionally the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, is detected in a tumour tissue sample, or in a blood sample.
  • a PRMT5 inhibitor for the manufacture of a medicament for the treatment of cancer, wherein the medicament is for use in the treatment of cancers that have been 35 identified as being CAAP1-null or CAAP1-deficient.
  • Clause 37 Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 36, wherein the cancer has a loss of function-related alteration in the CAAP1 gene.
  • Clause 38 Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 36 or 37, wherein the cancer has a homozygous deletion of the CAAP1 gene. 5 Clause 39.
  • a PRMT5 inhibitor for the manufacture of a medicament according to clause 36 or 37, wherein the loss of function-related alteration in the CAAP1 gene is due to epigenic silencing of the gene.
  • Clause 40 Use of a PRMT5 inhibitor for the manufacture of a medicament according to any of clauses 36 to 39, wherein the cancer has been identified as being MTAP-deficient or MTAP- 10 null (e.g. MTAP-deficient).
  • Clause 41 Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 40, wherein the tumour cells have a loss of function-related alteration in the MTAP gene.
  • a PRMT5 inhibitor for the manufacture of a medicament according to clause 40 or 41, wherein the cancer has a homozygous deletion of the MTAP gene.
  • Clause 43 Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 40 or 41, wherein the loss of function-related alteration in the MTAP gene is due to epigenic silencing of the gene.
  • Clause 44 Use of a PRMT5 inhibitor for the manufacture of a medicament according to any of clauses 36 to 43, wherein the PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 20 inhibitor 2, or a PRMT5 inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344.
  • a PRMT5 inhibitor for the manufacture of a medicament according to any of clauses 36 to 44, wherein the cancer is pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), 25 lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, 30 melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tum
  • Clause 46 Use of a PRMT5 inhibitor for the manufacture of a medicament according to any of clauses 36 to 45, wherein the medicine is for use as a monotherapy.
  • Clause 47 A pharmaceutical composition comprising a PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1- deficient.
  • Clause 48 A pharmaceutical composition comprising a PRMT5 inhibitor for use according to 5 clause 47, wherein the cancer has a loss of function-related alteration in the CAAP1 gene.
  • Clause 49 A pharmaceutical composition comprising a PRMT5 inhibitor for use according to clause 47 or 48, wherein the cancer has a homozygous deletion of the CAAP1 gene.
  • a pharmaceutical composition comprising a PRMT5 inhibitor for use according to clause 47 or 48, wherein the loss of function-related alteration in the CAAP1 gene is due to 10 epigenic silencing of the gene.
  • Clause 51 A pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 50, wherein the cancer has been identified as being MTAP-deficient or MTAP-null (e.g. MTAP-deficient).
  • a pharmaceutical composition comprising a PRMT5 inhibitor for use according to 15 clause 51, wherein the cancer has a loss of function-related alteration in the MTAP gene.
  • a pharmaceutical composition comprising a PRMT5 inhibitor for use according to clause 51 or 52, wherein the cancer has a homozygous deletion of the MTAP gene.
  • Clause 54. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to clause 51 or 52, wherein the loss of function-related alteration in the MTAP gene is due to 20 epigenic silencing of the gene.
  • Clause 55. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 54, wherein the PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 inhibitor 2, or a PRMT5 inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344. 25 Clause 56.
  • a pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 55, wherein the cancer is pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, 30 cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour)
  • Clause 57 A pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 56, wherein the composition is for use as a monotherapy.
  • Clause 58. A MAT2A inhibitor for use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient.
  • Clause 59. Use of a MAT2A inhibitor for the manufacture of a medicament for the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient.
  • Clause 60 A pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 56, wherein the composition is for use as a monotherapy.
  • a method of treating cancer comprising administering a therapeutically effective amount of a MAT2A inhibitor to a patient in need thereof, wherein the patient’s cancer or tumour has been characterised as being CAAP1-null or CAAP1-deficient.
  • a kit comprising a PRMT5 inhibitor or a MAT2A inhibitor and instructions for their use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1- deficient.
  • the PRMT5 inhibitor is (S)-2-((5- Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline- 15 1,3’-pyrrolidine]-2’,3-dione): inhibitor 1), or a pharmaceutically acceptable salt thereof.
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61 to 64, wherein the PRMT5 inhibitor is (S)-2-((5-20 Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline- 1,3’-pyrrolidine]-2’,3-dione): (PRMT5 inhibitor 1). Clause 66.
  • the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1).
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit 5 according to any one of clauses 1 to 57 or 61 to 63, wherein the PRMT5 inhibitor is (S)-2-((5- Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline- 1,3’-pyrrolidine]-2’,3-dione: inhibitor 2). or a pharmaceutically acceptable salt thereof. 10 Clause 68.
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 to 63 or 67, wherein the PRMT5 inhibitor is (S)-2-((5- Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline- 1,3'-pyrrolidine]-2',3-dione: inhibitor 2). 15 Clause 69.
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 to 63 or 67, wherein the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione: 5 inhibitor 2).
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61, wherein the PRMT5 inhibitor is (P)-2-[4-[4- (aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- 5 fluoro-benzonitrile: , or a pharmaceutically acceptable salt thereof.
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 70, wherein the PRMT5 inhibitor is (P)-2-[4-[4-10 (aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- fluoro-benzonitrile: . Clause 72.
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61, 70 or 72, wherein the PRMT5 inhibitor is a hydrochloride salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]- 4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: 5 . Clause 74.
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61, wherein the PRMT5 inhibitor is (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: 10 , or a pharmaceutically acceptable salt thereof.
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 74, wherein the PRMT5 inhibitor is (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- 15 yl]methanone: . Clause 76.
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 77, wherein the PRMT5 inhibitor is N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: 10 .
  • Clause 80 is a pharmaceutically acceptable salt of N-(6-amino-5-methylpyridin-3-yl)-2-((2R,5S)-2- (benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: 15 .
  • a PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61, wherein the PRMT5 inhibitor is N-(6-amino-5- ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin- 1-yl)-2-oxoacetamide: 5 , or a pharmaceutically acceptable salt thereof.
  • the PRMT5 inhibitor is N-(6-amino-5- ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin- 1-yl)-2-oxoacetamide: 5 , or a pharmaceutically acceptable salt thereof.
  • Clause 83 A PRMT5 inhibitor for use, method, use, pharmaceutical composition, in vitro diagnostic test, MAT2A inhibitor for use or kit according to any preceding clause, wherein the cancer is lung cancer (such as NSCLC).
  • Example 1 The generation of cas9 expressing human cancer cell lines. NCI-H838, Lu-99, SW1573, HCC-15, NCI-H1650 and NCI-H2126 human lung cancer cell lines were cultured and transduced with a lentiviral vector carrying a Cas9 transgene as well as a 5 blasticidin resistance cassette. After 72 hours, transduced cell populations were selected by treatment with blasticidin. Cas9 expressing cell lines were then transduced with a reporter virus carrying BFP, GFP and a gRNA targeted against GFP, or a control reporter virus comprised of the same backbone and fluorophore composition but lacking the gRNA region.
  • Cas9 activity was analysed via the 10 measurement of the percentage population of BFP+/GFP- cells within a population. GFP gating was assessed based on the positive signal from cell populations transduced with the control reporter virus. Results Transduction of human lung cancer cell lines with a lentiviral Cas9 vector resulted in Cas9 activity 15 in all cell lines assessed. BFP+/GFP- cells represented over 80% of populations in cells sequentially transduced with Cas9, followed by a reporter virus carrying BFP, GFP and a gRNA targeting GFP ( Figure 1). Therefore, in all cell lines, efficiency exceeds 80% following transduction.
  • Example 2 Identifying PRMT5 inhibitor sensitising genes in human lung cancer cell lines using 20 a CRISPR-based genome wide screen Cas9 expressing lines were incubated with a genome-wide gRNA lentiviral library (Yusa_v3) for 24 hours. Transduced cells were selected by treatment with puromycin 72 hours after transduction. Transduction levels were then predicted based on the levels of BFP+ cells within a population. 25 Transduced cells were divided and treated with either vehicle (DMSO) or PRMT5 inhibitor 1 for a period of 14-34 days, dependent on the time taken for control cultures to double ten times. A small population of cells were taken at baseline, for sequencing analysis. At the end-point, cells were harvested for sequencing and the sgRNA counts were calculated and compared between groups.
  • DMSO vehicle
  • BFP positivity was used to assess genome-wide gRNA lentiviral transduction in Cas9 expressing CDKN2A/MTAP null cell lines. Prior to selection, BFP was detected in >20% of cells in each of the six cell lines tested. Puromycin selection increased the percentage of BFP+ cells in transduced cell populations, yielding >60% BFP+ cells. Over 80% of cells expressed BFP at Day 8 (+Puromycin) in NCI-H838, LU99, SW1573 and HCC15 cells and by Day 11 (+ Puromycin) in 35 H1650 and H2126 cells (Figure 2). PRMT5 inhibitor sensitizer hits were identified in all 6 CDKN2A/MTAP null cell lines tested (Table 1).
  • Example 3 Generation and characterization of CAAP1 deficient cell lines HEK 293T cells were seeded in Nunc Cell-Culture Treated 6-well plates (Thermo Fisher Scientific) at a density of 1x106 cells/well. After 24 hours, cells were transfected using X-tremeGENE HP DNA Transfection Reagent (#06 366 236 001, Roche), according to the manufacturer’s instructions.
  • cells were transfected with 2 ⁇ g of packaging plasmid psPAX2 (#12260, 25 Addgene), 1 ⁇ g of the envelope plasmid pMD2.G (#12259, Addgene) and 2 ⁇ g of gRNA lentiviral construct in the final transfection volume of 200 ⁇ l/well (including X-tremeGENE HP DNA Transfection Reagent, used at 3:1 ratio), using OptiMEM (Thermo Fisher Scientific). After 48 hours, the supernatant was filtered using 0.45 ⁇ m cell strainers (BD Falcon).
  • HCC15 and NCI-H838 cell lines stably expressing Cas9 were cultured in RPMI-1640, (31870074, Thermo Fisher Scientific), supplemented with 1% GlutaMax (35050-038, Thermo Fisher 5 Scientific), 10% FCS, and 7 ⁇ g/ ⁇ l, and 5.5 ⁇ g/ ⁇ l of blasticidin (A1113903, Thermo Fisher Scientific), respectively.
  • CAAP1 KO cell lines 75000 cells/well were seeded in Nunc Cell-Culture Treated 6-well plates (Thermo Fisher Scientific), and 16 hours later the media was replaced with fresh media containing a pool of 3 CAAP1 gRNA expressing lentiviruses (see above, each diluted 1:250), and PolyBrene (TR-1003, Sigma-Aldrich). After 48 hours, transduced 10 cells were selected using puromycin (2 ⁇ g/ml for HCC15 and 1.5 ⁇ g/ml for NCI-H838).
  • CAAP1 gRNAs were selected from the whole genome Yusa library (CAGGAGCTCTAACTGTTCC, TTAGTGGAAGTGTCACCGG), and the whole genome Vienna library (AGAGAATAAGCAACCTGA).
  • Control cells were transduced with a lentivirus expressing a non-targeting control gRNA sequence (063-1010-000-000, Synthego). 15 Cells were collected and lysed in RIPA buffer (TF 89901; with complete protease and phosphatase inhibitors (Sigma).
  • Protein lysates were normalised for protein content (Biorad, #5000002) and boiled in LDS/reducing agent (TF NP0007/NP0004) before loading 20 ⁇ g onto 4- 12% BIS-TRIS gels (Invitrogen) for SDS-PAGE. Gels were transferred to nitrocellulose using iBlot2 (TF) and probed with antibodies. Immunostaining was visualised by HRP-labelled 20 secondary antibodies (Jackson ImmunoResearch) and enhanced chemiluminescence (ThermoFisher #34075) using a 16bit CCD camera (Syngene GBOX).
  • CAAP1 (Atlas/Merck #HPA024029), GAPDH (CST #97166) and Vinculin (Sigma #SAB4200729. Results Upon genetic modification using CRISPR-Cas9 technology, expression levels of CAAP1 protein25 of HCC15 NTC (HCCNTC), HCC15 CAAP1 KO (HCCKO), NCI-H838 NTC (H838NTC) and NCI- H838 CAAP1 KO (H838KO) were assessed by Western Blot as shown in Figure 6. Significant decrease in CAAP1 protein expression levels was detected in HCCKO vs HCCNTC whereas no CAAP1 protein could be detected in H838KO cells.
  • Example 4 The effect of PRMT5 inhibition on CAAP1 null cell lines in vitro 30 HCC15 cell lines were originally obtained from ATCC and were grown in RPMI-1640 growth media (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS) and 2 mM glutamine at 37°C, 5% CO2. Cells were dosed with PRMT5 inhibitor 2, MRTX-1719 or GSK3326595 inhibitor in a 6 well plate (Corning) at doses of 0.1, 0.3 ⁇ M or 1 ⁇ M using the HP D300e Digital Dispenser (HP Life Science Dispensing).
  • FBS fetal bovine serum
  • Live-cell imaging was acquired at 10x magnification at every 8h 35 and cell confluency were quantified using incucyte S32022B software (Essen Bioscience). Cell growth was quantified using percentage phase confluency.
  • Cells were plated in a 6 well plate and treated with 0.1 ⁇ M, 0.3 ⁇ M or 1 ⁇ M PRMT5 inhibitor 2. After 4 days of treatment, cells were collected using TrypLE (TF #12604013) in a 96 well v-bottom plate. Cells were spun down (1600rpm for 4mins) in a centrifuge and supernatant was discarded. Cell pellets were stained using the dead cell apoptosis kit (TF #V13241) according to 5 manufacturer's instructions.
  • CAAP1 deficiency also increased 20 sensitivity to an additional MTA cooperative PRMT5 inhibitor, MRTX-1719 (Figure 9A), as well as to 1 st generation PRMT5 inhibitor GSK3326595 ( Figure 9B), suggesting that CAAP1 deletion is a biomarker of sensitivity to both MTA-cooperative and non-MTA-cooperative PRMT5 inhibitors.
  • MRTX-1719 is the codename for the compound (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin- 25 6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile:
  • Example 5 The effect of PRMT5 inhibition on CAAP1 null tumour growth in PDX models Tumour xenograft fragments from human lung, gastric, oesophageal, pancreatic, bladder and head and neck cancers were grafted subcutaneously at the right flank of the mice. When the 30 tumors reached 100-200mm 3 , mice were randomized into two groups with half administered PRMT5 inhibitor 2, and half administered vehicle.
  • PRMT5 inhibitor 2 was administered orally at a dose of 100mg/kg BID for a period of up to 63 days.
  • Tumours were characterised as either CAAP1 wild-type (WT) or CAAP1 null. Tumour growth in vivo was measured for up to 63 days post dosing start and tumour growth index was calculated. 5 Results 81 different PDX (patient derived xenograft) models were exposed to treatment with PRMT5 inhibitor 2. A control arm cohort were grafted and administered vehicle.
  • CAAP1 null PDX models demonstrated regression in response to PRMT5 inhibitor 2 treatment.
  • 6 CAAP1 null models were driven to stasis (defined as 0-20% of 10 tumor growth relative to vehicle) upon PRMT5 inhibitor 2 treatment and the remaining 6 CAAP1 null PDX models showed an extent of tumour growth inhibition with PRMT5 inhibitor 2 treatment ( Figures 10 and 11). These results demonstrate the potential for PRMT5 inhibitor monotherapy treatment of CAAP1 null tumours.
  • B296, M1030, CTG-1076 and M425 are codenames for bladder cancer PDX models.
  • LD2-0017- 15 201064 and LD1-0017-200808 are codenames for gastric cancer PDX models.
  • CTG-2986 and LD1-0023-200615 are codenames for head and neck cancer PDX models.
  • LD1-0025-200629, LD1-0025-360765, LD1-0025-360961 and CTG-3196 are codenames for lung cancer PDX models.
  • LD2-0033-200923, LD2-0033-200926 and LD2-0033-200938 are codenames for pancreatic cancer PDX models.
  • 20 CAAP1 null tumour size was measured twice a week in the control group cohort and PRMT5 inhibitor 2 treatment arm. All CAAP1 null PDX models showed growth following implantation in control animals ( Figure 12A-12F).
  • mice were divided into 8 groups and then administered vehicle or PRMT5 inhibitor 1 (at three 15 individual dose levels: 50mg/kg BID, 10mg/kg BID, 1mg/kg BID), GSK3326595 (at three dose levels 100mg/kg BID, 10mg/kg BID, 1mg/kg BID) or JNJ64619178 (10mg/kg QD).
  • PRMT5 inhibitor 1 at three 15 individual dose levels: 50mg/kg BID, 10mg/kg BID, 1mg/kg BID
  • GSK3326595 at three dose levels 100mg/kg BID, 10mg/kg BID, 1mg/kg BID
  • JNJ64619178 10mg/kg QD.
  • the highest dose of all compounds used in the study induced tumour regression in this CAAP1-null PDX model indicating that CAAP1 loss can sensitise a tumour to treatment with both 1 st generation (non-MTA synergistic) and 2

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

This specification relates to a PRMT5 inhibitor for use in the treatment of a tumour, wherein the tumour cells have been identified as being CAAP1-null or CAAP1-deficient. Methods for identifying patients having cancers that will be sensitive to treatment with a PRMT5 inhibitor and methods of treating cancer are also disclosed. The specification also relates to a MAT2A inhibitor for use in the treatment of a tumour, wherein the tumour cells have been identified as being CAAP1-null or CAAP1-deficient are also disclosed.

Description

CANCER THERAPY The present specification claims benefit of priority to UK Patent Application No.2302018.3, filed 13 February 2023, and Taiwanese Patent Application No.113105079, filed 07 February 2024, 5 the contents of which are hereby incorporated by reference in their entirety for all purposes. TECHNICAL FIELD This specification relates to the use of CAAP1 as a novel biomarker for identifying patients having a cancer that will be sensitive to treatment with an agent that inhibits PRMT5. The specification also relates to the treatment of CAAP1-deficient or CAAP1-null tumours using a PRMT5 inhibitor. 10 The specification also relates to the treatment of CAAP1-deficient or CAAP1-null tumours using a MAT2A inhibitor. Analytical/diagnostic tests and test kits for the detection of CAAP1-deficient or CAAP1 null tumours are also provided. BACKGROUND Protein arginine methyltransferase 5 (PRMT5) is a member of the PRMT family of arginine 15 methyltransferase enzymes that catalyse the addition of methyl groups to the guanidine motif of arginine residues, using S-adenosyl-L-methionine (SAM) as methyl donor. PRMT5 is a type II arginine methyltransferase that symmetrically dimethylates the guanidine group of arginine residues thus converting a guanidine NH2 group of arginine to a NMe2 group. PRMT5 methylates a number of diverse substrates including histone and non-histone proteins, and in so doing 20 regulates processes such as RNA splicing, DNA repair and cellular proliferation. Significantly, PRMT5 is overexpressed in various cancer types and has been identified as a candidate for therapeutic intervention through the development of small molecules that inhibit PRMT5 methyltransferase activity (see e.g. Kim et al., (2020) Cell Stress 4(8) 199-2151). A number of first generation (non-MTA selective) PRMT5 inhibitors have entered clinical trial 25 including Johnson & Johnson’s onametostat (JNJ-64619178), GSK’s pemrametostat (GSK3326595, EPZ015938), Pfizer’s PF-06939999, and Prelude Therapeutics’ PRT811 and PRT543. Cyclin dependent kinase inhibitor 2A (CDKN2A) is a tumour suppressor gene that is homozygously deleted in approximately 15% of cancers. Loss of the 9p21 chromosome locus 30 (where CDKN2A resides) results in the co-deletion of additional genes including the gene MTAP encoding methylthioadenosine phosphorylase (MTAP). MTAP is a metabolic enzyme involved in methionine salvage. Loss of MTAP results in increased concentrations of the MTAP substrate methylthioadenosine (MTA) in CDKN2A/MTAP deleted cancer cells. MTA itself acts as a weak PRMT5 inhibitor and MTA accumulation in CDKN2A/MTAP deleted cancer cell lines accordingly 35 leads to a partial inhibition of PRMT5 activity. Compromised PRMT5 activity renders CDKN2A/MTAP deleted cancer cells susceptible to further targeting of PRMT5, for example using short hairpin RNA (shRNA). A “collateral vulnerability” in cancer, where CDKN2A/MTAP deleted tumours may be selectively targeted through PRMT5 inhibition, has been identified (see Marjon et al., (2016) Cell Reports 15, 574-587; Mavrakis et al., (2016) Science 11;351(6278):1208-13; 5 Kryukov et al., (2016) Science 11;351(6278):1214-8). Recently, reports of MTA-synergistic PRMT5 inhibitors, i.e. PRMT5 inhibitors that bind to PRMT5 preferentially in the presence of MTA, have emerged (see e.g. WO2022026892A1, WO2022115377 and WO2021163344). These MTA-synergistic PRMT5 inhibitors are designed to exploit the “collateral vulnerability” arising from CDKN2A/MTAP gene deletion described in the10 literature. Several “MTA-synergistic” PRMT5 inhibitors have entered clinical trials, such as MRTX- 1719 (NCT05245500); TNG-908 (NCT05275478); TNG-462 (NCT05732831); AMG-193 (NCT05094336, NCT05094336); and AZD3470 (NCT06130553; NCT06137144). Significantly, MTA-synergistic PRMT5 inhibitors exert a greater inhibitory effect on PRMT5, in environments where relatively high concentrations of MTA are present, such as that found in 15 CDKN2A/MTAP deleted tumour cells, but not in healthy tissues where elevated concentrations of MTA are not present and where inhibition of PRMT5 would otherwise result in toxic side effects. Consequently, MTA-synergistic PRMT5 inhibitors should possess a high therapeutic index, with greatly reduced on-target toxicity in healthy cells relative to first generation PRMT5 inhibitors, as their anti-proliferative activity will selectively manifest in the targeted, MTA rich, environment of 20 CDKN2A/MTAP deleted tumour cells. There is a need for the identification of novel biomarkers that will allow the stratification of patients with tumours that are sensitive to PRMT5 inhibitors, enabling precision anti-cancer treatment and improved therapeutic efficacy and clinical outcomes. Reference to tumours herein and above will be understood to be references to malignant tumours 25 (i.e. cancers) that require therapeutic intervention. Furthermore, reference to cancers herein and above encompass solid and haematological cancers. Reference to CAAP1-null tumours or cancers as used herein and above refers to cells in which the CAAP1 gene has been homozygously deleted and in which the CAAP1 gene is not present, and therefore the tumour cells do not express any CAAP1 protein. 30 Likewise, reference to MTAP-null tumours or cancers as used herein and above refers to those tumours or cancers in which the MTAP gene has been homozygously deleted and in which the MTAP gene is not present, and therefore the tumour cells do not express any MTAP protein. SUMMARY According to a first aspect, the specification provides a PRMT5 inhibitor for use in the treatment 35 of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient. According to a second aspect, the specification provides a method for identifying a cancer patient having a cancer that is sensitive to treatment with a PRMT5 inhibitor, comprising the step(s) of: i. detecting the presence or absence of CAAP1 protein in a sample obtained from the patient, and/or 5 ii. determining that the cancer is CAAP1-null, by analysing a sample obtained from the patient, wherein if the detection of step i) reveals there is no, or significantly reduced, CAAP1 protein present in the sample; and/or if the determination of step ii) reveals that the cancer is CAAP1- null; then the patient is identified as having a tumour that is sensitive treatment with a PRMT5 10 inhibitor. A third aspect of the specification is directed to an in vitro diagnostic test for detecting CAAP1 protein in a tumour sample obtained from a cancer patient or for establishing the CAAP1-null status of a tumour from a sample obtained from a cancer patient. A fourth aspect of the specification is directed to the use of CAAP1 protein or the polynucleotide 15 encoding the CAAP1 gene as a biomarker for identifying a cancer that will be sensitive to treatment with a PRMT5 inhibitor. A fifth aspect of the specification provides a method of treatment of cancer, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s tumour has been characterised as being CAAP1-deficient or the patient’s 20 cancer has been characterised as being CAAP1-null. In a related aspect the specification provides a method of treatment of cancer, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient has a cancer that has been determined to be CAAP1-deficient or CAAP1-null. A sixth aspect of the specification provides a method of treating a cancer patient comprising the 25 steps of: i. obtaining a biological sample from the patient; ii. detecting the expression of CAAP1 protein in the sample and/or determining that the patient has a cancer that is CAAP1-null by analysing the sample; iii. characterising the patient’s cancer as being sensitive to treatment with a PRMT5 30 inhibitor if a) reduced levels of, or no, CAAP1 protein is detected in the sample or b) if the cancer is determined to be CAAP1-null; and iv. administering a therapeutically effective amount of a PRMT5 inhibitor to the patient if the cancer is characterised as being sensitive to treatment with a PRMT5 inhibitor in step iii. A seventh aspect of the specification is directed to the use of a PRMT5 inhibitor for the manufacture of a medicament for the treatment of cancer, wherein the medicament is for use in the treatment of cancers that have been identified as being CAAP1-null or CAAP1-deficient. An eighth aspect of the specification provides a pharmaceutical composition comprising a PRMT5 5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient. A ninth aspect of the specification provides a MAT2A inhibitor for use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient. A tenth aspect of the specification provides a kit comprising a PRMT5 inhibitor or a MAT2A 10 inhibitor and instructions for their use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient. DESCRIPTION OF THE FIGURES Figure 1 is a bar graph showing the efficiency of Caspase 9 (Cas9) activity in NCI-H838, LU99, SW1573, HCC-15, NCI-H1650 and NCI-H2126 human lung cancer cell lines transduced with a 15 Caspase 9 lentivirus. Figure 2 is a bar chart demonstrating the percentage of BFP-positive (BFP+) cells following transduction with a genome-wide gRNA lentiviral library, with vectors including BFP. Puromycin (Puro) was used to select for transduced cells. By 8 days post-transduction over 50% of puromycin treated cell populations express BFP in all cell lines tested. 20 Figure 3 is a heatmap highlighting PRMT5 inhibitor sensitizer hits, following a CRISPR/Cas9 genome-wide screen. Black boxes indicate a significant difference in sgRNA count between cell populations treated with PRMT5 inhibitor 1 and untreated controls. PRMT5 inhibition correlates with significantly lower CAAP1 sgRNA counts in NCI-H838, HCC-15 and NCI-H2126 cell populations. 25 Figure 4 is a collection of violin plots showing the normalised CAAP1 sgRNA counts at baseline and following treatment with either vehicle (DMSO) or PRMT5 inhibitor 1 in A) NCI-H838, B) LU99, C) SW1573, D) HCC-15, E) NCI-H1650 and F) NCI-H2126 cell cultures. Figures 4A, 4D and 4F show significantly (indicated by *) lower CAAP1 sgRNA counts in PRMT5 inhibitor treated NCI-H838, HCC-15 and NCI-H2126 cells, respectively, when compared to sgRNA counts in 30 vehicle (DMSO) treated cultures. Figure 5 is a series of line graphs showing the time taken for A) NCI-H383, B) LU99, C) SW1573, D) HCC-15, E) NCI-H1650, F) NCI-H2126 cell cultures, to reach 10 doublings when treated with (X) or without (•) PRMT5 inhibitor 1. No cultures administered with PRMT5 inhibitor 1 reached 10 doublings within 14-34 days of treatment. Figure 6 is a representation of Western Blot results showing the levels of CAAP1 protein in HCC15 and NCI-H838 cell lines upon CRISPR-Cas9 genetic modification using gRNAs against non targeting control (NTC) and against CAAP1 (KO). Actin was used as a loading control. Figure 7 is a series of line graphs showing cellular confluency of NTC and CAAP1 KO cells upon 5 treatment with DMSO (●, ○), 0.1 μM ( , ), 0.3μM PRMT5 inhibitor 2 (■, □) and 1μM PRMT5 inhibitor 2 (▲,∆ ) respectively. Figure 7A represents confluency of HCC15 cell lines and Figure 7B confluency of NCI-H838 cell lines. Figure 8 is a series of bar charts representing A) percentage of apoptotic cells (mean of 3 experiments , error bars represent SEM), measured by AnexinV assay, and B) total cell counts 10 (mean of three experiments, error bars represent SEM) upon treatment of HCC15 NTC (solid bars) and HCC15 CAAP1 KO (dashed bars) cells with DMSO and indicated doses of PRMT5 inhibitor 2. Figure 9 is a series of line graphs showing cellular confluency of HCC15 NTC and HCC15 CAAP1 KO cells upon treatment with DMSO (●, ○), 0.1 μM ( , ), 0.3μM (■, □) and 1μM (▲,∆ ) A) 15 MRTX-1719 or B) GSK3326595. Figure 10 is a waterfall plot showing tumour growth, stasis or regression following the treatment of PDX (patient derived xenograft models) obtained from human lung (LU), gastric (GA, STO), oesophageal (ES), head and neck (HN), pancreatic (PA) and bladder (BL) tumour tissue. Bars represent tumour volume in mice treated with PRMT5 inhibitor 2, relative to the tumour volume in 20 vehicle treated control mice after grafting or the initial grafted tumour volume. 14/26 (53.84%) CAAP1 null PDX models (dashed bars) show regression in response to PRMT5 inhibitor 2 treatment (where 100% represents lack of tumour growth inhibition upon treatment and negative values represents regression, stasis is defined as 0-20% of tumour growth relative to vehicle). However, only 16/55 (29.09%) CAAP1 wild-type expressing PDX models (solid black bars) show 25 regression in response to PRMT5 inhibitor 2 treatment. The remaining 39/55 CAAP1 wild type and 12/26 CAAP1 null tumours show an extent of tumour growth inhibition after treatment with PRMT5 inhibitor 2. Figure 11 is a waterfall plot showing the growth of CAAP1 null human cancer tissue, transplanted into mice (PDX), after treatment with PRMT5 inhibitor 2. Tumour volume is relative to tumour 30 growth in vehicle treated control mice or the initial grafted tumour volume (where 100% represents lack of tumour growth inhibition and negative values represents regression).14/26 PDX models show regression in response to PRMT5 inhibitor 2 treatment, the remaining 12 tumour graft show an extent of tumour growth inhibition after treatment with PRMT5 inhibitor 2 with 6 models in which this treatment is inducing stasis in response to PRMT5 inhibitor 2 treatment. 35 Figure 12 is a series of line graphs demonstrating mean relative tumour volume (± SEM) of human CAAP1 null PDX models in vehicle treated control (○) and PRMT5 inhibitor 2 (□) treated mice. Figures 12A-C, Figures 12D/E and Figure 12F represent the growth of tumours derived from lung (LU), oesophageal (ES) and gastric (GA) cancers, respectively.5/6 PDX models show regression in response to PRMT5 inhibitor 2 treatment, as shown in Figures 12B-F. Figure 12A shows the stasis of tumour LU5165 in response to PRMT5 inhibitor 2 treatment. All vehicle treated 5 control animals show tumour growth. Figure 13 is a series of line graphs demonstrating mean relative tumour volume (± SEM) of human CAAP1 null PDX models in vehicle treated control (○) and PRMT5 inhibitor 2 (□) treated mice. Figures 13A-B, and Figure 13C represent the growth of tumours derived from lung (LU) and oesophageal (ES) cancers, respectively. Figure 13A-B show the duration of regression upon 10 PRMT5 inhibitor 2 treatment cessation. Figure 13C shows the response of the PDX model upon re-challenging with PRMT5 inhibitor 2. All vehicle treated control animals show tumour growth. Grey shaded area represents treatment duration. Figure 14 is a series of line graphs demonstrating mean relative tumour volume (± SEM) of human CAAP1 null PDX models. Figures 14A and 14B represent the growth of tumours derived 15 from lung (LU) and oesophageal (ES) cancers, respectively, in vehicle treated control ( ) and AG-270 (a MAT2A inhibitor) treated mice ( ), as described in Kalev et al., 2021, Cancer Cell, 39, 209-224. Figures 14C and 14D represent the growth of tumours derived from the same lung (LU) and oesophageal (ES) cancers, respectively, in vehicle controlled ( ) and PRMT5 inhibitor 2 ( ) treated mice. Both PDX models show regression following either PRMT5 inhibitor 20 2 treatment or MAT2A treatment, as shown in Figures 14A-D. Figure 15 is a line graph representing mean tumour volume (± SEM) of GA2254 CAAP1 null PDX model in a vehicle treated control ( ), mice treated with 100mg/kg BID of GSK3326595 ( ), 10mg/kg BID GSK3326595 ( ), 1mg/kg BID GSK3326595 ( ), 50mg/kg BID PRMT5 inhibitor 1 BID inhibitor 1 ( ), 1mg/kg BID PRMT5 inhibitor 1 ( ) and 10mg/kg 25 . The top dose of all three compounds (PRMT5 inhibitor 1, GSK3326595, JNJ64619178) induce tumour regression. N=10 mice per treatment arm. Figure 16 is a series of line graphs demonstrating tumour volume of vehicle ) and MRTX-1719 treated ( ) PDX models (PA0372, LU6408 and GA2254). Figure 17 shows the proximity of MTAP, CDKN2a and CAAP1 on chromosome 9. 30 DETAILED DESCRIPTION The present inventors have discovered that CAAP1-null tumours, those tumours in which the CAAP1 gene is not present (i.e. where there is a homozygous loss/deletion of CAAP1-gene), or CAAP1-deficient tumours, those tumours in which CAAP1 protein is significantly reduced or is absent, are sensitive to treatment with a PRMT5 inhibitor. Absence or significant reduction of functional CAAP1 protein may result from a deletion of the CAAP1 gene, a loss of function-related alteration in the CAAP1 gene, or in its regulatory or promoter sequences, or through epigenetic silencing of the CAAP1 gene. Tumours in which CAAP1 protein is absent or significantly reduced can be termed CAAP1-deficient. For the avoidance of doubt, reference to CAAP1-deletion and 5 CAAP1-null herein collectively or individually relate to those tumours sensitised to PRMT5 inhibition as a result of the homozygous deletion of CAAP1, whilst references to CAAP1-deficient or CAAP1-deficiency herein relate to tumours that are characterised by having significantly reduced expression or absence of CAAP1-protein in the tumour. It is therefore an object of the present specification to utilise CAAP1 protein or CAAP1 gene status as a novel biomarker, to 10 allow for the stratification of cancer patients having tumours that are sensitive to PRMT5 inhibitors, enabling precision anti-cancer treatment, improved therapeutic efficacy and clinical outcomes. As such, the present specification provides new approaches for treating cancer that exploit this hitherto unrealised sensitisation of CAAP1-deficient tumours to PRMT5 inhibitor treatment. Advantageously, monotherapy with PRMT5 inhibitors has been identified as a potentially effective 15 option for the treatment of CAAP1-null tumours. A monotherapy approach, i.e. treatment of a cancer with a PRMT5 inhibitor in the absence of any other anti-cancer drugs, can be beneficial for patients as it decreases the risk of harmful side-effects of multiple cancer therapies, the complications of potential drug-drug interactions, avoids the need to multiple drugs to be administered including administration on different dosing schedules and is more cost-effective for 20 healthcare providers. Combination therapy of CAAP1-null cancers with a PRMT5 inhibitor and a further anti-cancer agent is also envisaged. The terms "patient" and “subject” are used interchangeably herein and refer to any animal (e.g. mammal), including, but not limited to, humans, non-human primates, canines, felines, rodents and the like. Typically, the term "patient" is used herein in reference to a human subject, and in 25 particular, a subject who has been diagnosed as having a cancer. The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals in which a population of cells are characterised by unregulated cell growth and tumour formation. As noted above, the term “cancer” encompasses solid and haematological cancers. The terms "cancer cell", “cancer”, "tumour cell" and “tumour” are used interchangeably herein and 30 refer to the total population of cells derived from a tumour or a pre-cancerous lesion. As used herein, the terms “treat,” “treating” and “treatment” refer to an action that reduces the severity of a disease, disorder or condition, or slows the progression of the disease, disorder or condition. As used herein, the terms “sample” or “biological sample” can refer to tumour tissue or tumour cells obtained from biopsy, blood or blood components (e.g. plasma), and circulating tumour DNA (ctDNA) isolated from blood or blood components. Methods for obtaining and preserving a tissue sample (biopsy) or blood sample (phlebotomy) from a patient will be apparent to the skilled 5 person. The most suitable biopsy methods will vary, depending on the nature and location of the tumour. As used herein, "PRMT5" refers to the gene or protein known as Protein Arginine Methyltransferase 5, also known as HRMT1L5; IBP72; JBP1; SKB1; or SKB1Hs External IDs: OMIM: 604045, MGI: 1351645, HomoloGene: 4454, ChEMBL: 1795116, GeneCards: PRMT5 10 Gene; EC number 2.1.1.125. Ensembl ENSG00000100462; UniProt O14744; Entrez Gene ID: 10419; RefSeq (mRNA): NM_001039619. The mouse homolog is NM_013768. The term “PRMT5 inhibitor” refers to any compound capable of inhibiting the production, level, activity, expression or presence of PRMT5. These include, as non-limiting examples, any compound inhibiting the transcription of the gene, inhibiting the maturation of RNA, inhibiting the 15 translation of mRNA, inhibiting the posttranslational modification of the protein, inhibiting the enzymatic activity of the protein, or inhibiting the interaction of same with a substrate, etc. The term also refers to any agent that inhibits the cellular function of the PRMT5 protein, either by ATP-competitive inhibition of the active site, allosteric modulation of the protein structure, disruption of protein-protein interactions, or by inhibiting the transcription, translation, post- 20 translational modification, or stability of PRMT5 protein. The PRMT5 inhibitor may, or may not, compete with another compound, protein or other molecule which interacts with PRMT5 and is necessary for PRMT5 function. For example, in some embodiments a PRMT5 inhibitor may compete with the co-factor S-adenosylmethionine (also known as SAM or AdoMet). In some embodiments, a PRMT5 inhibitor is uncompetitive with 25 methylthioadenosine (MTA). In some embodiments, the PRMT5 inhibitor is uncompetitive with MTA and competitive with SAM. In some embodiments, the PRMT5 inhibitor is uncompetitive with MTA and uncompetitive with SAM but binds with a higher degree of potency for the MTA complex relative to the SAM complex. In some embodiments, the PRMT5 inhibitor’s potency as an inhibitor of PRMT5 is enhanced when the inhibitor binds to PRMT5 in conjunction with MTA. In such 30 embodiments, the inhibitory activity of the PRMT5 inhibitor when it is bound to PRMT5 in conjunction with MTA is 10-fold greater, for example 20-fold greater, 30-fold greater or more, than that observed when the PRMT5 inhibitor binds to PRMT5 without MTA, such PRMT5 inhibitors are referred to as MTA-synergistic inhibitors herein. By way of a non-limiting example, the inhibitory activity of the PRMT5 inhibitor can be measured 35 using the MTase-Glo enzymatic assay protocol, which is described below, and also in WO2020205660 (incorporated herein by reference). Further assays that can be used to evaluate PRMT5 inhibitory activity and MTA selectivity are described in PCT/EP2022/075248 (also incorporated herein by reference). Mtase-Glo enzymatic assay protocol: Inhibitor compounds are serial diluted by 5-fold to the desired concentrations in DMSO. Inhibitors 5 are added into reaction buffer (30 mM Tris-HCl at pH 7.4, 500 mM NaCl, 2 mM MgC12, 2 mM TCEP, 0.1% (wt/vol) BSA and 0.01% (vol/vol) Tween-20) with final DMSO concentration at 2% (vol/vol). The enzymatic inhibition assay is performed in a solid white low-volume 384-well plate (Greiner, #7784075) with total reaction volume of 16 pi and in the presence of 100 nM PRMT5:MEP50 enzymes, 10 mM SAM (Sigma- Aldrich, A4377), 2 mM substrate histone H4 (1- 10 21) (ANASPEC, #AS-62499) and test compounds at indicated concentrations. Reactions without enzyme are conducted as negative control and reactions without compound are performed as positive control in every experiment. Methyltransferase reaction was started by adding 4 uL of SAM/H4 substrate mixture to each well that contains 8 uL enzyme and 4 uL test compound which are pre-mixed and incubated for 10 min. The reaction is performed at room temperature for 60 15 min followed by the addition of 4 uL 5X Mtase-Glo Reagent to produce SAH and concomitantly convert it to ADP. Mix the plate by shaking for 2 min, and incubate at room temperature for 30 min. Then, 20 uL room-temperature Mtase-Glo Detection Solution is added and mixed well before incubating for another 30 min and recording luminescence. Luminescence can be measured using the Synergy Neo2 HTS multimode microplate reader (BioTek). 20 The first generation of PRMT5 inhibitors were non-MTA selective and their clinical utility was impaired due to their limited therapeutic window resulting from the adverse events observed in patients in clinical trials believed to result from on-target activity (i.e. PRMT5 inhibition) in healthy tissue. However, the present specification provides a means of using these 1st generation drugs in a more targeted way, by using them to treat tumours that have been specifically characterised 25 as being sensitive to PRMT5 inhibitors, thereby increasing the chance of successful treatment outcomes and decreasing the risk of adverse effects. Examples of so-called 1st generation PRMT5 inhibitors include, but are not limited to, onametostat JNJ-64619178); pemrametostat (GSK3326595, EPZ015938); PF-06939999; PRT811; PRT543; and GSK2303591 (EPZ015866). 30 Onametostat (also known as JNJ-64619178) is the compound with the following structure: . Pemrametostat (also known as GSK3326595 or EPZ015938) is the compound with the following structure: . PF-06939999 is the codename for the compound with the following structure: 5 . GSK2303591 (also known as EPZ015866) is the codename for the compound with the following structure: . The second generation of PRMT5 inhibitor drugs are MTA-synergistic inhibitors, which bind to 10 PRMT5 preferentially in the presence of MTA. These MTA-synergistic PRMT5 inhibitors are designed to exploit the “collateral vulnerability” arising from CDKN2A/MTAP gene deletion, as described above. Examples of so-called 2nd generation PRMT5 inhibitors include, but are not limited to, PRMT5 inhibitor 1, PRMT5 inhibitor 2 and compounds disclosed in WO2022026892, WO2022115377 and 15 WO2021163344 (the content of these patent publications is incorporated by reference herein). Other examples of 2nd generation PRMT5 inhibitors include, but are not limited to CN202310191381, WO2021086879, WO2021050915, WO2022192745, WO2023278564, WO2022132914, WO2022169948, WO2023081367, WO2023098439, WO2023098439, WO2023143210, WO2023125540, WO2023174250 and WO2023207556 (the content of these 20 patent publications is incorporated by reference herein). In embodiments, the PRMT5 inhibitor is selected from a PRMT5 inhibitor disclosed in CN202310191381, WO2021086879, WO2021050915, WO2022192745, WO2023278564, WO2022132914, WO2022169948, WO2023081367, WO2023098439, WO2023098439, WO2023143210, WO2023125540, WO2023174250 or WO2023207556. In embodiments, the PRMT5 inhibitor is selected from the following: onametostat JNJ-64619178); pemrametostat (GSK3326595, EPZ015938); PF-06939999; PRT811; PRT543; GSK2303591 (EPZ015866); PRMT5 inhibitor 1; PRMT5 inhibitor 2; or any of the PRMT5 inhibitors disclosed in WO2022026892, WO2022115377 and WO2021163344 (the content of these patent publications is incorporated by reference herein). In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor as disclosed in WO2023/036974 (the content of which is incorporated by reference herein). In embodiments, the PRMT5 inhibitor is a compound of formula (I): wherein: the ring containing X and Y is a pyrrole and X is NH and Y is CH or X is CH and Y is NH; Z is selected from CH, CF, CCl or, if Q is not N, N; Q is selected from CH, CF, CCl or, if Z is not N, N; m is 0, 1 or 2; n is 0, 1 or 2; p is 1 or 2; R1 is in each occurrence independently selected from F, Cl, CN, Me, CF3, C1-C3 alkyl, cyclopropyl, C1-C3 fluoroalkyl, OMe or C1-C3 alkoxy; R2 is in each occurrence independently selected from F, Cl, Me, MeO and CF3; R3 is H, Me, C1-C3 alkyl or C1-C3 fluoroalkyl; R4 is H, Me or C1-C3 alkyl; R5 is H, Me, C1-C3 alkyl, C1-C3 fluoroalkyl, CH2OMe, CH2OCHF2, CH2OCF3, CH2O(C1-C3 alkyl), CH2O(C1-C3 fluoroalkyl), C(CH2CH2)R6, CCR7, CH2R8, R9 or CH2R10; R6 is H, Me, CH2F, CHF2, CF3, CH2OH or CH2OMe; R7 is H, Me, cyclopropyl, C1-C3 alkyl, C1-C3 fluoroalkyl, C3-C6 cycloalkyl or a 5-membered heteroaryl group optionally substituted with Me, C1-C3 alkyl, F or Cl; R8 is a 5-membered heteroaryl optionally substituted with Me, C1-C3 alkyl, F or Cl; R9 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group; and R10 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group, or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is a compound of formula (I). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I). In embodiments, the PRMT5 inhibitor is selected from the group consisting of: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(prop-2-yn-1-yl)spiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(3-(1-methyl-1H- pyrazol-4-yl)prop-2-yn-1-yl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-4-((2-((5-amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-2’,3-dioxospiro [isoindoline-1,3’-pyrrolidin]-1’-yl)methyl)-2-fluorobenzonitrile; (S)-1’-(3-(2H-1,2,3-Triazol-2-yl)benzyl)-2-((5-amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(2,5-difluorobenzyl)-5- fluorospiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(2,2-difluoroethyl)-5-fluorospiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-((1-(fluoromethyl) cyclopropyl)methyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’- methylspiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(2-(difluoromethoxy)ethyl)-5- fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-((3-fluoropyridin-2- yl)methyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; 5 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(isoxazol-5-ylmethyl) spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-((5-(trifluoromethyl) pyridazin-3-yl)methyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-((1-methyl-1H-indazol- 10 5-yl)methyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(benzo[d]oxazol-2-ylmethyl)-5- fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(2-(4-fluorophenoxy) ethyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; 15 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(2-(4-methylthiazol-5- yl)ethyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-((R*)-1-(1- methylcyclopropyl)ethyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(3-cyclopropylprop-2-yn-1-yl)-5- 20 fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-4-chloro-1’-(4-fluorobenzyl)spiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2’-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1-(4- fluorobenzyl)spiro[pyrrolidine-3,1’-pyrrolo[3,4-c]pyridine]-2,3’(2’H)-dione; 25 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’,7-dimethylspiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-7-methoxy-1’-methylspiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2’-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1-(4- 30 fluorobenzyl)spiro[pyrrolidine-3,3’-pyrrolo[3,4-c]pyridine]-1’,2(2’H)-dione; (S)-5-Amino-2-((5-fluoro-1’-((1-methylcyclopropyl)methyl)-2’,3-dioxospiro[isoindoline-1,3’- pyrrolidin] -2-yl)methyl)-1H-pyrrolo[3,2-b]pyridine-7-carbonitrile; (S)-2-((5-Amino-6-chloro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(2-(trifluoromethoxy) ethyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; (S)-2-((6-Amino-4-methyl-1H-pyrrolo[2,3-b]pyridin-2-yl)methyl)-5-fluoro-1’-(2,4,5-trifluorobenzyl) spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione; and 5 (1S,5’S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’,5’-dimethylspiro [isoindoline-1,3’-pyrrolidine]-2’,3-dione; or a pharmaceutically acceptable salt of any one thereof. PRMT5 inhibitor 1 has the following structure and is described as Example 1 in PCT/EP2022/075248, filed 12 September 2022 and published as International Publication 10 Pamphlet WO2023/036974: PRMT5 inhibitor 1: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4- fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): . 15 In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1), or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- 20 yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): 5 inhibitor 1). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6- fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’- pyrrolidine]-2’,3-dione): 5 inhibitor 1). PRMT5 inhibitor 2 has the following structure and is described as Example 2 in PCT/EP2022/075248, filed 12 September 2022 and published as International Publication Pamphlet WO2023/036974. PRMT5 inhibitor 2: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1- 10 yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: . In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: (PRMT5 inhibitor 2), 15 or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: inhibitor 2). 5 In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6- fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’- pyrrolidine]-2’,3-dione: inhibitor 2). 10 In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022169948, WO2022192745, WO2022132914, WO2021086879, WO2021050915, WO2021055797, WO2020249663, WO2020206308, WO2020206289, WO2020206299, WO2020152557, WO2018085818, US20190284193, WO2019178368, WO2018085833, WO2018085818, WO2018075601, WO2017212385, WO2017218802, WO2017153186, WO2017032840, 15 WO2016135582, or WO2015198229. In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2021/050915 (the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is (P)-2-[4- [4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- fluoro-benzonitrile: 20 , or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl- pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (P)-2-[4-[4-(aminomethyl)- 5 1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . Suitably, the PRMT5 inhibitor is a hydrochloride salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H- phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . 10 In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor disclosed in WO2022/132914 (the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is (4-amino- 1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: , 15 or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- (trifluoromethyl)phenyl]morpholin-4-yl]methanone: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: 5 . In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022/026892 (the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is N-(6-amino- 5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2- oxoacetamide: 10 , or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is N-(6-amino-5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol- 5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: . 15 Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: . Suitably, the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: , 5 or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5-ethylpyridin-10 3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2- oxoacetamide: . As used herein, "CAAP1" refers to the gene (“CAAP1”) or protein (“CAAP1”) Caspase Activity and Apoptosis Inhibitor 1, also known as Conserved Anti-Apoptotic Protein (CAAP); C9orf82; or 15 FLJ13657. External IDs: HGNC: 25834, NCBI Entrez Gene ID: 79886, Ensembl: ENSG00000120159, UniProt/Swiss-Prot: Q9H8G2. RefSeq (mRNA): NM_024828; location: Chr 9: 26.84-26.90 Mb. By “wild-type” CAAP1 is meant that encoded by NM_ 024828 or having the same amino acid sequence (NP_ 001161047.1). There are two isoforms of CAAP1. Isoform 1 of the CAAP1 mRNA polynucleotide is referred to 5 herein as SEQ ID NO.1 and isoform 2 of the CAAP1 mRNA polynucleotide is referred to herein as SEQ ID NO.2. Isoform 1 of the CAAP1 polypeptide is referred to herein as SEQ ID NO.3 and isoform 2 of the CAAP1 polypeptide is referred to herein as SEQ ID NO.4. In embodiments, this specification provides a PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient. In this aspect of the 10 specification, the patient’s tumour has previously been characterised as being CAAP1-null or CAAP1-deficient, and therefore sensitive to a PRMT5 inhibitor drug. Therefore, in this aspect of the specification, CAAP1 (and, in particular, CAAP1-deficiency) is used as a novel biomarker for the stratification of cancer patients having tumours that are sensitive to PRMT5 inhibitors. Suitably, in one embodiment the cancer is identified as being CAAP1-null. Suitably, in one 15 embodiment the cancer is identified as being CAAP1-deficient. As used herein, the terms “CAAP1-deficient” and “CAAP1-deficiency” refer to tumour cells that do not express any CAAP1 protein, or functional CAAP1 protein, or have a significant reduction in post-translational modification, production, expression, level, stability and/or activity of CAAP1 relative to that in a control, e.g., reference or corresponding normal or non-cancerous cells. The 20 reduction can be a decrease in production, expression, level, stability and/or activity compared to a control, or in which the CAAP1 gene carries a loss of function alteration and therefore the tumour cells have an absence or significant reduction in functional CAAP1 protein expression. A tumour may, for example, be rendered CAAP1-deficient by virtue of epigenetic silencing of CAAP1 gene expression, such tumours can be termed CAAP1 gene silenced tumours. The CAAP1-deficiency 25 status can be determined by interpretation of an immunohistochemistry assay by a skilled pathologist. As used herein, the term “PRMT5 inhibitor sensitive” and the like refers to a tumour cell that is sensitised to, and therefore can be treated with, a PRMT5 inhibitor, due to the CAAP1-deficient character of the tumour cells. 30 “CDKN2A” refers to cyclin dependent kinase inhibitor 2A, also known as ARF; MLM; P14; P16; P19; CMM2; INK4; MTS1; TP16; CDK4I; CDKN2; INK4A; MTS-1; P14ARF; P19ARF; P16INK4; P16INK4A; and P16-INK4A. External IDs: HGNC: 1787; NCBI Entrez Gene: 1029; Ensembl: ENSG00000147889; OMIM: 600160; UniProtKB/Swiss-Prot: Q8N726; UniProtKB/Swiss-Prot: P42771. RefSeq (mRNA): NM_058195; location: Chr 9: 21.97-22.0 Mb. 35 By “wild-type” CDKN2A is meant that encoded by NM_ 058195 or having the same amino acid sequence (NP_ 000068.1). As explained above, CDKN2A is a tumour suppressor gene that is homozygously deleted in approximately 15% of cancers. Loss of the 9p21 chromosome locus (where CDKN2A resides) results in the co-deletion of additional genes including the gene MTAP encoding methylthioadenosine phosphorylase (MTAP). Figure 17 shows the proximity of MTAP, CDKN2A 5 and CAAP1 on chromosome 9. Therefore, in another embodiment, the patient’s tumour has previously been further characterised as being MTAP-null or MTAP-deficient. Suitably, the patient’s tumour has previously been further characterised as being MTAP-null. Suitably, the patient’s tumour has previously been further characterised as being MTAP-deficient. Suitably, the patient’s tumour has previously been further 10 characterised as being CAAP1-null and MTAP-null. “MTAP” refers to methylthioadenosine phosphorylase, also known as S-methyl-5'-thioadenosine phosphorylase, BDMF; DMSFH; DMSMFH; LGMBF; MSAP; and c86fus. External IDs: OMIM: 156540 MGI: 1914152 HomoloGene:1838 chEMBL: 4941 GeneCards: MTAP Gene; Entrez 4507; RefSeq (mRNA): NM_002451; location: Chr 9: 21.8–21.93 Mb. By “wild-type” MTAP is meant that 15 encoded by NM_002451 or having the same amino acid sequence (NP_002442). (Schmid et al. Oncogene 2000, 19, pp 5747-54). As used herein, the terms “MTAP-deficient” and “MTAP-deficiency” refer to tumour cells that do not express any MTAP protein, or have a significant reduction in post-translational modification, production, expression, level, stability and/or activity of MTAP relative to that in a control, e.g., 20 reference or normal or non-cancerous cells. The reduction can be a decrease in production, expression, level, stability and/or activity of the protein compared to a control. A tumour may, for example, be rendered MTAP-deficient by virtue of epigenetic silencing of MTAP gene expression, such tumours can be termed MTAP gene silenced tumours. The MTAP-deficiency status can be determined by interpretation of an immunohistochemistry assay by a skilled pathologist. 25 Loss of MTAP results in increased concentrations (or accumulation) of the MTAP substrate methylthioadenosine (MTA, also known as, S-methyl-5’-thioadenosine, 5'-(methylthio)adenosine and 5′-deoxy, 5′-methylthioadenosine) in CDKN2A/MTAP null cancer cells. MTA selectively inhibits PRMT5 methyltransferase activity, and therefore acts as a weak PRMT5 inhibitor. MTA accumulation in CDKN2A/MTAP-null cancer cell lines leads to a partial inhibition 30 of PRMT5 activity. Compromised PRMT5 activity renders CDKN2A/MTAP null cancer cells susceptible to further targeting of PRMT5. Methods for detecting MTA include, but are not limited to, liquid chromatography–electrospray ionization–tandem mass spectrometry (LC-ESI-MS/MS), as described in Stevens et al. J. Chromatogr. A.2010, 1217, pp 3282-3288. CAAP1-deficiency and MTAP-deficiency may be due to the presence of a loss of function-related alteration in the CAAP1 and MTAP genes, respectively. A loss of function-related alteration can refer to any genetic alteration, compared to the wild-type gene, resulting in loss of transcriptional activity and/or failure to express functional protein, or resulting in a significant reduction in post- 5 translational modification, production, expression, level, stability and/or activity of expressed protein relative to that in a control, e.g., reference or corresponding normal or non-cancerous cells. Loss of function-related alterations may encompass the entire gene locus or may be located within the gene sequence or in regulatory or promoter sequences. Loss of function-related alterations include, but are not limited to, point mutations, insertions, deletions, frame-shift 10 mutations, translocation, loss of heterozygosity and/or DNA methylation, which can result in gene deletion or a null allele genotype. In an embodiment, the loss of function-related alteration in the CAAP1 or MTAP genes may be due to epigenic silencing of the gene. The term “epigenic silencing of the gene” is generally defined as an epigenetic modification of gene expression (i.e. genetic control by factors other 15 than an individual’s DNA sequence) leading to inactivation of previously active individual genes or larger chromosome regions. Mechanisms responsible for silencing include changes in levels of DNA methylation and alterations in covalent modifications of histone proteins, which lead to chromatin compaction, making genes inaccessible to the transcription machinery. Gene silencing can also occur post-transcriptionally due to mRNA degradation and/or repression of its 20 translation. These effects are often mediated by small RNA regulators such as small interfering RNAs (siRNAs), microRNAs (miRNAs), or Piwi-associated RNAs (piRNAs), which are generated from different forms of double-stranded RNA (dsRNA) accumulating in cells. Small RNAs, particularly siRNAs, can also participate in silencing of genes at the level of transcription (Filipowicz et al., 25 Brenner’s Encyclopedia of Genetics (2nd Edition) 2013). While modification at the genetic level may cause reduced (or no) expression of the gene product, it may also be that modification at the genetic level results in expression of protein with reduced or no functional activity. Accordingly, CAAP1 protein activity levels in tumour cells can be used identify tumours that are sensitive to treatment with a PRMT5 inhibitor. 30 Alternatively, the presence of a loss of function-related alteration in the CAAP1 gene and/or the MTAP gene may be established by analysis of circulating tumour DNA (ctDNA) in a liquid biopsy sample obtained from a subject. Deletion of the CAAP1 and/or MTAP genes can be similarly detected in a liquid biopsy sample obtained from a subject. The use of ctDNA is advantageous as it is a sensitive and specific non-invasive method for detecting, analysing and monitoring 35 tumours. Many tumour release DNA fragments into the bloodstream, which can be identified and analysis via liquid biopsy in the form of a simple blood test. A methodology for detection of ctDNA in human malignancies is described by Chetan Bettegowda et al., Sci. Transl Med.2014 February 19; 6(224). The entire content of this publication is incorporated by reference herein. In certain embodiments the CAAP1 status of the tumour is characterised by determining the status of a gene or genes adjacent to CAAP1 e.g. for example a gene close but to the left hand side of 5 CAAP1 (i.e. between CDKN2A and CAAP1) such as TEK or a gene adjacent to, but on the right hand side of, CAAP1. It is expected that deletion (such as homozygous deletion) of certain adjacent genes (e.g. TEK) may result in co-deletion of CAAP1, enabling indirect determination of CAAP1 status. In embodiments, the CAAP1 status of the tumour is characterised by determining the status of a gene or genes located on chromosome 9, such as DMRTA1, ELAVL2, IZUMO3, 10 TUSC1, PLAA, IFT74, LRRC19, MOB3B, C90rf72, IFNK, EQTN and/or LINGO2. It is also expected that deletion (e.g. homozygous deletion) of such genes may also result in co-deletion of CAAP1. Accordingly, in embodiments CAAP1-null status may be assigned by establishing the deletion of a surrogate gene (e.g. a gene or genes located on chromosome 9, such as a gene or genes adjacent to CAAP1, for example TEK). 15 By understanding or “diagnosing” the CAAP1 status of the tumour (and optionally also the MTAP status of the tumour) or the CAAP1-null status of the tumour in advance of treatment, therapies can be administered in a more targeted and personalised manner, leading to improved outcomes, a reduction in unnecessary or ineffective therapeutic interventions and fewer adverse events. As used herein, the term “status” refers to the condition or state of a gene or its products. As 20 specifically described herein, the status of a biomarker (i.e. CAAP1, and optionally MTAP) can be evaluated by a number of parameters known in the art. Typically an alteration in the status of a biomarker includes an increase or, importantly in the context of the present specification, a decrease in biomarker mRNA and/or protein expression. The CAAP1 status of the tumour (and optionally also the MTAP status of the tumour) can be 25 determined by detecting the presence or quantity of the respective biomarker gene polynucleotides in a biological sample (e.g. tumour biopsy tissue or cells, blood or blood products (e.g. plasma)). In an embodiment, the biological sample is a blood sample containing ctDNA. Detectable biomarker polynucleotides include, for example, mRNA, and recombinant DNA or RNA molecules containing a biomarker polynucleotide. A number of methods for amplifying 30 and/or detecting the presence or quantity of polynucleotides are well-known in the art and may be employed in the practice of this aspect of the specification. Non-limiting examples of technologies suitable for analysing changes in CAAP1 (and MTAP) genes include next generation sequencing (NGS) using either a tumour tissue sample or a blood sample. Methods for NGS are described in Slatko BE, Gardner AF, Ausubel FM. Overview of 35 Next-Generation Sequencing Technologies. Curr Protoc Mol Biol. 2018 Apr;122(1):e59. doi: 10.1002/cpmb.59. PMID: 29851291; PMCID: PMC6020069. CAAP1 (and MTAP) deficiency status, i.e. CAAP1 (and MTAP) protein levels can be established by immunohistochemistry (IHC) using a tumour tissue sample. Methods for IHC analysis are described in IHC Guidebook: Sixth Edition from Dako (https://www.agilent.com/en/dako-pathology-education-guides). In one embodiment, a method for detecting a biomarker gene mRNA in a biological sample 5 includes obtaining a sample, producing cDNA from the sample by reverse transcription using at least one primer that binds the biomarker polynucleotide; amplifying the cDNA so produced using biomarker oligonucleotides as sense and antisense primers to amplifying cDNAs therein; and detecting the presence of the amplified cDNA. Such assays can be qualitative or quantitative. As mentioned above, point mutations may be responsible for loss of gene function or loss of 10 protein functional activity. As the skilled person will be aware, there are a variety of methods available for the detection of point mutations in molecular diagnostics, including denaturing gradient gel electrophoresis, PCR-single stranded conformation polymorphism, heteroduplex analysis, protein truncation test, RNASE A cleavage method, chemical/enzyme mismatch cleavage, allele specific oligonucleotide hybridisation on DNA chips, allele specific PCR with a 15 blocking reagent (to suppress amplification of wild-type allele) followed by real time PCR, direct sequencing of PCR products, pyrosequencing and next generation sequencing systems. As mentioned above, gene loss and/or loss of protein functional activity may be due to insertions, deletions and frame-shift mutations, relative to the wild-type polynucleotide sequence. Deletion may be of part or all the gene. In an embodiment, the loss of function-related alternation is 20 homozygous deletion of the gene. As the skilled person will be aware, suitable techniques for detection of insertions, deletions, frame-shift mutations include pyrosequencing, big dye terminator sequencing, next generation sequencing systems and heteroduplex analysis using capillary/microchip-based electrophoresis. A translocation occurs when a chromosome breaks and the fragmented pieces re-attach to 25 different chromosomes, which can result in loss of the gene(s) located at the affected chromosomal locus. DNA methylation, caused primarily by covalent addition of methyl groups to cytosine within CpG dinucleotides, occurs primarily in promoter regions of genes due to the large proportion of CpG islands found there. Hypermethylation results in transcriptional silencing. 30 Methods for determining the methylation state of specific genes are known in the art and include, for example, methylation-specific PCR (also known as MethyLight; as described in Eads et al, Nucleic Acids Res.2000; 28(8), and Widschwendler et al, Cancer Res., 2004; 64:3807-3813), combined bisulphate restriction analyses, bisulphite sequencing, methylation-sensitive single nucleotide primer extension and the use of CpG island microarrays. Commercially available kits 35 for the study of DNA methylation are available. Loss of heterozygosity (LOH) refers to loss of the entire gene locus in one allele. LOH can be measured using various techniques, including semi quantitative RT-PCR analysis, high- resolution PCR based fluorescence quantitation using capillary electrophoresis systems, amplification of microsatellites by PCR using radiolabeled nucleotides followed by 5 autoradiography and next generation sequencing (Ion Torrent™, Life Technologies). The term “null allele” refers to a non-functional allele caused by a genetic mutation, such as those described above. As previously mentioned, such mutations can cause a complete lack of production of the associated gene product (protein) or a product that does not function properly; in either case, the allele may be considered non-functional. 10 A mutant allele that produces no RNA transcript is called an RNA null (shown by e.g. Northern blotting or by DNA sequencing of a deletion allele), and one that produces no protein is called a protein null (shown by e.g. Western blotting). A genetic null or amorphic allele has the same phenotype when homozygous as when heterozygous with a deficiency that disrupts the locus in question. A genetic null allele may be both a protein null and an RNA null, but may also express 15 normal levels of a gene product that is non-functional due to mutation. Methods for identifying the presence (or absence) of protein, or the level of protein in a sample include determining protein levels or studying the expression level of the gene. In an embodiment, the sample is a tumour tissue or tumour cell sample. As used herein the term "expression level" refers to the amount of the specified protein (or mRNA coding for the protein) in the tumour 20 sample. The expression level is then compared to that of a control. The control may be a tumour sample that is known to have a functioning wild-type gene or may be a reference value or normal, non-tumour, cells. It will be apparent to the skilled person that comparing expression levels of a control and the test sample will allow a decision to be made as to whether the expression level in the test sample and 25 control are similar or different, and therefore whether the patient has a tumour that is sensitive to treatment with a PRMT5 inhibitor. Methods of measuring the level of expression of a biomarker protein from a biological sample (such as a tumour tissue, tumour cell or blood sample) are well known in the art and any suitable method may be used. Protein or nucleic acid from the sample may be analysed to determine the 30 expression level, and examples of suitable methods include semi-quantitative methods such as in situ hybridisation (ISH) and fluorescence in situ hybridisation (FISH), and variants of these methods for detecting mRNA levels in tissue or cell preparations, Northern blotting, and quantitative PCR reactions. The use of Northern blotting techniques or quantitative PCR to detect gene expression levels is well known in the art. Kits for quantitative PCR-based gene expression 35 analysis are commercially available, for example the Quantitect system manufactured by Qiagen. Simultaneous analysis of expression levels in multiple samples using a hybridisation-based nucleic acid array system is well known in the art and is also within the scope of the specification. Mutation-specific PCR may also be used, as will be appreciated by the skilled person. Various immunological assays useful for the binding to, detection and quantification of biomarker proteins. Such methods and assays generally include one or more biomarker-specific antibodies 5 capable of recognizing and binding a biomarker protein, as appropriate, and can be performed within various immunological assay / immunohistochemical assay formats well-known in the art, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), immunohistochemistry and the like. 10 Antibodies may also be used in methods for purifying biomarker proteins and for isolating biomarker protein homologues and related molecules. Various methods for the preparation of antibodies are well-known in the art. For example, antibodies may be prepared by immunizing a suitable mammalian host using a biomarker protein, peptide, or fragment, in isolated or immunoconjugated form (Harlow & Lane, eds. (1988) Antibodies: A Laboratory Manual, CSH 15 Press). The term "antibody" has its usual meaning in the art and refers to an immunoglobulin which specifically recognises an epitope on a target as determined by the binding characteristics of the immunoglobulin variable domains of the heavy and light chains (VH S and VL S), more specifically the complementarity-determining regions (CDRs). Many potential antibody forms are known in 20 the art, which may include, but are not limited to, a plurality of intact monoclonal antibodies or polyclonal mixtures comprising intact monoclonal antibodies, antibody fragments (for example Fab and Fr fragments, linear antibodies, single chain antibodies, and multispecific antibodies comprising antibody fragments), single chain variable fragments (scFv S), multispecific antibodies, chimeric antibodies, humanised antibodies and fusion proteins comprising the 25 domains necessary for the recognition of a given epitope on a target. Antibodies may also be conjugated to various moieties for a diagnostic effect, including but not limited to radionuclides, fluorophores or dyes. The term "specifically recognises", in the context of antibody-epitope interactions, refers to an interaction wherein the antibody and epitope associate more frequently or rapidly, or with greater 30 duration or affinity, or with any combination of the above, than when either antibody or epitope is substituted for an alternative substance, for example an unrelated protein. Generally, but not necessarily, reference to binding means specific recognition. Methods of measuring the level of expression of a biomarker protein in a biological sample also include the use of primers and primer pairs, which bind to biomarker genes and allow the specific 35 amplification of the polynucleotides of the specification or of any specific parts thereof, and probes that selectively or specifically bind or hybridize to polynucleotide molecules of the specification or to any part thereof. Probes can be labelled with a detectable biomarker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme. Such probes and primers are agents which can be used to detect the presence or quantity of a biomarker polynucleotide in a sample and as a means for detecting a 5 cell expressing a biomarker protein. In further embodiments of the specification there are provided methods for identifying a cancer patient having a tumour that is sensitive to treatment with a PRMT5 inhibitor. Such methods of the specification comprise detecting the presence or absence of CAAP1 protein in a sample obtained from the patient, and/or determining that the cancer is CAAP1-null by analysing a sample 10 obtained from the patient. Determining that the cancer is CAAP1-null may involve identifying that the cancer is CAAP1-gene deleted. Determining that the cancer is CAAP1-deficient may involve a) detecting the presence of a loss of function-related alteration in the CAAP1 gene, or in its regulatory or promoter sequences, or b) identifying that the CAAP1-gene is epigenetically silenced, in each case in a sample obtained from the patient. 15 The sample may be tumour biopsy tissue or cells, or a blood sample. In an embodiment the sample is a blood sample. In another embodiment the sample is a tumour biopsy sample. The sample type used for detection of the presence or absence of protein may be the same or different to the sample type used for detection of the presence of a loss of function-related alteration in a gene, or in its regulatory or promoter sequences. In an embodiment, a tumour biopsy (tissue or 20 cell) sample is used for detection of the presence or absence of CAAP1 protein. In an embodiment, a tumour biopsy (tissue or cells) sample or a blood sample is used for detection of the presence of a loss of function-related alteration in the CAAP1 gene, or in its regulatory or promoter sequences. CAAP1-deficiency status can be determined by interpretation of an immunohistochemistry assay 25 by a skilled pathologist. If there a post-translational modification resulting in reduced production, expression, level, stability and/or activity of CAAP1 relative to that in a control (e.g., reference or normal or non-cancerous cells), then the patient is identified as having a tumour that is CAAP1- deficient and therefore sensitive treatment with a PRMT5 inhibitor. Alternatively, or additionally, if the presence of a loss of a function-related alteration in the CAAP1 30 gene, or in its regulatory or promoter sequences, is detected in the sample obtained from the patient then the patient is identified as having a tumour that is CAAP1-deficient and therefore sensitive treatment with a PRMT5 inhibitor. This method enables the stratification of patients who have a tumour that is likely to respond to treatment with a PRMT5 inhibitor from those patients whose tumour is unlikely or less likely to 35 respond to treatment with a PRMT5 inhibitor. By understanding or “diagnosing” the CAAP1 status of the tumour in advance of treatment, therapies can be administered in a more targeted and personalised way, leading to more positive outcomes, a reduction in unnecessary or ineffective therapeutic interventions and fewer adverse events. All steps of this method are carried out in vitro. For the avoidance of doubt, the term "in vitro" has its usual meaning in the art, referring to methods that are carried out in or on a tissue or blood 5 sample in an artificial environment outside the body of the patient from whom the tissue or blood sample has been obtained. Biopsy methods for obtaining a biological sample (such as a tumour sample) for analysis are well- known in the art. Likewise obtaining a blood sample from a patient and analysing the blood sample for the presence of circulating tumour DNA (ctDNA) and elucidating the genetic profile of a tumour 10 are well known in the art. Suitable methods for analysing gene expression and protein levels and detecting genetic alterations in a biological sample such as a tumour biopsy or a blood sample are known in the art and described in detail above. In a further embodiment, the method of the specification comprises detecting the presence of 15 MTAP protein in a sample obtained from the patient and/or detecting the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, in a sample obtained from the patient. According to the present specification, a tumour that is identified as CAAP1/MTAP-deficient is characterised as being sensitised to, and suitable for treatment with, a PRMT5 inhibitor, for example a second generation MTA-synergistic PRMT5 inhibitor. 20 In an embodiment, a tumour biopsy (tissue or cell) sample is used for detection of the presence or absence of MTAP protein. In an embodiment, a tumour biopsy (tissue or cells) sample or a blood sample is used for detection of the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences. According to the specification, a tumour cell that is characterised as accumulating MTA or having 25 “MTA accumulation” (i.e. a cell that through the lack of MTAP protein is unable to phosphorylate MTA to generate adenine and 5-methylthioribose-1-phosphate, and thus characteristically has concentrations of MTA, greater than that found in normal or non-cancerous cells) in combination with CAAP1-null or CAAP1-deficiency is characterised as being sensitised to, and suitable for treatment with, a PRMT5 inhibitor, for example and advantageously for treatment with a second 30 generation MTA-synergistic PRMT5 inhibitor. The presence or absence of biomarker proteins in the biological sample can be identified using methods that are familiar to the skilled person and described in detail above. Methods for detecting the presence or absence of CAAP1 protein in the biological sample include using a CAAP1-specific antibody, or a probe for the CAAP1 gene, mRNA or specific CAAP1 gene 35 mutations. In further embodiments the specification provides an in vitro diagnostic test for detecting CAAP1 protein in a sample obtained from a cancer patient, or for detecting the CAAP1 gene deletion status of a tumour from a sample obtained from a cancer patient. In embodiments, the sample obtained from the patient is a tumour tissue sample or a blood sample containing ctDNA. 5 Non-limiting examples of technologies suitable for analysing CAAP1-gene status or CAAP1 protein status include next generation sequencing using either a tumour tissue sample or a blood sample; immunohistochemistry (IHC) using a tumour tissue sample. A skilled pathologist will be able to identify that a tumour is CAAP1-deficient by analysing the results of an IHC test for CAAP1. In further embodiments the specification provides the use of CAAP1 protein or the polynucleotide 10 encoding the CAAP1 gene as a biomarker for identifying a tumour that will be sensitive to treatment with a PRMT5 inhibitor. The CAAP1 polypeptide (protein) or CAAP1 polynucleotide (gene) biomarkers can be used in in vitro diagnostic and patient stratification methods and methods of treating cancer patients, as disclosed herein. The biomarkers may also be used in non-clinical research settings, for example 15 for characterising tumour cell lines, or for use in drug development studies (including, but not limited to the development of PRMT5 inhibitor drugs). In further embodiments the specification provides methods of treatment of cancer, for example a malignant tumour, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s cancer or tumour has been 20 characterised as being CAAP1-deficient. In embodiments, the specification provides methods of treatment of cancer, for example a malignant tumour, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s cancer has been characterised as being CAAP1-null. As used herein, a “therapeutically effective amount” of a compound is an amount sufficient to 25 provide a therapeutic benefit in the treatment of a disease, disorder or condition, or to delay or minimize one or more symptoms associated with the disease, disorder or condition. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapies, which provides a therapeutic benefit in the treatment of the disease, disorder or condition. The term “therapeutically effective amount” can encompass an 30 amount that improves overall therapy, reduces or avoids symptoms or causes of disease or condition, or enhances the therapeutic efficacy of another therapeutic agent. The therapeutically effective amount can vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject to be treated. Analysis of the literature and other resources has revealed that significant numbers of cancer 35 patients have tumours that are CAAP1 deficient. Exemplary cancers in which CAAP1-null status has been confirmed, often in conjunction with MTAP deficiency, include pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) 5 mesothelioma. In embodiments, the use of a PRMT5 inhibitor for treatment or in a method of treatment as identification by the identification of its CAAP1-null or CAAP1 deficient status, is for the treatment of a cancer selected from pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver 10 cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) and mesothelioma, such as selected from pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) and mesothelioma. In embodiments, the cancer is 15 lung cancer (such as NSCLC). In embodiments, the cancer is gastric cancer. In embodiments, the cancer is pancreatic cancer. In embodiments, the cancer is oesophageal cancer. In embodiments, the cancer is bladder cancer. In embodiments, the cancer is head and neck cancer (such as HNSCC). In an embodiment, a PRMT5 inhibitor is administered as a monotherapy, meaning that no 20 additional or further therapeutic agents are required to treat the tumour. A monotherapy approach is beneficial for patients as it decreases the risk of harmful side-effects of multiple cancer therapies, avoids the need to multiple drugs to be administered and is more cost-effective for healthcare providers. Alternatively, the PRMT5 inhibitor may be formulated, or administered, in combination with one 25 or more other therapeutic agents (e.g. anti-cancer agents) in a combination therapy approach. In embodiments, the PRMT5 inhibitor for administration to a patient is selected from onametostat (JNJ-64619178); pemrametostat (GSK3326595, EPZ015938); PF-06939999; PRT811; PRT543; PRMT5 inhibitor 1, PRMT5 inhibitor 2 and GSK2303591 (EPZ015866). In embodiments, the PRMT5 inhibitor for administration to the patient is selected from a PRMT5 30 inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344. In embodiments, the PRMT5 inhibitor is selected from a PRMT5 inhibitor disclosed in CN202310191381, WO2021086879, WO2021050915, WO2022192745, WO2023278564, WO2022132914, WO2022169948, WO2023081367, WO2023098439, WO2023098439, WO2023143210, WO2023125540, WO2023174250 or WO2023207556. In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor as disclosed in WO2023/036974 (the content of which is incorporated by reference herein). In embodiments, the PRMT5 inhibitor is a compound of formula (I): wherein: the ring containing X and Y is a pyrrole and X is NH and Y is CH or X is CH and Y is NH; Z is selected from CH, CF, CCl or, if Q is not N, N; Q is selected from CH, CF, CCl or, if Z is not N, N; m is 0, 1 or 2; n is 0, 1 or 2; p is 1 or 2; R1 is in each occurrence independently selected from F, Cl, CN, Me, CF3, C1-C3 alkyl, cyclopropyl, C1-C3 fluoroalkyl, OMe or C1-C3 alkoxy; R2 is in each occurrence independently selected from F, Cl, Me, MeO and CF3; R3 is H, Me, C1-C3 alkyl or C1-C3 fluoroalkyl; R4 is H, Me or C1-C3 alkyl; R5 is H, Me, C1-C3 alkyl, C1-C3 fluoroalkyl, CH2OMe, CH2OCHF2, CH2OCF3, CH2O(C1-C3 alkyl), CH2O(C1-C3 fluoroalkyl), C(CH2CH2)R6, CCR7, CH2R8, R9 or CH2R10; R6 is H, Me, CH2F, CHF2, CF3, CH2OH or CH2OMe; R7 is H, Me, cyclopropyl, C1-C3 alkyl, C1-C3 fluoroalkyl, C3-C6 cycloalkyl or a 5-membered heteroaryl group optionally substituted with Me, C1-C3 alkyl, F or Cl; R8 is a 5-membered heteroaryl optionally substituted with Me, C1-C3 alkyl, F or Cl; R9 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group; and R10 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group, or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is a compound of formula (I). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I). 5 In embodiments, the PRMT5 inhibitor is selected from the group consisting of: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(4-fluorobenzyl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; 10 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(prop-2-yn-1-yl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(3-(1-methyl-1H- pyrazol-4-yl)prop-2-yn-1-yl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-4-((2-((5-amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-2',3-dioxospiro 15 [isoindoline-1,3'-pyrrolidin]-1'-yl)methyl)-2-fluorobenzonitrile; (S)-1'-(3-(2H-1,2,3-Triazol-2-yl)benzyl)-2-((5-amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2,5-difluorobenzyl)-5- fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; 20 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2,2-difluoroethyl)-5-fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((1-(fluoromethyl) cyclopropyl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'- 25 methylspiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2-(difluoromethoxy)ethyl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((3-fluoropyridin-2- yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; 30 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(isoxazol-5-ylmethyl) spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((5-(trifluoromethyl) pyridazin-3-yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((1-methyl-1H-indazol- 5-yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; 5 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(benzo[d]oxazol-2-ylmethyl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(4-fluorophenoxy) ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(4-methylthiazol-5- 10 yl)ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((R*)-1-(1- methylcyclopropyl)ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(3-cyclopropylprop-2-yn-1-yl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; 15 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-4-chloro-1'-(4-fluorobenzyl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2'-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1-(4- fluorobenzyl)spiro[pyrrolidine-3,1'-pyrrolo[3,4-c]pyridine]-2,3'(2'H)-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1',7-dimethylspiro 20 [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-7-methoxy-1'-methylspiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2'-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1-(4- fluorobenzyl)spiro[pyrrolidine-3,3'-pyrrolo[3,4-c]pyridine]-1',2(2'H)-dione; 25 (S)-5-Amino-2-((5-fluoro-1'-((1-methylcyclopropyl)methyl)-2',3-dioxospiro[isoindoline-1,3'- pyrrolidin] -2-yl)methyl)-1H-pyrrolo[3,2-b]pyridine-7-carbonitrile; (S)-2-((5-Amino-6-chloro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(trifluoromethoxy) ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((6-Amino-4-methyl-1H-pyrrolo[2,3-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2,4,5-trifluorobenzyl) 30 spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; and (1S,5'S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1',5'-dimethylspiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; or a pharmaceutically acceptable salt of any one thereof. In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1), 5 or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6-10 fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’- pyrrolidine]-2’,3-dione): inhibitor 1). In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: 15 (PRMT5 inhibitor 2). or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione: inhibitor 2). 5 In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6- fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'- pyrrolidine]-2',3-dione: inhibitor 2). In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022169948, 10 WO2022192745, WO2022132914, WO2021086879, WO2021050915, WO2021055797, WO2020249663, WO2020206308, WO2020206289, WO2020206299, WO2020152557, WO2018085818, US20190284193, WO2019178368, WO2018085833, WO2018085818, WO2018075601, WO2017212385, WO2017218802, WO2017153186, WO2017032840, WO2016135582, or WO2015198229. 15 In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2021/050915 (the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is (P)-2-[4- [4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- fluoro-benzonitrile: , 20 or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl- pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (P)-2-[4-[4-(aminomethyl)- 5 1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . Suitably, the PRMT5 inhibitor is a hydrochloride salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H- phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . 10 In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor disclosed in WO2022/132914(the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- (trifluoromethyl)phenyl]morpholin-4-yl]methanone: , 15 or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- (trifluoromethyl)phenyl]morpholin-4-yl]methanone: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: 5 . In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022/026892 (the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is N-(6-amino- 5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2- oxoacetamide: 10 , or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is N-(6-amino-5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol- 5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: . 15 Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: . Suitably, the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: , 5 or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5-ethylpyridin-10 3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2- oxoacetamide: . In embodiments, the PRMT5 inhibitor for administration to the patient is selected from PRMT5 inhibitor 1 and PRMT5 inhibitor 2, as shown above. In embodiments, the patient’s tumour has been characterised as being CAAP1-deficient or CAAP1-null (e.g. CAAP1-null) according to the methods described herein above. In embodiments the tumour has also been characterised as being MTAP-deficient or MTAP-null (e.g. MTAP-null). Determination of the MTAP protein or MTAP-gene status of a tumour can be 5 made using according to the methods disclosed herein above. In embodiments, the tumour cells have been characterised as being CAAP1/ MTAP-deficient or CAAP1/ MTAP-null. Suitably, the tumour cells have been characterised as being CAAP1-null and MTAP-null. In related embodiments the specification provides a method of treating a cancer patient 10 comprising the steps of: i. obtaining a biological sample from the patient; ii. detecting the expression of CAAP1 protein in the sample and/or determining that the patient has a tumour that is CAAP1-null by analysing the sample; iii. characterising the patient’s tumour as being sensitive to treatment with a PRMT5 15 inhibitor if a) reduced levels of, or no, CAAP1 protein is detected in the sample or b) if the tumour is determined to be CAAP1 null; and iv. administering a therapeutically effective amount of a PRMT5 inhibitor to the patient if the tumour is characterised as being sensitive to treatment with a PRMT5 inhibitor in step iii. 20 In an embodiment, CAAP1-deficiency status can be determined by interpretation of an immunohistochemistry assay by a skilled pathologist. The biological sample may be a tumour biopsy sample (tumour tissue or tumour cells) or a blood sample. In an embodiment, the presence (or absence) of CAAP1 protein is detected in a tumour tissue sample obtained from the patient. In an embodiment, the CAAP1-null status is determined 25 on the basis of CAAP1-gene deletion in the tumour. In an embodiment, the CAAP1-deficiency is determined by the presence of a loss of function-related alteration in the tumour’s CAAP1 gene, or in its regulatory or promoter sequences, as detected in a tumour tissue sample, or in a blood sample. In an embodiment, the method of the specification further comprises detecting the presence of 30 MTAP protein in a sample of tumour cells obtained from the patient and/or detecting the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, in a sample obtained from the patient. In an embodiment, the presence (or absence) of MTAP protein is detected in a tumour tissue sample. In an embodiment, the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, is detected in a tumour tissue sample or in a blood sample. According to the present specification, a tumour that is identified as CAAP1/MTAP-deficient or CAAP1/MTAP-null is characterised as being sensitised to, and suitable for treatment with, a therapeutically effective amount of a PRMT5 inhibitor. In embodiments, the PRMT5 inhibitor is an MTA-synergistic PRMT5 inhibitor. In embodiments, the PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 inhibitor 2, or a PRMT inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344. In embodiments, the PRMT5 inhibitor is selected from a PRMT5 inhibitor disclosed in CN202310191381, WO2021086879, WO2021050915, WO2022192745, WO2023278564, WO2022132914, WO2022169948, WO2023081367, WO2023098439, WO2023098439, WO2023143210, WO2023125540, WO2023174250 or WO2023207556. In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor as disclosed in WO2023/036974 (the content of which is incorporated by reference herein). In embodiments, the PRMT5 inhibitor is a compound of formula (I): wherein: the ring containing X and Y is a pyrrole and X is NH and Y is CH or X is CH and Y is NH; Z is selected from CH, CF, CCl or, if Q is not N, N; Q is selected from CH, CF, CCl or, if Z is not N, N; m is 0, 1 or 2; n is 0, 1 or 2; p is 1 or 2; R1 is in each occurrence independently selected from F, Cl, CN, Me, CF3, C1-C3 alkyl, cyclopropyl, C1-C3 fluoroalkyl, OMe or C1-C3 alkoxy; R2 is in each occurrence independently selected from F, Cl, Me, MeO and CF3; R3 is H, Me, C1-C3 alkyl or C1-C3 fluoroalkyl; R4 is H, Me or C1-C3 alkyl; R5 is H, Me, C1-C3 alkyl, C1-C3 fluoroalkyl, CH2OMe, CH2OCHF2, CH2OCF3, CH2O(C1-C3 alkyl), CH2O(C1-C3 fluoroalkyl), C(CH2CH2)R6, CCR7, CH2R8, R9 or CH2R10; R6 is H, Me, CH2F, CHF2, CF3, CH2OH or CH2OMe; R7 is H, Me, cyclopropyl, C1-C3 alkyl, C1-C3 fluoroalkyl, C3-C6 cycloalkyl or a 5-membered heteroaryl group optionally substituted with Me, C1-C3 alkyl, F or Cl; R8 is a 5-membered heteroaryl optionally substituted with Me, C1-C3 alkyl, F or Cl; R9 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group; and R10 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group, or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is a compound of formula (I). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I). In embodiments, the PRMT5 inhibitor is selected from the group consisting of: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(4-fluorobenzyl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(prop-2-yn-1-yl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(3-(1-methyl-1H- pyrazol-4-yl)prop-2-yn-1-yl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-4-((2-((5-amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-2',3-dioxospiro [isoindoline-1,3'-pyrrolidin]-1'-yl)methyl)-2-fluorobenzonitrile; (S)-1'-(3-(2H-1,2,3-Triazol-2-yl)benzyl)-2-((5-amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2,5-difluorobenzyl)-5- fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2,2-difluoroethyl)-5-fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((1-(fluoromethyl) cyclopropyl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; 5 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'- methylspiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2-(difluoromethoxy)ethyl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((3-fluoropyridin-2- 10 yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(isoxazol-5-ylmethyl) spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((5-(trifluoromethyl) pyridazin-3-yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione 15 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((1-methyl-1H-indazol- 5-yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(benzo[d]oxazol-2-ylmethyl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(4-fluorophenoxy) 20 ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(4-methylthiazol-5- yl)ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((R*)-1-(1- methylcyclopropyl)ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; 25 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(3-cyclopropylprop-2-yn-1-yl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-4-chloro-1'-(4-fluorobenzyl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2'-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1-(4- 30 fluorobenzyl)spiro[pyrrolidine-3,1'-pyrrolo[3,4-c]pyridine]-2,3'(2'H)-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1',7-dimethylspiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-7-methoxy-1'-methylspiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2'-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1-(4- fluorobenzyl)spiro[pyrrolidine-3,3'-pyrrolo[3,4-c]pyridine]-1',2(2'H)-dione; 5 (S)-5-Amino-2-((5-fluoro-1'-((1-methylcyclopropyl)methyl)-2',3-dioxospiro[isoindoline-1,3'- pyrrolidin] -2-yl)methyl)-1H-pyrrolo[3,2-b]pyridine-7-carbonitrile; (S)-2-((5-Amino-6-chloro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(trifluoromethoxy) ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((6-Amino-4-methyl-1H-pyrrolo[2,3-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2,4,5-trifluorobenzyl) 10 spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; and (1S,5'S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1',5'-dimethylspiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; or a pharmaceutically acceptable salt of any one thereof. In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- 15 yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1), or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): 20 (PRMT5 inhibitor 1). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6- fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’- pyrrolidine]-2’,3-dione): 5 inhibitor 1). In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: inhibitor 2). 5 or a pharmaceutically acceptable salt thereof. In embodiments, the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione: inhibitor 2). In embodiments, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6-10 fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'- pyrrolidine]-2',3-dione: (PRMT5 inhibitor 2). In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022169948, 15 WO2022192745, WO2022132914, WO2021086879, WO2021050915, WO2021055797, WO2020249663, WO2020206308, WO2020206289, WO2020206299, WO2020152557, WO2018085818, US20190284193, WO2019178368, WO2018085833, WO2018085818, WO2018075601, WO2017212385, WO2017218802, WO2017153186, WO2017032840, WO2016135582, or WO2015198229. 5 In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2021/050915 (the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is (P)-2-[4- [4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- fluoro-benzonitrile: , 10 or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl- pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (P)-2-[4-[4-(aminomethyl)- 15 1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . Suitably, the PRMT5 inhibitor is a hydrochloride salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H- phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor disclosed in WO2022/132914 (the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- 5 (trifluoromethyl)phenyl]morpholin-4-yl]methanone: , or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4- (trifluoromethyl)phenyl]morpholin-4-yl]methanone: 10 . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: . 15 In embodiments, the PRMT5 inhibitor is a PRMT5 inhibitor described in WO2022/026892 (the content of which is incorporated by reference herein). Suitably, the PRMT5 inhibitor is N-(6-amino- 5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2- oxoacetamide: , or a pharmaceutically acceptable salt thereof. 5 Suitably, the PRMT5 inhibitor is N-(6-amino-5-methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol- 5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: 10 . Suitably, the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: , or a pharmaceutically acceptable salt thereof. Suitably, the PRMT5 inhibitor is N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: . Suitably, the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5-ethylpyridin- 5 3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2- oxoacetamide: . In further embodiments the specification provides the use of a PRMT5 inhibitor for the manufacture of a medicament for the treatment of cancer, wherein the cancer has been identified 10 as being CAAP1-null or CAAP1-deficient. Suitably, the cancer has been identified as being CAAP1-null. Suitably, the cancer has been identified as being CAAP1-deficient. MAT2A (methionine adenosyltransferase 2a) has been previously reported as being a synthetically lethal target in MTAP-deleted (i.e. MTAP-null) cancers (Kalev et al., 2021, Cancer Cell, 39, 209-224). In brief outline, the universal methyl donor S-adenosylmethionine (SAM) is 15 utilised by the type II arginine methyltransferase PRMT5. SAM levels can be reduced by MAT2A inhibitors. The high-MTA environments of MTAP-null cancers, in which MTA inhibits PRMT5 activity is sensitive to reduction in SAM levels, for example as dictated by MAT2A inhibition. The paper of Kalev et al. reports the increased sensitivity of two xenograft models to MAT2A inhibitor treatment and attributes this to mutations in the FANCI gene. However, as is described in 20 Example 3 below, the two xenograft models in the Kalev paper are both MTAP-null CAAP1-null and these PDX models respond in a similar manner to MAT2A inhibitor treatment and PRMT5 inhibitor treatment in a MTAP-null and CAAP1-null PDX study. As identified for the first time herein, deletion of CAAP1 is implicated in increased sensitivity of tumours to MAT2A inhibitor treatment and, accordingly the specification provides methods for identifying cancer patients that 25 will respond to MAT2A inhibitor treatment and methods of treatment of cancer patients that have been identified as having CAAP1-null or CAAP1-deficient tumours. Therefore, in one embodiment the specification provides a MAT2A inhibitor for use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient. Suitably, the cancer is identified as being CAAP1-null. Suitably, the cancer is identified as being CAAP1-deficient. The specification also provides the use of a MAT2A inhibitor for the manufacture of a medicament 5 for the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient. Suitably, the cancer has been identified as being CAAP1-null. Suitably, the cancer has been identified as being CAAP1-deficient. The specification also provides methods of treatment of cancer, comprising administering a therapeutically effective amount of a MAT2A inhibitor to a patient in need thereof, wherein the 10 patient’s cancer or tumour has been characterised as being CAAP1-deficient. In embodiments, the specification provides methods of treatment of cancer comprising administering a therapeutically effective amount of a MAT2A inhibitor to a patient in need thereof, wherein the patient’s cancer has been characterised as being CAAP1-null. The specification also provides a method for identifying a cancer patient having a cancer that is 15 sensitive to treatment with a MAT2A inhibitor, comprising the step(s) of: i. detecting the presence or absence of CAAP1 protein in a sample obtained from the patient, and/or ii. determining that the cancer is CAAP1-null, by analysing a sample obtained from the patient, 20 wherein if the detection of step i) reveals there is no, or significantly reduced, CAAP1 protein present in the sample; and/or if the determination of step ii) reveals that the cancer is CAAP1- null; then the patient is identified as having a tumour that is sensitive treatment with a MAT2A inhibitor. The specification also provides a method of treating a cancer patient comprising the steps of: 25 i. obtaining a biological sample from the patient; ii. detecting the expression of CAAP1 protein in the sample and/or determining that the patient has a cancer that is CAAP1-null by analysing the sample ; iii. characterising the patient’s cancer as being sensitive to treatment with a MAT2A inhibitor if a) reduced levels of, or no, CAAP1 protein is detected in the sample or 30 b) if the cancer is determined to be CAAP1 null; and iv. administering a therapeutically effective amount of a MAT2A inhibitor to the patient if the tumour is characterised as being sensitive to treatment with a MAT2A inhibitor in step iii. Suitably the cancer is selected from pancreatic cancer, oesophageal cancer, bladder cancer, 35 head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) and mesothelioma. Suitably, the cancer is selected from pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, 5 glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) and mesothelioma. Suitably, the cancer is lung cancer (such as NSCLC). Suitably, the cancer is gastric cancer. Suitably, the cancer is pancreatic cancer. Suitably, the cancer is oesophageal cancer. Suitably, the cancer is bladder cancer. Suitably, the cancer is head and neck cancer (such as HNSCC). 10 A PRMT5 or MAT2A inhibitor can be formulated into a pharmaceutical composition including a carrier suitable for the desired delivery method. Therefore, in embodiments the specification provides a pharmaceutical composition comprising a PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient. The specification also provides a pharmaceutical composition comprising a MAT2A inhibitor for use 15 in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient. Suitably, the cancer has been identified as being CAAP1-null. Suitably, the cancer has been identified as being CAAP1-deficient. Suitably, the pharmaceutical composition is administered as a monotherapy. Pharmaceutical compositions may be for human or animal usage in human and veterinary 20 medicine and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier, or excipient. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit.1985). The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard 25 pharmaceutical practice. The pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s). Preservatives, stabilizers, dyes and even flavouring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid 30 and esters of hydroxybenzoic acid. Antioxidants and suspending agents may be also used. There may be different composition/formulation requirements dependent on the different delivery systems. Where appropriate, the pharmaceutical compositions can be injected parenterally, for example intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions 35 may be used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood. Dosages and administration protocols for the treatment of cancers will vary with the method and the target cancer and will generally depend on a number of other factors appreciated in the art. The specification also provides a kit comprising a PRMT5 inhibitor or a MAT2A inhibitor and instructions for their use in the treatment of cancer, wherein the cancer is identified as being 5 CAAP1-null or CAAP1-deficient. The specification may be further defined by the following clauses: CLAUSES Clause 1. A PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient. 10 Clause 2. A PRMT5 inhibitor for use according to clause 1, wherein the cancer has a loss of function-related alteration in the CAAP1 gene. Clause 3. A PRMT5 inhibitor for use according to clause 1 or 2, wherein the cancer has a homozygous deletion of the CAAP1 gene. Clause 4. A PRMT5 inhibitor for use according to clause 1 or 2, wherein the loss of 15 function-related alteration in the CAAP1 gene is due to epigenic silencing of the gene. Clause 5. A PRMT5 inhibitor for use according to any preceding clause, wherein the cancer has been identified as being MTAP-deficient or MTAP-null (e.g. MTAP-deficient). Clause 6. A PRMT5 inhibitor for use according to clause 5, wherein the cancer has a loss of function-related alteration in the MTAP gene. 20 Clause 7. A PRMT5 inhibitor for use according to clause 5 or 6, wherein the tumour cells have a homozygous deletion of the MTAP gene. Clause 8. A PRMT5 inhibitor for use according to clause 5 or 6, wherein the loss of function-related alteration in the MTAP gene is due to epigenic silencing of the gene. Clause 9. A PRMT5 inhibitor for use according to any preceding clause, wherein the 25 PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 inhibitor 2, or a PRMT inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344. Clause 10. A PRMT5 inhibitor for use according to any preceding clause, wherein the cancer is pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung 30 cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma. Clause 11. A PRMT5 inhibitor for use according to any preceding clause, wherein the inhibitor for use is for administration as a monotherapy. 5 Clause 12. A method for identifying a cancer patient having a tumour that is sensitive to treatment with a PRMT5 inhibitor, comprising the step(s) of: a. detecting the presence or absence of CAAP1 protein in a sample obtained from the patient, and/or b. determining that the cancer is CAAP1-null, by analysing a sample obtained from the 10 patient, wherein if the detection of step i) reveals there is no, or significantly reduced, CAAP1 protein present in the sample; and/or if the determination of step ii) reveals that the cancer is CAAP1- null; then the patient is identified as having a tumour that is sensitive treatment with a PRMT5 inhibitor. 15 Clause 13. A method according to clause 12, further comprising the steps of detecting the presence or absence of MTAP protein in a sample obtained from the patient and/or detecting the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, in a sample obtained from the patient, wherein a tumour that is identified as CAAP1/MTAP-deficient is characterised as being sensitive to treatment with a PRMT5 20 inhibitor. Clause 14. A method according to clause 12 or 13, wherein the sample obtained from the patient is a tumour tissue sample and/or a blood sample. Clause 15. A method according to any of clauses 12 to 14, wherein the presence of CAAP1 protein, and optionally MTAP protein, is detected in a tumour tissue sample. 25 Clause 16. A method according to any of clauses 12 to 15, wherein the presence of a loss of function-related alteration in the CAAP1 gene, or in its regulatory or promoter sequences, and optionally the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, is detected in a tumour tissue sample, or in a blood sample. Clause 17. A method according to any one of clauses 12 to 16, wherein the cancer is 30 pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma. Clause 18. An in vitro diagnostic test for detecting CAAP1 protein in a sample obtained from 5 a cancer patient, or for detecting the CAAP1 gene deleted status of a tumour from a sample obtained from a cancer patient. Clause 19. An vitro diagnostic test according to clause 18, wherein sample obtained from the patient is a tumour tissue sample or a blood sample. Clause 20. Use of CAAP1 protein or the polynucleotide encoding the CAAP1 gene as a 10 biomarker for identifying a tumour that will be sensitive to treatment with a PRMT5 inhibitor. Clause 21. A method of treatment of a tumour, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s tumour has been characterised as being CAAP1-deficient or CAAP1-null. Clause 22. A method according to clause 21, wherein the cancer has a loss of function- 15 related alteration in the CAAP1 gene. Clause 23. A method according to clause 21 or 22, wherein the cancer has a homozygous deletion of the CAAP1 gene. Clause 24. A PRMT5 inhibitor for use according to clause 21 or 22, wherein the loss of function-related alteration in the CAAP1 gene is due to epigenic silencing of the gene. 20 Clause 25. A method according to clause 21, wherein the tumour cells are MTAP-deficient or MTAP-null. Clause 26. A method according to clause 25, wherein the cancer has a loss of function- related alteration in the MTAP gene. Clause 27. A method according to clause 25 or 26, wherein the tumour cells have a 25 homozygous deletion of the MTAP gene. Clause 28. A method according to clause 25 or 26, wherein the loss of function-related alteration in the MTAP gene is due to epigenic silencing of the gene. Clause 29. A method according to any one of clauses 21 to 28, wherein the PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 inhibitor 2, or a PRMT5 inhibitor disclosed in 30 WO2022026892, WO2022115377 and WO2021163344. Clause 30. A method according to any one of clauses 21 to 29, wherein the cancer is pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, 5 prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma. Clause 31. A method of treatment of a tumour according to any of clauses 21 to 30, wherein the PRMT5 inhibitor is administered as monotherapy. Clause 32. A method of treating a cancer patient comprising the steps of: 10 i. obtaining a biological sample from the patient; ii. detecting the expression of CAAP1 protein in the sample and/or determining that the patient has a cancer that is CAAP1-null by analysing the sample ; iii. characterising the patient’s cancer as being sensitive to treatment with a PRMT5 inhibitor if a) reduced levels of, or no, CAAP1 protein is detected in the sample or 15 b) if the cancer is determined to be CAAP1-null; and iv. administering a therapeutically effective amount of a PRMT5 inhibitor to the patient if the tumour is characterised as being sensitive to treatment with a PRMT5 inhibitor in step iii. Clause 33. A method of treating a cancer patient according to clause 32, further comprising 20 detecting the presence of MTAP protein in a sample obtained from the patient and/or detecting the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, in a sample obtained from the patient, wherein a tumour that is identified as CAAP1/MTAP-deficient or CAAP1/MTAP-null is characterised as being sensitised to, and suitable for treatment with, a therapeutically effective amount of a PRMT5 inhibitor. 25 Clause 34. A method of treating a cancer patient according to clauses 32 or 33, wherein the presence of CAAP1 protein, and optionally MTAP protein, is detected in a tumour tissue sample. Clause 35. A method of treating a cancer patient according to any of clauses 32 to 34, wherein the presence of a loss of function-related alteration in the CAAP1 gene, or in its 30 regulatory or promoter sequences, and optionally the presence of a loss of function-related alteration in the MTAP gene, or in its regulatory or promoter sequences, is detected in a tumour tissue sample, or in a blood sample. Clause 36. Use of a PRMT5 inhibitor for the manufacture of a medicament for the treatment of cancer, wherein the medicament is for use in the treatment of cancers that have been 35 identified as being CAAP1-null or CAAP1-deficient. Clause 37. Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 36, wherein the cancer has a loss of function-related alteration in the CAAP1 gene. Clause 38. Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 36 or 37, wherein the cancer has a homozygous deletion of the CAAP1 gene. 5 Clause 39. Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 36 or 37, wherein the loss of function-related alteration in the CAAP1 gene is due to epigenic silencing of the gene. Clause 40. Use of a PRMT5 inhibitor for the manufacture of a medicament according to any of clauses 36 to 39, wherein the cancer has been identified as being MTAP-deficient or MTAP- 10 null (e.g. MTAP-deficient). Clause 41. Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 40, wherein the tumour cells have a loss of function-related alteration in the MTAP gene. Clause 42. Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 40 or 41, wherein the cancer has a homozygous deletion of the MTAP gene. 15 Clause 43. Use of a PRMT5 inhibitor for the manufacture of a medicament according to clause 40 or 41, wherein the loss of function-related alteration in the MTAP gene is due to epigenic silencing of the gene. Clause 44. Use of a PRMT5 inhibitor for the manufacture of a medicament according to any of clauses 36 to 43, wherein the PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 20 inhibitor 2, or a PRMT5 inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344. Clause 45. Use of a PRMT5 inhibitor for the manufacture of a medicament according to any of clauses 36 to 44, wherein the cancer is pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), 25 lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, 30 melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma. Clause 46. Use of a PRMT5 inhibitor for the manufacture of a medicament according to any of clauses 36 to 45, wherein the medicine is for use as a monotherapy. Clause 47. A pharmaceutical composition comprising a PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1- deficient. Clause 48. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to 5 clause 47, wherein the cancer has a loss of function-related alteration in the CAAP1 gene. Clause 49. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to clause 47 or 48, wherein the cancer has a homozygous deletion of the CAAP1 gene. Clause 50. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to clause 47 or 48, wherein the loss of function-related alteration in the CAAP1 gene is due to 10 epigenic silencing of the gene. Clause 51. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 50, wherein the cancer has been identified as being MTAP-deficient or MTAP-null (e.g. MTAP-deficient). Clause 52. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to 15 clause 51, wherein the cancer has a loss of function-related alteration in the MTAP gene. Clause 53. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to clause 51 or 52, wherein the cancer has a homozygous deletion of the MTAP gene. Clause 54. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to clause 51 or 52, wherein the loss of function-related alteration in the MTAP gene is due to 20 epigenic silencing of the gene. Clause 55. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 54, wherein the PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 inhibitor 2, or a PRMT5 inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344. 25 Clause 56. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 55, wherein the cancer is pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, 30 cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma. Clause 57. A pharmaceutical composition comprising a PRMT5 inhibitor for use according to any of clauses 47 to 56, wherein the composition is for use as a monotherapy. Clause 58. A MAT2A inhibitor for use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1-deficient. Clause 59. Use of a MAT2A inhibitor for the manufacture of a medicament for the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient. Clause 60. A method of treating cancer, comprising administering a therapeutically effective amount of a MAT2A inhibitor to a patient in need thereof, wherein the patient’s cancer or tumour has been characterised as being CAAP1-null or CAAP1-deficient. Clause 61. A kit comprising a PRMT5 inhibitor or a MAT2A inhibitor and instructions for their use in the treatment of cancer, wherein the cancer is identified as being CAAP1-null or CAAP1- deficient. Clause 62. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61, wherein the PRMT5 inhibitor is a compound of formula (I): wherein: the ring containing X and Y is a pyrrole and X is NH and Y is CH or X is CH and Y is NH; Z is selected from CH, CF, CCl or, if Q is not N, N; Q is selected from CH, CF, CCl or, if Z is not N, N; m is 0, 1 or 2; n is 0, 1 or 2; p is 1 or 2; R1 is in each occurrence independently selected from F, Cl, CN, Me, CF3, C1-C3 alkyl, cyclopropyl, C1-C3 fluoroalkyl, OMe or C1-C3 alkoxy; R2 is in each occurrence independently selected from F, Cl, Me, MeO and CF3; R3 is H, Me, C1-C3 alkyl or C1-C3 fluoroalkyl; R4 is H, Me or C1-C3 alkyl; R5 is H, Me, C1-C3 alkyl, C1-C3 fluoroalkyl, CH2OMe, CH2OCHF2, CH2OCF3, CH2O(C1-C3 alkyl), CH2O(C1-C3 fluoroalkyl), C(CH2CH2)R6, CCR7, CH2R8, R9 or CH2R10; R6 is H, Me, CH2F, CHF2, CF3, CH2OH or CH2OMe; R7 is H, Me, cyclopropyl, C1-C3 alkyl, C1-C3 fluoroalkyl, C3-C6 cycloalkyl or a 5-membered heteroaryl group optionally substituted with Me, C1-C3 alkyl, F or Cl; R8 is a 5-membered heteroaryl optionally substituted with Me, C1-C3 alkyl, F or Cl; R9 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group; and R10 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group, or a pharmaceutically acceptable salt thereof. Clause 63. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 62, wherein the PRMT5 inhibitor is selected from: (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(4-fluorobenzyl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(prop-2-yn-1-yl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(3-(1-methyl-1H- pyrazol-4-yl)prop-2-yn-1-yl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-4-((2-((5-amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-2',3-dioxospiro [isoindoline-1,3'-pyrrolidin]-1'-yl)methyl)-2-fluorobenzonitrile; (S)-1'-(3-(2H-1,2,3-Triazol-2-yl)benzyl)-2-((5-amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2,5-difluorobenzyl)-5- fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2,2-difluoroethyl)-5-fluorospiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((1-(fluoromethyl) cyclopropyl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'- methylspiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; 5 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(2-(difluoromethoxy)ethyl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((3-fluoropyridin-2- yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(isoxazol-5-ylmethyl) 10 spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((5-(trifluoromethyl) pyridazin-3-yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((1-methyl-1H-indazol- 5-yl)methyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; 15 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(benzo[d]oxazol-2-ylmethyl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(4-fluorophenoxy) ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(4-methylthiazol-5- 20 yl)ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-((R*)-1-(1- methylcyclopropyl)ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(3-cyclopropylprop-2-yn-1-yl)-5- fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; 25 (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-4-chloro-1'-(4-fluorobenzyl)spiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2'-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1-(4- fluorobenzyl)spiro[pyrrolidine-3,1'-pyrrolo[3,4-c]pyridine]-2,3'(2'H)-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1',7-dimethylspiro 30 [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-7-methoxy-1'-methylspiro [isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2'-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1-(4- fluorobenzyl)spiro[pyrrolidine-3,3'-pyrrolo[3,4-c]pyridine]-1',2(2'H)-dione; (S)-5-Amino-2-((5-fluoro-1'-((1-methylcyclopropyl)methyl)-2',3-dioxospiro[isoindoline-1,3'- pyrrolidin] -2-yl)methyl)-1H-pyrrolo[3,2-b]pyridine-7-carbonitrile; 5 (S)-2-((5-Amino-6-chloro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2-(trifluoromethoxy) ethyl)spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; (S)-2-((6-Amino-4-methyl-1H-pyrrolo[2,3-b]pyridin-2-yl)methyl)-5-fluoro-1'-(2,4,5-trifluorobenzyl) spiro[isoindoline-1,3'-pyrrolidine]-2',3-dione; and (1S,5'S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1',5'-dimethylspiro 10 [isoindoline-1,3'-pyrrolidine]-2',3-dione; or a pharmaceutically acceptable salt of any one thereof. Clause 64. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61 to 63, wherein the PRMT5 inhibitor is (S)-2-((5- Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline- 15 1,3’-pyrrolidine]-2’,3-dione): inhibitor 1), or a pharmaceutically acceptable salt thereof. Clause 65. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61 to 64, wherein the PRMT5 inhibitor is (S)-2-((5-20 Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline- 1,3’-pyrrolidine]-2’,3-dione): (PRMT5 inhibitor 1). Clause 66. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61 to 64, wherein the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-5-fluoro-1’-(4-fluorobenzyl)spiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione): inhibitor 1). Clause 67. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit 5 according to any one of clauses 1 to 57 or 61 to 63, wherein the PRMT5 inhibitor is (S)-2-((5- Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline- 1,3’-pyrrolidine]-2’,3-dione: inhibitor 2). or a pharmaceutically acceptable salt thereof. 10 Clause 68. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 to 63 or 67, wherein the PRMT5 inhibitor is (S)-2-((5- Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2-yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline- 1,3'-pyrrolidine]-2',3-dione: inhibitor 2). 15 Clause 69. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 to 63 or 67, wherein the PRMT5 inhibitor is a pharmaceutically acceptable salt of (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2-b]pyridin-2- yl)methyl)-1'-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3'-pyrrolidine]-2',3-dione: 5 inhibitor 2). Clause 70. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61, wherein the PRMT5 inhibitor is (P)-2-[4-[4- (aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- 5 fluoro-benzonitrile: , or a pharmaceutically acceptable salt thereof. Clause 71. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 70, wherein the PRMT5 inhibitor is (P)-2-[4-[4-10 (aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3- fluoro-benzonitrile: . Clause 72. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 70, wherein the PRMT5 inhibitor is a15 pharmaceutically acceptable salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2- methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: . Clause 73. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61, 70 or 72, wherein the PRMT5 inhibitor is a hydrochloride salt of (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin-6-yl]-2-methyl-pyrazol-3-yl]- 4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: 5 . Clause 74. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61, wherein the PRMT5 inhibitor is (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- yl]methanone: 10 , or a pharmaceutically acceptable salt thereof. Clause 75. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 74, wherein the PRMT5 inhibitor is (4-amino-1,3- dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)-3-[4-(trifluoromethyl)phenyl]morpholin-4- 15 yl]methanone: . Clause 76. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 74, wherein the PRMT5 inhibitor is a pharmaceutically acceptable salt of (4-amino-1,3-dihydrofuro[3,4-c][1,7]naphthyridin-8-yl)-[(3S)- 20 3-[4-(trifluoromethyl)phenyl]morpholin-4-yl]methanone: . Clause 77. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61, wherein the PRMT5 inhibitor is N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: 5 , or a pharmaceutically acceptable salt thereof. Clause 78. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 77, wherein the PRMT5 inhibitor is N-(6-amino-5- methylpyridin-3-yl)-2-((2R,5S)-2-(benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: 10 . Clause 79. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 78, wherein the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5-methylpyridin-3-yl)-2-((2R,5S)-2- (benzo[d]thiazol-5-yl)-5-methylpiperidin-1-yl)-2-oxoacetamide: 15 . Clause 80. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57 or 61, wherein the PRMT5 inhibitor is N-(6-amino-5- ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin- 1-yl)-2-oxoacetamide: 5 , or a pharmaceutically acceptable salt thereof. Clause 81. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 80, wherein the PRMT5 inhibitor is N-(6-amino-5- ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1-methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin- 10 1-yl)-2-oxoacetamide: . Clause 82. A PRMT5 inhibitor for use, method, use, pharmaceutical composition or kit according to any one of clauses 1 to 57, 61 or 80, wherein the PRMT5 inhibitor is a pharmaceutically acceptable salt of N-(6-amino-5-ethylpyridin-3-yl)-2-((2R,5S)-5-methyl-2-(2-(1- 15 methylpiperidin-4-yl)benzo[d]thiazol-5-yl)piperidin-1-yl)-2-oxoacetamide: . Clause 83. A PRMT5 inhibitor for use, method, use, pharmaceutical composition, in vitro diagnostic test, MAT2A inhibitor for use or kit according to any preceding clause, wherein the cancer is lung cancer (such as NSCLC). Clause 84. A PRMT5 inhibitor for use, method, use, pharmaceutical composition, in vitro diagnostic test, MAT2A inhibitor for use or kit according to any preceding clause, wherein the cancer is gastric cancer. Clause 85. A PRMT5 inhibitor for use, method, use, pharmaceutical composition, in vitro 5 diagnostic test, MAT2A inhibitor for use or kit according to any preceding clause, wherein the cancer is pancreatic cancer. Clause 86. A PRMT5 inhibitor for use, method, use, pharmaceutical composition, in vitro diagnostic test, MAT2A inhibitor for use or kit according to any preceding clause, wherein the cancer is oesophageal cancer. 10 Clause 87. A PRMT5 inhibitor for use, method, use, pharmaceutical composition, in vitro diagnostic test, MAT2A inhibitor for use or kit according to any preceding clause, wherein the cancer is bladder cancer. Clause 88. A PRMT5 inhibitor for use, method, use, pharmaceutical composition, in vitro diagnostic test, MAT2A inhibitor for use or kit according to any preceding clause, wherein the 15 cancer is head and neck cancer (such as HNSCC).
SEQUENCES SEQ ID NO.1 (CAAP1 mRNA isoform 1) 1 agtgcctgcc gcccacggcc gcaggagtcg ggcttcggtc gcaccagaga cagcggactt 5 61 tcctccgatg gttgcagcag agggatcatg acggggaaaa agtcctcccg ggagaaacgg 121 cgcaaacgta gcagtcagga ggcggccgca gcgctcgcgg ccccggacat cgtacccgcg 181 ttggccagcg gcagcagtgg aagcactagc ggctgcggga gcgccggggg ctgcgggagc 241 gtcagctgct gtgggaacgc caattttagt ggaagtgtca ccggcggtgg gagcggcggc 301 agctgttggg gcgggagcag cgtggagcgc agcgagcgcc ggaagcggag gagtaccgac 10 361 tcttccagcg tctcgggctc cttgcagcag gaaactaaat atattttgcc aactttggaa 421 aaagaattat tcttggcaga gcacagtgac cttgaagaag gtggactgga cctgactgtg 481 tcattgaaac cagttagttt ctatatatca gacaaaaaag aaatgcttca gcagtgcttc 541 tgtattatag gagagaaaaa gttacagaag atgcttcctg atgtgttaaa gaactgttca 601 atagaagaaa ttaaaaaact atgccaggaa cagttagagc tcctgtctga aaaaaaaatt 15 661 ttgaagattc ttgagggtga caatggaatg gactctgata tggaagagga agcagatgat 721 ggttctaaga tgggatctga tttagtcagt cagcaagaca tctgtataga ttctgcttca 781 tccgtgagag agaataagca acctgaaggt ttggaattaa aacaaggaaa aggggaagat 841 agtgatgtac tcagtataaa tgcagatgct tatgacagcg acatagaagg cccatgcaac 901 gaagaagcag ctgctcccga ggcaccagaa aatacagtcc aaagtgaagc tggtcagata 20 961 gatgacctgg agaaagacat tgagaaaagt gtgaatgaga ttctaggact ggcagagtct 1021 agcccaaacg aacccaaagc agccaccctg gctgttcctc caccagaaga tgttcaacct 1081 tctgcacagc aactggagct gctagaactt gagatgaggg caagagcgat taaagcccta 1141 atgaaagctg gtgatataaa aaagccagcc taggtattta acttgatttt gaattttagg 1201 tatgtttgaa caaagccaca tcatttaatt ttgtatctaa aatttatttg gggtcttata 25 1261 tgttatttct catgtaaccc ttattaggac tcattttagc cctaaattac ctgtggctgt 1321 ttctttttat ttttttgact acttttatat tataaatgtg tgttactgtc ttatgaattc 1381 atggcaatat agttggatag cctggatact ttgttagatg agtatttagc tgtgtctgca 1441 aatcttaaaa gccattagca aagagtcgtg gtattttttt ctttattttt aaatgtttgg 1501 gcaccaaacc taaaagcaaa agattgacga agcatgtttc tcttaaggct acttgtattt 30 1561 tacaatacaa tattaaatta tttaatttga gaaatttagt tttgcttata tgcacttttt 1621 aaatatatac tattttgaag attccttatg taaatgcaaa tttcctagtt aaaaccgaat 1681 aacagagatc tgaaatgact gagaaaaact tttttattaa aggaaggaat taatttaagg 1741 caatttttaa ctatgtagaa ctaattgccc atgtttaatt atagcagaca cgccattcta 1801 acaggtattt gataccattg gatgcattat tctaggtttt ttctttaata aaaatggaac 35 1861 aagttttcat ttacattcca agctgtcagg aaatgaagaa tattttatta tctaggattt 1921 tatctgatgt agttgcttaa agatctgatg tgctataatt ccatgaatca gaaataataa 1981 aatgctatca ttctggatct gaagactttt gatacttttt caaaagcaaa attaatttca 2041 ggaacctttg ataagttgtt gttataatta atctaatttt gtatagtttt tgtaaataaa 2101 ttaccatcct tccacaatta gggatgcttt tatcccccca tcactaattg cagttgtttg 40 2161 ataccaaaat aaatttacgt agagatcctt aacttaaaat aaattaattt tttcaaaaaa 2221 cataaatctg gaactgttgt ttctatattt gataacaaat acagtatatt ttatttataa 2281 gccatggtct actgatactg tatgaggact ttccttatat ataaaagttg cagggattgt 2341 gttttattag ctgctttaat tatgttaatt ttagagagtt tttaaatgga aatagaggac 2401 atttatgaaa cgctggaatt gcagttacaa attctttttg ttgttgttgt tcctgaacat 45 2461 gccttggaat aattctacca ttttttcccc ctccataaat ctttctaata aagcatagaa 2521 aaagcctata tgattttaaa tgcttctctt aagctggtaa acagatttga gttatgagtt 2581 cattgttatt gcttcaagat gaaaagacag tgatataatt tttctatttc aacttaaaag 2641 taatagttaa tatgctaaag tagtacagaa taaactttat tgctgcttac taactacaaa 2701 atactgtaga tggcatctgt atgattaaac atataaagta aaacaggtct gagggctttg 2761 tagatgatta aagtctccac cttcatgaa 5 SEQ ID NO.2: (CAAP1 mRNA isoform 2) 1 agtgcctgcc gcccacggcc gcaggagtcg ggcttcggtc gcaccagaga cagcggactt 61 tcctccgatg gttgcagcag agggatcatg acggggaaaa agtcctcccg ggagaaacgg 121 cgcaaacgta gcagtcagga ggcggccgca gcgctcgcgg ccccggacat 10 cgtacccgcg 181 ttggccagcg gcagcagtgg aagcactagc ggctgcggga gcgccggggg ctgcgggagc 241 gtcagctgct gtgggaacgc caattttagt ggaagtgtca ccggcggtgg gagcggcggc 15 301 agctgttggg gcgggagcag cgtggagcgc agcgagcgcc ggaagcggag gagtaccgac 361 tcttccagcg tctcgggctc cttgcagcag gtgcgtgcgc gcccctctgg ccgcttcctg 421 gagctgctgc tttttcggaa gaagtcgggc ttccagaggg atggggcgca 20 ggctggagct 481 cactgctagc gcggcaatct caaggtcgtc cgtccttgag gttcatgttc ctacctaagt 541 cctggaaact aaatatattt tgccaacttt ggaaaaagaa ttattcttgg cagagcacag 25 601 tgaccttgaa gaaggtggac tggacctgac tgtgtcattg aaaccagtta gtttctatat 661 atcagacaaa aaagaaatgc ttcagcagtg cttctgtatt ataggagaga aaaagttaca 721 gaagatgctt cctgatgtgt taaagaactg ttcaatagaa gaaattaaaa 30 aactatgcca 781 ggaacagtta gagctcctgt ctgaaaaaaa aattttgaag attcttgagg gtgacaatgg 841 aatggactct gatatggaag aggaagcaga tgatggttct aagatgggat ctgatttagt 35 901 cagtcagcaa gacatctgta tagattctgc ttcatccgtg agagagaata agcaacctga 961 aggtttggaa ttaaaacaag gaaaagggga agatagtgat gtactcagta taaatgcaga 1021 tgcttatgac agcgacatag aaggcccatg caacgaagaa gcagctgctc 40 ccgaggcacc 1081 agaaaataca gtccaaagtg aagctggtca gatagatgac ctggagaaag acattgagaa 1141 aagtgtgaat gagattctag gactggcaga gtctagccca aacgaaccca aagcagccac 5 1201 cctggctgtt cctccaccag aagatgttca accttctgca cagcaactgg agctgctaga 1261 acttgagatg agggcaagag cgattaaagc cctaatgaaa gctggtgata taaaaaagcc 1321 agcctaggta tttaacttga ttttgaattt taggtatgtt tgaacaaagc 10 cacatcattt 1381 aattttgtat ctaaaattta tttggggtct tatatgttat ttctcatgta acccttatta 1441 ggactcattt tagccctaaa ttacctgtgg ctgtttcttt ttattttttt gactactttt 15 1501 atattataaa tgtgtgttac tgtcttatga attcatggca atatagttgg atagcctgga 1561 tactttgtta gatgagtatt tagctgtgtc tgcaaatctt aaaagccatt agcaaagagt 1621 cgtggtattt ttttctttat ttttaaatgt ttgggcacca aacctaaaag 20 caaaagattg 1681 acgaagcatg tttctcttaa ggctacttgt attttacaat acaatattaa attatttaat 1741 ttgagaaatt tagttttgct tatatgcact ttttaaatat atactatttt gaagattcct 25 1801 tatgtaaatg caaatttcct agttaaaacc gaataacaga gatctgaaat gactgagaaa 1861 aactttttta ttaaaggaag gaattaattt aaggcaattt ttaactatgt agaactaatt 1921 gcccatgttt aattatagca gacacgccat tctaacaggt atttgatacc 30 attggatgca 1981 ttattctagg ttttttcttt aataaaaatg gaacaagttt tcatttacat tccaagctgt 2041 caggaaatga agaatatttt attatctagg attttatctg atgtagttgc ttaaagatct 35 2101 gatgtgctat aattccatga atcagaaata ataaaatgct atcattctgg atctgaagac 2161 ttttgatact ttttcaaaag caaaattaat ttcaggaacc tttgataagt tgttgttata 2221 attaatctaa ttttgtatag tttttgtaaa taaattacca tccttccaca 40 attagggatg 2281 cttttatccc cccatcacta attgcagttg tttgatacca aaataaattt acgtagagat 2341 ccttaactta aaataaatta attttttcaa aaaacataaa tctggaactg ttgtttctat 2401 atttgataac aaatacagta tattttattt ataagccatg gtctactgat actgtatgag 5 2461 gactttcctt atatataaaa gttgcaggga ttgtgtttta ttagctgctt taattatgtt 2521 aattttagag agtttttaaa tggaaataga ggacatttat gaaacgctgg aattgcagtt 2581 acaaattctt tttgttgttg ttgttcctga acatgccttg gaataattct 10 accatttttt 2641 ccccctccat aaatctttct aataaagcat agaaaaagcc tatatgattt taaatgcttc 2701 tcttaagctg gtaaacagat ttgagttatg agttcattgt tattgcttca agatgaaaag 15 2761 acagtgatat aatttttcta tttcaactta aaagtaatag ttaatatgct aaagtagtac 2821 agaataaact ttattgctgc ttactaacta caaaatactg tagatggcat ctgtatgatt 2881 aaacatataa agtaaaacag gtctgagggc tttgtagatg attaaagtct 20 ccaccttcat 2941 gaa SEQ ID NO.3 (CAAP1 protein isoform 1) 1 mtgkkssrek rrkrssqeaa aalaapdivp alasgssgst sgcgsaggcg svsccgnanf 25 61 sgsvtgggsg gscwggssve rserrkrrst dsssvsgslq qetkyilptl ekelflaehs 121 dleeggldlt vslkpvsfyi sdkkemlqqc fciigekklq kmlpdvlknc sieeikklcq 181 eqlellsekk ilkilegdng mdsdmeeead dgskmgsdlv sqqdicidsa ssvrenkqpe 241 glelkqgkge dsdvlsinad aydsdiegpc neeaaapeap entvqseagq iddlekdiek 301 svneilglae sspnepkaat lavpppedvq psaqqlelle lemraraika lmkagdikkp 30 361 a SEQ ID NO.4: (CAAP1 protein isoform 2) 1 mlqqcfciig ekklqkmlpd vlkncsieei kklcqeqlel lsekkilkil egdngmdsdm 61 eeeaddgskm gsdlvsqqdi cidsassvre nkqpeglelk qgkgedsdvl sinadaydsd 35 121 iegpcneeaa apeapentvq seagqiddle kdieksvnei lglaesspne pkaatlavpp 181 pedvqpsaqq lellelemra raikalmkag dikkpa The specification will now be further defined by reference to the following non-limiting examples. 40 EXAMPLES Example 1: The generation of cas9 expressing human cancer cell lines. NCI-H838, Lu-99, SW1573, HCC-15, NCI-H1650 and NCI-H2126 human lung cancer cell lines were cultured and transduced with a lentiviral vector carrying a Cas9 transgene as well as a 5 blasticidin resistance cassette. After 72 hours, transduced cell populations were selected by treatment with blasticidin. Cas9 expressing cell lines were then transduced with a reporter virus carrying BFP, GFP and a gRNA targeted against GFP, or a control reporter virus comprised of the same backbone and fluorophore composition but lacking the gRNA region. Cas9 activity was analysed via the 10 measurement of the percentage population of BFP+/GFP- cells within a population. GFP gating was assessed based on the positive signal from cell populations transduced with the control reporter virus. Results Transduction of human lung cancer cell lines with a lentiviral Cas9 vector resulted in Cas9 activity 15 in all cell lines assessed. BFP+/GFP- cells represented over 80% of populations in cells sequentially transduced with Cas9, followed by a reporter virus carrying BFP, GFP and a gRNA targeting GFP (Figure 1). Therefore, in all cell lines, efficiency exceeds 80% following transduction. Example 2: Identifying PRMT5 inhibitor sensitising genes in human lung cancer cell lines using 20 a CRISPR-based genome wide screen Cas9 expressing lines were incubated with a genome-wide gRNA lentiviral library (Yusa_v3) for 24 hours. Transduced cells were selected by treatment with puromycin 72 hours after transduction. Transduction levels were then predicted based on the levels of BFP+ cells within a population. 25 Transduced cells were divided and treated with either vehicle (DMSO) or PRMT5 inhibitor 1 for a period of 14-34 days, dependent on the time taken for control cultures to double ten times. A small population of cells were taken at baseline, for sequencing analysis. At the end-point, cells were harvested for sequencing and the sgRNA counts were calculated and compared between groups. Results 30 BFP positivity was used to assess genome-wide gRNA lentiviral transduction in Cas9 expressing CDKN2A/MTAP null cell lines. Prior to selection, BFP was detected in >20% of cells in each of the six cell lines tested. Puromycin selection increased the percentage of BFP+ cells in transduced cell populations, yielding >60% BFP+ cells. Over 80% of cells expressed BFP at Day 8 (+Puromycin) in NCI-H838, LU99, SW1573 and HCC15 cells and by Day 11 (+ Puromycin) in 35 H1650 and H2126 cells (Figure 2). PRMT5 inhibitor sensitizer hits were identified in all 6 CDKN2A/MTAP null cell lines tested (Table 1). Of these, 11 candidates were identified as PRMT5 inhibitor sensitising genes in at least 3 CDKN2A/MTAP null cell lines following a CRISPR screen. Among these was CAAP1, which was shown to significantly sensitise NCI-H838, HCC-15 and NCI-H2126 cells to PRMT5 inhibition 5 (Figure 3). Table 1. Cell lines: CDKN2A/MTAP null Number of PRMT5i sensitizers identified in total NCI-H838 138 LU99 17 SW1573 25 HCC-15 176 NCI-H1650 47 NCI-H2126 53 The average normalised CAAP1 sgRNA counts in PRMT5 inhibitor treated cells was found to be lower than their untreated counterparts in all CDKN2A/MTAP null cell lines tested (Figure 4). In 10 NCI-H838 (Figure 4A), HCC-15 (Figure 4D) and NCI-H2126 cells (Figure 4F), normalised CAAP1 sgRNA counts were significantly lower in PRMT5 inhibitor cultures, when compared to untreated cultures. To assess the effect of PRMT5 inhibition on the proliferation of CDKN2A/MTAP null cell lines, the doublings of treated cells was compared to untreated cells. In all cell lines, the number of 15 doublings of PRMT5 inhibitor 1 treated cells was lower over a 14–34-day period, compared to untreated cell populations (Figure 5). In fact, in the time taken for the appropriate control cultures to reach ten doublings, at most, PRMT5 inhibitor 1 treated cultures reached around four doublings (Figure 5C). NCI-H2126 cells treated with PRMT5 inhibitor 1 almost halved in number over a 34- day period (Figure 5F). 20 Example 3: Generation and characterization of CAAP1 deficient cell lines HEK 293T cells were seeded in Nunc Cell-Culture Treated 6-well plates (Thermo Fisher Scientific) at a density of 1x106 cells/well. After 24 hours, cells were transfected using X-tremeGENE HP DNA Transfection Reagent (#06 366 236 001, Roche), according to the manufacturer’s instructions. Briefly, cells were transfected with 2 μg of packaging plasmid psPAX2 (#12260, 25 Addgene), 1 μg of the envelope plasmid pMD2.G (#12259, Addgene) and 2 μg of gRNA lentiviral construct in the final transfection volume of 200 μl/well (including X-tremeGENE HP DNA Transfection Reagent, used at 3:1 ratio), using OptiMEM (Thermo Fisher Scientific). After 48 hours, the supernatant was filtered using 0.45 µm cell strainers (BD Falcon). HCC15 and NCI-H838 cell lines stably expressing Cas9 were cultured in RPMI-1640, (31870074, Thermo Fisher Scientific), supplemented with 1% GlutaMax (35050-038, Thermo Fisher 5 Scientific), 10% FCS, and 7 µg/µl, and 5.5 µg/µl of blasticidin (A1113903, Thermo Fisher Scientific), respectively. To generate the CAAP1 KO cell lines, 75000 cells/well were seeded in Nunc Cell-Culture Treated 6-well plates (Thermo Fisher Scientific), and 16 hours later the media was replaced with fresh media containing a pool of 3 CAAP1 gRNA expressing lentiviruses (see above, each diluted 1:250), and PolyBrene (TR-1003, Sigma-Aldrich). After 48 hours, transduced 10 cells were selected using puromycin (2 µg/ml for HCC15 and 1.5 µg/ml for NCI-H838). The sequences of the CAAP1 gRNAs were selected from the whole genome Yusa library (CAGGAGCTCTAACTGTTCC, TTAGTGGAAGTGTCACCGG), and the whole genome Vienna library (AGAGAGAATAAGCAACCTGA). Control cells were transduced with a lentivirus expressing a non-targeting control gRNA sequence (063-1010-000-000, Synthego). 15 Cells were collected and lysed in RIPA buffer (TF 89901; with complete protease and phosphatase inhibitors (Sigma). Protein lysates were normalised for protein content (Biorad, #5000002) and boiled in LDS/reducing agent (TF NP0007/NP0004) before loading 20 μg onto 4- 12% BIS-TRIS gels (Invitrogen) for SDS-PAGE. Gels were transferred to nitrocellulose using iBlot2 (TF) and probed with antibodies. Immunostaining was visualised by HRP-labelled 20 secondary antibodies (Jackson ImmunoResearch) and enhanced chemiluminescence (ThermoFisher #34075) using a 16bit CCD camera (Syngene GBOX). Antibodies: CAAP1 (Atlas/Merck #HPA024029), GAPDH (CST #97166) and Vinculin (Sigma #SAB4200729. Results Upon genetic modification using CRISPR-Cas9 technology, expression levels of CAAP1 protein25 of HCC15 NTC (HCCNTC), HCC15 CAAP1 KO (HCCKO), NCI-H838 NTC (H838NTC) and NCI- H838 CAAP1 KO (H838KO) were assessed by Western Blot as shown in Figure 6. Significant decrease in CAAP1 protein expression levels was detected in HCCKO vs HCCNTC whereas no CAAP1 protein could be detected in H838KO cells. Example 4: The effect of PRMT5 inhibition on CAAP1 null cell lines in vitro 30 HCC15 cell lines were originally obtained from ATCC and were grown in RPMI-1640 growth media (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS) and 2 mM glutamine at 37°C, 5% CO2. Cells were dosed with PRMT5 inhibitor 2, MRTX-1719 or GSK3326595 inhibitor in a 6 well plate (Corning) at doses of 0.1, 0.3 μM or 1 μM using the HP D300e Digital Dispenser (HP Life Science Dispensing). Live-cell imaging was acquired at 10x magnification at every 8h 35 and cell confluency were quantified using incucyte S32022B software (Essen Bioscience). Cell growth was quantified using percentage phase confluency. Cells were plated in a 6 well plate and treated with 0.1 μM, 0.3 μM or 1 μM PRMT5 inhibitor 2. After 4 days of treatment, cells were collected using TrypLE (TF #12604013) in a 96 well v-bottom plate. Cells were spun down (1600rpm for 4mins) in a centrifuge and supernatant was discarded. Cell pellets were stained using the dead cell apoptosis kit (TF #V13241) according to 5 manufacturer's instructions. Cells were then acquired on the BD fortessa and analysed for Annexin and PI positivity. The whole cell pellet was acquired to assess for total number of cells. Results Genetically modified HCC15 and NCI-H838 cell lines that express CAAP1 (NTC) or are devoid of CAAP1 expression (KO) were treated with three doses of PRMT5 inhibitor 2 and cell confluency 10 was assessed by live imaging. As shown in Figure 7, cells expressing CAAP1 were less sensitive to PRMT5 inhibitor 2 compared to their KO isogenic pair. Compound washout did not result in regrowth of any of the examined cell lines. To further understand whether CAAP1 KO cells are more prone to apoptosis upon treatment with PRMT5 inhibitor 2, Anexin V staining was performed. Upon 4 days of treatment with PRMT5 15 inhibitor 2, an increase in the percentage of apoptotic cells was detected in HCC15 CAAP1 KO cells compared to HCC15 NTC cells, independently of the dose of the inhibitor that was used (Figure 8A). This effect was further confirmed by addressing the total cell numbers upon PRMT5 inhibitor 2 treatment where the decrease in total cell numbers was higher in HCC15 CAAP1 KO compared to HCC15 NTC cells (Figure 8B). Moreover, CAAP1 deficiency also increased 20 sensitivity to an additional MTA cooperative PRMT5 inhibitor, MRTX-1719 (Figure 9A), as well as to 1st generation PRMT5 inhibitor GSK3326595 (Figure 9B), suggesting that CAAP1 deletion is a biomarker of sensitivity to both MTA-cooperative and non-MTA-cooperative PRMT5 inhibitors. MRTX-1719 is the codename for the compound (P)-2-[4-[4-(aminomethyl)-1-oxo-2H-phthalazin- 25 6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: Example 5: The effect of PRMT5 inhibition on CAAP1 null tumour growth in PDX models Tumour xenograft fragments from human lung, gastric, oesophageal, pancreatic, bladder and head and neck cancers were grafted subcutaneously at the right flank of the mice. When the 30 tumors reached 100-200mm3, mice were randomized into two groups with half administered PRMT5 inhibitor 2, and half administered vehicle. PRMT5 inhibitor 2 was administered orally at a dose of 100mg/kg BID for a period of up to 63 days. Tumours were characterised as either CAAP1 wild-type (WT) or CAAP1 null. Tumour growth in vivo was measured for up to 63 days post dosing start and tumour growth index was calculated. 5 Results 81 different PDX (patient derived xenograft) models were exposed to treatment with PRMT5 inhibitor 2. A control arm cohort were grafted and administered vehicle. Over the course of treatment, 14/26 (53.84%) CAAP1 null PDX models demonstrated regression in response to PRMT5 inhibitor 2 treatment.6 CAAP1 null models were driven to stasis (defined as 0-20% of 10 tumor growth relative to vehicle) upon PRMT5 inhibitor 2 treatment and the remaining 6 CAAP1 null PDX models showed an extent of tumour growth inhibition with PRMT5 inhibitor 2 treatment (Figures 10 and 11). These results demonstrate the potential for PRMT5 inhibitor monotherapy treatment of CAAP1 null tumours. B296, M1030, CTG-1076 and M425 are codenames for bladder cancer PDX models. LD2-0017- 15 201064 and LD1-0017-200808 are codenames for gastric cancer PDX models. CTG-2986 and LD1-0023-200615 are codenames for head and neck cancer PDX models. LD1-0025-200629, LD1-0025-360765, LD1-0025-360961 and CTG-3196 are codenames for lung cancer PDX models. LD2-0033-200923, LD2-0033-200926 and LD2-0033-200938 are codenames for pancreatic cancer PDX models. 20 CAAP1 null tumour size was measured twice a week in the control group cohort and PRMT5 inhibitor 2 treatment arm. All CAAP1 null PDX models showed growth following implantation in control animals (Figure 12A-12F). However, 5/6 CAAP1 null PDX models demonstrated regression by weeks 2-5 post-implantation in PRMT5 inhibitor 2 treated mice (Figure 12B-12F). The remaining PDX model showed stasis throughout PRMT5 inhibitor 2 treatment, demonstrating 25 substantially less growth than that observed in untreated control mice (Figure 12A). Two CAAP1 null PDX models (LU0038 and LU2551) that were driven to complete regression by PRMT5 inhibitor 2 treatment were followed upon the treatment cessation to assess the durability of the treatment effect. In case of LU0038 no tumor growth was detected nearly 2 months after treatment was stopped (Figure 13A), whereas LU2551 was tumor free for almost 40 days before 30 tumor regrowth was detected (Figure 13B), thus implying long treatment effect in CAAP1 null models. To understand whether tumors that regrow after treatment cessation are still responsive to PRMT5 inhibitor 2, ES11088 model was dosed with PRMT5 inhibitor 2 and tumor growth inhibition was induced. Upon treatment cessation, tumor growth continued and showed response when treated with second round of PRMT5 inhibitor 2 (Figure 13C), suggesting the potential for 35 re-treatment with the same inhibitor. The results of treatment in CAAP1 null PDX models in LU0038 and ES0214 with AG-270 have previously been reported (Kalev et al., 2021, Cancer Cell 39, 209-224 (Figures 14A-B). Similar tumour regression is observed upon treatment of the same PDX models with PRMT5 inhibitor 2 (Figures 14C-D) suggesting that deletion of CAAP1-deletion is implicated in the increased 5 sensitivity to MAT2A inhibitors. AG-270 is the code name for the compound with the following structure: . Example 6: Activity of MTA-synergistic and non-MTA-synergistic PRMT5 inhibitors in CAAP1 null PDX models 10 PDX tumour fragments (GA2254, obtained from human gastric cancer), harvested from donor mice, were inoculated subcutaneously at the upper right dorsal flank of female Balb/c nude mice. When the tumour size had reached approximately 150 mm3 mice were allocated to treatment arms. Mice were divided into 8 groups and then administered vehicle or PRMT5 inhibitor 1 (at three 15 individual dose levels: 50mg/kg BID, 10mg/kg BID, 1mg/kg BID), GSK3326595 (at three dose levels 100mg/kg BID, 10mg/kg BID, 1mg/kg BID) or JNJ64619178 (10mg/kg QD). As shown in Figure 15, the highest dose of all compounds used in the study induced tumour regression in this CAAP1-null PDX model indicating that CAAP1 loss can sensitise a tumour to treatment with both 1st generation (non-MTA synergistic) and 2nd generation, MTA-synergistic, PRMT5 inhibitors. 20 The results of treatment in CAAP1 null PDX models (PA0372 and GA2254) with MRTX-1719 have been reported (Engstorm LD et al. Cancer Discovery, 2023 Nov 1;13(11):2412-2431) (Figure 16) and show regression upon MRTX-1719 treatment. All references cited herein, including patents, patent applications, papers, textbooks, and the like, and the references cited therein, to the extent that they are not already, are hereby incorporated 25 herein by reference in their entirety for all purposes.

Claims

CLAIMS 1. A PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient.
2. Use of a PRMT5 inhibitor for the manufacture of a medicament for the treatment of 5 cancer, wherein the medicament is for use in the treatment of cancers that have been identified as being CAAP1-null or CAAP1-deficient.
3. A method of treatment of a tumour, comprising administering a therapeutically effective amount of a PRMT5 inhibitor to a patient in need thereof, wherein the patient’s tumour has been characterised as being CAAP1-deficient or CAAP1-null.
4. A pharmaceutical composition comprising a PRMT5 inhibitor for use in the treatment of cancer, wherein the cancer has been identified as being CAAP1-null or CAAP1-deficient.
5. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any one of claims 1 to 4, wherein the cancer has a loss of function-related alteration in the CAAP1 gene.
6. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any one of claims 1 to 5, wherein the cancer has a homozygous deletion of the CAAP1 gene.
7. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any one of claims 1 to 5, wherein the loss of function-related alteration in the CAAP1 gene is due to epigenic silencing of the gene.
8. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the cancer has been identified as being MTAP-null or MTAP-deficient.
9. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to claim 8, wherein the cancer has a loss of function-related alteration in the MTAP gene.
10. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to claim 8 or 9, wherein the tumour cells have a homozygous deletion of the MTAP gene.
11. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to claim 8 or 9, wherein the loss of function-related alteration in the MTAP gene is due to epigenic silencing of the gene.
12. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the PRMT5 inhibitor is selected from PRMT5 inhibitor 1, PRMT5 inhibitor 2, or a PRMT5 inhibitor disclosed in WO2022026892, WO2022115377 and WO2021163344.
13. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the PRMT5 inhibitor is a compound of formula (I): wherein: the ring containing X and Y is a pyrrole and X is NH and Y is CH or X is CH and Y is NH; Z is selected from CH, CF, CCl or, if Q is not N, N; Q is selected from CH, CF, CCl or, if Z is not N, N; m is 0, 1 or 2; n is 0, 1 or 2; p is 1 or 2; R1 is in each occurrence independently selected from F, Cl, CN, Me, CF3, C1-C3 alkyl, cyclopropyl, C1-C3 fluoroalkyl, OMe or C1-C3 alkoxy; R2 is in each occurrence independently selected from F, Cl, Me, MeO and CF3; R3 is H, Me, C1-C3 alkyl or C1-C3 fluoroalkyl; R4 is H, Me or C1-C3 alkyl; R5 is H, Me, C1-C3 alkyl, C1-C3 fluoroalkyl, CH2OMe, CH2OCHF2, CH2OCF3, CH2O(C1-C3 alkyl), CH2O(C1-C3 fluoroalkyl), C(CH2CH2)R6, CCR7, CH2R8, R9 or CH2R10; R6 is H, Me, CH2F, CHF2, CF3, CH2OH or CH2OMe; R7 is H, Me, cyclopropyl, C1-C3 alkyl, C1-C3 fluoroalkyl, C3-C6 cycloalkyl or a 5-membered heteroaryl group optionally substituted with Me, C1-C3 alkyl, F or Cl; R8 is a 5-membered heteroaryl optionally substituted with Me, C1-C3 alkyl, F or Cl; R9 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group; and R10 is an optionally substituted phenyl, 5- or 6-membered heteroaryl, or bicyclic heteroaryl group, or a pharmaceutically acceptable salt thereof.
14. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H-pyrrolo[3,2- b]pyridin-2-yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3-dione: inhibitor 2). or a pharmaceutically acceptable salt thereof.
15. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any one of claims 12 to 14, wherein the PRMT5 inhibitor is (S)-2-((5-Amino-6-fluoro-1H- pyrrolo[3,2-b]pyridin-2-yl)methyl)-1’-(but-2-yn-1-yl)-5-fluorospiro[isoindoline-1,3’-pyrrolidine]-2’,3- dione: inhibitor 2).
16. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any one of claims 1 to 11, wherein the PRMT5 inhibitor is (P)-2-[4-[4-(aminomethyl)-1-oxo-2H- phthalazin-6-yl]-2-methyl-pyrazol-3-yl]-4-chloro-6-(cyclopropoxy)-3-fluoro-benzonitrile: , or a pharmaceutically acceptable salt thereof.
17. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the cancer is pancreatic cancer, oesophageal cancer, bladder cancer, head and neck cancer (such as head and neck squamous cell 5 carcinomas (HNSCC)), lung cancer (such as non-small cell lung cancer (NSCLC)), gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma, such as pancreatic cancer, oesophageal cancer, bladder cancer, HNSCC, NSCLC, gastric cancer, glioblastoma, ovarian, cancer, liver cancer, colorectal cancer, prostate cancer, melanoma, cholangiocarcinoma, MPNST (Malignant Peripheral Nerve Sheath Tumour) or mesothelioma.
18. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the cancer is lung cancer (such as NSCLC).
19. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the cancer is gastric cancer.
20. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the cancer is pancreatic cancer.
21. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the cancer is oesophageal cancer.
22. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the cancer is bladder cancer.
23. A PRMT5 inhibitor for use, use, method or pharmaceutical composition for use according to any preceding claim, wherein the cancer is head and neck cancer (such as HNSCC).
EP24705395.2A 2023-02-13 2024-02-12 Prmt5 inhibitor for use in cancer therapy Pending EP4665337A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB2302018.3A GB202302018D0 (en) 2023-02-13 2023-02-13 Cancer therapy
PCT/EP2024/053460 WO2024170488A1 (en) 2023-02-13 2024-02-12 Prmt5 inhibitor for use in cancer therapy

Publications (1)

Publication Number Publication Date
EP4665337A1 true EP4665337A1 (en) 2025-12-24

Family

ID=85704297

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24705395.2A Pending EP4665337A1 (en) 2023-02-13 2024-02-12 Prmt5 inhibitor for use in cancer therapy

Country Status (9)

Country Link
EP (1) EP4665337A1 (en)
JP (1) JP2026506597A (en)
KR (1) KR20250141268A (en)
CN (1) CN121001722A (en)
AU (1) AU2024223332A1 (en)
GB (1) GB202302018D0 (en)
IL (1) IL322660A (en)
MX (1) MX2025009435A (en)
TW (1) TW202446385A (en)

Also Published As

Publication number Publication date
MX2025009435A (en) 2025-09-02
TW202446385A (en) 2024-12-01
IL322660A (en) 2025-10-01
CN121001722A (en) 2025-11-21
AU2024223332A1 (en) 2025-09-25
JP2026506597A (en) 2026-02-25
GB202302018D0 (en) 2023-03-29
KR20250141268A (en) 2025-09-26

Similar Documents

Publication Publication Date Title
Ghosh et al. Telomerase directly regulates NF-κB-dependent transcription
Adamson et al. OTX2 is critical for the maintenance and progression of Shh-independent medulloblastomas
US10407725B2 (en) Methods of treating autoimmune conditions in patients with genetic variations in DcR3 or in a DcR3 network gene
Pan et al. YY1 controls Igκ repertoire and B-cell development, and localizes with condensin on the Igκ locus
JP6877429B2 (en) MAT2A inhibitor for treating MTAP null cancer
WO2024170488A1 (en) Prmt5 inhibitor for use in cancer therapy
EP2944961A1 (en) Markers for cancer prognosis and therapy and methods of use
EP3364974B1 (en) Modulators of telomere disease
US11685954B2 (en) Biomarkers predictive of endocrine resistance in breast cancer
WO2008154590A2 (en) Predicting responsiveness to temozolomide
CA2948351A1 (en) Biomarkers for response to pi3k inhibitors
EP3271485A1 (en) Methods for diagnosing and treating follicular lymphoma
EP3289104B1 (en) Method for treating high-grade gliomas
US20210140943A1 (en) Novel fusions and method for detecting same
WO2010129515A1 (en) Modulation of the tgf-beta and pi3k/akt pathways in the diagnosis and treatment of squamous cell carcinoma
CN118512469A (en) Pharmaceutical composition for preventing or treating cancer comprising terminal uridyl transferase 4/7 expression regulatory factor
JP4299299B2 (en) Apoptosis-inducing agent for cancer cells
AU2024223332A1 (en) Prmt5 inhibitor for use in cancer therapy
JP2024509530A (en) How to treat red blood cell disorders
Choi et al. Transcriptional activation of the carboxylesterase 2 gene by the p53 pathway
US20190105340A1 (en) Methods and compositions for targeting vascular mimicry
Poirier et al. ZNF768 loss amplifies p53 action and reduces lung tumorigenesis in mice
Hager et al. Genetic ablation of Bcl-x attenuates invasiveness without affecting apoptosis or tumor growth in a mouse model of pancreatic neuroendocrine cancer
Feng et al. Functional analysis of DNA methylation of the PACSIN1 promoter in pig peripheral blood mononuclear cells
US20250327124A1 (en) Method for testing pulmonary hypertension, pathological animal model for pulmonary arterial hypertension, and preventive or therapeutic agent for pulmonary hypertension

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250915

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

P01 Opt-out of the competence of the unified patent court (upc) registered

Free format text: CASE NUMBER: UPC_APP_0001658_4665337/2026

Effective date: 20260116