EP4658289A1 - Development of generation z (genz) single-stranded aav serotype vectors - Google Patents

Development of generation z (genz) single-stranded aav serotype vectors

Info

Publication number
EP4658289A1
EP4658289A1 EP24751101.7A EP24751101A EP4658289A1 EP 4658289 A1 EP4658289 A1 EP 4658289A1 EP 24751101 A EP24751101 A EP 24751101A EP 4658289 A1 EP4658289 A1 EP 4658289A1
Authority
EP
European Patent Office
Prior art keywords
sequence
genome
aav
raav
raav genome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24751101.7A
Other languages
German (de)
French (fr)
Inventor
Keyun Qing
Jakob SHOTI
Arun Srivastava
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Florida
University of Florida Research Foundation Inc
Original Assignee
University of Florida
University of Florida Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Florida, University of Florida Research Foundation Inc filed Critical University of Florida
Publication of EP4658289A1 publication Critical patent/EP4658289A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14121Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present disclosure is based at least in part on the realization that inefficient second- strand synthesis of single-stranded AAV genomes impedes efficient expression of transgenes delivered by AAV vectors.
  • Modification of D-sequences of inverted terminal repeats (ITRs) within AAV genomes can increase second-strand synthesis, and thereby improve various aspects of AAV packaging, replication, transduction efficiency, and transgene expression.
  • ITRs inverted terminal repeats
  • rAAV recombinant AAV
  • rAAV recombinant adeno-associated virus genomes
  • an rAAV genome comprises a heterologous nucleotide T18934 Attorney Docket No.
  • the heterologous nucleotide sequence is (i) inserted within a first D- sequence of the rAAV genome, (ii) inserted within the rAAV genome at a position adjacent to a 3' or 5' end of the first D-sequence, or (iii) substituted in place of a portion of the first D- sequence in the rAAV genome, wherein the first D-sequence is proximal to the 3' terminus of the rAAV genome, and wherein the rAAV genome is single-stranded.
  • substitution of the heterologous nucleotide sequence in place of 5, 6, 7, 8, 9, 10, or more nucleotides at the 3' terminus of the first D-sequence does not substantially inhibit packaging of the rAAV genome.
  • the heterologous nucleotide sequence is substituted in place of a portion of the first D-sequence.
  • the heterologous nucleotide sequence is substituted in place of a portion of the first D-sequence, and wherein the portion of the first D-sequence: (i) is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length; and/or (ii) is equal in length to the heterologous nucleotide sequence.
  • the portion of the first D-sequence comprises consecutive nucleotides including the 3'-most nucleotide of the first D-sequence.
  • the heterologous nucleotide sequence comprises, consists of, or consists essentially of a sequence of 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • an rAAV genome further comprises a second heterologous nucleotide sequence, wherein the second heterologous nucleotide sequence is (i) inserted within a second D-sequence of the rAAV genome, (ii) inserted within the rAAV genome at a position adjacent to a 3' or 5' end of the second D-sequence, or (iii) substituted in place of a portion of the second D-sequence in the rAAV genome, wherein the second D-sequence is proximal to the 5' terminus of the rAAV genome.
  • the second heterologous nucleotide sequence is substituted in place of a portion of the second D-sequence.
  • the second heterologous nucleotide sequence is substituted in place of a portion of the second D-sequence, and wherein the portion of the second D- sequence: T18934 Attorney Docket No. U1202.70129WO00 (i) is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length; and/or (ii) is equal in length to the second heterologous nucleotide sequence.
  • the portion of the second D-sequence comprises consecutive nucleotides including the 5'-most nucleotide of the second D-sequence.
  • the second heterologous nucleotide sequence comprises, consists of, or consists essentially of a sequence of 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • the rAAV genome is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, or a combination thereof.
  • the rAAV genome is of serotype AAV2, AAV3, or AAV6.
  • the rAAV genome comprises AAV2 inverted terminal repeats (ITRs).
  • the rAAV genome further comprises a nucleic acid sequence comprising a gene of interest.
  • the gene of interest encodes a therapeutic agent and/or a diagnostic agent.
  • the rAAV genome further comprises a regulatory element.
  • the regulatory element comprises a promoter, an enhancer, a silencer, an insulator, a response element, an initiation site, a termination signal, or a ribosome binding site.
  • the promoter is a constitutive promoter.
  • the promoter is an inducible promoter.
  • the promoter is a tissue-specific promoter, a cell type-specific promoter, or a synthetic promoter.
  • the rAAV genome is at least 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb or more in length.
  • rAAV particles are provided herein.
  • an rAAV particle comprises an rAAV genome disclosed herein and a capsid.
  • the capsid comprises a modified capsid protein, wherein the modified capsid protein comprises an amino acid substitution at a position corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2.
  • the modified capsid protein comprises amino acid substitutions at positions corresponding to each of T491, Y444, T18934 Attorney Docket No. U1202.70129WO00 Y500, and Y730 of SEQ ID NO: 2, optionally wherein the amino acid substitutions correspond to T491V, Y444F, Y500F, and Y730F substitutions in SEQ ID NO: 2.
  • the capsid is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, or a combination thereof.
  • the capsid is of serotype AAVrh74.
  • plasmids comprising a nucleic acid sequence corresponding to an rAAV genome disclosed herein are provided.
  • compositions are provided herein, wherein the composition comprises an rAAV genome disclosed herein or a plasmid disclosed herein.
  • compositions are provided herein, wherein the composition comprises an rAAV particle disclosed herein.
  • a composition disclosed herein further comprises a pharmaceutically acceptable carrier.
  • methods comprising contacting a cell with a composition disclosed herein are provided.
  • the cell is a mammalian cell.
  • the contacting is in vivo.
  • the method further comprises administering the composition comprising the rAAV particle to a subject.
  • the cell is in the subject.
  • the subject is human.
  • the subject is at risk of or has been diagnosed with a disease, disorder, or condition.
  • the composition is administered to the subject by intravenous injection, by subcutaneous injection, by intramuscular injection, by intraperitoneal injection, or orally.
  • the contacting is in vitro or ex vivo.
  • FIG.1 shows a schematic of an inverted terminal repeat (ITR) at the 3' end of an AAV genome.
  • ITR inverted terminal repeat
  • FIG.2 shows a schematic for the preparation and assembly of an N10 sequence library, in which the proximal 10 nucleotides of the D-sequence (relative to the terminus of the genome) are replaced with random nucleotides (shown in bold in the nucleotide sequences). Sequences with N10 substitutions are prepared and processed using restriction enzymes, then assembled into pSub201 plasmids. After processing by EcoRV restriction enzyme, the N10 library is processed and rescue, replication, and packaging are evaluated. [0043] FIG.3 shows a schematic for a screen of the N10 sequence library, with different types of modifications in the left and right ITRs. Only the N10-L1 version of the library demonstrated AAV packaging.
  • FIG.4 shows a schematic of the plasmid used to generate GenZ vectors (top), with N10 sequences replacing the D10 sequences in both ITRs (cross-hatched boxes).
  • the plasmid and corresponding AAV genome comprise a chicken ⁇ -actin promoter (“CBAp”) operably linked to nucleic acid sequences encoding firefly luciferase (“FLuc”) and a yellow fluorescent T18934 Attorney Docket No. U1202.70129WO00 protein (“EYFP”) with a poly A tail (“pA”), situated between the N10-modified ITRs.
  • CBAp chicken ⁇ -actin promoter
  • EYFP firefly luciferase
  • pA poly A tail
  • FIG.5 shows a schematic of a GenZ ssAAV-CBAp-FLuc-EYFP vector. In the schematic, both ITRs are modified with the N10 substitution.
  • the schematic on the left side of the figure shows an overview of the vector for illustrative purposes, to show the overall structure rather than a specific sequence of the vector.
  • Each segment (indicated by a shaded block) in the schematic on the left side represents a different portion of an AAV genome, including the ITR, TRS-N10, and D10 segments, an enhancer segment, a promoter segment, an intron segment, a coding sequence segment (encoding firefly luciferase), a second coding sequence segment (encoding EYFP), a polyA tail segment, and second D10, N10-TRS, and ITR segments.
  • FIGs.6A and 6B show results of transduction of primary human skeletal muscle cells in vitro with GenZ ssAAV-CBAp-FLuc-EYFP vectors.
  • FIG.6A shows fluorescence micrographs of EYFP in mock-treated cells (left panel, “Mock”), cells treated with 3,000 viral genomes (vgs) per cell (middle panel, “3,000 vgs/cell”), and cells treated with 10,000 vgs per cell (right panel, “10,000 vgs/cell”).
  • FIG. 6B shows quantification of the transgene expression in the skeletal muscle cells, measured as EYFP-positive pixels 2 per visual field.
  • FIGs.7A and 7B show transduction efficiency of wild-type control (ssAAV-FLuc- EYFP) and GenZ (GenZ ssAAV-Fluc-EYFP) vectors in HeLa cells in vitro.
  • FIG.7A shows a fluorescence micrograph of EYFP in cells treated with the control vector (not comprising the GenZ genome modifications).
  • FIG.7B shows a fluorescence micrograph of EYFP in cells treated with the GenZ vector. The micrographs show about 20-fold higher transgene expression in the GenZ- treated cells relative to the control-treated cells.
  • FIGs.8A and 8B show transduction efficiency of wild-type control (ssAAV-FLuc- EYFP) and GenZ (GenZ ssAAV-FLuc-EYFP) vectors in C57BL6/J mice in vivo. Approximately 1x10 8 viral genomes (vgs) of each vector were administered intravenously via the tail vein and whole-body bioluminescence images were obtained 8 days after administration.
  • FIG.8A shows bioluminescence imaging of mice administered the control T18934 Attorney Docket No. U1202.70129WO00 vector (not comprising the GenZ genome modifications).
  • FIG.8B shows bioluminescence imaging of mice administered the GenZ vector.
  • FIGs.9A-9D show transduction efficiency of wild-type (WT, left panels) and GenZ (right panels) ssAAVrh74 (FIG.9A), AAV3 (FIG.9B), AAV2 (FIG.9C), and AAV6 (FIG. 9D) vectors in human HeLa cells in vitro.
  • Cells were transduced with each vector at 1,000 viral genomes (vgs)/cell and transgene expression was visualized via fluorescence microscopy 72 hours post-transduction.
  • FIG.10 shows transgene expression in HeLa cells transduced with wild-type (WT) or GenZ ssAAVrh74 vectors (3,000 vgs/cell), with pre-incubation (“Before”) or co-incubation (“During”) with AAVrh74 empty capsids (“+AAVrh74 empty capsids”), AAV2 empty capsids (“+AAV2 empty capsids”), AAV3 empty capsids (“+AAV3 empty capsids”), or AAV6 empty capsids (“+AAV6 empty capsids”).
  • WT wild-type
  • GenZ ssAAVrh74 vectors 3,000 vgs/cell
  • the present disclosure is based at least in part on the development of adeno-associated virus (AAV) genomes and particles useful in the delivery of various cargoes to cells, facilitating efficient transgene expression therein.
  • AAV adeno-associated virus
  • the disclosure relates, at least in part, to the finding that incorporation of sequence modifications into AAV genomes results in improvements in various characteristics of AAVs, such as packaging, transduction efficiency, transgene expression, etc. These improvements may result from increased second-strand synthesis of the AAV genome, resulting from modifications therein.
  • the AAV genomes, particles, etc., disclosed herein may be used in a variety of applications including but not limited to compositions and methods (e.g., therapeutic and diagnostic methods).
  • compositions comprising AAV particles (e.g., infectious AAV particles), AAV genomes (e.g., genomes comprising sequence modifications), and methods of using the compositions for transducing cells of interest (e.g., for treating or diagnosing a disease or condition in a subject.
  • AAV particles e.g., infectious AAV particles
  • AAV genomes e.g., genomes comprising sequence modifications
  • methods of using the compositions for transducing cells of interest e.g., for treating or diagnosing a disease or condition in a subject.
  • nucleic acid vectors e.g., AAV genomes, e.g., recombinant AAV (rAAV) genomes
  • rAAV recombinant AAV
  • a nucleic acid vector (e.g., an AAV genome) provided herein may comprise AAV inverted terminal repeat(s) modified to improve (e.g., increase the rate, efficiency, etc.) second- strand synthesis.
  • an ITR as provided herein is a 5' ITR, i.e. an ITR that is 5' from a transgene in a nucleic acid vector (e.g., an AAV genome).
  • An ITR serves as an origin of replication and is comprised of two arm palindromes (B-B' and C-C') embedded in a larger stem palindrome (A-A').
  • An AAV ITR can be in flip or flop configurations.
  • an ITR has the B-B' and the C-C' palindrome closest to the 3' end.
  • the D- sequence is present only once at each end of the genome thus remaining single-stranded.
  • the D-sequence is also referred to as the “D-element” in the art.
  • the D-sequence consists of 20 or approximately 20 (e.g., 19, 20, 21, 22, 23, 24, etc.) nucleotides adjacent to the terminal resolution site (trs), and generally consists or consists essentially of the medial 20 (or approximately 20) nucleotides of the ITR (where “medial” indicates the segment of the ITR that is adjacent to the center of the AAV genome).
  • the first nucleotide of the D-sequence is generally at position 126 or approximately position 126 from the terminus of the AAV genome.
  • a nucleic acid vector (e.g., an AAV genome) as provided herein comprises a first inverted terminal repeat (ITR) and a second ITR.
  • ITR inverted terminal repeat
  • the first ITR is modified.
  • the second ITR is modified.
  • a modification of an ITR comprises substitution of the entire D-sequence or substitution of part of a D-sequence.
  • a modification of an ITR comprises deletion of an entire D-sequence (e.g., the D-sequence of the left ITR or the right ITR) or deletion of part of a D-sequence (e.g., the proximal 10 nucleotides of the ITR, relative to the terminus of the nucleic acid vector).
  • a modification of an ITR may in some embodiments comprise deletion or substitution of 1-20 nucleotides of the D-sequence.
  • the proximal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides of the D-sequence, relative to the terminus of the nucleic acid vector are deleted or substituted.
  • the proximal 10 nucleotides of the D-sequence, relative to the terminus of the nucleic acid vector, are deleted or substituted.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in the middle of the D-sequence are deleted or substituted (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides beginning 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 3' or 5' end of the D-sequence).
  • the distal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides of the D- sequence, relative to the terminus of the nucleic acid vector are deleted or substituted.
  • the distal 10 nucleotides of the D-sequence, relative to the terminus of the nucleic acid vector are deleted or substituted.
  • a D-sequence comprises the sequence CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16) of the wild-type AAV2 ITR, or a corresponding sequence of a different serotype ITR.
  • a D-sequence is defined by the sequence CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16).
  • the substituted sequence may be any alternative sequence described herein, such as a sequence described as a “heterologous nucleotide sequence.”
  • a “heterologous” nucleotide sequence or nucleic acid sequence refers to a sequence that is not native to an AAV or naturally-occurring in an AAV.
  • a heterologous sequence can be a short sequence (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides in length, or of a similar length), or can be a longer sequence (e.g., about 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 nucleotides in length, or longer).
  • U1202.70129WO00 heterologous sequence can comprise a coding sequence (e.g., encoding a gene of interest) or can be a non-coding sequence (e.g., inserted in or replacing a regulatory or structural portion of an AAV nucleic acid, such as an AAV genome).
  • a nucleic acid vector e.g., an AAV genome
  • ITR inverted terminal repeat
  • a nucleic acid vector (e.g., an AAV genome) is encapsidated within an AAV capsid forming an AAV particle.
  • a nucleic acid vector disclosed herein is encapsidated by a wild-type AAV capsid disclosed herein or another AAV capsid disclosed herein, such as an AAV capsid comprising one or more amino acid substitutions.
  • a nucleic acid vector (e.g., an AAV genome) comprises native AAV genes or native AAV nucleotide sequences.
  • one or more native AAV genes or native AAV nucleotide sequences may be removed from a nucleic acid vector (e.g., an AAV genome). In some embodiments, one or more native AAV genes or native AAV nucleotide sequences may be removed from a nucleic acid vector (e.g., an AAV genome) and replaced with a gene or interest.
  • a nucleic acid vector (e.g., an AAV genome) can be of any AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, or AAVrh74, or a combination of serotypes.
  • a nucleic acid vector (e.g., an AAV genome) encapsidated within an AAV capsid forms a pseudotyped AAV particle, such that the genome is of a serotype distinct from the capsid in which it is encapsidated.
  • a nucleic acid vector (e.g., an AAV genome) of serotype AAV2 may be encapsidated within a capsid of serotype AAVrh74.
  • a nucleic acid vector e.g., an AAV genome
  • the first ITR refers to the ITR at the 5' terminus of the nucleic acid vector (e.g., AAV genome)
  • the second ITR refers to the ITR at the 3' terminus of the nucleic acid vector (e.g., AAV genome).
  • Each ITR in its native or wild-type form is or is about 145 nucleotides in length (e.g., about 140 nucleotides, about 145 nucleotides, about 150 nucleotides, about 155 nucleotides, about 160 nucleotides, or about 165 nucleotides) and comprises a D-sequence.
  • Each ITR can independently be of any AAV serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, T18934 Attorney Docket No.
  • U1202.70129WO00 AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, or AAVrh74), or both ITRs may be of the same serotype.
  • ITRs are described, for example, in Grimm et al. J. Virol. 80(1):426-439 (2006).
  • Exemplary left ITR sequences are provided below. In each ITR sequence, the D-sequence is underlined.
  • a right ITR has a nucleotide sequence which is the reverse complement of the corresponding left ITR (e.g., the AAV2 right ITR has a nucleotide sequence which is the reverse complement of the AAV2 left ITR).
  • Example of wild-type AAV1 left ITR TTGCCCACTCCCTCTCTGCGCTCGCTCGGTGGGGCCTGCGGACCAAAGGTCCGCAGACGGCAG AGGTCTCCTCTGCCGGCCCCACCGAGCGAGCGAGCGCGCAGAGAGGGAGTGGGCAACTCCATCACTAGG GGTAA (SEQ ID NO: 28)
  • Example of wild-type AAV2 left ITR TTGGCCACTCCCTCTCTGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCG GGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGG GGTTCCT (SEQ ID NO: 29)
  • Example of wild-type AAV3 left ITR TTGGCCACTCCCTCTATGCGCACTCGCTCGCTCGGTGGGGCCTGGCGACCAAAGGTCGCCAGACGGACG TGCTTTGCACGTCCGGCC
  • a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of an ITR.
  • a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of a left ITR.
  • a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of a right ITR.
  • a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of both a left ITR and a right ITR.
  • a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of either a left ITR or a right ITR, but not both (i.e., the nucleic acid vector comprises a modification of only one ITR).
  • the ITR sequence comprises a terminal sequence at the 5' or 3' end of the nucleic acid vector (e.g., AAV genome) which forms a palindromic double-stranded T-shaped hairpin structure, and an additional sequence which remains single-stranded (i.e., is not part of the T- shaped hairpin structure), termed the D-sequence.
  • the D-sequence of an ITR is typically approximately 20 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides located at the distal (relative to the terminus of the nucleic acid vector) end of the ITR (e.g., the 3' end of the ITR at the 5' end of the genome, or the 5' end of the ITR at the 3' end of the genome), and corresponds to the sequence of CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16) of the wild-type AAV2 left ITR or a corresponding sequence in an ITR of another serotype.
  • the D- sequence of an ITR in some embodiments comprises, consists essentially of, or consists of the nucleic acid sequence CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16) of the wild-type AAV2 left ITR or a corresponding sequence in an ITR of another serotype.
  • the D-sequence of an ITR e.g., the first ITR or the second ITR
  • a nucleic acid vector e.g., an AAV genome
  • the D-sequence of both ITRs of a nucleic acid vector (e.g., an AAV genome) disclosed herein is entirely or partially removed.
  • the D- sequence of an ITR (e.g., the first ITR or the second ITR) is entirely or partially replaced with a non-AAV sequence (i.e., a nucleotide sequence that is not from an AAV nucleic acid).
  • the D-sequence of an ITR (e.g., the first ITR or the second ITR) is entirely or partially replaced with a heterologous nucleotide sequence.
  • the heterologous nucleotide sequence comprises, consists essentially of, or consists of the nucleic acid sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: T18934 Attorney Docket No. U1202.70129WO00 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • the heterologous nucleotide sequence has at least 70% identity (e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity) with the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • identity e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least
  • the heterologous nucleotide sequence has less than 95% identity (e.g., less than 90% identity, less than 85% identity, less than 80% identity, less than 75% identity, or less than 70% identity) with the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • the heterologous nucleotide sequence has about 70% to about 95% identity (e.g., about 95% identity, about 90% identity, about 85% identity, about 80% identity, about 75% identity, or about 70% identity) with the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • the heterologous nucleotide sequence has fewer than 6 mismatches (e.g., fewer than 5, fewer than 4, fewer than 3, fewer than 2, 1, or no mismatches) relative to the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • mismatches e.g., fewer than 5, fewer than 4, fewer than 3, fewer than 2, 1, or no mismatches
  • the heterologous nucleotide sequence has 1, 2, 3, 4, 5, or 6 mismatches relative to the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • the heterologous nucleotide sequence has a length of or about 10 nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides).
  • a heterologous nucleotide sequence is inserted into a nucleic acid vector (e.g., an AAV genome) (i.e., instead of substituting a portion of an ITR).
  • a heterologous nucleotide sequence may be inserted inside the D-sequence of an ITR, upstream of the D-sequence of an ITR, or downstream of the D-sequence of an ITR.
  • substitution of a D-sequence comprises substitution of at least 5 nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides) of the D- sequence with a different nucleotide sequence (e.g., a heterologous nucleotide sequence or portion thereof). In some embodiments, substitution of a D-sequence comprises substitution of 10 nucleotides of the D-sequence.
  • substitution of a D-sequence comprises substitution of the 3'-most 10 nucleotides of the D-sequence (e.g., of the D-sequence of the ITR at the 3' end of the nucleic acid vector (e.g., AAV genome)). In some embodiments, substitution of a D-sequence comprises substitution of the 5'-most 10 nucleotides of the D- sequence (e.g., of the D-sequence of the ITR at the 5' end of the nucleic acid vector (e.g., AAV genome)).
  • substitution of a D-sequence comprises substitution of an internal portion (i.e., not comprising a terminal nucleotide) of the D-sequence, such as 10 nucleotides of the internal portion of the D-sequence.
  • an ITR comprising a substitution, insertion, or deletion as disclosed herein comprises one or more additional modifications, such as an additional substitution, modification, or deletion in another portion of the ITR.
  • modification of a nucleic acid vector e.g., an AAV genome
  • wild-type AAV genomes are approximately 4.7 kilobases (kb) in length; recombinant AAV genomes have typically been limited to approximately this same length. See, e.g., Wu, et al., Mol Ther. (2010) 18(1): 80-86. Self-complementary AAV genomes are often even more limited, with maximum packaging capacities of about 2.3 kb.
  • the modifications provided herein can, in some embodiments, enable substantially larger AAV genomes (comprising the modification(s)) to be useful in generating AAV particles for delivery of genes of interest.
  • an AAV genome disclosed herein comprising a modification can be generated having a length greater than a corresponding AAV genome not comprising the modification, without substantial negative impacts on AAV genome rescue, replication, and/or packaging.
  • an AAV genome disclosed herein is about 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb, 14.5 kb, 15 kb, 15.5 kb, 16 kb, 16.5 kb, 17 kb, 17.5 kb, or more in length.
  • an AAV genome disclosed herein is at least 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb, 14.5 kb, 15 kb, 15.5 kb, 16 T18934 Attorney Docket No.
  • an AAV genome disclosed herein is less than 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb, 14.5 kb, 15 kb, 15.5 kb, 16 kb, 16.5 kb, 17 kb, or 17.5 kb in length.
  • a nucleic acid vector e.g., an AAV genome as disclosed herein in some embodiments comprises one or more regulatory elements, such as regulatory elements operably linked to a transgene.
  • a regulatory element is located between two ITRs, a 5' ITR and a 3' ITR.
  • a regulatory element is located upstream of or 5' relative to a transgene.
  • a regulatory element is located downstream of or 3' relative to the 5' ITRs as described herein. In some embodiments, a regulatory element is located upstream of or 5' relative to a transgene and downstream of or 3' relative to a 5' ITR.
  • a regulatory element refers to a nucleotide sequence or structural component of a nucleic acid vector which is involved in the regulation of expression of components of the nucleic acid vector (e.g., a gene of interest comprised therein). Regulatory elements include, but are not limited to, promoters, enhancers, silencers, insulators, response elements, initiation sites, termination signals, and ribosome binding sites.
  • Promoters include constitutive promoters, inducible promoters, tissue-specific promoters, cell type-specific promoters, and synthetic promoters.
  • a nucleic acid vector disclosed herein may include viral promoters or promoters from mammalian genes that are generally active in promoting transcription.
  • constitutive viral promoters include the Herpes Simplex virus (HSV), thymidine kinase (TK), Rous Sarcoma Virus (RSV), Simian Virus 40 (SV40), Mouse Mammary Tumor Virus (MMTV), Ad E1A and cytomegalovirus (CMV) promoters.
  • Non-limiting examples of constitutive mammalian promoters include various housekeeping gene promoters, as exemplified by the ⁇ -actin promoter.
  • Inducible promoters or other inducible regulatory elements may also be used to achieve desired expression levels of a gene of interest (e.g., a protein or polypeptide of interest).
  • suitable inducible promoters include those from genes such as cytochrome P450 genes, heat shock protein genes, metallothionein genes, and hormone- T18934 Attorney Docket No. U1202.70129WO00 inducible genes, such as the estrogen gene promoter.
  • Another example of an inducible promoter is the tetVP16 promoter that is responsive to tetracycline.
  • a nucleic acid vector e.g., an AAV genome
  • a nucleic acid vector comprises a nucleotide sequence encoding a product (e.g., a protein or polypeptide product).
  • a nucleotide sequence comprises a nucleotide sequence of a gene of interest.
  • a gene of interest encodes a therapeutic and/or diagnostic agent (e.g., protein or polypeptide).
  • a therapeutic or diagnostic agent is an antibody, a peptibody, a growth factor, a clotting factor, a hormone, a membrane protein, a cytokine, a chemokine, an activating or inhibitory peptide acting on cell surface receptors or ion channels, a cell-permeant peptide targeting intracellular processes, a thrombolytic agent, an enzyme, a bone morphogenetic protein, a nuclease, a protein used for gene editing, an Fc- fusion protein, an anticoagulant, or a protein or polypeptide that can be detected using a laboratory test.
  • a nucleic acid vector (e.g., an AAV genome) provided herein comprises a nucleotide sequence encoding a guide RNA or other nucleic acid used for gene editing, optionally in addition to a protein used for gene editing.
  • a product encoded by a nucleic acid vector (e.g., an AAV genome) disclosed herein is a detectable molecule.
  • a detectable molecule is a molecule that can be visualized (e.g., using a naked eye, under a microscope, or using a light detection device such as a camera).
  • the detectable molecule is a fluorescent molecule, a bioluminescent molecule, or a molecule that provides color (e.g., ⁇ -galactosidase, ⁇ -lactamase, ⁇ -glucuronidase, or spheroidenone).
  • the detectable molecule is a fluorescent, bioluminescent or enzymatic protein or functional peptide or polypeptide thereof.
  • fluorescent protein is a blue fluorescent protein, a cyan fluorescent protein, a green fluorescent protein, a yellow fluorescent protein, an orange fluorescent protein, a red fluorescent protein, or a functional peptide or polypeptide thereof.
  • a blue fluorescent protein may be azurite, EBFP, EBFP2, mTagBFP, or Y66H.
  • a cyan fluorescent protein may be ECFP, AmCyan1, Cerulean, CyPet, mECFP, Midori-ishi Cyan, mTFP1, or TagCFP.
  • a Green fluorescent protein may be AcGFP, Azami Green, EGFP, T18934 Attorney Docket No. U1202.70129WO00 Emarald, GFP or a mutated form of GFP (e.g., GFP-S65T, mWasabi, Stemmer, Superfolder GFP, TagGFP, TurboGFP, or ZsGreen).
  • a yellow fluorescent protein may be EYFP, mBanana, mCitrine, PhiYFp, TagYFP, Topaz, Venus, YPet, or ZsYellow1.
  • An orange fluorescent protein may be DsRed, RFP, DsRed2, DsRed-Express, Ds-Red-monomer, Tomato, tdTomato, Kusabira Orange, mKO2, mOrange, mOrange2, mTangerine, TagRFP, or TagRFP- T.
  • a red fluorescent protein may be AQ142, AsRed2, dKeima-Tandem, HcRed1, tHcRed, Jred, mApple, mCherry, mPlum, mRasberry, mRFP1, mRuby or mStrawberry.
  • a detectable molecule is a bioluminescent protein or a functional peptide or polypeptide thereof.
  • bioluminescent proteins are firefly luciferase, click-beetle luciferase, Renilla luciferase, and luciferase from Oplophorus gracilirostris.
  • a detectable molecule may be any polypeptide or protein that can be detected using methods known in the art. Non-limiting methods of detection are fluorescence imaging, luminescent imaging, bright filed imaging, and include imaging facilitated by immunofluorescence or immunohistochemical staining. [0087] Additional features of AAV particles, nucleic acid vectors, and capsid proteins are described in Patent Application Publication No. US2017/0356009, the contents of which are incorporated herein by reference in their entirety. [0088] In some embodiments, a nucleic acid vector (e.g., an AAV genome) is comprised within or encoded by a plasmid.
  • Nucleic acid vectors as disclosed herein, e.g., comprising modified ITRs, can be prepared by one of ordinary skill in the art by known methods.
  • AAV Particles [0090] According to some aspects, provided herein are AAV particles that comprise any of the nucleic acid vectors (e.g., AAV genomes) disclosed herein.
  • An AAV particle is a supramolecular assembly of 60 individual capsid protein subunits forming a non-enveloped T- 1 icosahedral lattice capable of protecting a single-stranded DNA genome.
  • a mature AAV particle is approximately 20 nm in diameter, and its capsid is formed from three structural capsid proteins VP1, VP2, and VP3, with molecular masses of 87, 73, and 62 kDa, respectively, in a ratio of approximately 1:1:18.
  • the 60 capsid proteins are arranged in an anti- Attorney Docket No. U1202.70129WO00 parallel ⁇ -strand barreloid arrangement, resulting in a defined tropism and a high resistance to degradation.
  • an AAV particle comprises an empty capsid (e.g., a capsid without a cargo).
  • an AAV particle comprises a capsid encapsidating a nucleic acid (e.g., a nucleic acid vector that comprises a gene of interest, such as a nucleic acid vector disclosed herein).
  • a nucleic acid encapsidated within an AAV capsid to generate an AAV particle comprises a nucleic acid vector disclosed herein.
  • an AAV particle disclosed herein comprises a capsid protein comprising one or more mutations, e.g., one or more amino acid substitutions.
  • an AAV particle described herein may have an AAV capsid protein (e.g., a wild-type AAV capsid protein or one comprising one or more amino acid substitutions) and an AAV nucleic acid vector comprising a modification (e.g., a deletion or substitution of a D-sequence, and/or an insertion of a non-AAV sequence).
  • AAV capsid protein e.g., a wild-type AAV capsid protein or one comprising one or more amino acid substitutions
  • an AAV nucleic acid vector comprising a modification e.g., a deletion or substitution of a D-sequence, and/or an insertion of a non-AAV sequence.
  • an AAV particle disclosed herein comprises a capsid protein comprising amino acid substitutions at one or more positions corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2.
  • an AAV particle disclosed herein comprises a capsid protein comprising one or more amino acid substitutions corresponding to T491V, Y444F, Y500F, and/or Y730F substitutions in SEQ ID NO: 2.
  • an AAV particle disclosed herein comprises a capsid protein comprising amino acid substitutions at one or more positions corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2 and further comprises a nucleic acid vector comprising modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of an ITR (e.g., a modification of a D-sequence of a right ITR, a left ITR, or both a right ITR and a left ITR).
  • modification e.g., a deletion, a substitution, or an insertion
  • the AAV particle comprises a capsid protein comprising amino acid substitutions at one or more positions corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2 and a nucleic acid vector comprising a substitution of a portion of a D- sequence of an ITR with a heterologous nucleotide sequence.
  • the amino acid substitutions correspond to T491V, Y444F, Y500F, and/or Y730F substitutions in SEQ ID NO: 2.
  • the heterologous nucleotide sequence comprises, consists essentially of, or consists of the nucleotide sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), Attorney Docket No. U1202.70129WO00 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27).
  • a portion or the entirety of a D-sequence of an ITR is substituted with the heterologous nucleotide sequence.
  • an AAV particle disclosed herein is replicative.
  • a replicative AAV particle is capable of replicating within a host cell (e.g., a host cell within a subject or a host cell in culture).
  • an AAV particle disclosed herein is non- replicating.
  • a non-replicating AAV particle is not capable of replicating within a host cell (e.g., a host cell within a subject or a host cell in culture), but can infect the host and incorporate a genetic components into the host’s genome for expression.
  • an AAV particle disclosed herein is capable of infecting a host cell.
  • an AAV particle disclosed herein is capable of facilitating stable integration of genetic components into the genome of a host cell. In some embodiments, an AAV particle disclosed herein is not capable of facilitating integration of genetic components into the genome of a host cell.
  • an AAV particle disclosed herein comprises a nucleic acid vector (e.g., an AAV genome) provided herein.
  • a nucleic acid vector e.g., AAV genome
  • the nucleic acid vector e.g., AAV genome
  • the nucleic acid vector is a single-stranded DNA vector.
  • an AAV particle disclosed herein comprises one single-stranded DNA. In some embodiments, an AAV particle disclosed herein comprises two complementary DNA strands, forming a self-complementary AAV (scAAV).
  • a nucleic acid vector that may be comprised in an AAV particle comprises an ITR comprising a modification (e.g., a deletion, substitution, or insertion) of part or all of the ITR’s D-sequence.
  • part or all of the ITR’s D-sequence is substituted with a heterologous nucleotide sequence. In some embodiments, part or all of the ITR’s D-sequence is deleted. Further description of such modifications (e.g., deletions, substitutions, and insertions) is provided elsewhere herein.
  • an ITR comprising a substitution, insertion, or deletion of a nucleic acid vector as disclosed herein comprises one or more additional modifications, such as an additional substitution, modification, or deletion in another portion of the ITR. T18934 Attorney Docket No.
  • An AAV particle disclosed herein may be of any AAV serotype (e.g., AAV serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13), including any derivative (including non-naturally occurring variants of a serotype) or pseudotype.
  • Non-limiting examples of derivatives and pseudotypes include AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41, AAV9.45, AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShH10, AAV2.15, AAV2.4, AAVM41, and AAVr3.45.
  • the AAV particle is a pseudotyped AAV particle, which comprises a nucleic acid vector comprising ITRs from one serotype (e.g., AAV2 or AAV3) and a capsid comprised of capsid proteins derived from another serotype (i.e., a serotype other than AAV2 or AAV3, respectively).
  • SEQ ID NOs: 1-14 provide examples of amino acid sequences of AAV capsid proteins of different serotypes.
  • Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J.
  • an AAV particle disclosed herein is a recombinant AAV (rAAV) particle, e.g., comprising a recombinant nucleic acid or transgene.
  • rAAV recombinant AAV
  • Any combination of modifications described herein may result in an additive or synergistic effect, in which the beneficial properties of the resulting combination are equal to or greater than, respectively, the sum of the effects of the individual modifications.
  • an AAV particle comprising a modified capsid protein and a modified genome may have improvements in transduction efficiency, transgene expression, and/or packaging efficiency relative to a corresponding wild-type AAV particle that are equal to the sum of the improvements conferred by the individual capsid protein modification and the genome modification, or that are greater than the sum of the improvements conferred by the individual modifications.
  • AAV particles as disclosed herein, e.g., comprising modified ITRs can be prepared by one of ordinary skill in the art by known methods. T18934 Attorney Docket No.
  • AAV particles e.g., comprising modified genome and/or capsid protein
  • a plasmid such as a pSub201 plasmid, which includes sequences encoding AAV Rep and capsid proteins, and in which a gene of interest can be inserted.
  • the pSub201 sequence is provided below, in which the open reading frame encoding ampicillin-resistance marker is bolded and the D-sequences are underlined. The portions of the underlined D-sequences that are also bolded are the preferred portion that can be replaced by a heterologous nucleotide sequence.
  • a corresponding position for replacement by a heterologous nucleotide sequence in a different sequence can be identified by methods known in the art.
  • an AAV capsid protein disclosed herein comprises amino acid substitutions at one or more positions corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2.
  • the amino acid substitutions correspond to T491V, Y444F, Y500F, and/or Y730F substitutions in SEQ ID NO: 2. It should be understood that an amino acid substitution at a position corresponding to a position of SEQ ID NO: 2 can be an amino acid substitution in a capsid protein of any serotype.
  • the corresponding position in a capsid protein having a different baseline amino acid sequence can be determined by methods known in the art, such as by constructing structural alignments of the amino acid sequences and identifying corresponding amino acids.
  • a “corresponding” amino acid to be substituted is one which is at the corresponding position, and may have the same amino acid identity (i.e., the amino acid at the corresponding position in the second capsid protein sequence is the same as the amino acid in the reference capsid protein sequence), or may be an amino acid with similar properties T18934 Attorney Docket No. U1202.70129WO00 (e.g., similar hydrophobicity, size, charge, etc.) as the amino acid in the reference capsid protein.
  • an amino acid substitution at a position corresponding to T491 of SEQ ID NO: 2, or corresponding to a T491V substitution in SEQ ID NO: 2 may be a substitution at a position corresponding to position 491 of SEQ ID NO: 2 in a second capsid protein, which may also be a threonine, or which may be a similar amino acid (e.g., another amino acid with a polar uncharged side chain, such as serine, asparagine, or glutamine).
  • an AAV capsid protein disclosed herein comprises amino acid substitutions as described in Patent Application Publication Nos.
  • an AAV capsid protein as disclosed herein is a VP1 protein, a VP2 protein, or a VP3 protein.
  • the VP1, VP2, and VP3 capsid proteins are each encoded from the same segment of the AAV genome, and differ in their N termini based on alternative mRNA splicing.
  • the different capsid proteins VP1, VP2, and VP3 are defined according to numbering of the full-length VP1 protein.
  • a VP1 capsid protein is defined by amino acids 1-735 of SEQ ID NO: 2; a VP2 capsid protein is defined by amino acids 138-735 of SEQ ID NO: 2; and a VP3 capsid protein is defined by amino acids 203-735 of SEQ ID NO: 2.
  • Numbering of AAV capsid proteins is provided according to the VP1 sequence.
  • T491 refers to the threonine at position 491 of SEQ ID NO: 2 in a VP1 protein or the corresponding threonine in a VP2 or VP3 protein.
  • Y444, Y500, and Y730 refer to the tyrosines at positions 444, 500, and 730 of SEQ ID NO: 2, respectively, in a VP1 protein, or the corresponding tyrosines in a VP2 or VP3 protein.
  • An AAV capsid protein disclosed herein can be of any serotype, or can be a chimeric capsid protein (i.e., comprising segments from capsid proteins of two or more serotypes).
  • a capsid protein disclosed herein is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, or AAVrh74 capsid protein.
  • an AAV capsid protein as provided herein is of serotype 2, serotype 3, serotype 6, or serotype rh74.
  • Amino acid sequences of capsid proteins of other AAV serotypes are known and can be aligned with SEQ ID NO: 2 (AAV2 capsid protein) using techniques known in the art. Examples of amino acid sequences of AAV capsid proteins of various serotypes are provided below.
  • a nucleic acid may comprise a sequence that encodes a capsid protein disclosed here (e.g., a capsid protein comprising one or more amino acid substitutions).
  • a sequence encoding a capsid protein disclosed herein can be determined by one of ordinary skill in the art by known methods.
  • a nucleic acid encoding a capsid protein may comprise a promoter or other regulatory sequence operably linked to the coding sequence.
  • a nucleic acid encoding a capsid protein may be in the form of a plasmid, an mRNA, or another nucleic acid capable of being used by enzymes or machinery of a host cell to produce a capsid protein.
  • Nucleic acids encoding capsid proteins as provided herein can be used to make AAV particles that can be used for delivering a gene to a cell. Methods of making AAV particles are known in the art. For example, see Scientific Reports volume 9, Article number: 13601 (2019); Methods Mol Biol.2012; 798: 267–284; and thermofisher.com/us/en/home/clinical/cell-gene-therapy/gene-therapy/aav-production- workflow.html. Example sequences of nucleic acids encoding capsid proteins are provided below.
  • Second-strand synthesis can be measured by one of ordinary skill in the art by known methods.
  • second-strand synthesis of an AAV genome disclosed herein is increased relative to a corresponding T18934 Attorney Docket No. U1202.70129WO00 wild-type AAV genome.
  • second-strand synthesis of an AAV genome disclosed herein is increased as a result of a decrease in binding of a host-cell protein (e.g., a phosphorylated host-cell protein, such as FKBP52) to the AAV genome (e.g., to a D-sequence of the AAV genome).
  • a host-cell protein e.g., a phosphorylated host-cell protein, such as FKBP52
  • the second-strand synthesis of an AAV genome as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the second-strand synthesis of a corresponding wild-type AAV genome.
  • 5% higher e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more
  • the second-strand synthesis of an AAV genome as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least 10-fold higher, at least 10.5-fold higher, at least 11-fold higher, at least 11.5-fold higher, at least 12-fold higher, at least 12.5-fold higher, at least 13-fold higher, at least 13.5-fold higher, at least 14-fold higher, at least 14.5-fold higher, at least 15-fold higher, at least 15.5-fold higher, at least 16-fold higher, at least 16.5-fold higher, at least 17- fold
  • second- strand synthesis of an AAV particle as disclosed herein is not modified relative to a corresponding wild-type AAV particle.
  • Transduction Efficiency e.g., transduction efficiency of an AAV particle disclosed herein (e.g., comprising a modification in a nucleic acid vector and/or in a capsid protein) is modified relative to a corresponding wild-type AAV particle (e.g., not comprising the modification in the nucleic acid vector and/or in the capsid protein).
  • Transduction efficiency of an AAV particle can be determined, for example, by comparing expression of a gene of interest in a cell following contacting the cell with the AAV particle, or by measuring the number of viral genome copies per cell following contacting a population of cells with the AAV particle.
  • transduction efficiency of an AAV particle as disclosed herein is higher than the transduction efficiency of a corresponding wild-type AAV particle (e.g., not comprising the modified capsid protein or nucleic acid modification).
  • the transduction efficiency of an AAV particle as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the transduction efficiency of a corresponding wild-type AAV particle.
  • the transduction efficiency of an AAV particle as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least 10-fold higher, at least 10.5-fold higher, at least 11-fold higher, at least 11.5-fold higher, at least 12-fold higher, at least 12.5-fold higher, at least 13-fold higher, at least 13.5-fold higher, at least 14-fold higher, at least 14.5-fold higher, at least 15-fold higher, at least 15.5- fold higher, at least 16-fold higher, at least 16.5-fold higher, at least 17-fold higher,
  • transduction efficiency of an AAV particle as disclosed herein is not modified relative to a corresponding wild-type AAV particle.
  • Transgene expression [0138] According to some aspects, expression of a transgene encoded by a nucleic acid vector comprising a modification (e.g., a deletion or substitution of a sequence, such as a D-sequence, or insertion of a sequence) disclosed herein is altered relative to expression of the transgene T18934 Attorney Docket No. U1202.70129WO00 encoded by a nucleic acid vector that does not comprise the modification.
  • transgene expression is, in some embodiments, on a per nucleic acid vector copy number basis (e.g., transgene expression in a cell, when normalized to the total amount of nucleic acid vector in the cell, is altered).
  • a modified AAV particle as disclosed herein results in greater transgene expression relative to a corresponding AAV particle not comprising the same modification but that delivers a comparable number of viral genomes to a cell.
  • Relative transgene expression levels can be determined, for example, by measuring expression of the transgene in a cell by methods known in the art following contacting the cell with an AAV particle comprising the modified nucleic acid vector encoding the transgene and comparing an equivalent measurement in another cell contacted with an AAV particle comprising a nucleic acid vector that does not comprise the modification.
  • transgene expression from a modified nucleic acid vector as disclosed herein is higher than the transgene expression from a corresponding nucleic acid vector that does not comprise the modification.
  • the transgene expression from a modified nucleic acid vector as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the transgene expression from a corresponding nucleic acid vector that does not comprise the modification.
  • the transgene expression from a modified nucleic acid vector as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least 10-fold higher, at least 10.5-fold higher, at least 11-fold higher, at least 11.5-fold higher, at least 12-fold higher, at least 12.5-fold higher, at least 13-fold higher, at least 13.5-fold higher, at least 14-fold higher, at least 14.5-fold higher, at least 15-fold higher, at least 15.5-fold higher, at least 16-fold higher, at least 16.5- fold
  • transgene expression from a modified nucleic acid vector as disclosed herein is not changed relative to transgene expression from a corresponding nucleic acid vector that does not comprise the modification.
  • Packaging efficiency [0142] According to some aspects, packaging efficiency of an AAV particle disclosed herein is modified relative to a corresponding wild-type AAV particle. Packaging efficiency of an AAV particle refers to the capability of a particular AAV capsid to encapsidate a particular viral genome. Packaging efficiency can be measured by one of ordinary skill in the art, such as by quantifying the ratio of capsids to viral genomes (see, e.g., Grimm, et al.
  • the packaging efficiency of an AAV particle as disclosed herein is higher than the packaging efficiency of a corresponding wild-type AAV particle.
  • the packaging efficiency of an AAV particle as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the packaging efficiency of a corresponding wild-type AAV particle.
  • the packaging efficiency of an AAV particle as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least 10-fold higher, at least 10.5-fold higher, at least 11-fold higher, at least 11.5-fold higher, at least 12-fold higher, at least 12.5-fold higher, at least 13-fold higher, at least 13.5-fold higher, at least 14-fold higher, at least 14.5-fold higher, at least 15-fold higher, at least 15.5-fold higher, at least 16-fold higher, at least 16.5-fold higher, at least 17-fold higher, at least 1.5-fold
  • the packaging efficiency of an AAV particle as disclosed herein is lower than the packaging efficiency of a corresponding wild-type AAV particle.
  • the packaging efficiency of an AAV particle as disclosed herein is decreased by at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more) relative to the packaging efficiency of a corresponding wild-type AAV particle.
  • packaging efficiency of an AAV particle disclosed herein is not modified relative to a corresponding wild-type AAV particle.
  • both the transduction efficiency and the packaging efficiency of an AAV particle as disclosed herein is modified (i.e., increased or decreased) relative to a corresponding unmodified or wild-type AAV particle (e.g., of the same serotype).
  • the immunogenicity of an AAV particle as disclosed herein is modified relative to a corresponding unmodified or wild-type AAV particle (e.g., of the same serotype).
  • Pharmaceutical compositions [0147] Any one of the AAV particles, capsid proteins, or nucleic acids disclosed herein may be comprised within a pharmaceutical composition comprising a pharmaceutically-acceptable carrier or may be comprised within a pharmaceutically-acceptable carrier.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the AAV particle, capsid protein, or nucleic acid is comprised or administered to a subject.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum oil such as mineral oil, vegetable oil such as peanut oil, soybean oil, and sesame oil, animal oil, or oil of synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers.
  • Non-limiting examples of pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline, syrup, methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, polyacrylic acids, lubricating agents (such as talc, magnesium stearate, and mineral oil), wetting agents, emulsifying agents, suspending agents, preserving agents (such as methyl-, ethyl-, and propyl-hydroxy-benzoates), and pH adjusting agents (such as inorganic and organic T18934 Attorney Docket No.
  • U1202.70129WO00 acids and bases and solutions or compositions thereof.
  • Other examples of carriers include phosphate buffered saline, HEPES-buffered saline, and water for injection, any of which may be optionally combined with one or more of calcium chloride dihydrate, disodium phosphate anhydrous, magnesium chloride hexahydrate, potassium chloride, potassium dihydrogen phosphate, sodium chloride, or sucrose.
  • carriers that might be used include saline (e.g., sterilized, pyrogen-free saline), saline buffers (e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. USP grade carriers and excipients are particularly useful for delivery of AAV particles to human subjects.
  • saline e.g., sterilized, pyrogen-free saline
  • saline buffers e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer
  • amino acids e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer
  • amino acids e.g., citrate buffer, phosphate buffer, acetate
  • compositions may contain at least about 0.1% of the therapeutic agent (e.g., AAV particle) or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation.
  • the amount of therapeutic agent(s) (e.g., AAV particle) in each therapeutically-useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound.
  • compositions as disclosed herein comprising nucleic acid vectors comprising modified ITRs and/or AAV particles comprising nucleic acid vectors comprising modified ITRs, can be prepared by one of ordinary skill in the art by known methods.
  • Methods of contacting a cell According to some aspects, methods of contacting a cell with an AAV particle or nucleic acid vector are provided herein.
  • Methods of contacting a cell may comprise, for example, contacting a cell in a culture with a composition comprising an AAV particle or nucleic acid vector.
  • contacting a cell comprises adding a composition comprising an AAV particle or nucleic acid vector to the supernatant of a cell culture (e.g., a cell culture on a tissue culture plate or dish) or mixing a composition comprising an AAV particle or nucleic acid vector with a cell culture (e.g., a suspension cell culture).
  • contacting a cell comprises mixing a composition comprising an AAV particle T18934 Attorney Docket No.
  • contacting a cell with an AAV particle or nucleic acid vector comprises administering a composition comprising an AAV particle or nucleic acid vector to a subject or device in which the cell is located. In some embodiments, contacting a cell comprises injecting a composition comprising an AAV particle or nucleic acid vector into a subject in which the cell is located. In some embodiments, contacting a cell comprises administering a composition comprising an AAV particle or nucleic acid vector directly to a cell, or into or substantially adjacent to a tissue of a subject in which the cell is present.
  • administering means providing a material to a subject in a manner that is pharmacologically useful.
  • an rAAV particle is administered to a subject enterally.
  • an enteral administration of the essential metal element/s is oral.
  • a rAAV particle is administered to the subject parenterally.
  • a rAAV particle is administered to a subject subcutaneously, intraocularly, intravitreally, subretinally, intravenously (IV), intracerebro- ventricularly, intramuscularly, intrathecally (IT), intracisternally, intraperitoneally, via inhalation, topically, or by direct injection to one or more cells, tissues, or organs.
  • a rAAV particle is administered to the subject by injection into the hepatic artery or portal vein.
  • a compositions of AAV particles is administered to a subject to treat a disease or condition.
  • compositions described above or elsewhere herein are typically administered to a subject in an effective amount, that is, an amount capable of producing a desirable result.
  • the desirable result will depend upon the active agent being administered.
  • an effective amount of rAAV particles may be an amount of the particles that are capable of transferring an expression construct to a host organ, tissue, or cell.
  • a therapeutically acceptable amount may be an amount that is capable of treating a disease, e.g., a muscular dystrophy.
  • a cell disclosed herein is a cell isolated or derived from a subject.
  • a cell is a mammalian cell (e.g., a cell isolated or derived from a mammal).
  • a cell is a human cell.
  • a cell is isolated or derived from a particular tissue of a subject, such as muscle tissue.
  • a cell is a muscle cell. In some embodiments, a cell is a skeletal muscle cell or a smooth muscle cell. In some embodiments, a cell is in vitro. In some embodiments, a cell is ex vivo. In some embodiments, a cell in in vivo. In some embodiments, a cell is within a subject (e.g., within a tissue or organ of a subject). In some embodiments, a cell is a primary cell. In some embodiments, a cell is from a cell line (e.g., an immortalized cell line). In some embodiments a cell is a cancer cell or an immortalized cell.
  • administering means providing a material to a subject in a manner that is pharmacologically useful.
  • administering means providing a material to a subject in a manner that is pharmacologically useful.
  • administering means providing a material to a subject in a manner that is pharmacologically useful.
  • an AAV particle disclosed herein in a suitably formulated pharmaceutical composition disclosed herein either subcutaneously, intraocularly, intravitreally, subretinally, parenterally, intravenously (IV), intracerebro- ventricularly, intramuscularly, intrathecally (IT), intracisternally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection to one or more cells, tissues, or organs by direct injection.
  • the administration is a route suitable for systemic delivery, such as by intravenous injection.
  • the administration is a route suitable for local delivery, such as by intramuscular injection.
  • “administering” or “administration” means providing a material to a subject in a manner that is pharmacologically useful.
  • the concentration of AAV particles administered to a subject may be on the order ranging from 10 6 to 10 14 particles/ml or 10 3 to 10 15 particles/ml, or any values therebetween for either range, such as for example, about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 particles/ml.
  • AAV particles of a higher concentration than 10 13 particles/ml are administered.
  • the concentration of AAV particles administered to a subject may be on the order ranging from 10 6 to 10 14 vector genomes (vgs)/ml or 10 3 to 10 15 vgs/ml, or any values therebetween for either range (e.g., 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 vgs/ml).
  • AAV particles of higher concentration than 10 13 vgs/ml are administered.
  • the AAV particles can be administered as a single dose, or divided into two or more administrations as may be required to achieve therapy of the particular disease or disorder being treated.
  • T18934 Attorney Docket No.
  • U1202.70129WO00 0.0001 ml to 10 ml are delivered to a subject.
  • the number of AAV particles administered to a subject may be on the order ranging from 10 6 -10 14 vgs/kg body mass of the subject, or any values therebetween (e.g., 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 vgs/kg).
  • the dose of AAV particles administered to a subject may be on the order ranging from 10 12 -10 14 vgs/kg.
  • the volume of AAVrh74 composition delivered to a subject is 0.0001 ml to 10 ml.
  • a composition disclosed herein e.g., comprising an AAV particle
  • the composition is administered to a subject multiple times (e.g., twice, three times, four times, five times, six times, or more).
  • Repeated administration to a subject may be conducted at a regular interval (e.g., daily, every other day, twice per week, weekly, twice per month, monthly, every six months, once per year, or less or more frequently) as necessary to treat (e.g., improve or alleviate) one or more symptoms of a disease, disorder, or condition in the subject.
  • a regular interval e.g., daily, every other day, twice per week, weekly, twice per month, monthly, every six months, once per year, or less or more frequently
  • a regular interval e.g., daily, every other day, twice per week, weekly, twice per month, monthly, every six months, once per year, or less or more frequently
  • a host cell in situ in a subject e.g., ex vivo or in vitro.
  • Non-limiting examples of non-human primate subjects include macaques (e.g., cynomolgus or rhesus macaques), marmosets, tamarins, spider monkeys, owl monkeys, vervet monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans.
  • the subject is a human subject.
  • Other exemplary subjects include domesticated animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters.
  • the subject has or is suspected of having a disease or disorder that may be treated with gene therapy.
  • a disease or disorder that may be treated with gene therapy may be characterized by one or more mutation(s) in the genome that results in abnormal structure or function of one or more proteins associated with development, health, maintenance and/or function of a cell and/or organ. Diseases and disorders can be characterized and identified, e.g., through laboratory tests and/or evaluation by a clinician.
  • the subject has or is suspected of having a disease (e.g., a disease caused by a defect, such as a genetic mutation, in one or more cells or genes).
  • U1202.70129WO00 nucleic acid isolated or derived from the subject is identified via sequencing (e.g., Sanger or next-generation sequencing) to comprise a mutation (e.g., in a gene associated with development, health, maintenance, or function of a cell and/or organ).
  • sequencing e.g., Sanger or next-generation sequencing
  • a subject comprises a mutant form of one or more genes associated with development, health, maintenance and/or function of a cell and/or organ.
  • methods disclosed herein provide a cell of a subject with a functional form of a gene.
  • Naturally-occurring adeno-associated viruses do not express their own genes efficiently, and viral second-strand DNA synthesis is required before gene expression can occur in a host cell.
  • Mammalian host cells do not have an RNA polymerase that is capable of transcribing the single-stranded DNA genome of an AAV.
  • RNA polymerase capable of transcribing the single-stranded DNA genome of an AAV.
  • proximal 10 nucleotides the 10 nucleotides closest to the terminus of the ITR, i.e., adjacent the hairpin structure of the ITR
  • deletion of the full 3' D-sequence substantially impedes rescue of the proviral genome, AAV replication, and AAV packaging (see, e.g., Wang, et al., J Virol. (1997) 71(4):3077-82).
  • ssAAV genomes comprising a sequence replacing the proximal 10 nucleotides of the 3' D-sequence allows successful packaging, while avoiding the negative impacts of the natural D-sequence (e.g., inhibited second-strand DNA synthesis).
  • a sequence library was generated with random 10-nucleotide sequences in place of the proximal 10 nucleotides (“D10-sequence random library”; FIG.1).
  • the library of sequences was cloned into plasmids to generate plasmid libraries comprising the random 10- nucleotide sequences in place of either the left ITR or the right ITR (FIG.2 and FIG.3).
  • the plasmids were transfected into HEK293 cells and rescue, replication, and packaging were observed.
  • FIG.3 only construct “N10-L1” resulted in successful generation of AAV particles, indicating that features of the other three constructs were incompatible with AAV rescue and/or packaging.
  • the failure of the other three constructs to successfully undergo rescue, replication, and packaging underscores the criticality of the D-sequence in the 3'-ITR to AAV packaging.
  • GenZ ssAAV particles were generated comprising this sequence substituted in place of the proximal 10 nucleotides (closest to the 5' and 3' ends of the AAV genome) of each D-sequence (FIG.4 and FIG.5).
  • GenZ ssAAV particles comprising a nucleic acid encoding firefly luciferase fused to EYFP with a chicken ⁇ -actin (CBA) promoter.
  • GenZ ssAAV particles achieve T18934 Attorney Docket No. U1202.70129WO00 strong transgene expression in host cells in a dose-dependent manner ( ⁇ 7,000 pixels 2 /visual field for cells treated with 3,000 vgs/cell and ⁇ 12,500 pixels 2 /visual field for cells treated with 10,000 vgs/cell; relative to no measurable EYFP expression in mock-treated cells; FIG.6A and 6B).
  • transgene expression from recombinant ssAAV vectors is also largely sub-optimal since the viral second-strand DNA synthesis is strongly inhibited by binding of phosphorylated forms of host cell chaperone protein, FKBP52, to the D-sequence at the 3'-end of the ssAAV genome (Proc Natl Acad Sci USA, 94(20): 10879-10884, 1997). It has not been possible to delete the D-sequence at the 3'-ITR as it serves as the “packaging signal” for the AAV genome (J. Virol., 70: 1668-1677, 1996).
  • 5'-ATGTGCTTGA-3' SEQ ID NO: 26
  • This sequence was inserted in a recombinant AAV2 genome replacing the proximal 10- nts in D-sequence at both ITRs flanking an expression cassette containing a firefly luciferase- enhanced yellow fluorescent protein (FLuc-EYFP) under the control of the chicken ⁇ -actin (CBA) promoter, designated as generation Z (“GenZ”) ssAAV vector.
  • FLuc-EYFP firefly luciferase- enhanced yellow fluorescent protein
  • CBA chicken ⁇ -actin
  • Transduction efficiencies of wild-type (WT) and GenZ ssAAVrh74-CBAp-FLuc-EYFP vectors were evaluated in human HeLa cells in vitro, the results of which are shown in FIGs.7A and 7B.
  • T18934 Attorney Docket No. U1202.70129WO00
  • the extent of transgene expression from the GenZ AAVrh74 vector was ⁇ 20-fold higher than that from the WT AAVrh74 vectors.
  • Transduction efficiencies of WT and GenZ ssAAVrh74-CBAp-FLuc-EYFP vectors were also evaluated in vivo in C57BL6/J mice following intravenous administration.
  • GenZ ssAAVrh74 vectors averaged ⁇ 5-fold increase in transgene expression in the liver, compared with that from the WT ssAAVrh74 vectors (FIGs.8A and 8B).
  • the observed increase in transgene expression was not as pronounced in vivo since AAVrh74 vectors are closely related to AAV8, and ssAAV8 vectors transduce mouse liver very efficiently.
  • the GenZ ssAAV DNA genome can be packaged into any AAV serotype capsid vector; and packaging of the GenZ ssAAV DNA genomes in capsid-modified NextGen AAV serotype vectors (comprising amino acid substitutions in their capsid proteins that correspond to substitutions Y444F, Y500F, Y730F, and/or T491V in an AAV2 capsid protein) should further enhance the performance of Opt Z vectors (which comprise both the amino acid substitutions corresponding to Y444F, Y500F, Y730F, and/or T491V and the GenZ genome modification), the availability of which has significant implications for their potential use in achieving high- efficiency transgene expression of larger genes.
  • Example 3 [0174] The GenZ ssAAV genome improves viral second-strand DNA synthesis, and mediates significantly higher levels of transgene expression. Thus, it behaves more like a scAAV genome, but without scAAV’s inherent size limitation. However, the extent of transgene expression from different GenZ AAV serotype vectors varies.
  • GenZ ssAAVrh74 and GenZ ssAAV3 vectors were ⁇ 20-fold and ⁇ 22-fold, respectively, compared with that of their wild-type (WT) counterparts (FIGs.9A and 9B, respectively)
  • the increase in transduction efficiency of GenZ ssAAV2 and GenZ ssAAV6 vectors was only ⁇ 3-fold and ⁇ 4-fold, respectively, compared with that of their WT counterparts (FIG.9C and 9D, respectively).
  • AAV2 J Virol., 88:10711079, 2014; J Virol 2016;90:7196-7204
  • AAV9 Mol. Ther., 28:1373-1380, 2020; T18934 Attorney Docket No. U1202.70129WO00 Hum. Gene Ther., 31:1155-1168, 2020
  • capsids play a role in transcription and second-strand DNA synthesis.
  • Experiments were conducted as explained below to test whether AAV2 and AAV6, but not AAVrh74 and AAV3 capsids, negatively impact transgene expression from GenZ ssAAV vectors.
  • GenZ ssAAVrh74 vectors were used to transduce HeLa cells in triplicates at 3x10 3 viral genomes (vgs)/cell, incubated with and without highly purified empty capsids of AAVrh74, AAV2, AAV3, and AAV6, either before or during transduction. Transgene expression was visualized via fluorescence microscopy 72 hours post-transduction. The results demonstrate that, while AAVrh74 and AAV3 empty capsids had no effect on transduction efficiency, both AAV2 and AAV6 empty capsids led to a significant decrease in transgene expression from GenZ ssAAVrh74 vectors (FIG.10).
  • any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
  • All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
  • All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
  • a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
  • “or” should be understood to have the same meaning as “and/or” as defined above.
  • At least one of A and B can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
  • transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of” and “consisting essentially of” the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B,” the disclosure T18934 Attorney Docket No. U1202.70129WO00 also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B.”

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Provided herein are modified AAV genomes, AAV particles comprising the modified genomes, compositions thereof, and methods of their use.

Description

T18934 Attorney Docket No. U1202.70129WO00 DEVELOPMENT OF GENERATION Z (GENZ) SINGLE-STRANDED AAV SEROTYPE VECTORS RELATED APPLICATIONS [0001] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No.63/442,830, entitled “DEVELOPMENT OF GENERATION Z (GENZ) SINGLE-STRANDED AAV SEROTYPE VECTORS”, filed on February 2, 2023, the entire contents of which are incorporated herein by reference. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING [0002] The contents of the electronic sequence listing (U120270129WO00-SEQ-COB.xml; Size: 91,163 bytes; and Date of Creation: January 29, 2024) are herein incorporated by reference in their entirety. BACKGROUND [0003] Gene therapy has the potential to treat subjects suffering from or at risk of suffering from various diseases. Improved adeno-associated virus (AAV) vectors for carrying genetic payloads would be beneficial to the development of gene therapies. Many AAV vectors are limited by low transduction efficiency and transgene expression. SUMMARY [0004] The present disclosure is based at least in part on the realization that inefficient second- strand synthesis of single-stranded AAV genomes impedes efficient expression of transgenes delivered by AAV vectors. Modification of D-sequences of inverted terminal repeats (ITRs) within AAV genomes can increase second-strand synthesis, and thereby improve various aspects of AAV packaging, replication, transduction efficiency, and transgene expression. Accordingly, provided herein in some embodiments are recombinant AAV (rAAV) genomes comprising sequence modifications that result in improved properties, rAAV particles comprising modified rAAV genomes, and methods of their use. [0005] According to some aspects, recombinant adeno-associated virus (rAAV) genomes are provided herein. In some embodiments, an rAAV genome comprises a heterologous nucleotide T18934 Attorney Docket No. U1202.70129WO00 sequence, wherein the heterologous nucleotide sequence is (i) inserted within a first D- sequence of the rAAV genome, (ii) inserted within the rAAV genome at a position adjacent to a 3' or 5' end of the first D-sequence, or (iii) substituted in place of a portion of the first D- sequence in the rAAV genome, wherein the first D-sequence is proximal to the 3' terminus of the rAAV genome, and wherein the rAAV genome is single-stranded. [0006] In some embodiments, substitution of the heterologous nucleotide sequence in place of 5, 6, 7, 8, 9, 10, or more nucleotides at the 3' terminus of the first D-sequence does not substantially inhibit packaging of the rAAV genome. [0007] In some embodiments, the heterologous nucleotide sequence is substituted in place of a portion of the first D-sequence. [0008] In some embodiments, the heterologous nucleotide sequence is substituted in place of a portion of the first D-sequence, and wherein the portion of the first D-sequence: (i) is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length; and/or (ii) is equal in length to the heterologous nucleotide sequence. [0009] In some embodiments, the portion of the first D-sequence comprises consecutive nucleotides including the 3'-most nucleotide of the first D-sequence. [0010] In some embodiments, the heterologous nucleotide sequence comprises, consists of, or consists essentially of a sequence of 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). [0011] In some embodiments, an rAAV genome further comprises a second heterologous nucleotide sequence, wherein the second heterologous nucleotide sequence is (i) inserted within a second D-sequence of the rAAV genome, (ii) inserted within the rAAV genome at a position adjacent to a 3' or 5' end of the second D-sequence, or (iii) substituted in place of a portion of the second D-sequence in the rAAV genome, wherein the second D-sequence is proximal to the 5' terminus of the rAAV genome. [0012] In some embodiments, the second heterologous nucleotide sequence is substituted in place of a portion of the second D-sequence. [0013] In some embodiments, the second heterologous nucleotide sequence is substituted in place of a portion of the second D-sequence, and wherein the portion of the second D- sequence: T18934 Attorney Docket No. U1202.70129WO00 (i) is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length; and/or (ii) is equal in length to the second heterologous nucleotide sequence. [0014] In some embodiments, the portion of the second D-sequence comprises consecutive nucleotides including the 5'-most nucleotide of the second D-sequence. [0015] In some embodiments, the second heterologous nucleotide sequence comprises, consists of, or consists essentially of a sequence of 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). [0016] In some embodiments, the rAAV genome is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, or a combination thereof. In some embodiments, the rAAV genome is of serotype AAV2, AAV3, or AAV6. [0017] In some embodiments, the rAAV genome comprises AAV2 inverted terminal repeats (ITRs). [0018] In some embodiments, the rAAV genome further comprises a nucleic acid sequence comprising a gene of interest. In some embodiments, the gene of interest encodes a therapeutic agent and/or a diagnostic agent. [0019] In some embodiments, the rAAV genome further comprises a regulatory element. In some embodiments, the regulatory element comprises a promoter, an enhancer, a silencer, an insulator, a response element, an initiation site, a termination signal, or a ribosome binding site. [0020] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a tissue-specific promoter, a cell type-specific promoter, or a synthetic promoter. [0021] In some embodiments, the rAAV genome is at least 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb or more in length. [0022] According to some aspects, rAAV particles are provided herein. In some embodiments, an rAAV particle comprises an rAAV genome disclosed herein and a capsid. [0023] In some embodiments, the capsid comprises a modified capsid protein, wherein the modified capsid protein comprises an amino acid substitution at a position corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2. In some embodiments, the modified capsid protein comprises amino acid substitutions at positions corresponding to each of T491, Y444, T18934 Attorney Docket No. U1202.70129WO00 Y500, and Y730 of SEQ ID NO: 2, optionally wherein the amino acid substitutions correspond to T491V, Y444F, Y500F, and Y730F substitutions in SEQ ID NO: 2. [0024] In some embodiments, the capsid is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, or a combination thereof. In some embodiments, the capsid is of serotype AAVrh74. [0025] According to some aspects, plasmids comprising a nucleic acid sequence corresponding to an rAAV genome disclosed herein are provided. [0026] According to some aspects, compositions are provided herein, wherein the composition comprises an rAAV genome disclosed herein or a plasmid disclosed herein. [0027] According to some aspects, compositions are provided herein, wherein the composition comprises an rAAV particle disclosed herein. [0028] In some embodiments, a composition disclosed herein further comprises a pharmaceutically acceptable carrier. [0029] According to some aspects, methods comprising contacting a cell with a composition disclosed herein are provided. [0030] According to some aspects, methods comprising contacting a cell with a composition comprising an rAAV particle disclosed herein, wherein the transduction efficiency of the rAAV particle is at least two-fold higher than a corresponding rAAV particle not comprising an rAAV genome (e.g., comprising a modification) disclosed herein. [0031] In some embodiments, the cell is a mammalian cell. [0032] In some embodiments, the contacting is in vivo. [0033] In some embodiments, the method further comprises administering the composition comprising the rAAV particle to a subject. [0034] In some embodiments, the cell is in the subject. [0035] In some embodiments, the subject is human. [0036] In some embodiments, the subject is at risk of or has been diagnosed with a disease, disorder, or condition. [0037] In some embodiments, the composition is administered to the subject by intravenous injection, by subcutaneous injection, by intramuscular injection, by intraperitoneal injection, or orally. [0038] In some embodiments, the contacting is in vitro or ex vivo. [0039] Each of the limitations of the disclosure can encompass various embodiments of the disclosure. It is, therefore, anticipated that each of the limitations of the disclosure involving T18934 Attorney Docket No. U1202.70129WO00 any one element or combinations of elements can be included in each aspect of the disclosure. This disclosure is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The disclosure is capable of other embodiments and of being practiced or of being carried out in various ways. BRIEF DESCRIPTION OF THE DRAWINGS [0040] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. [0041] FIG.1 shows a schematic of an inverted terminal repeat (ITR) at the 3' end of an AAV genome. The proximal 10 nucleotides of the D-sequence (relative to the terminus of the genome, labeled “D10”) are essential for AAV packaging, but are also bound by a host cell protein which suppresses second-strand synthesis. A sequence library in which 10 random nucleotides replace the D10 sequence was prepared and screened for replacement sequences that maintain AAV packaging. [0042] FIG.2 shows a schematic for the preparation and assembly of an N10 sequence library, in which the proximal 10 nucleotides of the D-sequence (relative to the terminus of the genome) are replaced with random nucleotides (shown in bold in the nucleotide sequences). Sequences with N10 substitutions are prepared and processed using restriction enzymes, then assembled into pSub201 plasmids. After processing by EcoRV restriction enzyme, the N10 library is processed and rescue, replication, and packaging are evaluated. [0043] FIG.3 shows a schematic for a screen of the N10 sequence library, with different types of modifications in the left and right ITRs. Only the N10-L1 version of the library demonstrated AAV packaging. “HP” indicates the hairpin element of the AAV-ITR in each construct. The 82 nucleotides in addition to the N10 sequence in the L1 and R1 constructs contain binding sites for muscle-specific transcription factors. The 111 nucleotides in addition to the N10 sequence in the L2 and R2 constructs contain liver-specific enhancer elements. [0044] FIG.4 shows a schematic of the plasmid used to generate GenZ vectors (top), with N10 sequences replacing the D10 sequences in both ITRs (cross-hatched boxes). The plasmid and corresponding AAV genome comprise a chicken β-actin promoter (“CBAp”) operably linked to nucleic acid sequences encoding firefly luciferase (“FLuc”) and a yellow fluorescent T18934 Attorney Docket No. U1202.70129WO00 protein (“EYFP”) with a poly A tail (“pA”), situated between the N10-modified ITRs. This plasmid can be used to generate GenZ AAV vectors with a single-stranded genome (bottom). [0045] FIG.5 shows a schematic of a GenZ ssAAV-CBAp-FLuc-EYFP vector. In the schematic, both ITRs are modified with the N10 substitution. The schematic on the left side of the figure shows an overview of the vector for illustrative purposes, to show the overall structure rather than a specific sequence of the vector. Each segment (indicated by a shaded block) in the schematic on the left side represents a different portion of an AAV genome, including the ITR, TRS-N10, and D10 segments, an enhancer segment, a promoter segment, an intron segment, a coding sequence segment (encoding firefly luciferase), a second coding sequence segment (encoding EYFP), a polyA tail segment, and second D10, N10-TRS, and ITR segments. [0046] FIGs.6A and 6B show results of transduction of primary human skeletal muscle cells in vitro with GenZ ssAAV-CBAp-FLuc-EYFP vectors. FIG.6A shows fluorescence micrographs of EYFP in mock-treated cells (left panel, “Mock”), cells treated with 3,000 viral genomes (vgs) per cell (middle panel, “3,000 vgs/cell”), and cells treated with 10,000 vgs per cell (right panel, “10,000 vgs/cell”). The fluorescence micrographs show no EYFP signal in mock-treated cells, and EYFP signal in both the cells treated with 3,000 vgs/cell and with 10,000 vgs/cell of the GenZ vectors, with more signal in the 10,000 vgs/cell micrograph. FIG. 6B shows quantification of the transgene expression in the skeletal muscle cells, measured as EYFP-positive pixels2 per visual field. [0047] FIGs.7A and 7B show transduction efficiency of wild-type control (ssAAV-FLuc- EYFP) and GenZ (GenZ ssAAV-Fluc-EYFP) vectors in HeLa cells in vitro. Cells were transduced with 1,000 viral genomes (vgs) per cell and transgene expression was visualized by fluorescence microscopy 72 hours post-transduction. FIG.7A shows a fluorescence micrograph of EYFP in cells treated with the control vector (not comprising the GenZ genome modifications). FIG.7B shows a fluorescence micrograph of EYFP in cells treated with the GenZ vector. The micrographs show about 20-fold higher transgene expression in the GenZ- treated cells relative to the control-treated cells. [0048] FIGs.8A and 8B show transduction efficiency of wild-type control (ssAAV-FLuc- EYFP) and GenZ (GenZ ssAAV-FLuc-EYFP) vectors in C57BL6/J mice in vivo. Approximately 1x108 viral genomes (vgs) of each vector were administered intravenously via the tail vein and whole-body bioluminescence images were obtained 8 days after administration. FIG.8A shows bioluminescence imaging of mice administered the control T18934 Attorney Docket No. U1202.70129WO00 vector (not comprising the GenZ genome modifications). FIG.8B shows bioluminescence imaging of mice administered the GenZ vector. The GenZ vector showed ~5-fold increase in transgene expression in the liver compared to the control vector. [0049] FIGs.9A-9D show transduction efficiency of wild-type (WT, left panels) and GenZ (right panels) ssAAVrh74 (FIG.9A), AAV3 (FIG.9B), AAV2 (FIG.9C), and AAV6 (FIG. 9D) vectors in human HeLa cells in vitro. Cells were transduced with each vector at 1,000 viral genomes (vgs)/cell and transgene expression was visualized via fluorescence microscopy 72 hours post-transduction. [0050] FIG.10 shows transgene expression in HeLa cells transduced with wild-type (WT) or GenZ ssAAVrh74 vectors (3,000 vgs/cell), with pre-incubation (“Before”) or co-incubation (“During”) with AAVrh74 empty capsids (“+AAVrh74 empty capsids”), AAV2 empty capsids (“+AAV2 empty capsids”), AAV3 empty capsids (“+AAV3 empty capsids”), or AAV6 empty capsids (“+AAV6 empty capsids”). Transgene expression was visualized and quantitated by ImageJ analysis. ns=not significant. DETAILED DESCRIPTION [0051] The present disclosure is based at least in part on the development of adeno-associated virus (AAV) genomes and particles useful in the delivery of various cargoes to cells, facilitating efficient transgene expression therein. The disclosure relates, at least in part, to the finding that incorporation of sequence modifications into AAV genomes results in improvements in various characteristics of AAVs, such as packaging, transduction efficiency, transgene expression, etc. These improvements may result from increased second-strand synthesis of the AAV genome, resulting from modifications therein. The AAV genomes, particles, etc., disclosed herein may be used in a variety of applications including but not limited to compositions and methods (e.g., therapeutic and diagnostic methods). Therapeutic and diagnostic methods disclosed herein include those useful in the treatment and diagnosis of various diseases, disorders, and conditions, in subjects in need thereof. [0052] Provided herein are compositions comprising AAV particles (e.g., infectious AAV particles), AAV genomes (e.g., genomes comprising sequence modifications), and methods of using the compositions for transducing cells of interest (e.g., for treating or diagnosing a disease or condition in a subject. T18934 Attorney Docket No. U1202.70129WO00 Nucleic Acid Vectors (e.g., AAV Genomes) [0053] According to some aspects, provided herein are nucleic acid vectors (e.g., AAV genomes, e.g., recombinant AAV (rAAV) genomes) that may be encapsidated by wild-type AAV capsids or any one of the AAV capsids (e.g., comprising a capsid protein comprising one or more amino acid substitutions) as provided herein. [0054] A nucleic acid vector (e.g., an AAV genome) provided herein may comprise AAV inverted terminal repeat(s) modified to improve (e.g., increase the rate, efficiency, etc.) second- strand synthesis. In some embodiments, an ITR as provided herein is a 5' ITR, i.e. an ITR that is 5' from a transgene in a nucleic acid vector (e.g., an AAV genome). An ITR serves as an origin of replication and is comprised of two arm palindromes (B-B' and C-C') embedded in a larger stem palindrome (A-A'). An AAV ITR can be in flip or flop configurations. See e.g., Mroske, et al., Human Gene Therapy Methods 23(2):128-36 (2012). In some embodiments, an ITR has the B-B' and the C-C' palindrome closest to the 3' end. In wild-type ITRs, the D- sequence is present only once at each end of the genome thus remaining single-stranded. The D-sequence is also referred to as the “D-element” in the art. The D-sequence consists of 20 or approximately 20 (e.g., 19, 20, 21, 22, 23, 24, etc.) nucleotides adjacent to the terminal resolution site (trs), and generally consists or consists essentially of the medial 20 (or approximately 20) nucleotides of the ITR (where “medial” indicates the segment of the ITR that is adjacent to the center of the AAV genome). The first nucleotide of the D-sequence is generally at position 126 or approximately position 126 from the terminus of the AAV genome. See, e.g., Yan, et al., “Inverted Terminal Repeat Sequences Are Important for Intermolecular Recombination and Circularization of Adeno-Associated Virus Genomes” J Virol.79(1):364-379 (2005); Earley, et al., “Adeno-Associated Virus Serotype-Specific Inverted Terminal Repeat Sequence Role in Vector Transgene Expression” Hum Gene Ther. 31(3-4):151-162 (2020); Shitik, et al., “AAV- based vector improvements unrelated to capsid protein modification” Front Med.10:1106085 (2023), doi: 10.3389/fmed.2023.1106085; Savy, et al., “Impact of Inverted Terminal Repeat Integrity on rAAV8 Production Using the Baculovirus/Sf9 Cells System” Hum Gene Ther Methods 28(5): 277-289 (2017); Wilmott, et al., “A User's Guide to the Inverted Terminal Repeats of Adeno-Associated Virus” Hum Gene Ther Methods 30(6): 206-213 (2019); and Zhou, et al., “Deletion of the B-B’ and C-C’ regions of inverted terminal repeats reduces rAAV productivity but increases transgene expression” Sci Rep.7:5432 (2017), doi: 10.1038/s41598-017-04054-4; the entire contents of each of which are herein incorporated by reference. T18934 Attorney Docket No. U1202.70129WO00 [0055] In some embodiments, a nucleic acid vector (e.g., an AAV genome) as provided herein comprises a first inverted terminal repeat (ITR) and a second ITR. In some embodiments, the first ITR is modified. In some embodiments, the second ITR is modified. In some embodiments, a modification of an ITR comprises substitution of the entire D-sequence or substitution of part of a D-sequence. In some embodiments, a modification of an ITR comprises deletion of an entire D-sequence (e.g., the D-sequence of the left ITR or the right ITR) or deletion of part of a D-sequence (e.g., the proximal 10 nucleotides of the ITR, relative to the terminus of the nucleic acid vector). For example, a modification of an ITR may in some embodiments comprise deletion or substitution of 1-20 nucleotides of the D-sequence. In some embodiments, the proximal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides of the D-sequence, relative to the terminus of the nucleic acid vector, are deleted or substituted. In some embodiments, the proximal 10 nucleotides of the D-sequence, relative to the terminus of the nucleic acid vector, are deleted or substituted. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides in the middle of the D-sequence are deleted or substituted (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides beginning 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 3' or 5' end of the D-sequence). In some embodiments, the distal 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides of the D- sequence, relative to the terminus of the nucleic acid vector, are deleted or substituted. In some embodiments, the distal 10 nucleotides of the D-sequence, relative to the terminus of the nucleic acid vector, are deleted or substituted. In some embodiments, a D-sequence comprises the sequence CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16) of the wild-type AAV2 ITR, or a corresponding sequence of a different serotype ITR. In some embodiments, a D-sequence is defined by the sequence CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16). In embodiments in which a portion or the entirety of a D-sequence of an ITR (e.g., the D- sequence of the left ITR or of the right ITR of a nucleic acid vector described herein) is substituted, the substituted sequence may be any alternative sequence described herein, such as a sequence described as a “heterologous nucleotide sequence.” [0056] As used herein, a “heterologous” nucleotide sequence or nucleic acid sequence refers to a sequence that is not native to an AAV or naturally-occurring in an AAV. A heterologous sequence can be a short sequence (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides in length, or of a similar length), or can be a longer sequence (e.g., about 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 nucleotides in length, or longer). A T18934 Attorney Docket No. U1202.70129WO00 heterologous sequence can comprise a coding sequence (e.g., encoding a gene of interest) or can be a non-coding sequence (e.g., inserted in or replacing a regulatory or structural portion of an AAV nucleic acid, such as an AAV genome). [0057] A nucleic acid vector (e.g., an AAV genome) may comprise one or more heterologous nucleic acid sequences comprising a gene of interest (e.g., encoding a protein or polypeptide of interest) and one or more sequences comprising inverted terminal repeat (ITR) sequences (e.g., wild-type ITR sequences or modified ITR sequences) flanking the one or more heterologous nucleic acid sequences. In some embodiments, a nucleic acid vector (e.g., an AAV genome) is encapsidated within an AAV capsid forming an AAV particle. In some embodiments, a nucleic acid vector disclosed herein is encapsidated by a wild-type AAV capsid disclosed herein or another AAV capsid disclosed herein, such as an AAV capsid comprising one or more amino acid substitutions. [0058] In some embodiments, a nucleic acid vector (e.g., an AAV genome) comprises native AAV genes or native AAV nucleotide sequences. In some embodiments, one or more native AAV genes or native AAV nucleotide sequences may be removed from a nucleic acid vector (e.g., an AAV genome). In some embodiments, one or more native AAV genes or native AAV nucleotide sequences may be removed from a nucleic acid vector (e.g., an AAV genome) and replaced with a gene or interest. [0059] A nucleic acid vector (e.g., an AAV genome) can be of any AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, or AAVrh74, or a combination of serotypes. In some embodiments, a nucleic acid vector (e.g., an AAV genome) encapsidated within an AAV capsid forms a pseudotyped AAV particle, such that the genome is of a serotype distinct from the capsid in which it is encapsidated. For example, a nucleic acid vector (e.g., an AAV genome) of serotype AAV2 may be encapsidated within a capsid of serotype AAVrh74. [0060] In some embodiments, a nucleic acid vector (e.g., an AAV genome) is single-stranded and comprises a first inverted terminal repeat (ITR) and a second ITR. As disclosed herein, the first ITR refers to the ITR at the 5' terminus of the nucleic acid vector (e.g., AAV genome), and the second ITR refers to the ITR at the 3' terminus of the nucleic acid vector (e.g., AAV genome). Each ITR in its native or wild-type form is or is about 145 nucleotides in length (e.g., about 140 nucleotides, about 145 nucleotides, about 150 nucleotides, about 155 nucleotides, about 160 nucleotides, or about 165 nucleotides) and comprises a D-sequence. Each ITR can independently be of any AAV serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, T18934 Attorney Docket No. U1202.70129WO00 AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, or AAVrh74), or both ITRs may be of the same serotype. ITRs are described, for example, in Grimm et al. J. Virol. 80(1):426-439 (2006). Exemplary left ITR sequences are provided below. In each ITR sequence, the D-sequence is underlined. A right ITR has a nucleotide sequence which is the reverse complement of the corresponding left ITR (e.g., the AAV2 right ITR has a nucleotide sequence which is the reverse complement of the AAV2 left ITR). [0061] Example of wild-type AAV1 left ITR: TTGCCCACTCCCTCTCTGCGCGCTCGCTCGCTCGGTGGGGCCTGCGGACCAAAGGTCCGCAGACGGCAG AGGTCTCCTCTGCCGGCCCCACCGAGCGAGCGAGCGCGCAGAGAGGGAGTGGGCAACTCCATCACTAGG GGTAA (SEQ ID NO: 28) [0062] Example of wild-type AAV2 left ITR: TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCG GGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGG GGTTCCT (SEQ ID NO: 29) [0063] Example of wild-type AAV3 left ITR: TTGGCCACTCCCTCTATGCGCACTCGCTCGCTCGGTGGGGCCTGGCGACCAAAGGTCGCCAGACGGACG TGCTTTGCACGTCCGGCCCCACCGAGCGAGCGAGTGCGCATAGAGGGAGTGGCCAACTCCATCACTAGA GGTATGGC (SEQ ID NO: 30) [0064] Example of wild-type AAV4 left ITR: TTGGCCACTCCCTCTATGCGCGCTCGCTCACTCACTCGGCCCTGGAGACCAAAGGTCTCCAGACTGCCG GCCTCTGGCCGGCAGGGCCGAGTGAGTGAGCGAGCGCGCATAGAGGGAGTGGCCAACTCCATCATCTAG GTTTGCCC (SEQ ID NO: 31) [0065] Example of wild-type AAV5 left ITR: CTCTCCCCCCTGTCGCGTTCGCTCGCTCGCTGGCTCGTTTGGGGGGGTGGCAGCTCAAAGAGCTGCCAG ACGACGGCCCTCTGGCCGTCGCCCCCCCAAACGAGCCAGCGAGCGAGCGAACGCGACAGGGGGGAGAGT GCCACACTCTCAAGCAAGGGGGTTTTGTA (SEQ ID NO: 32) [0066] Example of wild-type AAV6 left ITR: TTGCCCACTCCCTCTATGCGCGCTCGCTCGCTCGGTGGGGCCTGCGGACCAAAGGTCCGCAGACGGCAG AGCTCTGCTCTGCCGGCCCCACCGAGCGAGCGAGCGCGCATAGAGGGAGTGGGCAACTCCATCACTAGG GGTA (SEQ ID NO: 33) [0067] Example of wild-type AAVrh74 left ITR: TTGCCCACTCCCTCTCTGCGCGCTCGCTCGCTCGGTGGGGCCTGCGGACCAAAGGTCCGCAGACGGCAG AGGTCTCCTCTGCCGGCCCCACCGAGCGAGCGAGCGCGCAGAGAGGGAGTGGGCAACTCCATCACTAGG GGTAA (SEQ ID NO: 34) T18934 Attorney Docket No. U1202.70129WO00 [0068] In some embodiments, a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of an ITR. In some embodiments, a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of a left ITR. In some embodiments, a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of a right ITR. In some embodiments, a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of both a left ITR and a right ITR. In some embodiments, a nucleic acid vector (e.g., an AAV genome) comprises a modification (e.g., a deletion, a substitution, or an insertion) of either a left ITR or a right ITR, but not both (i.e., the nucleic acid vector comprises a modification of only one ITR). [0069] The ITR sequence comprises a terminal sequence at the 5' or 3' end of the nucleic acid vector (e.g., AAV genome) which forms a palindromic double-stranded T-shaped hairpin structure, and an additional sequence which remains single-stranded (i.e., is not part of the T- shaped hairpin structure), termed the D-sequence. The D-sequence of an ITR is typically approximately 20 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides located at the distal (relative to the terminus of the nucleic acid vector) end of the ITR (e.g., the 3' end of the ITR at the 5' end of the genome, or the 5' end of the ITR at the 3' end of the genome), and corresponds to the sequence of CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16) of the wild-type AAV2 left ITR or a corresponding sequence in an ITR of another serotype. The D- sequence of an ITR in some embodiments comprises, consists essentially of, or consists of the nucleic acid sequence CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16) of the wild-type AAV2 left ITR or a corresponding sequence in an ITR of another serotype. [0070] In some embodiments, the D-sequence of an ITR (e.g., the first ITR or the second ITR) of a nucleic acid vector (e.g., an AAV genome) disclosed herein is entirely or partially removed. In some embodiments, the D-sequence of both ITRs of a nucleic acid vector (e.g., an AAV genome) disclosed herein is entirely or partially removed. In some embodiments, the D- sequence of an ITR (e.g., the first ITR or the second ITR) is entirely or partially replaced with a non-AAV sequence (i.e., a nucleotide sequence that is not from an AAV nucleic acid). In some embodiments, the D-sequence of an ITR (e.g., the first ITR or the second ITR) is entirely or partially replaced with a heterologous nucleotide sequence. In some embodiments, the heterologous nucleotide sequence comprises, consists essentially of, or consists of the nucleic acid sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: T18934 Attorney Docket No. U1202.70129WO00 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). In some embodiments, the heterologous nucleotide sequence has at least 70% identity (e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity) with the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). In some embodiments, the heterologous nucleotide sequence has less than 95% identity (e.g., less than 90% identity, less than 85% identity, less than 80% identity, less than 75% identity, or less than 70% identity) with the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). In some embodiments, the heterologous nucleotide sequence has about 70% to about 95% identity (e.g., about 95% identity, about 90% identity, about 85% identity, about 80% identity, about 75% identity, or about 70% identity) with the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). In some embodiments, the heterologous nucleotide sequence has fewer than 6 mismatches (e.g., fewer than 5, fewer than 4, fewer than 3, fewer than 2, 1, or no mismatches) relative to the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). In some embodiments, the heterologous nucleotide sequence has 1, 2, 3, 4, 5, or 6 mismatches relative to the sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). In some embodiments, the heterologous nucleotide sequence has a length of or about 10 nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides). [0071] In some embodiments, a heterologous nucleotide sequence is inserted into a nucleic acid vector (e.g., an AAV genome) (i.e., instead of substituting a portion of an ITR). For example, a heterologous nucleotide sequence may be inserted inside the D-sequence of an ITR, upstream of the D-sequence of an ITR, or downstream of the D-sequence of an ITR. T18934 Attorney Docket No. U1202.70129WO00 [0072] In some embodiments, substitution of a D-sequence comprises substitution of at least 5 nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides) of the D- sequence with a different nucleotide sequence (e.g., a heterologous nucleotide sequence or portion thereof). In some embodiments, substitution of a D-sequence comprises substitution of 10 nucleotides of the D-sequence. In some embodiments, substitution of a D-sequence comprises substitution of the 3'-most 10 nucleotides of the D-sequence (e.g., of the D-sequence of the ITR at the 3' end of the nucleic acid vector (e.g., AAV genome)). In some embodiments, substitution of a D-sequence comprises substitution of the 5'-most 10 nucleotides of the D- sequence (e.g., of the D-sequence of the ITR at the 5' end of the nucleic acid vector (e.g., AAV genome)). In some embodiments, substitution of a D-sequence comprises substitution of an internal portion (i.e., not comprising a terminal nucleotide) of the D-sequence, such as 10 nucleotides of the internal portion of the D-sequence. [0073] In some embodiments, an ITR comprising a substitution, insertion, or deletion as disclosed herein comprises one or more additional modifications, such as an additional substitution, modification, or deletion in another portion of the ITR. [0074] In some embodiments, modification of a nucleic acid vector (e.g., an AAV genome) as provided herein results in the generation of a nucleic acid vector with increased capacity. For example, wild-type AAV genomes are approximately 4.7 kilobases (kb) in length; recombinant AAV genomes have typically been limited to approximately this same length. See, e.g., Wu, et al., Mol Ther. (2010) 18(1): 80-86. Self-complementary AAV genomes are often even more limited, with maximum packaging capacities of about 2.3 kb. The modifications provided herein can, in some embodiments, enable substantially larger AAV genomes (comprising the modification(s)) to be useful in generating AAV particles for delivery of genes of interest. [0075] In some embodiments, an AAV genome disclosed herein comprising a modification can be generated having a length greater than a corresponding AAV genome not comprising the modification, without substantial negative impacts on AAV genome rescue, replication, and/or packaging. [0076] In some embodiments, an AAV genome disclosed herein is about 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb, 14.5 kb, 15 kb, 15.5 kb, 16 kb, 16.5 kb, 17 kb, 17.5 kb, or more in length. In some embodiments, an AAV genome disclosed herein is at least 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb, 14.5 kb, 15 kb, 15.5 kb, 16 T18934 Attorney Docket No. U1202.70129WO00 kb, 16.5 kb, 17 kb, 17.5 kb, or more in length. In some embodiments, an AAV genome disclosed herein is less than 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb, 14.5 kb, 15 kb, 15.5 kb, 16 kb, 16.5 kb, 17 kb, or 17.5 kb in length. It should be understood that an AAV genome disclosed herein can be of any size or size range within the kb values disclosed herein (e.g., an AAV genome can be 4-17.5 kb in length, 7-10 kb in length, 6-9.5 kb in length, or any range or combination of lengths disclosed herein). [0077] A nucleic acid vector (e.g., an AAV genome) as disclosed herein in some embodiments comprises one or more regulatory elements, such as regulatory elements operably linked to a transgene. In some embodiments, a regulatory element is located between two ITRs, a 5' ITR and a 3' ITR. In some embodiments, a regulatory element is located upstream of or 5' relative to a transgene. In some embodiments, a regulatory element is located downstream of or 3' relative to the 5' ITRs as described herein. In some embodiments, a regulatory element is located upstream of or 5' relative to a transgene and downstream of or 3' relative to a 5' ITR. A regulatory element refers to a nucleotide sequence or structural component of a nucleic acid vector which is involved in the regulation of expression of components of the nucleic acid vector (e.g., a gene of interest comprised therein). Regulatory elements include, but are not limited to, promoters, enhancers, silencers, insulators, response elements, initiation sites, termination signals, and ribosome binding sites. [0078] Promoters include constitutive promoters, inducible promoters, tissue-specific promoters, cell type-specific promoters, and synthetic promoters. For example, a nucleic acid vector disclosed herein may include viral promoters or promoters from mammalian genes that are generally active in promoting transcription. Non-limiting examples of constitutive viral promoters include the Herpes Simplex virus (HSV), thymidine kinase (TK), Rous Sarcoma Virus (RSV), Simian Virus 40 (SV40), Mouse Mammary Tumor Virus (MMTV), Ad E1A and cytomegalovirus (CMV) promoters. Non-limiting examples of constitutive mammalian promoters include various housekeeping gene promoters, as exemplified by the β-actin promoter. [0079] Inducible promoters or other inducible regulatory elements may also be used to achieve desired expression levels of a gene of interest (e.g., a protein or polypeptide of interest). Non- limiting examples of suitable inducible promoters include those from genes such as cytochrome P450 genes, heat shock protein genes, metallothionein genes, and hormone- T18934 Attorney Docket No. U1202.70129WO00 inducible genes, such as the estrogen gene promoter. Another example of an inducible promoter is the tetVP16 promoter that is responsive to tetracycline. [0080] Tissue-specific promoters or other tissue-specific regulatory elements are also contemplated herein. [0081] Synthetic promoters are also contemplated herein. A synthetic promoter may comprise, for example, regions of known promoters, regulatory elements, transcription factor binding sites, enhancer elements, repressor elements, and the like. [0082] In some embodiments, a nucleic acid vector (e.g., an AAV genome) provided herein comprises a nucleotide sequence encoding a product (e.g., a protein or polypeptide product). In some embodiments, a nucleotide sequence comprises a nucleotide sequence of a gene of interest. In some embodiments, a gene of interest encodes a therapeutic and/or diagnostic agent (e.g., protein or polypeptide). In some embodiments, a therapeutic or diagnostic agent is an antibody, a peptibody, a growth factor, a clotting factor, a hormone, a membrane protein, a cytokine, a chemokine, an activating or inhibitory peptide acting on cell surface receptors or ion channels, a cell-permeant peptide targeting intracellular processes, a thrombolytic agent, an enzyme, a bone morphogenetic protein, a nuclease, a protein used for gene editing, an Fc- fusion protein, an anticoagulant, or a protein or polypeptide that can be detected using a laboratory test. In some embodiments, a nucleic acid vector (e.g., an AAV genome) provided herein comprises a nucleotide sequence encoding a guide RNA or other nucleic acid used for gene editing, optionally in addition to a protein used for gene editing. [0083] In some embodiments, a product encoded by a nucleic acid vector (e.g., an AAV genome) disclosed herein is a detectable molecule. A detectable molecule is a molecule that can be visualized (e.g., using a naked eye, under a microscope, or using a light detection device such as a camera). In some embodiments, the detectable molecule is a fluorescent molecule, a bioluminescent molecule, or a molecule that provides color (e.g., β-galactosidase, β-lactamase, β-glucuronidase, or spheroidenone). In some embodiments, the detectable molecule is a fluorescent, bioluminescent or enzymatic protein or functional peptide or polypeptide thereof. [0084] In some embodiments, fluorescent protein is a blue fluorescent protein, a cyan fluorescent protein, a green fluorescent protein, a yellow fluorescent protein, an orange fluorescent protein, a red fluorescent protein, or a functional peptide or polypeptide thereof. A blue fluorescent protein may be azurite, EBFP, EBFP2, mTagBFP, or Y66H. A cyan fluorescent protein may be ECFP, AmCyan1, Cerulean, CyPet, mECFP, Midori-ishi Cyan, mTFP1, or TagCFP. A Green fluorescent protein may be AcGFP, Azami Green, EGFP, T18934 Attorney Docket No. U1202.70129WO00 Emarald, GFP or a mutated form of GFP (e.g., GFP-S65T, mWasabi, Stemmer, Superfolder GFP, TagGFP, TurboGFP, or ZsGreen). A yellow fluorescent protein may be EYFP, mBanana, mCitrine, PhiYFp, TagYFP, Topaz, Venus, YPet, or ZsYellow1. An orange fluorescent protein may be DsRed, RFP, DsRed2, DsRed-Express, Ds-Red-monomer, Tomato, tdTomato, Kusabira Orange, mKO2, mOrange, mOrange2, mTangerine, TagRFP, or TagRFP- T. A red fluorescent protein may be AQ142, AsRed2, dKeima-Tandem, HcRed1, tHcRed, Jred, mApple, mCherry, mPlum, mRasberry, mRFP1, mRuby or mStrawberry. [0085] In some embodiments, a detectable molecule is a bioluminescent protein or a functional peptide or polypeptide thereof. Non-limiting examples of bioluminescent proteins are firefly luciferase, click-beetle luciferase, Renilla luciferase, and luciferase from Oplophorus gracilirostris. [0086] In some embodiments, a detectable molecule may be any polypeptide or protein that can be detected using methods known in the art. Non-limiting methods of detection are fluorescence imaging, luminescent imaging, bright filed imaging, and include imaging facilitated by immunofluorescence or immunohistochemical staining. [0087] Additional features of AAV particles, nucleic acid vectors, and capsid proteins are described in Patent Application Publication No. US2017/0356009, the contents of which are incorporated herein by reference in their entirety. [0088] In some embodiments, a nucleic acid vector (e.g., an AAV genome) is comprised within or encoded by a plasmid. [0089] Nucleic acid vectors as disclosed herein, e.g., comprising modified ITRs, can be prepared by one of ordinary skill in the art by known methods. AAV Particles [0090] According to some aspects, provided herein are AAV particles that comprise any of the nucleic acid vectors (e.g., AAV genomes) disclosed herein. An AAV particle is a supramolecular assembly of 60 individual capsid protein subunits forming a non-enveloped T- 1 icosahedral lattice capable of protecting a single-stranded DNA genome. A mature AAV particle is approximately 20 nm in diameter, and its capsid is formed from three structural capsid proteins VP1, VP2, and VP3, with molecular masses of 87, 73, and 62 kDa, respectively, in a ratio of approximately 1:1:18. The 60 capsid proteins are arranged in an anti- Attorney Docket No. U1202.70129WO00 parallel β-strand barreloid arrangement, resulting in a defined tropism and a high resistance to degradation. [0091] In some embodiments, an AAV particle comprises an empty capsid (e.g., a capsid without a cargo). In some embodiments, an AAV particle comprises a capsid encapsidating a nucleic acid (e.g., a nucleic acid vector that comprises a gene of interest, such as a nucleic acid vector disclosed herein). In some embodiments, a nucleic acid encapsidated within an AAV capsid to generate an AAV particle comprises a nucleic acid vector disclosed herein. In some embodiments, an AAV particle disclosed herein comprises a capsid protein comprising one or more mutations, e.g., one or more amino acid substitutions. [0092] It is contemplated herein that any capsid protein mutations disclosed herein (e.g., amino acid substitutions) can be combined with any nucleic acid vector modifications disclosed herein (e.g., sequence deletions, substitutions, or insertions). For example, an AAV particle described herein may have an AAV capsid protein (e.g., a wild-type AAV capsid protein or one comprising one or more amino acid substitutions) and an AAV nucleic acid vector comprising a modification (e.g., a deletion or substitution of a D-sequence, and/or an insertion of a non-AAV sequence). [0093] In some embodiments, an AAV particle disclosed herein comprises a capsid protein comprising amino acid substitutions at one or more positions corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2. In some embodiments, an AAV particle disclosed herein comprises a capsid protein comprising one or more amino acid substitutions corresponding to T491V, Y444F, Y500F, and/or Y730F substitutions in SEQ ID NO: 2. [0094] In some embodiments, an AAV particle disclosed herein comprises a capsid protein comprising amino acid substitutions at one or more positions corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2 and further comprises a nucleic acid vector comprising modification (e.g., a deletion, a substitution, or an insertion) of a D-sequence of an ITR (e.g., a modification of a D-sequence of a right ITR, a left ITR, or both a right ITR and a left ITR). [0095] In some embodiments, the AAV particle comprises a capsid protein comprising amino acid substitutions at one or more positions corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2 and a nucleic acid vector comprising a substitution of a portion of a D- sequence of an ITR with a heterologous nucleotide sequence. In some embodiments, the amino acid substitutions correspond to T491V, Y444F, Y500F, and/or Y730F substitutions in SEQ ID NO: 2. In some embodiments, the heterologous nucleotide sequence comprises, consists essentially of, or consists of the nucleotide sequence 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), Attorney Docket No. U1202.70129WO00 5'-TCAAGCACAT-3' (SEQ ID NO: 27), or a reverse or reverse complement of either 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). In some embodiments, a portion or the entirety of a D-sequence of an ITR (e.g., the D-sequence of the left ITR) is substituted with the heterologous nucleotide sequence. [0096] In some embodiments, an AAV particle disclosed herein is replicative. A replicative AAV particle is capable of replicating within a host cell (e.g., a host cell within a subject or a host cell in culture). In some embodiments, an AAV particle disclosed herein is non- replicating. A non-replicating AAV particle is not capable of replicating within a host cell (e.g., a host cell within a subject or a host cell in culture), but can infect the host and incorporate a genetic components into the host’s genome for expression. In some embodiments, an AAV particle disclosed herein is capable of infecting a host cell. In some embodiments, an AAV particle disclosed herein is capable of facilitating stable integration of genetic components into the genome of a host cell. In some embodiments, an AAV particle disclosed herein is not capable of facilitating integration of genetic components into the genome of a host cell. [0097] In some embodiments, an AAV particle disclosed herein comprises a nucleic acid vector (e.g., an AAV genome) provided herein. In some embodiments, a nucleic acid vector (e.g., AAV genome) comprises two inverted terminal repeats (ITRs) adjacent to the ends of a sequence encoding a gene of interest. In some embodiments, the nucleic acid vector (e.g., AAV genome) is a single-stranded DNA vector. In some embodiments, an AAV particle disclosed herein comprises one single-stranded DNA. In some embodiments, an AAV particle disclosed herein comprises two complementary DNA strands, forming a self-complementary AAV (scAAV). [0098] In some embodiments, a nucleic acid vector that may be comprised in an AAV particle (e.g., a WT particle or particle comprising a capsid comprising any one or more mutations as disclosed herein) comprises an ITR comprising a modification (e.g., a deletion, substitution, or insertion) of part or all of the ITR’s D-sequence. In some embodiments, part or all of the ITR’s D-sequence is substituted with a heterologous nucleotide sequence. In some embodiments, part or all of the ITR’s D-sequence is deleted. Further description of such modifications (e.g., deletions, substitutions, and insertions) is provided elsewhere herein. In some embodiments, an ITR comprising a substitution, insertion, or deletion of a nucleic acid vector as disclosed herein comprises one or more additional modifications, such as an additional substitution, modification, or deletion in another portion of the ITR. T18934 Attorney Docket No. U1202.70129WO00 [0099] An AAV particle disclosed herein may be of any AAV serotype (e.g., AAV serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13), including any derivative (including non-naturally occurring variants of a serotype) or pseudotype. Non-limiting examples of derivatives and pseudotypes include AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41, AAV9.45, AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShH10, AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives/pseudotypes, and methods of producing such derivatives/pseudotypes are known in the art (see, e.g., Mol. Ther.2012 Apr; 20(4):699-708. doi: 10.1038/mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan A, Schaffer DV, Samulski RJ.). In some embodiments, the AAV particle is a pseudotyped AAV particle, which comprises a nucleic acid vector comprising ITRs from one serotype (e.g., AAV2 or AAV3) and a capsid comprised of capsid proteins derived from another serotype (i.e., a serotype other than AAV2 or AAV3, respectively). SEQ ID NOs: 1-14 provide examples of amino acid sequences of AAV capsid proteins of different serotypes. Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods, 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet., 10:3075-3081 (2001)). [0100] In some embodiments, an AAV particle disclosed herein is a recombinant AAV (rAAV) particle, e.g., comprising a recombinant nucleic acid or transgene. [0101] Any combination of modifications described herein (e.g., capsid protein modifications, a deletion or substitution of a D-sequence, and/or an insertion of a non-AAV sequence into an AAV genome, e.g., adjacent to or in a D-sequence) may result in an additive or synergistic effect, in which the beneficial properties of the resulting combination are equal to or greater than, respectively, the sum of the effects of the individual modifications. For example, an AAV particle comprising a modified capsid protein and a modified genome may have improvements in transduction efficiency, transgene expression, and/or packaging efficiency relative to a corresponding wild-type AAV particle that are equal to the sum of the improvements conferred by the individual capsid protein modification and the genome modification, or that are greater than the sum of the improvements conferred by the individual modifications. [0102] AAV particles as disclosed herein, e.g., comprising modified ITRs, can be prepared by one of ordinary skill in the art by known methods. T18934 Attorney Docket No. U1202.70129WO00 [0103] In some embodiments, AAV particles (e.g., comprising modified genome and/or capsid protein) disclosed herein can be generated using a plasmid, such as a pSub201 plasmid, which includes sequences encoding AAV Rep and capsid proteins, and in which a gene of interest can be inserted. The pSub201 sequence is provided below, in which the open reading frame encoding ampicillin-resistance marker is bolded and the D-sequences are underlined. The portions of the underlined D-sequences that are also bolded are the preferred portion that can be replaced by a heterologous nucleotide sequence. A corresponding position for replacement by a heterologous nucleotide sequence in a different sequence can be identified by methods known in the art. CAGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGT CGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTG TAGTTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGCTCTAGAGTCCTGTATTAGAGGTCA CGTGAGTGTTTTGCGACATTTTGCGACACCATGTGGTCACGCTGGGTATTTAAGCCCGAGTGAGCACGC AGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCCGCCATGCCGGGGTTTTACGAGATTGTGAT TAAGGTCCCCAGCGACCTTGACGGGCATCTGCCCGGCATTTCTGACAGCTTTGTGAACTGGGTGGCCGA GAAGGAATGGGAGTTGCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAGGCACCCCTGACCGT GGCCGAGAAGCTGCAGCGCGACTTTCTGACGGAATGGCGCCGTGTGAGTAAGGCCCCGGAGGCCCTTTT CTTTGTGCAATTTGAGAAGGGAGAGAGCTACTTCCACATGCACGTGCTCGTGGAAACCACCGGGGTGAA ATCCATGGTTTTGGGACGTTTCCTGAGTCAGATTCGCGAAAAACTGATTCAGAGAATTTACCGCGGGAT CGAGCCGACTTTGCCAAACTGGTTCGCGGTCACAAAGACCAGAAATGGCGCCGGAGGCGGGAACAAGGT GGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCGTGGAC TAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTGGCGCAGCATCT GACGCACGTGTCGCAGACGCAGGAGCAGAACAAAGAGAATCAGAATCCCAATTCTGATGCGCCGGTGAT CAGATCAAAAACTTCAGCCAGGTACATGGAGCTGGTCGGGTGGCTCGTGGACAAGGGGATTACCTCGGA GAAGCAGTGGATCCAGGAGGACCAGGCCTCATACATCTCCTTCAATGCGGCCTCCAACTCGCGGTCCCA AATCAAGGCTGCCTTGGACAATGCGGGAAAGATTATGAGCCTGACTAAAACCGCCCCCGACTACCTGGT GGGCCAGCAGCCCGTGGAGGACATTTCCAGCAATCGGATTTATAAAATTTTGGAACTAAACGGGTACGA TCCCCAATATGCGGCTTCCGTCTTTCTGGGATGGGCCACGAAAAAGTTCGGCAAGAGGAACACCATCTG GCTGTTTGGGCCTGCAACTACCGGGAAGACCAACATCGCGGAGGCCATAGCCCACACTGTGCCCTTCTA CGGGTGCGTAAACTGGACCAATGAGAACTTTCCCTTCAACGACTGTGTCGACAAGATGGTGATCTGGTG GGAGGAGGGGAAGATGACCGCCAAGGTCGTGGAGTCGGCCAAAGCCATTCTCGGAGGAAGCAAGGTGCG CGTGGACCAGAAATGCAAGTCCTCGGCCCAGATAGACCCGACTCCCGTGATCGTCACCTCCAACACCAA CATGTGCGCCGTGATTGACGGGAACTCAACGACCTTCGAACACCAGCAGCCGTTGCAAGACCGGATGTT CAAATTTGAACTCACCCGCCGTCTGGATCATGACTTTGGGAAGGTCACCAAGCAGGAAGTCAAAGACTT TTTCCGGTGGGCAAAGGATCACGTGGTTGAGGTGGAGCATGAATTCTACGTCAAAAAGGGTGGAGCCAA GAAAAGACCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAACGGGTGCGCGAGTCAGTTGCGCAGCC ATCGACGTCAGACGCGGAAGCTTCGATCAACTACGCAGACAGGTACCAAAACAAATGTTCTCGTCACGT GGGCATGAATCTGATGCTGTTTCCCTGCAGACAATGCGAGAGAATGAATCAGAATTCAAATATCTGCTT CACTCACGGACAGAAAGACTGTTTAGAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTGTCGTCAA AAAGGCGTATCAGAAACTGTGCTACATTCATCATATCATGGGAAAGGTGCCAGACGCTTGCACTGCCTG CGATCTGGTCAATGTGGATTTGGATGACTGCATCTTTGAACAATAAATGATTTAAATCAGGTATGGCTG CCGATGGTTATCTTCCAGATTGGCTCGAGGACACTCTCTCTGAAGGAATAAGACAGTGGTGGAAGCTCA AACCTGGCCCACCACCACCAAAGCCCGCAGAGCGGCATAAGGACGACAGCAGGGGTCTTGTGCTTCCTG GGTACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGAGAGCCGGTCAACGAGGCAGACGCCGCGG CCCTCGAGCACGTCAAAGCCTACGACCGGCAGCTCGACAGCGGAGACAACCCGTACCTCAAGTACAACC ACGCCGACGCGGAGTTTCAGGAGCGCCTTAAAGAAGATACGTCTTTTGGGGGCAACCTCGGACGAGCAG TCTTCCAGGCGAAAAAGAGGGTTCTTGAACCTCTGGGCCTGGTTGAGGAACCTGTTAAGACGGCTCCGG GAAAAAAGAGGCCGGTAGAGCACTCTCCTGTGGAGCCAGACTCCTCCTCGGGAACCGGAAAGGCGGGCC T18934 Attorney Docket No. U1202.70129WO00 AGCAGCCTGCAAGAAAAAGATTGAATTTTGGTCAGACTGGAGACGCAGACTCAGTACCTGACCCCCAGC CTCTCGGACAGCCACCAGCAGCCCCCTCTGGTCTGGGAACTAATACGATGGCTACAGGCAGTGGCGCAC CAATGGCAGACAATAACGAGGGCGCCGACGGAGTGGGTAATTCCTCgGGAAATTGGCATTGCGATTCCA CATGGATGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACC TCTACAAACAAATTTCCAGCCAATCAGGAGCCTCGAACGACAATCACTACTTTGGCTACAGCACCCCTT GGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAAAGACTCATCAACA ACAACTGGGGATTCCGACCCAAGAGACTCAACTTCAAGCTCTTTAACATTCAAGTCAAAGAGGTCACGC AGAATGACGGTACGACGACGATTGCCAATAACCTTACCAGCACGGTTCAGGTGTTTACTGACTCGGAGT ACCAGCTCCCGTACGTCCTCGGCTCGGCGCATCAAGGATGCCTCCCGCCGTTCCCAGCAGACGTCTTCA TGGTGCCACAGTATGGATACCTCACCCTGAACAACGGGAGTCAGGCAGTAGGACGCTCTTCATTTTACT GCCTGGAGTACTTTCCTTCTCAGATGCTGCGTACCGGAAACAACTTTACCTTCAGCTACACTTTTGAGG ACGTTCCTTTCCACAGCAGCTACGCTCACAGCCAGAGTCTGGACCGTCTCATGAATCCTCTCATCGACC AGTACCTGTATTACTTGAGCAGAACAAACACTCCAAGTGGAACCACCACGCAGTCAAGGCTTCAGTTTT CTCAGGCCGGAGCGAGTGACATTCGGGACCAGTCTAGGAACTGGCTTCCTGGACCCTGTTACCGCCAGC AGCGAGTATCAAAGACATCTGCGGATAACAACAACAGTGAATACTCGTGGACTGGAGCTACCAAGTACC ACCTCAATGGCAGAGACTCTCTGGTGAATCCGGGGCCCGCCATGGCAAGCCACAAGGACGATGAAGAAA AGTTTTTTCCTCAGAGCGGGGTTCTCATCTTTGGGAAGCAAGGCTCAGAGAAAACAAATGTGAACATTG AAAAGGTCATGATTACAGACGAAGAGGAAATCGGAACAACCAATCCCGTGGCTACGGAGCAGTATGGTT CTGTATCTACCAACCTCCAGAGAGGCAACAGACAAGCAGCTACCGCAGATGTCAACACACAAGGCGTTC TTCCAGGCATGGTCTGGCAGGACAGAGATGTGTACCTTCAGGGGCCCATCTGGGCAAAGATTCCACACA CGGACGGACATTTTCACCCCTCTCCCCTCATGGGTGGATTCGGACTTAAACACCCTCCTCCACAGATTC TCATCAAGAACACCCCGGTACCTGCGAATCCTTCGACCACCTTCAGTGCGGCAAAGTTTGCTTCCTTCA TCACACAGTACTCCACGGGACACGGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAGGAAAACAGCAAA CGCTGGAATCCCGAAATTCAGTACACTTCCAACTACAACAAGTCTGTTAATCGTGGACTTACCGTGGAT ACTAATGGCGTGTATTCAGAGCCTCGCCCCATTGGCACCAGATACCTGACTCGTAATCTGTAATTGCTT GTTAATCAATAAACCGTTTAATTCGTTTCAGTTGAACTTTGGTCTCTGCGTATTTCTTTCTTATCTAGT TTCCATGCTCTAGAGCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAACCC CTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTC GCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCCAGCTGGCGTAATAGCGA AGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGAATTCCAGACGATT GAGCGTCAAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAATGGCTGGCGGTAATATTGTTCTG GATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGA AGTATTGCGACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAA AACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCC CGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAG CGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGC GCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAA TCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGG TGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTT CTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTT ATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAA TTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTT CTGATTATCAACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGT TTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGAGACCTCTCAAAAATAGCTACCCTCTCC GGCATGAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGTGATTTGACTGTCTCCGGCCTTTCT CACCCGTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTAAAAAT TTTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACA ACCGATTTAGCTTTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGAT TTATTGGATGTTGGAATTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCAT ATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACC CGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGG GAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACG CCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAA TGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATA T18934 Attorney Docket No. U1202.70129WO00 ACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCT TATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGA TGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGA GAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATT ATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGA GTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCAT AACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGC TTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCAT ACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGG CGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACC ACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTC TCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGG GAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTG GTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAG GATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTG AGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTG CTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTT TCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGG CCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGC TGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCG GTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATA CCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAG CGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCC TGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATG GAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTT TCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCG CAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCC TCTCCCCGCGCGTTGGCCGATTCATTAATG (SEQ ID NO: 35) Capsid Proteins [0104] AAV particles disclosed herein in some embodiments comprise capsid proteins having one or more modifications characterized by amino acid substitutions. In some embodiments, an AAV capsid protein disclosed herein comprises amino acid substitutions at one or more positions corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2. In some embodiments, the amino acid substitutions correspond to T491V, Y444F, Y500F, and/or Y730F substitutions in SEQ ID NO: 2. It should be understood that an amino acid substitution at a position corresponding to a position of SEQ ID NO: 2 can be an amino acid substitution in a capsid protein of any serotype. The corresponding position in a capsid protein having a different baseline amino acid sequence can be determined by methods known in the art, such as by constructing structural alignments of the amino acid sequences and identifying corresponding amino acids. A “corresponding” amino acid to be substituted is one which is at the corresponding position, and may have the same amino acid identity (i.e., the amino acid at the corresponding position in the second capsid protein sequence is the same as the amino acid in the reference capsid protein sequence), or may be an amino acid with similar properties T18934 Attorney Docket No. U1202.70129WO00 (e.g., similar hydrophobicity, size, charge, etc.) as the amino acid in the reference capsid protein. For example, an amino acid substitution at a position corresponding to T491 of SEQ ID NO: 2, or corresponding to a T491V substitution in SEQ ID NO: 2 may be a substitution at a position corresponding to position 491 of SEQ ID NO: 2 in a second capsid protein, which may also be a threonine, or which may be a similar amino acid (e.g., another amino acid with a polar uncharged side chain, such as serine, asparagine, or glutamine). [0105] In some embodiments, an AAV capsid protein disclosed herein comprises amino acid substitutions as described in Patent Application Publication Nos. US2010/0104561, US2014/0050701, US2016/0333372, US2015/0133530, US2014/0341852, and WO2022/226289, the contents of each of which are herein incorporated by reference in their entireties for this purpose. [0106] In some embodiments, an AAV capsid protein as disclosed herein is a VP1 protein, a VP2 protein, or a VP3 protein. The VP1, VP2, and VP3 capsid proteins are each encoded from the same segment of the AAV genome, and differ in their N termini based on alternative mRNA splicing. [0107] The different capsid proteins VP1, VP2, and VP3 are defined according to numbering of the full-length VP1 protein. In some embodiments, for AAV2 capsid proteins, a VP1 capsid protein is defined by amino acids 1-735 of SEQ ID NO: 2; a VP2 capsid protein is defined by amino acids 138-735 of SEQ ID NO: 2; and a VP3 capsid protein is defined by amino acids 203-735 of SEQ ID NO: 2. Numbering of AAV capsid proteins is provided according to the VP1 sequence. For example, T491 refers to the threonine at position 491 of SEQ ID NO: 2 in a VP1 protein or the corresponding threonine in a VP2 or VP3 protein. Similarly, Y444, Y500, and Y730 refer to the tyrosines at positions 444, 500, and 730 of SEQ ID NO: 2, respectively, in a VP1 protein, or the corresponding tyrosines in a VP2 or VP3 protein. [0108] An AAV capsid protein disclosed herein can be of any serotype, or can be a chimeric capsid protein (i.e., comprising segments from capsid proteins of two or more serotypes). In some embodiments, a capsid protein disclosed herein is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, or AAVrh74 capsid protein. In some embodiments, an AAV capsid protein as provided herein is of serotype 2, serotype 3, serotype 6, or serotype rh74. Amino acid sequences of capsid proteins of other AAV serotypes are known and can be aligned with SEQ ID NO: 2 (AAV2 capsid protein) using techniques known in the art. Examples of amino acid sequences of AAV capsid proteins of various serotypes are provided below. T18934 Attorney Docket No. U1202.70129WO00 [0109] Example of an amino acid sequence of wild-type AAV1 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY 51 KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF 101 QERLQEDTSF GGNLGRAVFQ AKKRVLEPLG LVEEGAKTAP GKKRPVEQSP 151 QEPDSSSGIG KTGQQPAKKR LNFGQTGDSE SVPDPQPLGE PPATPAAVGP 201 TTMASGGGAP MADNNEGADG VGNASGNWHC DSTWLGDRVI TTSTRTWALP 251 TYNNHLYKQI SSASTGASND NHYFGYSTPW GYFDFNRFHC HFSPRDWQRL 301 INNNWGFRPK RLNFKLFNIQ VKEVTTNDGV TTIANNLTST VQVFSDSEYQ 351 LPYVLGSAHQ GCLPPFPADV FMIPQYGYLT LNNGSQAVGR SSFYCLEYFP 401 SQMLRTGNNF TFSYTFEEVP FHSSYAHSQS LDRLMNPLID QYLYYLNRTQ 451 NQSGSAQNKD LLFSRGSPAG MSVQPKNWLP GPCYRQQRVS KTKTDNNNSN 501 FTWTGASKYN LNGRESIINP GTAMASHKDD EDKFFPMSGV MIFGKESAGA 551 SNTALDNVMI TDEEEIKATN PVATERFGTV AVNFQSSSTD PATGDVHAMG 601 ALPGMVWQDR DVYLQGPIWA KIPHTDGHFH PSPLMGGFGL KNPPPQILIK 651 NTPVPANPPA EFSATKFASF ITQYSTGQVS VEIEWELQKE NSKRWNPEVQ 701 YTSNYAKSAN VDFTVDNNGL YTEPRPIGTR YLTRPL (SEQ ID NO: 1) [0110] Example of an amino acid sequence of wild-type AAV2 capsid protein 1 MAADGYLPDW LEDTLSEGIR QWWKLKPGPP PPKPAERHKD DSRGLVLPGY 51 KYLGPFNGLD KGEPVNEADA AALEHDKAYD RQLDSGDNPY LKYNHADAEF 101 QERLKEDTSF GGNLGRAVFQ AKKRVLEPLG LVEEPVKTAP GKKRPVEHSP 151 VEPDSSSGTG KAGQQPARKR LNFGQTGDAD SVPDPQPLGQ PPAAPSGLGT 201 NTMATGSGAP MADNNEGADG VGNSSGNWHC DSTWMGDRVI TTSTRTWALP 251 TYNNHLYKQI SSQSGASNDN HYFGYSTPWG YFDFNRFHCH FSPRDWQRLI 301 NNNWGFRPKR LNFKLFNIQV KEVTQNDGTT TIANNLTSTV QVFTDSEYQL 351 PYVLGSAHQG CLPPFPADVF MVPQYGYLTL NNGSQAVGRS SFYCLEYFPS 401 QMLRTGNNFT FSYTFEDVPF HSSYAHSQSL DRLMNPLIDQ YLYYLSRTNT 451 PSGTTTQSRL QFSQAGASDI RDQSRNWLPG PCYRQQRVSK TSADNNNSEY 501 SWTGATKYHL NGRDSLVNPG PAMASHKDDE EKFFPQSGVL IFGKQGSEKT 551 NVDIEKVMIT DEEEIRTTNP VATEQYGSVS TNLQRGNRQA ATADVNTQGV 601 LPGMVWQDRD VYLQGPIWAK IPHTDGHFHP SPLMGGFGLK HPPPQILIKN 651 TPVPANPSTT FSAAKFASFI TQYSTGQVSV EIEWELQKEN SKRWNPEIQY 701 TSNYNKSVNV DFTVDTNGVY SEPRPIGTRY LTRNL (SEQ ID NO: 2) [0111] Example of an amino acid sequence of wild-type AAV3 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWALKPGVP QPKANQQHQD NRRGLVLPGY 51 KYLGPGNGLD KGEPVNEADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF 101 QERLQEDTSF GGNLGRAVFQ AKKRILEPLG LVEEAAKTAP GKKGAVDQSP 151 QEPDSSSGVG KSGKQPARKR LNFGQTGDSE SVPDPQPLGE PPAAPTSLGS 201 NTMASGGGAP MADNNEGADG VGNSSGNWHC DSQWLGDRVI TTSTRTWALP 251 TYNNHLYKQI SSQSGASNDN HYFGYSTPWG YFDFNRFHCH FSPRDWQRLI 301 NNNWGFRPKK LSFKLFNIQV RGVTQNDGTT TIANNLTSTV QVFTDSEYQL 351 PYVLGSAHQG CLPPFPADVF MVPQYGYLTL NNGSQAVGRS SFYCLEYFPS 401 QMLRTGNNFQ FSYTFEDVPF HSSYAHSQSL DRLMNPLIDQ YLYYLNRTQG 451 TTSGTTNQSR LLFSQAGPQS MSLQARNWLP GPCYRQQRLS KTANDNNNSN 501 FPWTAASKYH LNGRDSLVNP GPAMASHKDD EEKFFPMHGN LIFGKEGTTA 551 SNAELDNVMI TDEEEIRTTN PVATEQYGTV ANNLQSSNTA PTTGTVNHQG 601 ALPGMVWQDR DVYLQGPIWA KIPHTDGHFH PSPLMGGFGL KHPPPQIMIK 651 NTPVPANPPT TFSPAKFASF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ 701 YTSNYNKSVN VDFTVDTNGV YSEPRPIGTR YLTRNL (SEQ ID NO: 3) [0112] Example of an amino acid sequence of wild-type AAV4 capsid protein 1 MTDGYLPDWL EDNLSEGVRE WWALQPGAPK PKANQQHQDN ARGLVLPGYK 51 YLGPGNGLDK GEPVNAADAA ALEHDKAYDQ QLKAGDNPYL KYNHADAEFQ 101 QRLQGDTSFG GNLGRAVFQA KKRVLEPLGL VEQAGETAPG KKRPLIESPQ 151 QPDSSTGIGK KGKQPAKKKL VFEDETGAGD GPPEGSTSGA MSDDSEMRAA T18934 Attorney Docket No. U1202.70129WO00 201 AGGAAVEGGQ GADGVGNASG DWHCDSTWSE GHVTTTSTRT WVLPTYNNHL 251 YKRLGESLQS NTYNGFSTPW GYFDFNRFHC HFSPRDWQRL INNNWGMRPK 301 AMRVKIFNIQ VKEVTTSNGE TTVANNLTST VQIFADSSYE LPYVMDAGQE 351 GSLPPFPNDV FMVPQYGYCG LVTGNTSQQQ TDRNAFYCLE YFPSQMLRTG 401 NNFEITYSFE KVPFHSMYAH SQSLDRLMNP LIDQYLWGLQ STTTGTTLNA 451 GTATTNFTKL RPTNFSNFKK NWLPGPSIKQ QGFSKTANQN YKIPATGSDS 501 LIKYETHSTL DGRWSALTPG PPMATAGPAD SKFSNSQLIF AGPKQNGNTA 551 TVPGTLIFTS EEELAATNAT DTDMWGNLPG GDQSNSNLPT VDRLTALGAV 601 PGMVWQNRDI YYQGPIWAKI PHTDGHFHPS PLIGGFGLKH PPPQIFIKNT 651 PVPANPATTF SSTPVNSFIT QYSTGQVSVQ IDWEIQKERS KRWNPEVQFT 701 SNYGQQNSLL WAPDAAGKYT EPRAIGTRYL THHL (SEQ ID NO: 4) [0113] Example of an amino acid sequence of wild-type AAV5 capsid protein 1 MSFVDHPPDW LEEVGEGLRE FLGLEAGPPK PKPNQQHQDQ ARGLVLPGYN 51 YLGPGNGLDR GEPVNRADEV AREHDISYNE QLEAGDNPYL KYNHADAEFQ 101 EKLADDTSFG GNLGKAVFQA KKRVLEPFGL VEEGAKTAPT GKRIDDHFPK 151 RKKARTEEDS KPSTSSDAEA GPSGSQQLQI PAQPASSLGA DTMSAGGGGP 201 LGDNNQGADG VGNASGDWHC DSTWMGDRVV TKSTRTWVLP SYNNHQYREI 251 KSGSVDGSNA NAYFGYSTPW GYFDFNRFHS HWSPRDWQRL INNYWGFRPR 301 SLRVKIFNIQ VKEVTVQDST TTIANNLTST VQVFTDDDYQ LPYVVGNGTE 351 GCLPAFPPQV FTLPQYGYAT LNRDNTENPT ERSSFFCLEY FPSKMLRTGN 401 NFEFTYNFEE VPFHSSFAPS QNLFKLANPL VDQYLYRFVS TNNTGGVQFN 451 KNLAGRYANT YKNWFPGPMG RTQGWNLGSG VNRASVSAFA TTNRMELEGA 501 SYQVPPQPNG MTNNLQGSNT YALENTMIFN SQPANPGTTA TYLEGNMLIT 551 SESETQPVNR VAYNVGGQMA TNNQSSTTAP ATGTYNLQEI VPGSVWMERD 601 VYLQGPIWAK IPETGAHFHP SPAMGGFGLK HPPPMMLIKN TPVPGNITSF 651 SDVPVSSFIT QYSTGQVTVE MEWELKKENS KRWNPEIQYT NNYNDPQFVD 701 FAPDSTGEYR TTRPIGTRYL TRPL (SEQ ID NO: 5) [0114] Example of an amino acid sequence of wild-type AAV6 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY 51 KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF 101 QERLQEDTSF GGNLGRAVFQ AKKRVLEPFG LVEEGAKTAP GKKRPVEQSP 151 QEPDSSSGIG KTGQQPAKKR LNFGQTGDSE SVPDPQPLGE PPATPAAVGP 201 TTMASGGGAP MADNNEGADG VGNASGNWHC DSTWLGDRVI TTSTRTWALP 251 TYNNHLYKQI SSASTGASND NHYFGYSTPW GYFDFNRFHC HFSPRDWQRL 301 INNNWGFRPK RLNFKLFNIQ VKEVTTNDGV TTIANNLTST VQVFSDSEYQ 351 LPYVLGSAHQ GCLPPFPADV FMIPQYGYLT LNNGSQAVGR SSFYCLEYFP 401 SQMLRTGNNF TFSYTFEDVP FHSSYAHSQS LDRLMNPLID QYLYYLNRTQ 451 NQSGSAQNKD LLFSRGSPAG MSVQPKNWLP GPCYRQQRVS KTKTDNNNSN 501 FTWTGASKYN LNGRESIINP GTAMASHKDD KDKFFPMSGV MIFGKESAGA 551 SNTALDNVMI TDEEEIKATN PVATERFGTV AVNLQSSSTD PATGDVHVMG 601 ALPGMVWQDR DVYLQGPIWA KIPHTDGHFH PSPLMGGFGL KHPPPQILIK 651 NTPVPANPPA EFSATKFASF ITQYSTGQVS VEIEWELQKE NSKRWNPEVQ 701 YTSNYAKSAN VDFTVDNNGL YTEPRPIGTR YLTRPL (SEQ ID NO: 6) [0115] Example of an amino acid sequence of wild-type AAV7 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD NGRGLVLPGY 51 KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF 101 QERLQEDTSF GGNLGRAVFQ AKKRVLEPLG LVEEGAKTAP AKKRPVEPSP 151 QRSPDSSTGI GKKGQQPARK RLNFGQTGDS ESVPDPQPLG EPPAAPSSVG 201 SGTVAAGGGA PMADNNEGAD GVGNASGNWH CDSTWLGDRV ITTSTRTWAL 251 PTYNNHLYKQ ISSETAGSTN DNTYFGYSTP WGYFDFNRFH CHFSPRDWQR 301 LINNNWGFRP KKLRFKLFNI QVKEVTTNDG VTTIANNLTS TIQVFSDSEY 351 QLPYVLGSAH QGCLPPFPAD VFMIPQYGYL TLNNGSQSVG RSSFYCLEYF 401 PSQMLRTGNN FEFSYSFEDV PFHSSYAHSQ SLDRLMNPLI DQYLYYLART T18934 Attorney Docket No. U1202.70129WO00 451 QSNPGGTAGN RELQFYQGGP STMAEQAKNW LPGPCFRQQR VSKTLDQNNN 501 SNFAWTGATK YHLNGRNSLV NPGVAMATHK DDEDRFFPSS GVLIFGKTGA 551 TNKTTLENVL MTNEEEIRPT NPVATEEYGI VSSNLQAANT AAQTQVVNNQ 601 GALPGMVWQN RDVYLQGPIW AKIPHTDGNF HPSPLMGGFG LKHPPPQILI 651 KNTPVPANPP EVFTPAKFAS FITQYSTGQV SVEIEWELQK ENSKRWNPEI 701 QYTSNFEKQT GVDFAVDSQG VYSEPRPIGT RYLTRNL (SEQ ID NO: 7) [0116] Example of an amino acid sequence of wild-type AAV8 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWALKPGAP KPKANQQKQD DGRGLVLPGY 51 KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLQAGDNPY LRYNHADAEF 101 QERLQEDTSF GGNLGRAVFQ AKKRVLEPLG LVEEGAKTAP GKKRPVEPSP 151 QRSPDSSTGI GKKGQQPARK RLNFGQTGDS ESVPDPQPLG EPPAAPSGVG 201 PNTMAAGGGA PMADNNEGAD GVGSSSGNWH CDSTWLGDRV ITTSTRTWAL 251 PTYNNHLYKQ ISNGTSGGAT NDNTYFGYST PWGYFDFNRF HCHFSPRDWQ 301 RLINNNWGFR PKRLSFKLFN IQVKEVTQNE GTKTIANNLT STIQVFTDSE 351 YQLPYVLGSA HQGCLPPFPA DVFMIPQYGY LTLNNGSQAV GRSSFYCLEY 401 FPSQMLRTGN NFQFTYTFED VPFHSSYAHS QSLDRLMNPL IDQYLYYLSR 451 TQTTGGTANT QTLGFSQGGP NTMANQAKNW LPGPCYRQQR VSTTTGQNNN 501 SNFAWTAGTK YHLNGRNSLA NPGIAMATHK DDEERFFPSN GILIFGKQNA 551 ARDNADYSDV MLTSEEEIKT TNPVATEEYG IVADNLQQQN TAPQIGTVNS 601 QGALPGMVWQ NRDVYLQGPI WAKIPHTDGN FHPSPLMGGF GLKHPPPQIL 651 IKNTPVPADP PTTFNQSKLN SFITQYSTGQ VSVEIEWELQ KENSKRWNPE 701 IQYTSNYYKS TSVDFAVNTE GVYSEPRPIG TRYLTRNL (SEQ ID NO: 8) [0117] Example of an amino acid sequence of wild-type AAV9 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NARGLVLPGY 51 KYLGPGNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LKYNHADAEF 101 QERLKEDTSF GGNLGRAVFQ AKKRLLEPLG LVEEAAKTAP GKKRPVEQSP 151 QEPDSSAGIG KSGAQPAKKR LNFGQTGDTE SVPDPQPIGE PPAAPSGVGS 201 LTMASGGGAP VADNNEGADG VGSSSGNWHC DSQWLGDRVI TTSTRTWALP 251 TYNNHLYKQI SNSTSGGSSN DNAYFGYSTP WGYFDFNRFH CHFSPRDWQR 301 LINNNWGFRP KRLNFKLFNI QVKEVTDNNG VKTIANNLTS TVQVFTDSDY 351 QLPYVLGSAH EGCLPPFPAD VFMIPQYGYL TLNDGSQAVG RSSFYCLEYF 401 PSQMLRTGNN FQFSYEFENV PFHSSYAHSQ SLDRLMNPLI DQYLYYLSKT 451 INGSGQNQQT LKFSVAGPSN MAVQGRNYIP GPSYRQQRVS TTVTQNNNSE 501 FAWPGASSWA LNGRNSLMNP GPAMASHKEG EDRFFPLSGS LIFGKQGTGR 551 DNVDADKVMI TNEEEIKTTN PVATESYGQV ATNHQSAQAQ AQTGWVQNQG 601 ILPGMVWQDR DVYLQGPIWA KIPHTDGNFH PSPLMGGFGM KHPPPQILIK 651 NTPVPADPPT AFNKDKLNSF ITQYSTGQVS VEIEWELQKE NSKRWNPEIQ 701 YTSNYYKSNN VEFAVNTEGV YSEPRPIGTR YLTRNL (SEQ ID NO: 9) [0118] Example of an amino acid sequence of wild-type AAV10 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY 51 KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF 101 QERLQEDTSF GGNLGRAVFQ AKKRVLEPLG LVEEGAKTAP GKKRPVEPSP 151 QRSPDSSTGI GKKGQQPAKK RLNFGQTGDS ESVPDPQPIG EPPAGPSGLG 201 SGTMAAGGGA PMADNNEGAD GVGSSSGNWH CDSTWLGDRV ITTSTRTWAL 251 PTYNNHLYKQ ISNGTSGGST NDNTYFGYST PWGYFDFNRF HCHFSPRDWQ 301 RLINNNWGFR PKRLNFKLFN IQVKEVTQNE GTKTIANNLT STIQVFTDSE 351 YQLPYVLGSA HQGCLPPFPA DVFMIPQYGY LTLNNGSQAV GRSSFYCLEY 401 FPSQMLRTGN NFEFSYQFED VPFHSSYAHS QSLDRLMNPL IDQYLYYLSR 451 TQSTGGTAGT QQLLFSQAGP NNMSAQAKNW LPGPCYRQQR VSTTLSQNNN 501 SNFAWTGATK YHLNGRDSLV NPGVAMATHK DDEERFFPSS GVLMFGKQGA 551 GKDNVDYSSV MLTSEEEIKT TNPVATEQYG VVADNLQQQN AAPIVGAVNS 601 QGALPGMVWQ NRDVYLQGPI WAKIPHTDGN FHPSPLMGGF GLKHPPPQIL 651 IKNTPVPADP PTTFSQAKLA SFITQYSTGQ VSVEIEWELQ KENSKRWNPE T18934 Attorney Docket No. U1202.70129WO00 701 IQYTSNYYKS TNVDFAVNTD GTYSEPRPIG TRYLTRNL (SEQ ID NO: 10) [0119] Example of an amino acid sequence of wild-type AAV11 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY 51 KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF 101 QERLQEDTSF GGNLGRAVFQ AKKRVLEPLG LVEEGAKTAP GKKRPLESPQ 151 EPDSSSGIGK KGKQPARKRL NFEEDTGAGD GPPEGSDTSA MSSDIEMRAA 201 PGGNAVDAGQ GSDGVGNASG DWHCDSTWSE GKVTTTSTRT WVLPTYNNHL 251 YLRLGTTSSS NTYNGFSTPW GYFDFNRFHC HFSPRDWQRL INNNWGLRPK 301 AMRVKIFNIQ VKEVTTSNGE TTVANNLTST VQIFADSSYE LPYVMDAGQE 351 GSLPPFPNDV FMVPQYGYCG IVTGENQNQT DRNAFYCLEY FPSQMLRTGN 401 NFEMAYNFEK VPFHSMYAHS QSLDRLMNPL LDQYLWHLQS TTSGETLNQG 451 NAATTFGKIR SGDFAFYRKN WLPGPCVKQQ RFSKTASQNY KIPASGGNAL 501 LKYDTHYTLN NRWSNIAPGP PMATAGPSDG DFSNAQLIFP GPSVTGNTTT 551 SANNLLFTSE EEIAATNPRD TDMFGQIADN NQNATTAPIT GNVTAMGVLP 601 GMVWQNRDIY YQGPIWAKIP HADGHFHPSP LIGGFGLKHP PPQIFIKNTP 651 VPANPATTFT AARVDSFITQ YSTGQVAVQI EWEIEKERSK RWNPEVQFTS 701 NYGNQSSMLW APDTTGKYTE PRVIGSRYLT NHL (SEQ ID NO: 11) [0120] Example of an amino acid sequence of wild-type AAV12 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWALKPGAP QPKANQQHQD NGRGLVLPGY 51 KYLGPFNGLD KGEPVNEADA AALEHDKAYD KQLEQGDNPY LKYNHADAEF 101 QQRLATDTSF GGNLGRAVFQ AKKRILEPLG LVEEGVKTAP GKKRPLEKTP 151 NRPTNPDSGK APAKKKQKDG EPADSARRTL DFEDSGAGDG PPEGSSSGEM 201 SHDAEMRAAP GGNAVEAGQG ADGVGNASGD WHCDSTWSEG RVTTTSTRTW 251 VLPTYNNHLY LRIGTTANSN TYNGFSTPWG YFDFNRFHCH FSPRDWQRLI 301 NNNWGLRPKS MRVKIFNIQV KEVTTSNGET TVANNLTSTV QIFADSTYEL 351 PYVMDAGQEG SFPPFPNDVF MVPQYGYCGV VTGKNQNQTD RNAFYCLEYF 401 PSQMLRTGNN FEVSYQFEKV PFHSMYAHSQ SLDRMMNPLL DQYLWHLQST 451 TTGNSLNQGT ATTTYGKITT GDFAYYRKNW LPGACIKQQK FSKNANQNYK 501 IPASGGDALL KYDTHTTLNG RWSNMAPGPP MATAGAGDSD FSNSQLIFAG 551 PNPSGNTTTS SNNLLFTSEE EIATTNPRDT DMFGQIADNN QNATTAPHIA 601 NLDAMGIVPG MVWQNRDIYY QGPIWAKVPH TDGHFHPSPL MGGFGLKHPP 651 PQIFIKNTPV PANPNTTFSA ARINSFLTQY STGQVAVQID WEIQKEHSKR 701 WNPEVQFTSN YGTQNSMLWA PDNAGNYHEL RAIGSRFLTH HL (SEQ ID NO: 12) [0121] Example of an amino acid sequence of wild-type AAVrh10 capsid protein 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD DGRGLVLPGY 51 KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLKAGDNPY LRYNHADAEF 101 QERLQEDTSF GGNLGRAVFQ AKKRVLEPLG LVEEGAKTAP GKKRPVEPSP 151 QRSPDSSTGI GKKGQQPAKK RLNFGQTGDS ESVPDPQPIG EPPAGPSGLG 201 SGTMAAGGGA PMADNNEGAD GVGSSSGNWH CDSTWLGDRV ITTSTRTWAL 251 PTYNNHLYKQ ISNGTSGGST NDNTYFGYST PWGYFDFNRF HCHFSPRDWQ 301 RLINNNWGFR PKRLNFKLFN IQVKEVTQNE GTKTIANNLT STIQVFTDSE 351 YQLPYVLGSA HQGCLPPFPA DVFMIPQYGY LTLNNGSQAV GRSSFYCLEY 401 FPSQMLRTGN NFEFSYQFED VPFHSSYAHS QSLDRLMNPL IDQYLYYLSR 451 TQSTGGTAGT QQLLFSQAGP NNMSAQAKNW LPGPCYRQQR VSTTLSQNNN 501 SNFAWTGATK YHLNGRDSLV NPGVAMATHK DDEERFFPSS GVLMFGKQGA 551 GKDNVDYSSV MLTSEEEIKT TNPVATEQYG VVADNLQQQN AAPIVGAVNS 601 QGALPGMVWQ NRDVYLQGPI WAKIPHTDGN FHPSPLMGGF GLKHPPPQIL 651 IKNTPVPADP PTTFSQAKLA SFITQYSTGQ VSVEIEWELQ KENSKRWNPE 701 IQYTSNYYKS TNVDFAVNTD GTYSEPRPIG TRYLTRNL (SEQ ID NO: [0122] Example of an amino acid sequence of wild-type AAVrh74 capsid protein: 1 MAADGYLPDW LEDNLSEGIR EWWDLKPGAP KPKANQQKQD NGRGLVLPGY 51 KYLGPFNGLD KGEPVNAADA AALEHDKAYD QQLQAGDNPY LRYNHADAEF T18934 Attorney Docket No. U1202.70129WO00 101 QERLQEDTSF GGNLGRAVFQ AKKRVLEPLG LVESPVKTAP GKKRPVEPSP 151 QRSPDSSTGI GKKGQQPAKK RLNFGQTGDS ESVPDPQPIG EPPAGPSGLG 201 SGTMAAGGGA PMADNNEGAD GVGSSSGNWH CDSTWLGDRV ITTSTRTWAL 251 PTYNNHLYKQ ISNGTSGGST NDNTYFGYST PWGYFDFNRF HCHFSPRDWQ 301 RLINNNWGFR PKRLNFKLFN IQVKEVTQNE GTKTIANNLT STIQVFTDSE 351 YQLPYVLGSA HQGCLPPFPA DVFMIPQYGY LTLNNGSQAV GRSSFYCLEY 401 FPSQMLRTGN NFEFSYNFED VPFHSSYAHS QSLDRLMNPL IDQYLYYLSR 451 TQSTGGTAGT QQLLFSQAGP NNMSAQAKNW LPGPCYRQQR VSTTLSQNNN 501 SNFAWTGATK YHLNGRDSLV NPGVAMATHK DDEERFFPSS GVLMFGKQGA 551 GKDNVDYSSV MLTSEEEIKT TNPVATEQYG VVADNLQQQN AAPIVGAVNS 601 QGALPGMVWQ NRDVYLQGPI WAKIPHTDGN FHPSPLMGGF GLKHPPPQIL 651 IKNTPVPADP PTTFNQAKLA SFITQYSTGQ VSVEIEWELQ KENSKRWNPE 701 IQYTSNYYKS TNVDFAVNTE GTYSEPRPIG TRYLTRNL (SEQ ID NO: 14) [0123] Also provided herein are nucleic acids encoding capsid proteins. A nucleic acid may comprise a sequence that encodes a capsid protein disclosed here (e.g., a capsid protein comprising one or more amino acid substitutions). A sequence encoding a capsid protein disclosed herein can be determined by one of ordinary skill in the art by known methods. A nucleic acid encoding a capsid protein may comprise a promoter or other regulatory sequence operably linked to the coding sequence. A nucleic acid encoding a capsid protein may be in the form of a plasmid, an mRNA, or another nucleic acid capable of being used by enzymes or machinery of a host cell to produce a capsid protein. Nucleic acids encoding capsid proteins as provided herein can be used to make AAV particles that can be used for delivering a gene to a cell. Methods of making AAV particles are known in the art. For example, see Scientific Reports volume 9, Article number: 13601 (2019); Methods Mol Biol.2012; 798: 267–284; and thermofisher.com/us/en/home/clinical/cell-gene-therapy/gene-therapy/aav-production- workflow.html. Example sequences of nucleic acids encoding capsid proteins are provided below. [0124] Example of a nucleotide sequence encoding AAV1 capsid protein: atggctgccgatggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggacttga aacctggagccccgaagcccaaagccaaccagcaaaagcaggacgacggccggggtctggtgcttcctggctacaa gtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggacgcagcggccctcgagcacgac aaggcctacgaccagcagctcaaagcgggtgacaatccgtacctgcggtataaccacgccgacgccgagtttcagg agcgtctgcaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaagaagcgggttctcga acctctcggtctggttgaggaaggcgctaagacggctcctggaaagaaacgtccggtagagcagtcgccacaagag ccagactcctcctcgggcatcggcaagacaggccagcagcccgctaaaaagagactcaattttggtcagactggcg actcagagtcagtccccgatccacaacctctcggagaacctccagcaacccccgctgctgtgggacctactacaat ggcttcaggcggtggcgcaccaatggcagacaataacgaaggcgccgacggagtgggtaatgcctcaggaaattgg cattgcgattccacatggctgggcgacagagtcatcaccaccagcacccgcacctgggccttgcccacctacaata accacctctacaagcaaatctccagtgcttcaacgggggccagcaacgacaaccactacttcggctacagcacccc ctgggggtattttgatttcaacagattccactgccacttttcaccacgtgactggcagcgactcatcaacaacaat tggggattccggcccaagagactcaacttcaaactcttcaacatccaagtcaaggaggtcacgacgaatgatggcg tcacaaccatcgctaataaccttaccagcacggttcaagtcttctcggactcggagtaccagcttccgtacgtcct cggctctgcgcaccagggctgcctccctccgttcccggcggacgtgttcatgattccgcaatacggctacctgacg ctcaacaatggcagccaagccgtgggacgttcatccttttactgcctggaatatttcccttctcagatgctgagaa cgggcaacaactttaccttcagctacacctttgaggaagtgcctttccacagcagctacgcgcacagccagagcct ggaccggctgatgaatcctctcatcgaccaatacctgtattacctgaacagaactcaaaatcagtccggaagtgcc T18934 Attorney Docket No. U1202.70129WO00 caaaacaaggacttgctgtttagccgtgggtctccagctggcatgtctgttcagcccaaaaactggctacctggac cctgttatcggcagcagcgcgtttctaaaacaaaaacagacaacaacaacagcaattttacctggactggtgcttc aaaatataacctcaatgggcgtgaatccatcatcaaccctggcactgctatggcctcacacaaagacgacgaagac aagttctttcccatgagcggtgtcatgatttttggaaaagagagcgccggagcttcaaacactgcattggacaatg tcatgattacagacgaagaggaaattaaagccactaaccctgtggccaccgaaagatttgggaccgtggcagtcaa tttccagagcagcagcacagaccctgcgaccggagatgtgcatgctatgggagcattacctggcatggtgtggcaa gatagagacgtgtacctgcagggtcccatttgggccaaaattcctcacacagatggacactttcacccgtctcctc ttatgggcggctttggactcaagaacccgcctcctcagatcctcatcaaaaacacgcctgttcctgcgaatcctcc ggcggagttttcagctacaaagtttgcttcattcatcacccaatactccacaggacaagtgagtgtggaaattgaa tgggagctgcagaaagaaaacagcaagcgctggaatcccgaagtgcagtacacatccaattatgcaaaatctgcca acgttgattttactgtggacaacaatggactttatactgagcctcgccccattggcacccgttaccttacccgtcc cctgtaa (SEQ ID NO: 15) [0125] Example of a nucleotide sequence encoding AAV2 capsid protein: atggctgccgatggttatcttccagattggctcgaggacactctctctgaaggaataagacagtggtggaagctca aacctggcccaccaccaccaaagcccgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtacaa gtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgccgcggccctcgagcacgac aaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacgcggagtttcagg agcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttcttga acctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtagagcactctcctgtggag ccagactcctcctcgggaaccggaaaggcgggccagcagcctgcaagaaaaagattgaattttggtcagactggag acgcagactcagtacctgacccccagcctctcggacagccaccagcagccccctctggtctgggaactaatacgat ggctacaggcagtggcgcaccaatggcagacaataacgagggcgccgacggagtgggtaattcctccggaaattgg cattgcgattccacatggatgggcgacagagtcatcaccaccagcacccgaacctgggccctgcccacctacaaca accacctctacaaacaaatttccagccaatcaggagcctcgaacgacaatcactactttggctacagcaccccttg ggggtattttgacttcaacagattccactgccacttttcaccacgtgactggcaaagactcatcaacaacaactgg ggattccgacccaagagactcaacttcaagctctttaacattcaagtcaaagaggtcacgcagaatgacggtacga cgacgattgccaataaccttaccagcacggttcaggtgtttactgactcggagtaccagctcccgtacgtcctcgg ctcggcgcatcaaggatgcctcccgccgttcccagcagacgtcttcatggtgccacagtatggatacctcaccctg aacaacgggagtcaggcagtaggacgctcttcattttactgcctggagtactttccttctcagatgctgcgtaccg gaaacaactttaccttcagctacacttttgaggacgttcctttccacagcagctacgctcacagccagagtctgga ccgtctcatgaatcctctcatcgaccagtacctgtattacttgagcagaacaaacactccaagtggaaccaccacg cagtcaaggcttcagttttctcaggccggagcgagtgacattcgggaccagtctaggaactggcttcctggaccct gttaccgccagcagcgagtatcaaagacatctgcggataacaacaacagtgaatactcgtggactggagctaccaa gtaccacctcaatggcagagactctctggtgaatccgggcccggccatggcaagccacaaggacgatgaagaaaag ttttttcctcagagcggggttctcatctttgggaagcaaggctcagagaaaacaaatgtggacattgaaaaggtca tgattacagacgaagaggaaatcaggacaaccaatcccgtggctacggagcagtatggttctgtatctaccaacct ccagagaggcaacagacaagcagctaccgcagatgtcaacacacaaggcgttcttccaggcatggtctggcaggac agagatgtgtaccttcaggggcccatctgggcaaagattccacacacggacggacattttcacccctctcccctca tgggtggattcggacttaaacaccctcctccacagattctcatcaagaacaccccggtacctgcgaatccttcgac caccttcagtgcggcaaagtttgcttccttcatcacacagtactccacgggacaggtcagcgtggagatcgagtgg gagctgcagaaggaaaacagcaaacgctggaatcccgaaattcagtacacttccaactacaacaagtctgttaatg tggactttactgtggacactaatggcgtgtattcagagcctcgccccattggcaccagatacctgactcgtaatct gtaa (SEQ ID NO: 47) [0126] Example of a nucleotide sequence encoding AAV3 capsid protein: atggctgctgacggttatcttccagattggctcgaggacaacctttctgaaggcattcgtgagtggtgggctctga aacctggagtccctcaacccaaagcgaaccaacaacaccaggacaaccgtcggggtcttgtgcttccgggttacaa atacctcggacccggtaacggactcgacaaaggagagccggtcaacgaggcggacgcggcagccctcgaacacgac aaagcttacgaccagcagctcaaggccggtgacaacccgtacctcaagtacaaccacgccgacgccgagtttcagg agcgtcttcaagaagatacgtcttttgggggcaaccttggcagagcagtcttccaggccaaaaagaggatccttga gcctcttggtctggttgaggaagcagctaaaacggctcctggaaagaagggggctgtagatcagtctcctcaggaa ccggactcatcatctggtgttggcaaatcgggcaaacagcctgccagaaaaagactaaatttcggtcagactggag actcagagtcagtcccagaccctcaacctctcggagaaccaccagcagcccccacaagtttgggatctaatacaat ggcttcaggcggtggcgcaccaatggcagacaataacgagggtgccgatggagtgggtaattcctcaggaaattgg cattgcgattcccaatggctgggcgacagagtcatcaccaccagcaccagaacctgggccctgcccacttacaaca accatctctacaagcaaatctccagccaatcaggagcttcaaacgacaaccactactttggctacagcaccccttg T18934 Attorney Docket No. U1202.70129WO00 ggggtattttgactttaacagattccactgccacttctcaccacgtgactggcagcgactcattaacaacaactgg ggattccggcccaagaaactcagcttcaagctcttcaacatccaagttagaggggtcacgcagaacgatggcacga cgactattgccaataaccttaccagcacggttcaagtgtttacggactcggagtatcagctcccgtacgtgctcgg gtcggcgcaccaaggctgtctcccgccgtttccagcggacgtcttcatggtccctcagtatggatacctcaccctg aacaacggaagtcaagcggtgggacgctcatccttttactgcctggagtacttcccttcgcagatgctaaggactg gaaataacttccaattcagctataccttcgaggatgtaccttttcacagcagctacgctcacagccagagtttgga tcgcttgatgaatcctcttattgatcagtatctgtactacctgaacagaacgcaaggaacaacctctggaacaacc aaccaatcacggctgctttttagccaggctgggcctcagtctatgtctttgcaggccagaaattggctacctgggc cctgctaccggcaacagagactttcaaagactgctaacgacaacaacaacagtaactttccttggacagcggccag caaatatcatctcaatggccgcgactcgctggtgaatccaggaccagctatggccagtcacaaggacgatgaagaa aaatttttccctatgcacggcaatctaatatttggcaaagaagggacaacggcaagtaacgcagaattagataatg taatgattacggatgaagaagagattcgtaccaccaatcctgtggcaacagagcagtatggaactgtggcaaataa cttgcagagctcaaatacagctcccacgactggaactgtcaatcatcagggggccttacctggcatggtgtggcaa gatcgtgacgtgtaccttcaaggacctatctgggcaaagattcctcacacggatggacactttcatccttctcctc tgatgggaggctttggactgaaacatccgcctcctcaaatcatgatcaaaaatactccggtaccggcaaatcctcc gacgactttcagcccggccaagtttgcttcatttatcactcagtactccactggacaggtcagcgtggaaattgag tgggagctacagaaagaaaacagcaaacgttggaatccagagattcagtacacttccaactacaacaagtctgtta atgtggactttactgtagacactaatggtgtttatagtgaacctcgccctattggaacccggtatctcacacgaaa cttgtga (SEQ ID NO: 17) [0127] Example of a nucleotide sequence encoding AAV4 capsid protein: atgactgacggttaccttccagattggctagaggacaacctctctgaaggcgttcgagagtggtgggcgctgcaac ctggagcccctaaacccaaggcaaatcaacaacatcaggacaacgctcggggtcttgtgcttccgggttacaaata cctcggacccggcaacggactcgacaagggggaacccgtcaacgcagcggacgcggcagccctcgagcacgacaag gcctacgaccagcagctcaaggccggtgacaacccctacctcaagtacaaccacgccgacgcggagttccagcagc ggcttcagggcgacacatcgtttgggggcaacctcggcagagcagtcttccaggccaaaaagagggttcttgaacc tcttggtctggttgagcaagcgggtgagacggctcctggaaagaagagaccgttgattgaatccccccagcagccc gactcctccacgggtatcggcaaaaaaggcaagcagccggctaaaaagaagctcgttttcgaagacgaaactggag caggcgacggaccccctgagggatcaacttccggagccatgtctgatgacagtgagatgcgtgcagcagctggcgg agctgcagtcgagggcggacaaggtgccgatggagtgggtaatgcctcgggtgattggcattgcgattccacctgg tctgagggccacgtcacgaccaccagcaccagaacctgggtcttgcccacctacaacaaccacctctacaagcgac tcggagagagcctgcagtccaacacctacaacggattctccaccccctggggatactttgacttcaaccgcttcca ctgccacttctcaccacgtgactggcagcgactcatcaacaacaactggggcatgcgacccaaagccatgcgggtc aaaatcttcaacatccaggtcaaggaggtcacgacgtcgaacggcgagacaacggtggctaataaccttaccagca cggttcagatctttgcggactcgtcgtacgaactgccgtacgtgatggatgcgggtcaagagggcagcctgcctcc ttttcccaacgacgtctttatggtgccccagtacggctactgtggactggtgaccggcaacacttcgcagcaacag actgacagaaatgccttctactgcctggagtactttccttcgcagatgctgcggactggcaacaactttgaaatta cgtacagttttgagaaggtgcctttccactcgatgtacgcgcacagccagagcctggaccggctgatgaaccctct catcgaccagtacctgtggggactgcaatcgaccaccaccggaaccaccctgaatgccgggactgccaccaccaac tttaccaagctgcggcctaccaacttttccaactttaaaaagaactggctgcccgggccttcaatcaagcagcagg gcttctcaaagactgccaatcaaaactacaagatccctgccaccgggtcagacagtctcatcaaatacgagacgca cagcactctggacggaagatggagtgccctgacccccggacctccaatggccacggctggacctgcggacagcaag ttcagcaacagccagctcatctttgcggggcctaaacagaacggcaacacggccaccgtacccgggactctgatct tcacctctgaggaggagctggcagccaccaacgccaccgatacggacatgtggggcaacctacctggcggtgacca gagcaacagcaacctgccgaccgtggacagactgacagccttgggagccgtgcctggaatggtctggcaaaacaga gacatttactaccagggtcccatttgggccaagattcctcataccgatggacactttcacccctcaccgctgattg gtgggtttgggctgaaacacccgcctcctcaaatttttatcaagaacaccccggtacctgcgaatcctgcaacgac cttcagctctactccggtaaactccttcattactcagtacagcactggccaggtgtcggtgcagattgactgggag atccagaaggagcggtccaaacgctggaaccccgaggtccagtttacctccaactacggacagcaaaactctctgt tgtgggctcccgatgcggctgggaaatacactgagcctagggctatcggtacccgctacctcacccaccacctgta ataacctgttaatcaataaaccggtttattcgtttcagttgaactttggtctccgtgtccttcttatcttatctcg tttcc (SEQ ID NO: 18) [0128] Example of a nucleotide sequence encoding AAV5 capsid protein: atgtcttttgttgatcaccctccagattggttggaagaagttggtgaaggtcttcgcgagtttttgggccttgaag cgggcccaccgaaaccaaaacccaatcagcagcatcaagatcaagcccgtggtcttgtgctgcctggttataacta tctcggacccggaaacggtctcgatcgaggagagcctgtcaacagggcagacgaggtcgcgcgagagcacgacatc T18934 Attorney Docket No. U1202.70129WO00 tcgtacaacgagcagcttgaggcgggagacaacccctacctcaagtacaaccacgcggacgccgagtttcaggaga agctcgccgacgacacatccttcgggggaaacctcggaaaggcagtctttcaggccaagaaaagggttctcgaacc ttttggcctggttgaagagggtgctaagacggcccctaccggaaagcggatagacgaccactttccaaaaagaaag aaggctcggaccgaagaggactccaagccttccacctcgtcagacgccgaagctggacccagcggatcccagcagc tgcaaatcccagcccaaccagcctcaagtttgggagctgatacaatgtctgcgggaggtggcggcccattgggcga caataaccaaggtgccgatggagtgggcaatgcctcgggagattggcattgcgattccacgtggatgggggacaga gtcgtcaccaagtccacccgaacctgggtgctgcccagctacaacaaccaccagtaccgagagatcaaaagcggct ccgtcgacggaagcaacgccaacgcctactttggatacagcaccccctgggggtactttgactttaaccgcttcca cagccactggagcccccgagactggcaaagactcatcaacaactactggggcttcagaccccggtccctcagagtc aaaatcttcaacattcaagtcaaagaggtcacggtgcaggactccaccaccaccatcgccaacaacctcacctcca ccgtccaagtgtttacggacgacgactaccagctgccctacgtcgtcggcaacgggaccgagggatgcctgccggc cttccctccgcaggtctttacgctgccgcagtacggttacgcgacgctgaaccgcgacaacacagaaaatcccacc gagaggagcagcttcttctgcctagagtactttcccagcaagatgctgagaacgggcaacaactttgagtttacct acaactttgaggaggtgcccttccactccagcttcgctcccagtcagaacctgttcaagctggccaacccgctggt ggaccagtacttgtaccgcttcgtgagcacaaataacactggcggagtccagttcaacaagaacctggccgggaga tacgccaacacctacaaaaactggttcccggggcccatgggccgaacccagggctggaacctgggctccggggtca accgcgccagtgtcagcgccttcgccacgaccaataggatggagctcgagggcgcgagttaccaggtgcccccgca gccgaacggcatgaccaacaacctccagggcagcaacacctatgccctggagaacactatgatcttcaacagccag ccggcgaacccgggcaccaccgccacgtacctcgagggcaacatgctcatcaccagcgagagcgagacgcagccgg tgaaccgcgtggcgtacaacgtcggcgggcagatggccaccaacaaccagagctccaccactgcccccgcgaccgg cacgtacaacctccaggaaatcgtgcccggcagcgtgtggatggagagggacgtgtacctccaaggacccatctgg gccaagatcccagagacgggggcgcactttcacccctctccggccatgggcggattcggactcaaacacccaccgc ccatgatgctcatcaagaacacgcctgtgcccggaaatatcaccagcttctcggacgtgcccgtcagcagcttcat cacccagtacagcaccgggcaggtcaccgtggagatggagtgggagctcaagaaggaaaactccaagaggtggaac ccagagatccagtacacaaacaactacaacgacccccagtttgtggactttgccccggacagcaccggggaataca gaaccaccagacctatcggaacccgataccttacccgacccctttaa (SEQ ID NO: 19) [0129] Example of a nucleotide sequence encoding AAV6 capsid protein: atggctgccgatggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggacttga aacctggagccccgaaacccaaagccaaccagcaaaagcaggacgacggccggggtctggtgcttcctggctacaa gtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggatgcagcggccctcgagcacgac aaggcctacgaccagcagctcaaagcgggtgacaatccgtacctgcggtataaccacgccgacgccgagtttcagg agcgtctgcaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaagaagagggttctcga accttttggtctggttgaggaaggtgctaagacggctcctggaaagaaacgtccggtagagcagtcgccacaagag ccagactcctcctcgggcattggcaagacaggccagcagcccgctaaaaagagactcaattttggtcagactggcg actcagagtcagtccccgacccacaacctctcggagaacctccagcaacccccgctgctgtgggacctactacaat ggcttcaggcggtggcgcaccaatggcagacaataacgaaggcgccgacggagtgggtaatgcctcaggaaattgg cattgcgattccacatggctgggcgacagagtcatcaccaccagcacccgaacatgggccttgcccacctataaca accacctctacaagcaaatctccagtgcttcaacgggggccagcaacgacaaccactacttcggctacagcacccc ctgggggtattttgatttcaacagattccactgccatttctcaccacgtgactggcagcgactcatcaacaacaat tggggattccggcccaagagactcaacttcaagctcttcaacatccaagtcaaggaggtcacgacgaatgatggcg tcacgaccatcgctaataaccttaccagcacggttcaagtcttctcggactcggagtaccagttgccgtacgtcct cggctctgcgcaccagggctgcctccctccgttcccggcggacgtgttcatgattccgcagtacggctacctaacg ctcaacaatggcagccaggcagtgggacggtcatccttttactgcctggaatatttcccatcgcagatgctgagaa cgggcaataactttaccttcagctacaccttcgaggacgtgcctttccacagcagctacgcgcacagccagagcct ggaccggctgatgaatcctctcatcgaccagtacctgtattacctgaacagaactcagaatcagtccggaagtgcc caaaacaaggacttgctgtttagccgggggtctccagctggcatgtctgttcagcccaaaaactggctacctggac cctgttaccggcagcagcgcgtttctaaaacaaaaacagacaacaacaacagcaactttacctggactggtgcttc aaaatataaccttaatgggcgtgaatctataatcaaccctggcactgctatggcctcacacaaagacgacaaagac aagttctttcccatgagcggtgtcatgatttttggaaaggagagcgccggagcttcaaacactgcattggacaatg tcatgatcacagacgaagaggaaatcaaagccactaaccccgtggccaccgaaagatttgggactgtggcagtcaa tctccagagcagcagcacagaccctgcgaccggagatgtgcatgttatgggagccttacctggaatggtgtggcaa gacagagacgtatacctgcagggtcctatttgggccaaaattcctcacacggatggacactttcacccgtctcctc tcatgggcggctttggacttaagcacccgcctcctcagatcctcatcaaaaacacgcctgttcctgcgaatcctcc ggcagagttttcggctacaaagtttgcttcattcatcacccagtattccacaggacaagtgagcgtggagattgaa tgggagctgcagaaagaaaacagcaaacgctggaatcccgaagtgcagtatacatctaactatgcaaaatctgcca acgttgatttcactgtggacaacaatggactttatactgagcctcgccccattggcacccgttacctcacccgtcc cctgtaat (SEQ ID NO: 20) T18934 Attorney Docket No. U1202.70129WO00 [0130] Example of a nucleotide sequence encoding AAV7 capsid protein: atggctgccgatggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggacctga aacctggagccccgaaacccaaagccaaccagcaaaagcaggacaacggccggggtctggtgcttcctggctacaa gtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggacgcagcggccctcgagcacgac aaggcctacgaccagcagctcaaagcgggtgacaatccgtacctgcggtataaccacgccgacgccgagtttcagg agcgtctgcaagaagatacgtcatttgggggcaacctcgggcgagcagtcttccaggccaagaagcgggttctcga acctctcggtctggttgaggaaggcgctaagacggctcctgcaaagaagagaccggtagagccgtcacctcagcgt tcccccgactcctccacgggcatcggcaagaaaggccagcagcccgccagaaagagactcaatttcggtcagactg gcgactcagagtcagtccccgaccctcaacctctcggagaacctccagcagcgccctctagtgtgggatctggtac agtggctgcaggcggtggcgcaccaatggcagacaataacgaaggtgccgacggagtgggtaatgcctcaggaaat tggcattgcgattccacatggctgggcgacagagtcattaccaccagcacccgaacctgggccctgcccacctaca acaaccacctctacaagcaaatctccagtgaaactgcaggtagtaccaacgacaacacctacttcggctacagcac cccctgggggtattttgactttaacagattccactgccacttctcaccacgtgactggcagcgactcatcaacaac aactggggattccggcccaagaagctgcggttcaagctcttcaacatccaggtcaaggaggtcacgacgaatgacg gcgttacgaccatcgctaataaccttaccagcacgattcaggtattctcggactcggaataccagctgccgtacgt cctcggctctgcgcaccagggctgcctgcctccgttcccggcggacgtcttcatgattcctcagtacggctacctg actctcaacaatggcagtcagtctgtgggacgttcctccttctactgcctggagtacttcccctctcagatgctga gaacgggcaacaactttgagttcagctacagcttcgaggacgtgcctttccacagcagctacgcacacagccagag cctggaccggctgatgaatcccctcatcgaccagtacttgtactacctggccagaacacagagtaacccaggaggc acagctggcaatcgggaactgcagttttaccagggcgggccttcaactatggccgaacaagccaagaattggttac ctggaccttgcttccggcaacaaagagtctccaaaacgctggatcaaaacaacaacagcaactttgcttggactgg tgccaccaaatatcacctgaacggcagaaactcgttggttaatcccggcgtcgccatggcaactcacaaggacgac gaggaccgctttttcccatccagcggagtcctgatttttggaaaaactggagcaactaacaaaactacattggaaa atgtgttaatgacaaatgaagaagaaattcgtcctactaatcctgtagccacggaagaatacgggatagtcagcag caacttacaagcggctaatactgcagcccagacacaagttgtcaacaaccagggagccttacctggcatggtctgg cagaaccgggacgtgtacctgcagggtcccatctgggccaagattcctcacacggatggcaactttcacccgtctc ctttgatgggcggctttggacttaaacatccgcctcctcagatcctgatcaagaacactcccgttcccgctaatcc tccggaggtgtttactcctgccaagtttgcttcgttcatcacacagtacagcaccggacaagtcagcgtggaaatc gagtgggagctgcagaaggaaaacagcaagcgctggaacccggagattcagtacacctccaactttgaaaagcaga ctggtgtggactttgccgttgacagccagggtgtttactctgagcctcgccctattggcactcgttacctcacccg taatctgtaa (SEQ ID NO: 21) [0131] Example of a nucleotide sequence encoding AAV8 capsid protein: atggctgccgatggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggcgctga aacctggagccccgaagcccaaagccaaccagcaaaagcaggacgacggccggggtctggtgcttcctggctacaa gtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggacgcagcggccctggagcacgac aaggcctacgaccagcagctgcaggcgggtgacaatccgtacctgcggtataaccacgccgacgccgagtttcagg agcgtctgcaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaagaagcgggttctcga acctctcggtctggttgaggaaggcgctaagacggctcctggaaagaagagaccggtagagccatcaccccagcgt tctccagactcctctacgggcatcggcaagaaaggccaacagcccgccagaaaaagactcaattttggtcagactg gcgactcagagtcagttccagaccctcaacctctcggagaacctccagcagcgccctctggtgtgggacctaatac aatggctgcaggcggtggcgcaccaatggcagacaataacgaaggcgccgacggagtgggtagttcctcgggaaat tggcattgcgattccacatggctgggcgacagagtcatcaccaccagcacccgaacctgggccctgcccacctaca acaaccacctctacaagcaaatctccaacgggacatcgggaggagccaccaacgacaacacctacttcggctacag caccccctgggggtattttgactttaacagattccactgccacttttcaccacgtgactggcagcgactcatcaac aacaactggggattccggcccaagagactcagcttcaagctcttcaacatccaggtcaaggaggtcacgcagaatg aaggcaccaagaccatcgccaataacctcaccagcaccatccaggtgtttacggactcggagtaccagctgccgta cgttctcggctctgcccaccagggctgcctgcctccgttcccggcggacgtgttcatgattccccagtacggctac ctaacactcaacaacggtagtcaggccgtgggacgctcctccttctactgcctggaatactttccttcgcagatgc tgagaaccggcaacaacttccagtttacttacaccttcgaggacgtgcctttccacagcagctacgcccacagcca gagcttggaccggctgatgaatcctctgattgaccagtacctgtactacttgtctcggactcaaacaacaggaggc acggcaaatacgcagactctgggcttcagccaaggtgggcctaatacaatggccaatcaggcaaagaactggctgc caggaccctgttaccgccaacaacgcgtctcaacgacaaccgggcaaaacaacaatagcaactttgcctggactgc tgggaccaaataccatctgaatggaagaaattcattggctaatcctggcatcgctatggcaacacacaaagacgac gaggagcgtttttttcccagtaacgggatcctgatttttggcaaacaaaatgctgccagagacaatgcggattaca gcgatgtcatgctcaccagcgaggaagaaatcaaaaccactaaccctgtggctacagaggaatacggtatcgtggc Attorney Docket No. U1202.70129WO00 agataacttgcagcagcaaaacacggctcctcaaattggaactgtcaacagccagggggccttacccggtatggtc tggcagaaccgggacgtgtacctgcagggtcccatctgggccaagattcctcacacggacggcaacttccacccgt ctccgctgatgggcggctttggcctgaaacatcctccgcctcagatcctgatcaagaacacgcctgtacctgcgga tcctccgaccaccttcaaccagtcaaagctgaactctttcatcacgcaatacagcaccggacaggtcagcgtggaa attgaatgggagctgcagaaggaaaacagcaagcgctggaaccccgagatccagtacacctccaactactacaaat ctacaagtgtggactttgctgttaatacagaaggcgtgtactctgaaccccgccccattggcacccgttacctcac ccgtaatctgtaa (SEQ ID NO: 22) [0132] Example of a nucleotide sequence encoding AAV9 capsid protein: atggctgccgatggttatcttccagattggctcgaggacaaccttagtgaaggaattcgcgagtggtgggctttga aacctggagcccctcaacccaaggcaaatcaacaacatcaagacaacgctcgaggtcttgtgcttccgggttacaa ataccttggacccggcaacggactcgacaagggggagccggtcaacgcagcagacgcggcggccctcgagcacgac aaggcctacgaccagcagctcaaggccggagacaacccgtacctcaagtacaaccacgccgacgccgagttccagg agcggctcaaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaaaaagaggcttcttga acctcttggtctggttgaggaagcggctaagacggctcctggaaagaagaggcctgtagagcagtctcctcaggaa ccggactcctccgcgggtattggcaaatcgggtgcacagcccgctaaaaagagactcaatttcggtcagactggcg acacagagtcagtcccagaccctcaaccaatcggagaacctcccgcagccccctcaggtgtgggatctcttacaat ggcttcaggtggtggcgcaccagtggcagacaataacgaaggtgccgatggagtgggtagttcctcgggaaattgg cattgcgattcccaatggctgggggacagagtcatcaccaccagcacccgaacctgggccctgcccacctacaaca atcacctctacaagcaaatctccaacagcacatctggaggatcttcaaatgacaacgcctacttcggctacagcac cccctgggggtattttgacttcaacagattccactgccacttctcaccacgtgactggcagcgactcatcaacaac aactggggattccggcctaagcgactcaacttcaagctcttcaacattcaggtcaaagaggttacggacaacaatg gagtcaagaccatcgccaataaccttaccagcacggtccaggtcttcacggactcagactatcagctcccgtacgt gctcgggtcggctcacgagggctgcctcccgccgttcccagcggacgttttcatgattcctcagtacgggtatctg acgcttaatgatggaagccaggccgtgggtcgttcgtccttttactgcctggaatatttcccgtcgcaaatgctaa gaacgggtaacaacttccagttcagctacgagtttgagaacgtacctttccatagcagctacgctcacagccaaag cctggaccgactaatgaatccactcatcgaccaatacttgtactatctctcaaagactattaacggttctggacag aatcaacaaacgctaaaattcagtgtggccggacccagcaacatggctgtccagggaagaaactacatacctggac ccagctaccgacaacaacgtgtctcaaccactgtgactcaaaacaacaacagcgaatttgcttggcctggagcttc ttcttgggctctcaatggacgtaatagcttgatgaatcctggacctgctatggccagccacaaagaaggagaggac cgtttctttcctttgtctggatctttaatttttggcaaacaaggaactggaagagacaacgtggatgcggacaaag tcatgataaccaacgaagaagaaattaaaactactaacccggtagcaacggagtcctatggacaagtggccacaaa ccaccagagtgcccaagcacaggcgcagaccggctgggttcaaaaccaaggaatacttccgggtatggtttggcag gacagagatgtgtacctgcaaggacccatttgggccaaaattcctcacacggacggcaactttcacccttctccgc tgatgggagggtttggaatgaagcacccgcctcctcagatcctcatcaaaaacacacctgtacctgcggatcctcc aacggccttcaacaaggacaagctgaactctttcatcacccagtattctactggccaagtcagcgtggagatcgag tgggagctgcagaaggaaaacagcaagcgctggaacccggagatccagtacacttccaactattacaagtctaata atgttgaatttgctgttaatactgaaggtgtatatagtgaaccccgccccattggcaccagatacctgactcgtaa tctgtaa (SEQ ID NO: 23) [0133] Example of a nucleotide sequence encoding AAV10 capsid protein: atggctgccgatggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggacttga aacctggagccccgaaacccaaagccaaccagcaaaagcaggacgacggccggggtctggtgcttcctggctacaa gtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggacgcagcggccctcgagcacgac aaggcctacgaccagcagctcaaagcgggtgacaatccgtacctgcggtataaccacgccgacgccgagtttcagg agcgtctgcaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaagaagcgggttctcga acctctcggtctggttgaggaaggcgctaagacggctcctggaaagaagagaccggtagagccatcaccccagcgt tctccagactcctctacgggcatcggcaagaaaggccagcagcccgcgaaaaagagactcaactttgggcagactg gcgactcagagtcagtgcccgaccctcaaccaatcggagaaccccccgcaggcccctctggtctgggatctggtac aatggctgcaggcggtggcgctccaatggcagacaataacgaaggcgccgacggagtgggtagttcctcaggaaat tggcattgcgattccacatggctgggcgacagagtcatcaccaccagcacccgaacctgggccctccccacctaca acaaccacctctacaagcaaatctccaacgggacttcgggaggaagcaccaacgacaacacctacttcggctacag caccccctgggggtattttgactttaacagattccactgccacttctcaccacgtgactggcagcgactcatcaac aacaactggggattccggcccaagagactcaacttcaagctcttcaacatccaggtcaaggaggtcacgcagaatg aaggcaccaagaccatcgccaataaccttaccagcacgattcaggtctttacggactcggaataccagctcccgta cgtcctcggctctgcgcaccagggctgcctgcctccgttcccggcggacgtcttcatgattcctcagtacgggtac ctgactctgaacaatggcagtcaggccgtgggccgttcctccttctactgcctggagtactttccttctcaaatgc Attorney Docket No. U1202.70129WO00 tgagaacgggcaacaactttgagttcagctaccagtttgaggacgtgccttttcacagcagctacgcgcacagcca aagcctggaccggctgatgaaccccctcatcgaccagtacctgtactacctgtctcggactcagtccacgggaggt accgcaggaactcagcagttgctattttctcaggccgggcctaataacatgtcggctcaggccaaaaactggctac ccgggccctgctaccggcagcaacgcgtctccacgacactgtcgcaaaataacaacagcaactttgcctggaccgg tgccaccaagtatcatctgaatggcagagactctctggtaaatcccggtgtcgctatggcaacccacaaggacgac gaagagcgattttttccgtccagcggagtcttaatgtttgggaaacagggagctggaaaagacaacgtggactata gcagcgttatgctaaccagtgaggaagaaattaaaaccaccaacccagtggccacagaacagtacggcgtggtggc cgataacctgcaacagcaaaacgccgctcctattgtaggggccgtcaacagtcaaggagccttacctggcatggtc tggcagaaccgggacgtgtacctgcagggtcctatctgggccaagattcctcacacggacggaaactttcatccct cgccgctgatgggaggctttggactgaaacacccgcctcctcagatcctgattaagaatacacctgttcccgcgga tcctccaactaccttcagtcaagctaagctggcgtcgttcatcacgcagtacagcaccggacaggtcagcgtggaa attgaatgggagctgcagaaagaaaacagcaaacgctggaacccagagattcaatacacttccaactactacaaat ctacaaatgtggactttgctgttaacacagatggcacttattctgagcctcgccccatcggcacccgttacctcac ccgtaatctgtaa (SEQ ID NO: 24) [0134] Example of a nucleotide sequence encoding AAVrh74 capsid protein: atggctgccgatggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggacctga aacctggagccccgaaacccaaagccaaccagcaaaagcaggacaacggccggggtctggtgcttcctggctacaa gtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggacgcagcggccctcgagcacgac aaggcctacgaccagcagctccaagcgggtgacaatccgtacctgcggtataatcacgccgacgccgagtttcagg agcgtctgcaagaagatacgtcttttgggggcaacctcgggcgcgcagtcttccaggccaaaaagcgggttctcga acctctgggcctggttgaatcgccggttaagacggctcctggaaagaagagaccggtagagccatcaccccagcgc tctccagactcctctacgggcatcggcaagaaaggccagcagcccgcaaaaaagagactcaattttgggcagactg gcgactcagagtcagtccccgaccctcaaccaatcggagaaccaccagcaggcccctctggtctgggatctggtac aatggctgcaggcggtggcgctccaatggcagacaataacgaaggcgccgacggagtgggtagttcctcaggaaat tggcattgcgattccacatggctgggcgacagagtcatcaccaccagcacccgcacctgggccctgcccacctaca acaaccacctctacaagcaaatctccaacgggacctcgggaggaagcaccaacgacaacacctacttcggctacag caccccctgggggtattttgacttcaacagattccactgccacttttcaccacgtgactggcagcgactcatcaac aacaactggggattccggcccaagaggctcaacttcaagctcttcaacatccaagtcaaggaggtcacgcagaatg aaggcaccaagaccatcgccaataaccttaccagcacgattcaggtctttacggactcggaataccagctcccgta cgtgctcggctcggcgcaccagggctgcctgcctccgttcccggcggacgtcttcatgattcctcagtacgggtac ctgactctgaacaatggcagtcaggctgtgggccggtcgtccttctactgcctggagtactttccttctcaaatgc tgagaacgggcaacaactttgaattcagctacaacttcgaggacgtgcccttccacagcagctacgcgcacagcca gagcctggaccggctgatgaaccctctcatcgaccagtacttgtactacctgtcccggactcaaagcacgggcggt actgcaggaactcagcagttgctattttctcaggccgggcctaacaacatgtcggctcaggccaagaactggctac ccggtccctgctaccggcagcaacgcgtctccacgacactgtcgcagaacaacaacagcaactttgcctggacggg tgccaccaagtatcatctgaatggcagagactctctggtgaatcctggcgttgccatggctacccacaaggacgac gaagagcgattttttccatccagcggagtcttaatgtttgggaaacagggagctggaaaagacaacgtggactata gcagcgtgatgctaaccagcgaggaagaaataaagaccaccaacccagtggccacagaacagtacggcgtggtggc cgataacctgcaacagcaaaacgccgctcctattgtaggggccgtcaatagtcaaggagccttacctggcatggtg tggcagaaccgggacgtgtacctgcagggtcccatctgggccaagattcctcatacggacggcaactttcatccct cgccgctgatgggaggctttggactgaagcatccgcctcctcagatcctgattaaaaacacacctgttcccgccga tcctccgaccaccttcaatcaggccaagctggcttctttcatcacgcagtacagtaccggtcaggtcagcgtggag atcgagtgggagctgcagaaggagaacagcaaacgctggaacccagagattcagtacacttccaactactacaaat ctacaaatgtggactttgctgtcaatactgagggtacttattccgagcctcgccccattggcacccgttacctcac ccgtaatctgtaa (SEQ ID NO: 25) Second-Strand Synthesis [0135] According to some aspects, second-strand synthesis of a single-stranded AAV genome disclosed herein (e.g., comprising a modification) is modified relative to a corresponding wild- type AAV genome (e.g., not comprising the modification). Second-strand synthesis can be measured by one of ordinary skill in the art by known methods. In some embodiments, second- strand synthesis of an AAV genome disclosed herein is increased relative to a corresponding T18934 Attorney Docket No. U1202.70129WO00 wild-type AAV genome. In some embodiments, second-strand synthesis of an AAV genome disclosed herein is increased as a result of a decrease in binding of a host-cell protein (e.g., a phosphorylated host-cell protein, such as FKBP52) to the AAV genome (e.g., to a D-sequence of the AAV genome). [0136] In some embodiments, the second-strand synthesis of an AAV genome as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the second-strand synthesis of a corresponding wild-type AAV genome. In some embodiments, the second-strand synthesis of an AAV genome as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least 10-fold higher, at least 10.5-fold higher, at least 11-fold higher, at least 11.5-fold higher, at least 12-fold higher, at least 12.5-fold higher, at least 13-fold higher, at least 13.5-fold higher, at least 14-fold higher, at least 14.5-fold higher, at least 15-fold higher, at least 15.5-fold higher, at least 16-fold higher, at least 16.5-fold higher, at least 17- fold higher, at least 17.5-fold higher, at least 18-fold higher, at least 18.5-fold higher, at least 19-fold higher, at least 19.5-fold higher, at least 20-fold higher, or more) than the second- strand synthesis of a corresponding wild-type AAV genome. In some embodiments, second- strand synthesis of an AAV particle as disclosed herein is not modified relative to a corresponding wild-type AAV particle. Transduction Efficiency [0137] According to some aspects, transduction efficiency of an AAV particle disclosed herein (e.g., comprising a modification in a nucleic acid vector and/or in a capsid protein) is modified relative to a corresponding wild-type AAV particle (e.g., not comprising the modification in the nucleic acid vector and/or in the capsid protein). Transduction efficiency of an AAV particle can be determined, for example, by comparing expression of a gene of interest in a cell following contacting the cell with the AAV particle, or by measuring the number of viral genome copies per cell following contacting a population of cells with the AAV particle. In T18934 Attorney Docket No. U1202.70129WO00 some embodiments, transduction efficiency of an AAV particle as disclosed herein (e.g., an AAV particle comprising a modified capsid protein (e.g., comprising one or more amino acid substitutions), a modified nucleic acid vector (e.g., modified by deletion and/or substitution of a D-sequence, or by insertion of a non-AAV sequence), or both a modified capsid protein (e.g., comprising one or more amino acid substitutions) and a modified nucleic acid vector (e.g., modified by deletion and/or substitution of a D-sequence, or by insertion of a non-AAV sequence)) is higher than the transduction efficiency of a corresponding wild-type AAV particle (e.g., not comprising the modified capsid protein or nucleic acid modification). In some embodiments, the transduction efficiency of an AAV particle as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the transduction efficiency of a corresponding wild-type AAV particle. In some embodiments, the transduction efficiency of an AAV particle as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least 10-fold higher, at least 10.5-fold higher, at least 11-fold higher, at least 11.5-fold higher, at least 12-fold higher, at least 12.5-fold higher, at least 13-fold higher, at least 13.5-fold higher, at least 14-fold higher, at least 14.5-fold higher, at least 15-fold higher, at least 15.5- fold higher, at least 16-fold higher, at least 16.5-fold higher, at least 17-fold higher, at least 17.5-fold higher, at least 18-fold higher, at least 18.5-fold higher, at least 19-fold higher, at least 19.5-fold higher, at least 20-fold higher, or more) than the transduction efficiency of a corresponding wild-type AAV particle. In some embodiments, transduction efficiency of an AAV particle as disclosed herein is not modified relative to a corresponding wild-type AAV particle. Transgene expression [0138] According to some aspects, expression of a transgene encoded by a nucleic acid vector comprising a modification (e.g., a deletion or substitution of a sequence, such as a D-sequence, or insertion of a sequence) disclosed herein is altered relative to expression of the transgene T18934 Attorney Docket No. U1202.70129WO00 encoded by a nucleic acid vector that does not comprise the modification. Such alteration of transgene expression is, in some embodiments, on a per nucleic acid vector copy number basis (e.g., transgene expression in a cell, when normalized to the total amount of nucleic acid vector in the cell, is altered). For example, in some embodiments, a modified AAV particle as disclosed herein results in greater transgene expression relative to a corresponding AAV particle not comprising the same modification but that delivers a comparable number of viral genomes to a cell. Relative transgene expression levels can be determined, for example, by measuring expression of the transgene in a cell by methods known in the art following contacting the cell with an AAV particle comprising the modified nucleic acid vector encoding the transgene and comparing an equivalent measurement in another cell contacted with an AAV particle comprising a nucleic acid vector that does not comprise the modification. [0139] In some embodiments, transgene expression from a modified nucleic acid vector as disclosed herein is higher than the transgene expression from a corresponding nucleic acid vector that does not comprise the modification. In some embodiments, the transgene expression from a modified nucleic acid vector as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the transgene expression from a corresponding nucleic acid vector that does not comprise the modification. [0140] In some embodiments, the transgene expression from a modified nucleic acid vector as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least 10-fold higher, at least 10.5-fold higher, at least 11-fold higher, at least 11.5-fold higher, at least 12-fold higher, at least 12.5-fold higher, at least 13-fold higher, at least 13.5-fold higher, at least 14-fold higher, at least 14.5-fold higher, at least 15-fold higher, at least 15.5-fold higher, at least 16-fold higher, at least 16.5- fold higher, at least 17-fold higher, at least 17.5-fold higher, at least 18-fold higher, at least 18.5-fold higher, at least 19-fold higher, at least 19.5-fold higher, at least 20-fold higher, or more) than the transgene expression from a corresponding nucleic acid vector that does not comprise the modification. T18934 Attorney Docket No. U1202.70129WO00 [0141] In some embodiments, transgene expression from a modified nucleic acid vector as disclosed herein is not changed relative to transgene expression from a corresponding nucleic acid vector that does not comprise the modification. Packaging efficiency [0142] According to some aspects, packaging efficiency of an AAV particle disclosed herein is modified relative to a corresponding wild-type AAV particle. Packaging efficiency of an AAV particle refers to the capability of a particular AAV capsid to encapsidate a particular viral genome. Packaging efficiency can be measured by one of ordinary skill in the art, such as by quantifying the ratio of capsids to viral genomes (see, e.g., Grimm, et al. Gene Ther.6:1322- 1330 (1999)). [0143] In some embodiments, the packaging efficiency of an AAV particle as disclosed herein (e.g., an AAV particle comprising a modified capsid protein, a modified nucleic acid vector, or both a modified capsid protein and a modified nucleic acid vector) is higher than the packaging efficiency of a corresponding wild-type AAV particle. In some embodiments, the packaging efficiency of an AAV particle as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the packaging efficiency of a corresponding wild-type AAV particle. In some embodiments, the packaging efficiency of an AAV particle as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least 10-fold higher, at least 10.5-fold higher, at least 11-fold higher, at least 11.5-fold higher, at least 12-fold higher, at least 12.5-fold higher, at least 13-fold higher, at least 13.5-fold higher, at least 14-fold higher, at least 14.5-fold higher, at least 15-fold higher, at least 15.5-fold higher, at least 16-fold higher, at least 16.5-fold higher, at least 17-fold higher, at least 17.5-fold higher, at least 18- fold higher, at least 18.5-fold higher, at least 19-fold higher, at least 19.5-fold higher, at least 20-fold higher, or more) than the packaging efficiency of a corresponding wild-type AAV particle. T18934 Attorney Docket No. U1202.70129WO00 [0144] In some embodiments, the packaging efficiency of an AAV particle as disclosed herein (e.g., an AAV particle comprising a modified capsid protein, a modified nucleic acid vector, or both a modified capsid protein and a modified nucleic acid vector) is lower than the packaging efficiency of a corresponding wild-type AAV particle. In some embodiments, the packaging efficiency of an AAV particle as disclosed herein is decreased by at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more) relative to the packaging efficiency of a corresponding wild-type AAV particle. [0145] In some embodiments, packaging efficiency of an AAV particle disclosed herein is not modified relative to a corresponding wild-type AAV particle. [0146] In some embodiments, both the transduction efficiency and the packaging efficiency of an AAV particle as disclosed herein is modified (i.e., increased or decreased) relative to a corresponding unmodified or wild-type AAV particle (e.g., of the same serotype). In some embodiments, the immunogenicity of an AAV particle as disclosed herein is modified relative to a corresponding unmodified or wild-type AAV particle (e.g., of the same serotype). Pharmaceutical compositions [0147] Any one of the AAV particles, capsid proteins, or nucleic acids disclosed herein may be comprised within a pharmaceutical composition comprising a pharmaceutically-acceptable carrier or may be comprised within a pharmaceutically-acceptable carrier. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the AAV particle, capsid protein, or nucleic acid is comprised or administered to a subject. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum oil such as mineral oil, vegetable oil such as peanut oil, soybean oil, and sesame oil, animal oil, or oil of synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers. Non-limiting examples of pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline, syrup, methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, polyacrylic acids, lubricating agents (such as talc, magnesium stearate, and mineral oil), wetting agents, emulsifying agents, suspending agents, preserving agents (such as methyl-, ethyl-, and propyl-hydroxy-benzoates), and pH adjusting agents (such as inorganic and organic T18934 Attorney Docket No. U1202.70129WO00 acids and bases), and solutions or compositions thereof. Other examples of carriers include phosphate buffered saline, HEPES-buffered saline, and water for injection, any of which may be optionally combined with one or more of calcium chloride dihydrate, disodium phosphate anhydrous, magnesium chloride hexahydrate, potassium chloride, potassium dihydrogen phosphate, sodium chloride, or sucrose. Other examples of carriers that might be used include saline (e.g., sterilized, pyrogen-free saline), saline buffers (e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. USP grade carriers and excipients are particularly useful for delivery of AAV particles to human subjects. [0148] Typically, such compositions may contain at least about 0.1% of the therapeutic agent (e.g., AAV particle) or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of therapeutic agent(s) (e.g., AAV particle) in each therapeutically-useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be designed. [0149] Pharmaceutical compositions as disclosed herein, e.g., comprising nucleic acid vectors comprising modified ITRs and/or AAV particles comprising nucleic acid vectors comprising modified ITRs, can be prepared by one of ordinary skill in the art by known methods. Methods of contacting a cell [0150] According to some aspects, methods of contacting a cell with an AAV particle or nucleic acid vector are provided herein. Methods of contacting a cell may comprise, for example, contacting a cell in a culture with a composition comprising an AAV particle or nucleic acid vector. In some embodiments, contacting a cell comprises adding a composition comprising an AAV particle or nucleic acid vector to the supernatant of a cell culture (e.g., a cell culture on a tissue culture plate or dish) or mixing a composition comprising an AAV particle or nucleic acid vector with a cell culture (e.g., a suspension cell culture). In some embodiments, contacting a cell comprises mixing a composition comprising an AAV particle T18934 Attorney Docket No. U1202.70129WO00 or nucleic acid vector with another solution, such as a cell culture media, and incubating a cell with the mixture. [0151] In some embodiments, contacting a cell with an AAV particle or nucleic acid vector comprises administering a composition comprising an AAV particle or nucleic acid vector to a subject or device in which the cell is located. In some embodiments, contacting a cell comprises injecting a composition comprising an AAV particle or nucleic acid vector into a subject in which the cell is located. In some embodiments, contacting a cell comprises administering a composition comprising an AAV particle or nucleic acid vector directly to a cell, or into or substantially adjacent to a tissue of a subject in which the cell is present. [0152] In some embodiments, “administering” or “administration” means providing a material to a subject in a manner that is pharmacologically useful. In some embodiments, an rAAV particle is administered to a subject enterally. In some embodiments, an enteral administration of the essential metal element/s is oral. In some embodiments, a rAAV particle is administered to the subject parenterally. In some embodiments, a rAAV particle is administered to a subject subcutaneously, intraocularly, intravitreally, subretinally, intravenously (IV), intracerebro- ventricularly, intramuscularly, intrathecally (IT), intracisternally, intraperitoneally, via inhalation, topically, or by direct injection to one or more cells, tissues, or organs. In some embodiments, a rAAV particle is administered to the subject by injection into the hepatic artery or portal vein. [0153] In some embodiments, a compositions of AAV particles is administered to a subject to treat a disease or condition. To "treat" a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. The compositions described above or elsewhere herein are typically administered to a subject in an effective amount, that is, an amount capable of producing a desirable result. The desirable result will depend upon the active agent being administered. For example, an effective amount of rAAV particles may be an amount of the particles that are capable of transferring an expression construct to a host organ, tissue, or cell. A therapeutically acceptable amount may be an amount that is capable of treating a disease, e.g., a muscular dystrophy. As is well known in the medical and veterinary arts, dosage for any one subject depends on many factors, including the subject's size, body surface area, age, the particular composition to be administered, the active ingredient(s) in the composition, time and route of administration, general health, and other drugs being administered concurrently. T18934 Attorney Docket No. U1202.70129WO00 [0154] In some embodiments, a cell disclosed herein is a cell isolated or derived from a subject. In some embodiments, a cell is a mammalian cell (e.g., a cell isolated or derived from a mammal). In some embodiments, a cell is a human cell. In some embodiments, a cell is isolated or derived from a particular tissue of a subject, such as muscle tissue. In some embodiments, a cell is a muscle cell. In some embodiments, a cell is a skeletal muscle cell or a smooth muscle cell. In some embodiments, a cell is in vitro. In some embodiments, a cell is ex vivo. In some embodiments, a cell in in vivo. In some embodiments, a cell is within a subject (e.g., within a tissue or organ of a subject). In some embodiments, a cell is a primary cell. In some embodiments, a cell is from a cell line (e.g., an immortalized cell line). In some embodiments a cell is a cancer cell or an immortalized cell. [0155] In some embodiments, “administering” or “administration” means providing a material to a subject in a manner that is pharmacologically useful. [0156] In certain circumstances it will be desirable to deliver an AAV particle disclosed herein in a suitably formulated pharmaceutical composition disclosed herein either subcutaneously, intraocularly, intravitreally, subretinally, parenterally, intravenously (IV), intracerebro- ventricularly, intramuscularly, intrathecally (IT), intracisternally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection to one or more cells, tissues, or organs by direct injection. In some embodiments, the administration is a route suitable for systemic delivery, such as by intravenous injection. In some embodiments, the administration is a route suitable for local delivery, such as by intramuscular injection. In some embodiments, “administering” or “administration” means providing a material to a subject in a manner that is pharmacologically useful. [0157] In some embodiments, the concentration of AAV particles administered to a subject may be on the order ranging from 106 to 1014 particles/ml or 103 to 1015 particles/ml, or any values therebetween for either range, such as for example, about 106, 107, 108, 109, 1010, 1011, 1012, 1013, or 1014 particles/ml. In some embodiments, AAV particles of a higher concentration than 1013 particles/ml are administered. In some embodiments, the concentration of AAV particles administered to a subject may be on the order ranging from 106 to 1014 vector genomes (vgs)/ml or 103 to 1015 vgs/ml, or any values therebetween for either range (e.g., 106, 107, 108, 109, 1010, 1011, 1012, 1013, or 1014 vgs/ml). In some embodiments, AAV particles of higher concentration than 1013 vgs/ml are administered. The AAV particles can be administered as a single dose, or divided into two or more administrations as may be required to achieve therapy of the particular disease or disorder being treated. In some embodiments, T18934 Attorney Docket No. U1202.70129WO00 0.0001 ml to 10 ml are delivered to a subject. In some embodiments, the number of AAV particles administered to a subject may be on the order ranging from 106-1014 vgs/kg body mass of the subject, or any values therebetween (e.g., 106, 107, 108, 109, 1010, 1011, 1012, 1013, or 1014 vgs/kg). In some embodiments, the dose of AAV particles administered to a subject may be on the order ranging from 1012-1014 vgs/kg. In some embodiments, the volume of AAVrh74 composition delivered to a subject (e.g., via one or more routes of administration as described herein) is 0.0001 ml to 10 ml. [0158] In some embodiments, a composition disclosed herein (e.g., comprising an AAV particle) is administered to a subject once. In some embodiments, the composition is administered to a subject multiple times (e.g., twice, three times, four times, five times, six times, or more). Repeated administration to a subject may be conducted at a regular interval (e.g., daily, every other day, twice per week, weekly, twice per month, monthly, every six months, once per year, or less or more frequently) as necessary to treat (e.g., improve or alleviate) one or more symptoms of a disease, disorder, or condition in the subject. Subjects [0159] Aspects of the disclosure relate to methods for use with a subject, such as human or non-human primate subjects; with a host cell in situ in a subject; or with a host cell derived from a subject (e.g., ex vivo or in vitro). Non-limiting examples of non-human primate subjects include macaques (e.g., cynomolgus or rhesus macaques), marmosets, tamarins, spider monkeys, owl monkeys, vervet monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans. In some embodiments, the subject is a human subject. Other exemplary subjects include domesticated animals such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters. [0160] In some embodiments, the subject has or is suspected of having a disease or disorder that may be treated with gene therapy. A disease or disorder that may be treated with gene therapy may be characterized by one or more mutation(s) in the genome that results in abnormal structure or function of one or more proteins associated with development, health, maintenance and/or function of a cell and/or organ. Diseases and disorders can be characterized and identified, e.g., through laboratory tests and/or evaluation by a clinician. In some embodiments, the subject has or is suspected of having a disease (e.g., a disease caused by a defect, such as a genetic mutation, in one or more cells or genes). In some embodiments, a T18934 Attorney Docket No. U1202.70129WO00 nucleic acid isolated or derived from the subject (e.g., genomic DNA, mRNA, or cDNA from the subject) is identified via sequencing (e.g., Sanger or next-generation sequencing) to comprise a mutation (e.g., in a gene associated with development, health, maintenance, or function of a cell and/or organ). [0161] In some embodiments, a subject comprises a mutant form of one or more genes associated with development, health, maintenance and/or function of a cell and/or organ. In some embodiments, methods disclosed herein provide a cell of a subject with a functional form of a gene. EXAMPLES Example 1. [0162] Naturally-occurring adeno-associated viruses do not express their own genes efficiently, and viral second-strand DNA synthesis is required before gene expression can occur in a host cell. Mammalian host cells do not have an RNA polymerase that is capable of transcribing the single-stranded DNA genome of an AAV. For use as a vector, it is desirable to generate single-stranded AAV genomes that are capable of expressing genes of interest (e.g., encoding therapeutic molecules) at high levels. This requires modification of the single- stranded AAV genome to allow efficient second-strand DNA synthesis and subsequent transgene expression. [0163] Previous studies have shown that the single-stranded nature of the AAV genome is a problem for transgene expression (see, e.g., Fisher, et al., J Virol. (1996) 70(1):520-532; Ferrari, et al., J Virol. (1996) 70(5):3227-34; Ponnazhagan, et al., Gene (1997) 190(1): 203- 210; Snyder, et al., Nat Genet. (1997) 16(3): 270-276). One reason for poor transgene expression is due to binding of a tyrosine-phosphorylated cellular protein to the D-sequence of the ssDNA genome, inhibiting second-strand DNA synthesis (see, e.g., Qing, et al., Proc Natl Acad Sci U S A. (1997) 94(20):10879-84 and Qing, et al., J Virol. (2001) 75(19):8968-76). Attempts to modify the D-sequence to overcome these problems have demonstrated that the proximal 10 nucleotides (the 10 nucleotides closest to the terminus of the ITR, i.e., adjacent the hairpin structure of the ITR) in the D-sequence at the 3' end of the single-stranded AAV genome are indispensable. For example, deletion of the full 3' D-sequence substantially impedes rescue of the proviral genome, AAV replication, and AAV packaging (see, e.g., Wang, et al., J Virol. (1997) 71(4):3077-82). By contrast, complete deletion of the D-sequence at the 5' end of the genome allows viral packaging and transgene expression, and can result in T18934 Attorney Docket No. U1202.70129WO00 more efficient transgene expression relative to conventional ssAAV vectors (see, e.g., Ling, et al., J Virol. (2015) 89(2): 952-61). [0164] The present Example demonstrates the development of ssAAV genomes in which the 3' D-sequence has been replaced with an alternative sequence without compromising packaging. This development of ssAAV genomes comprising a sequence replacing the proximal 10 nucleotides of the 3' D-sequence allows successful packaging, while avoiding the negative impacts of the natural D-sequence (e.g., inhibited second-strand DNA synthesis). [0165] To identify useful sequences to replace the proximal 10 nucleotides of the 3' D- sequence, a sequence library was generated with random 10-nucleotide sequences in place of the proximal 10 nucleotides (“D10-sequence random library”; FIG.1). The library of sequences was cloned into plasmids to generate plasmid libraries comprising the random 10- nucleotide sequences in place of either the left ITR or the right ITR (FIG.2 and FIG.3). The plasmids were transfected into HEK293 cells and rescue, replication, and packaging were observed. As shown in FIG.3, only construct “N10-L1” resulted in successful generation of AAV particles, indicating that features of the other three constructs were incompatible with AAV rescue and/or packaging. The failure of the other three constructs to successfully undergo rescue, replication, and packaging underscores the criticality of the D-sequence in the 3'-ITR to AAV packaging. [0166] Isolation of viruses from the library screen that were successful in rescue, replication, and packaging, and subsequent DNA sequencing of the isolated viruses was conducted. A heterologous nucleotide sequence (replacing the proximal 10 nucleotides of the D-sequence, relative to the terminus of the AAV genome) that did not substantially inhibit viral rescue, replication, and/or packaging was identified in the sequencing having a sequence of 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) (with complementary sequence 5'-TCAAGCACAT-3' (SEQ ID NO: 27)). GenZ ssAAV particles were generated comprising this sequence substituted in place of the proximal 10 nucleotides (closest to the 5' and 3' ends of the AAV genome) of each D-sequence (FIG.4 and FIG.5). [0167] To evaluate the transduction efficiency of the GenZ genome-modified AAV, primary human skeletal muscles were transduced with GenZ ssAAV particles comprising a nucleic acid encoding firefly luciferase fused to EYFP with a chicken β-actin (CBA) promoter. AAV particles were added to cell cultures at doses of 3,000 viral genomes (vgs) per cell or 10,000 vgs per cell and transgene expression was measured by quantifying EYFP fluorescence (pixels2 per visual field) 72 hours later. The results demonstrate that GenZ ssAAV particles achieve T18934 Attorney Docket No. U1202.70129WO00 strong transgene expression in host cells in a dose-dependent manner (~7,000 pixels2/visual field for cells treated with 3,000 vgs/cell and ~12,500 pixels2/visual field for cells treated with 10,000 vgs/cell; relative to no measurable EYFP expression in mock-treated cells; FIG.6A and 6B). [0168] The results of this study demonstrate that the library screening identified a heterologous nucleotide sequence inserted in place of the proximal 10 nucleotides of the D-sequence (which were previously considered essential for AAV packaging, but that also resulted in suppressed second-strand synthesis of the AAV genome) which not only allows AAV packaging, but that also allows efficient transgene expression following AAV delivery to cells. Example 2. [0169] The wild-type (WT) AAV contains a single-stranded DNA genome, and expresses its genes poorly, because there is no host cell RNA polymerase that can transcribe a single- stranded DNA. Similarly, transgene expression from recombinant ssAAV vectors is also largely sub-optimal since the viral second-strand DNA synthesis is strongly inhibited by binding of phosphorylated forms of host cell chaperone protein, FKBP52, to the D-sequence at the 3'-end of the ssAAV genome (Proc Natl Acad Sci USA, 94(20): 10879-10884, 1997). It has not been possible to delete the D-sequence at the 3'-ITR as it serves as the “packaging signal” for the AAV genome (J. Virol., 70: 1668-1677, 1996). It has previously been reported that the distal 10-nucleotides (nts) in the D-sequence are dispensable (J. Virol., 71: 3077-3082, 1997). [0170] In this Example, an N10-sequence library was generated in which the proximal 10-nts in the D-sequence were replaced with random 10-nts to test the hypothesis that one or more of these N10-sequences would allow successful packaging of the AAV genome, and also evade FKBP52-mediated inhibition of the viral second-strand DNA synthesis, thereby allowing robust transgene expression from ssAAV vectors. One such sequence, 5'-ATGTGCTTGA-3' (SEQ ID NO: 26), was identified that allowed successful rescue, replication, and packaging of the AAV genome. [0171] This sequence was inserted in a recombinant AAV2 genome replacing the proximal 10- nts in D-sequence at both ITRs flanking an expression cassette containing a firefly luciferase- enhanced yellow fluorescent protein (FLuc-EYFP) under the control of the chicken β-actin (CBA) promoter, designated as generation Z (“GenZ”) ssAAV vector. Transduction efficiencies of wild-type (WT) and GenZ ssAAVrh74-CBAp-FLuc-EYFP vectors were evaluated in human HeLa cells in vitro, the results of which are shown in FIGs.7A and 7B. T18934 Attorney Docket No. U1202.70129WO00 The extent of transgene expression from the GenZ AAVrh74 vector was ~20-fold higher than that from the WT AAVrh74 vectors. [0172] Transduction efficiencies of WT and GenZ ssAAVrh74-CBAp-FLuc-EYFP vectors were also evaluated in vivo in C57BL6/J mice following intravenous administration. The GenZ ssAAVrh74 vectors averaged ~5-fold increase in transgene expression in the liver, compared with that from the WT ssAAVrh74 vectors (FIGs.8A and 8B). The observed increase in transgene expression was not as pronounced in vivo since AAVrh74 vectors are closely related to AAV8, and ssAAV8 vectors transduce mouse liver very efficiently. [0173] Taken together, these results demonstrate that (i) a GenZ ssAAV DNA genome has been created that overcomes the problem of viral second-strand DNA synthesis; and (ii) the GenZ ssAAV vectors behave more like scAAV vectors, but without the size-limitation. The GenZ ssAAV DNA genome can be packaged into any AAV serotype capsid vector; and packaging of the GenZ ssAAV DNA genomes in capsid-modified NextGen AAV serotype vectors (comprising amino acid substitutions in their capsid proteins that correspond to substitutions Y444F, Y500F, Y730F, and/or T491V in an AAV2 capsid protein) should further enhance the performance of OptZ vectors (which comprise both the amino acid substitutions corresponding to Y444F, Y500F, Y730F, and/or T491V and the GenZ genome modification), the availability of which has significant implications for their potential use in achieving high- efficiency transgene expression of larger genes. Example 3 [0174] The GenZ ssAAV genome improves viral second-strand DNA synthesis, and mediates significantly higher levels of transgene expression. Thus, it behaves more like a scAAV genome, but without scAAV’s inherent size limitation. However, the extent of transgene expression from different GenZ AAV serotype vectors varies. For example, while the increase in transduction efficiency of GenZ ssAAVrh74 and GenZ ssAAV3 vectors was ~20-fold and ~22-fold, respectively, compared with that of their wild-type (WT) counterparts (FIGs.9A and 9B, respectively), the increase in transduction efficiency of GenZ ssAAV2 and GenZ ssAAV6 vectors was only ~3-fold and ~4-fold, respectively, compared with that of their WT counterparts (FIG.9C and 9D, respectively). [0175] Following these observations, whether different AAV capsids modulate transgene expression was evaluated. Previous studies by others have documented that AAV2 (J Virol., 88:10711079, 2014; J Virol 2016;90:7196-7204) and AAV9 (Mol. Ther., 28:1373-1380, 2020; T18934 Attorney Docket No. U1202.70129WO00 Hum. Gene Ther., 31:1155-1168, 2020) capsids play a role in transcription and second-strand DNA synthesis. Experiments were conducted as explained below to test whether AAV2 and AAV6, but not AAVrh74 and AAV3 capsids, negatively impact transgene expression from GenZ ssAAV vectors. GenZ ssAAVrh74 vectors were used to transduce HeLa cells in triplicates at 3x103 viral genomes (vgs)/cell, incubated with and without highly purified empty capsids of AAVrh74, AAV2, AAV3, and AAV6, either before or during transduction. Transgene expression was visualized via fluorescence microscopy 72 hours post-transduction. The results demonstrate that, while AAVrh74 and AAV3 empty capsids had no effect on transduction efficiency, both AAV2 and AAV6 empty capsids led to a significant decrease in transgene expression from GenZ ssAAVrh74 vectors (FIG.10). [0176] These data provide a mechanistic insight into the observed difference in the extent of transgene expression mediated by different GenZ ssAAV serotype vectors. However, given the absolute requirement of the D-sequence for the optimal rescue, replication, and packaging of the AAV genome, a reduction in the efficiency of rescue and replication of the GenZ AAV genome from recombinant plasmids was observed. Depending on the AAV serotype capsid, the efficiency of GenZ AAV genome packaging ranged between about 10% and about 60% that of the AAV genome containing the D-sequence. Despite this limitation, the availability of the GenZ AAV genome has important implications for its potential use in achieving high- efficiency transgene expression from ssAAV vectors. EQUIVALENTS AND SCOPE [0177] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are T18934 Attorney Docket No. U1202.70129WO00 presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure. [0178] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms. [0179] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document. [0180] The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” [0181] The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc. [0182] As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be T18934 Attorney Docket No. U1202.70129WO00 interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law. [0183] As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc. [0184] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited. [0185] In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of” and “consisting essentially of” the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B,” the disclosure T18934 Attorney Docket No. U1202.70129WO00 also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B.”

Claims

T18934 Attorney Docket No. U1202.70129WO00 CLAIMS What is claimed is: 1. A recombinant adeno-associated virus (rAAV) genome comprising a heterologous nucleotide sequence, wherein the heterologous nucleotide sequence is (i) inserted within a first D-sequence of the rAAV genome, (ii) inserted within the rAAV genome at a position adjacent to a 3' or 5' end of the first D-sequence, or (iii) substituted in place of a portion of the first D-sequence in the rAAV genome, wherein the first D-sequence is proximal to the 3' terminus of the rAAV genome, and wherein the rAAV genome is single-stranded. 2. The rAAV genome of claim 1, wherein substitution of the heterologous nucleotide sequence in place of 5, 6, 7, 8, 9, 10, or more nucleotides at the 3' terminus of the first D- sequence does not substantially inhibit packaging of the rAAV genome. 3. The rAAV genome of claim 1 or claim 2, wherein the heterologous nucleotide sequence is substituted in place of a portion of the first D-sequence. 4. The rAAV genome of any preceding claim, wherein the heterologous nucleotide sequence is substituted in place of a portion of the first D-sequence, and wherein the portion of the first D-sequence: (i) is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length; and/or (ii) is equal in length to the heterologous nucleotide sequence. 5. The rAAV genome of claim 4, wherein the portion of the first D-sequence comprises consecutive nucleotides including the 3'-most nucleotide of the first D-sequence. 6. The rAAV genome of any preceding claim, wherein the heterologous nucleotide sequence comprises, consists of, or consists essentially of a sequence of 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). 7. The rAAV genome of any preceding claim, further comprising a second heterologous nucleotide sequence, wherein the second heterologous nucleotide sequence is (i) inserted T18934 Attorney Docket No. U1202.70129WO00 within a second D-sequence of the rAAV genome, (ii) inserted within the rAAV genome at a position adjacent to a 3' or 5' end of the second D-sequence, or (iii) substituted in place of a portion of the second D-sequence in the rAAV genome, wherein the second D-sequence is proximal to the 5' terminus of the rAAV genome. 8. The rAAV genome of claim 7, wherein the second heterologous nucleotide sequence is substituted in place of a portion of the second D-sequence. 9. The rAAV genome of claim 7 or claim 8, wherein the second heterologous nucleotide sequence is substituted in place of a portion of the second D-sequence, and wherein the portion of the second D-sequence: (i) is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length; and/or (ii) is equal in length to the second heterologous nucleotide sequence. 10. The rAAV genome of claim 9, wherein the portion of the second D-sequence comprises consecutive nucleotides including the 5'-most nucleotide of the second D- sequence. 11. The rAAV genome of any one of claims 7-10, wherein the second heterologous nucleotide sequence comprises, consists of, or consists essentially of a sequence of 5'-ATGTGCTTGA-3' (SEQ ID NO: 26) or 5'-TCAAGCACAT-3' (SEQ ID NO: 27). 12. The rAAV genome of any preceding claim, wherein the rAAV genome is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, or a combination thereof. 13. The rAAV genome of any preceding claim, wherein the rAAV genome is of serotype AAV2, AAV3, or AAV6. 14. The rAAV genome of any preceding claim, wherein the rAAV genome comprises AAV2 inverted terminal repeats (ITRs). T18934 Attorney Docket No. U1202.70129WO00 15. The rAAV genome of any preceding claim, further comprising a nucleic acid sequence comprising a gene of interest. 16. The rAAV genome of claim 15, wherein the gene of interest encodes a therapeutic agent and/or a diagnostic agent. 17. The rAAV genome of any preceding claim, further comprising a regulatory element. 18. The rAAV genome of claim 17, wherein the regulatory element comprises a promoter, an enhancer, a silencer, an insulator, a response element, an initiation site, a termination signal, or a ribosome binding site. 19. The rAAV genome of claim 18, wherein the promoter is a constitutive promoter. 20. The rAAV genome of claim 18, wherein the promoter is an inducible promoter. 21. The rAAV genome of any one of claims 18-20, wherein the promoter is a tissue- specific promoter, a cell type-specific promoter, or a synthetic promoter. 22. The rAAV genome of any preceding claim, wherein the rAAV genome is at least 4 kilobases (kb), 4.5 kb, 5 kb, 5.5 kb, 6 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 10.5 kb, 11 kb, 11.5 kb, 12 kb, 12.5 kb, 13 kb, 13.5 kb, 14 kb or more in length. 23. An rAAV particle comprising the rAAV genome of any preceding claim and a capsid. 24. The rAAV particle of claim 23, wherein the capsid comprises a modified capsid protein, wherein the modified capsid protein comprises an amino acid substitution at a position corresponding to T491, Y444, Y500, and/or Y730 of SEQ ID NO: 2. 25. The rAAV particle of claim 24, wherein the modified capsid protein comprises amino acid substitutions at positions corresponding to each of T491, Y444, Y500, and Y730 of SEQ ID NO: 2, optionally wherein the amino acid substitutions correspond to T491V, Y444F, Y500F, and Y730F substitutions in SEQ ID NO: 2. T18934 Attorney Docket No. U1202.70129WO00 26. The rAAV particle of any one of claims 23-25, wherein the capsid is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAVrh74, or a combination thereof. 27. The rAAV particle of any one of claims 23-26, wherein the capsid is of serotype AAVrh74. 28. A plasmid comprising a nucleic acid sequence corresponding to the rAAV genome of any one of claims 1-22. 29. A composition comprising the rAAV genome of any one of claims 1-22 or the plasmid of claim 28. 30. A composition comprising the rAAV particle of any one of claims 23-27. 31. The composition of claim 29 or claim 30, further comprising a pharmaceutically acceptable carrier. 32. A method comprising contacting a cell with the composition of any one of claims 29- 31. 33. A method comprising contacting a cell with a composition comprising the rAAV particle of any one of claims 23-27, wherein the transduction efficiency of the rAAV particle is at least two-fold higher than a corresponding rAAV particle not comprising the rAAV genome of any one of claims 1-22 or not comprising a modification present in the rAAV genome of any one of claims 1-22. 34. The method of claim 32 or claim 33, wherein the cell is a mammalian cell. 35. The method of any one of claims 32-34, wherein the contacting is in vivo. 36. The method of claim 35, further comprising administering the composition comprising the rAAV particle to a subject. T18934 Attorney Docket No. U1202.70129WO00 37. The method of claim 36, wherein the cell is in the subject. 38. The method of claim 36 or claim 37, wherein the subject is human. 39. The method of any one of claims 36-38, wherein the subject is at risk of or has been diagnosed with a disease, disorder, or condition. 40. The method of any one of claims 36-39, wherein the composition is administered to the subject by intravenous injection, by subcutaneous injection, by intramuscular injection, by intraperitoneal injection, or orally. 41. The method of any one of claims 32-34, wherein the contacting is in vitro or ex vivo.
EP24751101.7A 2023-02-02 2024-02-02 Development of generation z (genz) single-stranded aav serotype vectors Pending EP4658289A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363442830P 2023-02-02 2023-02-02
PCT/US2024/014220 WO2024163870A1 (en) 2023-02-02 2024-02-02 Development of generation z (genz) single-stranded aav serotype vectors

Publications (1)

Publication Number Publication Date
EP4658289A1 true EP4658289A1 (en) 2025-12-10

Family

ID=92147365

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24751101.7A Pending EP4658289A1 (en) 2023-02-02 2024-02-02 Development of generation z (genz) single-stranded aav serotype vectors

Country Status (2)

Country Link
EP (1) EP4658289A1 (en)
WO (1) WO2024163870A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998009524A1 (en) * 1996-09-06 1998-03-12 Chiron Corporation Methods and compositions for liver specific delivery of therapeutic molecules using recombinant aav vectors
US10900053B2 (en) * 2014-11-21 2021-01-26 University Of Florida Research Foundation, Incorporated Genome-modified recombinant adeno-associated virus vectors

Also Published As

Publication number Publication date
WO2024163870A1 (en) 2024-08-08

Similar Documents

Publication Publication Date Title
US20220347317A1 (en) Aavrh74 vectors for gene therapy of muscular dystrophies
US11266748B2 (en) Recombinant adeno-associated virus vectors to target medullary thyroid carcinoma
JP2022549380A (en) Adeno-associated virus (AAV) system for the treatment of hereditary deafness
CN116209768A (en) Methods for engineering new hybrid AAV capsids by hypervariable region exchange
JPH09509564A (en) Generation of high titer recombinant AAV vector
JP2023524291A (en) Cross-species compatible adeno-associated virus compositions and methods of use thereof
US20020076754A1 (en) Overcoming AAV vector size limitation through viral DNA hetero-dimerization
US12383615B2 (en) Protoparvovirus compositions comprising a protoparvovirus variant VP1 capsid polypeptide and related methods
KR20250131772A (en) Gene therapy for frontotemporal dementia
EP4683931A1 (en) Parvovirus compositions and related methods for gene therapy
US20240342311A1 (en) Engineering aav vectors with improved cns targeting
JP2022533448A (en) UBE3A genes and expression cassettes and their uses
US20230250422A1 (en) Cpg-free itrs for aav gene therapy
US20030190746A1 (en) Gene expression control system and its use in recombinant virus packaging cell lines
EP4658289A1 (en) Development of generation z (genz) single-stranded aav serotype vectors
JP2025534666A (en) Engineered nucleic acid regulatory elements and methods of use thereof
WO2025217505A1 (en) Itr-modified aav vectors
US20250121094A1 (en) Aav particles with modified inverted terminal repeats for enhanced gene expression in muscle
JP2023545384A (en) Recombinant adeno-associated virus for central nervous system or muscle delivery
US20240398991A1 (en) Aavrh74 particles for gene therapy of muscle disease
CN117355603A (en) AAVRH74 vectors for gene therapy of muscular dystrophy
Shoti Development of Genome-Modified Adeno-Associated Viral Vectors With Enhanced Transgene Expression for Human Gene Therapy
WO2026064739A1 (en) Parvovirus compositions and related methods for gene therapy
WO2026064736A1 (en) Parvovirus compositions and related methods for gene therapy
Dong et al. Analysis of adeno-associated virus-mediated ex vivo transferred human β-globin gene in bone marrow engrafted mice

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250901

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR