EP4658763A1 - Method for preparing a 3d prevascularized adipose tissue construct, said 3d prevascularized adipose tissue construct and uses thereof - Google Patents
Method for preparing a 3d prevascularized adipose tissue construct, said 3d prevascularized adipose tissue construct and uses thereofInfo
- Publication number
- EP4658763A1 EP4658763A1 EP24703035.6A EP24703035A EP4658763A1 EP 4658763 A1 EP4658763 A1 EP 4658763A1 EP 24703035 A EP24703035 A EP 24703035A EP 4658763 A1 EP4658763 A1 EP 4658763A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- brown
- cells
- gel
- beige
- adipose tissue
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0653—Adipocytes; Adipose tissue
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0697—Artificial constructs associating cells of different lineages, e.g. tissue equivalents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/05—Inorganic components
- C12N2500/10—Metals; Metal chelators
- C12N2500/20—Transition metals
- C12N2500/24—Iron; Fe chelators; Transferrin
- C12N2500/25—Insulin-transferrin; Insulin-transferrin-selenium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
- C12N2500/36—Lipids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/30—Organic components
- C12N2500/38—Vitamins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/105—Insulin-like growth factors [IGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/11—Epidermal growth factor [EGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/15—Transforming growth factor beta (TGF-β)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/155—Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/10—Growth factors
- C12N2501/165—Vascular endothelial growth factor [VEGF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
- C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
- C12N2506/1346—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2513/00—3D culture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/50—Proteins
- C12N2533/54—Collagen; Gelatin
Definitions
- the present invention relates to the general field of artificial, three-dimensional tissue constructs in particular created in vitro to mimic or resemble the emergence and functionality and/or histological structure of tissue or organs.
- the present invention proposes a method for producing a 3D pre-vascularized brown/beige adipose tissue construct using mesenchymal stroma/stem cells and endothelial cells, a porous matrix such as a gel or a hydrogel and a particular differentiation medium.
- the present invention also concerns the 3D pre-vascularized brown/beige adipose tissue construct thus produced and its use in the medical domain or in the research domain.
- Adipose tissues are among the main organs responsible for energy regulation. While white adipose tissues (WAT) are specialized in energy storage and release, brown and beige adipose tissues (BAT) dissipate energy as heat thanks to their high mitochondrial content equipped with uncoupling protein-1 (UCP1). Therefore, brown and beige adipocytes are promising cell targets to counteract metabolic diseases and BAT activation has become a main trend in pharmaceutical approach to treat obesity (Mukherjee et al, Curr. Diabetes Rev., 2016, 12, 414-428).
- True recapitulation of brown/beige adipose tissue microenvironment includes modeling tissue cell composition and 3D spatial organization of cells based on cell-cell and cell-extracellular matrix interactions.
- Main cellular components of adipose tissues are the adipocytes that are organized as clusters of cells, called lobules, surrounded by extracellular matrix (ECM) mainly composed of collagen type I and IV.
- ECM extracellular matrix
- Remaining cells compose the stromal vascular fraction (SVF) which includes adipocyte progenitors, also referred as adipose mesenchymal stromal cells (ASCs), endothelial cells and immune cells.
- SSF stromal vascular fraction
- ASCs adipose mesenchymal stromal cells
- endothelial cells endothelial cells and immune cells.
- a first approach to obtain 3D cell structures can be achieved by forcing cells to interact with each other and self-aggregate.
- Such structures are commonly referred as spheroids or organoids and are obtained by preventing cell attachment to cell culture support using ultra-low adherence surfaces.
- spheroids or organoids can recapitulate physiological characteristics of tissues regarding cellular heterogeneity, cellular interaction and biochemical diffusion gradients.
- spheroids possess high cell density and cellular cohesion, they represent interesting building blocks to initiate and maintain continuous cellular interactions which are determinant for tissue organization.
- spheroids still suffer from non-physiological shape and size as well as the failure of long-term culture maintenance.
- tissue engineering technologies using biomaterials have been developed to recreate in vivo chemical and physical microenvironments.
- cell suspensions are seeded onto biodegradable on non-biodegradable materials providing a physical support for cell proliferation and migration.
- seeding cells on such scaffolds leads to non-uniform cell distribution and does not recapitulate the 3D organization of the cell environment found in vivo.
- cells are seeded in 3D within a biodegradable material that provides to the cells a porous environment that mimics some aspects of the extracellular matrix (ECM). This approach could lead to non-uniform cell distribution and low cell density compared to in vivo tissues.
- ECM extracellular matrix
- a suitable strategy to enhance cell-organization could be to assemble spheroids in biomaterial instead of isolated cells and provide them with a suitable microenvironment. Compared to individual cells, spheroids secrete higher amounts of trophic growth factors promoting cell migration and angiogenesis. Enhanced angiogenic potential is particularly interesting since integrating vascularization in tissue-engineered constructs has become a main challenge to overcome diffusion limitations.
- hydrogels are promising tools to control spatiotemporal growth and shape-guided morphogenesis of cells from spheroids.
- hydrogels are formed of hydrophilic polymer networks allowing them to hold high water contents. Consequently, hydrogels show viscoelastic properties especially interesting for engineering soft tissues such as adipose tissues.
- gelatin hydrogels are biocompatible and biodegradable collagen-derived hydrogels that offer a control of several physicochemical parameters such as, for example, porosity and stiffness of the cell environment.
- GelMA hydrogels can provide a cell promoting microenvironment for human adipose tissue-derived mesenchymal stroma/stem cells (hAD-MSCs). Nevertheless, the study performed by this group has only used this particular type of cells and not the different cellular types necessary to obtain a prevascularized brown/beige adipose tissue.
- the present invention relates to an in vitro method for preparing a 3D pre-vascularized brown/beige adipose tissue construct, the 3D pre-vascularized brown/beige adipose tissue construct thus prepared, an intermediate construct obtained during this preparation and different uses thereof.
- the present inventors propose a modular approach to generate ex vivo a 3D human pre-vascularized brown/beige adipose tissue construct by promoting the selforganization of cells derived from human white adipose tissue into 3D structure scaffold such as a gel or hydrogel.
- 3D structure scaffold such as a gel or hydrogel.
- the control of initial culture conditions is essential to drive multicellular responses towards the emergence of complex and functional tissue constructs. These include i) cell nature and their differentiation potential, ii) engineering chemical and mechanical permissive environments to promote their self-organizing ability, and iii) the controlling of the 3D spatial structuration to define shape and size organization of cells.
- the present inventors have developed an optimized microenvironment and conditions thanks to which cells comprising mesenchymal stroma/stem cells and endothelial cells can produce a 3D pre-vascularized brown/beige adipose tissue construct and in particular a 3D pre-vascularized beige adipose tissue construct.
- These optimized microenvironment and conditions correspond, in one hand, to a 3D structure scaffold such as a gel or hydrogel and, in particular, a GelMA hydrogel and, in the other one, to a particular differentiation medium which comprises a TGF- inhibitor.
- the 3D pre-vascularized brown/beige adipose tissue constructs produced by the method implemented by the inventors could be used either as an ex vivo model of human BAT or as an implantable source of brown/beige adipocytes and, in particular, of beige adipocytes for therapeutic perspective.
- the present invention concerns an in vitro method for preparing a three-dimensional (3D) pre-vascularized brown/beige adipose tissue construct
- said differentiation medium comprises at least one adipogenic agent and a TGF-P inhibitor.
- Three-dimensional tissue construct and "organoid” are used interchangeably herein and, as used herein, refer to a composition of live cells, typically in a carrier media, arranged in a three-dimensional configuration as opposed to a monolayer.
- An organoid is an artificial, three-dimensional construct created in vitro to mimic or resemble the functionality and/or histological structure of an organ, tissue, or a portion thereof.
- three-dimensional (3D) pre-vascularized brown/beige adipose tissue construct and "three-dimensional (3D) pre-vascularized brown/beige adipose organoid” are used interchangeably herein and, as used herein, refer to a composition of live cells comprising, among brown/beige adipocytes, endothelial cells self-assembling to form an organized endothelial network whereby a preformed vasculature is generated among brown/beige adipocytes, in a carrier media which is a porous matrix such as gel or a hydrogel, arranged in a three-dimensional configuration as opposed to a monolayer.
- a carrier media which is a porous matrix such as gel or a hydrogel
- a three-dimensional (3D) pre-vascularized brown/beige adipose organoid is an artificial, three-dimensional construct created in vitro to mimic or resemble the emergence and the functionality and/or histological structure of brown/beige adipose tissue, or a portion thereof.
- a "portion thereof" refers, in particular, to beige adipose tissue.
- native human brown/beige adipose tissue is organized into multilocular adipocytes interspersed within a dense vascularization.
- the three-dimensional pre-vascularized brown/beige adipose tissue construct of the present invention there may be either one single clustered with highly organized endothelial networks among brown/beige adipocytes in the porous matrix such as the gel or the hydrogel, or at least two different zones with, in each one, an organized endothelial network among brown/beige adipocytes in the porous matrix such as the gel or the hydrogel.
- this construct can be defined as an individual block construct or an individual spheroid construct.
- this construct can be defined as a multi-block construct or a multi-spheroid construct.
- adipocytes refers to a type of cells specialized in storage and release of lipids in adipose tissue, an organ specialized in storing and releasing energy in the form of triglycerides. Adipocytes are classified as white, beige or brown adipocytes, all three derived from Mesenchymal Stroma/Stem Cells (MSCs).
- White adipocytes have an adipokine secretory function with a morphology characterized by the presence of large lipid vacuoles.
- Brown adipocytes are responsible for thermogenesis with expression of the Uncoupling Protein 1 (UCP1; Entrez Gene: 7350) gene within the inner mitochondrial membrane, with a morphology characterized by the presence of several small lipid vacuoles.
- UCP1 Uncoupling Protein 1
- Beige adipocytes can be considered phenotypically as fat cells possessing characteristics between those of the white adipocytes, accumulators of energy, and the brown adipocytes, which produce heat.
- beige adipocytes are formed and clustered within specific white adipose tissues and can be activated to display thermogenic features by a reversible mechanism called "beiging".
- Adipose tissue constitutes the only reserve of energy that can be mobilized in the long term and therefore occupies a preponderant place in the control of the energy balance in mammals. Consequently, a defect in the storage of lipids within the adipose tissue leads to significant metabolic disorders and associated diseases.
- step a) implements at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells.
- cell aggregate refers to an aggregation or cluster of cells forming an organized structure.
- Cell aggregate is the result of the clustering and interaction processes of initially separate cells.
- Cell aggregate is a generic term with no defined cell number and shape that include spheroids, organoids and high density cell suspensions.
- the cell aggregate is a spheroid.
- spheroid refers to a 3D sphere-like cell aggregate.
- 2D culture e.g. a monolayer
- 3D culture is achieved by improving the potential for cells to adhere, as example, using an ultra-low attachment plate.
- the methods of the present invention comprise a further step comprising seeding a population of cells on an ultra-low adherence surface.
- the cell aggregate is a high-density cell suspension.
- a high-density cell suspension may be a high-density of cells suspended in a culture medium or in a gel.
- a high-density cell suspension is reached when obtaining at least 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , IO 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 or 10 17 cells per mL of culture medium or of gel.
- a high- density cell suspension is reached when obtaining at least 10 4 cells per mL of culture medium, of porous matrix or of gel such as hydrogel.
- Mesenchymal Stroma/Stem Cells refers to multipotent stromal cells having the ability to proliferate in culture and to display mesenchymal potentials. These cells belong to a cell population initially identified in the bone marrow but are present in all tissues. As example, mesenchymal stroma/stem cells can be derived not only from adipose tissue (e.g.
- the mesenchymal stroma/stem cells are adipose tissue-derived stem cells.
- the adipose tissue-derived stem cells are white adipose tissue-derived stem cells (i.e. WAT-derived stem cells).
- the mesenchymal stroma/stem cells are infants, child or adult mesenchymal stroma/stem cells. In some embodiments, the mesenchymal stroma/stem cells are non-embryonic mesenchymal stroma/stem cells.
- Endothelial Cells refers to a population of cells that line the walls of vessels and are tightly connected to each other by cell-cell junctions.
- the endothelium is a thin membrane that lines the inside of the heart and blood vessels.
- Endothelial cells release substances that control vascular relaxation and contraction as well as enzymes that control blood clotting, immune function and platelet adhesion.
- ECs are defined by their cell surface biomarkers, and are in particular CD31+.
- EPCs Endothelial Progenitor Cells
- the cell population(s) implemented in step a) of the method of the invention may consist(s) of mesenchymal stroma/stem cells and endothelial cells.
- the cell population(s) implemented in step a) of the method of the invention may comprise mesenchymal stroma/stem cells, endothelial cells and at least one other cell type.
- At least two cell aggregates may be from the same cell source or from different cell sources.
- the cell aggregate(s) implemented in step a) of the method of the invention may be obtained from primary cell cultures. Alternatively, they may be obtained as cellular sample derived from white adipose tissue, such as Stromal Vascular Fraction (SVF) or amplified SVF (PO-SVF).
- SVF Stromal Vascular Fraction
- PO-SVF amplified SVF
- the expression "Stromal Vascular Fraction” or “SVF” corresponds to a heterogeneous cell population derived from white adipose tissues that does not contain mature adipocytes and can contain typically adipose-derived stem cells (ADSCs), endothelial cells and immune cells (macrophages, dendritic cells, lymphocytes...) as example.
- the mesenchymal stroma/stem cells are collected from a SVF derived from a dermolipectomy or a lipoaspirate (i.e. an ex-vivo waste product of liposuction).
- adipocytes When cells are isolated from adipose tissue extracellular matrix by enzymatic digestion, the adipocytes float in the cell suspension and are eliminated. About 90% of the volume of adipose tissue is made up of adipocytes, the remaining 10% represents the stromal vascular fraction (SVF).
- SVF stromal vascular fraction
- the MSCs and ECs are derived from a SVF collected on a subject and the three-dimensional pre-vascularized brown/beige adipose tissue construct obtained from this SVF or from the corresponding PO-SVF is intended to be relocated in said subject.
- the three-dimensional pre-vascularized brown/beige adipose tissue construct is autologous.
- the mesenchymal stroma/stem cells and endothelial cells are derived from a SVF collected on a first subject and the three-dimensional prevascularized brown/beige adipose tissue construct obtained from this SVF or from the corresponding PO-SVF is intended to be relocated in a second subject different from the first one.
- the three-dimensional pre-vascularized brown/beige adipose tissue construct is allogenic.
- the term "subject" refers to a mammal, such as a rodent, a feline, a canine or a primate.
- the subject is a human.
- the subject is a mouse.
- the subject is a human.
- amplified Stromal Vascular Fraction As used herein, the expressions "amplified Stromal Vascular Fraction", “amplified SVF” or “PO-SVF” that may be used interchangeably herein correspond to an amplified population of SVF cells.
- This amplified population is obtained by contacting the SVF with an amplification medium that will be defined hereinafter. Thanks to this contacting, the expansion of the SVF corresponds to a selection by adhesion that rapidly eliminates the vast majority of immune cells and strongly enriches in progenitor cells, making it possible to obtain many more cells of interest. It results in a greater homogeneity of the cells, and therefore in a better response to inducers.
- PO-SVF contains adipose stem cells, endothelial cells and macrophages.
- the population is amplified or expanded until reaching a high cellular concentration.
- a high cellular concentration is reached when obtaining at least 70% of confluency in a culture medium and in particular at least 80% of confluency in a culture medium.
- a high cellular concentration is reached at least 90% of confluency in a culture medium.
- the population is amplified until reaching 100% of confluency in a culture medium.
- the population is amplified until reaching at least 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 or 10 17 cells per mL in a culture medium.
- the at least one cell aggregate implemented in step a) is at least one spheroid derived from SVF or from PO-SVF.
- the cell aggregate(s) implemented in step a) of the method according to the present invention comprise(s) between 10 3 cells and 10 9 cells, in particular, between 10 4 cells and 10 8 cells, more particularly, for example, about 5.10 4 cells (i.e. 5.10 4 cells ⁇ 10 4 cells), about 10 5 cells (i.e. 10 5 cells ⁇ 4.10 4 cells), about 5.10 5 cells (i.e. 5.10 5 cells ⁇ 10 5 cells), about 10 6 cells (i.e. 10 6 cells ⁇ 4.10 5 cells), about 5.10 6 cells (i.e. 5.10 6 cells ⁇ 10 6 cells), about 10 7 cells (i.e. 10 7 cells ⁇ 4.10 6 cells), about 5.10 7 cells (i.e. 5.10 7 cells ⁇ 10 7 cells), and about 10 8 cells (i.e. 10 8 cells ⁇ 4.10 7 cells).
- about 5.10 4 cells i.e. 5.10 4 cells ⁇ 10 4 cells
- about 10 5 cells i.e. 10 5 cells ⁇ 4.10 4 cells
- step a) of the method according to the present invention at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is embedded in a porous matrix.
- porous matrix refers to a scaffold creating an artificial environment in which biological cells are permitted to grow or interact with their surroundings in all three dimensions. Typically, the porous matrix tends to reproduce in v/vo-like conditions (e.g. communication, proliferation, migration of the cells).
- porous matrix includes, but is not limited to, a gel or a biomaterial.
- the porous matrix is a gel, a biomaterial of natural or synthetic origin, a sponge, a porous plastic scaffold, a porous microsphere, a cryogel, a microscale macroporous cryogel or a decellularized extracellular matrix.
- the porous matrix implemented in the invention is typically biocompatible and eventually biodegradable.
- step a) of the method according to the present invention at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is embedded in a gel.
- gel refers to a material formed from at least two constituents: a solution, also known as gel solution which is a liquid « trapped » by a second compound which forms a three-dimensional net or three-dimensional network throughout the entire solution.
- This three-dimensional network is composed of gel precursor compounds able to form a matrix i.e. a solid continuous phase.
- a gel is a soft material, swollen with solution and capable of undergoing major deformation.
- step a) of the method according to the present invention at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is embedded in a hydrogel.
- hydrogel refers to a gel as previously defined in which the gel solution is water or an aqueous solution i.e. a solution the solvent of which is water.
- gel precursor compounds generally employed to prepare gel or hydrogel can be used in the invention.
- these gel precursor compounds are of organic nature: they are generally macromolecules which typically are molecules of relatively high molecular weight having a structure essentially formed of multiple repeat units derived, de facto or via design, from molecules of low molecular weight.
- the gel or the hydrogel implemented in the present invention may comprise, as gel precursor compounds, agarose, sucrose, sepharose, chitosan, xanthan, carrageenan, dextran, dextran acrylate, dextran methacrylate, agar, alginate, gelatin, gelatin acrylate, gelatin methacrylate, thiol-modified gelatin, collagen, collagen acrylate, collagen methacrylate, thiol-modified collagen, fibrin, fibrin acrylate, fibrin methacrylate, polyethylene glycol, thiol-modified polyethylene glycol, polyethylene glycol diacrylate, polyethylene glycol diacrylamide, polyethylene glycol dimethacrylate, hyaluronic acid, hyaluronic acid acrylate, hyaluronic acid methacrylate, thiol-modified hyaluronic acid, starch, starch acrylate, starch methacrylate, silk, alginate, al
- the gel or the hydrogel implemented in the invention is a gelatin methacroyl (GelMA) hydrogel.
- gelatin methacryloyl As used herein, the expressions "gelatin methacryloyl”, “methacrylated gelatin”, “gelatin methacrylate” “gelatin methacrylamide” or “GelMA” that are equivalent and may be used interchangeably herein correspond to a gelatin some lysine and hydroxyl residues of which are modified by methacrylamide and methacrylate side groups following to its direct reaction with methacrylic anhydride.
- a gel or a hydrogel as previously defined and, in particular, a GelMA hydrogel is an excellent candidate to generate biologically relevant 3D pre-vascularized brown/beige adipose tissue constructs as cell aggregates comprising stroma/mesenchymal stem cells and endothelial cells have readily adhered to, proliferated within, and migrated when embedded within the 3D matrix of such a hydrogel.
- At least one cell aggregate described herein is embedded in a porous matrix such as previously defined and in particular in a gel or a hydrogel such as previously defined.
- the at least one cell aggregate is entrapped/encapsulated in a porous matrix such as previously defined and in particular in a gel or a hydrogel such as previously defined i.e. each cell aggregate implemented in the present invention is completely surrounded/covered by such a porous matrix and in particular such a gel or such an hydrogel, such that it is not released therefrom.
- the endothelial network of this construct can extend into the surrounding porous matrix and in particular into the surrounding gel or hydrogel and even may reach adjacent blocks or spheroids in the 3D pre-vascularized brown/beige adipose tissue construct when several cell aggregates are implemented.
- the embedding/encapsulating of cell aggregate(s) at step a) can implement deposit technique by manual handling, robotic handling, aspiration, microfluidic technique and/or 3D bioprinting technique.
- this step consists in i) taking a volume of a solution comprising at least one gel precursor compound and a single cell aggregate comprising stroma/mesenchymal stem cells and endothelial cells; then ii) exposing said volume to conditions allowing the formation of a gel such as a hydrogel from the at least one gel precursor compound thereby forming a gel such as an hydrogel in which is embedded a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells.
- the volume taking at step i) can implement any technique known to the one skilled in the art such as aspiration, injection, manual pipetting, automated pipetting, dispensing, microfluidic technique and/or 3D bioprinting technique.
- the volume of the solution taken at step i) may range between 500 nl and 5 pl, in particular between 1 pl and 3 pl and, more particularly, is about 1.5 pl (i.e. 1.5 pl ⁇ 0.3 pl).
- the volume taken at step i) may be in the form of a droplet.
- the volume can be deposited on an anti-adhesive support or on a support made of gel as previously defined or on a solution comprising at least one gel precursor compound.
- the conditions implemented at step ii) to allow the formation of a gel such as a hydrogel is dependent on the compounds employed, and is known in the corresponding field. It should be noted that the conditions implemented are appropriate cell-compatible conditions, i.e. conditions which are not detrimental or not significantly detrimental to the viability of the cells in the cell aggregate.
- the gel may form spontaneously.
- chemical compounds such as polysaccharides or some proteins such as gelatin
- gelification occurs on cooling the solution containing the gel precursor compounds.
- polyacrylamide gels the formation of the gel requires the use of a crosslinking agent and acrylamide.
- photocrosslinked gels the formation of the gel requires the use of a photoinitiator and the condition necessary for the formation of such gels is light.
- this step consists in i) taking a volume of a solution comprising at least one photocrosslinkable polymer, a photoinitiator and a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; then ii) exposing to light said volume thereby forming a photocrosslinked gel such as photocrosslinked hydrogel in which is embedded a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells.
- step a) of the method of the invention at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells are embedded in a porous matrix.
- a plurality of cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells are entrapped or encapsulated within a single porous matrix such a gel or a hydrogel.
- a porous matrix, a gel or a hydrogel such as previously defined may entrap or encapsulate two or more, three or more, four or more, five or more, ten or more or even fifteen or more different cell aggregates.
- two adjacent cell aggregates may be in contact with each other or be separated the one from the other one by a distance lower or equal to 3 mm, in particular a distance between 40 pm and 2 mm and more particularly between 50 pm and 1 mm.
- the distances separating adjacent cell aggregates may be identical or different.
- step a) consists in: i') forming at least two gels such as hydrogels in which is embedded a single cell aggregate comprising mesenchymal stem cells and endothelial cells, according to the method as defined in any one of the particular embodiments previously defined; ii') assembling the at least two gels using a biological adhesive thereby forming a gel such as an hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells.
- the different gels or hydrogels implemented at step i') may be of identical or different nature.
- they are of identical nature i.e. they are obtained from the same gel precursor compound(s).
- biological adhesives also known as "bioadhesives” or “biological glues” usable in the present invention.
- Biological adhesive is a biomedical material typically used to prevent tissue adhesion, hemostasis, and prevention of air and body fluid leakage during surgery.
- biological adhesives usable in the present invention one can cite cyanoacrylate adhesives or fibrin adhesives.
- this step consists in: i") covering an anti-adhesive support with a solution comprising at least one gel precursor compound; ii") depositing, on said solution, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; iii") repeating step ii”) at least once; iv”) optionally adding some solution comprising at least one gel precursor compound to the whole; and then v") exposing the whole to conditions allowing the formation of a gel such as a hydrogel from said at least one gel precursor compound thereby forming a gel such as a hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells.
- this step consists in: i”) covering an anti-adhesive support with a solution comprising at least one photocrosslinkable polymer and a photoinitiator; ii”) depositing, on said solution, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; iii”) repeating step ii”) at least once; iv”) optionally adding some solution comprising at least one photocrosslinkable polymer and a photoinitiator to the whole; and then v") exposing to light the whole thereby forming a gel such as a hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stem cells and endothelial cells.
- the whole at step iv") refers to the solution covering the anti-adhesive support and the cell aggregates deposited thereon.
- the whole at step v") refers to the solution covering the anti-adhesive support, the cell aggregates deposited thereon and the additional solution covering them.
- the solutions implemented at step i”) and at step iv”) may be identical or different.
- the solutions implemented at step i") and at step iv”) are identical.
- this step consists in: i'") covering an anti-adhesive support with a solution comprising at least one gel precursor compound; ii'") exposing said solution to conditions allowing the formation of a gel such as a hydrogel from said at least one gel precursor compound thereby forming a gel such as a hydrogel; iii'”) depositing, on said gel, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; and iv'”) repeating step ii'”) at least once, thereby forming a gel such as a hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells; v'") optionally adding, to the whole, some solution comprising at least one gel
- this step consists in: i"') covering an anti-adhesive support with a solution comprising at least one photocrosslinkable polymer and a photoinitiator; ii'") exposing to light said solution thereby forming a gel such as a hydrogel; iii'") depositing, on said gel, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; and iv'") repeating step ii''') at least once, thereby forming a gel such as a hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells; v"') optionally adding,
- the deposit of cell aggregate at step ii') or at step iii''') can implement deposit technique by manual aspiration or injection, automated handling, microfluidic technique and/or 3D printing or bioprinting technique.
- the solutions implemented at step i"') and at step iv''') may be identical or different.
- the solutions implemented at step i'") and at step iv''') are identical.
- the cell aggregate which is deposited may be alone, in a volume of liquid such as a solution comprising at least one gel precursor compound or even in a volume of gel.
- anti-adhesive support refers to a support such as a culture vessel, a plate or a mold on which specific and non-specific cell attachment is prevented, thereby maintaining cells into a suspended state.
- This support is also known as “low attachment support” or even “ultra-low attachment support”.
- This kind of support may be commercially available, for example, ultra-low attachment (ULA) plates or flasks from any one of the following companies: Corning Incorporated, Costar, Sarstedt, Greiner, Falcon and Eppendorf.
- this support may be prepared by covalently binding, to the surface of a support, a coating such as a coating of agarose, poly-(2- hydroxyethylmethacrylate) (poly(HEMA)), polyethylene glycol) (PEG), poly-L-Lysine (PLL), PLL-PEG, parylene, pluronics, polydimethylsiloxane (PDMS) or any combination thereof.
- a coating such as a coating of agarose, poly-(2- hydroxyethylmethacrylate) (poly(HEMA)), polyethylene glycol) (PEG), poly-L-Lysine (PLL), PLL-PEG, parylene, pluronics, polydimethylsiloxane (PDMS) or any combination thereof.
- the surface of the anti-adhesive support may be flat or patterned. When the support surface is patterned, it presents advantageously cavities, grooves, holes or trenches.
- Each one may be devoted to host at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells after filling it with a solution comprising at least one gel precursor compound and optionally after exposing it to conditions allowing the formation of a gel such as a hydrogel.
- the experimental part hereinafter discloses a patterned mold on the surface of which a coating as previously defined is covalently bound.
- solution comprising at least one photocrosslinkable polymer and a photoinitiator refers to a solution in which the photocrosslinkable polymer(s) and a photoinitiator are dissolved in a biological buffer such as Phosphate buffered saline (PBS).
- PBS Phosphate buffered saline
- photocrosslinkable polymer refers to a polymer presenting, in its backbone or amongst its pending groups, photocrosslinkable groups.
- photocrosslinkable polymers include dextran acrylate, dextran methacrylate, gelatin acrylate, gelatin methacrylate, thiol-modified gelatin, collagen acrylate, collagen methacrylate, thiol-modified collagen, fibrin acrylate, fibrin methacrylate, polyethylene glycol diacrylate, thiol-modified polyethylene glycol, polyethylene glycol diacrylamide, polyethylene glycol dimethacrylate, hyaluronic acid acrylate, hyaluronic acid methacrylate, thiol-modified hyaluronic acid, starch acrylate, starch methacrylate, alginate acrylate, alginate methacrylate, thiol- modified alginate or any mixture thereof.
- the photocrosslinkable polymer is gelatin methacrylate
- it is present, in the solution implemented at step i) or i") or i'"), in an amount ranging from 2% (w/v) to 30% (w/v), in particular, from 4% (w/v) to 25% and more particularly from 5% (w/v) to 20% (w/v).
- an amount ranging from 2% (w/v) to 30% (w/v), in particular, from 4% (w/v) to 25% and more particularly from 5% (w/v) to 20% (w/v).
- an amount of about 10% (w/v) i.e. 10% (w/v) ⁇ 2% (w/v)).
- photoinitiator refers to a molecule that creates reactive species, such as free radicals, cations or anions, thanks to which the photocrosslinking of photocrosslinkable polymer(s) is initiated.
- photoinitiators include tyramine, tyrosine, eosin Y, triethanolamine, l-vinyl-2-pyrrolidinone, lithium phenyl-2,4,6- trimethylbenzoylphosphinate (also known as "LAP”), 2-hydroxy-4'-(2-hydroxyethoxy)-2- methylpropiophenone (also known as “Irgacure 2959”), phenylbis(2,4,6- trimethylbenzoyl)phosphine oxide (also known as "Irgacure 819”), diphenyl(2,4,6- trimethylbenzoyl)phosphine oxide (also known as "TPO”), and ruthenium based
- a mixture of different photoinitiators may be used.
- the amount of photoinitiator(s) present in the solution is comprised between 0.01% (w/v) and 1% (w/v), in particular between 0.05% (w/v) and 0.5% (w/v) and, more particularly, in an amount of about 0.1% (w/v) (i.e. 0.1% (w/v) ⁇ 0.02% (w/v)).
- the conditions of the light exposure at step ii) or v') or v") or ii'") or v'”) in terms of duration and wavelength range will depend on the photoinitiator present in the solution(s). The one skilled in the art will be able to identify the conditions to be used without inventive effort.
- the photoinitiator is LAP
- the light exposition at step ii) or v") or v") or ii'”) or v'”) is performed during between 30 s and 1.5 min and, for example, during about 40 s (i.e. 40 s ⁇ 5 s), during about 60 s (i.e. 60 s ⁇ 10 s) or during about 80 s (i.e. 80 s ⁇ 10 s) under blue light (405 nm).
- the at least one cell aggregate implemented in step a) is at least one spheroid derived from SVF or from PO-SVF.
- the method of the invention may comprise a step consisting of preparing spheroid(s) derived from SVF or from PO-SVF prior to step a).
- the spheroid preparation method comprises culturing said SVF cells or said PO-SVF cells on an anti-adhesive support such as previously defined in the presence of an amplification medium and under agitation. This agitation is also implemented to avoid cell adherence to the support and to facilitate cell aggregation.
- a spheroid derived from SVF or a spheroid derived from PO-SVF may be obtained respectively after a culture of about 5 days (5 days ⁇ 12 h) and after a culture of about 24 h (24 h ⁇ 3 h).
- step b) consists in contacting the embedded cells obtained at step a) with an amplification medium.
- the porous matrix and in particular the gel or the hydrogel in which at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is embedded is put into contact with an amplification medium whereby the cells present in the cell aggregate(s) can expand.
- amplification medium and “expansion medium” that are equivalent and may be used interchangeably refer to a culture medium able to optimize the growth and proliferation of cells.
- the amplification medium comprises serum and a mix of growth factors.
- the term "mix of growth factors" refers to a growth supplement for cell culture media containing at least two growth-promoting factors.
- the mix of growth factors comprises at least two growth-promoting factors selected in the group comprising growth factors of the VEGF family, of the EGF family, of the FGF family or an insulin-like growth factor.
- the mix of growth factors is provided by serum and in particular such as fetal serum as previously defined.
- the mix of growth factors is provided by platelet lysate. For in vitro purposes, fetal bovine serum may be preferred. For in vivo purposes, platelet lysate may be preferred.
- the mix of growth factors is added in an amount between 1% (v/v) and 3% (v/v) and in particular of about 2% (v/v) (i.e. 2% ⁇ 0.5% (v/v).
- the volume of mix of growth factors is given relative to total volume of the amplification medium.
- the mix of growth factors comprises at least two growthpromoting factors selected in the group consisting of growth factors of the VEGF family, of the EGF family, of the FGF family or an insulin-like growth factor (IGF).
- IGF insulin-like growth factor
- the amplification medium comprises at least IGF and VEGF.
- the amplification medium comprises VEGF
- the latter may be selected from the group consisting of VEGF-A, preferably VEGF-A splice form VEGF121, VEGF 145 or VEGF 165, VEGF-B, VEGF-C, VEGF-D and PGF.
- VEGF as previously defined may be present in an amount between 0.4 ng.mL 1 and 0.6 ng.mL 1 and in particular of about 0.5 ng.mL 1 (i.e. 0.5 ng.mL 1 ⁇ 0.05 ng.mL -1 ).
- the IGF may be selected from the group consisting of IGF- 1, IGF-2, IGFL1, IGFL2, IGFL3 and IGFL4 and synthetic analogs thereof such as long(R3)- IGF-I.
- IGF as previously defined may be present in an amount between 15 ng.mL 1 and 25 ng.mL 1 and in particular of about 20 ng.mL 1 (i.e. 20 ng.mL 1 ⁇ 2 ng.mL -1 ).
- the mix of growth factors is provided by fetal serum such as bovine fetal serum.
- the mix of growth factors is provided by platelet lysate.
- fetal bovine serum may be preferred.
- platelet lysate may be preferred.
- the mix of growth factors is added in an amount between 1% (v/v) and 5% (v/v), preferably 2% (v/v).
- the amplification medium comprises serum such as fetal serum, IGF and VEGF.
- fetal serum refers to a growth supplement for cell culture media containing high levels of embryonic growth-promoting factors.
- Bovine Fetal Serum (FBS) or fetal calf serum is the most widely used in the art.
- the fetal serum is bovine fetal serum.
- serum or fetal serum as previously defined may be present in an amount between 1% (v/v) and 5% (v/v) and in particular of about 2% (v/v) (i.e. 2% ⁇ 0.5% (v/v)).
- the amplification medium comprises fetal serum, long(R3)- IGF-l and VEGF 165.
- the amplification medium comprises or consists in fetal bovine serum, Epidermal Growth Factor (EGF), basic fibroblast growth factor (basic FGF), long(R3)-IGF-l, VEGF 165, ascorbic acid, heparin and hydrocortisone.
- EGF Epidermal Growth Factor
- basic FGF basic fibroblast growth factor
- VEGF 165 ascorbic acid
- heparin and hydrocortisone is added in an amount between 4 ng.mL 1 and 6 ng.mL 1 and, in particular, of about 5 ng.mL 1 (i.e. 5 ng.mL 1 ⁇ 0.5 ng.mL -1 ).
- basic FGF When present in the amplification medium, basic FGF is added in an amount between 5 ng.mL 1 and 20 ng.mL 1 and, in particular, of about 10 ng.mL 1 (i.e. 10 ng.mL 1 ⁇ 1 ng.mL -1 ).
- long(R3)-IGF-l is added in an amount between 10 ng.mL 1 and 30 ng.mL 1 and, in particular, of about 5 ng.mL 1 (i.e. 2 ng.mL 1 ⁇ 20 ng.mL 1 ).
- VEGF 165 When present in the amplification medium, VEGF 165 is added in an amount between 0.1 ng.mL 1 and 10 ng.mL 1 and, in particular, of about 5 ng.mL 1 (i.e. 0.5 ng.mL 1 ⁇ 0.1 ng.mL 1 ).
- heparin is added in an amount between 15 pg.mL 1 and 25 pg.mL 1 and, in particular, of about 22.5 pg.mL 1 (i.e. 22.5 pg.mL 1 ⁇ 2 pg.mL 1 ).
- ascorbic acid is added in an amount between 0,5 pg.mL 1 and 1,5 pg.mL 1 and, in particular, of about 1 pg.mL 1 (i.e. 1 pg.mL 1 ⁇ 0.5 pg.mL -1 ).
- hydrocortisone is added in an amount between 0.1 pg.mL 1 and 0.3pg.mL 1 and, in particular, of about 0.2 pg.mL 1 (i.e. 0.2 pg.mL 1 ⁇ 0.05 pg.mL -1 ).
- the amplification medium is EGM-2 medium (PromoCell, Germany). In some embodiments, the EGM-2 medium is supplemented by amphotericin B (Life-Technologies, UK) and streptomycin/penicillin (Life-Technologies, UK). In some embodiments, the EGM-2 medium is supplemented by 0.1% (v/v) amphotericin B and 1% (v/v) streptomycin/penicillin.
- the step b) in the method of the present invention lasts 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days.
- this contacting it is possible to replace the amplification medium with a fresh amplification medium presenting the same or a different formulation.
- the amplification medium is replaced by a fresh one of the same formulation.
- step c) consists in contacting the expanded embedded cells obtained at step b) with a differentiation medium until obtaining a 3D pre-vascularized brown/beige adipose tissue construct.
- the porous matrix such as a gel or a hydrogel in which at least one expanded cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is obtained after step b) is put into contact with a differentiation medium whereby the cells present in the cell population(s) can differentiate.
- differentiation medium refers to a medium formulated to optimize the preferential differentiation of immature cells such as MSCs or ASCs into mature cells with specific functions such as adipocytes or brown/beige adipocytes.
- the differentiation medium is an adipogenic medium, the latter is able to induce the differentiation of mesenchymal stroma/stem cells into adipocytes.
- adipogenic medium refers to a medium comprising at least one adipogenic agent.
- adipogenic agent refers to a compound able to induce the differentiation of mesenchymal stroma/stem cells into adipocytes.
- the adipogenic agent is preferably a browning agent.
- the term "browning agent” or “browning inducer” refers to an adipogenic compound able to induce the differentiation of mesenchymal stroma/stem cells into brown/beige adipocytes.
- a browning agent is deemed to induce brown/beige adipogenesis if it leads to an increase in the expression of the gene encoding UCP1 (i.e. Uncoupling Protein 1; Entrez Gene: 7350).
- the browning agent is insulin or Insulin-like Growth Factor (IGF) or a Bone Morphogenic Protein (BMP).
- the browning agent is insulin and BMP7.
- insulin refers to a peptide hormone produced by p-cells of the pancreatic islets encoded in humans by INS gene (Entrez Gene: 3630).
- Insulin Growth Factor may be used to substitute for insulin.
- IGF may be selected from the group consisting of IGF-1, IGF-2, IGFL1, IGFL2, IGFL3 and IGFL4. Synthetic analogs can also be used.
- insulin or IGF is in the differentiation medium in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (5 pg/mL ⁇ 1 pg/mL).
- BMP Breast Morphogenic Protein
- TGF- Transforming Growth Factor
- BMPs include but are not limited to BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8 and BMP9.
- the BMP is BMP7.
- BMP such as BMP7 is in the differentiation medium in an amount between 20 ng/mL and 80 ng/mL and in particular of 50 ng/mL of about 50 ng/mL (50 ng/mL ⁇ 10 ng/mL).
- the differentiation medium implemented in the method of the present invention is particular because it comprises a TGF-P inhibitor.
- TGF-P has its general meaning in the art and refers to the Transforming Growth Factor-P which is a multifunctional cytokine belonging to the TGF superfamily.
- the TGF-P includes three different mammalian isoforms, namely TGF- Pl, TGF-P2 and TGF-P3.
- TGF-P inhibitor refers to a compound able to inhibits TGF-P gene expression or able to inhibit the activity of TGF-P (e.g. interactions with other partners).
- Such inhibitors are well-known in the art and comprise low molecular weight compounds, antibodies directed against TGF-P, single domain antibodies directed against TGF-P, aptamers, polypeptides such as a mutated TGF-P proteins or similar proteins without the function of TGF-P, inhibitors of TGF-P gene expression, small inhibitory RNAs (siRNAs), small double stranded RNA (dsRNA) or ribozymes.
- siRNAs small inhibitory RNAs
- dsRNA small double stranded RNA
- the TGF-P inhibitor is a low molecular weight compound, an antibody directed against TGF-P, a single domain antibody directed against TGF-P, an aptamer, a polypeptide, an inhibitor of TGF-P gene expression, a small inhibitory RNA (siRNA), a small double stranded RNA (dsRNA) or a ribozyme.
- siRNA small inhibitory RNA
- dsRNA small double stranded RNA
- the TGF-P inhibitor is a low molecular weight compound, i.e. a small organic molecule (natural or not).
- small organic molecule refers to a molecule (natural or not) of a size comparable to those organic molecules generally used in pharmaceuticals. Preferred small organic molecules range in size up to about 10000 Da, more preferably up to 5000 Da, more preferably up to 2000 Da and most preferably up to about 1000 Da.
- the TGF-P inhibitor is SB431542.
- the term “SB431542” refers to 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)- l/7-imidazol-2-yl]benzamide (CAS number: 301836-41-9).
- the TGF-P inhibitor is present in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (5 pg/mL ⁇ 1 pg/mL).
- the differentiation medium comprises a mix of growth factors.
- the mix of growth factors comprises at least two growthpromoting factors selected in the group comprising growth factors of the VEGF family, of the EGF family, of the FGF family or an insulin-like growth factor.
- the mix of growth factors is provided by serum and in particular such as fetal serum as previously defined.
- the mix of growth factors is provided by platelet lysate.
- fetal bovine serum may be preferred.
- platelet lysate may be preferred.
- the mix of growth factors is added in an amount between 1% (v/v) and 3% (v/v) and in particular of about 2% (v/v) (i.e. 2% ⁇ 0.5% (v/v)).
- the differentiation medium comprises a-MEM, a mix of growth factors, insulin or insulin-like growth factor, apo-transferrin, a bone morphogenic protein, and a TGF- inhibitor. In some embodiments, the differentiation medium consists essentially in a-MEM, a mix of growth factors, insulin or insulin-like growth factor, apotransferrin, a bone morphogenic protein, and a TGF-P inhibitor. In some embodiments, the differentiation medium comprises a-MEM, fetal serum, insulin or insulin-like growth factor, apo-transferrin, a bone morphogenic protein, and a TGF-P inhibitor.
- the differentiation medium consists essentially in a-MEM, fetal serum, insulin or insulin-like growth factor, apo-transferrin, a bone morphogenic protein, and a TGF-P inhibitor.
- the term “consist essentially in” means that the differentiation medium does not comprise any other active substance that has an effect on the differentiation of mesenchymal stroma/stem cells into brown/beige adipocytes.
- the differentiation medium consists in a-MEM, fetal serum, insulin or insulin-like growth factor, apo-transferrin, a bone morphogenic protein and a TGF-P inhibitor.
- the differentiation medium consists in a-MEM-ASP, fetal bovine serum, insulin, apo-transferrin, BMP7 and SB431542.
- a-MEM refers to a-Minimal Essential Medium.
- a-MEM comprises in amino acids, sodium pyruvate, lipoic acid, vitamin B12, biotin and/or ascorbic acid.
- a-MEM consists essentially in amino acids, sodium pyruvate, lipoic acid, vitamin B12, biotin and ascorbic acid.
- a-MEM consists in amino acids, sodium pyruvate, lipoic acid, vitamin B12, biotin and ascorbic acid.
- the a-MEM is supplemented with amphotericin B and streptomycin/penicillin.
- the a-MEM medium is supplemented by 0.1% (v/v) amphotericin B and 1% (v/v) streptomycin/penicillin.
- the a-MEM is a-MEM-ASP.
- apo-transferrin refers to an iron free transferrin. Transferrins are single chain glycoproteins with two nonidentical iron-binding sites having a high affinity for ferric iron under physiological conditions. Transferrins are found in vertebrates and mediate the transport of iron through blood plasma. When not bound to iron, transferrin is known as "apo-transferrin". In some embodiments, apo-transferrin is present in the differentiation medium in an amount between 5 pg/mL and 15 pg/mL and in particular of about 10 pg/mL (i.e. 10 pg/mL ⁇ 2 pg/mL).
- the differentiation medium implemented in the method of the present invention is deprived of intralipids® (CAS Number: 68890-65-3). It was not obvious before the present invention to implement a differentiation medium deprived of intralipids® all the more than Muller et al (Scientific Reports, 2019, 9, article No. 7250) discloses that such intralipids® promote adipogenesis. On the contrary, the present inventors have shown that a differentiation medium deprived of intralipids® increases significantly pseudo-vascular formation and BAT adipocyte differentiation in the cell aggregates embedded in the porous matrix such as a gel or a hydrogel.
- adipose tissue such as pre-vascularized brown/beige adipose tissue construct.
- adenylate cyclase activator(s) such as forskolin in the differentiation medium implemented in the invention is not mandatory to increase adipocyte browning.
- the differentiation medium implemented in the step c) of the method of the invention comprises or consists of:
- - fetal serum such as FBS in an amount between 1% (v/v) and 5% (v/v) and in particular of about 2% (v/v) (i.e. 2% ⁇ 1%), - insulin in an amount between 1 pg/mL and 10 pg/mL and in particular of about
- - apo-transferrin in an amount between 5 pg/mL and 15 pg/mL and in particular of about 10 pg/mL (i.e. 10 pg/mL ⁇ 2 pg/mL),
- a bone morphogenic protein such as BMP7 in an amount between 20 ng/mL and 80 ng/mL and in particular of about 50 ng/mL (i.e. 50 ng/mL ⁇ 10 ng/mL), and
- TGF-P inhibitor such as 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-l/7-imidazol- 2-yl]benzamide (SB431542) in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (i.e. 5 pg/mL ⁇ 2 pg/mL).
- the culture of the expanded embedded cells in the differentiation medium is carried out at step c) for at least 7 days, in particular at least 14 days and, more particularly, for about 21 days (i.e. 21 days ⁇ 2 days).
- the present inventors have identified a real synergistic effect using the differentiation medium as previously defined with a gel or a hydrogel and in particular a GelMA hydrogel. Indeed, when this differentiation medium is used with spheroids containing Stromal Vascular Fraction (SVF) cells, the latter do not differentiate into brown/beige adipocytes. On the contrary, the combination of spheroids containing "SVF" cells in a GelMA hydrogel and this differentiation medium makes it possible to obtain differentiated brown/beige adipocytes.
- SVF Stromal Vascular Fraction
- - fetal serum such as FBS in an amount between 1% (v/v) and 5% (v/v) and in particular of about 2% (v/v) (i.e. 2% ⁇ 1%),
- - insulin in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (i.e. 5 pg/mL ⁇ 2 pg/mL),
- - apo-transferrin in an amount between 5 pg/mL and 15 pg/mL and in particular of about 10 pg/mL (i.e. 10 pg/mL ⁇ 2 pg/mL),
- a bone morphogenic protein such as BMP7 in an amount between 20 ng/mL and 80 ng/mL and in particular of about 50 ng/mL (i.e. 50 ng/mL ⁇ 10 ng/mL), and
- TGF-P inhibitor such as 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-l/7-imidazol- 2-yl]benzamide (SB431542) in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (i.e. 5 pg/mL ⁇ 2 pg/mL).
- Three-dimensional (3D) vascularized brown/beige adipose tissue constructs and uses thereof Another aspect of the invention relates to a 3D pre-vascularized brown/beige adipose tissue construct obtained with the in vitro methods as previously described.
- the three-dimensional pre-vascularized brown/beige adipose tissue construct thus obtained comprise one single zone with organized endothelial network among brown/beige adipocytes in the porous matrix such as a gel or a hydrogel.
- This construct is sub- millimetric i.e. the higher size of this construct is less than 1 mm.
- the three-dimensional pre-vascularized brown/beige adipose tissue construct thus obtained comprise at least two different zones with organized endothelial networks among brown/beige adipocytes in the porous matrix such as a gel or a hydrogel.
- This construct is millimetric to centimetric i.e. the higher size of this construct is more than 1 mm and less than 1 cm. It should be noted that, after differentiation, the endothelial networks become continuous between the different zones in this construct.
- the present invention relates to at least one 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention for use in the treatment of a metabolic disorder.
- the treatment comprises at least one 3D pre-vascularized brown/beige adipose tissue construct to be transplanted.
- the present invention relates a method of treating a subject suffering from a metabolic disorder comprising administering to said subject a therapeutically effective amount of at least one 3D pre-vascularized brown/beige adipose tissue construct.
- metabolic disorder denotes a state that negatively alters the body's processing and distribution of macronutrients such as proteins, fats and carbohydrates. It occurs when abnormal chemical reactions in the body alter the normal metabolic process.
- metabolic disorders include type 2 diabetes, impaired glucose tolerance, obesity, insulin resistance, dyslipidemia, non-alcoholic hepatic syndrome (NASH), hypertension and cardiovascular diseases.
- the metabolic disorder is selected from the group consisting of type 2 diabetes, impaired glucose tolerance, obesity, insulin resistance, dyslipidemia, NASH, hypertension and cardiovascular diseases.
- the present invention relates to a method of treating a subject suffering from a disease selected in the group consisting of cancers, massive burn and inflammatory diseases comprising administering to said subject a therapeutically effective amount of at least 3D pre-vascularized brown/beige adipose tissue construct.
- treating refers to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subject at risk of contracting the disease or suspected to have contracted the disease as well as subject who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse.
- treatment particularly refers to the preventive treatment of a metabolic disorder, in particular with a cell based-therapy comprising at least one 3D vascularized brown/beige adipose tissue construct.
- the treatment may be administered to a subject having a medical disorder or a subject likely to suffer from the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment.
- therapeutic regimen is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy.
- a therapeutic regimen may include an induction regimen and a maintenance regimen.
- induction regimen or “induction period” refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease.
- the general goal of an induction regimen is to provide a high level of a cell based-therapy to a subject during the initial period of a treatment regimen.
- An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the cell based-therapy than a physician would employ during a maintenance regimen, administering a cell based- therapy more frequently than a physician would administer the cell based-therapy during a maintenance regimen, or both.
- the phrase "maintenance regimen” or “maintenance period” refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years).
- a maintenance regimen may employ continuous therapy (e.g., administering a cell based-therapy at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).
- continuous therapy e.g., administering a cell based-therapy at regular intervals, e.g., weekly, monthly, yearly, etc.
- intermittent therapy e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).
- administering refers to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., at least one 3D pre-vascularized brown/beige adipose tissue construct) into the subject, such as by mucosal, intradermal, subcutaneous delivery and/or any other method of physical delivery described herein or known in the art.
- a disease, or a symptom thereof is being treated, administration of the at least one 3D vascularized brown/beige adipose tissue construct typically occurs after the onset of the disease or symptoms thereof.
- administration of the at least one 3D pre-vascularized brown/beige adipose tissue construct typically occurs before the onset of the disease or symptoms thereof.
- the term "efficient” denotes a state wherein the administration of at least one 3D pre-vascularized brown/beige adipose tissue construct to a subject permit to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or to prolong the survival of a subject beyond that expected in the absence of such treatment.
- a “therapeutically effective amount” is intended for a minimal amount of cell-based therapy which is necessary to impart therapeutic benefit to a subject.
- a “therapeutically effective amount” to a subject is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder.
- the specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; at least one 3D pre-vascularized brown/beige adipose tissue construct used in combination or coincidental with another specific compound employed; and like factors well known in the medical arts. For example, it is well-known within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
- the present invention relates to at least one 3D vascularized brown/beige adipose tissue construct generated with the methods of the present invention for use in adipose-tissue transplantation.
- the adipose-tissue transplantation is an autologous tissue transplantation.
- autologous tissue transplantation denotes a procedure in which a subject's own tissue is collected to replace or sustain the activity of his damaged tissue.
- the adipose-tissue transplantation is a allogenic tissue transplantation.
- allogenic tissue transplantation denotes a procedure in which a first subject tissue is collected to replace or sustain the activity of the damaged tissue of a second subject different from the first one.
- the 3D pre-vascularized brown/beige adipose tissue construct can be as example introduced in a therapeutic composition for adipose-tissue transplantation.
- the present invention relates to a method for performing an adipose-tissue transplantation in a subject comprising administering to said subject at least one 3D pre-vascularized brown/beige adipose tissue construct or a therapeutic composition comprising at least one 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention.
- the present invention also relates to a therapeutic composition comprising at least one 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention.
- the invention relates to a therapeutic composition comprising at least one 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention for use in the adipose-tissue transplantation as previously defined and/or in the treatment of a metabolic disorder or a disease as previously defined in a subject in need thereof.
- the therapeutic compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
- vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
- These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.
- the doses used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, or alternatively of the desired duration of treatment.
- Pharmaceutical compositions of the present invention may comprise a further therapeutic active agent.
- the construct consists of at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells embedded in a porous matrix and expanded.
- This intermediate construct may comprise a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells embedded in a porous matrix and expanded.
- this intermediate construct may comprise at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells embedded in a porous matrix and expanded.
- the 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention can be used as a search tool in an in vitro method of screening compounds that modulates brown/beige adipocyte activity.
- the present invention relates to an in vitro method of screening compounds that modulate brown/beige adipocyte activity comprising contacting either a 3D pre-vascularized brown/beige adipose tissue construct according to the invention or an intermediate construct according to the invention with a candidate compound, and monitoring the effect of said candidate compound on the activity of brown/beige adipocytes in said construct.
- the in vitro method of screening a candidate compound comprises the steps of: a) optionally measuring the level of at least one marker into a 3D pre-vascularized brown/beige adipose tissue construct of the invention or generated with the methods of the invention or an intermediate construct according to the invention or obtained after step b) as previously defined;
- the predetermined reference value is relative to a number or value derived from studies, as example, led on cells or tissues of subjects, including without limitation, subjects of the same or similar age range, subjects in the same or similar ethnic group, and subjects having the same severity of lesion.
- Such predetermined reference values can be derived from statistical analyses and/or risk prediction data obtained from mathematical algorithms and computed indices.
- Said measurement of the level of at least one marker may involve as example intercalating agents or fluorescent dyes in techniques well-known to those skilled in the art.
- said level can be measured at the transcriptomic or protein level.
- the marker is a survival marker assessing cell viability (e.g. propidium iodide).
- the marker is brown/beige adipocyte markers such as, for example, UCP1, cell death-inducing DFFA-like effector A (CIDEA) and Peroxisome proliferator-activated receptor-y coactivator (PGCla).
- the in vitro methods of screening a compound that modulates brown/beige adipose tissue activity is used for screening a compound increasing UCP1 expression in said 3D pre-vascularized brown/beige adipose tissue construct.
- the in vitro method comprises a further step consisting in monitoring UCP1 expression.
- the in vitro methods of screening a compound that modulates brown/beige adipose tissue activity is used for screening compounds increasing the mitochondrial activity in said 3D pre-vascularized brown/beige adipose tissue construct.
- the in vitro method comprises a further step consisting in monitoring mitochondrial activity.
- the in vitro methods of screening a compound that modulates brown/beige adipose tissue activity is used for screening compounds favouring or inhibiting the differentiation of mesenchymal stroma/stem cells into beige adipocytes.
- the 3D prevascularized brown/beige adipose tissue construct or the intermediate construct can be used as an organ-on-a-chip. In this technology, both constructs may be cultured in a small chip.
- An organ-on-a-chip can be used to study in detail the behavior of pre-vascularized brown/beige adipose tissue and the mechanism of physicochemical reactions in microenvironment, and can be used as a model for drug toxicity and efficacy evaluation in new drug development.
- the present invention relates to kit for producing 3D prevascularized brown/beige adipose tissue construct comprising (i) at least one differentiation medium such as previously defined and (ii) a solution comprising at least one gel precursor compound such as previously defined.
- the solution (ii) comprises at one photocrosslinkable polymer and a photoiniator.
- the kit of the invention further comprises an amplification medium such as previously defined.
- the kit of the invention further comprises an amplification medium such as previously defined and an anti-adhesive support such as previously defined.
- the kit comprises (i) at least one differentiation medium such as previously defined, (ii) a GelMA solution such as previously defined, (iii) an amplification medium such as previously defined and optionally (iv) an anti-adhesive support such as previously defined.
- Figure 1 GelMA hydrogel processing and mechanical properties characterization
- B) Mechanical characterization of GelMA 15%, 10%, 8% and 5% depending on photo-polymerization duration. Youngs moduli of the hydrogels were calculated according to their stress strain curves (n 5). Poisson's ratio was 0.5.
- Compression speed was 5 mm/min until 20% deformation. Data were obtained once samples were formed (Day 0) and after samples were kept in PBS at 37°C in a CO2 incubator for a week (Day 7). Data are shown as mean +/- standard deviation.
- Figure 2 Optimal GelMA embedding parameters to promote cell mass expansion. After formation, PO-SVF spheroids were either embedded in 3 or 1.5 pl of GelMA 15%, 10%, 8%, 5%. Spheroid morphology inside hydrogel was observed after seven days in EGM2 proliferation medium and compared to spheroid maintained without GelMA (Spheroid alone).
- Folds are relatively expressed to nonembedded undifferentiated spheroids.
- Statistical analysis was performed on -Ct values by two sample t-test. * p ⁇ 0.05.
- FIG. 4 Activation of beige adipose organoids by UCP1 canonical inducers.
- Spheroids embedded in GelMA 10% were differentiated for 21 days in adipogenic medium with SB431542 and treated (Ind) or not (Ctrl) with UCP1 inducers for the last three days of culture.
- A) Evaluation of lipolysis measured as glycerol release from embedded spheroids stimulated or not with cAMP (n 3).
- B) Gene expression analysis of brown adipocytes markers (UCP1, CIDEA, PGCla). Fold changes are relatively expressed to Ctrl condition as mean +/- standard deviation (n 6).
- Murine brown adipose tissue (BAT) from wild type (WT) and UCP1 KO mouse were used as positive and negative control respectively.
- FIG. 5 Combination of TGF-P inhibition and GelMA embedding unlocks beige adipogenesis and promotesvascular formation from SVF cells.
- A-E Spheroids obtained directly from freshly isolated human stromal vascular fraction were embedded or not in GelMA 10% and analyzed at day 21 of differentiation in adipogenic medium with SB431542.
- B Quantification of dead cells percentage inside spheroids from propidium iodide staining. Statistical analysis was performed by two sample t-tests.
- B) Average DNA content per spheroid with or without GelMA (n 5).
- D) Gene expression analysis of brown adipocytes markers (UCP1, CIDEA, PGCla) and generic adipocyte markers (PPARg2, FABP4, ADIPOQ) in spheroids embedded or not in GelMA (n 8) after 21 days of differentiation. Folds are relatively expressed to non-embedded undifferentiated spheroids.
- E) Gene expression analysis of brown adipocytes markers (UCP1, CIDEA, PGC1). Fold changes are relatively expressed to control (n 3).
- Figure 6 Generation of beige adipose micro-tissue by multispheroid assembly in GelMA
- SVF Human Stromal Vascular Fraction
- Adipose tissue was mechanically dissociated and enzymatically digested for 45 min at 37°C, under stirring, using collagenase NB4 (Coger, Germany) at 13.6 U/mL in a-MEM (Life-Technologies, UK), supplemented with 0.1% (v/v) amphotericin B (Life-Technologies, UK), and 1% (v/v) streptomycin/penicillin (Life-Technologies, UK) hereafter named aMEM-ASP. After filtration on a 100 pm nylon net filter (Steriflip, Millipore, USA) and centrifugation (600g, 10 min), cells were washed in aMEM-ASP and centrifuged again (600g, 5 min).
- erythrocyte lysis buffer eBioscienceTM RBC Lysis Buffer Multi-species, Life-Technologies, UK
- EGM2 PromoCell, Germany
- Final cell solution was counted using a Malassez cell and seeded directly in suspension for spheroid formation or at 4000 cells/cm 2 in two-dimension (2D) culture for further amplification.
- 2D cultures were maintained in EGM2, medium was changed every three days until they reached 80% confluency.
- the resulting amplified cells PO-SVF were used for spheroid formation or adipocyte differentiation in 2D cultures.
- a solution of porcine skin gelatin type A (110 bloom, Sigma, USA) was prepared in 0.25 M carbonate-bicarbonate (CB) buffer.
- CB comprised 0.075 mol sodium carbonate and 0.175 mol sodium bicarbonate in 1 L of dH2O.
- pH of the buffer was adjusted to 9 by using 5 M sodium hydroxide or 6 M hydrochloric acid.
- gelatin (20%, w/v) was dissolved in CB buffer at 60°C for 1-2 h.
- GelMA preparation A solution of GelMA at 5, 8, 10 or 15% w/v, with photoinitiator lithium phenyl- 2,4,6-trimethyl-benzoylphosphinate (LAP, Sigma, USA) at 0.1% w/v, was prepared by dissolving lyophilized GelMA in D-PBS and kept at 4°C until use.
- LAP lithium phenyl- 2,4,6-trimethyl-benzoylphosphinate
- Hydrogels samples were frozen in liquid nitrogen, lyophilized for 6h and sputter coated with Au (10 nm). Morphology was analysed with a Scanning Electron Microscope (Hitachi S-4800S-4800, Japan). Dimensional analysis of porosity and pore sizes was performed with Image J software (NIH).
- PDMS molds were prepared by casting on 3D printed templates.
- 3D templates were obtained by stereolithography using a DWS 29J+ system (DWS, Italy) and DL260 photoresist (DWS, Italy).
- FDTS FluoroDecyltrochloroSilane
- PDMS Sylgard 184, Dow Corning
- Crosslinking of PDMS was performed for 2h at 60°C. Then, PDMS molds were removed manually from the templates.
- PDMS molds were then incubated overnight at RT with an anti-adhesive treatment using 20 mg/mL pluronic F127 (Sigma, USA) followed by three washes in D-PBS and air-drying before use.
- pluronic F127 20 mg/mL
- D-PBS D-PBS
- air-drying before use.
- flat pluronic-coated PDMS surface were prepared samely by pooring PDMS in petri dish. After curing, pluronic treatment was performed without further removal of the PDMS.
- mice C57BI/6J UCP1 deficient mice kindly provided by Leslie Kozak (Enerback et al, Nature, 1997, 387, 90-94) and their wild type littermates were housed in a controlled environment (12h light/dark cycles at 21°C) with unrestricted access to water and a standard chow diet, in pathogen-free animal facility. All experimental procedures were done in compliance with French Ministry of Agriculture regulations for animal experimentation. At the time of sacrifice (10 weeks old animals), brown adipose tissues were dissected, snap frozen in liquid nitrogen and stored at -80°C until protein extraction for ProteinSimple capillary immunoassay.
- Spheroids were formed from either PO-SVF cells or from SVF cells.
- 50 000 cells were seeded in small volume (50 pL) of EGM2 medium in ultralow attachment (ULA) 96-well round-bottom plates (Corning Incorporated Lifes Sciences, USA) and maintained overnight under stirring (150 rpm).
- UAA ultralow attachment
- cell seeding step was followed by plate centrifugation (600g for 5 min). The following day, 150 pL of EGM2 was added in each well. Cells were maintained in proliferation medium until spheroid formation, i.e. five days for SVF-spheroids and one day for PO-SVF-spheroids.
- GelMA embedded spheroids To generate GelMA embedded spheroids, once formed, spheroids were mixed with pre-warmed GelMA/0.1% LAP solution (37°C, 10 min). Spheroids were then individually pipetted in a defined volume of GelMA/0.1%LAP solution and dispensed on an anti-adhesive PDMS surface, prepared as described above. GelMA droplets containing one spheroid were then photocrosslinked via exposure to 405 nm light for 40 seconds (Form cure, Formlabs, Germany). Embedded spheroids were individually transferred in 24-wells flat bottom ULA plate (Corning Incorporated, Lifes Sciences, USA) in 1 mL of EGM2 medium. Embedded spheroids were maintained in EGM2 proliferation medium for seven days before differentiation. Half of the medium was changed every two to three days.
- GelMA was poured in an appropriate PDMS mold. One spheroid was handled using a manual aspiration method and positioned in the middle of the mold microwell filled with GelMA. When all the spheroids were correctly positioned, GelMA was cured (40 seconds with 405 nm light). The GelMA multipsheroid construct was unmolded before the culture process.
- Spheroid handling was performed by aspiration of the spheroid using a microneedle.
- 27 G or 30 G metallic needle was mounted on a plastic syringe and connected to a vacuum source with pressures varying from 0 to 100 m Bar below the atmospheric pressure (Pa).
- a MFCS or Flow easy system (Fluigent SA, France) was connected to the syringe and controlled manually.
- Spheroids were taken by aspiration from a suspension in a culture medium, maintained at the tip of the microneedle by aspiration and finally released into the structure of the PDMS or GelMA molds by switching the aspiration pressure to Pa.
- a standard adipogenic cocktail was used (Standard Cocktail). This standard cocktail consists of aMEM-ASP supplemented with 2% Fetal Bovine Serum (FBS, Life technologies, UK), 1 pM dexamethasone (Sigma, USA), 60 pM indomethacin (Sigma, USA), 2 pM rosiglitazone (Sigma, USA), 5 pg/mL insulin (Sigma, USA). 450 pM 3-isobutyl-l-methylxanthine (IBMX, Sigma, USA) was also added for the first three days of culture only.
- adipogenic Cocktail 1 consists of aMEM-ASP supplemented with 2% FBS, 5 pg/mL insulin, 10 pg/mL apotransferrin (Sigma, USA), 50 ng/mL bone morphogenetic protein 7 (BMP7, MiltenyiBiotec, France) with 0.2% intralipids (20% emulsion, Sigma, USA).
- adipogenic Cocktail 2 A variation of adipogenic Cocktail 1 deprived from intralipids was also tested and is referred to as adipogenic Cocktail 2 (C2).
- 3 pathway inhibitor SB431542 (MiltenyiBiotec, Germany), also referred to as SB4, was added to the adipogenic cocktail at a concentration of 5 pg/mL.
- Imaging of spheroid size was performed during the culture process at indicated times using a Nikon eclipse TE2000-5 microscope with a 10X objective. Spheroid area was measured using Fiji software (National Institutes of Health, USA). Six to eight spheroids were measured for each time point per human sample. lodure propidium staining
- a 3D image-based cell viability quantification was conducted by staining free spheroids and embedded spheroids with 10 pg/mL propidium iodide (Invitrogen, USA) in culture medium for one hour at 37°C. After three DPBS washes, samples were fixed with 4% paraformaldehyde. The fixed cultures were permeabilized and stained with DAPI as described above. Samples were washed three times with D-PBS (30 min, RT) and cleared at least for 48h with Scale S4 solution before imaging. All samples were imaged using a confocal microscope (LSM 880, Carl Zeiss, France).
- Optical slices were taken from the surface at 4.5 pm intervals, up to the depth of 200 pm (spheroids) or 400 pm (GelMA embedded spheroids) and presented as a vertical projection.
- total number of nuclei and IP+ nuclei were quantified using imageJ.
- the average viability percentage was calculated as the number of IP+ nuclei/DAPI+ nuclei per slice.
- DAPI signal was segmented using 2D Stardist pluging (Schmidt et al, Proceedings Part II, 2018, 265-273), a deep-learning- based method of 2D nucleus detection. Three spheroids or GelMA embedded spheroids were measured for each condition per human sample.
- DNA quantification was performed to assess cell proliferation and maintenance.
- DNA was extracted from an average of 24 spheroids or five GelMA embedded spheroids according to the blood and tissue DNA extraction kit (Qiagen) manual. Spheroids were washed with D-PBS and lysed in 200 pL ALT /Proteinase K buffer overnight under mixing (800 rpm). To ensure the DNA purity, RNase A (Qiagen) was added to the samples and incubated for 2 min at RT before addition of 1:1 AL/100% ethanol mix. DNA was detected with the lx QubitTM High sensitivity dsDNA kit according to manufacturer's instructions. Fluorescent intensities were measured with Qubit 4.0 fluorometer (Invitrogen, CRCT, Toulouse). Data were expressed as DNA quantity/spheroids (ng).
- RNA samples were homogenized in QIAzol Lysis Reagent (Qiagen, USA). 3D culture samples were further disrupted for 2 min at 30 Hz using Tissue Lyser (Qiagen).
- Total RNA was isolated using Phenol-chloroform extractions followed by Quick-RNA microprep kit procedure (Zymo Research, USA) and reverse transcribed into cDNA using high capacity cDNA reverse transcription kit (Applied Biosystems, USA). qPCR was performed on StepOne system (Applied Biosystems, USA) using Fast SYBR Green Master Mix supplemented with l/10e diluted cDNA and 300 nM of primers listed in hereinafter Table
- Table 1 List of primers used for qPCR and qRT-PCR analyses
- Relative gene expression was calculated by the 2 -AACT method.
- the ACt was obtained by normalizing mean expression values of each gene to the geometric mean of the reference genes, Ribosomal Protein Lateral Stalk Subunit P0 (RPLPO), Glucuronidase
- Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta (YWAZ).
- the AACt was calculated by normalizing conditions to 2D undifferentiated cells for 2D experiments or to non-embedded undifferentiated spheroids for 3D culture experiments.
- Neurosci., 2011, 14, 1481-1488 composed of 40% (w/v) D-(-)-Sorbitol (Sigma, USA), 10% (w/v) glycerol (Euromedex, France), 4 M Urea (Sigma, USA), 0.2%Triton X-100, 20% (v/v) Dimethylsulfoxide (Sigma, USA). Samples were analyzed by confocal imaging (LSM 880, Carl Zeiss, France) and images were processed using Fiji software (National Institutes of Health, USA).
- a lipolysis assay measuring glycerol release was conducted on embedded spheroids after differentiation using Free Glycerol Reagent kit (Sigma) according to manufacturer's recommendations. At the end of the differentiation protocol embedded spheroids were transferred in 96 wells ULA plate in 90 pL phenol red free DMEM medium supplemented with 5 mM glucose. Following 24h of lipolysis stimulation with 200 pM 8 cpt-AMPc, 20 pL of media was collected and added to the reaction mix. After 15 min incubation, absorbance was read at OD 540 nm, and glycerol released was calculated using a standard curve. Four days prior to the experiment, adipogenic medium was depleted in insulin to prevent lipolysis inhibition. Data are normalized to DNA quantity.
- Lactate and glucose levels were measured after treatments with UCP1 inducers to assess the change in metabolic activity of embedded spheroids. Lactate and glucose levels were measured with the Lactate Pro II test meter (Arkray) and Contour XT TS (Bayer) respectively. To account for increase of molecules concentrations that could arise from medium evaporation, differences in glucose and lactate levels were calculated in comparison to evaporation control wells without cells. Data are normalized to DNA quantity. Seahorse metabolic assay
- Metabolic profiling of embedded spheroids was performed by evaluating oxygen consumption rate (OCR) of cells with Seahorse XF24 Extracellular Flux Analyzer (Seahorse Biosciences) in XF24 islet capture plate. Two embedded spheroids were placed in a well of an islet capture microplate (Agilent). Once in position, culture medium was replaced by 500 pL of assay XF Seahorse DMEM media supplemented with 2 mM glutamine, 10 mM glucose and 1 mM pyruvate. Embedded spheroids were incubated 45 min in a CO2 free incubator at 37°C prior to metabolic analysis. During Seahorse XF cell Mito stress run, cells were first exposed to 200 pM 8cpt-AMP to assess for adrenergic stimulation.
- OCR oxygen consumption rate
- Basal respiration was calculated by subtracting non-mitochondrial respiration to OCR obtained before oligomycin injection. All values were expressed in percentage of maximal respiration. Five human samples were analyzed. For each condition five wells were used to measure mean OCR values from each human donor.
- IL6, Meterorin-like, GDF15 and CXCL14 were measured using ELISA. Medium was collected at the end of the culture process and stored at -80°C. IL6, Meterorin-like, GDF15 and CXCL14levels were determined using commercial ELISA kits (R & D Systems, Minneapolis, USA, # D6050, # DY7867-05, # DY957; Ray Biotech, Peachtree Corners, USA, # ELH-CXCL14 respectively). Medium that has not been in contact with cells was used as a detection control for ELISA assays. Data are normalized to DNA quantity.
- adipocytes were found in close proximity to endothelial CD31+ cells aligned with aSMA+ ( Figure 3E) in contrast to what could be observed in spheroids alone where adipocytes and endothelial cells compartments were present at different locations within the spheroid. Therefore, GelMA embedding promoted the generation of vascularized beige adipose organoid more closely recapitulating in vivo-like adipose tissue cell organization. Then, the functionality of the vascularized beige adipose organoids at the end of the culture process was assessed.
- OCR oxygen consumption rate
- the SVF obtained directly after adipose tissue digestion contains heterogeneous cell populations comprising ASC, endothelial progenitors but also hematopoietic cells.
- SVF model recapitulate more closely patient tissue heterogeneity as compared to amplified PO-SVF.
- the generation process of beige adipose tissue organoids was evaluated using SVF cells directly isolated from native adipose tissue.
- the resulting embedded multi-spheroid constructs were submitted to a 7 days proliferation phase followed by 21 days of differentiation in adipogenic medium with SB431542.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Rheumatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Brown and beige adipose tissues (BAT) dissipate energy as heat thanks to their high mitochondrial content equipped with uncoupling protein1 (UCP1). Therefore, brown and beige adipocytes are promising cell targets to counteract metabolic diseases. Nevertheless, current studies on pharmaceutical activation of BAT are still impeded by the lack of relevant human in vitro BAT model. The models available to date poorly reflect the complex environment in which cells reside in vivo. A solution to overcome this problem is to provide a prevascularized human brown/beige adipose tissue transplant clinically relevant in size and functions. Accordingly, the present invention proposes an in vitro method for preparing a 3D prevascularized brown/beige adipose tissue construct, the 3D prevascularized brown/beige adipose tissue construct thus prepared, an intermediate construct obtained during this preparation and different uses thereof.
Description
METHOD FOR PREPARING A 3D PRE-VASCULARIZED ADIPOSE TISSUE CONSTRUCT, SAID 3D PRE-VASCULARIZED ADIPOSE TISSUE CONSTRUCT AND USES THEREOF
DESCRIPTION
FIELD OF THE INVENTION
The present invention relates to the general field of artificial, three-dimensional tissue constructs in particular created in vitro to mimic or resemble the emergence and functionality and/or histological structure of tissue or organs.
More particularly, the present invention proposes a method for producing a 3D pre-vascularized brown/beige adipose tissue construct using mesenchymal stroma/stem cells and endothelial cells, a porous matrix such as a gel or a hydrogel and a particular differentiation medium.
The present invention also concerns the 3D pre-vascularized brown/beige adipose tissue construct thus produced and its use in the medical domain or in the research domain.
BACKGROUND OF THE INVENTION
Obesity and associated metabolic diseases are increasing major public health concerns associated with increased mortality. They are characterized by imbalance between energy intake and energy expenditure. Adipose tissues (AT) are among the main organs responsible for energy regulation. While white adipose tissues (WAT) are specialized in energy storage and release, brown and beige adipose tissues (BAT) dissipate energy as heat thanks to their high mitochondrial content equipped with uncoupling protein-1 (UCP1). Therefore, brown and beige adipocytes are promising cell targets to counteract metabolic diseases and BAT activation has become a main trend in pharmaceutical approach to treat obesity (Mukherjee et al, Curr. Diabetes Rev., 2016, 12, 414-428).
Therefore, activation or increase in mass of human BAT has been investigated as therapeutic approaches to counteract obesity and diabetes. Beneficial effects of transplantation of mice or human brown/beige adipocytes as therapeutic agents have been demonstrated in rodents where normoglycemia was recovered in diabetic mice and energy expenditure increased in obese mice. However, translation of such approaches in humans requires the development of tissue engineering processes to generate human brown/beige adipose tissue transplant clinically relevant in size and functions.
Nevertheless, current studies on pharmaceutical activation of BAT are still impeded by the lack of relevant human in vitro BAT model. Indeed, to date marketed brown enhancers displayed limited efficacy and/or substantial adverse effects, likely due to the use of two-dimensional (2D) cell-based screening assay which poorly reflect the complex environment in which cells reside in vivo.
True recapitulation of brown/beige adipose tissue microenvironment includes modeling tissue cell composition and 3D spatial organization of cells based on cell-cell and cell-extracellular matrix interactions. Main cellular components of adipose tissues are the adipocytes that are organized as clusters of cells, called lobules, surrounded by extracellular matrix (ECM) mainly composed of collagen type I and IV. Remaining cells compose the stromal vascular fraction (SVF) which includes adipocyte progenitors, also referred as adipose mesenchymal stromal cells (ASCs), endothelial cells and immune cells. The development of three-dimensional (3D) tissue engineering techniques by cell selfassembly or using scaffold-based approach represents a key advance to mimic physiological tissue (Langhans, Front. Pharmacol., 2018, 9, Article 6).
A first approach to obtain 3D cell structures can be achieved by forcing cells to interact with each other and self-aggregate. Such structures are commonly referred as spheroids or organoids and are obtained by preventing cell attachment to cell culture support using ultra-low adherence surfaces. Numerous studies showed that spheroids or organoids can recapitulate physiological characteristics of tissues regarding cellular heterogeneity, cellular interaction and biochemical diffusion gradients. As spheroids possess high cell density and cellular cohesion, they represent interesting building blocks to initiate and maintain continuous cellular interactions which are determinant for tissue
organization. However, spheroids still suffer from non-physiological shape and size as well as the failure of long-term culture maintenance.
Alternatively, tissue engineering technologies using biomaterials have been developed to recreate in vivo chemical and physical microenvironments. In some approaches, cell suspensions are seeded onto biodegradable on non-biodegradable materials providing a physical support for cell proliferation and migration. However, seeding cells on such scaffolds leads to non-uniform cell distribution and does not recapitulate the 3D organization of the cell environment found in vivo. In some other approaches, cells are seeded in 3D within a biodegradable material that provides to the cells a porous environment that mimics some aspects of the extracellular matrix (ECM). This approach could lead to non-uniform cell distribution and low cell density compared to in vivo tissues. Besides, when individual cells are distributed within a 3D environment they present a low density and preferentially interact with the substrate without forming coherent 3D cellular structures.
Current challenges in developing engineered tissue-based therapeutic approaches rely on the difficulty to find technologies that can promote and drive inherent selforganizing ability of cells while incorporating them into transplantable devices. A suitable strategy to enhance cell-organization could be to assemble spheroids in biomaterial instead of isolated cells and provide them with a suitable microenvironment. Compared to individual cells, spheroids secrete higher amounts of trophic growth factors promoting cell migration and angiogenesis. Enhanced angiogenic potential is particularly interesting since integrating vascularization in tissue-engineered constructs has become a main challenge to overcome diffusion limitations.
By mimicking native extracellular matrices, hydrogels are promising tools to control spatiotemporal growth and shape-guided morphogenesis of cells from spheroids. Among biomaterials, hydrogels are formed of hydrophilic polymer networks allowing them to hold high water contents. Consequently, hydrogels show viscoelastic properties especially interesting for engineering soft tissues such as adipose tissues. For instance, gelatin hydrogels are biocompatible and biodegradable collagen-derived hydrogels that
offer a control of several physicochemical parameters such as, for example, porosity and stiffness of the cell environment.
In particular, covalent modifications of gelatin with methacrylate groups have allowed the engineering of stable photopolymerizable hydrogels such as gelatin- metacryloyl (GelMA). As illustrative example, Pepelanova et al (Bioengineering, 2018, 5, 55) have demonstrated that GelMA hydrogels can provide a cell promoting microenvironment for human adipose tissue-derived mesenchymal stroma/stem cells (hAD-MSCs). Nevertheless, the study performed by this group has only used this particular type of cells and not the different cellular types necessary to obtain a prevascularized brown/beige adipose tissue.
Therefore, there is still a need for a method for preparing ex vivo a prevascularized human brown/beige adipose tissue transplant clinically relevant in size and functions.
SUMMARY OF THE INVENTION
The invention is defined by the claims. In particular, the present invention relates to an in vitro method for preparing a 3D pre-vascularized brown/beige adipose tissue construct, the 3D pre-vascularized brown/beige adipose tissue construct thus prepared, an intermediate construct obtained during this preparation and different uses thereof.
DETAILED DESCRIPTION OF THE INVENTION
The present inventors propose a modular approach to generate ex vivo a 3D human pre-vascularized brown/beige adipose tissue construct by promoting the selforganization of cells derived from human white adipose tissue into 3D structure scaffold such as a gel or hydrogel. To this end, the control of initial culture conditions is essential to drive multicellular responses towards the emergence of complex and functional tissue constructs. These include i) cell nature and their differentiation potential, ii) engineering chemical and mechanical permissive environments to promote their self-organizing
ability, and iii) the controlling of the 3D spatial structuration to define shape and size organization of cells.
The present inventors have developed an optimized microenvironment and conditions thanks to which cells comprising mesenchymal stroma/stem cells and endothelial cells can produce a 3D pre-vascularized brown/beige adipose tissue construct and in particular a 3D pre-vascularized beige adipose tissue construct. These optimized microenvironment and conditions correspond, in one hand, to a 3D structure scaffold such as a gel or hydrogel and, in particular, a GelMA hydrogel and, in the other one, to a particular differentiation medium which comprises a TGF- inhibitor.
The 3D pre-vascularized brown/beige adipose tissue constructs produced by the method implemented by the inventors could be used either as an ex vivo model of human BAT or as an implantable source of brown/beige adipocytes and, in particular, of beige adipocytes for therapeutic perspective.
In vitro method for preparing a 3D pre-vascularized brown/beige adipose tissue construct
In a first aspect, the present invention concerns an in vitro method for preparing a three-dimensional (3D) pre-vascularized brown/beige adipose tissue construct comprising the steps of a) embedding at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells in a porous matrix; b) contacting said embedded cells obtained at step a) with an amplification medium; and then c) contacting said expanded embedded cells obtained at step b) with a differentiation medium until obtaining a 3D pre-vascularized brown/beige adipose tissue construct, wherein said differentiation medium comprises at least one adipogenic agent and a TGF-P inhibitor.
"Three-dimensional tissue construct" and "organoid" are used interchangeably herein and, as used herein, refer to a composition of live cells, typically in a carrier media, arranged in a three-dimensional configuration as opposed to a monolayer. An organoid is an artificial, three-dimensional construct created in vitro to mimic or resemble the functionality and/or histological structure of an organ, tissue, or a portion thereof.
Consequently, "three-dimensional (3D) pre-vascularized brown/beige adipose tissue construct" and "three-dimensional (3D) pre-vascularized brown/beige adipose organoid" are used interchangeably herein and, as used herein, refer to a composition of live cells comprising, among brown/beige adipocytes, endothelial cells self-assembling to form an organized endothelial network whereby a preformed vasculature is generated among brown/beige adipocytes, in a carrier media which is a porous matrix such as gel or a hydrogel, arranged in a three-dimensional configuration as opposed to a monolayer. Thus a three-dimensional (3D) pre-vascularized brown/beige adipose organoid is an artificial, three-dimensional construct created in vitro to mimic or resemble the emergence and the functionality and/or histological structure of brown/beige adipose tissue, or a portion thereof. A "portion thereof" refers, in particular, to beige adipose tissue. As a reminder, native human brown/beige adipose tissue is organized into multilocular adipocytes interspersed within a dense vascularization.
In the three-dimensional pre-vascularized brown/beige adipose tissue construct of the present invention, there may be either one single clustered with highly organized endothelial networks among brown/beige adipocytes in the porous matrix such as the gel or the hydrogel, or at least two different zones with, in each one, an organized endothelial network among brown/beige adipocytes in the porous matrix such as the gel or the hydrogel. When the three-dimensional pre-vascularized brown/beige adipose tissue construct of the invention presents one single zone, this construct can be defined as an individual block construct or an individual spheroid construct. When the three- dimensional pre-vascularized brown/beige adipose tissue construct of the invention presents at least two different zones, this construct can be defined as a multi-block construct or a multi-spheroid construct.
As used herein, the term "adipocytes" refers to a type of cells specialized in storage and release of lipids in adipose tissue, an organ specialized in storing and releasing energy in the form of triglycerides. Adipocytes are classified as white, beige or brown adipocytes, all three derived from Mesenchymal Stroma/Stem Cells (MSCs). White adipocytes have an adipokine secretory function with a morphology characterized by the presence of large lipid vacuoles. Brown adipocytes are responsible for thermogenesis with expression of the Uncoupling Protein 1 (UCP1; Entrez Gene: 7350) gene within the inner mitochondrial membrane, with a morphology characterized by the presence of several small lipid vacuoles. Beige adipocytes can be considered phenotypically as fat cells possessing characteristics between those of the white adipocytes, accumulators of energy, and the brown adipocytes, which produce heat. In addition, contrary to brown adipocytes, beige adipocytes are formed and clustered within specific white adipose tissues and can be activated to display thermogenic features by a reversible mechanism called "beiging". Adipose tissue constitutes the only reserve of energy that can be mobilized in the long term and therefore occupies a preponderant place in the control of the energy balance in mammals. Consequently, a defect in the storage of lipids within the adipose tissue leads to significant metabolic disorders and associated diseases.
In the method according to the present invention, step a) implements at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells.
As used herein, the expression "cell aggregate" refers to an aggregation or cluster of cells forming an organized structure. Cell aggregate is the result of the clustering and interaction processes of initially separate cells. Cell aggregate is a generic term with no defined cell number and shape that include spheroids, organoids and high density cell suspensions.
In some embodiments, the cell aggregate is a spheroid. As used herein, the term "spheroid" refers to a 3D sphere-like cell aggregate. The skilled artisan well knows culture systems enabling 3D spheroid formation. Contrarily to 2D culture (e.g. a monolayer), 3D culture is achieved by improving the potential for cells to adhere, as example, using an ultra-low attachment plate. In some embodiments, the methods of the present invention
comprise a further step comprising seeding a population of cells on an ultra-low adherence surface.
In some embodiments, the cell aggregate is a high-density cell suspension. Typically, a high-density cell suspension may be a high-density of cells suspended in a culture medium or in a gel. In some embodiments, a high-density cell suspension is reached when obtaining at least 103, 104, 105, 106, 107, 108, 109, IO10, 1011, 1012, 1013, 1014, 1015, 1016 or 1017 cells per mL of culture medium or of gel. In some embodiments, a high- density cell suspension is reached when obtaining at least 104 cells per mL of culture medium, of porous matrix or of gel such as hydrogel.
As used herein, the expression "Mesenchymal Stroma/Stem Cells" or "MSCs" refers to multipotent stromal cells having the ability to proliferate in culture and to display mesenchymal potentials. These cells belong to a cell population initially identified in the bone marrow but are present in all tissues. As example, mesenchymal stroma/stem cells can be derived not only from adipose tissue (e.g. after a lipoaspiration or dermolipectomy - hereinafter named "adipose stem cells", "adipose tissue-derived stem cells" or "ADSCs") or from bone marrow (hereinafter named "bone marrow-derived mesenchymal stroma/stem cells") of an adult human but also from any tissue (muscle, liver, heart...). In some embodiments, the mesenchymal stroma/stem cells are adipose tissue-derived stem cells. In some embodiments, the adipose tissue-derived stem cells are white adipose tissue-derived stem cells (i.e. WAT-derived stem cells). In some embodiments, the mesenchymal stroma/stem cells are infants, child or adult mesenchymal stroma/stem cells. In some embodiments, the mesenchymal stroma/stem cells are non-embryonic mesenchymal stroma/stem cells.
As used herein, the expression "Endothelial Cells" or "ECs" refers to a population of cells that line the walls of vessels and are tightly connected to each other by cell-cell junctions. The endothelium is a thin membrane that lines the inside of the heart and blood vessels. Endothelial cells release substances that control vascular relaxation and contraction as well as enzymes that control blood clotting, immune function and platelet adhesion. ECs are defined by their cell surface biomarkers, and are in particular CD31+. Endothelial Progenitor Cells (EPCs) are able to differentiate into endothelial cells.
The cell population(s) implemented in step a) of the method of the invention may consist(s) of mesenchymal stroma/stem cells and endothelial cells. Alternatively, the cell population(s) implemented in step a) of the method of the invention may comprise mesenchymal stroma/stem cells, endothelial cells and at least one other cell type.
When at least two cell aggregates are used in step a) of the method of the invention, at least two cell aggregates may be from the same cell source or from different cell sources.
The cell aggregate(s) implemented in step a) of the method of the invention may be obtained from primary cell cultures. Alternatively, they may be obtained as cellular sample derived from white adipose tissue, such as Stromal Vascular Fraction (SVF) or amplified SVF (PO-SVF).
As used herein, the expression "Stromal Vascular Fraction" or "SVF" corresponds to a heterogeneous cell population derived from white adipose tissues that does not contain mature adipocytes and can contain typically adipose-derived stem cells (ADSCs), endothelial cells and immune cells (macrophages, dendritic cells, lymphocytes...) as example. In some embodiments, the mesenchymal stroma/stem cells are collected from a SVF derived from a dermolipectomy or a lipoaspirate (i.e. an ex-vivo waste product of liposuction). When cells are isolated from adipose tissue extracellular matrix by enzymatic digestion, the adipocytes float in the cell suspension and are eliminated. About 90% of the volume of adipose tissue is made up of adipocytes, the remaining 10% represents the stromal vascular fraction (SVF).
In some embodiments, the MSCs and ECs are derived from a SVF collected on a subject and the three-dimensional pre-vascularized brown/beige adipose tissue construct obtained from this SVF or from the corresponding PO-SVF is intended to be relocated in said subject. Thus, the three-dimensional pre-vascularized brown/beige adipose tissue construct is autologous. By using such an autologous three-dimensional pre-vascularized brown/beige adipose tissue construct in a treatment, immunological tolerance and safety are favoured, particularly by promoting the inhibition of regulatory cells and by decreasing on-going inflammation.
In some embodiments, the mesenchymal stroma/stem cells and endothelial cells are derived from a SVF collected on a first subject and the three-dimensional prevascularized brown/beige adipose tissue construct obtained from this SVF or from the corresponding PO-SVF is intended to be relocated in a second subject different from the first one. Thus, the three-dimensional pre-vascularized brown/beige adipose tissue construct is allogenic. As used herein, the term "subject" refers to a mammal, such as a rodent, a feline, a canine or a primate. In some embodiments the subject is a human. In some embodiments, the subject is a mouse. Preferably, the subject is a human.
As used herein, the expressions "amplified Stromal Vascular Fraction", "amplified SVF" or "PO-SVF" that may be used interchangeably herein correspond to an amplified population of SVF cells. This amplified population is obtained by contacting the SVF with an amplification medium that will be defined hereinafter. Thanks to this contacting, the expansion of the SVF corresponds to a selection by adhesion that rapidly eliminates the vast majority of immune cells and strongly enriches in progenitor cells, making it possible to obtain many more cells of interest. It results in a greater homogeneity of the cells, and therefore in a better response to inducers. Typically, PO-SVF contains adipose stem cells, endothelial cells and macrophages. In some embodiments, the population is amplified or expanded until reaching a high cellular concentration. In some embodiments, a high cellular concentration is reached when obtaining at least 70% of confluency in a culture medium and in particular at least 80% of confluency in a culture medium. In some embodiments, a high cellular concentration is reached at least 90% of confluency in a culture medium. In some embodiments, the population is amplified until reaching 100% of confluency in a culture medium. In some embodiments, the population is amplified until reaching at least 103, 104, 105, 106, 107, 108, 109, 1010, 1011, 1012, 1013, 1014, 1015, 1016 or 1017 cells per mL in a culture medium.
In a particular embodiment, the at least one cell aggregate implemented in step a) is at least one spheroid derived from SVF or from PO-SVF.
The cell aggregate(s) implemented in step a) of the method according to the present invention comprise(s) between 103 cells and 109 cells, in particular, between 104 cells and 108 cells, more particularly, for example, about 5.104 cells (i.e. 5.104 cells ± 104
cells), about 105 cells (i.e. 105 cells ± 4.104 cells), about 5.105 cells (i.e. 5.105 cells ± 105 cells), about 106 cells (i.e. 106 cells ± 4.105 cells), about 5.106 cells (i.e. 5.106 cells ± 106 cells), about 107 cells (i.e. 107 cells ± 4.106 cells), about 5.107 cells (i.e. 5.107 cells ± 107 cells), and about 108 cells (i.e. 108 cells ± 4.107 cells).
In step a) of the method according to the present invention, at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is embedded in a porous matrix.
As used herein, the term "porous matrix" refers to a scaffold creating an artificial environment in which biological cells are permitted to grow or interact with their surroundings in all three dimensions. Typically, the porous matrix tends to reproduce in v/vo-like conditions (e.g. communication, proliferation, migration of the cells).
Typically, porous matrix includes, but is not limited to, a gel or a biomaterial. In some embodiments, the porous matrix is a gel, a biomaterial of natural or synthetic origin, a sponge, a porous plastic scaffold, a porous microsphere, a cryogel, a microscale macroporous cryogel or a decellularized extracellular matrix. In addition, the porous matrix implemented in the invention is typically biocompatible and eventually biodegradable.
In some embodiments, in step a) of the method according to the present invention, at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is embedded in a gel.
As used herein, the expression "gel" refers to a material formed from at least two constituents: a solution, also known as gel solution which is a liquid « trapped » by a second compound which forms a three-dimensional net or three-dimensional network throughout the entire solution. This three-dimensional network is composed of gel precursor compounds able to form a matrix i.e. a solid continuous phase. Typically, a gel is a soft material, swollen with solution and capable of undergoing major deformation.
In some embodiments, in step a) of the method according to the present invention, at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is embedded in a hydrogel.
As used herein, the expression "hydrogel" refers to a gel as previously defined in which the gel solution is water or an aqueous solution i.e. a solution the solvent of which is water.
In the present invention, all the gel precursor compounds generally employed to prepare gel or hydrogel can be used in the invention. Advantageously, these gel precursor compounds are of organic nature: they are generally macromolecules which typically are molecules of relatively high molecular weight having a structure essentially formed of multiple repeat units derived, de facto or via design, from molecules of low molecular weight.
The gel or the hydrogel implemented in the present invention may comprise, as gel precursor compounds, agarose, sucrose, sepharose, chitosan, xanthan, carrageenan, dextran, dextran acrylate, dextran methacrylate, agar, alginate, gelatin, gelatin acrylate, gelatin methacrylate, thiol-modified gelatin, collagen, collagen acrylate, collagen methacrylate, thiol-modified collagen, fibrin, fibrin acrylate, fibrin methacrylate, polyethylene glycol, thiol-modified polyethylene glycol, polyethylene glycol diacrylate, polyethylene glycol diacrylamide, polyethylene glycol dimethacrylate, hyaluronic acid, hyaluronic acid acrylate, hyaluronic acid methacrylate, thiol-modified hyaluronic acid, starch, starch acrylate, starch methacrylate, chitosan, silk, alginate, alginate acrylate, alginate methacrylate, thiol-modified alginate, polylactic glycolic acid, polycaprolactone, polyacrylamide, polyvinyl alcohol, or mixtures thereof.
In a particular embodiment, the gel or the hydrogel implemented in the invention is a gelatin methacroyl (GelMA) hydrogel.
As used herein, the expressions "gelatin methacryloyl", "methacrylated gelatin", "gelatin methacrylate" "gelatin methacrylamide" or "GelMA" that are equivalent and may be used interchangeably herein correspond to a gelatin some lysine and hydroxyl residues of which are modified by methacrylamide and methacrylate side groups following to its direct reaction with methacrylic anhydride.
A gel or a hydrogel as previously defined and, in particular, a GelMA hydrogel is an excellent candidate to generate biologically relevant 3D pre-vascularized brown/beige adipose tissue constructs as cell aggregates comprising stroma/mesenchymal stem cells
and endothelial cells have readily adhered to, proliferated within, and migrated when embedded within the 3D matrix of such a hydrogel.
Within the context of the invention, at least one cell aggregate described herein is embedded in a porous matrix such as previously defined and in particular in a gel or a hydrogel such as previously defined. In other words, the at least one cell aggregate is entrapped/encapsulated in a porous matrix such as previously defined and in particular in a gel or a hydrogel such as previously defined i.e. each cell aggregate implemented in the present invention is completely surrounded/covered by such a porous matrix and in particular such a gel or such an hydrogel, such that it is not released therefrom. It should nevertheless be noted that when the 3D pre-vascularized brown/beige adipose tissue construct is obtained, the endothelial network of this construct can extend into the surrounding porous matrix and in particular into the surrounding gel or hydrogel and even may reach adjacent blocks or spheroids in the 3D pre-vascularized brown/beige adipose tissue construct when several cell aggregates are implemented.
The embedding/encapsulating of cell aggregate(s) at step a) can implement deposit technique by manual handling, robotic handling, aspiration, microfluidic technique and/or 3D bioprinting technique. In a particular embodiment, when the step a) of the method of the invention implements a single cell aggregate comprising stroma/mesenchymal stem cells and endothelial cells, this step consists in i) taking a volume of a solution comprising at least one gel precursor compound and a single cell aggregate comprising stroma/mesenchymal stem cells and endothelial cells; then ii) exposing said volume to conditions allowing the formation of a gel such as a hydrogel from the at least one gel precursor compound thereby forming a gel such as an hydrogel in which is embedded a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells.
The volume taking at step i) can implement any technique known to the one skilled in the art such as aspiration, injection, manual pipetting, automated pipetting, dispensing, microfluidic technique and/or 3D bioprinting technique. In some embodiments, the volume of the solution taken at step i) may range between 500 nl and
5 pl, in particular between 1 pl and 3 pl and, more particularly, is about 1.5 pl (i.e. 1.5 pl ± 0.3 pl). In some embodiments, the volume taken at step i) may be in the form of a droplet.
At step i), once taken, the volume can be deposited on an anti-adhesive support or on a support made of gel as previously defined or on a solution comprising at least one gel precursor compound.
The conditions implemented at step ii) to allow the formation of a gel such as a hydrogel is dependent on the compounds employed, and is known in the corresponding field. It should be noted that the conditions implemented are appropriate cell-compatible conditions, i.e. conditions which are not detrimental or not significantly detrimental to the viability of the cells in the cell aggregate.
The gel may form spontaneously. For chemical compounds such as polysaccharides or some proteins such as gelatin, it is generally necessary to heat and then cool the solution containing the gel precursor compounds. Heating ensures dispersion of the compounds in the solution and allows cleavage of some of the weak bonds existing between the different compounds which can then reorganize themselves to form a three-dimensional network. For other chemical compounds such as collagen, gelification occurs on cooling the solution containing the gel precursor compounds. In another example, regarding polyacrylamide gels, the formation of the gel requires the use of a crosslinking agent and acrylamide. In another example, regarding photocrosslinked gels, the formation of the gel requires the use of a photoinitiator and the condition necessary for the formation of such gels is light.
Depending on the gel precursor compound(s) implemented, the one skilled in the art will know, without any inventive effort, which other compounds have to be added to the solution implemented at step i) such as, for example, photoinitiators and crosslinking agents.
In a particular example of this particular embodiment, when the step a) of the method of the invention implements a photocrosslinked gel such as a photocrosslinked hydrogel and a single cell aggregate comprising stroma/mesenchymal stem cells and endothelial cells, this step consists in
i) taking a volume of a solution comprising at least one photocrosslinkable polymer, a photoinitiator and a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; then ii) exposing to light said volume thereby forming a photocrosslinked gel such as photocrosslinked hydrogel in which is embedded a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells.
Alternatively, at step a) of the method of the invention, at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells are embedded in a porous matrix.
In this alternative, a plurality of cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells are entrapped or encapsulated within a single porous matrix such a gel or a hydrogel. For example, a porous matrix, a gel or a hydrogel such as previously defined may entrap or encapsulate two or more, three or more, four or more, five or more, ten or more or even fifteen or more different cell aggregates.
In this alternative, two adjacent cell aggregates may be in contact with each other or be separated the one from the other one by a distance lower or equal to 3 mm, in particular a distance between 40 pm and 2 mm and more particularly between 50 pm and 1 mm. The distances separating adjacent cell aggregates may be identical or different.
In a 1st embodiment of this alternative, step a) consists in: i') forming at least two gels such as hydrogels in which is embedded a single cell aggregate comprising mesenchymal stem cells and endothelial cells, according to the method as defined in any one of the particular embodiments previously defined; ii') assembling the at least two gels using a biological adhesive thereby forming a gel such as an hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells.
The different gels or hydrogels implemented at step i') may be of identical or different nature. Advantageously, they are of identical nature i.e. they are obtained from the same gel precursor compound(s).
The one skilled in the art knows biological adhesives also known as "bioadhesives" or "biological glues" usable in the present invention. Biological adhesive is a biomedical material typically used to prevent tissue adhesion, hemostasis, and prevention of air and body fluid leakage during surgery. As examples of biological adhesives usable in the present invention, one can cite cyanoacrylate adhesives or fibrin adhesives.
In 2nd embodiment of this alternative, when the step a) of the method of the invention implements at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells, this step consists in: i") covering an anti-adhesive support with a solution comprising at least one gel precursor compound; ii") depositing, on said solution, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; iii") repeating step ii”) at least once; iv”) optionally adding some solution comprising at least one gel precursor compound to the whole; and then v") exposing the whole to conditions allowing the formation of a gel such as a hydrogel from said at least one gel precursor compound thereby forming a gel such as a hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells.
In a particular example of this 2nd embodiment, when the step a) of the method of the invention implements a photocrosslinked gel such as a photocrosslinked hydrogel and at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells, this step consists in: i”) covering an anti-adhesive support with a solution comprising at least one photocrosslinkable polymer and a photoinitiator; ii”) depositing, on said solution, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; iii”) repeating step ii”) at least once; iv”) optionally adding some solution comprising at least one photocrosslinkable polymer and a photoinitiator to the whole; and then
v") exposing to light the whole thereby forming a gel such as a hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stem cells and endothelial cells.
The whole at step iv") refers to the solution covering the anti-adhesive support and the cell aggregates deposited thereon. When step iv”) is not optional, the whole at step v") refers to the solution covering the anti-adhesive support, the cell aggregates deposited thereon and the additional solution covering them.
The solutions implemented at step i”) and at step iv”) may be identical or different. Advantageously, the solutions implemented at step i") and at step iv”) are identical.
In 3rd embodiment of this alternative, when the step a) of the method of the invention implements at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells, this step consists in: i'") covering an anti-adhesive support with a solution comprising at least one gel precursor compound; ii'") exposing said solution to conditions allowing the formation of a gel such as a hydrogel from said at least one gel precursor compound thereby forming a gel such as a hydrogel; iii'") depositing, on said gel, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; and iv'”) repeating step ii'”) at least once, thereby forming a gel such as a hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells; v'") optionally adding, to the whole, some solution comprising at least one gel precursor compound; and exposing it to conditions allowing the formation of a gel such as a hydrogel from said at least one gel precursor compound.
In a particular example of this 3rd embodiment, when the step a) of the method of the invention implements a photocrosslinked gel such as a photocrosslinked hydrogel and at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells, this step consists in:
i"') covering an anti-adhesive support with a solution comprising at least one photocrosslinkable polymer and a photoinitiator; ii'") exposing to light said solution thereby forming a gel such as a hydrogel; iii'") depositing, on said gel, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; and iv'") repeating step ii''') at least once, thereby forming a gel such as a hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells; v"') optionally adding, to the whole, some solution comprising at least one photocrosslinkable polymer and a photoinitiator; and exposing it to light.
The deposit of cell aggregate at step ii') or at step iii''') can implement deposit technique by manual aspiration or injection, automated handling, microfluidic technique and/or 3D printing or bioprinting technique.
The solutions implemented at step i"') and at step iv''') may be identical or different. Advantageously, the solutions implemented at step i'") and at step iv''') are identical.
In any one of the embodiments previously disclosed, the cell aggregate which is deposited may be alone, in a volume of liquid such as a solution comprising at least one gel precursor compound or even in a volume of gel.
As used herein, the expressions "anti-adhesive support" refers to a support such as a culture vessel, a plate or a mold on which specific and non-specific cell attachment is prevented, thereby maintaining cells into a suspended state. This support is also known as "low attachment support" or even "ultra-low attachment support". This kind of support may be commercially available, for example, ultra-low attachment (ULA) plates or flasks from any one of the following companies: Corning Incorporated, Costar, Sarstedt, Greiner, Falcon and Eppendorf. Alternatively, this support may be prepared by covalently binding, to the surface of a support, a coating such as a coating of agarose, poly-(2- hydroxyethylmethacrylate) (poly(HEMA)), polyethylene glycol) (PEG), poly-L-Lysine (PLL), PLL-PEG, parylene, pluronics, polydimethylsiloxane (PDMS) or any combination thereof.
The surface of the anti-adhesive support may be flat or patterned. When the support surface is patterned, it presents advantageously cavities, grooves, holes or trenches. Each one may be devoted to host at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells after filling it with a solution comprising at least one gel precursor compound and optionally after exposing it to conditions allowing the formation of a gel such as a hydrogel. The experimental part hereinafter discloses a patterned mold on the surface of which a coating as previously defined is covalently bound.
As used herein, the expression "solution comprising at least one photocrosslinkable polymer and a photoinitiator" refers to a solution in which the photocrosslinkable polymer(s) and a photoinitiator are dissolved in a biological buffer such as Phosphate buffered saline (PBS).
As used herein, the term "photocrosslinkable polymer" refers to a polymer presenting, in its backbone or amongst its pending groups, photocrosslinkable groups. Particular examples of photocrosslinkable polymers usable in the context of the invention include dextran acrylate, dextran methacrylate, gelatin acrylate, gelatin methacrylate, thiol-modified gelatin, collagen acrylate, collagen methacrylate, thiol-modified collagen, fibrin acrylate, fibrin methacrylate, polyethylene glycol diacrylate, thiol-modified polyethylene glycol, polyethylene glycol diacrylamide, polyethylene glycol dimethacrylate, hyaluronic acid acrylate, hyaluronic acid methacrylate, thiol-modified hyaluronic acid, starch acrylate, starch methacrylate, alginate acrylate, alginate methacrylate, thiol- modified alginate or any mixture thereof.
For example, when the photocrosslinkable polymer is gelatin methacrylate, it is present, in the solution implemented at step i) or i") or i'"), in an amount ranging from 2% (w/v) to 30% (w/v), in particular, from 4% (w/v) to 25% and more particularly from 5% (w/v) to 20% (w/v). As an illustrative and non-limitative example, one can cite an amount of about 10% (w/v) (i.e. 10% (w/v) ± 2% (w/v)).
As used herein, the term "photoinitiator" refers to a molecule that creates reactive species, such as free radicals, cations or anions, thanks to which the photocrosslinking of photocrosslinkable polymer(s) is initiated. Particular examples of
photoinitiators usable in the context of the invention include tyramine, tyrosine, eosin Y, triethanolamine, l-vinyl-2-pyrrolidinone, lithium phenyl-2,4,6- trimethylbenzoylphosphinate (also known as "LAP"), 2-hydroxy-4'-(2-hydroxyethoxy)-2- methylpropiophenone (also known as "Irgacure 2959"), phenylbis(2,4,6- trimethylbenzoyl)phosphine oxide (also known as "Irgacure 819"), diphenyl(2,4,6- trimethylbenzoyl)phosphine oxide (also known as "TPO"), and ruthenium based photoinitiators such as ruthenium/sodium persulfate (Ru/SPS). In the solution implemented at step i) or i”) or i'”), a mixture of different photoinitiators may be used. The amount of photoinitiator(s) present in the solution is comprised between 0.01% (w/v) and 1% (w/v), in particular between 0.05% (w/v) and 0.5% (w/v) and, more particularly, in an amount of about 0.1% (w/v) (i.e. 0.1% (w/v) ± 0.02% (w/v)).
The conditions of the light exposure at step ii) or v') or v") or ii'") or v'") in terms of duration and wavelength range will depend on the photoinitiator present in the solution(s). The one skilled in the art will be able to identify the conditions to be used without inventive effort. As for illustrative and non-limitative example, when the photoinitiator is LAP, the light exposition at step ii) or v") or v") or ii'”) or v'”) is performed during between 30 s and 1.5 min and, for example, during about 40 s (i.e. 40 s ± 5 s), during about 60 s (i.e. 60 s ± 10 s) or during about 80 s (i.e. 80 s ± 10 s) under blue light (405 nm).
In a particular embodiment, the at least one cell aggregate implemented in step a) is at least one spheroid derived from SVF or from PO-SVF. Accordingly, the method of the invention may comprise a step consisting of preparing spheroid(s) derived from SVF or from PO-SVF prior to step a).
Any method known by the one skilled in the art to prepare a cell spheroid and in particular a spheroid comprising mesenchymal stroma/stem cells and endothelial cells may be used in the context of the present invention. Typically, the spheroid preparation method comprises culturing said SVF cells or said PO-SVF cells on an anti-adhesive support such as previously defined in the presence of an amplification medium and under agitation. This agitation is also implemented to avoid cell adherence to the support and to facilitate cell aggregation. A spheroid derived from SVF or a spheroid derived from PO-SVF
may be obtained respectively after a culture of about 5 days (5 days ± 12 h) and after a culture of about 24 h (24 h ± 3 h).
In the method of the present invention, step b) consists in contacting the embedded cells obtained at step a) with an amplification medium. In other words, the porous matrix and in particular the gel or the hydrogel in which at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is embedded is put into contact with an amplification medium whereby the cells present in the cell aggregate(s) can expand.
As used herein, the expressions "amplification medium" and "expansion medium" that are equivalent and may be used interchangeably refer to a culture medium able to optimize the growth and proliferation of cells.
In some embodiments, the amplification medium comprises serum and a mix of growth factors.
As used herein, the term "mix of growth factors" refers to a growth supplement for cell culture media containing at least two growth-promoting factors. In some embodiments, the mix of growth factors comprises at least two growth-promoting factors selected in the group comprising growth factors of the VEGF family, of the EGF family, of the FGF family or an insulin-like growth factor. In some embodiments, the mix of growth factors is provided by serum and in particular such as fetal serum as previously defined. In some embodiments, the mix of growth factors is provided by platelet lysate. For in vitro purposes, fetal bovine serum may be preferred. For in vivo purposes, platelet lysate may be preferred. In some embodiments, the mix of growth factors is added in an amount between 1% (v/v) and 3% (v/v) and in particular of about 2% (v/v) (i.e. 2% ± 0.5% (v/v). the volume of mix of growth factors is given relative to total volume of the amplification medium.
In some embodiments, the mix of growth factors comprises at least two growthpromoting factors selected in the group consisting of growth factors of the VEGF family, of the EGF family, of the FGF family or an insulin-like growth factor (IGF).
In some embodiments, the amplification medium comprises at least IGF and VEGF.
When the amplification medium comprises VEGF, the latter may be selected from the group consisting of VEGF-A, preferably VEGF-A splice form VEGF121, VEGF 145 or VEGF 165, VEGF-B, VEGF-C, VEGF-D and PGF. In the amplification medium, VEGF as previously defined may be present in an amount between 0.4 ng.mL 1 and 0.6 ng.mL 1 and in particular of about 0.5 ng.mL 1 (i.e. 0.5 ng.mL 1 ± 0.05 ng.mL -1).
In some embodiments, the IGF may be selected from the group consisting of IGF- 1, IGF-2, IGFL1, IGFL2, IGFL3 and IGFL4 and synthetic analogs thereof such as long(R3)- IGF-I. In the amplification medium, IGF as previously defined may be present in an amount between 15 ng.mL 1 and 25 ng.mL 1 and in particular of about 20 ng.mL 1 (i.e. 20 ng.mL 1 ± 2 ng.mL -1).
In some embodiments, the mix of growth factors is provided by fetal serum such as bovine fetal serum. In some embodiments, the mix of growth factors is provided by platelet lysate. For in vitro purposes, fetal bovine serum may be preferred. For in vivo purposes, platelet lysate may be preferred. In some embodiments, the mix of growth factors is added in an amount between 1% (v/v) and 5% (v/v), preferably 2% (v/v).
In some embodiments, the amplification medium comprises serum such as fetal serum, IGF and VEGF.
As used herein, the term "fetal serum" refers to a growth supplement for cell culture media containing high levels of embryonic growth-promoting factors. The Bovine Fetal Serum (FBS) or fetal calf serum is the most widely used in the art. Thus, in some embodiments, the fetal serum is bovine fetal serum. In the amplification medium, serum or fetal serum as previously defined may be present in an amount between 1% (v/v) and 5% (v/v) and in particular of about 2% (v/v) (i.e. 2% ± 0.5% (v/v)).
In some embodiments, the amplification medium comprises fetal serum, long(R3)- IGF-l and VEGF 165.
In some embodiments, the amplification medium comprises or consists in fetal bovine serum, Epidermal Growth Factor (EGF), basic fibroblast growth factor (basic FGF), long(R3)-IGF-l, VEGF 165, ascorbic acid, heparin and hydrocortisone. When present in the amplification medium, EGF is added in an amount between 4 ng.mL 1 and 6 ng.mL 1 and, in particular, of about 5 ng.mL 1 (i.e. 5 ng.mL 1 ± 0.5 ng.mL -1). When present in the
amplification medium, basic FGF is added in an amount between 5 ng.mL 1 and 20 ng.mL 1 and, in particular, of about 10 ng.mL 1 (i.e. 10 ng.mL 1 ± 1 ng.mL -1). When present in the amplification medium, long(R3)-IGF-l is added in an amount between 10 ng.mL 1 and 30 ng.mL 1 and, in particular, of about 5 ng.mL 1 (i.e. 2 ng.mL 1 ± 20 ng.mL 1). When present in the amplification medium, VEGF 165 is added in an amount between 0.1 ng.mL 1 and 10 ng.mL 1 and, in particular, of about 5 ng.mL 1 (i.e. 0.5 ng.mL 1 ± 0.1 ng.mL 1). When present in the amplification medium, heparin is added in an amount between 15 pg.mL 1 and 25 pg.mL 1 and, in particular, of about 22.5 pg.mL 1 (i.e. 22.5 pg.mL 1 ± 2 pg.mL 1). When present in the amplification medium, ascorbic acid is added in an amount between 0,5 pg.mL 1 and 1,5 pg.mL 1 and, in particular, of about 1 pg.mL 1 (i.e. 1 pg.mL 1 ± 0.5 pg.mL -1). When present in the amplification medium, hydrocortisone is added in an amount between 0.1 pg.mL 1 and 0.3pg.mL 1 and, in particular, of about 0.2 pg.mL 1 (i.e. 0.2 pg.mL 1 ± 0.05 pg.mL -1).
In some embodiments, the amplification medium is EGM-2 medium (PromoCell, Germany). In some embodiments, the EGM-2 medium is supplemented by amphotericin B (Life-Technologies, UK) and streptomycin/penicillin (Life-Technologies, UK). In some embodiments, the EGM-2 medium is supplemented by 0.1% (v/v) amphotericin B and 1% (v/v) streptomycin/penicillin.
Typically, the step b) in the method of the present invention lasts 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 days. During this contacting, it is possible to replace the amplification medium with a fresh amplification medium presenting the same or a different formulation. In a particular embodiment, after two or three days of contacting, the amplification medium is replaced by a fresh one of the same formulation.
In the method of the present invention, step c) consists in contacting the expanded embedded cells obtained at step b) with a differentiation medium until obtaining a 3D pre-vascularized brown/beige adipose tissue construct. In other words, the porous matrix such as a gel or a hydrogel in which at least one expanded cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells is obtained after step b)
is put into contact with a differentiation medium whereby the cells present in the cell population(s) can differentiate.
As used herein, the term "differentiation medium" refers to a medium formulated to optimize the preferential differentiation of immature cells such as MSCs or ASCs into mature cells with specific functions such as adipocytes or brown/beige adipocytes. As example, when the differentiation medium is an adipogenic medium, the latter is able to induce the differentiation of mesenchymal stroma/stem cells into adipocytes.
As used herein, the term "adipogenic medium" refers to a medium comprising at least one adipogenic agent. As used herein, the term "adipogenic agent" refers to a compound able to induce the differentiation of mesenchymal stroma/stem cells into adipocytes. In the present invention, the adipogenic agent is preferably a browning agent.
As used herein, the term "browning agent" or "browning inducer" refers to an adipogenic compound able to induce the differentiation of mesenchymal stroma/stem cells into brown/beige adipocytes. As example, a browning agent is deemed to induce brown/beige adipogenesis if it leads to an increase in the expression of the gene encoding UCP1 (i.e. Uncoupling Protein 1; Entrez Gene: 7350). In some embodiments, the browning agent is insulin or Insulin-like Growth Factor (IGF) or a Bone Morphogenic Protein (BMP). In some embodiments, the browning agent is insulin and BMP7.As used herein, the term "insulin" refers to a peptide hormone produced by p-cells of the pancreatic islets encoded in humans by INS gene (Entrez Gene: 3630). Alternatively, Insulin Growth Factor may be used to substitute for insulin. As example, IGF may be selected from the group consisting of IGF-1, IGF-2, IGFL1, IGFL2, IGFL3 and IGFL4. Synthetic analogs can also be used. When present, insulin or IGF is in the differentiation medium in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (5 pg/mL ± 1 pg/mL).
As used herein, the term "Bone Morphogenic Protein" or "BMP" refers to a bone- derived factor capable of inducing ectopic bone formation and belonging to the Transforming Growth Factor (TGF- ) superfamily. Examples of BMPs include but are not limited to BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8 and BMP9. In some embodiments, the BMP is BMP7. When present, BMP such as BMP7 is in the
differentiation medium in an amount between 20 ng/mL and 80 ng/mL and in particular of 50 ng/mL of about 50 ng/mL (50 ng/mL ± 10 ng/mL).
As already explained, the differentiation medium implemented in the method of the present invention is particular because it comprises a TGF-P inhibitor.
As used herein, the term "TGF-P" has its general meaning in the art and refers to the Transforming Growth Factor-P which is a multifunctional cytokine belonging to the TGF superfamily. The TGF-P includes three different mammalian isoforms, namely TGF- Pl, TGF-P2 and TGF-P3.
As used herein, the term "TGF-P inhibitor" refers to a compound able to inhibits TGF-P gene expression or able to inhibit the activity of TGF-P (e.g. interactions with other partners). Such inhibitors are well-known in the art and comprise low molecular weight compounds, antibodies directed against TGF-P, single domain antibodies directed against TGF-P, aptamers, polypeptides such as a mutated TGF-P proteins or similar proteins without the function of TGF-P, inhibitors of TGF-P gene expression, small inhibitory RNAs (siRNAs), small double stranded RNA (dsRNA) or ribozymes. Thus, in some embodiments, the TGF-P inhibitor is a low molecular weight compound, an antibody directed against TGF-P, a single domain antibody directed against TGF-P, an aptamer, a polypeptide, an inhibitor of TGF-P gene expression, a small inhibitory RNA (siRNA), a small double stranded RNA (dsRNA) or a ribozyme.
In some embodiments, the TGF-P inhibitor is a low molecular weight compound, i.e. a small organic molecule (natural or not). The term "small organic molecule" refers to a molecule (natural or not) of a size comparable to those organic molecules generally used in pharmaceuticals. Preferred small organic molecules range in size up to about 10000 Da, more preferably up to 5000 Da, more preferably up to 2000 Da and most preferably up to about 1000 Da. In some embodiments, the TGF-P inhibitor is SB431542. As used herein, the term "SB431542" refers to 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)- l/7-imidazol-2-yl]benzamide (CAS number: 301836-41-9). In the differentiation medium, the TGF-P inhibitor is present in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (5 pg/mL ± 1 pg/mL).
In some embodiments, the differentiation medium comprises a mix of growth factors. In some embodiments, the mix of growth factors comprises at least two growthpromoting factors selected in the group comprising growth factors of the VEGF family, of the EGF family, of the FGF family or an insulin-like growth factor. In some embodiments, the mix of growth factors is provided by serum and in particular such as fetal serum as previously defined. In some embodiments, the mix of growth factors is provided by platelet lysate. For in vitro purposes, fetal bovine serum may be preferred. For in vivo purposes, platelet lysate may be preferred. In some embodiments, the mix of growth factors is added in an amount between 1% (v/v) and 3% (v/v) and in particular of about 2% (v/v) (i.e. 2% ± 0.5% (v/v)).
In some embodiments, the differentiation medium comprises a-MEM, a mix of growth factors, insulin or insulin-like growth factor, apo-transferrin, a bone morphogenic protein, and a TGF- inhibitor. In some embodiments, the differentiation medium consists essentially in a-MEM, a mix of growth factors, insulin or insulin-like growth factor, apotransferrin, a bone morphogenic protein, and a TGF-P inhibitor. In some embodiments, the differentiation medium comprises a-MEM, fetal serum, insulin or insulin-like growth factor, apo-transferrin, a bone morphogenic protein, and a TGF-P inhibitor. In some embodiments, the differentiation medium consists essentially in a-MEM, fetal serum, insulin or insulin-like growth factor, apo-transferrin, a bone morphogenic protein, and a TGF-P inhibitor. As used herein, the term "consist essentially in" means that the differentiation medium does not comprise any other active substance that has an effect on the differentiation of mesenchymal stroma/stem cells into brown/beige adipocytes. In some embodiments, the differentiation medium consists in a-MEM, fetal serum, insulin or insulin-like growth factor, apo-transferrin, a bone morphogenic protein and a TGF-P inhibitor. In some embodiments, the differentiation medium consists in a-MEM-ASP, fetal bovine serum, insulin, apo-transferrin, BMP7 and SB431542.
As used herein, the term "a-MEM" refers to a-Minimal Essential Medium. In some embodiments, a-MEM comprises in amino acids, sodium pyruvate, lipoic acid, vitamin B12, biotin and/or ascorbic acid. In some embodiments, a-MEM consists essentially in amino acids, sodium pyruvate, lipoic acid, vitamin B12, biotin and ascorbic acid. In some
embodiments, a-MEM consists in amino acids, sodium pyruvate, lipoic acid, vitamin B12, biotin and ascorbic acid. In some embodiments, the a-MEM is supplemented with amphotericin B and streptomycin/penicillin. In some embodiments, the a-MEM medium is supplemented by 0.1% (v/v) amphotericin B and 1% (v/v) streptomycin/penicillin. In some embodiments, the a-MEM is a-MEM-ASP.
As used herein, the term "apo-transferrin" refers to an iron free transferrin. Transferrins are single chain glycoproteins with two nonidentical iron-binding sites having a high affinity for ferric iron under physiological conditions. Transferrins are found in vertebrates and mediate the transport of iron through blood plasma. When not bound to iron, transferrin is known as "apo-transferrin". In some embodiments, apo-transferrin is present in the differentiation medium in an amount between 5 pg/mL and 15 pg/mL and in particular of about 10 pg/mL (i.e. 10 pg/mL ± 2 pg/mL).
In a particular embodiment, the differentiation medium implemented in the method of the present invention is deprived of intralipids® (CAS Number: 68890-65-3). It was not obvious before the present invention to implement a differentiation medium deprived of intralipids® all the more than Muller et al (Scientific Reports, 2019, 9, article No. 7250) discloses that such intralipids® promote adipogenesis. On the contrary, the present inventors have shown that a differentiation medium deprived of intralipids® increases significantly pseudo-vascular formation and BAT adipocyte differentiation in the cell aggregates embedded in the porous matrix such as a gel or a hydrogel. This advantage is particularly interesting for generating relevant models of adipose tissue, such as pre-vascularized brown/beige adipose tissue construct. In addition, it should be noted that the addition of adenylate cyclase activator(s) such as forskolin in the differentiation medium implemented in the invention is not mandatory to increase adipocyte browning.
In a particular embodiment, the differentiation medium implemented in the step c) of the method of the invention comprises or consists of:
- aMEM-ASP,
- fetal serum such as FBS in an amount between 1% (v/v) and 5% (v/v) and in particular of about 2% (v/v) (i.e. 2% ± 1%),
- insulin in an amount between 1 pg/mL and 10 pg/mL and in particular of about
5 pg/mL (i.e. 5 pg/mL ± 2 pg/mL),
- apo-transferrin in an amount between 5 pg/mL and 15 pg/mL and in particular of about 10 pg/mL (i.e. 10 pg/mL ± 2 pg/mL),
- a bone morphogenic protein such as BMP7 in an amount between 20 ng/mL and 80 ng/mL and in particular of about 50 ng/mL (i.e. 50 ng/mL ± 10 ng/mL), and
- a TGF-P inhibitor such as 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-l/7-imidazol- 2-yl]benzamide (SB431542) in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (i.e. 5 pg/mL ± 2 pg/mL).
Typically, the culture of the expanded embedded cells in the differentiation medium is carried out at step c) for at least 7 days, in particular at least 14 days and, more particularly, for about 21 days (i.e. 21 days ± 2 days).
In addition, the present inventors have identified a real synergistic effect using the differentiation medium as previously defined with a gel or a hydrogel and in particular a GelMA hydrogel. Indeed, when this differentiation medium is used with spheroids containing Stromal Vascular Fraction (SVF) cells, the latter do not differentiate into brown/beige adipocytes. On the contrary, the combination of spheroids containing "SVF" cells in a GelMA hydrogel and this differentiation medium makes it possible to obtain differentiated brown/beige adipocytes.
In a particular embodiment, the present invention concerns an in vitro method for preparing a three-dimensional pre-vascularized brown/beige adipose tissue construct comprising the steps of a) embedding at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells in a GelMA hydrogel; b) contacting said embedded cells obtained at step a) with an amplification medium such as defined in any one of the previously disclosed alternatives; and then c) contacting said expanded embedded cells obtained at step b) with a differentiation medium until obtaining a 3D vascularized brown/beige adipose tissue construct,
wherein said differentiation medium comprises at least one adipogenic agent and a TGF-P inhibitor and is as defined in any one of the previously disclosed alternatives.
In a more particular embodiment, the present invention concerns an in vitro method for preparing a three-dimensional pre-vascularized brown/beige adipose tissue construct comprising the steps of a) embedding at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells in a GelMA hydrogel; b) contacting said embedded cells obtained at step a) with an amplification medium comprising fetal bovine serum, Epidermal Growth Factor (EGF), basic fibroblast growth factor (basic FGF), long(R3)-IGF-l, VEGF 165, ascorbic acid, heparin and hydrocortisone; and then c) contacting said expanded embedded cells obtained at step b) with a differentiation medium until obtaining a 3D vascularized brown/beige adipose tissue construct, wherein said differentiation medium comprises or consists of:
- a MEM -ASP,
- fetal serum such as FBS in an amount between 1% (v/v) and 5% (v/v) and in particular of about 2% (v/v) (i.e. 2% ± 1%),
- insulin in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (i.e. 5 pg/mL ± 2 pg/mL),
- apo-transferrin in an amount between 5 pg/mL and 15 pg/mL and in particular of about 10 pg/mL (i.e. 10 pg/mL ± 2 pg/mL),
- a bone morphogenic protein such as BMP7 in an amount between 20 ng/mL and 80 ng/mL and in particular of about 50 ng/mL (i.e. 50 ng/mL ± 10 ng/mL), and
- a TGF-P inhibitor such as 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-l/7-imidazol- 2-yl]benzamide (SB431542) in an amount between 1 pg/mL and 10 pg/mL and in particular of about 5 pg/mL (i.e. 5 pg/mL ± 2 pg/mL).
Three-dimensional (3D) vascularized brown/beige adipose tissue constructs and uses thereof
Another aspect of the invention relates to a 3D pre-vascularized brown/beige adipose tissue construct obtained with the in vitro methods as previously described.
As already explained, when in the step a) of the method, only a single cell population comprising mesenchymal stroma/stem cells and endothelial cells is used, the three-dimensional pre-vascularized brown/beige adipose tissue construct thus obtained comprise one single zone with organized endothelial network among brown/beige adipocytes in the porous matrix such as a gel or a hydrogel. This construct is sub- millimetric i.e. the higher size of this construct is less than 1 mm.
On the contrary, when in the step a) of the method, at least two different cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells are used, the three-dimensional pre-vascularized brown/beige adipose tissue construct thus obtained comprise at least two different zones with organized endothelial networks among brown/beige adipocytes in the porous matrix such as a gel or a hydrogel. This construct is millimetric to centimetric i.e. the higher size of this construct is more than 1 mm and less than 1 cm. It should be noted that, after differentiation, the endothelial networks become continuous between the different zones in this construct.
Brown/beige tissue transplant.
In a first aspect, the present invention relates to at least one 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention for use in the treatment of a metabolic disorder. According to this first aspect and in some embodiments, the treatment comprises at least one 3D pre-vascularized brown/beige adipose tissue construct to be transplanted.
In some embodiments, the present invention relates a method of treating a subject suffering from a metabolic disorder comprising administering to said subject a therapeutically effective amount of at least one 3D pre-vascularized brown/beige adipose tissue construct.
As used herein, the term "metabolic disorder" denotes a state that negatively alters the body's processing and distribution of macronutrients such as proteins, fats and carbohydrates. It occurs when abnormal chemical reactions in the body alter the normal
metabolic process. As example, metabolic disorders include type 2 diabetes, impaired glucose tolerance, obesity, insulin resistance, dyslipidemia, non-alcoholic hepatic syndrome (NASH), hypertension and cardiovascular diseases. Thus, in some embodiments, the metabolic disorder is selected from the group consisting of type 2 diabetes, impaired glucose tolerance, obesity, insulin resistance, dyslipidemia, NASH, hypertension and cardiovascular diseases.
In addition to be associated with cardiometabolic health, emerging findings highlight that brown/beige adipose tissues may have roles in additional pathophysiological contexts including cancers, massive burn and inflammatory diseases. Accordingly, in some embodiments, the present invention relates to a method of treating a subject suffering from a disease selected in the group consisting of cancers, massive burn and inflammatory diseases comprising administering to said subject a therapeutically effective amount of at least 3D pre-vascularized brown/beige adipose tissue construct.
As used herein, the terms "treating", "treatment" or "therapy" refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subject at risk of contracting the disease or suspected to have contracted the disease as well as subject who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. In some embodiments, the term "treatment" particularly refers to the preventive treatment of a metabolic disorder, in particular with a cell based-therapy comprising at least one 3D vascularized brown/beige adipose tissue construct. The treatment may be administered to a subject having a medical disorder or a subject likely to suffer from the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment.
By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is
used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of a cell based-therapy to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the cell based-therapy than a physician would employ during a maintenance regimen, administering a cell based- therapy more frequently than a physician would administer the cell based-therapy during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a cell based-therapy at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).
As used herein the terms "administering" or "administration" refer to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., at least one 3D pre-vascularized brown/beige adipose tissue construct) into the subject, such as by mucosal, intradermal, subcutaneous delivery and/or any other method of physical delivery described herein or known in the art. When a disease, or a symptom thereof, is being treated, administration of the at least one 3D vascularized brown/beige adipose tissue construct typically occurs after the onset of the disease or symptoms thereof. When a disease or symptoms thereof, are being prevented, administration of the at least one 3D pre-vascularized brown/beige adipose tissue construct typically occurs before the onset of the disease or symptoms thereof.
As used herein, the term "efficient" denotes a state wherein the administration of at least one 3D pre-vascularized brown/beige adipose tissue construct to a subject permit to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or to prolong the survival of a subject beyond that expected in the absence of such treatment. A "therapeutically effective amount" is intended for a minimal amount of cell-based therapy which is necessary to
impart therapeutic benefit to a subject. For example, a "therapeutically effective amount" to a subject is such an amount which induces, ameliorates or otherwise causes an improvement in the pathological symptoms, disease progression or physiological conditions associated with or resistance to succumbing to a disorder. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; at least one 3D pre-vascularized brown/beige adipose tissue construct used in combination or coincidental with another specific compound employed; and like factors well known in the medical arts. For example, it is well-known within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.
In another embodiment, the present invention relates to at least one 3D vascularized brown/beige adipose tissue construct generated with the methods of the present invention for use in adipose-tissue transplantation.
In some embodiments, the adipose-tissue transplantation is an autologous tissue transplantation. As used herein, the term "autologous tissue transplantation" denotes a procedure in which a subject's own tissue is collected to replace or sustain the activity of his damaged tissue.
In some embodiments, the adipose-tissue transplantation is a allogenic tissue transplantation. As used herein, the term "allogenic tissue transplantation" denotes a procedure in which a first subject tissue is collected to replace or sustain the activity of the damaged tissue of a second subject different from the first one.
The 3D pre-vascularized brown/beige adipose tissue construct can be as example introduced in a therapeutic composition for adipose-tissue transplantation.
In other words, the present invention relates to a method for performing an adipose-tissue transplantation in a subject comprising administering to said subject at
least one 3D pre-vascularized brown/beige adipose tissue construct or a therapeutic composition comprising at least one 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention.
In addition, the present invention also relates to a therapeutic composition comprising at least one 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention. In some embodiments, the invention relates to a therapeutic composition comprising at least one 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention for use in the adipose-tissue transplantation as previously defined and/or in the treatment of a metabolic disorder or a disease as previously defined in a subject in need thereof.
Advantageously, the therapeutic compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The doses used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, or alternatively of the desired duration of treatment. Pharmaceutical compositions of the present invention may comprise a further therapeutic active agent.
Intermediate construct obtained after step b) of the method according to the invention
Another aspect of the invention relates to the construct obtained after step b) of the in vitro methods as previously described. Thus the construct consists of at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells embedded in a porous matrix and expanded.
This intermediate construct may comprise a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells embedded in a porous matrix and expanded.
Alternatively, this intermediate construct may comprise at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells embedded in a porous matrix and expanded.
Method of screening compounds that modulates brown/beige adipose tissue
In a second aspect, the 3D pre-vascularized brown/beige adipose tissue construct generated with the methods of the invention can be used as a search tool in an in vitro method of screening compounds that modulates brown/beige adipocyte activity.
Accordingly, in some embodiments, the present invention relates to an in vitro method of screening compounds that modulate brown/beige adipocyte activity comprising contacting either a 3D pre-vascularized brown/beige adipose tissue construct according to the invention or an intermediate construct according to the invention with a candidate compound, and monitoring the effect of said candidate compound on the activity of brown/beige adipocytes in said construct. In a more particular embodiment, the in vitro method of screening a candidate compound comprises the steps of: a) optionally measuring the level of at least one marker into a 3D pre-vascularized brown/beige adipose tissue construct of the invention or generated with the methods of the invention or an intermediate construct according to the invention or obtained after step b) as previously defined;
P) contacting said 3D pre-vascularized brown/beige adipose tissue construct or said intermediate construct with said candidate compound and then measuring the level of said at least one marker into said 3D pre-vascularized brown/beige adipose tissue construct or in said intermediate construct; y) comparing the level measured at step |3) (i.e. after the contact with said compound suspected to modulate tissue activity) with the level measured at step a) (i.e. before the contact with said candidate compound) or with a predetermined reference
value whether or not said candidate compound is capable of modulating the brown/beige adipose tissue activity.
In some embodiments, the predetermined reference value is relative to a number or value derived from studies, as example, led on cells or tissues of subjects, including without limitation, subjects of the same or similar age range, subjects in the same or similar ethnic group, and subjects having the same severity of lesion. Such predetermined reference values can be derived from statistical analyses and/or risk prediction data obtained from mathematical algorithms and computed indices.
Said measurement of the level of at least one marker may involve as example intercalating agents or fluorescent dyes in techniques well-known to those skilled in the art. As example, said level can be measured at the transcriptomic or protein level.
In some embodiments, the marker is a survival marker assessing cell viability (e.g. propidium iodide). In some embodiments, the marker is brown/beige adipocyte markers such as, for example, UCP1, cell death-inducing DFFA-like effector A (CIDEA) and Peroxisome proliferator-activated receptor-y coactivator (PGCla).
In a particular embodiment, the in vitro methods of screening a compound that modulates brown/beige adipose tissue activity is used for screening a compound increasing UCP1 expression in said 3D pre-vascularized brown/beige adipose tissue construct. Thus, in some embodiments, the in vitro method comprises a further step consisting in monitoring UCP1 expression.
In another particular embodiment, the in vitro methods of screening a compound that modulates brown/beige adipose tissue activity is used for screening compounds increasing the mitochondrial activity in said 3D pre-vascularized brown/beige adipose tissue construct. Thus, in some embodiments, the in vitro method comprises a further step consisting in monitoring mitochondrial activity.
In another particular embodiment implementing said intermediate construct, the in vitro methods of screening a compound that modulates brown/beige adipose tissue activity is used for screening compounds favouring or inhibiting the differentiation of mesenchymal stroma/stem cells into beige adipocytes.
In the in vitro methods of screening candidate compounds, the 3D prevascularized brown/beige adipose tissue construct or the intermediate construct can be used as an organ-on-a-chip. In this technology, both constructs may be cultured in a small chip. An organ-on-a-chip can be used to study in detail the behavior of pre-vascularized brown/beige adipose tissue and the mechanism of physicochemical reactions in microenvironment, and can be used as a model for drug toxicity and efficacy evaluation in new drug development.
Kit for generating 3D vascularized brown/beige adipose tissue constructs
In another aspect, the present invention relates to kit for producing 3D prevascularized brown/beige adipose tissue construct comprising (i) at least one differentiation medium such as previously defined and (ii) a solution comprising at least one gel precursor compound such as previously defined.
All what has previously been disclosed for the solution and the gel precursor compound(s) applies to the kit containing them. In some embodiments, the solution (ii) comprises at one photocrosslinkable polymer and a photoiniator.
In particular, the kit of the invention further comprises an amplification medium such as previously defined. In particular, the kit of the invention further comprises an amplification medium such as previously defined and an anti-adhesive support such as previously defined.
More particularly, the kit comprises (i) at least one differentiation medium such as previously defined, (ii) a GelMA solution such as previously defined, (iii) an amplification medium such as previously defined and optionally (iv) an anti-adhesive support such as previously defined.
Other characteristics and advantages of the present invention will additionally be apparent to the one skilled in the art on reading the examples below, which are given as an illustration and not a limitation, with reference to the attached figures.
FIGURES
Figure 1: GelMA hydrogel processing and mechanical properties characterization A) Scheme of spheroid embedding process in GelMA. Briefly, once formed spheroids were collected and mixed with GelMA/0.1% LAP solution. Spheroids were pipetted individually in 1.5 or 3 pL of GelMA and droplets containing spheroids were dispensed on an antiadhesive PDMS surface before crosslinking with 405 nm light. Droplets were further collected and maintained in 24-wells ultra-low adherence plates. B) Mechanical characterization of GelMA 15%, 10%, 8% and 5% depending on photo-polymerization duration. Youngs moduli of the hydrogels were calculated according to their stress strain curves (n=5). Poisson's ratio was 0.5. Compression speed was 5 mm/min until 20% deformation. Data were obtained once samples were formed (Day 0) and after samples were kept in PBS at 37°C in a CO2 incubator for a week (Day 7). Data are shown as mean +/- standard deviation. C) SEM image of GelMA 10% cross sections. Bottom image shows higher magnification of white squared area from the top image.
Figure 2: Optimal GelMA embedding parameters to promote cell mass expansion. After formation, PO-SVF spheroids were either embedded in 3 or 1.5 pl of GelMA 15%, 10%, 8%, 5%. Spheroid morphology inside hydrogel was observed after seven days in EGM2 proliferation medium and compared to spheroid maintained without GelMA (Spheroid alone). A) Representative brigthfields images of whole GelMA-spheroid droplets and spheroid alone at day 7. B) Immunofluorescence confocal images of DAPI staining (cell nuclei) to assess spheroid morphology depending on GelMA percentage and droplet volume. Images are z projection from top to bottom confocal slices of spheroids inside hydrogel. Yellow dashed lines highlight the delimitation of the GelMA droplet. C) Average DNA content per embedded spheroid. Data are expressed relatively to spheroid alone. D) Quantification of spheroid area inside hydrogel from confocal z-projection. All quantitative values are shown as mean +/- standard deviations. Statistical differences between GelMA embbeded conditions and spheroid alone were analysed by one sample t test. Statistical significances: * p<0.05, ** p<0.01.
Figure 3: GelMA embedding promotes beige adipogenesis and vascular formation while preserving long-term cell maintenance. Spheroids embedded (G10%) or
not (sph.) in GelMA 10% were analyzed at day 21 of differentiation in C2+SB4 medium. A) Average DNA content per spheroid with (n=6) or without GelMA (n=6). B) Immunofluorescence images of propidium iodide () and DAPL C) Quantification of dead cells percentage inside spheroids from propidium iodide staining. Data are expressed as mean +/- standard deviation of independent experiments from four human donors. Statistical analysis was performed by two sample t-tests. D) Immunofluorescence images of adipocytes and pseudo-vascular organization within embedded PO-SVF spheroids at day 21. Lipids-containing cells were stained with bodipy while endothelial cells and pericytes were revealed by CD31 and aSMA stainings respectively. White squared image is a zoomed area showing endothelial cells organization inside spheroids. Scales : 200 pm. E) Gene expression analysis of brown adipocytes markers (UCP1, CIDEA, PGCla) and generic adipocyte markers (PPARg2, FABP4, ADIPOQ) in spheroids (n=8) and G10% embedded spheroids (n=8) after 21 days of differentiation. Folds are relatively expressed to nonembedded undifferentiated spheroids. Statistical analysis was performed on -Ct values by two sample t-test. * p<0.05. F) Relative mitochondrial DNA (mt-DNA) level was quantified using qPCR by amplification of ND1 and mt-DNA genes belonging to stable part of mtDNA and normalized against -actine gene encoded by nuclear genome. mtDNA/nDNA ratio is expressed relatively to undifferentiated spheroids. Significant differences of mtDNA/nDNA ratio in spheroids embedded (n=3) or not (n=3) in GelMA 10% compared to undifferentiated spheroid was analyzed on -Ct value by one sample t-test. Statistical significance: * p<0.05.
Figure 4: Activation of beige adipose organoids by UCP1 canonical inducers. Spheroids embedded in GelMA 10% were differentiated for 21 days in adipogenic medium with SB431542 and treated (Ind) or not (Ctrl) with UCP1 inducers for the last three days of culture. A) Evaluation of lipolysis measured as glycerol release from embedded spheroids stimulated or not with cAMP (n=3). B) Gene expression analysis of brown adipocytes markers (UCP1, CIDEA, PGCla). Fold changes are relatively expressed to Ctrl condition as mean +/- standard deviation (n=6). C) Expression of UCP1 protein of embedded spheroids under control (Ctrl) or induction (Ind) condition derived from four different donors. Murine brown adipose tissue (BAT) from wild type (WT) and UCP1 KO
mouse were used as positive and negative control respectively. Total protein assay was used as a loading control. Quantification of UCP1 expression normalized to total protein signal. Fold change is relatively expressed to control condition (n=4). D) Immunofluorescence images of UCP1 staining (green) on cryosections of embedded spheroids. Lipids-containing cells were revealed by perilipin staining (red) and all cell nuclei by DAPI staining. Scale bar: 200 pm. White squared images show areas at higher magnifications where UCP1+ cells (white arrowheads) could be observed. Scale: 50 pm. E) Evaluation of basal (left) and uncoupled cell respiration (right) from embedded spheroids at day 21 of differentiation under control or induction condition with Seahorse XF24. OCR is expressed in percentage of maximal respiration (n=5). F) Measure of glucose uptake and lactate release during the three days of treatment (n=6). G) Determination of Meteorin-like, IL-6, GDF15 and CXCL14 secretions of embedded spheroids (n=6). For all the evaluations of molecules concentrations in culture media (glycerol and lactate release, glucose uptake, Mtrln, IL6, GDF15 and CXCL14 secretions) data were normalized by DNA quantity/spheroid. All quantitative data are expressed as mean +/- standard deviation. Statistical analysis of fold change to control was performed by one sample t- test while statistical analysis for means comparisons was performed by paired two sample t-test. Statistical significances: * p<0.05, ** p<0.01, *** p<0.01, **** p<0.0001.
Figure 5: Combination of TGF-P inhibition and GelMA embedding unlocks beige adipogenesis and promotesvascular formation from SVF cells. A-E) Spheroids obtained directly from freshly isolated human stromal vascular fraction were embedded or not in GelMA 10% and analyzed at day 21 of differentiation in adipogenic medium with SB431542. A) Immunofluorescence images of propidium iodide (Dead cells in red) and DAPI (all cell nuclei in blue) stainings. Scale bar: 200 pm. B) Quantification of dead cells percentage inside spheroids from propidium iodide staining. Statistical analysis was performed by two sample t-tests. B) Average DNA content per spheroid with or without GelMA (n=5). C) Immunofluorescence images of adipocytes and pseudo-vascular organization within embedded PO-SVF spheroids at day 21. Lipids-containing cells were stained with bodipy (yellow) while endothelial cells and pericytes were revealed by CD31 (green) and aSMA (red) stainings respectively. White squared image is a zoomed area
showing endothelial cells organization inside spheroids. Scales: 200 pm. D) Gene expression analysis of brown adipocytes markers (UCP1, CIDEA, PGCla) and generic adipocyte markers (PPARg2, FABP4, ADIPOQ) in spheroids embedded or not in GelMA (n=8) after 21 days of differentiation. Folds are relatively expressed to non-embedded undifferentiated spheroids. E-G) To assess browning potential, GelMA 10% embedded SVF spheroid were treated (Ind) or not (Ctrl) with UCP1 inducers for the last three days of differentiation. E) Gene expression analysis of brown adipocytes markers (UCP1, CIDEA, PGC1). Fold changes are relatively expressed to control (n=3). F) Analysis of UCP1 protein expression by ProteinSimple capillary electrophoresis immunoassay. Wild type mouse brown adipose tissue (BAT UCP1 +/+) and UCP1 KO mouse brown adipose tissue (BAT UCP1 KO) were used as positive and negative control respectively. G) Evaluation of basal (left) and uncoupled cell respiration (right) from embedded spheroids at day 21 of differentiation under control or induction condition with Seahorse XF24. OCR is expressed in percentage of maximal respiration (n=3). All quantitative data are expressed as mean +/- standard deviation. Statistical analysis of fold change to control was performed by one sample t-test while statistical analysis for means comparisons was performed by paired two sample t-test. Statistical significances: * p<0.05, ** p<0.01, *** p<0.01, **** p<0.0001.
Figure 6: Generation of beige adipose micro-tissue by multispheroid assembly in GelMA A) Schematic view of the engineering process to generate multi-spheroid tissue construct. B) Macroscopic view of spheroid deposition in the PDMS mold and GelMA multispheroid construct after demolding. Dotted lines highlight the contours of the GelMA construct. Scale: 2.5 mm. C) Gene expression analysis of beige adipocytes markers (UCP1, CIDEA, PGCla) and adipocyte markers (PPARg2, FABP4, ADIPOQ) in individually embedded spheroids (lsp) compared to multi-spheroid construct (14 sp) at the end of the culture process. Folds are relatively expressed to non-embedded undifferentiated spheroids (DO) (n=4). D) Immunofluorescence staining of embedded multi-spheroid P0- SVF construct at the end of the culture process. Lipids-containing cells were stained with bodipy while endothelial cells were revealed by CD31. DAPI staining highlight cell nuclei. Scale bar: 1000 pm. The right image depicts magnify area. Scale bar: 200 pm. E-G)
Assessment of embedded multi-spheroid construct (14sp) response to UCP1 inducers in comparison to individually embedded spheroids (lsp). For each type of construct, cells were treated or not (Ind vs Ctrl) with UCP1 inducers for the last three days of culture. E) Gene expression analysis of brown adipocytes markers (UCP1, CIDEA, PGCla). Fold changes are relatively expressed to non-embedded undifferentiated spheroids (DO) (n=4). F) UCP1 protein expression of multi-spheroid (14sp) and individual embedded spheroid (lsp) under control and induction conditions derived from two different donors. Wild type (WT) and UCP1 KO mouse brown adipose tissue (BAT) were used as positive and negative control respectively. Total protein assay was used as a loading control. G) Quantification of UCP1 expression normalized to total protein signal. Fold change is relatively expressed to lsp Ctrl condition (n=2-3). All quantitative data are expressed as mean +/- standard deviation. Statistical analysis for means comparisons was performed by two samples t-test or one-way ANOVA. Statistical significances: ns. non-significant, * p<0.05, ** p<0.01
EXAMPLE
Material & Methods
Human donors for adipose tissues biopsies
Human Stromal Vascular Fraction (SVF) was isolated from abdominal dermolipectomy (plastic surgery department, CHU Toulouse, France) of female donors (body max index ranging from 22.3 to 27.9 kg/m2). The experimental protocols were approved by the French research ministry's institutional ethics committee (No: DC-2015- 23-49) and informed consent was obtained from all subjects in accordance with institutional guidelines on human tissue handling and use.
Isolation and amplification of stromal-vascular fraction cells from human adipose tissue
Adipose tissue was mechanically dissociated and enzymatically digested for 45 min at 37°C, under stirring, using collagenase NB4 (Coger, Germany) at 13.6 U/mL in a-MEM (Life-Technologies, UK), supplemented with 0.1% (v/v) amphotericin B (Life-Technologies,
UK), and 1% (v/v) streptomycin/penicillin (Life-Technologies, UK) hereafter named aMEM-ASP. After filtration on a 100 pm nylon net filter (Steriflip, Millipore, USA) and centrifugation (600g, 10 min), cells were washed in aMEM-ASP and centrifuged again (600g, 5 min). Cell pellet was resuspended in erythrocyte lysis buffer (eBioscience™ RBC Lysis Buffer Multi-species, Life-Technologies, UK) and incubated 5 min at RT to eliminate erythrocytes. Isolated Stromal Vascular Fraction cells (SVF-cells) were then centrifuged (600g, 5 min) and resuspended in EGM2 (PromoCell, Germany) supplemented with ASP. Final cell solution was counted using a Malassez cell and seeded directly in suspension for spheroid formation or at 4000 cells/cm2 in two-dimension (2D) culture for further amplification. 2D cultures were maintained in EGM2, medium was changed every three days until they reached 80% confluency. The resulting amplified cells (PO-SVF) were used for spheroid formation or adipocyte differentiation in 2D cultures.
Hydrogel preparation
GelMA synthesis
A solution of porcine skin gelatin type A (110 bloom, Sigma, USA) was prepared in 0.25 M carbonate-bicarbonate (CB) buffer. CB comprised 0.075 mol sodium carbonate and 0.175 mol sodium bicarbonate in 1 L of dH2O. Then, pH of the buffer was adjusted to 9 by using 5 M sodium hydroxide or 6 M hydrochloric acid. Initially, gelatin (20%, w/v) was dissolved in CB buffer at 60°C for 1-2 h. Then solution was cooled to 50°C and methacrylic anhydride (Sigma, USA) was added to the gelatin solution under magnetic stirring for 3h at 50°C (methacrylic anhydride/gelatin feeding ratio: O.l mL/l g). Afterwards pH was readjusted to 7.4 to terminate the reaction. The resultant solution was filtered and dialysed (MW CO 10,000) against distilled water for 3 days at 40°C to remove the excess methacrylic acid and salts. Dialysate was changed every 12h. This solution was lyophilized for 3 days and stored at 4°C until further use (Shirahama et al, Science Reports, 2016, 6, 31036). The degree of methacyloyl substitution was quantified to be 63% using 1H-proton magnetic resonance spectroscopy.
GelMA preparation
A solution of GelMA at 5, 8, 10 or 15% w/v, with photoinitiator lithium phenyl- 2,4,6-trimethyl-benzoylphosphinate (LAP, Sigma, USA) at 0.1% w/v, was prepared by dissolving lyophilized GelMA in D-PBS and kept at 4°C until use.
GelMA rheological characterization
The conservation modulus of GelMA hydrogels was obtained using a mechanical tester (Mark-10 ESM, USA). The system was operated with a 5 N load cell at a displacement speed of 5 mm/min speed with 20% deformation threshold. GelMA solutions prepared as described above were introduced in cylindrical molds (6 mm in diameter x 4 mm in thickness) and crosslinked by exposing to 405 nm light (Formlabs, USA) at room temperature for various durations (10 s - 3 min). The samples were kept in PBS for 8h before testing. Conservation moduli of hydrogels were calculated from the slope of the very first linear region of the stress-strain curve. The evolution of the mechanical properties were also investigated by performing mechanical tests 7 days (immersion in PBS at 37°C) after preparation (n=5).
Electron microscopy
Hydrogels samples were frozen in liquid nitrogen, lyophilized for 6h and sputter coated with Au (10 nm). Morphology was analysed with a Scanning Electron Microscope (Hitachi S-4800S-4800, Japan). Dimensional analysis of porosity and pore sizes was performed with Image J software (NIH).
Preparation of anti-adhesive PDMS surface and molds for GelMA molding
PDMS molds were prepared by casting on 3D printed templates. 3D templates were obtained by stereolithography using a DWS 29J+ system (DWS, Italy) and DL260 photoresist (DWS, Italy). Once fabricated, the 3D templates were treated using FluoroDecyltrochloroSilane (FDTS) after SiO2 coating using the SPD system. PDMS (Sylgard 184, Dow Corning) was prepared in a 10:1 (Base:Curing agent) ratio, degassed under vacuum and poured on the 3D printed mold. Crosslinking of PDMS was performed for 2h at 60°C. Then, PDMS molds were removed manually from the templates. PDMS molds were then incubated overnight at RT with an anti-adhesive treatment using 20 mg/mL pluronic F127 (Sigma, USA) followed by three washes in D-PBS and air-drying
before use. For GelMA droplet formation, flat pluronic-coated PDMS surface were prepared samely by pooring PDMS in petri dish. After curing, pluronic treatment was performed without further removal of the PDMS.
Animals
C57BI/6J UCP1 deficient mice kindly provided by Leslie Kozak (Enerback et al, Nature, 1997, 387, 90-94) and their wild type littermates were housed in a controlled environment (12h light/dark cycles at 21°C) with unrestricted access to water and a standard chow diet, in pathogen-free animal facility. All experimental procedures were done in compliance with French Ministry of Agriculture regulations for animal experimentation. At the time of sacrifice (10 weeks old animals), brown adipose tissues were dissected, snap frozen in liquid nitrogen and stored at -80°C until protein extraction for ProteinSimple capillary immunoassay.
Generation of beige adipose tissue spheroids and culture
Spheroid formation
Spheroids were formed from either PO-SVF cells or from SVF cells. To promote cell aggregation, 50 000 cells were seeded in small volume (50 pL) of EGM2 medium in ultralow attachment (ULA) 96-well round-bottom plates (Corning Incorporated Lifes Sciences, USA) and maintained overnight under stirring (150 rpm). For SVF cells, to further improve cell aggregation, cell seeding step was followed by plate centrifugation (600g for 5 min). The following day, 150 pL of EGM2 was added in each well. Cells were maintained in proliferation medium until spheroid formation, i.e. five days for SVF-spheroids and one day for PO-SVF-spheroids.
Individual spheroid embedding
To generate GelMA embedded spheroids, once formed, spheroids were mixed with pre-warmed GelMA/0.1% LAP solution (37°C, 10 min). Spheroids were then individually pipetted in a defined volume of GelMA/0.1%LAP solution and dispensed on an anti-adhesive PDMS surface, prepared as described above. GelMA droplets containing one spheroid were then photocrosslinked via exposure to 405 nm light for 40 seconds
(Form cure, Formlabs, Germany). Embedded spheroids were individually transferred in 24-wells flat bottom ULA plate (Corning Incorporated, Lifes Sciences, USA) in 1 mL of EGM2 medium. Embedded spheroids were maintained in EGM2 proliferation medium for seven days before differentiation. Half of the medium was changed every two to three days.
Multispheroid construct generation
GelMA was poured in an appropriate PDMS mold. One spheroid was handled using a manual aspiration method and positioned in the middle of the mold microwell filled with GelMA. When all the spheroids were correctly positioned, GelMA was cured (40 seconds with 405 nm light). The GelMA multipsheroid construct was unmolded before the culture process.
Spheroid handling was performed by aspiration of the spheroid using a microneedle. 27 G or 30 G metallic needle was mounted on a plastic syringe and connected to a vacuum source with pressures varying from 0 to 100 m Bar below the atmospheric pressure (Pa). For that purpose a MFCS or Flow easy system (Fluigent SA, France) was connected to the syringe and controlled manually. Spheroids were taken by aspiration from a suspension in a culture medium, maintained at the tip of the microneedle by aspiration and finally released into the structure of the PDMS or GelMA molds by switching the aspiration pressure to Pa.
Adipocyte cell differentiation from 3D cultures
For all types of culture, cells were differentiated for 21 days with appropriate adipogenic cocktails. Half of the medium was changed every three to four days. Differentiation onset varied according to the type of cultures. For spheroids in absence of GelMA hydrogel, differentiation was initiated once spheroids were formed. Finally for GelMA embedded spheroids, either individually or in multiple constructs, differentiation was initiated after a proliferation phase of 7 days in EGM2 medium.
As a reference for white adipocyte differentiation, a standard adipogenic cocktail was used (Standard Cocktail). This standard cocktail consists of aMEM-ASP supplemented with 2% Fetal Bovine Serum (FBS, Life technologies, UK), 1 pM dexamethasone (Sigma, USA), 60 pM indomethacin (Sigma, USA), 2 pM rosiglitazone (Sigma, USA), 5 pg/mL
insulin (Sigma, USA). 450 pM 3-isobutyl-l-methylxanthine (IBMX, Sigma, USA) was also added for the first three days of culture only. The inventors also used an adipogenic cocktail previously described by their team (Muller et al, 2019) to be compatible for both endothelial cells (ECs) maintenance and white adipocyte differentiation. This cocktail, referred to in the text as adipogenic Cocktail 1 (Cl), consists of aMEM-ASP supplemented with 2% FBS, 5 pg/mL insulin, 10 pg/mL apotransferrin (Sigma, USA), 50 ng/mL bone morphogenetic protein 7 (BMP7, MiltenyiBiotec, France) with 0.2% intralipids (20% emulsion, Sigma, USA). A variation of adipogenic Cocktail 1 deprived from intralipids was also tested and is referred to as adipogenic Cocktail 2 (C2). When specified, the TGF|3 pathway inhibitor SB431542 (MiltenyiBiotec, Germany), also referred to as SB4, was added to the adipogenic cocktail at a concentration of 5 pg/mL.
Cell viability assay
Spheroid size measurements
Imaging of spheroid size was performed during the culture process at indicated times using a Nikon eclipse TE2000-5 microscope with a 10X objective. Spheroid area was measured using Fiji software (National Institutes of Health, USA). Six to eight spheroids were measured for each time point per human sample. lodure propidium staining
A 3D image-based cell viability quantification was conducted by staining free spheroids and embedded spheroids with 10 pg/mL propidium iodide (Invitrogen, USA) in culture medium for one hour at 37°C. After three DPBS washes, samples were fixed with 4% paraformaldehyde. The fixed cultures were permeabilized and stained with DAPI as described above. Samples were washed three times with D-PBS (30 min, RT) and cleared at least for 48h with Scale S4 solution before imaging. All samples were imaged using a confocal microscope (LSM 880, Carl Zeiss, France).
Optical slices were taken from the surface at 4.5 pm intervals, up to the depth of 200 pm (spheroids) or 400 pm (GelMA embedded spheroids) and presented as a vertical projection. For each optical slice, total number of nuclei and IP+ nuclei were quantified using imageJ. The average viability percentage was calculated as the number of IP+
nuclei/DAPI+ nuclei per slice. Prior to nuclei counting, DAPI signal was segmented using 2D Stardist pluging (Schmidt et al, Proceedings Part II, 2018, 265-273), a deep-learning- based method of 2D nucleus detection. Three spheroids or GelMA embedded spheroids were measured for each condition per human sample.
DNA quantification
DNA quantification was performed to assess cell proliferation and maintenance. DNA was extracted from an average of 24 spheroids or five GelMA embedded spheroids according to the blood and tissue DNA extraction kit (Qiagen) manual. Spheroids were washed with D-PBS and lysed in 200 pL ALT /Proteinase K buffer overnight under mixing (800 rpm). To ensure the DNA purity, RNase A (Qiagen) was added to the samples and incubated for 2 min at RT before addition of 1:1 AL/100% ethanol mix. DNA was detected with the lx Qubit™ High sensitivity dsDNA kit according to manufacturer's instructions. Fluorescent intensities were measured with Qubit 4.0 fluorometer (Invitrogen, CRCT, Toulouse). Data were expressed as DNA quantity/spheroids (ng).
RNA extraction and quantitative relative real time PCR
Cell samples were homogenized in QIAzol Lysis Reagent (Qiagen, USA). 3D culture samples were further disrupted for 2 min at 30 Hz using Tissue Lyser (Qiagen). Total RNA was isolated using Phenol-chloroform extractions followed by Quick-RNA microprep kit procedure (Zymo Research, USA) and reverse transcribed into cDNA using high capacity cDNA reverse transcription kit (Applied Biosystems, USA). qPCR was performed on StepOne system (Applied Biosystems, USA) using Fast SYBR Green Master Mix supplemented with l/10e diluted cDNA and 300 nM of primers listed in hereinafter Table
1.
Gene Sequence (5' -3')
CGTCCTCGTGGAAGTGACAT
Forward
(SEQ ID NO: 1 in the appended sequence listing)
RPLP0
TAGTTGGACTTCCAGGTCGC
Reverse
(SEQ ID NO: 2 in the appended sequence listing)
GUSB Forward AGCCAGTTCCTCATCAATGG
(SEQ ID NO: 3 in the appended sequence listing)
GGTAGTGGCTGGTACGGAAA
Reverse
(SEQ ID NO: 4 in the appended sequence listing)
GCCGAGGAAAACCGTGTACTAT Forward
(SEQ ID NO: 5 in the appended sequence listing)
PPIA
TCTTTGGGACCTTGTCTGCAA
Reverse
(SEQ ID NO: 6 in the appended sequence listing)
AGCAGGCTGAGCGATATGAT
Forward
(SEQ ID NO: 7 in the appended sequence listing)
TCTCAGCACCTTCCGTCTTT Reverse
(SEQ ID NO: 8 in the appended sequence listing)
AAACTGGTGGTGGAATGCGT
Forward
(SEQ ID NO: 9 in the appended sequence listing)
FABP4
GCGAACTTCAGTCCAGGTCA
Reverse
(SEQ ID NO: 10 in the appended sequence listing)
GATACACTGTCTGCAAACATATCA Forward
(SEQ ID NO: 11 in the appended sequence listing)
PPARGv2
CACGGAGCTGATCCCAA
Reverse
(SEQ ID NO: 12 in the appended sequence listing)
CAGAGATGGCACCCCTGGTG
Forward
(SEQ ID NO: 13 in the appended sequence listing)
ADIPOQ
TTCACCGATGTCTCCCTTAG
Reverse
(SEQ ID NO: 14 in the appended sequence listing)
GTGTGCCCAACTGTGCAATG
Forward
(SEQ ID NO: 15 in the appended sequence listing)
CCAGGATCCAAGTCGCAAGA Reverse
(SEQ ID NO: 16 in the appended sequence listing)
AGTCCTGTTGACCCCGCTC
Forward
(SEQ ID NO: 17 in the appended sequence listing)
CIDEA
GCTATTCCCGACCTCTTCGG
Reverse
(SEQ ID NO: 18 in the appended sequence listing)
CCGCACGCACCGAAA
Forward
(SEQ ID NO: 19 in the appended sequence listing)
PGCl-a
TCGTGCTGATATTCCTCGTAGCT
Reverse
(SEQ ID NO: 20 in the appended sequence listing)
GGAAAGCTGTCCCTGATGC
Forward
(SEQ ID NO: 21 in the appended sequence listing)
CD31
CATCTGGCCTTGCTGTCTAA
Reverse
(SEQ ID NO: 22 in the appended sequence listing)
GATGGAGTCCAGCACCAGTT vWF Forward
(SEQ ID NO: 23 in the appended sequence listing)
GCTACTTCACACAGGCCACA
Reverse
(SEQ ID NO: 24 in the appended sequence listing)
CTATGCCTCTGGACGCACAACT
Forward
(SEQ ID NO: 25 in the appended sequence listing) aSMA CAGATCCAGACGCATGATGGCA
Reverse
(SEQ ID NO: 26 in the appended sequence listing)
GCTAACCCCCTCCCCAGCCA
Forward
(SEQ ID NO: 27 in the appended sequence listing)
COL1 GAGCAGGAGCCGGAGGTCCA
Reverse
(SEQ ID NO: 28 in the appended sequence listing)
TGCCCGGGAAATGCTGCGAG
Forward
(SEQ ID NO: 29 in the appended sequence listing)
CTGF CAGTCGGTAAGCCGCGAGGG
Reverse
(SEQ ID NO: 30 in the appended sequence listing)
AGGGTATCTGGGCTCTGG
Forward
(SEQ ID NO: 31 in the appended sequence listing)
NuD GGCTGAAAAGCTCCCGATTAT
Reverse
(SEQ ID NO: 32 in the appended sequence listing)
AGAGCTACGAGCTGCCTGAC Forward
(SEQ ID NO: 33 in the appended sequence listing) Nu-B-actine
AGCACTGTGTTGGCGTACAG Reverse
(SEQ ID NO: 34 in the appended sequence listing)
CCCTAAAACCCGCCCACATCT
Forward , , , , ,
(SEQ ID NO: 35 in the appended sequence listing) mt-NDl GAGCGATGGTGAGAGCTAAGGT Reverse (SEQ ID NO: 36 in the appended sequence listing)
ACACCCTCCTAGCCTTACTAC Forward
(SEQ ID NO: 37 in the appended sequence listing) Mt-DNA
GATATAGGGTCGAAGCCGC Reverse
(SEQ ID NO: 38 in the appended sequence listing)
Table 1: List of primers used for qPCR and qRT-PCR analyses
Relative gene expression was calculated by the 2-AACT method. The ACt was obtained by normalizing mean expression values of each gene to the geometric mean of the reference genes, Ribosomal Protein Lateral Stalk Subunit P0 (RPLPO), Glucuronidase
Beta (GUSB), Peptidylprolyl Isomerase A (PPIA) and Tyrosine 3-
Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Zeta (YWAZ). The AACt was calculated by normalizing conditions to 2D undifferentiated cells for 2D experiments or to non-embedded undifferentiated spheroids for 3D culture experiments.
Immunofluorescence analysis
2D and 3D cultures were fixed with 4% paraformaldehyde at RT. In the case of 3D culture, after D-PBS washing, samples were permeabilized and blocked in D-PBS solution supplemented with 1% Triton X-100 (Sigma, USA) and 3% horse serum (Jackson Immunoresearch, UK) for 3h at RT. Samples were then incubated with primary antibody in D-PBS solution supplemented with 1% horse serum and 1% Triton X-100, at the appropriate dilution, overnight at RT. The hereinafter Table 2 gives a list of antibodies and dyes used for immunofluorescence imaging of beige/brown adipocytes, endothelial cells and myofibroblast-related markers.
Type Name Dilution Company Cat. No.
Anti-Human CD31 Rabbit Epitomics (Burlingame,
1:200 AC-0083A monoclonal (Clone: EP78) USA)
Anti-Human CD31 Mouse Dako-Agilent (Paris,
1:200 M0823 monoclonal (Clone: JC70A) France)
Primary Anti-perilipine Guinea pig Progen
1:100 GP29 antibodies polyclonal (Heidelberg, Germany)
Anti-aSMA mouse Dako-Agilent (Paris,
1:100 M0851 monoclonal (Clone: 1A4) France)
Anti-human/mouse UCP1 R&D Systems Biotechne
1:500 MAB6158 monoclonal mouse lgGzB (Mineapolis, USA)
Alexa Fluor 488 Goat anti- Life technologies
1:500 A11008 rabbit IgG (Paisley, UK)
Alexa Fluor 594 Goat anti- Life technologies
1:500 A21207 rabbit IgG (Paisley, UK)
Secondary
Alexa Fluor 647 Goat antiantibodies Life technologies
Guinea Pig IgG Highly Cross- 1:500 A21450
(Paisley, UK)
Adsorbed
Alexa Fluor 594 Goat anti- Life technologies
1:500 A11005 mouse IgG (Paisley, UK)
BODIPY™ 493/503
(4,4-Difluoro-l,3,5,7,8- Life technologies
1:500 D3922
Pentamethyl-4-Bora-3a,4a- (Paisley, UK)
Diaza-s-lndacene)
Dyes DAPI (4',6-Diamidino-2-
Life technologies Phenylindole, 1:5000 D1306
(Paisley, UK) Dihydrochloride)
Propidium Iodide solution in Life technologies
1:100 P3566 water 1.0 mg/mL (Paisley, UK)
Table 2
After three washes in D-PBS, secondary antibodies coupled with Alexa-488, Alexa- 594 or Alexa-647 (Life Technologies, UK), diluted at 1:500 in D-PBS supplemented with 1% horse serum and 1% Triton X-100 were added as specified, 3h at RT. For lipid droplets staining, 2 pg/mL 493-Bodipy (Life Technologies, UK) was added to the solution. After D- PBS washes, nuclei were stained with 2 pg/mL DAPI, lh at RT (Sigma, USA). For 3D culture imaging, samples were cleared for at least 48h in Scale S4 solution (Hama et al, Nat. Neurosci., 2011, 14, 1481-1488) composed of 40% (w/v) D-(-)-Sorbitol (Sigma, USA), 10% (w/v) glycerol (Euromedex, France), 4 M Urea (Sigma, USA), 0.2%Triton X-100, 20% (v/v) Dimethylsulfoxide (Sigma, USA). Samples were analyzed by confocal imaging (LSM 880, Carl Zeiss, France) and images were processed using Fiji software (National Institutes of Health, USA).
ProteinSimple capillary immunoassay
For western analysis, 24 spheroids or 12 embedded spheroids were washed with PBS lx and resuspended in 100 pL of ice-cold RIPA buffer (Sigma, R0278) adjusted to 2% SDS and completed with anti-protease and phosphatase inhibitors. For protein extraction from mouse tissues, 1 mL/100 mg of complete RIPA buffer was used. Samples were mechanically dissociated with precellys tissue homogenizer at 4°C. Protein lysates were then transferred in other tubes and sonicated with an ultrasonic homogenizer two times for 30s in ice at 20kHz. Samples were centrifuged 10 min at 10000 rpm and whole protein
cell extracts were quantified by Lowry method. Samples were run with proteinSimple capillary electrophoresis immunoassay according to the ProteinSimple user manual. Briefly, protein extracts (1.5 to 3 ng/well) were mixed with 40 mM dithothreitol (DTT) and master mix (ProteinSimple). Samples were heated at 95°C for 5 min and dispensed in a designated plate along with blocking reagent, primary antibodies HRP-conjugated secondary antibodies, chemiluminescent substrate and total protein detection reagents. All electrophoresis and immunodetection steps were realized automatically within the capillary system (ProteinSimple Jess). Chemiluminescent intensities were quantified with Compass software (ProteinSimple) and normalized to total protein signal.
Lipolysis assay
A lipolysis assay measuring glycerol release was conducted on embedded spheroids after differentiation using Free Glycerol Reagent kit (Sigma) according to manufacturer's recommendations. At the end of the differentiation protocol embedded spheroids were transferred in 96 wells ULA plate in 90 pL phenol red free DMEM medium supplemented with 5 mM glucose. Following 24h of lipolysis stimulation with 200 pM 8 cpt-AMPc, 20 pL of media was collected and added to the reaction mix. After 15 min incubation, absorbance was read at OD 540 nm, and glycerol released was calculated using a standard curve. Four days prior to the experiment, adipogenic medium was depleted in insulin to prevent lipolysis inhibition. Data are normalized to DNA quantity.
Metabolic functionality
Lactate and glucose measurements
Extracellular levels of lactate and glucose were measured after treatments with UCP1 inducers to assess the change in metabolic activity of embedded spheroids. Lactate and glucose levels were measured with the Lactate Pro II test meter (Arkray) and Contour XT TS (Bayer) respectively. To account for increase of molecules concentrations that could arise from medium evaporation, differences in glucose and lactate levels were calculated in comparison to evaporation control wells without cells. Data are normalized to DNA quantity.
Seahorse metabolic assay
Metabolic profiling of embedded spheroids was performed by evaluating oxygen consumption rate (OCR) of cells with Seahorse XF24 Extracellular Flux Analyzer (Seahorse Biosciences) in XF24 islet capture plate. Two embedded spheroids were placed in a well of an islet capture microplate (Agilent). Once in position, culture medium was replaced by 500 pL of assay XF Seahorse DMEM media supplemented with 2 mM glutamine, 10 mM glucose and 1 mM pyruvate. Embedded spheroids were incubated 45 min in a CO2 free incubator at 37°C prior to metabolic analysis. During Seahorse XF cell Mito stress run, cells were first exposed to 200 pM 8cpt-AMP to assess for adrenergic stimulation.
Sequential injections of inhibitors of key components of cellular respiration were used to determine metabolic parameters such as basal, maximal or uncoupled respiration. First, 3 pM oligomycin was added to inhibit ATP synthase and reveal uncoupled respiration. Then, 3 pM of uncoupler FCCP was added to induce maximal respiration. Finally, a mix of 3 pM rotenone and 3 pM antimycin A which inhibit complexes I and III in the electron transport chain was added to determine the non- mitochondrial respiration.
Basal respiration was calculated by subtracting non-mitochondrial respiration to OCR obtained before oligomycin injection. All values were expressed in percentage of maximal respiration. Five human samples were analyzed. For each condition five wells were used to measure mean OCR values from each human donor.
Measurement of organoid protein secretions
Levels of secreted IL6, Meterorin-like, GDF15 and CXCL14 were measured using ELISA. Medium was collected at the end of the culture process and stored at -80°C. IL6, Meterorin-like, GDF15 and CXCL14levels were determined using commercial ELISA kits (R & D Systems, Minneapolis, USA, # D6050, # DY7867-05, # DY957; Ray Biotech, Peachtree Corners, USA, # ELH-CXCL14 respectively). Medium that has not been in contact with cells was used as a detection control for ELISA assays. Data are normalized to DNA quantity.
Statistical analysis
All results are presented as mean values of independent experiments, each from a different donor, ± standard deviation. The data were analyzed for normal distribution with Kolmogorow-Smirnow test and homoscedasticity with Levene test. Significant differences among groups were evaluated with two samples t-test students or one-way analysis of variance (ANOVA-l) type III followed by post hoc analysis with Tukey's multiple comparison test. Significant fold differences compared to a reference control set to one were analyzed by one sample t-test. For qPCR analysis, statistical tests were performed on -AACt values as previously described (Stahlberg et al, Methods, 2013, 59, 80-88). p- values < 0.05 were considered significant.
Results
GelMA embedding process for cell mass
To find a suitable biomechanical environment ensuring cell mass expansion after embedding DO spheroid inside GelMA (Figure 1A), different parameters of hydrogel embedding were studied (Figures 1-2). GelMA stiffness was tuned by varying gel percentage and photopolymerization time (Figure 1). Up to 10% (w/v) GelMA percentage and one minute cross-linking duration, stiffness of hydrogel alone remained below 8 kPa, within the range of beige adipose tissue stiffness, and appeared stable after 7 days in culture (Figure IB).
To generate stable reticulated GelMA droplets for spheroid embedding while limiting exposition to free radical and subsequent phototoxicity, a short crosslinking duration (40 seconds) was privileged. This duration generated hydrogels with Young's modulus ranging from 2 to 30 kPa (5%: 1.97 ± 0.4, 8%: 4.02 ± 1.07, 10%: 6.11 ± 0.15, 15%: 30.36 ± 3.49) (Figure IB).
Scanning electron microscope images of GelMA hydrogel cross sections highlighted the presence of interconnected and macro-porous structures within 10% GelMA hydrogel photopolymerized for 40 seconds (Figure 1C).
In combination to GelMA stiffness, the impact of the hydrogel volume for spheroid embedding was considered to promote cell survival and expansion (Figure 2A). Brightfield images revealed an important collapse of the hydrogel after 7 days of culture with 1.5 pl
of GelMA 5% (Figure 2A). Total DNA content was measured to account for total cell expansion (Figure 2B).
In addition, evolution of the initial spheroid in the different conditions was studied by evaluating internal cell mass expansion area with DAPI staining (Figure 2D). Except for GelMA 5%, the DNA content was significantly higher in the presence of the hydrogel compared to spheroid alone, regardless of hydrogel volume.
Between the different droplet volumes, the 1.5 pl was the most suitable volume to maintain high DNA content independently of hydrogel composition (Figure 2C). When internal cell mass expansion was estimated for these conditions, the highest internal mass expansion was observed for 10% GelMA. Overall, these results identified the combination of 1.5 pl and 10% GelMA as the best one and the latter was used in the following experiments.
Generation and functional characterization of PO-SVF derived vascularized beige adipose organoid
The effect of GelMA embedding on long-term cells maintenance of PO-SVF cells and differentiation was investigated (Figure 3A). GelMA embedding promoted the generation of tissue construct with increased cell number compared to non-embedded spheroids, as demonstrated by DNA quantification (Figure 3B) associated with almost no dead cells detected by PI staining (Figure 3C). Interestingly, this result was also true in absence of TGF|3 inhibition.
Regarding beige adipocyte differentiation and vascular formation, PO-SVF cells embedded in GelMA maintained their potential to differentiate into adipocytes in the presence of TGF|3 inhibition with a similar increase in expression of adipocyte markers such as PPARy2, FABP4 and ADIPOQ compared to spheroids alone (Figure 3D). Interestingly, expression of beige adipocyte markers, including UCP1 and CIDEA was significantly higher in embedded conditions compared to spheroids alone (Figure 3D). Hence, GelMA embedding promoted ASC differentiation toward the beige adipocyte phenotype while increasing the cell mass expansion.
Immunofluorescence experiments after differentiation confirmed the presence of adipocytes stained by Bodipy. These adipocytes were found in close proximity to endothelial CD31+ cells aligned with aSMA+ (Figure 3E) in contrast to what could be observed in spheroids alone where adipocytes and endothelial cells compartments were present at different locations within the spheroid. Therefore, GelMA embedding promoted the generation of vascularized beige adipose organoid more closely recapitulating in vivo-like adipose tissue cell organization. Then, the functionality of the vascularized beige adipose organoids at the end of the culture process was assessed.
Treating differentiated embedded spheroids with cAMP significantly increased glycerol release within the supernatant, highlighting the responsiveness of embedded spheroids to cAMP-induced lipolysis (Figure 4A). Treatment of differentiated embedded spheroids with a cocktail of inducers containing cAMP, rosiglitazone (PPARy agonist), retinoid acid and thyroid hormone (T3), strongly increased UCP1, CIDEA and PGCla mRNA levels (Figure 4B) demonstrating adipocytes sensitivity to canonical beiging inducers. This increase was concomitant with an increase in UCP1 protein content (Figure 4C) compared to untreated embedded spheroids where almost no UCP1 protein could be detected. The presence of UCP1 protein in perilipin expressing adipocytes was confirmed by immunofluorescence analysis (Figure 4D).
To go further into the functional metabolic characterization, oxygen consumption rate (OCR) of differentiated organoids was quantified using seahorse technology. The contribution of basal respiration to maximal respiration tended to increase after UCP1 induction, suggesting that cells were metabolically closer to their maximal oxidative capacities (Figure 4E). Although the extemporaneous addition of cAMP did not further increase basal OCR, the contribution of uncoupled respiration to maximal respiration was significantly increased in response to the UCP1 cocktail of inducers (Figure 4E), as expected for mature beige adipocytes. Additionally, differentiated embedded spheroids exhibited increased glucose uptake and lactate release after activation with the UCP1 cocktail inducers (Figure 4F).
Finally, the secretion of batokines known to be released by activated brown/beige adipocytes such as Meteorin-like, IL6, GDF15 or CXCL14 were quantified within organoid
supernatants. Significantly higher levels of Meteorin-like, IL6 and CXCL14 were increased in the supernatant of beige organoids activated with the cocktail of inducers compared to control (Figure 4G) whereas GDF15 amount was within the same range for both conditions. Altogether, these data clearly demonstrated that differentiated embedded spheroids displayed many metabolic and paracrine features of a functional beige adipose tissue.
Generation of vascularized beige adipose organoid from native stromal-vascular fraction cells
The SVF obtained directly after adipose tissue digestion contains heterogeneous cell populations comprising ASC, endothelial progenitors but also hematopoietic cells. SVF model recapitulate more closely patient tissue heterogeneity as compared to amplified PO-SVF. The generation process of beige adipose tissue organoids was evaluated using SVF cells directly isolated from native adipose tissue.
As observed with PO-SVF cells, GelMA embedding significantly decreased cell mortality of SVF cells after 21 days of differentiation compared to spheroids cultivated without hydrogel (Figure 5A) for which dead cell percentage was even higher than in PO- SVF spheroids at day 21 (SVF: 3.76%+/-1.82, Figure 5A vs PO-SVF: 1.29%+/-l-07, Figure 3A, two samples t.test: p = 0.058).
Besides, GelMA embedding promoted more homogeneous and slightly increased DNA quantity in embedded SVF spheroids compared to SVF spheroid alone (Figure 5B). Considering the differentiation process, contrary to PO-SVF cells, the adipogenic medium containing the TGF|3 pathway inhibitor was not sufficient to induce robust adipocyte differentiation from SVF cells in 3D spheroid model without hydrogel as revealed by low mRNA levels of adipocytes markers FABP4, PPARG2 and ADIPOQ (Figure 5C) and by the scarcity of Bodipy staining (Figure 5D). Interestingly, combination of GelMA embedding with TGFP inhibition led to a significant increase in gene expression of adipogenesis and beige adipocytes markers (Figure 5C).
Immunofluorescence analysis performed on differentiated embedded SVF spheroids revealed the presence of adipocytes in between CD31+ and aSMA+ cell
networks (Figure 5D). The beiging potential of SVF beige adipose organoid was then assessed.
Treatment of SVF organoids with the cocktail of UCP1 inducers led to a significant increase in gene expression of beige adipocyte markers UCP1, CIDEA and PGCla (Figure 7D). Increase of UCP1 at the protein level was also detected in SVF organoid with induction compared to control (Figure 5F), although its overall expression remained rather low compared to PO-SVF cells.
These results validated the feasibility to generate adipose organoids containing UCP1 expressing cells from SVF cells using the developed GelMA embedding engineering approach. Further metabolic characterization of SVF beige adipose organoid by cell respiration analysis showed that basal oxygen consumption rate and uncoupled respiration of SVF cells was comparable to PO-SVF cells which might be inferred to the overall low UCP1 protein expression.
Generation of vascularized beige adipose micro-tissue
Translation of beige organoid generation process to the macro-scale level was then investigated using PO-SVF cells to engineer beige adipose micro-tissue of centimetric size. For this purpose, the inventors introduced a guided-assembly approach of multiple DO spheroids in GelMA using micro-fabricated PDMS molds composed of 14 cavities (Figure 6A). This mold was especially designed to preserve the GelMA volume per spheroid established for beige adipose organoid generation. Thanks to a syringe-based aspiration system, DO spheroids were successfully deposited in the center of the cavities before photo-polymerization and complete removal of the construct from the mold (Figure 6B). As for embedded spheroids (1 spheroid hereafter named lsp), the resulting embedded multi-spheroid constructs (14sp) were submitted to a 7 days proliferation phase followed by 21 days of differentiation in adipogenic medium with SB431542.
At the end of the culture process, gene expression of both adipogenesis and beige adipocyte markers of PO-SVF cells cultivated as embedded multi-spheroid constructs (14sp) were nearly similar to those of embedded spheroids (lsp) (Figure 6C). Besides, Bodipy staining revealed the abundant presence of adipocytes on most of the tissue
construct, surrounded by a continuous network of CD31+ cells connecting all different cavities (Figure 6D) truly recapitulating in vivo-like adipose tissue structure. To further confirm beige adipocyte identity of the cells, treatment with UCP1 inducers were performed on differentiated embedded multi-spheroids. As for embedded spheroids, the UCP1 inducers cocktail reproducibly led to an increased gene expression of beige adipocyte markers compared to the control condition in embedded multi-spheroids (Figure 6E). Increase of UCP1 expression was further confirmed at the protein level (Figure 6F) in a comparable manner to individually embedded spheroids. Taken together, these results demonstrated that GelMA embedding could be translated from individual to multiple spheroids strategy for the generation of centimetric size tissue construct without hindering the beige adipocyte differentiation. Moreover, using such approach, vascular formation could be driven throughout the structure resulting in the generation of a pre-vascularized beige adipose micro-tissue. Interestingly, this beige adipose micro-tissue mostly conserved its initial shape and size of 20 mm2 remaining easy to handle for further use after 28 days of culture.
Claims
1) An in vitro method for preparing a three-dimensional pre-vascularized brown/beige adipose tissue construct comprising the steps of a) embedding at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells in a porous matrix; b) contacting said embedded cells obtained at step a) with an amplification medium; and then c) contacting said expanded embedded cells obtained at step b) with a differentiation medium until obtaining a 3D pre-vascularized brown/beige adipose tissue construct, wherein said differentiation medium comprises at least one adipogenic agent and a TGF-P inhibitor.
2. The in vitro method according to claim 1, wherein said at least one cell aggregate is at least one spheroid derived from Stromal Vascular Fraction (SVF) or from amplified SVF (PO-SVF).
3. The in vitro method according to claim 1 or 2, wherein said amplification medium comprises or consists of fetal bovine serum, Epidermal Growth Factor (EGF), basic fibroblast growth factor, long(R3)-IGF-l, VEGF 165, ascorbic acid, heparin and hydrocortisone.
4. The in vitro method according to any one of claims 1 to 3, wherein said differentiation medium comprises or consists of:
- a IVIE M- ASP,
- fetal serum such as FBS in an amount between 1% (v/v) and 5% (v/v),
- insulin in an amount between 1 pg/mL and 10 pg/mL,
- apotransferrin in an amount between 5 pg/mL and 15 pg/mL,
- a bone morphogenic protein such as BMP7 in an amount between 20 ng/mL and
80 ng/mL, and
- a TGF-P inhibitor such as 4-[4-(l,3-benzodioxol-5-yl)-5-(2-pyridinyl)-l/7-imidazol- 2-yl]benzamide (SB431542) in an amount between 1 pg/mL and 10 pg/mL.
5. The in vitro method according to any one of claims 1 to 4, wherein said porous matrix is a gel.
6. The in vitro method according to claim 5, wherein said gel is a gelatin methacryloyl (GelMA) hydrogel.
7. The in vitro method according to claim 5 or 6, wherein said step a) implements a single cell aggregate comprising stroma/mesenchymal stem cells and endothelial cells and consists in i) taking a volume of a solution comprising at least one gel precursor compound and a single cell aggregate comprising stroma/mesenchymal stem cells and endothelial cells; then ii) exposing said volume to conditions allowing the formation of a gel from the at least one gel precursor compound thereby forming a gel in which is embedded a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells.
8. The in vitro method according to claim 5 or 6, wherein said step a) implements at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells and consists in: i') forming at least two gels in which is embedded a single cell aggregate comprising mesenchymal stem cells and endothelial cells, according to the method as defined in claim 7; ii') assembling the at least two gels using a biological adhesive thereby forming a gel such as an hydrogel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells.
9. The in vitro method according to claim 5 or 6, wherein said step a) implements at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells and consists in: i") covering an anti-adhesive support with a solution comprising at least one gel precursor compound; ii") depositing, on said solution, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; iii") repeating step ii”) at least once; iv”) optionally adding some solution comprising at least one gel precursor compound; and then v") exposing the whole to conditions allowing the formation of a gel from said at least one gel precursor compound thereby forming a gel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells.
10. The in vitro method according to claim 5 or 6, wherein said step a) implements at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells and consists in: i'") covering an anti-adhesive support with a solution comprising at least one gel precursor compound; ii'”) exposing said solution to conditions allowing the formation of a gel from said at least one gel precursor compound thereby forming a gel; iii'”) depositing, on said gel, a single cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells; and iv'”) repeating step ii'”) at least once, thereby forming a gel in which are embedded at least two cell aggregates comprising mesenchymal stroma/stem cells and endothelial cells; v'") optionally adding, to the whole, some solution comprising at least one gel precursor compound; and exposing it to conditions allowing the formation of a gel from said at least one gel precursor compound.
11. A 3D pre-vascularized brown/beige adipose tissue construct prepared by an in vitro method as defined in any one of claims 1 to 7, comprising one single zone with organized endothelial networks among brown/beige adipocytes in the porous matrix.
12. A 3D pre-vascularized brown/beige adipose tissue construct prepared by an in vitro method as defined in any one of claims 1 to 6 and 8 to 10, comprising at least two different zones with organized endothelial networks among brown/beige adipocytes in porous matrix.
13. A therapeutic composition comprising at least one 3D pre-vascularized brown/beige adipose tissue construct according to claim 11 or 12.
14. Method of treating a subject suffering from a metabolic disorder comprising administering to said subject a therapeutically effective amount of at least one 3D prevascularized brown/beige adipose tissue construct according to claim 11 or 12 or of the therapeutic composition according to claim 13.
15. Method for performing an adipose-tissue transplantation in a subject comprising administering to said subject at least one 3D pre-vascularized brown/beige adipose tissue construct according to claim 11 or 12 or a therapeutic composition according to claim 13.
16. A construct obtained after step b) of the in vitro methods as defined in claim 1 or 2, said construct consisting in at least one cell aggregate comprising mesenchymal stroma/stem cells and endothelial cells embedded in a porous matrix and expanded.
17. An in vitro method of screening compounds that modulate brown/beige adipocyte activity comprising contacting the 3D pre-vascularized brown/beige adipose tissue construct according to claim 11 or 12 or the construct according to claim 16 with a
candidate compound, and monitoring the effect of said candidate compound on the activity of brown/beige adipocytes in said construct.
18. A kit for producing 3D pre-vascularized brown/beige adipose tissue construct comprising (i) at least one differentiation medium such as defined in claim 1 or 4 and (ii) a solution comprising at least one gel precursor compound.
19. The kit according to claim 18, wherein it further comprises an amplification medium such as defined in claim 3.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP23305136 | 2023-02-02 | ||
| PCT/EP2024/052547 WO2024160980A1 (en) | 2023-02-02 | 2024-02-01 | Method for preparing a 3d prevascularized adipose tissue construct, said 3d prevascularized adipose tissue construct and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4658763A1 true EP4658763A1 (en) | 2025-12-10 |
Family
ID=85321301
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24703035.6A Pending EP4658763A1 (en) | 2023-02-02 | 2024-02-01 | Method for preparing a 3d prevascularized adipose tissue construct, said 3d prevascularized adipose tissue construct and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4658763A1 (en) |
| WO (1) | WO2024160980A1 (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10335437B2 (en) * | 2012-08-10 | 2019-07-02 | The Trustees Of Columbia University In The City Of New York | Injectable brown adipose microtissues for treatment and prevention of obesity and diabetes |
| WO2017009263A1 (en) * | 2015-07-10 | 2017-01-19 | Etablissement Francais Du Sang | Method for obtaining human brown/beige adipocytes |
| FR3112558A1 (en) * | 2020-07-15 | 2022-01-21 | Centre National De La Recherche Scientifique (Cnrs) | IN VITRO OR EX VIVO AMPLIFICATION PROCESS OF BROWN OR BEIGE ADIPOCYTE STEM CELLS |
-
2024
- 2024-02-01 WO PCT/EP2024/052547 patent/WO2024160980A1/en not_active Ceased
- 2024-02-01 EP EP24703035.6A patent/EP4658763A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024160980A1 (en) | 2024-08-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhu et al. | Decellularized extracellular matrix for remodeling bioengineering organoid's microenvironment | |
| Qin et al. | Cell‐Laden scaffolds for vascular‐innervated bone regeneration | |
| KR102656200B1 (en) | Vascular organoids, methods of making and using said organoids | |
| Lee et al. | Development of liver decellularized extracellular matrix bioink for three-dimensional cell printing-based liver tissue engineering | |
| Duan et al. | Hybrid gel composed of native heart matrix and collagen induces cardiac differentiation of human embryonic stem cells without supplemental growth factors | |
| Liu et al. | Co-culture of human umbilical vein endothelial cells and human bone marrow stromal cells into a micro-cavitary gelatin-methacrylate hydrogel system to enhance angiogenesis | |
| Solorio et al. | Engineered cartilage via self-assembled hMSC sheets with incorporated biodegradable gelatin microspheres releasing transforming growth factor-β1 | |
| Guerrero et al. | Cell interactions between human progenitor-derived endothelial cells and human mesenchymal stem cells in a three-dimensional macroporous polysaccharide-based scaffold promote osteogenesis | |
| Lee et al. | The use of injectable spherically symmetric cell aggregates self-assembled in a thermo-responsive hydrogel for enhanced cell transplantation | |
| US11998658B2 (en) | Injectable porous hydrogels | |
| Hamilton et al. | A silk‐based encapsulation platform for pancreatic islet transplantation improves islet function in vivo | |
| EP2970882B1 (en) | Cell repopulated collagen matrix for soft tissue repair and regeneration | |
| CN105164250A (en) | Use of Perfused Decellularized Liver for Recellularization of Islet Cells | |
| KR102041360B1 (en) | Composition for promoting direct conversion comprising decellularized extracellular matrix and use thereof | |
| Guan et al. | Biodegradable dual-cross-linked hydrogels with stem cell differentiation regulatory properties promote growth plate injury repair via controllable three-dimensional mechanics and a cartilage-like extracellular matrix | |
| Yu et al. | Enhanced angiogenic potential of adipose-derived stem cell sheets by integration with cell spheroids of the same source | |
| Li et al. | Umbilical cord derived mesenchymal stem cell-GelMA microspheres for accelerated wound healing | |
| CN115105583A (en) | Preparation and application of cadherin fusion protein improved composite microsphere | |
| Tang et al. | Investigating the adipogenic effects of different tissue-derived decellularized matrices | |
| Zhu et al. | Cell–cell interactions enhance cartilage zonal development in 3D gradient hydrogels | |
| Kemaloğlu et al. | The optimal effective dose of adipose-derived stem cell exosomes in wound healing | |
| JP2013511314A (en) | Graft composition for nerve tissue regeneration and its manufacture and use | |
| Zhou et al. | Microsphere-composite hydrogel for recruiting stem cells and promoting osteogenic differentiation | |
| WO2024160980A1 (en) | Method for preparing a 3d prevascularized adipose tissue construct, said 3d prevascularized adipose tissue construct and uses thereof | |
| Komez et al. | A two-compartment bone tumor model to investigate interactions between healthy and tumor cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250812 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |