EP4658258A1 - Use of glutamine for the treatment of cancer and for enhancing the efficacy of an immunotherapy - Google Patents

Use of glutamine for the treatment of cancer and for enhancing the efficacy of an immunotherapy

Info

Publication number
EP4658258A1
EP4658258A1 EP24750936.7A EP24750936A EP4658258A1 EP 4658258 A1 EP4658258 A1 EP 4658258A1 EP 24750936 A EP24750936 A EP 24750936A EP 4658258 A1 EP4658258 A1 EP 4658258A1
Authority
EP
European Patent Office
Prior art keywords
glutamine
cells
inhibitors
subject
dcs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24750936.7A
Other languages
German (de)
French (fr)
Inventor
Hongbo CHI
Chuansheng GUO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
St Jude Childrens Research Hospital
Original Assignee
St Jude Childrens Research Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by St Jude Childrens Research Hospital filed Critical St Jude Childrens Research Hospital
Publication of EP4658258A1 publication Critical patent/EP4658258A1/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198—Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/15—Cells of the myeloid line, e.g. granulocytes, basophils, eosinophils, neutrophils, leucocytes, monocytes, macrophages or mast cells; Myeloid precursor cells; Antigen-presenting cells, e.g. dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/10—Cellular immunotherapy characterised by the cell type used
    • A61K40/19—Dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00—Cellular immunotherapy
    • A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
    • A61K40/24—Antigen-presenting cells [APC]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/50—Colon
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/57—Skin; melanoma

Definitions

  • TME tumor microenvironment
  • altered glucose or amino acid composition contributes to impaired T-cell effector function 11-15 or dysregulated myeloid cell activity 7 .
  • DCs dendritic cells capture and present tumor-associated antigens on major histocompatibility complex (MHC) molecules and provide costimulatory signals and soluble 1 168222090v1 Attorney Docket No.243734.000197 factors to promote anti-tumor immunity 3 .
  • DAMPs damage-associated molecular patterns
  • the invention provides a method for inhibiting growth of a tumor in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-tumor immunotherapy.
  • the invention provides a method for enhancing the efficacy of an anti-cancer immunotherapy in a subject in need thereof, comprising administering to the subject said immunotherapy and an effective amount of glutamine.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-cancer immunotherapy.
  • the immunotherapy and glutamine are administered simultaneously.
  • the immunotherapy and glutamine are administered sequentially in any order.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting solute carrier family 38 member 2 (SLC38A2)-mediated glutamine uptake in cancer cells of the subject.
  • SLC38A2 solute carrier family 38 member 2
  • the method further comprises administering to the subject an effective amount of an anti-cancer immunotherapy.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting lysosomal signaling pathway in dendritic cells (DCs) of the subject.
  • DCs dendritic cells
  • inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor of lysosomal signaling pathway selected from lysosomal protease inhibitors, vacuolar H + -ATPase inhibitors, intravesicular 2 168222090v1 Attorney Docket No.243734.000197 acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof.
  • the method further comprises administering to the subject an effective amount of an anti-cancer immunotherapy.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors.
  • said DCs are type-1 conventional dendritic cells (cDC1s).
  • said DCs have been pre-exposed to an antigen associated with said cancer.
  • said DCs are autologous to the subject.
  • the glutamine- sufficient medium comprises 0.6-2 mM glutamine.
  • the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H + - ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof.
  • the DCs and glutamine are administered simultaneously. In certain embodiments, the DCs and glutamine are administered sequentially in any order. In certain embodiments, the method further comprises administering to the subject an effective amount of an anti-cancer immunotherapy.
  • glutamine is administered in an amount effective for augmenting DC-mediated CD8+ T-cell anti-cancer immunity in the subject.
  • glutamine is administered intratumorally.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and inhibiting lysosomal signaling pathway in DCs of the subject.
  • inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor of lysosomal signaling pathway selected from lysosomal protease inhibitors, vacuolar H + -ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof.
  • the immunotherapy and the inhibitor of lysosomal signaling pathway are administered simultaneously.
  • the immunotherapy and the inhibitor of lysosomal signaling pathway are 3 168222090v1 Attorney Docket No.243734.000197 administered sequentially in any order.
  • the method further comprises administering an effective amount of glutamine to the subject.
  • glutamine is administered in an amount effective for augmenting DC-mediated CD8+ T-cell anti-cancer immunity in the subject.
  • glutamine is administered intratumorally.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors.
  • said DCs are cDC1s.
  • said DCs have been pre- exposed to an antigen associated with said cancer.
  • said DCs are autologous to the subject.
  • the glutamine-sufficient medium comprises 0.6-2 mM glutamine.
  • the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H + -ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof.
  • the immunotherapy and the DCs are administered simultaneously. In certain embodiments, the immunotherapy and the DCs are administered sequentially in any order.
  • the method further comprises administering an effective amount of glutamine to the subject.
  • glutamine is administered in an amount effective for augmenting DC-mediated CD8+ T-cell anti-cancer immunity in the subject.
  • glutamine is administered intratumorally.
  • said immunotherapy can be a DC-based therapy, a T-cell-mediated therapy, or an immune checkpoint blockade therapy.
  • Non-limiting examples of useful DC-based therapies include, e.g., DC vaccines, adoptive transfer of antigen-loaded or activated DCs, administration of DC-activating factors, administration of DC-mobilizing agents, administration of antigens and/or adjuvants, using DC- specific antibodies to deliver an antigen or adjuvant or nanoparticle, and any combinations thereof.
  • Non-limiting examples of useful T-cell-mediated therapies include, e.g., chimeric antigen receptor (CAR) T cell therapies, adoptive T cell transfer (ACT) therapies (e.g., wherein the transferred T cells are antigen-specific CD8 + T cells), T cell receptor (TCR) T cell therapies, tumor-infiltrating lymphocyte (TIL) therapies, neoantigen cancer vaccines, and any combinations thereof.
  • CAR chimeric antigen receptor
  • ACT adoptive T cell transfer
  • T cells are antigen-specific CD8 + T cells
  • TCR T cell receptor
  • TIL tumor-infiltrating lymphocyte
  • Non- limiting examples of useful immune checkpoint blockade therapies include, e.g., anti-programmed 4 168222090v1 Attorney Docket No.243734.000197 death 1 (anti-PD-1) therapies, anti-programmed death ligand 1 (anti-PD-L1) therapies, anti- lymphocyte activation gene-3 (anti-LAG-3) therapies, anti-cytotoxic T-lymphocyte antigen-4 (anti-CTLA-4) therapies, anti-T-cell immunoglobulin and mucin domain 3 (anti-TIM-3) therapies, and any combinations thereof.
  • the method further comprises inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject.
  • the method further comprises inhibiting lysosomal signaling pathway in DCs of the subject.
  • inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor selected from lysosomal protease inhibitors, vacuolar H + -ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof.
  • the method further comprises administering to the subject DCs, wherein said DCs have been pre-incubated in a glutamine- sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors.
  • said DCs are cDC1s.
  • the glutamine-sufficient medium comprises 0.6-2 mM glutamine.
  • the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H + -ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof.
  • said DCs have been pre-exposed to an antigen associated with said cancer.
  • said DCs are autologous to the subject.
  • said cancer is characterized by tumors with glutamine deprivation.
  • said cancer is selected from colon cancer, melanoma, breast cancer, pancreatic cancer, and lung cancer.
  • the invention provides a method for enhancing anti-tumor CD8+ T- cell immunity in a tumor of a subject in need thereof, comprising administering to the subject intratumorally an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors.
  • said DCs are cDC1s.
  • the glutamine-sufficient medium comprises 0.6-2 mM glutamine.
  • the one or more lysosomal 5 168222090v1 Attorney Docket No.243734.000197 signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H + -ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof.
  • said DCs have been pre-exposed to an antigen associated with said tumor.
  • the method further comprises administering to the subject intratumorally an effective amount of glutamine and/or inhibiting SLC38A2-mediated glutamine uptake in tumor cells of the subject and/or inhibiting lysosomal signaling pathway in DCs of the subject.
  • inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor selected from lysosomal protease inhibitors, vacuolar H + -ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof.
  • said tumor has glutamine deprivation.
  • Figs. 1A-1O depict that intratumoral glutamine supplementation promotes cDC1- mediated anti-tumor immunity.
  • Gln was injected as in Figs.1B-1C.
  • Anti-PD-1 (200 ⁇ g) was intraperitoneally injected at days 7, 10 and 13 6 168222090v1 Attorney Docket No.243734.000197 after tumor inoculation.
  • Fig. 1I WT mice with established MC38 tumors were treated with PBS or Gln intratumorally daily starting at day 5 after tumor inoculation, and euthanized at day 15.
  • Dendritic cells CD45 + CD64 ⁇ CD11c + MHC-II +
  • CD45 + non-macrophage immune cells CD45 + CD64 ⁇
  • macrophages CD45 + CD64 +
  • Violin plots show activity score of signature genes related to different functional states (early activation, memory precursor, memory, and effector/cytokine) in intratumoral CD8 + T cells from PBS or Gln-treated mice.
  • Intratumoral lymphocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h.
  • Fig.1L plot depicting normalized enrichment score (NES) and statistical significance of the GSEA performed to assess the effects of glutamine supplementation on conventional dendritic cells (cDCs), neutrophils, plasmacytoid dendritic cells (pDCs), B cells, macrophages and CD45 ⁇ cells that were predominantly tumor cells (these populations were identified by scRNA-seq analysis in Fig. 5G).
  • Fig.1O WT mice were inoculated with B16-OVA cells.
  • Figs. 2A-2R depict that glutamine interplay between tumor cells and cDC1 modulates anti-tumor immunity.
  • sort-purified cDC1 were pulsed with OVA protein (200 ⁇ g/ml) in medium containing all 20 common amino acids (+AA) or medium lacking an individual amino acid as indicated, irradiated and then cocultured with OT-I (Fig.2A) or OT-II (Fig.2B) T cells at a ratio of 1:10.
  • OVA protein 200 ⁇ g/ml
  • OT-I Fig.2A
  • OT-III Fig.2B
  • Fig.2C effect of MC38 supernatant on the priming function of cDC1.
  • Fig. 2D effect of individual amino acid supplementation in MC38 supernatant on the priming capacity of cDC1.
  • cDC1 were pulsed with OVA protein in MC38 cell culture supernatant supplemented with an individual amino acid as indicated, irradiated, and then cocultured with OT-I T cells.
  • Fig.2E MC38 cells and bone marrow-derived DCs (BMDCs) were cultured in a transwell at a ratio of 1:4 in RPMI 1640 medium supplemented with 2 or 0.6 mM glutamine.
  • Fig.2F expression of glutamine transporters SLC1A5, SLC6A14, SLC6A19, SLC38A1, SLC38A2, SLC38A3, SLC38A4 and SLC38A5 in human melanoma cells, DCs and CD8 + T cells derived from a publicly available human melanoma scRNA-seq dataset (GSE72056) 39 .
  • MC38-Cas9-expressing MC38 cells were transduced with sgRNA targeting Slc38a2 (sgSlc38a2) or non-targeting control (sgNTC) sgRNA.
  • SLC38A2 was analyzed by immunoblot.
  • ⁇ -Actin was used as loading control.
  • Molecular weight markers were indicated in kilodaltons (kDa).
  • Fig.2L cDC1 were sorted from the spleen of WT
  • NS not significant; *P ⁇ 0.05; **P ⁇ 0.01; ***P ⁇ 0.001; ****P ⁇ 0.0001; two-tailed unpaired Student’s t-test (Figs.2C, 2E, 2I, 2J, 2L-N, 2Q, 2R) or two-way ANOVA (Figs.2H, 2K, 2O, 2P). Data are representative of one (Fig. 2G), two (Figs. 2E, 2I-2K, 2M-2R), or at least three (Figs. 2A-2D, 2H, 2L) independent experiments. Numbers indicate percentages of cells in gates (Figs.2J, 2N).
  • Figs.3A-3S depict that glutamine promotes the priming effect and anti-tumor immunity of cDC1 via FLcN.
  • Fig. 3A HEK293T cells were transfected with HA-FLCN and Flag-FNIP2. Cells were starved with glutamine (Gln)-free medium for 3 h, and Gln was added back for 10 or 15 min. The interaction between FLCN and FNIP2 was analyzed by anti-HA immunoprecipitation and immunoblot for Flag (for FNIP2) and HA (for FLCN). Molecular weights were indicated in kilodaltons (kDa). Long and short exposures (exp.) for HA immunoblot were shown.
  • Fig. 3A HEK293T cells were transfected with HA-FLCN and Flag-FNIP2. Cells were starved with glutamine (Gln)-free medium for 3 h, and Gln was added back for 10 or 15 min. The interaction between FLCN and FNIP
  • [ 3 H] thymidine ([ 3 H] TdR) incorporation by OT-I T cells was measured.
  • HKLM-OVA heat-killed Listeria monocytogenes
  • Fig.3I effect of Gln supplementation on the priming effect of WT and FLCN-deficient cDC1.
  • MC38 supernatant MC38 cell culture-derived supernatant
  • Supernatant + Gln Supernatant + Gln
  • [ 3 H] TdR incorporation by OT-II T cells was measured.
  • Figs.3M-3N MC38 cells were inoculated subcutaneously into WT and Flcn ⁇ DC mice.
  • Fig.3N MHC-I antigen presentation
  • Fig.3O violin plots show the activity scores of gene signatures related to early activation, memory precursor, memory and effector/cytokine in intratumoral CD8 + T cells (profiled by scRNA-seq analysis) from WT and Flcn DDC mice.
  • Fig. 3P quantification of effector-like and stem-like cells among intratumoral CD8 + T cells from WT and Flcn ⁇ DC mice.
  • Intratumoral lymphocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h. Quantification of the frequencies of IFN ⁇ + (left), TNF ⁇ + (middle) and Granzyme B + (right) cells among intratumoral CD8 + T cells.
  • Intratumoral lymphocytes were stimulated with OVA257-264 peptide in the 11 168222090v1 Attorney Docket No.243734.000197 presence of monensin for 4 h.
  • Flow cytometry analysis (left) and quantification of the frequency (middle) and number (right) of TNF ⁇ + IFN ⁇ + cells among intratumoral CD8 + T cells (Fig. 3S).
  • Data are means ⁇ s.e.m. NS, not significant; *P ⁇ 0.05; **P ⁇ 0.01; ***P ⁇ 0.001; ****P ⁇ 0.0001; two-tailed unpaired Student’s t-test (Figs.
  • FIG. 3B-D, 3K, 3L, 3Q03S 3B-D, 3K, 3L, 3Q03S
  • one-way ANOVA Figs. 3E, 3I, 3J
  • two-way ANOVA Figs. 3F-3H
  • Wilcoxon rank sum test Figs. .
  • Data are representative of two (Figs.3A, 3D, 3E, 3I, 3J, 3R, 3S), or at least three (Figs. 3B, 3C, 3F-3H, 3K, 3L, 3Q) independent experiments. Numbers indicate percentages of cells in gates (Figs.3E, 3R, 3S).
  • Figs.4A-4L depict that co-deletion of TFEB restores the priming effect of cDC1 caused by FLCN deficiency and glutamine restriction.
  • Figs. 4B-4C GSEA enrichment plots showing upregulation of KEGG lysosome pathway (Fig.4B) and putative TFEB target genes (derived from a public dataset that identified TFEB targets by integrating TFEB ChIP-seq analysis and TFEB overexpression 52 ) (Fig.
  • splenic cDC1 from Flcn ⁇ DC versus WT mice FDR, false discovery rate; NES, normalized enrichment score.
  • Fig.4E immunoblot analysis of Cathepsin D (pro and mature forms), FLCN and TFEB expression in cDC1 from WT, Flcn ⁇ DC , Tfeb ⁇ DC and Flcn/Tfeb ⁇ DC mice. GAPDH was used as loading control. Molecular weights were indicated in kilodaltons (kDa). Fig.
  • [ 3 H] thymidine ([ 3 H] TdR) incorporation by OT-I T cells was measured.
  • mice were inoculated with MC38 cells, and euthanized at day 15.
  • Flow cytometry analysis left and quantification of the frequencies (right) of effector-like (CD39 + Ly108 ⁇ or TIM-3 + TCF1 ⁇ ) and stem-like (CD39 ⁇ Ly108 + or TIM-3 ⁇ TCF1 + ) subsets of intratumoral CD8 + T cells (Fig. 4I).
  • Flow cytometry analysis (left) and quantification (right) of the MFI of T-bet in intratumoral CD8 + T cells (Fig. 4J).
  • Fig. 4K splenic cDC1 were sort-purified from WT and Flcn ⁇ DC mice and incubated in glutamine (Gln)-sufficient medium or starved in Gln-free medium for 3 h.
  • TFEB protein expression in cytosolic and nuclear fractions was analyzed by immunoblot analysis. The protein levels of cytosolic or nuclear TFEB were normalized to GAPDH or Lamin B1, respectively. Numbers indicate the abundance of cytosolic or nuclear TFEB relative to that of WT in the presence of Gln. Molecular weights were indicated in kDa.
  • Figs. 4H Data are representative of two (Figs. 4D, 4E, 4J, 4L), or at least three (Figs. 4H, 4I, 4K) independent experiments. Data are pooled from two (Fig. 4G) or three (Fig. 4F) independent experiments. Numbers indicate percentages of cells in gates (Fig.4I) or MFI (Figs.4D, 4J). [0029] Figs.5A-5O depict that glutamine supplementation enhances anti-tumor immunity. Fig. 5A, wild-type (WT) mice were inoculated with B16-OVA tumor cells.
  • matched plasma and tumor interstitial fluid TIF
  • glutamine Gln; left
  • glucose right
  • n 4 mice
  • Figs.5B-5C WT mice were inoculated with MC38 or B16-OVA cells, and euthanized at day 15 after tumor challenge.
  • the levels of 20 common amino acids in matched plasma and TIF from MC38 Fig. 5B
  • B16-OVA Fig. 5C
  • FIG. 5H dot plot showing expression of activation and effector genes including Cd44, Gzmb, Prf1, Tbx21 and Tnf in intratumoral CD8 + T cells from mice treated with PBS or Gln.
  • Fig.5I violin plot showing Gzmb (left) and Prf1 (right) expression in intratumoral CD8 + T cells from mice treated with PBS or Gln.
  • Fig. 5J the fraction of stem-like (TIM-3 ⁇ TCF1 + ) and effector-like (TIM- 3 + TCF1 ⁇ ) CD8 + T cell subclusters in mice with established MC38 tumors treated with PBS or Gln.
  • Fig. 5L violin plot showing activity score of signatures related to MHC-I antigen presentation pathway in intratumoral cDCs from mice treated with PBS or Gln.
  • MFI mean fluorescence intensity
  • Fig.5O WT mice were inoculated with B16-OVA cells.
  • FIG. 6A-6P depict that glutamine promotes the priming capacity of cDCs.
  • FIG. 6A schematic of functional amino acid screening assay used in Figs.2A, 2B, 6B, and 6C.
  • Sort-purified splenic cDC1 or cDC2 were pulsed with OVA protein (200 ⁇ g/ml) in medium without an individual amino acid (AA), irradiated and then cocultured with OT-I or OT-II T cells at a ratio of 1:10 for 3 days.
  • 3 H-thymidine [ 3 H] TdR
  • Figs.6B-6C sort-purified cDC1 were pulsed with OVA in medium containing all 20 common amino acids (+AA) or medium lacking an individual amino acid as indicated, irradiated and then cocultured with OT-I (Fig. 6B) or OT-II (Fig.6C) T cells at a ratio of 1:10 for 3 days.
  • Sort-purified splenic cDC1 or cDC2 were pulsed with OVA protein in AA-free medium supplemented with an individual amino acid for 2 h, irradiated and then cocultured with OT-I or OT-II T cells for 3 days. [ 3 H] TdR was added for the last 8 h to measure [ 3 H] TdR incorporation.
  • Figs.6H-6I, cDC1 Fig.
  • Fig. 6H or cDC2 (Fig.6I) were pulsed with OVA protein in AA-free medium supplemented with an 15 168222090v1 Attorney Docket No.243734.000197 individual amino acid as indicated, irradiated and then cocultured with OT-I or OT-II T cells for 3 days.
  • Fig. 6J MC38 cells were cultured in RPMI 1640 medium supplemented with 10% (v/v) dialyzed FBS and 0.6 mM Gln for 48 h.
  • cDC1 were pulsed with OVA protein and culture supernatant derived from MC38 cells cultured in Gln-free medium supplemented with various concentrations (0.3, 0.6 or 2 mM) of Gln for 2 h. The cDC1 were then irradiated and cocultured with OT-II T cells.
  • sort-purified cDC1 were cultured in fresh medium, MC38 supernatant, or MC38 supernatant supplemented with 0.6 mM Gln for 2 h. Intracellular Gln abundance in cDC1 was quantified by mass spectrometry.
  • Fig.6O sort-purified cDC1 were pulsed with OVA protein in fresh medium, B16F10 supernatant (B16 supernatant), or B16 supernatant supplemented with Gln (B16 supernatant + Gln), and then cocultured with OT-I T cells.
  • B16 supernatant B16 supernatant
  • B16 supernatant + Gln B16 supernatant + Gln
  • FIG. 7A-7I depict that SLC38A2 deficiency in tumor cells promotes anti-tumor immunity.
  • Fig. 7A expression of glutamine transporters Slc1a5, Slc6a19, Slc38a1, Slc38a2, Slc38a3 and Slc38a5 in murine tumor cells, DCs and CD8 + T cells from publicly available mouse scRNA-seq dataset (GSE121861) 40 , which profiled six syngeneic tumor models including B16F10 melanoma, EMT6 breast mammary carcinoma, LL2 Lewis lung carcinoma, CT26 colon carcinoma, MC38 colon carcinoma and Sa1N fibrosarcoma.
  • Fig.7C WT mice were inoculated with B16-FLT3L tumor cells, and euthanized at day 15 after tumor inoculation. Intratumoral cDC1, CD8 + T and tumor cells were sort-purified, and SLC38A2 expression was analyzed by immunoblot. ⁇ -Actin was used as loading control. Molecular weights are indicated in kilodaltons (kDa). Fig.
  • MC38- Cas9-expressing MC38 (MC38- Cas9) cells were transduced with sgRNA targeting Slc38a2 (sgSlc38a2) or non-targeting control (sgNTC) sgRNA.
  • Fig.7F Cas9-expressing B16-OVA (B16- OVA-Cas9) cells were transduced with sgSlc38a2 or sgNTC. Immunoblot analysis of SLC38A2. ⁇ -Actin was used as loading control. Molecular weights are indicated in kDa.
  • WT wild-type mice inoculated with sgNTC- or sgSlc38a2-transduced B16- OVA-Cas9 cells
  • Figs. 7B, 7D, 7E, 7H two-tailed unpaired Student’s t-test
  • Figs. 7G, 7I two-way ANOVA
  • Data are representative of one (Figs. 7B, 7C, 7F) or two (Fig.7D, 7E, 7G-7I) independent experiments.
  • Figs. 8A-8G depict characterization of DC and T cell phenotypes in Slc38a2 ⁇ DC mice.
  • Fig.8B cDC1 and cDC2 were sort-purified from WT and Slc38a2 ⁇ DC mice.
  • PPN peripheral lymph nodes
  • MN mesenteric lymph nodes
  • Fig. 8G splenocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h.
  • Figs.8A, 8B Data are representative of two (Figs.8A, 8B) or three (Figs.8H-8J) independent experiments or pooled from two (Figs.8C-8G) independent experiments. Numbers indicate percentages of cells in gates or quadrants (Figs.8D- 8G). 18 168222090v1 Attorney Docket No.243734.000197 [0033] Figs. 9A-9E depict that SLC38A2 deficiency in DCs impairs anti-tumor adaptive immune responses.
  • Fig.9D WT mice were inoculated with B16-OVA cells.
  • HEK293T cells were maintained in glutamine (Gln)-sufficient medium (no starvation), or starved of Gln ( ⁇ Gln) for 3 h, followed by refeeding with Gln for 15 min (Gln add-back).
  • Immunoprecipitation (IP) was performed using anti-DEPDC5 (component of GATOR1) (Fig. 10A) or anti-WDR24 (component of GATOR2) (Fig.10B) antibody.
  • the immunoprecipitated proteins were analyzed by immunoblot as indicated. Molecular weights were indicated in kilodaltons (kDa). Data are representative of two (Figs.10A, 10B) independent experiments.
  • Figs.11A-11K depict that FLCN deficiency in DCs impairs anti-tumor immunity.
  • IL-2 (left) and IFN ⁇ (right) production by OT-I T cells was measured.
  • IL-2 production by OT-II T cells was measured.
  • [ 3 H] thymidine ([ 3 H] TdR) incorporation by OT-I (left) and OT-II (right) T cells was measured.
  • Fig. 11J Quantification of the frequencies of CD8 + T cells, CD4 + Foxp3 ⁇ conventional T cells, monocytes/macrophages (Mo/Mac), NK cells and Treg cells among non-DC CD45 + cells in scRNA-seq (Fig. 11J).
  • Fig. 11K GSEA enrichment plot showing downregulated antigen processing and presentation pathway in intratumoral cDC1 from Flcn ⁇ DC mice versus WT mice (profiled by scRNA-seq analysis).
  • FDR false discovery rate
  • NES normalized enrichment score.
  • Data are means ⁇ s.e.m.
  • Figs. 11A-11D data are representative of one (Fig. 11F), two (Fig. 11A) or at least three (Figs.11B-11E, 11G) independent experiments.
  • Figs. 12A-12G depict that FLCN deficiency in DCs impairs the effector function of cytotoxic CD8+ T cells in the TME.
  • MFI mean fluorescence intensity.
  • Figs.12A-12G Data are means ⁇ s.e.m. NS, not significant; *P ⁇ 0.05; **P ⁇ 0.01; ***P ⁇ 0.001; two-tailed unpaired Student’s t- test (Figs.12A-12G). Data are representative of two (Figs.12B, 12E, 12F) or at least three (Figs. 12A, 12C, 12D, 12G) independent experiments. Numbers indicate MFI (Figs.12A, 12B, 12E) or percentages of cells in gates (Figs.12D, 12F). [0037] Figs. 13A-13J depict that FLCN-deficient cDC1 show enhanced lysosomal activation, which is rescued by TFEB co-deletion. Fig.
  • FIG. 13A principal component analysis (PCA) plot of ATAC-seq data for WT and FLCN-deficient cDC1 with the percentage of variance shown.
  • FIGs. 13B-13C GSEA of transcriptome analysis of FLCN-deficient versus WT cDC1 using KEGG pathway (Fig.13B) and Hallmark gene sets combined with putative TFEB target genes (derived from a public dataset that identified TFEB targets by integrating TFEB ChIP-seq analysis and TFEB overexpression 52 ) (Fig.13C).
  • FDR false discovery rate
  • NES normalized enrichment score
  • Fig. 13G immunoblot analysis of Cathepsin D (pro and mature forms) expression in cDC1 from WT and Flcn ⁇ DC mice. ⁇ -Tubulin was used as loading 21 168222090v1 Attorney Docket No.243734.000197 control. Molecular weights were indicated in kDa.
  • Fig.13H accessibility of the Ctsd gene and its upstream regions in WT and FLCN-deficient cDC1 assessed by ATAC-seq.
  • Fig.13H accessibility of the Ctsd gene and its upstream regions in WT and FLCN-deficient cDC1 assessed by ATAC-seq.
  • IL-2 left
  • IFN ⁇ right
  • Data are means ⁇ s.e.m. NS, not significant; *P ⁇ 0.05; **P ⁇ 0.01; ****P ⁇ 0.0001; two-tailed unpaired Student’s t-test (Fig. 13E) or one-way ANOVA (Figs.13I, 13J).
  • Figs.14A-14H depict roles of the FLCN–TFEB signaling axis in mediating anti-tumor immunity and glutamine availability.
  • Intratumoral lymphocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h.
  • Flow cytometry analysis (left) and quantification of the frequencies (right) of IFN ⁇ + (upper), TNF ⁇ + (middle) and Granzyme B + (lower) cells among intratumoral CD8 + T cells (Fig. 14D).
  • Fig. 14E venn diagram showing the overlap of putative TFEB target genes 52 and significantly upregulated genes in FLCN-deficient (versus WT) cDC1, with the 26 overlapped genes shown.
  • FIG. 14F GSEA plot depicting the enrichment of the gene set containing the 26 overlapped genes identified in Fig.14E, in cDC1 treated with glutamine (Gln)-free medium versus complete medium.
  • Fig. 14H schematic of glutamine intercellular crosstalk between cDC1 and tumor cells, and nutrient signaling in cDC1 in modulating anti-tumor immunity.
  • cDC1 and tumor cells both express the glutamine transporter SLC38A2 to mediate glutamine uptake, with tumor cells expressing higher 22 168222090v1 Attorney Docket No.243734.000197 level of SLC38A2 than cDC1.
  • Deficiency of SLC38A2 in tumors reduces tumor growth by impinging upon anti-tumor immunity, while its deletion in cDC1 impairs anti-tumor responses (not depicted).
  • glutamine induces FLCN–FNIP2 complex assembly and inhibits TFEB activity to promote the cross-presentation capacity of cDC1.
  • DCs dendritic cells
  • cDC1 type-1 conventional DCs
  • PRRs pattern recognition receptors
  • Nutrients are emerging as mediators of adaptive immunity 6-9 , but the extent to which nutrients impact DC function or innate- adaptive cell communication is largely unresolved.
  • glutamine is identified as an intercellular metabolic checkpoint that mediates tumor-cDC1 crosstalk by licensing the functionality of cDC1 in activating cytotoxic T cells.
  • TME tumor microenvironment
  • intratumoral glutamine supplementation alone markedly inhibits tumor growth by augmenting cDC1-mediated CD8 + T-cell immunity, and overcomes therapeutic resistance to checkpoint blockade and T-cell-mediated immunotherapies.
  • glutamine is the dominant amino acid to promote cDC1 function; accordingly, single-cell RNA- sequencing (scRNA-seq) analysis reveals elevated conventional DC functional capacity in glutamine-supplemented tumors.
  • scRNA-seq single-cell RNA- sequencing
  • the beneficial anti-tumor effect of glutamine supplementation is blunted upon depletion of cDC1 or lymphocytes, revealing immune-mediated, tumor-extrinsic rather than tumor-intrinsic effects.
  • tumor cells and cDC1 compete for glutamine uptake via transporter SLC38A2. Indeed, loss of SLC38A2 in tumor cells and cDC1 enhances and dampens anti-tumor immunity, respectively. Furthermore, in cDC1, glutamine induces nutrient-dependent intracellular signaling via folliculin (FLCN) to impinge upon transcription factor EB (TFEB) function.
  • FLCN folliculin
  • TFEB transcription factor EB
  • cDC1 preferentially promote the priming of CD8 + cytotoxic T cells, whereas cDC2 are superior at CD4 + T-cell priming 4, 5 .
  • cDC1 are involved in anti-tumor immunity, as they cross- present tumor-associated antigens to cytotoxic CD8 + T cells and promote their expansion and effector function within tumors. As such, cDC1 function is associated with immune-mediated tumor rejection and the success of immune checkpoint blockade (ICB) and adoptive T-cell therapies (ACT) 19-22 .
  • the immunosuppressive microenvironment in tumors can contribute to immunoevasion via impairing the functional activity of DCs 3 , which may be mediated by dysregulated abundance or sensing of local environmental cues.
  • the present invention is based, in part, on identifying glutamine as a limiting factor and important driver for the activation and function of cDC1 in anti-tumor immunity, and the underlying mechanisms for glutamine acquisition and signaling.
  • glutamine abundance is highly depleted in the TME and tumor cell culture supernatants, and glutamine supplementation alone in vivo or in vitro is sufficient to restore the functionality of cDC1 for CD8 + T-cell priming.
  • the therapeutic anti-tumor effect of glutamine supplementation is abrogated in mice deficient in cDC1 (Batf3 –/– ) or lymphocytes (Rag1 –/– ), revealing the extraordinarility of immune-mediated, tumor cell-extrinsic effect of glutamine in vivo, rather than tumor cell-intrinsic glutamine effect that has been a subject of extensive interest and debate 23 .
  • glutamine supplementation shows pronounced effects at improving the therapeutic efficacies of ICB or ACT, thereby possibly overcoming therapeutic resistance to current immunotherapies, which may have therapeutic implications 1, 2 .
  • Glutamine 24 168222090v1 Attorney Docket No.243734.000197 transporter SLC38A2 was further revealed herein as an intercellular metabolic checkpoint to dictate glutamine availability to tumor cells and cDC1, and genetic deletion analyses reveal that tumor-expressed SLC38A2 impairs, while DC-expressed SLC38A2 promotes, anti-tumor immunity.
  • the beneficial anti-tumor effect of intratumoral glutamine supplementation is blunted upon DC-specific deletion of SLC38A2 or FLCN, thereby linking SLC38A2 and FLCN in coordinating glutamine-dependent effects in DCs in vivo.
  • the results of the present disclosure establish SLC38A2 and FLCN as highly selective drivers for cDC1 in orchestrating anti-tumor immunity, and suggest that manipulation of glutamine uptake and intracellular signaling represents a means to reinforce the functionality of cDC1 for cancer therapy.
  • intratumoral glutamine supplementation alone markedly suppresses tumor growth, and significantly enhances the efficacy of immune checkpoint blockade (anti-PD-1/PD-L1 treatment) and adoptive T cell transfer therapies.
  • T cell includes thymocytes, naive T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, or activated T lymphocytes.
  • a T cell can be a T helper (Th) cell, for example a T helper 1 (Thl), a T helper 2 (Th2) cell, a T helper 17 (Th17) or regulatory T (Treg) cell.
  • the T cell can be a T helper cell (Th; CD4 + T cell) CD4 + T cell, a cytotoxic T cell (CTL; CD8 + T cell), a tumor infiltrating cytotoxic T cell (TIL; CD8 + T cell), CD4 + CD8 + T cell, or any other subset of T cells.
  • T helper cell Th
  • CD4 + T cell CD4 + T cell
  • CTL cytotoxic T cell
  • TIL tumor infiltrating cytotoxic T cell
  • CD8 + T cell CD4 + CD8 + T cell
  • Other illustrative populations of T cells suitable for use in particular embodiments include naive T cells and memory T cells.
  • NKT cells refer to a specialized population of T cells that express a semi-invariant ⁇ T- cell receptor, but also express a variety of molecular markers that are typically associated with NK cells, such as NK1.1.
  • NKT cells include NK1.1 + and NK1.1-, as well as CD4 + , CD4-, CD8 + and CD8- cells.
  • the TCR on NKT cells is unique in that it recognizes glycolipid antigens presented by the MHC I-like molecule CD Id. NKT cells can have either protective or deleterious effects due to their abilities to produce cytokines that promote either inflammation or immune tolerance.
  • gamma-delta T cells which refer to a specialized population that to a 26 168222090v1 Attorney Docket No.243734.000197 small subset of T cells possessing a distinct TCR on their surface, and unlike the majority of T cells in which the TCR is composed of two glycoprotein chains designated ⁇ - and ⁇ -TCR chains, the TCR in ⁇ T cells is made up of a ⁇ -chain and a ⁇ -chain.
  • ⁇ T cells can play a role in immunosurveillance and immunoregulation, and were found to be an important source of IL-17 and to induce robust CD8 + cytotoxic T cell response.
  • Tregs refers to T cells that suppress an abnormal or excessive immune response and play a role in immune tolerance.
  • Tregs cells are typically transcription factor Foxp3-positive CD4 + T cells and can also include transcription factor Foxp3-negative regulatory T cells that are IL-10-producing CD4 + T cells.
  • the terms “dendritic cell” and “DC” as used herein refer to any member of a diverse population of morphologically similar type of immune cell that is found in lymphoid or non- lymphoid tissues and boosts immune responses by showing antigens on its surface to other cells of the immune system.
  • Dendritic cells serve a key function in host defense, linking innate detection of pathogens to the activation of pathogen-specific adaptive immune responses (Steinman et al., 2006; Takeuchi et al., 2009).
  • DCs are formed in bone marrow and are present in lymphoid and other tissues specializing in the uptake of particulate material by phagocytosis and acting as antigen-presenting cells in immune responses.
  • Non-limiting examples of dendritic cells include bone marrow-derived dendritic cells (BMDC), plasmacytoid dendritic cells, Langerhans cells, interdigitating cells, veiled cells, and dermal dendritic cells.
  • Dendritic cells are also divided in three major DC subsets: plasmacytoid DC (pDC), myeloid/conventional DC1 (cDC1) and myeloid/conventional DC2 (cDC2).
  • the terms “treat” or “treatment” of a state, disorder or condition include: (1) preventing, delaying, or reducing the incidence and/or likelihood of the appearance of at least one clinical or sub-clinical symptom of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition, but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof or at least one clinical or sub-clinical symptom thereof; or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms.
  • the benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician.
  • 27 168222090v1 Attorney Docket No.243734.000197
  • the term “effective” applied to dose or amount refers to that quantity of a compound or pharmaceutical composition that is sufficient to result in a desired activity upon administration to a subject in need thereof. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular drug or drugs employed, the mode of administration, and the like.
  • compositions described herein refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., a human).
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.
  • patient refers to mammals, including, without limitation, human and veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.) and experimental animal models.
  • subject is a human.
  • Singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise.
  • a reference to “a method” includes one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure.
  • the term “about” or “approximately” includes being within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, still more preferably within 10%, and even more preferably within 5% of a given value or range.
  • the allowable variation encompassed by the term “about” or “approximately” depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art.
  • glutamine includes glutamine, also known as glutamic acid 5-amide, and hydrolyzable derivatives thereof, such as esters and/or amides of glutamine that yield glutamine in the body of a mammal, as well as pharmaceutically acceptable salts of glutamine.
  • glutamine also known as glutamic acid 5-amide
  • hydrolyzable derivatives thereof such as esters and/or amides of glutamine that yield glutamine in the body of a mammal, as well as pharmaceutically acceptable salts of glutamine.
  • useful pharmaceutically acceptable salts of glutamine include, e.g., the acid addition salts of amines, such as hydrochlorides, tartrates, acetates, citrates, and the like, and carboxylate salts, such as potassium and sodium salts.
  • the weight of glutamine or weight ratio of glutamine to other components refers to the weight of the glutamine portion of a hydrolyzable glutamine derivative, or the weight of the glutamine portion of a salt of glutamine.
  • the practice of the present invention employs, unless otherwise indicated, conventional techniques of statistical analysis, molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such tools and techniques are described in detail in e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual.3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York; Ausubel et al.
  • glutamine is administered to a subject.
  • glutamine is administered in combination with an anti-tumor immunotherapy or an anti-cancer immunotherapy.
  • the immunotherapy and glutamine are administered simultaneously.
  • the immunotherapy and glutamine are administered sequentially in any order.
  • glutamine is administered in combination with inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject. In certain embodiments, glutamine is administered in combination with inhibiting lysosomal signaling pathway in DCs of the subject. In certain embodiments, glutamine is administered in combination with an effective amount of DCs, wherein said DCs have been pre- incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal 29 168222090v1 Attorney Docket No.243734.000197 signaling inhibitors.
  • glutamine is administered in combinations with an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors and with an effective amount of an anti-cancer immunotherapy.
  • glutamine is administered in combination with an effective amount of an anti-cancer immunotherapy and with inhibiting lysosomal signaling pathway in DCs of the subject.
  • glutamine is administered in combination with an effective amount of an anti-cancer immunotherapy and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors.
  • glutamine is administered in combination with an effective amount of an anti-cancer immunotherapy, an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors and with inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject.
  • glutamine is administered in combination with an effective amount of an anti-cancer immunotherapy, an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors, with inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject, and with comprising inhibiting lysosomal signaling pathway in DCs of the subject.
  • one or more of glutamine, inhibitors, and/or immunotherapies of the invention can be formulated as one or more pharmaceutical compositions and administered to a subject, such as a human patient, in a variety of forms adapted to the chosen route(s) of administration.
  • Non-limiting examples of useful routes of administration include, e.g., intratumoral, peritumoral, intravenous, parenteral, topical, transdermal, enteral, oral, intramuscular, subcutaneous, intraperitoneal (e.g., by infusion or injection), or by direct administration to the gastrointestinal tract (e.g., by enema or suppository).
  • the administration is intratumoral or peritumoral.
  • the amount of glutamine administered to the subject can be, but is not limited to, at least 0.5 mg/day/kg body mass of the subject or 0.2 to 3.0 g/day/kg body mass.
  • glutamine can be administered to the subject, e.g., one or two times per day. 30 168222090v1 Attorney Docket No.243734.000197 [0060]
  • solutions of glutamine or its salts can be prepared in water, optionally mixed with a nontoxic surfactant.
  • dispersions can be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • administering glutamine comprises administering a composition comprising about 5-15% w/w glutamine, 30-50% w/w carbohydrate carriers, including a disaccharide, a sugar alcohol or polyol, and glycerin, with the remainder of dry solids comprising, for example, an effective amount of a buffer, or buffering compound, modified cellulose, and optionally comprising stabilizers and emulsifiers, excipients/stabilizing agents (e.g., L-arginine), preservatives, defoamants, and flavoring.
  • the disaccharide can be, but is not limited to, sucrose.
  • the polyol can be, but is not limited to, sorbitol.
  • the buffer or buffering compound can be, but is not limited to, anhydrous monobasic sodium phosphate.
  • the modified cellulose can be, but is not limited to, Avicel® Cellulose Gel.
  • the stabilizers and emulsifiers can be, but is not limited to, xanthan gum and/or carrageenan.
  • the preservative can be, but is not limited to, methylparaben and/or potassium sorbate.
  • the defoamant can be, but is not limited to, simethicone.
  • glutamine can be administered as a liquid composition.
  • the liquid composition comprises 5-25% w/v L-glutamine, 20-40% w/v carbohydrate carrier, including a disaccharide, a sugar alcohol, and glycerin, 5-10% w/v citric acid, and an effective amount of buffer, and the remainder water or alcohol-water.
  • the liquid composition can optionally comprise stabilizers, preservatives, emulsifiers and flavorings.
  • the effective amount of buffer can comprise 0.4-0.8% sodium phosphate.
  • the use of a carbohydrate carrier in the composition can increase the cellular absorption of the amino acid by at least ten times over direct administration of the amino acid in water.
  • glutamine can be administered as an aqueous composition comprising 38% w/v L-glutamine, 30% w/v sucrose, and 2.8% w/v sorbitol.
  • excipients can also be added to the glutamine composition, provided that the necessary concentration of carbohydrate carrier is maintained.
  • the excipient can be, but is not limited to, a sweetener/solvent, emulsifying and 31 168222090v1 Attorney Docket No.243734.000197 stabilizing agents, preservatives and stabilizers, a defoamant/base ingredient, flavoring, or other ingredients which improve the stability and administration of the composition.
  • the sweetener/solvent is glycerin.
  • the emulsifying and stabilizing agent can be a cellulose gel, xanthan gum and/or carrageenan.
  • the cellulose gel is Avicel® Microcrystalline Cellulose Gel (FMC Corp., Philadelphia, Pa.).
  • the preservatives and stabilizers can be citric acid and/or methylparaben.
  • the defoamant/base ingredient can be simethicone.
  • the pharmaceutical glutamine dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising glutamine which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes.
  • the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage.
  • the liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, but not limited to, water, ethanol, a polyol, vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof.
  • the polyol can be, but is not limited to, glycerol, propylene glycol, liquid polyethylene glycols, and the like.
  • the proper fluidity can be maintained by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants.
  • various antibacterial and antifungal agents can be used to prevent the action of microorganisms.
  • the antibacterial and antifungal agents can be, without limitation, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents can be included, for example, sugars, buffers or sodium chloride.
  • agents delaying absorption can be used to achieve prolonged absorption of the injectable glutamine compositions.
  • the agents delaying absorption can be, aluminum monostearate and/or gelatin.
  • sterile injectable solutions are prepared by incorporating glutamine in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization.
  • compositions comprising glutamine may be applied in pure form, e.g., when they are liquids, for topical administration. However, it will generally be desirable to administer them to the skin as compositions or formulations, in combination with a dermatologically acceptable carrier.
  • the dermatologically acceptable carrier can be a solid or a liquid.
  • Solid carriers include, but are not limited to, finely divided solids such as talc, microcrystalline cellulose, clay, alumina, silica and the like.
  • Liquid carriers include, but are not limited to, water, alcohols or glycols or water-alcohol/glycol blends, in which glutamine can be dissolved or dispersed at effective levels.
  • glutamine can be dissolved or dispersed with the aid of non-toxic surfactants.
  • adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use.
  • the resultant liquid glutamine compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers.
  • thickeners can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the subject.
  • the thickeners can be synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials.
  • Dermatological compositions which can be used to deliver glutamine to the skin are known to the art. See U.S. Pat. No.4,608,392, U.S. Pat. No.4,992,478, U.S. Pat. No.4,559,157 and U.S. Pat. No. 4,820,508.
  • glutamine can be adapted for topical administration to the eye.
  • an ophthalmologically acceptable vehicle is employed.
  • the ophthalmologically acceptable vehicle can be, but is not limited to, an aqueous vehicle, a gel or an ointment.
  • the ophthalmologically acceptable vehicle can be buffered to about pH 5-6 and can also contain preservatives, thickeners and solubilizing agents as needed.
  • glutamine is formulated as eye drops.
  • the liquid eye drop compositions comprises 0.1% sodium hyaluronate (average molecular weight 1,800,000) or 0.1% Polysorbate 80 by weight to volume in water.
  • the liquid glutamine compositions also may contain buffers, isotonic salts, and preservatives such as EDTA and thimerisol. 33 168222090v1 Attorney Docket No.243734.000197 [0071]
  • the ophthalmic aqueous glutamine compositions of the invention have ophthalmic ally compatible pH and osmolality.
  • these compositions incorporate means to inhibit microbial growth. Such means may include, but are not limited to, preparation and packaging under sterile conditions and/or through inclusion of an antimicrobial effective amount of an ophthalmic acceptable preservative.
  • the glutamine composition is an in situ gellable aqueous composition.
  • the glutamine composition is an in situ gellable aqueous solution.
  • a glutamine composition comprises a gelling agent in a concentration effective to promote gelling upon contact with the eye or with lacrimal fluid in the exterior of the eye.
  • gelling agents include, but are not limited to, thermosetting polymers, polycarbophil, and polysaccharides such as gellan, carrageenan (e.g., kappa-carrageenan and iota-carrageenan), chitosan and alginate gums.
  • the thermosetting polymer can be tetra- substituted ethylene diamine block copolymers of ethylene oxide and propylene oxide, such as poloxamine 1307.
  • the carrageenan can be kappa-carrageenan and/or iota- carrageenan.
  • the term “in situ gellable” includes liquids of low viscosity, as well as more viscous liquids such as semi-fluid and thixotropic gels.
  • the liquids of low viscosity form gels upon contact with the eye or with lacrimal fluid in the exterior of the eye.
  • the more viscous liquids exhibit substantially increased viscosity or gel stiffness upon administration to the eye.
  • the glutamine of the invention can also be administered to the eye by an ophthalmic delivery device.
  • glutamine may be applied to a contact lens before the lens is placed in the eye, or after the contact lens is in the eye.
  • glutamine has a stable shelf-life.
  • the glutamine preparation of the present invention can be provided to the subject well 34 168222090v1 Attorney Docket No.243734.000197 in advance of the time of administration.
  • the glutamine preparations of the present invention can be stored in the clinic or the patient's home for administration as needed.
  • Pharmaceutically acceptable salts can be obtained using standard procedures well known in the art. Such procedures may include but are not limited to reacting a sufficiently basic compound with a suitable acid affording a physiologically acceptable anion.
  • the basic compound can be an amine.
  • Alkali metal or alkaline earth metal salts of carboxylic acids can also be made.
  • the alkali metal can be, but is not limited to, sodium, potassium or lithium.
  • alkaline earth metal can be, but is not limited to, calcium.
  • glutamine can be formulated for topical administration as ointment, gel or liquid form, including administration by transdermal patches.
  • a glutamine preparation can be applied to oral, nasal, and esophageal lesions by oral rinse, a gel, or an ingestible drink.
  • the carbohydrate carrier can be chosen from among a number of monosaccharides, disaccharides, or a combination of both, or from their polymers, such as dextrins, maltodextrins, and high fructose corn syrup products.
  • the carbohydrate carriers include sucrose, sorbitol and high fructose corn syrup products.
  • either a suspension or a drink can be provided as a dry mixture of carbohydrate carrier and an effective amount of amino acid, for reconstitution with water, juice, or other liquid.
  • bulk packaging of the dry mixture or packets containing single applications can be provided to a patient, health care provider, or any individual for whom the delivery of an increased concentration of active agent is desired.
  • the glutamine preparation can be constituted with water, juice, or other liquid before administration to provide for easy administration and increase the absorption of glutamine into the epithelial tissue.
  • premixed liquid bulk or unit dosage forms can also be used.
  • a glutamine composition having a relatively low concentration of free water can be accomplished by providing a lozenge or a form of candy or other medicated confection, such as a common lollipop, utilizing a suitable carbohydrate carrier, such as sucrose or sorbitol, and a gelling or thickening agent, as needed.
  • a suitable carbohydrate carrier such as sucrose or sorbitol
  • chewing gum can be used to deliver the carbohydrate carrier, such as sucrose, xylitol, sorbitol, or corn syrup solids, and glutamine.
  • the chewing gum can incorporate a central pocket of flavored syrup, composed of the appropriate mixture of carbohydrate carrier, 35 168222090v1 Attorney Docket No.243734.000197 such as xylose, sorbitol, or sucrose, and an effective amount of glutamine.
  • a solid solution of glutamine can be used in the preparation of chewing gum, lozenges, or a candy form such as a lollipop. Such solid solutions can be formed from comelts, coprecipitates, or by mechanical activation of the carbohydrate carrier and glutamine.
  • the candy or gum is placed in the mouth, where the surrounding fluids dissolve it.
  • the carbohydrate can proved the carrier to facilitate absorption of the glutamine into the epithelial cells of the oral cavity, the esophagus, and the stomach.
  • a toothpaste can also be formed to incorporate a carbohydrate carrier and glutamine. Microencapsulation of ingredients in toothpaste compositions has been described in U.S. Pat. No.4,348,378, U.S. Pat. No.4,071,614, and U.S. Pat. No.3,957,964.
  • the glutamine of the present invention can also be delivered by suppository to epithelial tissues of the colon and rectum.
  • an enema preparation can also be formed of a carbohydrate carrier and an amino acid, incorporating a sufficient amount of water to form an aqueous solution.
  • a solid solution of the biologically active agent in the carbohydrate carrier can also be administered in a suppository or enema, drawing the aqueous component from the colon or rectum.
  • a filled capsule can be used for delivery to the stomach. Such method has been described in U.S. Pat. No. 5,569,466.
  • enteric coated capsules or tablets, or enteric coated microparticles can be employed to delivery to the upper or lower intestines.
  • glutamine can be delivered in ice cream formulations.
  • glutamine can be delivered in frozen confections such as a popsicle.
  • DCs of the present invention are pre-incubated in a glutamine- sufficient medium.
  • glutamine-sufficient medium comprises from about 0.6 mM to about 2 mM glutamine.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting 36 168222090v1 Attorney Docket No.243734.000197 lysosomal signaling pathway in DCs of the subject.
  • inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of a lysosomal signaling pathway inhibitor.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and inhibiting lysosomal signaling pathway in DCs of the subject.
  • inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of a lysosomal signaling pathway inhibitor.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors.
  • Non-limiting examples of useful lysosomal signaling pathway inhibitors include, e.g., lysosomal protease inhibitors (e.g., leupeptin and/or pepstatin), vacuolar H + -ATPase inhibitors (e.g., Bafilomycin A1), intravesicular acidification inhibitors (e.g., chloroquine), cysteine protease inhibitors (e.g., E64), Cathepsin B inhibitors (e.g., CA-074), Cathepsin L inhibitors (e.g., Cathepsin L inhibitor III), and any combinations thereof.
  • lysosomal protease inhibitors e.g., leupeptin and/or pepstatin
  • vacuolar H + -ATPase inhibitors e.g., Bafilomycin A1
  • intravesicular acidification inhibitors e.g., chloroquine
  • cysteine protease inhibitors
  • the invention provides a method for inhibiting growth of a tumor in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-tumor immunotherapy.
  • the invention provides a method for enhancing the efficacy of an anti-cancer immunotherapy in a subject in need thereof, comprising administering to the subject said immunotherapy and an effective amount of glutamine.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-cancer immunotherapy.
  • the immunotherapy and glutamine are administered simultaneously. In certain embodiments of any of the above methods, the immunotherapy and glutamine are administered sequentially in any order.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject, and further comprising administering to the subject an effective amount of an anti-cancer immunotherapy.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting lysosomal signaling pathway in dendritic cells (DCs) of the subject, and further comprising administering to the subject an effective amount of an anti-cancer immunotherapy.
  • DCs dendritic cells
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors, and further comprising administering to the subject an effective amount of an anti-cancer immunotherapy.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and inhibiting lysosomal signaling pathway in DCs of the subject.
  • the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors.
  • immunotherapies useful in the methods of the invention include, e.g., DC-based therapies, T-cell-mediated therapies, and immune checkpoint blockade therapies.
  • Non-limiting examples of useful DC-based therapies include, e.g., DC vaccines, adoptive transfer of antigen-loaded or activated DCs, administration of DC-activating factors, administration of DC-mobilizing agents, administration of antigens and/or adjuvants, using DC- specific antibodies to deliver an antigen or adjuvant or nanoparticle, and any combinations thereof.
  • the DC-based therapy is selected from DC vaccines, adoptive transfer of 38 168222090v1 Attorney Docket No.243734.000197 antigen-loaded or activated DCs, administration of DC-activating factors, administration of DC- mobilizing agents, administration of antigens and/or adjuvants, using DC-specific antibodies to deliver an antigen or adjuvant or nanoparticle, and any combinations thereof.
  • the DC-based therapy comprises adoptive transfer of antigen- loaded and activated DCs.
  • the antigen-loaded and activated DCs are autologous.
  • the DC-based therapy comprises administration of DC- activating factors.
  • the DC-activating factor can be, but is not limited to, adjuvants poly (I:C), or CpG.
  • the DC-based therapy comprises administration of DC- mobilizing agents.
  • the DC-mobilizing agent can be, but is not limited to, growth factor GM-CSF, or FLT3L.
  • the DC-based therapy comprises administration of antigens and adjuvants.
  • the DC-based therapy comprises using DC-specific antibodies to deliver antigen/adjuvant or nanoparticles.
  • the immunotherapy is a T-cell-mediated therapy.
  • Non-limiting examples of useful T-cell-mediated therapies include, e.g., chimeric antigen receptor (CAR) T cell therapies, adoptive T cell transfer (ACT) therapies (e.g., wherein the transferred T cells are antigen-specific CD8 + T cells), T cell receptor (TCR) T cell therapies, tumor-infiltrating lymphocyte (TIL) therapies, neoantigen cancer vaccines, and any combinations thereof.
  • the immunotherapy is a tumor-infiltrating lymphocyte (TIL) therapy.
  • the immunotherapy is an immune checkpoint blockade therapy.
  • Non-limiting examples of useful immune checkpoint blockade therapies include, e.g., anti- programmed death 1 (anti-PD-1) therapies, anti-programmed death ligand 1 (anti-PD-L1) therapies, anti-lymphocyte activation gene-3 (anti-LAG-3) therapies, anti-cytotoxic T-lymphocyte antigen-4 (anti-CTLA-4) therapies, anti-T-cell immunoglobulin and mucin domain 3 (anti-TIM- 3) therapies, and any combinations thereof.
  • the immune checkpoint blockade therapy can be an anti-CTLA- 4 antibody, a functional fragment thereof or a functional equivalent thereof, or any combinations thereof.
  • CTLA-4 (CD152) is a protein receptor that, functioning as an immune checkpoint, 39 168222090v1 Attorney Docket No.243734.000197 downregulates immune responses.
  • the anti-CTLA-4 antibody inhibits CTLA-4 activity or function, thereby enhancing immune responses.
  • the anti-CTLA-4 antibody can be, but is not limited to, ipilimumab (Bristol-Myers Squibb), tremelimumab (Pfizer; AstraZeneca) or BN-13 (BioXCell).
  • the anti- CTLA-4 antibody can be UC10-4F10-11, 9D9 or 9H10 (BioXCell), or a human or humanized counterpart thereof.
  • the immune checkpoint blockade therapy can be a small molecule drug that is an immune response checkpoint inhibitor.
  • the terms “immune response checkpoint inhibitor” or “immune checkpoint inhibitor” refer to any molecule that modulates (e.g., inhibits or activates) the activity or function of one or more checkpoint molecules (e.g., proteins).
  • Checkpoint molecules are responsible for costimulatory or inhibitory interactions of T cell responses.
  • Checkpoint molecules regulate and maintain self-tolerance and the duration and amplitude of physiological immune responses.
  • Stimulatory checkpoint molecules serve a role in enhancing the immune response.
  • stimulatory checkpoint molecules are known, such as for example and without limitation: CD27, CD28, CD40, CD122, CD137, CD137/4-1BB, ICOS, IL-10, OX40, TGF beta, TOR receptor, and glucocorticoid-induced TNFR-related protein GITR.
  • the small molecule drug is an agonist or superagonist of one or more stimulatory checkpoint molecules.
  • the skilled person will be well aware of small molecule drugs that may be used to modulate stimulatory checkpoint molecules.
  • Inhibitory checkpoint molecules serve a role in reducing or blocking the immune response (e.g., a negative feedback loop).
  • inhibitory checkpoint proteins are known, such as for example CTLA-4 and its ligands CD80 and CD86; and PD-1 and its ligands PD-L1 and PD-L2.
  • Other inhibitory checkpoint molecules include, without limitation, adenosine A2A receptor (A2AR); B7-H3 (CD276); B7-H4 (VTCN1); BTLA (CD272); killer-cell immunoglobulin-like receptor (KIR); lymphocyte activation gene-3 (LAG3); V-domain Ig suppressor of T cell activation (VISTA); and T cell immunoglobulin domain and mucin domain 3 (TIM-3); as well as their ligands and/or receptors.
  • A2AR adenosine A2A receptor
  • B7-H3 CD276
  • B7-H4 VTCN1
  • BTLA CD272
  • KIR killer-cell immunoglobulin-like receptor
  • LAG3 killer-cell immunoglobulin-like receptor
  • the small molecule drug is an antagonist (i.e., an inhibitor) of one or more inhibitory checkpoint molecules.
  • an antagonist i.e., an inhibitor
  • the skilled 40 168222090v1 Attorney Docket No.243734.000197 person will be well aware of small molecule drugs that may be used to modulate inhibitory checkpoint molecules.
  • an immune response checkpoint inhibitor is an inhibitor of PD- L1, PD-1, CTLA-4 (CD154), PD-L2 (B7-DC, CD273), LAG3 (CD223), TIM3 (HAVCR2, CD366), 41BB (CD137), 2B4, A2aR, B7H1, B7H3, B7H4, B- and T-lymphocyte attenuator (BTLA), CD2, CD27, CD28, CD30, CD33, CD40, CD70, CD80, CD86, CD160, CD226, CD276, DR3, GAL9, GITR, HVEM, ICOS (inducible T cell co-stimulator), Killer inhibitory receptor (KIR), LAG-3, LAIR1, LIGHT, MARCO (macrophage receptor with collageneous structure), phosphatidylserine (PS), OX-40, Siglec 5, Siglec-7, Siglec-9, Siglec-11, SLAM, TIGIT,
  • an immune response checkpoint inhibitor is an inhibitor of PD- L1, PD-1, CTLA-4, LAG3, TIM3, 41BB, ICOS, KIR, CD27, OX-40, GITR, or PS, or any combinations thereof.
  • Anti-PD1/Anti-PD-L1 the immune checkpoint blockade therapy can be an anti-PD-1 or PD-L1 antibody, a functional fragment thereof or a functional equivalent thereof, or any combinations thereof.
  • PD-1/PD-L1 modulates T cell response. The normal function of PD-1, expressed on the cell surface of activated T cells under healthy conditions, is to down-modulate unwanted or excessive immune responses, including autoimmune reactions.
  • the PD-1 pathway represents a major immune control switch that may be engaged by tumor cells to overcome active T cell immune surveillance, and it is regularly hijacked by tumors to suppress immune control.
  • Tregs that express PD-1 have been shown to have an immune inhibitor response and PD-1/PD-L1 expression is thus thought to play a role in self-tolerance.
  • tumor cells overexpress PD-1 and PD-L1 in order to evade recognition by the immune system.
  • Anti-cancer therapy that blocks the PD-L1/PD-1 increases effector T cell activity and decreases suppressive Treg activity which allows recognition and destruction of the tumor by an individual’s immune system.
  • the methods described herein involve the use of an anti-PD-1 antibody, a functional fragment thereof or a functional equivalent thereof, or any combinations thereof.
  • PD-1 (CD279) is a cell surface receptor that, functioning as an immune checkpoint, 41 168222090v1 Attorney Docket No.243734.000197 downregulates immune responses and promotes self-tolerance.
  • the PD1 antibody can be, but is not limited to, nivolumab (Opdivo TM ; Bristol-Myers Squibb), pembrolizumab (Keytruda TM ; Merck), pidilizumab (Cure Tech), AMP-224 (MedImmune & GSK), or RMP1-4 or J43 (BioXCell) or a human or humanized counterpart thereof.
  • the PD-1 antibody can be pembrolizumab.
  • the methods described herein involve the use of an anti-PD-L1 antibody, a functional fragment thereof or a functional equivalent thereof, or any combinations thereof.
  • the PD-L1 is a ligand of the PD-1 receptor, and binding to its receptor transmits an inhibitory signal that reduces proliferation of CD8+ T cells and can also induce apoptosis.
  • the PDL1 antibody can be, but is not limited to, BMS-936559 (Bristol Myers Squibb), atezolizumab (MPDL3280A; Roche), avelumab (Merck & Pfizer), durvalumab (MEDI4736; MedImmune/AstraZeneca), tislelizumab (BeiGene), or cemiplimab (Regeneron).
  • the antibody, functional fragment or functional equivalent thereof may be an anti-PD-1 or anti-PD-L1 antibody, such as for example those disclosed in WO 2015/103602, which is incorporate herein by reference in its entirety for all intended purposes.
  • the methods of the present disclosure can also be used for: a) glutamine supplementation combined with immune checkpoint blockade therapy (e.g., anti-PD-1/PD-L1 treatment) to enhance the efficacy of immunotherapies; b) DC vaccines for cancer treatments by targeting lysosomal signaling; c) combination of lysosomal targeting-based DC vaccination with immune checkpoint blockade therapy; d) targeting of SLC38A2 for tumor therapy; e) glutamine supplementation combined with immunotherapy; f) glutamine supplementation combined with inhibiting SLC38A2-mediated glutamine uptake in cancer cells; g) glutamine supplementation combined with inhibiting lysosomal signaling pathway in DCs; h) glutamine supplementation combined with DCs pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors; i) immunotherapy combined with inhibiting lysosomal signaling pathway in DCs;
  • immune checkpoint blockade therapy e
  • the methods of the present disclosure can be used for treating cancer and related diseases.
  • the cancer is characterized by tumors with glutamine deprivation.
  • the cancer is selected from colon cancer, melanoma, breast cancer, pancreatic cancer, and lung cancer.
  • EXAMPLES [00120] The present invention is also described and demonstrated by way of the following examples. However, the use of these and other examples anywhere in the specification is illustrative only and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to any particular preferred embodiments described here.
  • Flcn fl/fl mice were kindly provided by Laura Schmidt 44 .
  • Tfeb fl/fl mice were kindly provided by Andrea Ballabio 55 .
  • the mice were backcrossed to the C57BL/6 background; sex- and age-matched mice were used throughout the study at 7–12 weeks old, and both male and female mice were used.
  • the genetically modified mice were viable and developed normally.
  • bone marrow cells from WT or Flcn ⁇ DC mice were mixed with cells from Batf3 ⁇ / ⁇ mice at a 1:1 ratio and transferred into lethally irradiated (11 Gy) CD45.1 + mice, followed by reconstitution for 6–8 weeks 35 .
  • bone marrow cells from wild-type or Flcn ⁇ DC mice were transferred into lethally irradiated (11 Gy) CD45.1 + mice. All mice were maintained in specific pathogen-free conditions in the Animal Resource Center at St. Jude Children’s Research Hospital. Experiments and procedures were approved by and performed in accordance with the Institutional Animal Care and Use Committee of St. Jude Children’s Research Hospital.
  • Enriched cells were stained and sorted for cDC1 (CD11c + CD8 ⁇ + CD24 + TCR ⁇ ⁇ CD49b ⁇ B220 ⁇ ) and cDC2 (CD11c + CD8 ⁇ ⁇ CD24 ⁇ TCR ⁇ ⁇ CD49b ⁇ B220 ⁇ ) on a MoFlow (Beckman-Coulter) or Reflection (i-Cyt) cell sorter. Lymphocytes from spleen and peripheral lymph nodes were sorted for na ⁇ ve OT-II T cells (CD4 + CD62L high CD44 low CD25 ⁇ ) and na ⁇ ve OT-I T cells (CD8 + CD62L high CD44 low CD25 ⁇ ).
  • Sorted DCs were cultured with specific medium as indicated under Brief Description of the Drawings.
  • Medium with or without individual amino acids was generated with RPMI 1640 powder (R8999-04A, US Biological) by supplementation of individual amino acids.
  • the medium was supplemented with 10% (v/v) dialyzed fetal bovine serum (FBS; A3382001, Thermo Fisher Scientific).
  • MC38 or B16F10 cells were cultured in glutamine-free RPMI 1640 medium (15-040- CV, Corning) supplemented with 10% (v/v) dialyzed FBS plus 1% (v/v) penicillin-streptomycin (15140122, Thermo Fisher Scientific), and different concentrations of glutamine (25030081, Thermo Fisher Scientific) as indicated in the figure legends.
  • Tumor cell culture supernatant was collected 48 h later.
  • In vitro bone marrow-derived DC (BMDC) culture [00123] Bone marrow cells were flushed from mouse tibias and femurs, and red blood cells were lysed using ACK lysis buffer.
  • FLT3L-BMDCs were cultured as previously described 35 .
  • bone marrow cells were cultured in RPMI 1640 complete medium with 200 ng/ml FLT3L-Ig (BE0098, Bio X Cell) for 7–9 days.
  • FLT3L-BMDCs were sorted as cDC1 (B220 ⁇ CD11c + CD24 + CD172 ⁇ ⁇ ) and cDC2 (B220 ⁇ CD11c + CD24 ⁇ CD172 ⁇ + ) for further experiments.
  • iCD103 + BMDCs were generated as previously described 67 .
  • bone marrow cells were plated in RPMI 1640 complete medium supplemented with 200 ng/ml FLT3L-Ig and 2 ng/ml mGM-CSF (315-03, Peprotech). Half of the fresh medium was supplemented to the cultures at day 5, and non-adherent cells were collected and replated in fresh medium at day 9.
  • Loosely adherent cells were harvested at days 15–17 for transwell assays. 44 168222090v1 Attorney Docket No.243734.000197 Flow cytometry [00124] For analysis of surface markers, cells were first incubated with Fc block (2.4G2, Bio X Cell) for 10 min in phosphate-buffered saline (PBS) containing 2% (w/v) FBS, and then stained with the appropriate antibodies on ice for appropriate 30 min.
  • Fc block 2.4G2, Bio X Cell
  • cytokine detection For intracellular cytokine detection, cells were stimulated for 4 h with phorbol 12-myristate 13-acetate (PMA) plus ionomycin or OVA257-264 in the presence of monensin before staining with a fixation/permeabilization kit (554774, BD Biosciences) according to the manufacturer’s instructions. Transcription factor staining was performed with FOXP3/transcription factor staining buffer set (00-5523-00, eBioscience) according to the manufacturer’s instructions. Lysotracker staining was performed with LysoTracker TM Red DND-99 dye (L7528, Invitrogen) according to the manufacturer’s instructions.
  • Flow cytometry data were acquired on LSRII or LSR Fortessa (BD Biosciences) and analyzed using FlowJo software (Tree Star). 7-Aminoactinomycin D (7AAD; A9400, 1:200, Sigma) or fixable viability dye (65-0865-14, 1:1,000, eBioscience) was used for dead-cell exclusion.
  • 7AAD 7-Aminoactinomycin D
  • fixable viability dye 65-0865-14, 1:1,000, eBioscience
  • PE-Cy7–anti- CD11c N418, 60-0114, 1:200, Tonbo Biosciences
  • FITC–anti-FOXP3 FJK-16s, 11-5773-82, 1:200
  • PE-Cyanine7–anti-T-bet 4B10, 25-5825-82, 1:100
  • PerCP-eFluor 710–anti-CD39 24DMS1, 46-0391-82, 1:400
  • APC-eFluor 780–anti-MHC-II M5/114.15.2, 47-5321-82, 1:400
  • PE-Cyanine7–anti-CD24 M1/69, 25-0242-82, 1:400
  • FITC–anti-CD86 GL1, 11-0862-82, 1:200
  • FITC–anti-CD86 GL1, 11-0862-82, 1:200
  • Antigen presentation assays 45 168222090v1 Attorney Docket No.243734.000197 [00125]
  • cDC1 and cCD2 were sorted from spleen, pulsed with 200 ⁇ g/ml OVA protein (Low Endo, LS003059, Worthington), 250 pg/ml OVA 257–264 peptide (vac-sin, InvivoGen) or 3 ⁇ g/ml OVA323–339 peptide (vac-isq, InvivoGen) for 2 h, then washed twice and cultured with na ⁇ ve CD44 low CD62L high OT-I or OT-II T cells for three days.
  • HKLM-OVA Listeria monocytogenes-OVA
  • sorted cells were cocultured with 1 ⁇ 10 7 HKLM-OVA and OT-I T cells for 3 days as previously described 41 .
  • 3 H- thymidine PerkinElmer
  • cDC1 or cDC2 were incubated with OVA protein in RPMI 1640 medium lacking an individual amino acid or amino acid-free medium supplemented with an individual amino acid for 2 h, irradiated and then cocultured with T cells.
  • cDC1 or cDC2 were incubated with OVA in the presence of MC38 or B16F10 culture supernatant or tumor cell culture supernatant supplemented with an individual amino acid for 2 h, followed by irradiation and coculture with OT-I or OT-II T cells.
  • OVA tumor cell culture supernatants
  • cDC1 or cDC2 were incubated with OVA in the presence of MC38 or B16F10 culture supernatant or tumor cell culture supernatant supplemented with an individual amino acid for 2 h, followed by irradiation and coculture with OT-I or OT-II T cells.
  • 1 ⁇ 10 6 CFSE-labeled na ⁇ ve CD45.1 + OT-I T cells were transferred into mice intravenously, followed by intravenous injection with 20 ⁇ g OVA 24 h later.
  • ELISA Culture supernatants from in vitro antigen presentation assays were collected, and the levels of IL-2 and IFN ⁇ were determined using IL-2 (88-7024-22, Thermo Fisher Scientific) and IFN ⁇ (88-7314-22, Thermo Fisher Scientific) ELISA kits according to manufacturer’s instructions.
  • DQ-Ovalbumin degradation assay [00127] Splenic cDC1 were sorted from wild-type and Flcn ⁇ DC mice as described above.
  • DQ-OVA DQ-Ovalbumin
  • D-12053 DQ-12053, Thermo Fisher Scientific
  • FITC + FITC +
  • Anti-PD-1 antibody J43, Bio X Cell
  • rat IgG2b isotype control LDF-2, Bio X Cell
  • Anti-PD-L1 antibody 10F.9G2, Bio X Cell
  • rat IgG2b isotype control LPF-2, Bio X Cell
  • mice with complete tumor rejections from intratumoral glutamine injection and anti-PD-1 combination therapy were rechallenged with 1 ⁇ 10 6 MC38 cells after 60 days.
  • 1 ⁇ 10 6 MC38-OVA cells were injected subcutaneously into mice.
  • Tumor antigen-specific CD8 + T cells were analyzed by H-2K b -OVA tetrameter staining for 30 min at room temperature. Tumors were measured regularly with digital calipers and tumor volumes were calculated using the formula: length ⁇ width ⁇ width ⁇ ⁇ /6.
  • tumors were harvested at day 15 after inoculation, excised, minced and digested with 1 mg/ml collagenase IV (Worthington) and 200 U/ml DNase I (Sigma) for 1 h at 37°C.
  • Generation of CRISPR/Cas9 knockout tumor cell lines [00129] MC38 or B16-OVA cells were transduced with lentivirus of pLenti-Cas9-GFP (86145, Addgene). Cas9-expressing (GFP + ) cells were sorted, and expression of Cas9 protein was confirmed by immunoblot analysis (see method details below; data not shown).
  • Cas9-expressing MC38 or B16-OVA cells were then transduced with lentivirus expressing Ametrine and control sgRNA (sgNTC: ATGACACTTACGGTACTCGT) (SEQ ID NO: 1) or sgRNA targeting Slc38a2 (sgSlc38a2: ATTAAATACTGACATTCCAA) (SEQ ID NO: 2) as previously described 68 .
  • sgNTC ATGACACTTACGGTACTCGT
  • SEQ ID NO: 2 sgRNA targeting Slc38a2
  • SEQ ID NO: 2 ATTAAATACTGACATTCCAA
  • sgNTC- or sgSlc38a2- transduced, Cas9-expressing MC38 or B16-OVA cells were injected subcutaneously into mice.
  • DC transfer and adoptive T cell transfer for tumor therapy 47 168222090v1 Attorney Docket No.243734.000197 [00130]
  • freshly isolated splenic cDC1 were used following an established strategy 34 .
  • B16-FLT3L cells 2.5 ⁇ 10 6
  • cDC1 were harvested 10 days after tumor inoculation, and cDC1 were enriched using CD8 + dendritic cell isolation kit (130-091-169, Miltenyi Biotec). Purified cDC1 were pulsed with 100 ⁇ g/ml OVA protein (low Endo, Worthington) together with 20 ⁇ g/ml poly I:C (InvivoGen) for 2 h in RPMI 1640 medium containing 10% dialyzed FBS with or without glutamine. cDC1 were washed and transferred (1 ⁇ 10 6 cells per mouse) subcutaneously adjacent to the tumors at day 5 after B16-OVA inoculation.
  • na ⁇ ve OT-I T cells were isolated using a na ⁇ ve CD8 ⁇ + T cell isolation kit (130-096-543; Miltenyi Biotec) according to the manufacturer’s instructions. Purified na ⁇ ve OT-I T cells were activated using 10 ⁇ g/ml anti-CD3 (2C11; Bio X Cell, BE0001-1) and 5 ⁇ g/ml anti-CD28 (37.51; Bio X Cell, BE0015-1) antibodies.
  • OT- I T cells were then expanded in Click’s medium (Irvine Scientific) containing 10% dialyzed FBS supplemented with or without glutamine in the presence of human recombinant IL-2 (20 IU/ml; PeproTech), mouse IL-7 (12.5 ng/ml; PeproTech) and IL-15 (25 ng/ml; PeproTech) for 2–3 days before adoptive transfer.
  • human recombinant IL-2 (20 IU/ml; PeproTech
  • mouse IL-7 (12.5 ng/ml; PeproTech
  • IL-15 25 ng/ml; PeproTech
  • HEK293T cells were starved with glutamine-free medium for 3 h, followed by the addition of 2 mM glutamine for 10 or 15 min.
  • the cells were then lysed in CHAPS buffer (0.3% CHAPS, 10 mM ⁇ -glycerol phosphate, 10 mM pyrophosphate, 40 mM HEPES pH 7.4, 2.5 mM MgCl 2 ) supplemented with protease inhibitor cocktail (04693124001, Roche) for 30 min.
  • the cell lysates were cleared by centrifugation and mixed with anti-HA magnetic beads (88837, Thermo Fisher Scientific) at 4°C for 4 h.
  • GATOR1 or GATOR2 complex For immunoprecipitation of GATOR1 or GATOR2 complex, the cleared cell lysates were incubated with anti-DEPCD5 (for GATOR1) and anti-WDR24 (for GATOR2) antibodies and control IgG (3000-0-AP, ProteinTech) at 4°C overnight, followed by a further incubation with protein A/G agarose beads (sc-2003, Santa Cruz) for 2 h. Immunoprecipitated complexes were washed three times with CHAPS buffer and subjected to immunoblot analyses.
  • Cytosolic and nuclear cell fractionation Freshly isolated splenic cDC1 from B16-FLT3L tumor-bearing mice were incubated in glutamine-sufficient medium or starved with glutamine-free medium for 3 h. The cells were washed twice with ice-cold PBS and harvested into cytosol extraction buffer (150 mM NaCl; 50 mM HEPES, pH 7.4; and 0.025% (w/v) digitonin) supplemented with protease and phosphatase inhibitor cocktail (Roche).
  • cytosol extraction buffer 150 mM NaCl; 50 mM HEPES, pH 7.4; and 0.025% (w/v) digitonin
  • Plasma and tumor interstitial fluid (TIF) were collected as previously described 7 .
  • Tumor cell culture supernatants were collected from medium cultured with MC38 cells in RPMI 1640 medium supplemented with 0.6 mM glutamine.1 ⁇ 10 6 sorted splenic cDC1 or cDC2 from wild- type or Slc38a2 ⁇ DC mice were collected. sgNTC- or sgSlc38a2-transduced, Cas9-expressing MC38 cells were cultured in DMEM supplemented with 10% (v/v) FBS and 1% (v/v) penicillin– streptomycin.
  • the cells were harvested and washed once with ice-cold PBS, and the metabolites were extracted using 750 ⁇ l of methanol/acetonitrile/water (5:3:2, v/v/v) and the supernatant was dried by lyophilization.
  • Aliquots of 20 ⁇ 50 ⁇ l from plasma and TIF were extracted with at least 15-fold excess volume of the methanol/acetonitrile/water solution, and the supernatant was then collected and dried by lyophilization.
  • Dried extracts containing the hydrophilic metabolites were dissolved in 40 ⁇ l of water/acetonitrile (8:2, v/v) and 10 ⁇ l were used in the procedure to derivatize amino acids as described previously 69 with some modifications.
  • the samples were placed into glass autosampler vials and then 35 ⁇ l of sodium borate buffer (100 mM, pH 9.0) was added and mixed by pipetting. Next, 10 ⁇ l of the 6-aminoquinolyl-N- hydroxysuccinimidyl carbamate (AQC, 10 mM in acetonitrile)-derivatizing reagent (Cayman Chemical) was added. The vial was sealed, mixed by vortexing, and then incubated at 55 o C for 15 min. The vial was cooled to room temperature and then 1 ⁇ l was analyzed by liquid chromatography with tandem mass spectrometry (LC-MS/MS).
  • AQC 6-aminoquinolyl-N- hydroxysuccinimidyl carbamate
  • the flow rate was 300 ⁇ l/min and the injection volume used was 1 ⁇ l. All LC/MS solvents and reagents were the highest purity available (water, acetonitrile, acetic acid, boric acid, sodium hydroxide) and were purchased from Thermo Fisher Scientific.
  • a Xevo TQ-XS Triple Quadrupole Mass Spectrometry (TQ-XS) (Waters Corp) equipped with a multi- mode ESI/APCI/ESCi ion source was employed as detector.
  • the TQ-XS was operated in the positive ion mode using the multiple reaction monitoring mass spec method (MRM).
  • MRM multiple reaction monitoring mass spec method
  • the operating 50 168222090v1 Attorney Docket No.243734.000197 conditions of the source were: Capillary Voltage 3.8 kV, Cone Voltage 40 V, Desolvation Temp 550 o C, Desolvation Gas Flow 1,000 L/h, Cone Gas Flow 150 L/h, Nebuliser 7.0 Bar, Source Temp 150 o C.
  • Authentic amino acids standards were purchased from Sigma-Aldrich (St. Louis, MO, USA) and employed to establish the MRM conditions and calibration curves.
  • the acquired MRM data was processed using the software application Skyline 21.2 (MacCoss Lab Software).
  • Sorted splenic cDC1 and cDC2 or sgNTC- and sgSlc38a2-transduced Cas9-expresing MC38 cells were washed once with PBS and were then plated into 6-well plates at 1 ⁇ 10 6 cells per well in RPMI 1640 medium containing 10% dialyzed FBS and 2 mM [ 13 C5]-glutamine for 10 min.
  • the cells were subsequently washed once with ice-cold PBS, and the polar metabolites were extracted using 1 ml of methanol/acetonitrile/water (5:3:2, v/v/v) and the supernatant was dried by lyophilization.
  • the dried extracts containing the hydrophilic metabolites were dissolved in 30 ⁇ l of water/acetonitrile (8:2, v/v) and 10 ⁇ l were used for the glutamine-derivatization procedure as described previously 69 with minor modifications. Briefly, the samples were placed into glass autosampler vials and then 35 ⁇ l of sodium borate buffer (100 mM, pH 9.0) was added, followed by mixing with pipetting.
  • a Vanquish Horizon UHPLC (Thermo Fisher Scientific) was used for the LC separations, using a non-linear gradient conditions as follows: 0 ⁇ 1 min 3% B; 1 ⁇ 22 min 3 to 96% B (using Curve #8, Thermo Scientific SII for Xcalibur); 22 ⁇ 25 min 96% B; 25 ⁇ 26 min 96 to 3% B; 26 ⁇ 30 min 3% B.
  • Mobile phase A was water supplemented with 0.15% acetic acid, and mobile phase B was acetonitrile with 0.15% acetic acid.
  • the column used was an Accucore C30 (250 ⁇ 2.1 mm, 2.6 ⁇ m) (Thermo Fisher Scientific), operated at 50°C.
  • the flow rate was 300 ⁇ l/min and the injection volume used was 15 ⁇ l. All LC/MS solvents and reagents were the highest purity available (water, acetonitrile, acetic acid, boric acid, sodium hydroxide) purchased from Thermo Fisher Scientific. A Q Exactive hybrid quadrupole-Orbitrap mass spectrometer (QE-MS) (Thermo Fisher Scientific) equipped with a HESI-II probe was employed as detector. The QE-MS was operated in the positive ion mode using targeted selected ions monitoring followed by a data-dependent MS/MS method (tSIM/dd-MS 2 ).
  • QE-MS Q Exactive hybrid quadrupole-Orbitrap mass spectrometer
  • the QE-MS was operated at a resolution of 140,000 (FWHM, at 200 m/z), AGC targeted of 1 ⁇ 10 6 , max injection time 100 msec.
  • AGC targeted of 1 ⁇ 10 5 , max injection time 50 msec, loop count 8, MS 2 isolation width 0.4 m/z and NCE 35.
  • the operating conditions of the source were: Sheath gas flow 45; aux gas flow 8; sweep gas 1; spray voltage 3.8 kV in positive ion mode; capillary temperature 325 o C; S-lenses RF level 55; aux gas heater at 325 o C.
  • RNA isolation and gene expression profiling [00136] RNA was isolated and purified from various cell types using the RNeasy Micro Kit (74004, Qiagen) following the manufacturer’s instructions.
  • cDNA synthesis was performed using the High Capacity cDNA Reverse Transcription Kit (4368813, Thermo Fisher Scientific) according to the manufacturer’s instructions.
  • Real-time PCR was performed on the QuantStudio 7 Flex System (Applied Biosystems) using the PowerSYBR Green PCR Master Mix (4367659, Thermo Fisher Scientific).
  • the sequences for mouse Flcn primers were previously described 44 .
  • Slc1a5-F CATCAACGACTCTGTTGTAGACC (SEQ ID NO: 3), Slc1a5-R: CGCTGGATACAGGATTGCGG (SEQ ID NO: 4); Slc6a14-F: GACAGCTTCATCCGAGAACTTC (SEQ ID NO: 5), Slc6a14-R: ATTGCCCAATCCCACTGCAT (SEQ ID NO: ; Slc6a19-F: CAGGTGCTCAGGTCTTCTACT (SEQ ID NO: 7), Slc6a19-R: CGATCACAGAATCCATCTCACAA (SEQ ID NO: 8); Slc38a1-F: AGCAACGACTCTAATGACTTCAC (SEQ ID NO: 9), Slc38a1-R: CCTCCTACTCTCCCGATCTGA (SEQ ID NO: 10); Slc38a2-F: TAATCTGAGCAATGCGATTGTGG
  • the gene expression probe signals were quantile normalized and summarized by the RMA algorithm by Affymetrix Expression Console (v1.4.1), then the differential gene expression analysis was performed by R package limma (v3.46.0). False discovery rate (FDR) was estimated by Benjamini–Hochberg method. Heatmaps were generated using ComplexHeatmap (v2.6.2) to show the average expression of genes from biological replicates of the same genotype.
  • the optimal cycle of further amplification was determined by Real-time PCR (KAPA SYBRFast system; Kapa Biosystems).
  • the final PCR products were purified using AMPure XP beads (Beckman Coulter).
  • the fragment distribution of each library was checked by a TapeStation System (Agilent Technologies) and then sequenced on an Illumina NovaSeq with ⁇ 300 million reads per sample. Data analysis [00138] ATAC-seq analysis was performed as described previously 68 .
  • the paired-end fastq files obtained from NovaSeq were trimmed for Nextera adaptor by trimmomatic (v0.36, 53 168222090v1 Attorney Docket No.243734.000197 paired-end mode, with parameter LEADING:10 TRAILING:10 SLIDINGWINDOW:4:18 MINLEN:25).
  • BWA v0.7.16
  • Resulting BAM files were filtered to remove duplicated reads (marked by Picard (v2.9.4)) and to remove mitochondrial reads.
  • DCs CD45 + CD64 ⁇ CD11c + MHC-II +
  • CD45 + non-macrophage immune cells CD45 + CD64 ⁇
  • macrophages CD45 + CD64 +
  • CD45 + cells and DCs (CD45 + CD64 ⁇ CD11c + MHC-II + ) in the tumor tissues were sorted at 15 d after tumor challenge and mixed at a 2:1 ratio.
  • the cell mixture was centrifuged at 2,000 rpm for 5 min and then resuspended in 1 ⁇ PBS (Thermo Fisher Scientific) plus 0.04% BSA (Amresco) with a final concentration of 1 ⁇ 10 6 cells/ml.
  • the single-cell suspensions were loaded onto a Chromium Controller and encapsulated into droplets.
  • Chromium Next GEM Single Cell 5' (v2) or Next GEM Single Cell 3' (v3.1) and Gel Bead Kit (10x Genomics) were used for the library preparation following 54 168222090v1 Attorney Docket No.243734.000197 manufacture’s instruction.
  • the final libraries were quality-checked by 2100 Bioanalyzer (Agilent Technologies) and quantified by Qubit Fluorometer (Invitrogen).
  • the resulting libraries were sequenced on NovaSeq (Illumina) with paired-end reads of 26 (for Chromium Next GEM Single Cell 5' kit) or 28 (for Chromium Next GEM Single Cell 3' kit) cycles (for read 1, 90 cycles for read 2 and 10 cycles for index 1 and 2 separately).
  • the top 15 principal components were used to build a Shared Nearest Neighbor (SNN) Graph, and cells were clustered using the Louvain algorithm as implemented in a FindClusters function from the Seurat package with resolution as 0.5.
  • the cluster-specific differentially expressed genes were calculated by FindAllMarkers function from Seurat.
  • the CD8 + T cell subset analysis the CD8 + T cells were subsetted by gating on the high expression of the CD3 subunit genes (Cd3e or Cd3d) and Cd8b gene and unsupervised clustering was performed using the same graph-based clustering method.
  • the CD8 + T cell subsets were further characterized by the high expression of Tcf7 (encodes TCF1) or Havcr2 (encodes TIM-3).
  • TCF1 encodes TCF1
  • Havcr2 encodes TIM-3
  • cDC cells with high expression of Ptprc and Flt3 were subsetted first.
  • a second-round of dimensionality reduction and unsupervised clustering were then performed.
  • cDC1 cell cluster 55 168222090v1 Attorney Docket No.243734.000197 was characterized by expression of Clec9a and Xcr1.
  • Differential expression (DE) analysis of genes was performed by FindMarkers function from Seurat package. The activity score of gene signatures was calculated by the average normalized expression of all target genes in the gene set.
  • GSEA pre-ranked gene set enrichment analysis
  • the set of ‘putative TFEB target genes’ signature was derived from a public dataset, which identified TFEB targets by integrating TFEB ChIP-seq analysis and TFEB overexpression 52 .
  • Public scRNA-seq dataset analysis [00143] To examine the expression of glutamine transporters in tumor cells, DCs and CD8 + T cells from tumor microenvironment, a human melanoma dataset 39 (GSE72056) and a mouse tumor scRNA-seq dataset 40 (GSE121861, profiling B16F10 melanoma, EMT6 breast mammary carcinoma, LL2 Lewis lung carcinoma, CT26 and MC38 colon carcinoma and Sa1N fibrosarcoma) were analyzed with Seurat (v4.0.2).
  • Tumor cells and CD45 + immune cells from different mouse tumor models were pooled for analysis in GSE121861. Expression of glutamine transporters in the three cell types was visualized by DotPlot function.
  • Statistical analysis for biological experiments [00144] For biological experiment (non-omics) analyses, data were analyzed using Prism 8 software (GraphPad) by two-tailed paired Student’s t-test, two-tailed unpaired Student’s t-test, or one-way ANOVA with Newman–Keuls’s test. Two-way ANOVA was performed for comparing tumor growth curves. The log-rank (Mantel–Cox) test was used for comparing mouse survival 56 168222090v1 Attorney Docket No.243734.000197 curves.
  • TME tumor interstitial fluid
  • B16-OVA OVA-expressing B16F10
  • mice treated with glutamine plus anti-PD-1 combination therapy develop memory responses against tumors.
  • an established assay 28 was adopted; specifically, mice were challenged with MC38 cells and treated with a combination of glutamine and anti-PD-1, and after 60 days, tumor-free mice were rechallenged with MC38 cells (and na ⁇ ve mice were challenged in parallel).
  • scRNA- seq was performed to profile intratumoral CD45 + immune cells and CD45 – non-immune (predominantly tumor) cells from PBS or glutamine-treated MC38 tumors (see methods for details). Unsupervised cluster analysis identified several major immune cell populations, including CD8 + T cells, Foxp3 – CD4 + T cells, Treg cells, cDCs, and plasmacytoid dendritic cells (pDCs) (Fig.5G).
  • CD8 + T cells were accumulated in the TME and their important role in anti- tumor immunity
  • the functional state of intratumoral CD8 + T cells was further examined by calculating the activity of previously established gene signatures related to CD8 + T-cell early activation, memory precursor, memory, and effector/cytokine signaling 29 .
  • Intratumoral CD8 + T cells from glutamine-treated mice showed a significantly increased activity score of these gene signatures (Fig.1I), indicating possibly enhanced functionality.
  • T-cell activation and effector molecules including Gzmb (encodes the cytotoxic molecule granzyme B), Prf1, Cd44, Tbx21 and Tnf were upregulated in intratumoral CD8 + T cells based on scRNA-seq analysis (Figs. 5H, 5I).
  • Flow cytometry analysis validated that glutamine supplementation 58 168222090v1 Attorney Docket No.243734.000197 increased the percentage and number of intratumoral CD8 + T cells that expressed IFN ⁇ , TNF ⁇ or granzyme B (Fig.1J), indicative of enhanced effector function.
  • GSEA gene set enrichment analysis
  • cDCs from glutamine-treated mice showed significantly increased activity score of antigen processing and presentation pathway compared to PBS-treated mice (Fig. 1L).
  • An increased activity of previously established MHC-I antigen presentation signature 29 was also observed in intratumoral cDCs from glutamine-treated mice compared to PBS-treated controls (Fig.5L).
  • cDCs are composed of cDC1 and cDC2 subsets with distinct phenotypic markers and functional roles 4, 5 , so flow cytometry analysis was performed next to profile the maturational status of cDC1 and cDC2.
  • cDC1 or cDC2 were pulsed with OVA protein in medium lacking each of the 20 common amino acids for 2 h, the cells were washed, and then cocultured cDC1 and cDC2 with OT-I or OT-II (OVA-specific CD4 + ) T cells in amino acid-sufficient medium for 3 days to induce T-cell priming (using T-cell proliferation and IL-2 and IFN ⁇ production by OT-I or IL-2 production by OT-II T cells as DC functional readouts 35 ) (Fig.6A).
  • cDC1 glutamine deprivation also lowered the priming capabilities of cDC2, although to a much lesser extent compared to its effect on cDC1 (i.e., a 40-fold versus a 2.8-fold reduction for priming OT-I T cells and a 15.7-fold versus 5-fold reduction for priming OT-II T cells) (Figs. 6D, 6E; compare with Figs. 2A, 2B).
  • BMDCs bone marrow-derived dendritic cells
  • cDC1 or cDC2 were incubated with OVA protein in amino acid-free medium supplemented with an individual amino acid, then cocultured cDC1 or cDC2 with OT-I and OT-II T cells (Fig.6G).
  • Glutamine supplementation alone in amino acid-free medium was found to enable cDC1 (and to a lesser extent cDC2)-dependent T-cell proliferation, whereas other amino acids had essentially no effects (Figs. 6H, 6I).
  • glutamine is both necessary and sufficient for supporting cDC function in mediating T-cell priming, with a preferential effect observed in cDC1 compared to cDC2.
  • cDC1 cultured with such MC38 cell-derived supernatant had an impaired capacity to prime OT-I or OT-II T-cell proliferation; remarkably, these effects were rectified when we used supernatant derived from MC38 cells cultured in the presence of 2 mM glutamine (Fig. 2C, Fig.6K).
  • Fig. 2C, Fig.6K supernatant derived from MC38 cells cultured in the presence of 2 mM glutamine
  • glutamine supplementation rectified the defective priming effect of cDC1 cultured with MC38 culture supernatant (Fig. 2D, Fig. 6L).
  • a transwell system was utilized wherein in vitro- derived immature DCs were added to the upper chamber in medium containing a physiological (0.6 mM) or supraphysiological (2 mM) concentration of glutamine, followed by coculture with MC38 cells applied to the lower chamber (such a system allowed for only soluble factors to influence DC maturation).
  • a physiological concentration (0.6 mM) of glutamine was used (Fig. 2E).
  • An impairment was observed for MHC-II expression, as well (Fig. 2E).
  • SLC solute carrier
  • the transcript for SLC38A2 (i.e., SLC38A2 in humans and Slc38a2 in mice) showed the highest expression level in both human and mouse tumor cells (Fig. 2F, Fig.7A). Also, tumor cells expressed higher transcript levels for SLC38A2 compared to DCs and CD8 + T cells (Fig.2F, Fig.7A). In line with this observation, real-time PCR analysis showed that Slc38a2 expression was approximately 10-fold higher in MC38 cells compared to cDC1 (Fig. 7B). Immunoblot analysis also revealed that tumor cells expressed much higher protein levels of SLC38A2 compared to intratumoral cDC1 and CD8 + T cells (Fig. 7C).
  • SLC38A2 represents a putative intercellular metabolic checkpoint for dictating glutamine uptake and downstream functions between tumor cells and cDC1.
  • SLC38A2-deficient B16-OVA tumor cells were also generated (Fig.7F) and found that they also showed slower growth than control tumors (Fig.7G).
  • Analysis of intratumoral lymphocytes revealed that sgSlc38a2-transduced MC38-Cas9 tumors contained elevated frequency and number of CD8 + T cells and a modestly increased frequency (but not number) of CD4 + Foxp3 – T cells (Fig. 2I, Fig. 7H).
  • intratumoral CD8 + T cells that expressed granzyme B, TNF ⁇ or IFN ⁇ in sgSlc38a2-transduced MC38-Cas9 tumors (Fig.2J), indicative of improved effector phenotypes.
  • SLC38A2 acts in a tumor-intrinsic manner or requires the immune system for its in vivo effects, by examining the growth of sgSlc38a2-transduced MC38-Cas9 tumors in Batf3 –/–33 or Rag1 –/–27 hosts that are deficient in cDC1 or lymphocytes, respectively.
  • the beneficial anti-tumor effect of SLC38A2 deficiency on MC38-Cas9 cell growth was blocked when inoculated into either Batf3 –/– or Rag1 –/– mice (Fig.2K, Fig.7I), revealing the importance of cDC1 and lymphocytes in such effects.
  • mice bearing DC-specific deletion of SLC38A2 (Slc38a2 ⁇ DC ) were also generated by crossing CD11c-Cre transgenic mice with mice bearing floxed Slc38a2 alleles.
  • the deletion efficiency of Slc38a2 was validated in cDC1 and cDC2 but not T or B cells (Fig.8A).
  • Glutamine uptake in DCs was then examined and was found that cDC1 showed higher glutamine uptake than cDC2, while SLC38A2 deficiency resulted in a substantial decrease in glutamine uptake by both cDC1 and cDC2 (Fig. 8B), revealing SLC38A2 as an important glutamine transporter in DCs.
  • Slc38a2 ⁇ DC mice Under steady state, Slc38a2 ⁇ DC mice exhibited normal homeostasis of DCs (Figs.8C, 8D) and T cells (Figs. 8E-8G).
  • SLC38A2-deficient cDC1 pulsed with OVA had impaired ability to promote in vitro proliferation of OT-I or OT-II T cells (Fig.2L), whereas SLC38A2-deficient cDC2 had no defects (Fig.8H).
  • IL-2 and IFN ⁇ production by OT- I and IL-2 production by OT-II T cells were decreased when cultured with OVA-pulsed SLC38A2- 63 168222090v1 Attorney Docket No.243734.000197 deficient cDC1 compared to WT cDC1 (Fig. 8I).
  • OVA-pulsed SLC38A2-deficient cDC2 showed no defects in inducing IL-2 production by OT-I or OT-II T cells (Fig. 8J).
  • the capacity of SLC38A2-deficient cDC1 to cross-present cell-associated antigens was also examined by incubating them with heat-killed OVA-expressing Listeria monocytogenes (HKLM-OVA) 41 .
  • SLC38A2-deficient cDC1 were defective in promoting OT-I T-cell proliferation in response to HKLM-OVA, while very little cross-presentation of HKLM-OVA by cDC2 was observed, as expected 41 (Fig. 2M).
  • Slc38a2 ⁇ DC mice showed decreased proportion and number of CD8 + T cells (but not conventional CD4 + Foxp3 – T cells or Foxp3 + Treg cells) in MC38 tumors (Fig. 9B), associated with decreased expression of granzyme B and IFN ⁇ from intratumoral CD8 + T cells (Fig. 9C).
  • glutamine supplementation in tumors had little effect on MC38 tumor growth in Slc38a2 ⁇ DC mice (Fig. 2P), indicating a functional link between glutamine and SLC38A2 expressed by DCs in anti-tumor immunity.
  • OVA-expressing MC38 cells (MC38-OVA) were inoculated into WT and Slc38a2 ⁇ DC mice, followed by OVA-tetramer staining.
  • Reduced frequency and cellularity of intratumoral OVA-tetramer + CD8 + T cells in MC38-OVA-bearing Slc38a2 ⁇ DC was observed compared to WT mice (Fig.2Q).
  • the production of IFN ⁇ and TNF ⁇ was decreased in intratumoral CD8 + T cells upon stimulation with OVA peptide (Fig.
  • mice with T cell- specific deletion of SLC38A2 were generated by breeding Slc38a2 floxed mice with CD4-Cre 64 168222090v1 Attorney Docket No.243734.000197 mice (Cd4 Cre Slc38a2 fl/fl mice) and it was found that deletion of Slc38a2 in T cells had no effect on tumor growth (Fig. 9E). Together, these results show that DCs but not T cells may require SLC38A2 to orchestrate anti-tumor immunity, and suggest that SLC38A2 represents a competitive checkpoint between tumor cells and cDC1 for glutamine acquisition and tumor–immune interactions.
  • GATOR1 containing DEPDC5, NPRL2 and NPRL3
  • GATOR2 complex containing WDR24, WDR59, MIOS, SEH1L and SEC13
  • Figs.10A, 10B the interaction between these two complexes was unaltered in the presence or absence of glutamine.
  • the effects of glutamine on the FLCN–FNIP complex were assessed next by examining the interactions between FLCN and FNIP2 after deprivation or add-back of glutamine.
  • the cross-presentation ability of FLCN-deficient cDC1 was also examined by using the HKLM-OVA system described 65 168222090v1 Attorney Docket No.243734.000197 above 41 , and found that FLCN-deficient cDC1 were markedly defective in mediating HKLM- OVA-induced T-cell proliferation (Fig.3D).
  • Batf3 –/– :Flcn ⁇ DC mixed bone marrow (BM) chimaeras were generated by following an established strategy 35, 45 to selectively restrict FLCN deficiency to cDC1, because Batf3 –/– BM cells can give rise to all cell lineages except for cDC1 33 .
  • WT or Flcn ⁇ DC BM cells were mixed with Batf3 –/– BM cells at a 1:1 ratio and used them to reconstitute C57BL/6 mice, with the resulting Batf3 –/– :Flcn ⁇ DC mixed BM chimaeras showing FLCN deficiency restricted to cDC1 but not other BM-derived cells (or in parallel, complete BM chimaeras were generated by reconstitution of either WT or Flcn ⁇ DC BM cells into C57BL/6 mice).
  • OT-I T cells were then adoptively transferred into these chimaeras and immunized with OVA.
  • XCR1-Cre mouse strain which expresses Cre-recombinase specifically in cDC1 46 , was crossed with Flcn fl/fl mice to generate mice with conditional deletion of FLCN in cDC1 (Xcr1 Cre/+ Flcn fl/fl ).
  • Xcr1 Cre/+ Flcn fl/fl mice After challenge with MC38 cells, Xcr1 Cre/+ Flcn fl/fl mice also exhibited greatly increased tumor growth compared to WT mice (Fig.3G), indicating the selective requirement of FLCN in cDC1 for tumor control.
  • MC38 culture supernatant suppressed WT cDC1-induced OT-I T-cell proliferation and glutamine supplementation reversed it, but neither MC38 culture supernatant alone nor glutamine supplementation had additional effects on the capacity of FLCN-deficient cDC1 to prime OT-I T-cell proliferation (Fig. 3I).
  • WT and FLCN-deficient cDC2 treated with MC38 culture supernatant were able to respond to glutamine by mediating OT-II T-cell proliferation (Fig. 3J).
  • FLCN is selectively required for glutamine to promote cDC1 functions but is dispensable for cDC2 effects, concomitant with its importance in vivo in mediating glutamine-dependent suppression of tumor growth.
  • scRNA-seq was utilized to unbiasedly profile intratumoral CD45 + cells in WT and Flcn ⁇ DC mice challenged with MC38 tumor cells (Figs. 11H, 11I). Specifically, non-DC immune (CD45 + ) cells and DCs were sorted at day 15 after tumor challenge and mixed for analysis by scRNA-seq.
  • Unsupervised clustering analysis revealed major immune cell populations in intratumoral CD45 + cells with a substantially decreased proportion of CD8 + T cells, whereas other cell populations were unaltered or showed only minor effects (e.g., slightly increased frequency of monocytes/macrophages) (Fig. 11J).
  • Flow cytometry analysis validated the reduction of intratumoral CD8 + T cells from Flcn ⁇ DC mice (Fig.3K).
  • a decreased ratio of CD8 + T cells to Treg cells in tumors from Flcn ⁇ DC mice was also observed (Fig. 3L), indicative of a more immunosuppressive TME.
  • cDC1 were then scored for activation and functional state and it was found that cDC1 from Flcn ⁇ DC tumor-bearing mice had lower activity score of gene signatures related to DC activation 47 and MHC-I antigen presentation 29 (Figs. 3M, 3N).
  • GSEA also revealed that antigen processing and presentation pathway was downregulated in intratumoral cDC1 from Flcn ⁇ DC mice (Fig.11K), in line with the 67 168222090v1 Attorney Docket No.243734.000197 defective cross-presentation capacity of FLCN-deficient cDC1 described above.
  • loss of FLCN can lead to impaired DC functional fitness, associated with reduced accumulation of CD8 + T cells in the TME.
  • TFEB co-deletion largely reversed the increased lysosomal mass and enhanced expression and maturation of cathepsin D in FLCN-deficient cDC1 (Fig.4E, Fig.13I).
  • the cross-presentation ability of cDC1 was examined next and it was found that TFEB co-deletion restored the defect of FLCN-deficient 69 168222090v1 Attorney Docket No.243734.000197 cDC1 in mediating the proliferation of OT-I T cells (Fig.4F), as well as IL-2 and IFN ⁇ production by OT-I T cells in vitro (Fig.13J).
  • OT-I T cells were adoptively transferred into mice lacking FLCN and TFEB alone or in combination, followed by OVA immunization.
  • TFEB deficiency alone had no effect on the ability of DCs to induce OT-I T-cell proliferation; however, the defective OT-I T-cell proliferation in Flcn ⁇ DC mice was reversed by TFEB co-deletion (Fig. 4G).
  • intratumoral glutamine supplementation substantially enhances anti-tumor immunity and immunotherapy efficacy by restoring the cross-presentation capacity of cDC1.
  • the synergistic effects of glutamine supplementation plus ICB suggest that combining checkpoint blockade with glutamine supplementation represents a potential new therapeutic strategy to overcome treatment resistance in patients with poor response to ICB therapy.
  • the present data further indicate that tumor cells and cDC1 both rely on the glutamine transporter SLC38A2 for glutamine uptake and downstream biological effects. Further, expression of SLC38A2 in tumor cells appears to restrict cDC1 access to glutamine, consistent with the notion that tumor cells have the highest uptake of glutamine in the TME 7 .
  • glutamine As the most abundant amino acid found in the body, glutamine has received broad attention for its metabolic effects, including its role in supporting tumor cell-intrinsic metabolism 23 as well as serving as the substrate for glutaminolysis in T cells 32 and macrophages 61 .
  • the signaling role of glutamine namely the impacts on intracellular signaling events or protein complexes, is incompletely defined.
  • glutamine availability reciprocally impacts FLCN–FNIP complex (stimulating) and TFEB activity (inhibitory), and that FLCN and TFEB form an intracellular signaling axis to mediate the effect of glutamine at orchestrating cDC1 cross-presentation and activation of cytotoxic effector-like CD8 + T-cell responses (Fig. 14H).
  • FLCN has been shown to act as a suppressor of TFEB activity 62, 63 , the inventors have established herein a previously unrecognized link between glutamine and FLCN–TFEB signaling pathway in cDC1 and anti-tumor immunity in vivo. Indeed, deletion of FLCN in DCs impairs tumor immunity and abrogates the beneficial anti-tumor effect of intratumoral glutamine supplementation, but co-deletion of TFEB reverses the impaired cDC1 function and anti-tumor immunity in Flcn ⁇ DC mice.
  • SLC38A2 deficiency in DCs eliminates the anti-tumor effect of glutamine supplementation, thereby linking this glutamine transporter and FLCN signaling as important drivers of cDC1 function and tumor immunity.
  • the present work provides important insights into the immunostimulatory effects of glutamine in DCs, which contrasts with the immunosuppressive or tolerogenic effects of lipids and indoleamine 2,3- dioxygenase 1 (IDO1)-mediated tryptophan catabolism in modulating DC functions in tumors or inflammatory settings 64-66 .
  • IDO1 indoleamine 2,3- dioxygenase 1
  • the present findings support the clinical application of targeting glutamine levels in tumors or glutamine-dependent signaling in cDC1 for cancer treatments, including the modulation of glutamine levels as means to enhance the efficacy of DC vaccines and ICB therapies to overcome tumor-mediated immunosuppression in the clinic.
  • 72 168222090v1 Attorney Docket No.243734.000197 References [00170] 1. Kalbasi, A. & Ribas, A. Tumour-intrinsic resistance to immune checkpoint blockade. Nat Rev Immunol 20, 25-39 (2020). [00171] 2. Zou, W., Wolchok, J.D. & Chen, L.
  • PD-L1 (B7-H1) and PD-1 pathway blockade for cancer therapy Mechanisms, response biomarkers, and combinations. Sci Transl Med 8, 328rv324 (2016).
  • Kidney-targeted Birt-Hogg-Dube gene inactivation in a mouse model Erk1/2 and Akt-mTOR activation, cell hyperproliferation, and polycystic kidneys. J Natl Cancer Inst 100, 140-154 (2008).
  • 45. Mashayekhi, M. et al. CD8alpha(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites. Immunity 35, 249- 259 (2011).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Zoology (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention is directed to methods for treating cancer by targeting glutamine levels in tumors and/or glutamine-dependent signaling in dendritic cells, including the modulation of glutamine levels as means to enhance the efficacy of cancer immunotherapies.

Description

Attorney Docket No.243734.000197 USE OF GLUTAMINE FOR THE TREATMENT OF CANCER AND FOR ENHANCING THE EFFICACY OF AN IMMUNOTHERAPY CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims priority to U.S. Provisional Application No. 63/482,616, filed February 1, 2023, the disclosure of which is herein incorporated by reference in its entirety. SEQUENCE LISTING [0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on January 25, 2024, is named 243734_000197_SL.xml and is 18,511 bytes in size bytes in size. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH [0003] This invention was made with government support under grant number AI105887 awarded by the National Institutes of Health. The government has certain rights in the invention. FIELD OF THE INVENTION [0004] The present invention is directed to methods for treating cancer by targeting glutamine levels in tumors and/or glutamine-dependent signaling in dendritic cells, including the modulation of glutamine levels as means to enhance the efficacy of cancer immunotherapies. BACKGROUND [0005] Nutrients, including glucose, amino acids and lipids, serve as important signals for shaping immune cell function and subset differentiation6-9. Understanding how nutrients orchestrate context-dependent immune responses in different tissue microenvironments is of enormous importance for both fundamental research and disease therapy. In particular, the tumor microenvironment (TME) is characterized by nutrient and metabolic alterations that impact the interplay between cancer cells and immune cells, especially T cells10. In the TME, altered glucose or amino acid composition contributes to impaired T-cell effector function11-15 or dysregulated myeloid cell activity7. As the specialized antigen-presenting cells for bridging innate and adaptive immunity, dendritic cells (DCs) capture and present tumor-associated antigens on major histocompatibility complex (MHC) molecules and provide costimulatory signals and soluble 1 168222090v1 Attorney Docket No.243734.000197 factors to promote anti-tumor immunity3. Sensing of environmental molecular cues, including endogenous damage-associated molecular patterns (DAMPs) derived from dying tumor cells, contributes to DC activation in anti-tumor immunity3, but there is a limited understanding of the nutrients or metabolic processes mediating DC function in the TME. Moreover, despite the emerging roles for intracellular metabolic pathways in the development and activation of DCs16- 18, the functional effects and signaling mechanisms of macronutrients in modulating DC functional capacity and heterogeneity remain largely unknown. SUMMARY OF THE INVENTION [0006] In one aspect, the invention provides a method for inhibiting growth of a tumor in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-tumor immunotherapy. [0007] In another aspect, the invention provides a method for enhancing the efficacy of an anti-cancer immunotherapy in a subject in need thereof, comprising administering to the subject said immunotherapy and an effective amount of glutamine. [0008] In yet another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-cancer immunotherapy. [0009] In certain embodiments of any of the above methods, the immunotherapy and glutamine are administered simultaneously. In certain embodiments of any of the above methods, the immunotherapy and glutamine are administered sequentially in any order. [0010] In another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting solute carrier family 38 member 2 (SLC38A2)-mediated glutamine uptake in cancer cells of the subject. In certain embodiments, the method further comprises administering to the subject an effective amount of an anti-cancer immunotherapy. [0011] In a further aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting lysosomal signaling pathway in dendritic cells (DCs) of the subject. In certain embodiments, inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor of lysosomal signaling pathway selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular 2 168222090v1 Attorney Docket No.243734.000197 acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. In certain embodiments, the method further comprises administering to the subject an effective amount of an anti-cancer immunotherapy. [0012] In yet another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. In certain embodiments, said DCs are type-1 conventional dendritic cells (cDC1s). In certain embodiments, said DCs have been pre-exposed to an antigen associated with said cancer. In certain embodiments, said DCs are autologous to the subject. In certain embodiments, the glutamine- sufficient medium comprises 0.6-2 mM glutamine. In certain embodiments, the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H+- ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. In certain embodiments, the DCs and glutamine are administered simultaneously. In certain embodiments, the DCs and glutamine are administered sequentially in any order. In certain embodiments, the method further comprises administering to the subject an effective amount of an anti-cancer immunotherapy. [0013] In certain embodiments of any of the above methods, glutamine is administered in an amount effective for augmenting DC-mediated CD8+ T-cell anti-cancer immunity in the subject. [0014] In certain embodiments of any of the above methods, glutamine is administered intratumorally. [0015] In another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and inhibiting lysosomal signaling pathway in DCs of the subject. In certain embodiments, inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor of lysosomal signaling pathway selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. In certain embodiments, the immunotherapy and the inhibitor of lysosomal signaling pathway are administered simultaneously. In certain embodiments, the immunotherapy and the inhibitor of lysosomal signaling pathway are 3 168222090v1 Attorney Docket No.243734.000197 administered sequentially in any order. In certain embodiments, the method further comprises administering an effective amount of glutamine to the subject. In certain embodiments, glutamine is administered in an amount effective for augmenting DC-mediated CD8+ T-cell anti-cancer immunity in the subject. In certain embodiments, glutamine is administered intratumorally. [0016] In a further aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. In certain embodiments, said DCs are cDC1s. In certain embodiments, said DCs have been pre- exposed to an antigen associated with said cancer. In certain embodiments, said DCs are autologous to the subject. In certain embodiments, the glutamine-sufficient medium comprises 0.6-2 mM glutamine. In certain embodiments, the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. In certain embodiments, the immunotherapy and the DCs are administered simultaneously. In certain embodiments, the immunotherapy and the DCs are administered sequentially in any order. In certain embodiments, the method further comprises administering an effective amount of glutamine to the subject. In certain embodiments, glutamine is administered in an amount effective for augmenting DC-mediated CD8+ T-cell anti-cancer immunity in the subject. In certain embodiments, glutamine is administered intratumorally. [0017] In certain embodiments of any of the above methods involving immunotherapy, said immunotherapy can be a DC-based therapy, a T-cell-mediated therapy, or an immune checkpoint blockade therapy. Non-limiting examples of useful DC-based therapies include, e.g., DC vaccines, adoptive transfer of antigen-loaded or activated DCs, administration of DC-activating factors, administration of DC-mobilizing agents, administration of antigens and/or adjuvants, using DC- specific antibodies to deliver an antigen or adjuvant or nanoparticle, and any combinations thereof. Non-limiting examples of useful T-cell-mediated therapies include, e.g., chimeric antigen receptor (CAR) T cell therapies, adoptive T cell transfer (ACT) therapies (e.g., wherein the transferred T cells are antigen-specific CD8+ T cells), T cell receptor (TCR) T cell therapies, tumor-infiltrating lymphocyte (TIL) therapies, neoantigen cancer vaccines, and any combinations thereof. Non- limiting examples of useful immune checkpoint blockade therapies include, e.g., anti-programmed 4 168222090v1 Attorney Docket No.243734.000197 death 1 (anti-PD-1) therapies, anti-programmed death ligand 1 (anti-PD-L1) therapies, anti- lymphocyte activation gene-3 (anti-LAG-3) therapies, anti-cytotoxic T-lymphocyte antigen-4 (anti-CTLA-4) therapies, anti-T-cell immunoglobulin and mucin domain 3 (anti-TIM-3) therapies, and any combinations thereof. [0018] In certain embodiments of any of the above methods, the method further comprises inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject. [0019] In certain embodiments of any of the above methods, the method further comprises inhibiting lysosomal signaling pathway in DCs of the subject. In certain embodiments, inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. [0020] In certain embodiments of any of the above methods, the method further comprises administering to the subject DCs, wherein said DCs have been pre-incubated in a glutamine- sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. In certain embodiments, said DCs are cDC1s. In certain embodiments, the glutamine-sufficient medium comprises 0.6-2 mM glutamine. In certain embodiments, the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. In certain embodiments, said DCs have been pre-exposed to an antigen associated with said cancer. In certain embodiments, said DCs are autologous to the subject. [0021] In certain embodiments of any of the above methods, said cancer is characterized by tumors with glutamine deprivation. In certain embodiments of any of the above methods, said cancer is selected from colon cancer, melanoma, breast cancer, pancreatic cancer, and lung cancer. [0022] In another aspect, the invention provides a method for enhancing anti-tumor CD8+ T- cell immunity in a tumor of a subject in need thereof, comprising administering to the subject intratumorally an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. In certain embodiments, said DCs are cDC1s. In certain embodiments, the glutamine-sufficient medium comprises 0.6-2 mM glutamine. In certain embodiments, the one or more lysosomal 5 168222090v1 Attorney Docket No.243734.000197 signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. In certain embodiments, said DCs have been pre-exposed to an antigen associated with said tumor. In certain embodiments, the method further comprises administering to the subject intratumorally an effective amount of glutamine and/or inhibiting SLC38A2-mediated glutamine uptake in tumor cells of the subject and/or inhibiting lysosomal signaling pathway in DCs of the subject. In certain embodiments, inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. In certain embodiments, said tumor has glutamine deprivation. [0023] In certain embodiments of any of the above methods, the subject is human. [0024] These and other aspects of the present invention will be apparent to those of ordinary skill in the art in the following description, claims and drawings. BRIEF DESCRIPTION OF THE DRAWINGS [0025] Figs. 1A-1O depict that intratumoral glutamine supplementation promotes cDC1- mediated anti-tumor immunity. Fig.1A, wild-type (WT) mice were inoculated with MC38 colon adenocarcinoma cells. At day 15 after tumor challenge, matched plasma and tumor interstitial fluid (TIF) were collected and levels of glutamine (Gln; left) and glucose (right) were quantified by mass spectrometry (n = 4 mice). Figs.1B-1C, WT mice with established MC38 (Fig.1B) or B16- OVA (Fig. 1C) tumors were treated with PBS or Gln (200 mg/kg) (n = 8 each group for MC38; 10 each group for B16-OVA) intratumorally starting at day 5 after tumor inoculation and for another 10 days after the first injection. Tumor growth curves (left) and tumor weight at endpoint (right; day 24 for MC38; day 18 for B16-OVA) were measured. Fig.1D, tumor growth curves in Rag1−/− mice with established MC38 tumors that were treated with PBS or Gln (n = 7 each group) intratumorally starting at day 5 after tumor inoculation and for another 10 days after the first injection. Fig.1E, WT mice with established MC38 tumors were treated with PBS, Gln, anti-PD- 1 or combination of Gln and anti-PD-1 (n = 12 for Gln + anti-PD-1; 13 for other groups). Gln was injected as in Figs.1B-1C. Anti-PD-1 (200 ^g) was intraperitoneally injected at days 7, 10 and 13 6 168222090v1 Attorney Docket No.243734.000197 after tumor inoculation. Tumor growth (left) and survival of mice (right) were monitored. Fig.1F, WT mice with established B16-OVA tumors were treated with PBS or Gln (n = 10 each group) intratumorally starting at day 5 after tumor inoculation and for another 10 days after the first injection. At day 12 after tumor challenge, activated OT-I T cells were adoptively transferred intravenously (indicated by an arrow). Tumor growth was measured. Fig. 1G, WT mice with established MC38 tumors were treated with combination of Gln and anti-PD-1 as in Fig.1E. Sixty days later, the tumor-free mice (n = 8) were rechallenged with 1 × 106 MC38 cells. Naïve mice (n = 5) were challenged with MC38 cells in parallel. Tumor growth curves after tumor rechallenge were shown. Fig.1H, WT mice with established MC38 tumors were treated with PBS (n = 7) or Gln (n = 5) intratumorally daily starting at day 5 after tumor inoculation, and euthanized at day 15. Quantification of the frequencies (left) and numbers (right) of intratumoral CD4+ T and CD8+ T cells. Fig. 1I, WT mice with established MC38 tumors were treated with PBS or Gln intratumorally daily starting at day 5 after tumor inoculation, and euthanized at day 15. Dendritic cells (CD45+CD64−CD11c+MHC-II+), CD45+ non-macrophage immune cells (CD45+CD64−), macrophages (CD45+CD64+), and CD45− tumor cells and non-immune cells in the tumor tissues were sorted and mixed at a 5:4:1:1 ratio for scRNA-seq analysis (n = 2 biological replicates per group). See also Fig. 5G for distribution of cell populations on UMAP (Uniform Manifold Approximation and Project) plot. Violin plots show activity score of signature genes related to different functional states (early activation, memory precursor, memory, and effector/cytokine) in intratumoral CD8+ T cells from PBS or Gln-treated mice. Figs.1J-1K, WT mice with established MC38 tumors were treated with PBS (n = 7) or Gln (n = 5) intratumorally daily starting at day 5 after tumor inoculation, and euthanized at day 15. Intratumoral lymphocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h. Quantification of frequencies (upper) and numbers (lower) of IFN ^+ (left), TNF ^+ (middle) and Granzyme B+ (right) cells among intratumoral CD8+ T cells (Fig. 1J). Flow cytometry analysis (left) and quantification of the frequencies (middle) and numbers (right) of effector-like TIM-3+TCF1− and stem-like TIM- 3−TCF1+ CD8+ T cells in MC38 tumors (Fig.1K). Fig.1L, plot depicting normalized enrichment score (NES) and statistical significance of the GSEA performed to assess the effects of glutamine supplementation on conventional dendritic cells (cDCs), neutrophils, plasmacytoid dendritic cells (pDCs), B cells, macrophages and CD45− cells that were predominantly tumor cells (these populations were identified by scRNA-seq analysis in Fig. 5G). Fig. 1M, WT mice with 7 168222090v1 Attorney Docket No.243734.000197 established MC38 tumors were treated with PBS or Gln (n = 5 each group) intratumorally daily starting at day 5 after tumor inoculation, and euthanized at day 15. Flow cytometry analysis quantification of the mean fluorescence intensity (MFI) of CD40, CD80, CD86 and MHC-II on intratumoral cDC1. Fig.1N, tumor growth curves in WT or Batf3−/− mice with established MC38 tumors that were treated with PBS (n = 10 for WT; 8 for Batf3−/− mice) or Gln (n = 9 for WT; 8 for Batf3−/− mice) intratumorally starting at day 5 after tumor inoculation and for another 10 days injection. Fig.1O, WT mice were inoculated with B16-OVA cells. Freshly isolated from B16-FLT3L tumor-bearing mice were cultured with soluble OVA and poly I:C in medium with or without Gln for 2 h, washed, and then transferred subcutaneously at day 5 after inoculation of B16-OVA cells (n = 9 for DC treated with Gln; 8 for DC treated without Gln). PBS was injected into non-transfer control mice (n = 10). Tumor growth was monitored. Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; two-tailed paired Student’s t-test (Fig.1A), two-tailed unpaired Student’s t-test (tumor weight of Figs. 1B, 1C, 1H, 1J, 1K, 1M), two-way ANOVA (tumor size of Figs.1B-1G, 1N, 1O), log-rank (Mantel– Cox) test (survival of Fig.1E) or Wilcoxon rank sum test (Fig.1I). Data are representative of two (Figs. 1A, 1D-1H, 1H, 1M-1O) or at least three (Figs. 1B, 1C, 1K) independent experiments. Numbers indicate percentages of cells in gates (Fig.1K) or MFI (Fig.1M). [0026] Figs. 2A-2R depict that glutamine interplay between tumor cells and cDC1 modulates anti-tumor immunity. Figs.2A-2B, sort-purified cDC1 were pulsed with OVA protein (200 ^g/ml) in medium containing all 20 common amino acids (+AA) or medium lacking an individual amino acid as indicated, irradiated and then cocultured with OT-I (Fig.2A) or OT-II (Fig.2B) T cells at a ratio of 1:10. At 64 h, 3H-thymidine ([3H] TdR) was added, and [3H] TdR incorporation by OT- I T cells was measured 8 h later (n = 4 each group). Fold change (+AA versus ^Gln) was indicated with an arrow. Fig.2C, effect of MC38 supernatant on the priming function of cDC1. cDC1 were pulsed with OVA protein and culture supernatant derived from MC38 cells cultured in glutamine- free medium supplemented with various concentrations (0.3, 0.6 or 2 mM) of glutamine for 2 h. The cDC1 were then irradiated and cocultured with OT-I T cells. [3H] TdR incorporation by OT- I T cells was measured 3 days later (n = 4 each group). Fig. 2D, effect of individual amino acid supplementation in MC38 supernatant on the priming capacity of cDC1. cDC1 were pulsed with OVA protein in MC38 cell culture supernatant supplemented with an individual amino acid as indicated, irradiated, and then cocultured with OT-I T cells. [3H] TdR incorporation by OT-I T 8 168222090v1 Attorney Docket No.243734.000197 cells was measured 3 days later (n = 4 each group). Fig.2E, MC38 cells and bone marrow-derived DCs (BMDCs) were cultured in a transwell at a ratio of 1:4 in RPMI 1640 medium supplemented with 2 or 0.6 mM glutamine. Quantification of the expression of CD86 (left) and MHC-II (right) on BMDCs at 24 h after culture (n = 4 each group). Fig.2F, expression of glutamine transporters SLC1A5, SLC6A14, SLC6A19, SLC38A1, SLC38A2, SLC38A3, SLC38A4 and SLC38A5 in human melanoma cells, DCs and CD8+ T cells derived from a publicly available human melanoma scRNA-seq dataset (GSE72056)39. Fig. 2G, Cas9-expressing MC38 cells (MC38-Cas9) were transduced with sgRNA targeting Slc38a2 (sgSlc38a2) or non-targeting control (sgNTC) sgRNA. The expression of SLC38A2 was analyzed by immunoblot. ^-Actin was used as loading control. Molecular weight markers were indicated in kilodaltons (kDa). Fig.2H, tumor growth curves in wild-type (WT) mice inoculated with sgNTC- or sgSlc38a2-transduced MC38-Cas9 cells (1 × 106 cells per mouse, n = 10 each group). Figs. 2I-2J, WT mice were inoculated with sgNTC- or sgSlc38a2-transduced MC38-Cas9 cells (n = 7 each group) and euthanized at day 15. Quantification of the numbers of intratumoral CD8+, CD4+Foxp3− conventional T and CD4+Foxp3+ Treg cells (Fig. 2I). Intratumoral lymphocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h. Flow cytometry analysis (upper) and quantification of the frequencies (lower) of IFN ^+ (left), TNF ^+ (middle) and Granzyme B+ (right) cells among intratumoral CD8+ T cells (Fig. 2J). Fig. 2K, tumor growth curves in Batf3−/− mice inoculated with sgNTC- or sgSlc38a2-transduced MC38-Cas9 cells (n = 10 each group). Fig.2L, cDC1 were sorted from the spleen of WT and Slc38a2ΔDC mice (n = 8 per genotype), and then pulsed with OVA protein, washed and cocultured with OT-I or OT-II T cells at a ratio of 1:10 for 3 days. [3H] TdR incorporation by OT-I (left) or OT-II (right) T cells was measured. Fig. 2M, WT and SLC38A2-deficient cDC1 (n = 8 per genotype) or cDC2 (n = 8 per genotype) were cultured with OT-I T cells and OVA-expressing heat-killed Listeria monocytogenes (HKLM-OVA) for 3 days. [3H] TdR incorporation by OT-I T cells was measured. Fig.2N, CFSE-labeled OT-I T cells were adoptively transferred into WT or Slc38a2ΔDC mice (n = 5 per genotype) and immunized with OVA protein 24 h later, followed by analysis of CFSE dilution 3 days later by flow cytometry (left). Right, quantification of the frequency of CFSElow (proliferated) OT-I T cells. Fig. 2O, tumor growth curves in WT (n = 10) and Slc38a2ΔDC (n = 9) mice inoculated with MC38 cells. Fig.2P, tumor growth curves in WT or Slc38a2ΔDC mice with established MC38 tumors that were treated with PBS (n = 9 for WT; 8 for Slc38a2ΔDC mice) or Gln (n = 7 per genotype) intratumorally starting 9 168222090v1 Attorney Docket No.243734.000197 at day 5 after tumor inoculation and for another 10 days. Figs.2Q-2R, WT (n = 8) and Slc38a2ΔDC (n = 10) mice were inoculated with MC38-OVA cells and euthanized at day 19. Quantification of the frequency (left) and number (right) of H-2Kb-OVA-tetramer+ (OVA-specific) CD8+ T cells in tumors (Fig. 2Q). Intratumoral lymphocytes were stimulated with OVA257-264 peptide in the presence of monensin for 4 h. Quantification of the frequency of IFN ^+ (left) and TNF ^+ (right) cells among intratumoral CD8+ T cells (Fig.2R). Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; two-tailed unpaired Student’s t-test (Figs.2C, 2E, 2I, 2J, 2L-N, 2Q, 2R) or two-way ANOVA (Figs.2H, 2K, 2O, 2P). Data are representative of one (Fig. 2G), two (Figs. 2E, 2I-2K, 2M-2R), or at least three (Figs. 2A-2D, 2H, 2L) independent experiments. Numbers indicate percentages of cells in gates (Figs.2J, 2N). [0027] Figs.3A-3S depict that glutamine promotes the priming effect and anti-tumor immunity of cDC1 via FLcN. Fig. 3A, HEK293T cells were transfected with HA-FLCN and Flag-FNIP2. Cells were starved with glutamine (Gln)-free medium for 3 h, and Gln was added back for 10 or 15 min. The interaction between FLCN and FNIP2 was analyzed by anti-HA immunoprecipitation and immunoblot for Flag (for FNIP2) and HA (for FLCN). Molecular weights were indicated in kilodaltons (kDa). Long and short exposures (exp.) for HA immunoblot were shown. Fig. 3B, cDC1 were sorted from the spleen of wild-type (WT) and FlcnΔDC mice (n = 9 per genotype), and then pulsed with OVA protein, washed and cocultured with OT-I T cells at a ratio of 1:10 for 3 days. [3H] thymidine ([3H] TdR) incorporation by OT-I T cells was measured. Fig.3C, cDC2 were sorted from the spleen of WT and FlcnΔDC mice (n = 9 per genotype), and then pulsed with OVA protein, washed and cocultured with OT-II T cells at a ratio of 1:10 for 3 days. [3H] TdR incorporation by OT-II T cells was measured. Fig.3D, WT and FLCN-deficient cDC1 (n = 9 per genotype) or cDC2 (n = 9 per genotype) were cultured with OT-I T cells and OVA-expressing heat-killed Listeria monocytogenes (HKLM-OVA) for 3 days. [3H] TdR incorporation by OT-I T cells was measured. Fig. 3E, CFSE-labeled OT-I T cells were adoptively transferred into Batf3−/−:WT or Batf3−/−:FlcnΔDC mixed chimaeras or WT or FlcnΔDC complete chimaeras followed by immunization with OVA protein 24 h later. After 3 days, CFSE dilution was assessed by flow cytometry (upper). Lower, quantification of frequency of CFSElow (proliferated) OT-I T cells (n = 6 per genotype). Fig.3F, tumor growth curves in WT (n = 6) and FlcnΔDC (n = 5) mice inoculated with MC38 cells. Fig.3G, tumor growth curves in WT (n = 10) and Xcr1Cre/+Flcnfl/fl (n = 8) mice inoculated with MC38 cells. Fig.3H, tumor growth curves in WT or FlcnΔDC mice with established 10 168222090v1 Attorney Docket No.243734.000197 MC38 tumors that were treated with PBS (n = 8 per genotype) or Gln (n = 8 per genotype) intratumorally starting at day 5 after tumor inoculation and for another 10 days after the first injection. Fig.3I, effect of Gln supplementation on the priming effect of WT and FLCN-deficient cDC1. WT and FLCN-deficient cDC1 were pulsed with OVA protein in fresh medium, MC38 cell culture-derived supernatant (MC38 supernatant) or MC38 supernatant plus Gln (Supernatant + Gln) (n = 4 each group), irradiated and then cocultured with OT-I T cells for 3 days. [3H] TdR incorporation by OT-I T cells was measured. Fig.3J, effect of Gln supplementation on the priming effect of WT and FLCN-deficient cDC2. WT and FLCN-deficient cDC2 were pulsed with OVA protein in fresh medium, MC38 supernatant or Supernatant + Gln (n = 4 each group), irradiated and then cultured with OT-II T cells for 3 days. [3H] TdR incorporation by OT-II T cells was measured. Figs.3K-3L, WT and FlcnΔDC mice (n = 6 per genotype) were inoculated with MC38 cells and euthanized at day 15. Quantification of the frequencies (left) and numbers (right) of intratumoral CD8+, CD4+Foxp3 ^ conventional T and CD4+Foxp3+ Treg cells (Fig. 3K), or the ratio of CD8+ T cells to Treg cells (Fig.3L) in tumors. Figs.3M-3N, MC38 cells were inoculated subcutaneously into WT and FlcnΔDC mice. Intratumoral CD45+ cells and DCs (CD45+CD64−CD11c+MHC-II+) were sorted at day 15 after tumor inoculation, and mixed at a 2:1 ratio for analysis by scRNA-seq (n = 2 biological replicates per genotype). See also Figs.11H, 11I for cell distribution on UMAP (Uniform Manifold Approximation and Projection) plots. Violin plots show the activity scores of gene signatures related to DC activation (Fig. 3M) and MHC-I antigen presentation (Fig.3N) in intratumoral cDC1 from WT and FlcnDDC mice. Fig.3O, violin plots show the activity scores of gene signatures related to early activation, memory precursor, memory and effector/cytokine in intratumoral CD8+ T cells (profiled by scRNA-seq analysis) from WT and FlcnDDC mice. Fig. 3P, quantification of effector-like and stem-like cells among intratumoral CD8+ T cells from WT and FlcnΔDC mice. Fig.3Q, WT (n = 6) and FlcnΔDC (n = 8) mice were inoculated with MC38 cells, and euthanized at day 15. Intratumoral lymphocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h. Quantification of the frequencies of IFN ^+ (left), TNF ^+ (middle) and Granzyme B+ (right) cells among intratumoral CD8+ T cells. Figs. 3R-3S, WT (n = 6) and FlcnΔDC (n = 5) mice were inoculated with MC38- OVA cells and euthanized at day 19. Flow cytometry analysis (left) and quantification of the frequency (middle) and number (right) of H-2Kb-OVA-tetramer+ (OVA-specific) CD8+ T cells in tumors (Fig. 3R). Intratumoral lymphocytes were stimulated with OVA257-264 peptide in the 11 168222090v1 Attorney Docket No.243734.000197 presence of monensin for 4 h. Flow cytometry analysis (left) and quantification of the frequency (middle) and number (right) of TNF ^+IFN ^+ cells among intratumoral CD8+ T cells (Fig. 3S). Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; two-tailed unpaired Student’s t-test (Figs. 3B-D, 3K, 3L, 3Q03S), one-way ANOVA (Figs. 3E, 3I, 3J), two-way ANOVA (Figs. 3F-3H) or Wilcoxon rank sum test (Figs. . Data are representative of two (Figs.3A, 3D, 3E, 3I, 3J, 3R, 3S), or at least three (Figs. 3B, 3C, 3F-3H, 3K, 3L, 3Q) independent experiments. Numbers indicate percentages of cells in gates (Figs.3E, 3R, 3S). [0028] Figs.4A-4L depict that co-deletion of TFEB restores the priming effect of cDC1 caused by FLCN deficiency and glutamine restriction. Fig.4A, cDC1 were sort-purified from the spleen of wild-type (WT) and FlcnΔDC mice (n = 4 per genotype) for ATAC-seq analysis. Differential footprinting analysis of transcriptional factors were performed by comparing FlcnΔDC versus WT splenic cDC1 and the transcription factors were ranked by their activity scores. Figs. 4B-4C, GSEA enrichment plots showing upregulation of KEGG lysosome pathway (Fig.4B) and putative TFEB target genes (derived from a public dataset that identified TFEB targets by integrating TFEB ChIP-seq analysis and TFEB overexpression52) (Fig. 4C) in splenic cDC1 from FlcnΔDC versus WT mice. FDR, false discovery rate; NES, normalized enrichment score. Fig. 4D, splenic cDC1 from WT and FlcnΔDC mice (n = 3 per genotype) were incubated with DQ-OVA for 0, 30, 60 or 120 min. DQ-OVA degradation was analyzed by flow cytometry. Flow cytometry analysis (upper) at 120 min and quantification (lower) of DQ-OVA release over time. MFI, mean fluorescence intensity. Fig.4E, immunoblot analysis of Cathepsin D (pro and mature forms), FLCN and TFEB expression in cDC1 from WT, FlcnΔDC, TfebΔDC and Flcn/TfebΔDC mice. GAPDH was used as loading control. Molecular weights were indicated in kilodaltons (kDa). Fig. 4F, splenic cDC1 were sort-purified from WT (n = 21), FlcnΔDC (n = 12), TfebΔDC (n = 15) and Flcn/TfebΔDC (n = 12) mice and pulsed with OVA protein, followed by coculture with OT-I T cells at a ratio of 1:10 for 3 days. [3H] thymidine ([3H] TdR) incorporation by OT-I T cells was measured. Fig. 4G, CFSE-labeled OT-I T cells were adoptively transferred into WT (n = 8), FlcnΔDC (n = 9), TfebΔDC (n = 6) or Flcn/TfebΔDC (n = 10) mice followed by immunization with OVA protein 24 h later. Quantification of the frequency of CFSElow (proliferated) OT-I T cells as assessed 3 days after OVA immunization. Fig.4H, tumor growth curves in WT (n = 9), FlcnΔDC (n = 7), TfebΔDC (n = 9) and Flcn/TfebΔDC (n = 7) mice inoculated with MC38 cells. Figs.4I-4J, WT (n = 8), FlcnΔDC (n 12 168222090v1 Attorney Docket No.243734.000197 = 7), TfebΔDC (n = 6) and Flcn/TfebΔDC (n = 7) mice were inoculated with MC38 cells, and euthanized at day 15. Flow cytometry analysis (left) and quantification of the frequencies (right) of effector-like (CD39+Ly108− or TIM-3+TCF1−) and stem-like (CD39−Ly108+ or TIM-3−TCF1+) subsets of intratumoral CD8+ T cells (Fig. 4I). Flow cytometry analysis (left) and quantification (right) of the MFI of T-bet in intratumoral CD8+ T cells (Fig. 4J). Fig. 4K, splenic cDC1 were sort-purified from WT and FlcnΔDC mice and incubated in glutamine (Gln)-sufficient medium or starved in Gln-free medium for 3 h. TFEB protein expression in cytosolic and nuclear fractions was analyzed by immunoblot analysis. The protein levels of cytosolic or nuclear TFEB were normalized to GAPDH or Lamin B1, respectively. Numbers indicate the abundance of cytosolic or nuclear TFEB relative to that of WT in the presence of Gln. Molecular weights were indicated in kDa. Fig.4L, Sort-purified cDC1 from WT and TfebΔDC mice (n = 6 per genotype) were pulsed with OVA protein in medium with or without Gln, washed and then cocultured with OT-I T cells for 3 days. [3H] TdR incorporation by OT-I T cells was measured. Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; two-tailed unpaired Student’s t-test (Fig.4D), one-way ANOVA (Figs.4F, 4G, 4I, 4J, 4L) or two-way ANOVA (Fig. 4H). Data are representative of two (Figs. 4D, 4E, 4J, 4L), or at least three (Figs. 4H, 4I, 4K) independent experiments. Data are pooled from two (Fig. 4G) or three (Fig. 4F) independent experiments. Numbers indicate percentages of cells in gates (Fig.4I) or MFI (Figs.4D, 4J). [0029] Figs.5A-5O depict that glutamine supplementation enhances anti-tumor immunity. Fig. 5A, wild-type (WT) mice were inoculated with B16-OVA tumor cells. At day 15 after tumor challenge, matched plasma and tumor interstitial fluid (TIF) were collected and levels of glutamine (Gln; left) and glucose (right) were quantified by mass spectrometry (n = 4 mice). Figs.5B-5C, WT mice were inoculated with MC38 or B16-OVA cells, and euthanized at day 15 after tumor challenge. The levels of 20 common amino acids in matched plasma and TIF from MC38 (Fig. 5B) and B16-OVA (Fig. 5C) tumor-bearing mice were quantified by mass spectrometry (n = 4). Fig.5D, WT mice with established B16-OVA tumors were treated with PBS, Gln, anti-PD-L1 or combination of Gln and anti-PD-L1 (n = 9 for Gln treatment; 10 for other groups). Gln was treated intratumorally starting at day 5 after tumor inoculation and for another 10 days. Anti-PD-L1 (200 ^g) was intraperitoneally injected at days 9, 12 and 15. Tumor growth curves of mice were monitored. Fig.5E, WT mice with established MC38 tumors were treated with PBS (n = 7) or Gln (n = 5) intratumorally daily starting at day 5 after tumor inoculation, and euthanized at day 15. 13 168222090v1 Attorney Docket No.243734.000197 Quantification of the frequencies (left) and numbers (right) of intratumoral CD4+Foxp3− conventional T and CD4+Foxp3+ Treg cells. Fig.5F, WT mice with established B16-OVA tumors were treated with PBS or Gln (n = 10 each group) intratumorally daily starting at day 5 after tumor inoculation, and euthanized at day 15. Quantification of the frequencies (left) and numbers (right) of intratumoral CD8+, CD4+Foxp3− conventional T and CD4+Foxp3+ Treg cells. Fig. 5G, WT mice with established MC38 tumors were treated with PBS or Gln starting at day 5 after tumor inoculation and for another 10 days after the first injection. Dendritic cells (CD45+CD64−CD11c+MHC-II+), CD45+ non-macrophage immune cells (CD45+CD64−), macrophages (CD45+CD64+) and CD45− tumor cells and non-immune cells were sorted from tumors at day 15, and mixed at a 5:4:1:1 ratio for scRNA-seq analysis (n = 2 biological replicates per group). UMAP (Uniform Manifold Approximation and Project) plot of cell subclusters. Fig. 5H, dot plot showing expression of activation and effector genes including Cd44, Gzmb, Prf1, Tbx21 and Tnf in intratumoral CD8+ T cells from mice treated with PBS or Gln. Fig.5I, violin plot showing Gzmb (left) and Prf1 (right) expression in intratumoral CD8+ T cells from mice treated with PBS or Gln. Fig. 5J, the fraction of stem-like (TIM-3−TCF1+) and effector-like (TIM- 3+TCF1−) CD8+ T cell subclusters in mice with established MC38 tumors treated with PBS or Gln. Fig.5K, Activated OT-I T cells were expanded in medium with Gln (+Gln) or without Gln (−Gln) for 2–3 days, and adoptively transferred into mice at day 12 after B16-OVA tumor inoculation (n = 6 each group; adoptive transfer indicated by an arrow). PBS was injected into non-transfer control mice (n = 4 mice). Tumor growth was measured. Fig. 5L, violin plot showing activity score of signatures related to MHC-I antigen presentation pathway in intratumoral cDCs from mice treated with PBS or Gln. Fig.5M, WT mice with established MC38 tumors were treated with PBS or Gln (n = 5 each group) intratumorally daily starting at day 5 after tumor inoculation, and euthanized at day 15. Flow cytometry quantification of the mean fluorescence intensity (MFI) of CD40, CD80, CD86 and MHC-II on intratumoral cDC2. Fig.5N, Tumor growth curves in Batf3−/− mice with established B16-OVA tumors that were treated with PBS or Gln (n = 8 per group) intratumorally daily starting at day 5 after tumor inoculation and for another 10 days. Fig.5O, WT mice were inoculated with B16-OVA cells. Freshly isolated splenic cDC1 from B16-FLT3L tumor-bearing mice were cultured with soluble OVA and poly I:C in medium with or without Gln for 2 h, washed, and then transferred subcutaneously at day 5 after inoculation of tumors (n = 9 for cDC1 treated with Gln; 8 for cDC1 treated without Gln). PBS was injected into non-transfer 14 168222090v1 Attorney Docket No.243734.000197 control mice (n = 10). Survival of mice was monitored. Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; two-tailed paired Student’s t-test (Fig.5A), two-tailed unpaired Student’s t-test (Figs.5B, 5C, 5E, 5F, 5M), two-way ANOVA (Figs.5D, 5K, 5N), Wilcoxon rank sum test (Figs. 5I, 5L) or log-rank (Mantel–Cox) test (Fig. 5O). Data are representative of two (Figs.5A-F, 5K, 5M-O) independent experiments. Numbers indicate MFI (Fig.5M). [0030] Figs. 6A-6P depict that glutamine promotes the priming capacity of cDCs. Fig. 6A, schematic of functional amino acid screening assay used in Figs.2A, 2B, 6B, and 6C. Sort-purified splenic cDC1 or cDC2 were pulsed with OVA protein (200 ^g/ml) in medium without an individual amino acid (AA), irradiated and then cocultured with OT-I or OT-II T cells at a ratio of 1:10 for 3 days. 3H-thymidine ([3H] TdR) was added for the last 8 h to measure [3H] TdR incorporation by OT-I or OT-II T cells. The production of IL-2 and IFN ^ by OT-I or IL-2 production by OT-II T cells was also measured as readouts. Figs.6B-6C, sort-purified cDC1 were pulsed with OVA in medium containing all 20 common amino acids (+AA) or medium lacking an individual amino acid as indicated, irradiated and then cocultured with OT-I (Fig. 6B) or OT-II (Fig.6C) T cells at a ratio of 1:10 for 3 days. Fig.6B, IL-2 (left) and IFN ^ (right) production by OT-I T cells was measured (n = 4 each group). Fig. 6C, IL-2 production by OT-II T cells was measured (n = 4 each group). Fold change (+AA versus ^Gln) was indicated with arrow. Figs.6D- 6E, cDC2 were pulsed with OVA protein in medium with 20 common AA or medium without an individual AA as indicated, irradiated and then cocultured with OT-I or OT-II T cells for 3 days. [3H] TdR incorporation by OT-I (Fig. 6D) or OT-II (Fig. 6E) T cells was measured (n = 4 each group). Fold change (+AA versus ^Gln) was indicated with arrow. Fig. 6F, sort-purified cDC1 (left, CD24high) and cDC2 (right, CD24low) FLT3L-BMDCs were pulsed with OVA protein in medium with or without Gln, and then cocultured with OT-I (first and third panels) or OT-II (second and fourth panels) T cells for 3 days. [3H] TdR incorporation by OT-I or OT-II T cells was measured (n = 5 each group). Fig. 6G, schematic of functional amino acid screening assay with AA-free medium supplemented with an individual AA used in Figs. 6H, 6I. Sort-purified splenic cDC1 or cDC2 were pulsed with OVA protein in AA-free medium supplemented with an individual amino acid for 2 h, irradiated and then cocultured with OT-I or OT-II T cells for 3 days. [3H] TdR was added for the last 8 h to measure [3H] TdR incorporation. Figs.6H-6I, cDC1 (Fig. 6H) or cDC2 (Fig.6I) were pulsed with OVA protein in AA-free medium supplemented with an 15 168222090v1 Attorney Docket No.243734.000197 individual amino acid as indicated, irradiated and then cocultured with OT-I or OT-II T cells for 3 days. [3H] TdR incorporation by OT-I (left) or OT-II (right) T cells was measured (n = 4 each group). Fold change (+Gln versus ^AA) was indicated with an arrow. Fig. 6J, MC38 cells were cultured in RPMI 1640 medium supplemented with 10% (v/v) dialyzed FBS and 0.6 mM Gln for 48 h. Cell culture supernatants were collected and levels of amino acids were quantified by mass spectrometry. Relative changes of amino acid levels compared to fresh medium were shown (n = 3 per group). Gln is indicated by the red bar. Fig.6K, effect of MC38 supernatant on the priming function of cDC1. cDC1 were pulsed with OVA protein and culture supernatant derived from MC38 cells cultured in Gln-free medium supplemented with various concentrations (0.3, 0.6 or 2 mM) of Gln for 2 h. The cDC1 were then irradiated and cocultured with OT-II T cells. [3H] TdR incorporation by OT-II T cells was measured 3 days later (n = 4 each group). Fig. 6L, effect of individual amino acid supplementation in MC38 supernatant on the priming capacity of cDC1. cDC1 were pulsed with OVA protein in MC38 supernatant supplemented with an individual amino acid as indicated, irradiated, and then cocultured with OT-II T cells. [3H] TdR incorporation by OT-II T cells was measured 3 days later (n = 4 each group). Fig. 6M, sort-purified cDC1 were cultured in fresh medium, MC38 supernatant, or MC38 supernatant supplemented with 0.6 mM Gln for 2 h. Intracellular Gln abundance in cDC1 was quantified by mass spectrometry. Fig.6N, B16F10 cells were cultured in RPMI 1640 medium supplemented with 10% (v/v) dialyzed FBS and 0.6 mM Gln for 48 h. Cell culture supernatants were collected and levels of amino acids were quantified by mass spectrometry. Relative changes of amino acid levels compared to fresh medium were shown (n = 3 per group). Fig.6O, sort-purified cDC1 were pulsed with OVA protein in fresh medium, B16F10 supernatant (B16 supernatant), or B16 supernatant supplemented with Gln (B16 supernatant + Gln), and then cocultured with OT-I T cells. [3H] TdR incorporation by OT-I T cells was measured 3 days later (n = 4 each group). Fig.6P, cDC1 were incubated with fresh medium, MC38 supernatant, Supernatant + Gln or Gln-free medium overnight (n = 6 each group). Quantification of the mean fluorescence intensity (MFI) of CD86 and MHC-II on cDC1. Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; two- tailed unpaired Student’s t-test (Figs.6F, 6K) or one-way ANOVA (Figs.6M, 6O, 6P). Data are representative of one (Figs.6J, 6M, 6N), two (Fig.6F) or at least three (Figs.6B-6E, 6H, 6I, 6K, 6L, 6O) independent experiments; or pooled from three (Fig.6P) independent experiments. 16 168222090v1 Attorney Docket No.243734.000197 [0031] Figs. 7A-7I depict that SLC38A2 deficiency in tumor cells promotes anti-tumor immunity. Fig. 7A, expression of glutamine transporters Slc1a5, Slc6a19, Slc38a1, Slc38a2, Slc38a3 and Slc38a5 in murine tumor cells, DCs and CD8+ T cells from publicly available mouse scRNA-seq dataset (GSE121861)40, which profiled six syngeneic tumor models including B16F10 melanoma, EMT6 breast mammary carcinoma, LL2 Lewis lung carcinoma, CT26 colon carcinoma, MC38 colon carcinoma and Sa1N fibrosarcoma. Specifically, tumor cells and CD45+ immune cells from different mouse tumor models are pooled for analysis in GSE121861. Fig.7B, real-time PCR analysis of glutamine transporters mRNA levels in MC38 cells and cDC1 (n = 3 each group). Fig.7C, WT mice were inoculated with B16-FLT3L tumor cells, and euthanized at day 15 after tumor inoculation. Intratumoral cDC1, CD8+ T and tumor cells were sort-purified, and SLC38A2 expression was analyzed by immunoblot. ^-Actin was used as loading control. Molecular weights are indicated in kilodaltons (kDa). Fig. 7D, Cas9-expressing MC38 (MC38- Cas9) cells were transduced with sgRNA targeting Slc38a2 (sgSlc38a2) or non-targeting control (sgNTC) sgRNA. Cells were incubated with medium containing 2 mM 13C-glutamine for 10 min, and intracellular 13C-glutamine level was quantified using mass spectrometry (n = 4 each group). Fig.7E, quantification of intracellular glutamine level of sgNTC- or sgSlc38a2-transduced MC38- Cas9 cells (n = 4 each group) using mass spectrometry. Fig.7F, Cas9-expressing B16-OVA (B16- OVA-Cas9) cells were transduced with sgSlc38a2 or sgNTC. Immunoblot analysis of SLC38A2. ^-Actin was used as loading control. Molecular weights are indicated in kDa. Fig. 7G, tumor growth curves in wild-type (WT) mice inoculated with sgNTC- or sgSlc38a2-transduced B16- OVA-Cas9 cells (1 × 106 cells per mouse; n = 7 for sgNTC group; 9 for sgSlc38a2 group). Fig. 7H, WT mice were inoculated with sgNTC- or sgSlc38a2-transduced MC38 cells that expressed Cas9 (MC38-Cas9; n = 7 each group), and euthanized at day 15 after tumor inoculation. Quantification of the frequencies of intratumoral CD8+, CD4+Foxp3− conventional T or CD4+Foxp3+ Treg cells. Fig.7I, tumor growth curves in Rag1−/− mice inoculated with sgNTC- or sgSlc38a2-transduced MC38-Cas9 cells (n = 14 each group). Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ****P < 0.0001; two-tailed unpaired Student’s t-test (Figs.7B, 7D, 7E, 7H) or two-way ANOVA (Figs. 7G, 7I). Data are representative of one (Figs. 7B, 7C, 7F) or two (Fig.7D, 7E, 7G-7I) independent experiments. [0032] Figs. 8A-8G depict characterization of DC and T cell phenotypes in Slc38a2ΔDC mice. Fig.8A, real-time PCR analysis of Slc38a2 mRNA level in splenic cDC1, cDC2, CD4+ T, CD8+ 17 168222090v1 Attorney Docket No.243734.000197 T and B cells from WT and Slc38a2ΔDC mice (n = 4 per genotype). Fig.8B, cDC1 and cDC2 were sort-purified from WT and Slc38a2ΔDC mice. Cells were incubated with medium containing 2 mM 13C-glutamine for 10 min, and intracellular 13C-glutamine level was quantified using mass spectrometry (cDC1, n = 5 per genotype; cDC2, n = 6 for WT and 4 for Slc38a2ΔDC). Fig. 8C, quantification of the frequencies (left) and numbers (right) of cDCs and plasmacytoid DCs (pDCs) in the spleen of WT (n = 6) and Slc38a2ΔDC (n = 4) mice. Fig.8D, flow cytometry analysis (left) and quantification of the frequencies (middle) and numbers (right) of cDC1 and cDC2 in the spleen of WT (n = 6) and Slc38a2ΔDC (n = 4) mice. Fig. 8E, flow cytometry analysis (left) and quantification of the frequencies of CD4+ (middle) and CD8+ (right) T cells in the spleen, peripheral lymph nodes (PLN) or mesenteric lymph nodes (MLN) of WT (n = 6) and Slc38a2ΔDC (n = 4) mice. Fig. 8F, flow cytometry analysis (left) and quantification of the frequencies of CD44highCD62Llow effector/memory cells among CD4+ (middle) and CD8+ (right) T cells in the spleen, PLN or MLN from WT (n = 6) and Slc38a2ΔDC (n = 4) mice. Fig. 8G, splenocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h. Flow cytometry analysis of CD44+IFN ^+ (left) and quantification of the frequencies of cytokine (IFN ^, IL-2, IL-4 or IL- 17A)-producing cells among CD4+ (middle) and CD8+ T cells (right) from the spleen of WT (n = 6) and Slc38a2ΔDC (n = 4) mice. Fig. 8H, cDC2 were sort-purified from the spleen of WT and Slc38a2ΔDC mice (n = 8 per genotype), and then pulsed with OVA protein, washed and cocultured with OT-I or OT-II T cells for 3 days. [3H] TdR incorporation by OT-I (left) and OT-II (right) T cells was measured. Fig. 8I, sort-purified cDC1 from WT and Slc38a2ΔDC mice (n = 6 per genotype) were pulsed with OVA, washed and then cocultured with OT-I or OT-II T cells for 3 days. IL-2 (left) and IFN ^ (middle) production by OT-I, and IL-2 production by OT-II T cells (right) were measured. Fig.8J, cDC2 were sort-purified from the spleen of WT and Slc38a2ΔDC mice (n = 6 per genotype), and then pulsed with OVA protein, washed and cocultured with OT-I or OT-II T cells for 3 days. IL-2 production by OT-I (left) and OT-II (right) T cells was measured. Data are means ± s.e.m. NS, not significant; ***P < 0.001; ****P < 0.0001; two-tailed unpaired Student’s t-test (Figs.8A, 8C-8J) or one-way ANOVA (Fig.8B). Data are representative of two (Figs.8A, 8B) or three (Figs.8H-8J) independent experiments or pooled from two (Figs.8C-8G) independent experiments. Numbers indicate percentages of cells in gates or quadrants (Figs.8D- 8G). 18 168222090v1 Attorney Docket No.243734.000197 [0033] Figs. 9A-9E depict that SLC38A2 deficiency in DCs impairs anti-tumor adaptive immune responses. Fig.9A, tumor growth curves in wild-type (WT) (n = 9) and Slc38a2ΔDC (n = 11) mice inoculated with B16-OVA cells. Figs.9B-9C, WT (n = 8) and Slc38a2ΔDC (n = 9) mice were inoculated with MC38 cells, and euthanized at day 15 after tumor inoculation. Quantification of the frequencies (left) and numbers (right) of intratumoral CD8+, CD4+Foxp3− conventional T and CD4+Foxp3+ Treg cells (Fig.9B). Intratumoral lymphocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h. Quantification of the frequencies of IFN ^+ (left) or Granzyme B+ (right) cells among intratumoral CD8+ T cells (Fig.9C). Fig.9D, WT mice were inoculated with B16-OVA cells. Activated Cas9-expressing OT-I T cells were transduced with Slc38a2-targeting (sgSlc38a2) or non-targeting control (sgNTC) sgRNA, sorted and adoptively transferred into mice (4 × 106 cells per mouse) at day 12 after tumor inoculation (n = 4 for sgNTC; 3 for sgSlc38a2; transfer indicated by an arrow). PBS was injected into non-transfer control mice (n = 3). Tumor growth was measured. Fig.9E, tumor growth curves in WT and Cd4CreSlc38a2fl/fl mice (n = 7 per genotype) inoculated with MC38 cells. Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; two-tailed unpaired Student’s t-test (Figs. 9B, 9C) or two-way ANOVA (Figs.9A, 9D, 9E). Data are representative of two (Figs.9A-9E) independent experiments. [0034] Figs.10A-10B depict effects of glutamine availability on GATOR1/2 complex assembly and GATOR1–GATOR2 interaction. Figs. 10A, 10B, HEK293T cells were maintained in glutamine (Gln)-sufficient medium (no starvation), or starved of Gln (−Gln) for 3 h, followed by refeeding with Gln for 15 min (Gln add-back). Immunoprecipitation (IP) was performed using anti-DEPDC5 (component of GATOR1) (Fig. 10A) or anti-WDR24 (component of GATOR2) (Fig.10B) antibody. The immunoprecipitated proteins were analyzed by immunoblot as indicated. Molecular weights were indicated in kilodaltons (kDa). Data are representative of two (Figs.10A, 10B) independent experiments. [0035] Figs.11A-11K depict that FLCN deficiency in DCs impairs anti-tumor immunity. Fig. 11A, real-time PCR analysis of Flcn mRNA level in cDC1, cDC2, CD4+ T, CD8+ T and B cells from WT and FlcnΔDC mice (n = 4 per genotype for cDC1 and cDC2; 2 per genotype for other cell types). Fig.11B, splenic cDC1 were sort-purified from WT and FlcnΔDC mice (n = 6 per genotype), and then pulsed with OVA protein, washed and cocultured with OT-I T cells at a ratio of 1:10 for 3 days. IL-2 (left) and IFN ^ (right) production by OT-I T cells was measured. Fig. 11C, cDC2 were sorted from the spleen of WT and FlcnΔDC mice (n = 6 per genotype), and then pulsed with 19 168222090v1 Attorney Docket No.243734.000197 OVA protein, washed and cocultured with OT-II T cells at a ratio of 1:10 for 3 days. IL-2 production by OT-II T cells was measured. Fig.11D, WT (n = 6) and FlcnΔDC (n = 5) mice were inoculated with MC38 cells as in Fig.3f. Tumor weight at endpoint (day 20) was measured. Fig. 11E, tumor growth curves in WT (n = 7) and FlcnΔDC (n = 4) mice inoculated with B16-OVA cells. Fig. 11F, tumor growth curves in WT or FlcnΔDC complete chimaeras or Batf3−/−:WT and Batf3−/−:FlcnΔDC mixed chimaeras (n = 8 for Batf3−/−:WT chimaeras; 6 for other chimaeras) inoculated with MC38 cells. Fig.11G, cDC1 and cDC2 were sort-purified from the spleen of WT and FlcnΔDC mice (n = 6 per genotype), and then pulsed with OVA protein in Gln-sufficient (+Gln) or Gln-free (−Gln) medium, washed and cocultured with OT-I and OT-II T cells, respectively, at a ratio of 1:10 for 3 days. [3H] thymidine ([3H] TdR) incorporation by OT-I (left) and OT-II (right) T cells was measured. Figs. 11H-11J, WT and FlcnΔDC mice were inoculated with MC38 cells, and euthanized at day 15 after tumor inoculation. Intratumoral CD45+ cells and DCs (CD45+CD64−CD11c+MHC-II+) were sorted and mixed at a ratio of 2:1, followed by scRNA-seq analysis (n = 2 biological replicates per genotype). UMAP (Uniform Manifold Approximation and Projection) plots of cells indicated by cell subclusters (Fig. 11H) and genotypes (Fig. 11I). Quantification of the frequencies of CD8+ T cells, CD4+Foxp3− conventional T cells, monocytes/macrophages (Mo/Mac), NK cells and Treg cells among non-DC CD45+ cells in scRNA-seq (Fig. 11J). Fig. 11K, GSEA enrichment plot showing downregulated antigen processing and presentation pathway in intratumoral cDC1 from FlcnΔDC mice versus WT mice (profiled by scRNA-seq analysis). FDR, false discovery rate; NES, normalized enrichment score. Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; two-tailed unpaired Student’s t-test (Figs. 11A-11D), one-way ANOVA or two-way ANOVA (Figs. 11E, 11F. Data are representative of one (Fig. 11F), two (Fig. 11A) or at least three (Figs.11B-11E, 11G) independent experiments. [0036] Figs. 12A-12G depict that FLCN deficiency in DCs impairs the effector function of cytotoxic CD8+ T cells in the TME. Figs.11A-12B, Wild-type (WT) (n = 6) and FlcnΔDC (n = 7) mice were inoculated with MC38 cells, and then euthanized at day 15 after tumor inoculation. Flow cytometry analysis (left) and quantification (right) of CD44 (Fig.12A) and CD69 (Fig.12B) expression on intratumoral CD8+ T cells. MFI, mean fluorescence intensity. Fig.12C, WT (n = 6) and FlcnΔDC (n = 8) mice were inoculated with MC38 cells, and then euthanized at day 15 after tumor inoculation. Quantification of the frequency (left) and number (right) of PD-1+ cells among 20 168222090v1 Attorney Docket No.243734.000197 intratumoral CD8+ T cells. Fig. 12D, flow cytometry analysis (left) and quantification of the frequencies (middle) and numbers (right) of effector-like (CD39+Ly108− or TIM-3+TCF1−) and stem-like (CD39−Ly108+ or TIM-3−TCF1+) CD8+ T cells in MC38 tumors from WT (n = 6) and FlcnΔDC (n = 8) mice. Fig.12E, flow cytometry analysis (left) and quantification (right) of the MFI intratumoral CD8+ T cells from WT (n = 6) and FlcnΔDC (n = 8) mice. Fig.12F, flow analysis (left) and quantification of the frequency (right) of Ki67+ cells among intratumoral CD8+ T cells from WT (n = 8) and FlcnΔDC (n = 8) mice. Fig.12G, quantification of the numbers of IFN ^+ (left), TNF ^+ (middle) or Granzyme B+ (right) CD8+ T cells in tumors from WT (n = 6) and FlcnΔDC (n = 8) mice (frequency data are described in Fig.3R). Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; two-tailed unpaired Student’s t- test (Figs.12A-12G). Data are representative of two (Figs.12B, 12E, 12F) or at least three (Figs. 12A, 12C, 12D, 12G) independent experiments. Numbers indicate MFI (Figs.12A, 12B, 12E) or percentages of cells in gates (Figs.12D, 12F). [0037] Figs. 13A-13J depict that FLCN-deficient cDC1 show enhanced lysosomal activation, which is rescued by TFEB co-deletion. Fig. 13A, principal component analysis (PCA) plot of ATAC-seq data for WT and FLCN-deficient cDC1 with the percentage of variance shown. Figs. 13B-13C, GSEA of transcriptome analysis of FLCN-deficient versus WT cDC1 using KEGG pathway (Fig.13B) and Hallmark gene sets combined with putative TFEB target genes (derived from a public dataset that identified TFEB targets by integrating TFEB ChIP-seq analysis and TFEB overexpression52) (Fig.13C). The false discovery rate (FDR) and normalized enrichment score (NES) of the top pathways (ranked by NES) were visualized. Fig.13D, splenic cDC1 were sort-purified from WT and FlcnΔDC mice (n = 2 per genotype). TFEB protein expression in cytosolic and nuclear fractions was analyzed by immunoblot analysis. The protein levels of cytosolic or nuclear TFEB were normalized to GAPDH or Lamin B1, respectively. Numbers indicate the abundance of cytosolic or nuclear TFEB protein relative to that of WT. Molecular weights were indicated in kilodaltons (kDa). Fig. 13E, flow cytometry analysis (left) and quantification (right) of Lysotracker staining in splenic cDC1 from WT (n = 7) and FlcnΔDC (n = 7) mice. MFI, mean fluorescence intensity. Fig.13F, heatmap showing expression of the top 20 leading-edge genes from GSEA using KEGG lysosome pathway (shown in 13B) in splenic cDC1 from WT (n = 2) and FlcnΔDC (n = 3) mice. Fig. 13G, immunoblot analysis of Cathepsin D (pro and mature forms) expression in cDC1 from WT and FlcnΔDC mice. ^-Tubulin was used as loading 21 168222090v1 Attorney Docket No.243734.000197 control. Molecular weights were indicated in kDa. Fig.13H, accessibility of the Ctsd gene and its upstream regions in WT and FLCN-deficient cDC1 assessed by ATAC-seq. Fig. 13I, flow cytometry analysis (left) and quantification (right) of Lysotracker staining in splenic cDC1 from WT (n = 7), FlcnΔDC (n = 4), TfebΔDC (n = 5) and Flcn/TfebΔDC (n = 4) mice. Fig. 13J, splenic cDC1 were sort-purified from WT, FlcnΔDC, TfebΔDC and Flcn/TfebΔDC mice (n = 6 per genotype) and pulsed with OVA protein, followed by coculture with OT-I T cells at a ratio of 1:10 for 3 days. IL-2 (left) and IFN ^ (right) production by OT-I T cells was measured. Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ****P < 0.0001; two-tailed unpaired Student’s t-test (Fig. 13E) or one-way ANOVA (Figs.13I, 13J). Data are representative of two (Figs.13D, 13G), three (Fig.13J) or pooled from three (Figs.13E, 13I) independent experiments. Numbers indicate MFI (Figs.13E, 13I). [0038] Figs.14A-14H depict roles of the FLCN–TFEB signaling axis in mediating anti-tumor immunity and glutamine availability. Fig.14A, WT (n = 9), FlcnΔDC (n = 7), TfebΔDC (n = 9) and Flcn/TfebΔDC (n = 7) mice were inoculated with MC38 cells as in Fig. 4H. Tumor weights at endpoint (day 22) were measured. Fig. 14B, tumor growth curves in WT (n = 11), FlcnΔDC (n = 11), TfebΔDC (n = 8) and Flcn/TfebΔDC (n = 8) mice inoculated with B16-OVA cells. Figs. 14C- 14D, WT (n = 8), FlcnΔDC (n = 7), TfebΔDC (n = 6) and Flcn/TfebΔDC (n = 7) mice were inoculated with MC38 cells, and euthanized at day 15 after tumor inoculation. Quantification of the frequencies (left) and numbers (right) of intratumoral CD4+ T and CD8+ T cells (Fig. 14C). Intratumoral lymphocytes were stimulated with PMA and ionomycin in the presence of monensin for 4 h. Flow cytometry analysis (left) and quantification of the frequencies (right) of IFN ^+ (upper), TNF ^+ (middle) and Granzyme B+ (lower) cells among intratumoral CD8+ T cells (Fig. 14D). Fig. 14E, venn diagram showing the overlap of putative TFEB target genes52 and significantly upregulated genes in FLCN-deficient (versus WT) cDC1, with the 26 overlapped genes shown. Fig. 14F, GSEA plot depicting the enrichment of the gene set containing the 26 overlapped genes identified in Fig.14E, in cDC1 treated with glutamine (Gln)-free medium versus complete medium. Fig. 14G, heatmap showing expression of the leading-edge genes from Fig. 14F in cDC1 treated with Gln-free medium and complete medium (n = 4 per group). Fig. 14H, schematic of glutamine intercellular crosstalk between cDC1 and tumor cells, and nutrient signaling in cDC1 in modulating anti-tumor immunity. cDC1 and tumor cells both express the glutamine transporter SLC38A2 to mediate glutamine uptake, with tumor cells expressing higher 22 168222090v1 Attorney Docket No.243734.000197 level of SLC38A2 than cDC1. Deficiency of SLC38A2 in tumors reduces tumor growth by impinging upon anti-tumor immunity, while its deletion in cDC1 impairs anti-tumor responses (not depicted). In cDC1, glutamine induces FLCN–FNIP2 complex assembly and inhibits TFEB activity to promote the cross-presentation capacity of cDC1. Consequently, glutamine-dependent signaling in cDC1 enhances cytokine production and generation of cytotoxic effector-like CD8+ T cells in the TME. Data are means ± s.e.m. NS, not significant; *P < 0.05; **P < 0.01; ***P < 0.001; one-way ANOVA (Figs. 14A, 14C, 14D) or two-way ANOVA (Fig. 14B). Data are representative of two (Figs.14A-14D) independent experiments. Numbers indicate percentages of cells in gates (Fig.14D). DETAILED DESCRIPTION [0039] Cancer cells evade T-cell-mediated killing through complex yet poorly understood mechanisms of tumor-immune interactions1,2. T-cell priming and therapeutic efficacy depend upon dendritic cells (DCs), with type-1 conventional DCs (cDC1) mediating anti-tumor immunity3. Despite emphasis on DC signaling via pattern recognition receptors (PRRs)3-5, how DCs are shaped by other environmental cues remains incompletely defined. Nutrients are emerging as mediators of adaptive immunity6-9, but the extent to which nutrients impact DC function or innate- adaptive cell communication is largely unresolved. Here, glutamine is identified as an intercellular metabolic checkpoint that mediates tumor-cDC1 crosstalk by licensing the functionality of cDC1 in activating cytotoxic T cells. While multiple nutrients are depleted in tumor microenvironment (TME), intratumoral glutamine supplementation alone markedly inhibits tumor growth by augmenting cDC1-mediated CD8+ T-cell immunity, and overcomes therapeutic resistance to checkpoint blockade and T-cell-mediated immunotherapies. In unbiased nutrient screening assays, glutamine is the dominant amino acid to promote cDC1 function; accordingly, single-cell RNA- sequencing (scRNA-seq) analysis reveals elevated conventional DC functional capacity in glutamine-supplemented tumors. Importantly, the beneficial anti-tumor effect of glutamine supplementation is blunted upon depletion of cDC1 or lymphocytes, revealing immune-mediated, tumor-extrinsic rather than tumor-intrinsic effects. Mechanistically, tumor cells and cDC1 compete for glutamine uptake via transporter SLC38A2. Indeed, loss of SLC38A2 in tumor cells and cDC1 enhances and dampens anti-tumor immunity, respectively. Furthermore, in cDC1, glutamine induces nutrient-dependent intracellular signaling via folliculin (FLCN) to impinge upon transcription factor EB (TFEB) function. Ablation of FLCN in DCs selectively impairs 23 168222090v1 Attorney Docket No.243734.000197 cDC1, but not type-2 conventional dendritic cells (cDC2), function in vivo in a TFEB-dependent manner, and phenocopies SLC38A2 deficiency by abrogating the therapeutic effect of glutamine supplementation. The findings discussed herein demonstrate glutamine-mediated intercellular metabolic crosstalk between tumor cells and cDC1 that underpins tumor immunoevasion, and reveal glutamine acquisition and signaling in cDC1 as limiting events and non-canonical signals for DC activation and putative targets for cancer treatment. [0040] Conventional DCs (cDCs) are generally divided into two functionally specialized subsets. cDC1 preferentially promote the priming of CD8+ cytotoxic T cells, whereas cDC2 are superior at CD4+ T-cell priming4, 5. cDC1 are involved in anti-tumor immunity, as they cross- present tumor-associated antigens to cytotoxic CD8+ T cells and promote their expansion and effector function within tumors. As such, cDC1 function is associated with immune-mediated tumor rejection and the success of immune checkpoint blockade (ICB) and adoptive T-cell therapies (ACT)19-22. However, the immunosuppressive microenvironment in tumors can contribute to immunoevasion via impairing the functional activity of DCs3, which may be mediated by dysregulated abundance or sensing of local environmental cues. Although different receptor systems such as PRRs sense environmental signals to orchestrate functional specification of DC subsets3-5, the roles of nutrients and metabolites in this process are largely unresolved, especially compared to lymphocytes6. Uncovering mechanisms mediating DC function or dysfunction in the TME may be important for designing effective cancer immunotherapy. [0041] The present invention is based, in part, on identifying glutamine as a limiting factor and important driver for the activation and function of cDC1 in anti-tumor immunity, and the underlying mechanisms for glutamine acquisition and signaling. It was found herein that glutamine abundance is highly depleted in the TME and tumor cell culture supernatants, and glutamine supplementation alone in vivo or in vitro is sufficient to restore the functionality of cDC1 for CD8+ T-cell priming. Importantly, the therapeutic anti-tumor effect of glutamine supplementation is abrogated in mice deficient in cDC1 (Batf3–/–) or lymphocytes (Rag1–/–), revealing the exquisite requirement of immune-mediated, tumor cell-extrinsic effect of glutamine in vivo, rather than tumor cell-intrinsic glutamine effect that has been a subject of extensive interest and debate23. Moreover, it was found herein that glutamine supplementation shows pronounced effects at improving the therapeutic efficacies of ICB or ACT, thereby possibly overcoming therapeutic resistance to current immunotherapies, which may have therapeutic implications1, 2. Glutamine 24 168222090v1 Attorney Docket No.243734.000197 transporter SLC38A2 was further revealed herein as an intercellular metabolic checkpoint to dictate glutamine availability to tumor cells and cDC1, and genetic deletion analyses reveal that tumor-expressed SLC38A2 impairs, while DC-expressed SLC38A2 promotes, anti-tumor immunity. It was found herein that mechanistically, intracellular glutamine signaling is integrated by the FLCN–TFEB axis, which shapes the homeostasis and degradative function of lysosomes. Deletion of FLCN in DCs (via CD11c-Cre) or cDC1 selectively (via XCR1-Cre) impairs anti- tumor function and cytotoxic CD8+ T-cell responses, and TFEB co-deletion restores DC function for priming T-cell anti-tumor activity in the TME. Importantly, the beneficial anti-tumor effect of intratumoral glutamine supplementation is blunted upon DC-specific deletion of SLC38A2 or FLCN, thereby linking SLC38A2 and FLCN in coordinating glutamine-dependent effects in DCs in vivo. The results of the present disclosure establish SLC38A2 and FLCN as highly selective drivers for cDC1 in orchestrating anti-tumor immunity, and suggest that manipulation of glutamine uptake and intracellular signaling represents a means to reinforce the functionality of cDC1 for cancer therapy. [0042] It was found herein that intratumoral glutamine supplementation alone markedly suppresses tumor growth, and significantly enhances the efficacy of immune checkpoint blockade (anti-PD-1/PD-L1 treatment) and adoptive T cell transfer therapies. More importantly, it was found herein that genetic deletion of glutamine transporter SLC38A2 in tumor cells significantly reduces tumor growth, indicating glutamine consumption by tumors induces an immunosuppressive microenvironment, and targeting SLC38A2-mediated glutamine uptake in tumor cells represents a promising putative drug target for cancer therapy. [0043] By performing unbiased nutrient screening assays, and single-cell RNA-sequencing (scRNA-seq) analysis of immune infiltrates from glutamine-supplemented tumors, the immune- modulatory effect of glutamine in orchestrating the antigen presentation function of type-1 conventional DCs (cDC1) was revealed herein. Transfer of glutamine-free medium treated cDC1 was less efficient to control tumor growth compared with transfer of glutamine-rich medium treated cDC1. Moreover, it was found herein that conditional deletion of glutamine transporter SLC38A2 in cDC1 promotes tumor growth, establishing the nutrients crosstalk and competition between the tumor and cDC1. Thus, increasing glutamine availability in tumor microenvironment may overcome tumor-induced immunosuppression and enhance the efficacy of DC vaccination. 25 168222090v1 Attorney Docket No.243734.000197 [0044] The intracellular signaling downstream of glutamine was explored herein and it was found that glutamine signals through lysosomal signaling to maintain cDC1 function. It was also found herein that targeting lysosomal signaling in DCs markedly enhances the efficacy of anti- PD-1 treatment, indicating that targeting lysosomal signaling in DCs can be harnessed to achieve more efficient cancer therapies. [0045] Altogether, the findings of the present disclosure establish glutamine-mediated intercellular metabolic crosstalk between tumor cells and DCs that underpins tumor immunoevasion, and reveal glutamine acquisition and signaling in cDC1 as limiting events and non-canonical signals for DC functions and putative targets for cancer treatment. [0046] It was found herein that intratumoral glutamine supplementation not only reduces tumor growth, but also overcomes the resistance to immune checkpoint blockade immunotherapies, which depends on DCs and lymphocytes. Compared with glutamine metabolism inhibitors that mostly target tumor cells, glutamine supplementation may reduce the toxicity induced by these drugs. Also, the efficacy of DC vaccines can be improved by targeting lysosomal signaling to treat cancers and/or boost the efficacy of immunotherapies. Definitions [0047] The terms “T cell” and “T lymphocyte” are interchangeable and used synonymously herein. As used herein, T cell includes thymocytes, naive T lymphocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, or activated T lymphocytes. A T cell can be a T helper (Th) cell, for example a T helper 1 (Thl), a T helper 2 (Th2) cell, a T helper 17 (Th17) or regulatory T (Treg) cell. The T cell can be a T helper cell (Th; CD4+ T cell) CD4+ T cell, a cytotoxic T cell (CTL; CD8+ T cell), a tumor infiltrating cytotoxic T cell (TIL; CD8+ T cell), CD4+CD8+ T cell, or any other subset of T cells. Other illustrative populations of T cells suitable for use in particular embodiments include naive T cells and memory T cells. Also included are “NKT cells”, which refer to a specialized population of T cells that express a semi-invariant αβ T- cell receptor, but also express a variety of molecular markers that are typically associated with NK cells, such as NK1.1. NKT cells include NK1.1+ and NK1.1-, as well as CD4+, CD4-, CD8+ and CD8- cells. The TCR on NKT cells is unique in that it recognizes glycolipid antigens presented by the MHC I-like molecule CD Id. NKT cells can have either protective or deleterious effects due to their abilities to produce cytokines that promote either inflammation or immune tolerance. Also included are “gamma-delta T cells (γδ T cells),” which refer to a specialized population that to a 26 168222090v1 Attorney Docket No.243734.000197 small subset of T cells possessing a distinct TCR on their surface, and unlike the majority of T cells in which the TCR is composed of two glycoprotein chains designated α- and β-TCR chains, the TCR in γδ T cells is made up of a γ-chain and a δ-chain. γδ T cells can play a role in immunosurveillance and immunoregulation, and were found to be an important source of IL-17 and to induce robust CD8+ cytotoxic T cell response. Also included are “regulatory T cells” or “Tregs” refers to T cells that suppress an abnormal or excessive immune response and play a role in immune tolerance. Tregs cells are typically transcription factor Foxp3-positive CD4+ T cells and can also include transcription factor Foxp3-negative regulatory T cells that are IL-10-producing CD4+ T cells. [0048] The terms “dendritic cell” and “DC” as used herein refer to any member of a diverse population of morphologically similar type of immune cell that is found in lymphoid or non- lymphoid tissues and boosts immune responses by showing antigens on its surface to other cells of the immune system. Dendritic cells (DCs) serve a key function in host defense, linking innate detection of pathogens to the activation of pathogen-specific adaptive immune responses (Steinman et al., 2006; Takeuchi et al., 2009). DCs are formed in bone marrow and are present in lymphoid and other tissues specializing in the uptake of particulate material by phagocytosis and acting as antigen-presenting cells in immune responses. Non-limiting examples of dendritic cells include bone marrow-derived dendritic cells (BMDC), plasmacytoid dendritic cells, Langerhans cells, interdigitating cells, veiled cells, and dermal dendritic cells. Dendritic cells are also divided in three major DC subsets: plasmacytoid DC (pDC), myeloid/conventional DC1 (cDC1) and myeloid/conventional DC2 (cDC2). [0049] The terms “treat” or “treatment” of a state, disorder or condition include: (1) preventing, delaying, or reducing the incidence and/or likelihood of the appearance of at least one clinical or sub-clinical symptom of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition, but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof or at least one clinical or sub-clinical symptom thereof; or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms. The benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician. 27 168222090v1 Attorney Docket No.243734.000197 [0050] The term “effective” applied to dose or amount refers to that quantity of a compound or pharmaceutical composition that is sufficient to result in a desired activity upon administration to a subject in need thereof. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular drug or drugs employed, the mode of administration, and the like. [0051] The phrase “pharmaceutically acceptable”, as used in connection with compositions described herein, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., a human). Preferably, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans. [0052] The terms “patient”, “individual”, “subject”, and “animal” are used interchangeably herein and refer to mammals, including, without limitation, human and veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.) and experimental animal models. In a preferred embodiment, the subject is a human. [0053] Singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to “a method” includes one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure. [0054] The term “about” or “approximately” includes being within a statistically meaningful range of a value. Such a range can be within an order of magnitude, preferably within 50%, more preferably within 20%, still more preferably within 10%, and even more preferably within 5% of a given value or range. The allowable variation encompassed by the term “about” or “approximately” depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art. [0055] The term “glutamine” includes glutamine, also known as glutamic acid 5-amide, and hydrolyzable derivatives thereof, such as esters and/or amides of glutamine that yield glutamine in the body of a mammal, as well as pharmaceutically acceptable salts of glutamine. Non-limiting 28 168222090v1 Attorney Docket No.243734.000197 examples of useful pharmaceutically acceptable salts of glutamine include, e.g., the acid addition salts of amines, such as hydrochlorides, tartrates, acetates, citrates, and the like, and carboxylate salts, such as potassium and sodium salts. When a salt or hydrolyzable derivative of glutamine is used, the weight of glutamine or weight ratio of glutamine to other components, refers to the weight of the glutamine portion of a hydrolyzable glutamine derivative, or the weight of the glutamine portion of a salt of glutamine. [0056] The practice of the present invention employs, unless otherwise indicated, conventional techniques of statistical analysis, molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such tools and techniques are described in detail in e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual.3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York; Ausubel et al. eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Bonifacino et al. eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, NJ; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, NJ; Coligan et al. eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, NJ; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, NJ. Additional techniques are explained, e.g., in U.S. Patent No. 7,912,698 and U.S. Patent Appl. Pub. Nos. 2011/0202322 and 2011/0307437. Glutamine [0057] In various embodiments of the present disclosure, glutamine is administered to a subject. In certain embodiments, glutamine is administered in combination with an anti-tumor immunotherapy or an anti-cancer immunotherapy. In certain embodiments, the immunotherapy and glutamine are administered simultaneously. In certain embodiments, the immunotherapy and glutamine are administered sequentially in any order. In certain embodiments, glutamine is administered in combination with inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject. In certain embodiments, glutamine is administered in combination with inhibiting lysosomal signaling pathway in DCs of the subject. In certain embodiments, glutamine is administered in combination with an effective amount of DCs, wherein said DCs have been pre- incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal 29 168222090v1 Attorney Docket No.243734.000197 signaling inhibitors. In certain embodiments, glutamine is administered in combinations with an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors and with an effective amount of an anti-cancer immunotherapy. In certain embodiments, glutamine is administered in combination with an effective amount of an anti-cancer immunotherapy and with inhibiting lysosomal signaling pathway in DCs of the subject. In certain embodiments, glutamine is administered in combination with an effective amount of an anti-cancer immunotherapy and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. In certain embodiments, glutamine is administered in combination with an effective amount of an anti-cancer immunotherapy, an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors and with inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject. In certain embodiments, glutamine is administered in combination with an effective amount of an anti-cancer immunotherapy, an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors, with inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject, and with comprising inhibiting lysosomal signaling pathway in DCs of the subject. [0058] In certain embodiments, one or more of glutamine, inhibitors, and/or immunotherapies of the invention can be formulated as one or more pharmaceutical compositions and administered to a subject, such as a human patient, in a variety of forms adapted to the chosen route(s) of administration. Non-limiting examples of useful routes of administration include, e.g., intratumoral, peritumoral, intravenous, parenteral, topical, transdermal, enteral, oral, intramuscular, subcutaneous, intraperitoneal (e.g., by infusion or injection), or by direct administration to the gastrointestinal tract (e.g., by enema or suppository). In certain embodiments, the administration is intratumoral or peritumoral. [0059] In certain embodiments, the amount of glutamine administered to the subject can be, but is not limited to, at least 0.5 mg/day/kg body mass of the subject or 0.2 to 3.0 g/day/kg body mass. In certain embodiments, glutamine can be administered to the subject, e.g., one or two times per day. 30 168222090v1 Attorney Docket No.243734.000197 [0060] In certain embodiments, solutions of glutamine or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. In certain embodiments, dispersions can be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. [0061] In certain non-limiting embodiments, administering glutamine comprises administering a composition comprising about 5-15% w/w glutamine, 30-50% w/w carbohydrate carriers, including a disaccharide, a sugar alcohol or polyol, and glycerin, with the remainder of dry solids comprising, for example, an effective amount of a buffer, or buffering compound, modified cellulose, and optionally comprising stabilizers and emulsifiers, excipients/stabilizing agents (e.g., L-arginine), preservatives, defoamants, and flavoring. In certain embodiments, the disaccharide can be, but is not limited to, sucrose. In certain embodiments, the polyol can be, but is not limited to, sorbitol. In certain embodiments, the buffer or buffering compound can be, but is not limited to, anhydrous monobasic sodium phosphate. In certain embodiments, the modified cellulose can be, but is not limited to, Avicel® Cellulose Gel. In certain embodiments, the stabilizers and emulsifiers can be, but is not limited to, xanthan gum and/or carrageenan. In certain embodiments, the preservative can be, but is not limited to, methylparaben and/or potassium sorbate. In certain embodiments, the defoamant can be, but is not limited to, simethicone. [0062] In certain embodiments, glutamine can be administered as a liquid composition. In certain embodiments, the liquid composition comprises 5-25% w/v L-glutamine, 20-40% w/v carbohydrate carrier, including a disaccharide, a sugar alcohol, and glycerin, 5-10% w/v citric acid, and an effective amount of buffer, and the remainder water or alcohol-water. The liquid composition can optionally comprise stabilizers, preservatives, emulsifiers and flavorings. In certain embodiments, the effective amount of buffer can comprise 0.4-0.8% sodium phosphate. [0063] In certain embodiments, the use of a carbohydrate carrier in the composition can increase the cellular absorption of the amino acid by at least ten times over direct administration of the amino acid in water. In certain embodiments, glutamine can be administered as an aqueous composition comprising 38% w/v L-glutamine, 30% w/v sucrose, and 2.8% w/v sorbitol. [0064] In certain embodiments, excipients can also be added to the glutamine composition, provided that the necessary concentration of carbohydrate carrier is maintained. In certain embodiments, the excipient can be, but is not limited to, a sweetener/solvent, emulsifying and 31 168222090v1 Attorney Docket No.243734.000197 stabilizing agents, preservatives and stabilizers, a defoamant/base ingredient, flavoring, or other ingredients which improve the stability and administration of the composition. In certain embodiments, the sweetener/solvent is glycerin. In certain embodiments, the emulsifying and stabilizing agent can be a cellulose gel, xanthan gum and/or carrageenan. In certain embodiments, the cellulose gel is Avicel® Microcrystalline Cellulose Gel (FMC Corp., Philadelphia, Pa.). In certain embodiments, the preservatives and stabilizers can be citric acid and/or methylparaben. In certain embodiments, the defoamant/base ingredient can be simethicone. [0065] In certain embodiments, the pharmaceutical glutamine dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising glutamine which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. The ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. In certain embodiments, the liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, but not limited to, water, ethanol, a polyol, vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. In certain embodiments, the polyol can be, but is not limited to, glycerol, propylene glycol, liquid polyethylene glycols, and the like. In certain embodiments, the proper fluidity can be maintained by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. In certain embodiments, various antibacterial and antifungal agents can be used to prevent the action of microorganisms. In certain embodiments, the antibacterial and antifungal agents can be, without limitation, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In certain embodiments, isotonic agents can be included, for example, sugars, buffers or sodium chloride. In certain embodiments, agents delaying absorption can be used to achieve prolonged absorption of the injectable glutamine compositions. In certain embodiments, the agents delaying absorption can be, aluminum monostearate and/or gelatin. [0066] In certain embodiments, sterile injectable solutions are prepared by incorporating glutamine in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In certain embodiments, the sterile powders for the glutamine preparation of sterile injectable solutions, are prepared by vacuum drying and the freeze-drying techniques. 32 168222090v1 Attorney Docket No.243734.000197 [0067] In certain embodiments, compositions comprising glutamine may be applied in pure form, e.g., when they are liquids, for topical administration. However, it will generally be desirable to administer them to the skin as compositions or formulations, in combination with a dermatologically acceptable carrier. In certain embodiments, the dermatologically acceptable carrier can be a solid or a liquid. [0068] Solid carriers include, but are not limited to, finely divided solids such as talc, microcrystalline cellulose, clay, alumina, silica and the like. Liquid carriers include, but are not limited to, water, alcohols or glycols or water-alcohol/glycol blends, in which glutamine can be dissolved or dispersed at effective levels. In certain embodiments, glutamine can be dissolved or dispersed with the aid of non-toxic surfactants. In certain embodiments, adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. In certain embodiments, the resultant liquid glutamine compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers. [0069] In certain embodiments, thickeners can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the subject. In certain embodiments, the thickeners can be synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials. [0070] Dermatological compositions which can be used to deliver glutamine to the skin are known to the art. See U.S. Pat. No.4,608,392, U.S. Pat. No.4,992,478, U.S. Pat. No.4,559,157 and U.S. Pat. No. 4,820,508. In certain embodiments, glutamine can be adapted for topical administration to the eye. In certain embodiments, an ophthalmologically acceptable vehicle is employed. In certain embodiments, the ophthalmologically acceptable vehicle can be, but is not limited to, an aqueous vehicle, a gel or an ointment. In certain embodiments, the ophthalmologically acceptable vehicle can be buffered to about pH 5-6 and can also contain preservatives, thickeners and solubilizing agents as needed. In certain embodiments, glutamine is formulated as eye drops. In certain embodiments, the liquid eye drop compositions comprises 0.1% sodium hyaluronate (average molecular weight 1,800,000) or 0.1% Polysorbate 80 by weight to volume in water. In certain embodiments, the liquid glutamine compositions also may contain buffers, isotonic salts, and preservatives such as EDTA and thimerisol. 33 168222090v1 Attorney Docket No.243734.000197 [0071] In certain embodiments, the ophthalmic aqueous glutamine compositions of the invention have ophthalmic ally compatible pH and osmolality. In certain embodiments, these compositions incorporate means to inhibit microbial growth. Such means may include, but are not limited to, preparation and packaging under sterile conditions and/or through inclusion of an antimicrobial effective amount of an ophthalmic acceptable preservative. [0072] In certain embodiments, the glutamine composition is an in situ gellable aqueous composition. In certain embodiments, the glutamine composition is an in situ gellable aqueous solution. Such a glutamine composition comprises a gelling agent in a concentration effective to promote gelling upon contact with the eye or with lacrimal fluid in the exterior of the eye. Examples of gelling agents include, but are not limited to, thermosetting polymers, polycarbophil, and polysaccharides such as gellan, carrageenan (e.g., kappa-carrageenan and iota-carrageenan), chitosan and alginate gums. In certain embodiments, the thermosetting polymer can be tetra- substituted ethylene diamine block copolymers of ethylene oxide and propylene oxide, such as poloxamine 1307. In certain embodiments, the carrageenan can be kappa-carrageenan and/or iota- carrageenan. [0073] The term “in situ gellable” includes liquids of low viscosity, as well as more viscous liquids such as semi-fluid and thixotropic gels. The liquids of low viscosity form gels upon contact with the eye or with lacrimal fluid in the exterior of the eye. The more viscous liquids exhibit substantially increased viscosity or gel stiffness upon administration to the eye. It may be advantageous to formulate the glutamine of the invention as a gel, in order to minimize loss of the glutamine immediately upon administration, as a result for example of lacrimation caused by reflex blinking. Although it is preferred that such a glutamine composition exhibit further increase in viscosity or gel stiffness upon administration, this is not absolutely required if the initial gel is sufficiently resistant to dissipation by lacrimal drainage to provide the effective residence time specified herein. [0074] The glutamine of the invention can also be administered to the eye by an ophthalmic delivery device. For instance, glutamine may be applied to a contact lens before the lens is placed in the eye, or after the contact lens is in the eye. [0075] In any of the glutamine preparations or the present invention, glutamine has a stable shelf-life. The glutamine preparation of the present invention can be provided to the subject well 34 168222090v1 Attorney Docket No.243734.000197 in advance of the time of administration. The glutamine preparations of the present invention can be stored in the clinic or the patient's home for administration as needed. [0076] Pharmaceutically acceptable salts can be obtained using standard procedures well known in the art. Such procedures may include but are not limited to reacting a sufficiently basic compound with a suitable acid affording a physiologically acceptable anion. In certain embodiments, the basic compound can be an amine. Alkali metal or alkaline earth metal salts of carboxylic acids can also be made. In certain embodiments, the alkali metal can be, but is not limited to, sodium, potassium or lithium. In certain embodiments, alkaline earth metal can be, but is not limited to, calcium. [0077] In certain embodiments, glutamine can be formulated for topical administration as ointment, gel or liquid form, including administration by transdermal patches. In certain embodiments, a glutamine preparation can be applied to oral, nasal, and esophageal lesions by oral rinse, a gel, or an ingestible drink. For either oral rinse or ingestible drink, the carbohydrate carrier can be chosen from among a number of monosaccharides, disaccharides, or a combination of both, or from their polymers, such as dextrins, maltodextrins, and high fructose corn syrup products. In certain embodiments, the carbohydrate carriers include sucrose, sorbitol and high fructose corn syrup products. In certain embodiments, either a suspension or a drink can be provided as a dry mixture of carbohydrate carrier and an effective amount of amino acid, for reconstitution with water, juice, or other liquid. In certain embodiments, bulk packaging of the dry mixture or packets containing single applications can be provided to a patient, health care provider, or any individual for whom the delivery of an increased concentration of active agent is desired. The glutamine preparation can be constituted with water, juice, or other liquid before administration to provide for easy administration and increase the absorption of glutamine into the epithelial tissue. In certain embodiments, premixed liquid bulk or unit dosage forms can also be used. [0078] In certain embodiments, application of a glutamine composition having a relatively low concentration of free water can be accomplished by providing a lozenge or a form of candy or other medicated confection, such as a common lollipop, utilizing a suitable carbohydrate carrier, such as sucrose or sorbitol, and a gelling or thickening agent, as needed. In certain embodiments, chewing gum can be used to deliver the carbohydrate carrier, such as sucrose, xylitol, sorbitol, or corn syrup solids, and glutamine. In certain embodiments, the chewing gum can incorporate a central pocket of flavored syrup, composed of the appropriate mixture of carbohydrate carrier, 35 168222090v1 Attorney Docket No.243734.000197 such as xylose, sorbitol, or sucrose, and an effective amount of glutamine. Formulations for preparation of chewing gum with a soft core portion are described in U.S. Pat. No.4,352,823 and U.S. Pat. No.4,352,825. In certain embodiments, a solid solution of glutamine can be used in the preparation of chewing gum, lozenges, or a candy form such as a lollipop. Such solid solutions can be formed from comelts, coprecipitates, or by mechanical activation of the carbohydrate carrier and glutamine. In certain embodiments, the candy or gum is placed in the mouth, where the surrounding fluids dissolve it. In this aqueous environment, the carbohydrate can proved the carrier to facilitate absorption of the glutamine into the epithelial cells of the oral cavity, the esophagus, and the stomach. [0079] In certain embodiments, a toothpaste can also be formed to incorporate a carbohydrate carrier and glutamine. Microencapsulation of ingredients in toothpaste compositions has been described in U.S. Pat. No.4,348,378, U.S. Pat. No.4,071,614, and U.S. Pat. No.3,957,964. [0080] The glutamine of the present invention can also be delivered by suppository to epithelial tissues of the colon and rectum. Methods of preparation of suppository formulations are known in the art. Such method has been described in U.S. Pat. No.4,439,194. In certain embodiments, an enema preparation can also be formed of a carbohydrate carrier and an amino acid, incorporating a sufficient amount of water to form an aqueous solution. In certain embodiments, a solid solution of the biologically active agent in the carbohydrate carrier can also be administered in a suppository or enema, drawing the aqueous component from the colon or rectum. [0081] In certain embodiments, a filled capsule can be used for delivery to the stomach. Such method has been described in U.S. Pat. No. 5,569,466. In certain embodiments, enteric coated capsules or tablets, or enteric coated microparticles can be employed to delivery to the upper or lower intestines. [0082] In certain embodiments, glutamine can be delivered in ice cream formulations. In certain embodiments, glutamine can be delivered in frozen confections such as a popsicle. [0083] In certain embodiments, DCs of the present invention are pre-incubated in a glutamine- sufficient medium. In certain embodiments, glutamine-sufficient medium comprises from about 0.6 mM to about 2 mM glutamine. Inhibitors of lysosomal signaling pathway in dendritic cells (DC) [0084] In one aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting 36 168222090v1 Attorney Docket No.243734.000197 lysosomal signaling pathway in DCs of the subject. In various embodiments, inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of a lysosomal signaling pathway inhibitor. [0085] In another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. [0086] In yet another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and inhibiting lysosomal signaling pathway in DCs of the subject. In various embodiments, inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of a lysosomal signaling pathway inhibitor. [0087] In a further aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. [0088] Non-limiting examples of useful lysosomal signaling pathway inhibitors include, e.g., lysosomal protease inhibitors (e.g., leupeptin and/or pepstatin), vacuolar H+-ATPase inhibitors (e.g., Bafilomycin A1), intravesicular acidification inhibitors (e.g., chloroquine), cysteine protease inhibitors (e.g., E64), Cathepsin B inhibitors (e.g., CA-074), Cathepsin L inhibitors (e.g., Cathepsin L inhibitor III), and any combinations thereof. Immunotherapy [0089] In one aspect, the invention provides a method for inhibiting growth of a tumor in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-tumor immunotherapy. [0090] In another aspect, the invention provides a method for enhancing the efficacy of an anti-cancer immunotherapy in a subject in need thereof, comprising administering to the subject said immunotherapy and an effective amount of glutamine. [0091] In yet another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-cancer immunotherapy. 37 168222090v1 Attorney Docket No.243734.000197 [0092] In certain embodiments of any of the above methods, the immunotherapy and glutamine are administered simultaneously. In certain embodiments of any of the above methods, the immunotherapy and glutamine are administered sequentially in any order. [0093] In another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting SLC38A2-mediated glutamine uptake in cancer cells of the subject, and further comprising administering to the subject an effective amount of an anti-cancer immunotherapy. [0094] In a further aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting lysosomal signaling pathway in dendritic cells (DCs) of the subject, and further comprising administering to the subject an effective amount of an anti-cancer immunotherapy. [0095] In yet another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors, and further comprising administering to the subject an effective amount of an anti-cancer immunotherapy. [0096] In another aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and inhibiting lysosomal signaling pathway in DCs of the subject. [0097] In a further aspect, the invention provides a method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and an effective amount of DCs, wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. [0098] Non-limiting examples of immunotherapies useful in the methods of the invention include, e.g., DC-based therapies, T-cell-mediated therapies, and immune checkpoint blockade therapies. [0099] Non-limiting examples of useful DC-based therapies include, e.g., DC vaccines, adoptive transfer of antigen-loaded or activated DCs, administration of DC-activating factors, administration of DC-mobilizing agents, administration of antigens and/or adjuvants, using DC- specific antibodies to deliver an antigen or adjuvant or nanoparticle, and any combinations thereof. In certain embodiments, the DC-based therapy is selected from DC vaccines, adoptive transfer of 38 168222090v1 Attorney Docket No.243734.000197 antigen-loaded or activated DCs, administration of DC-activating factors, administration of DC- mobilizing agents, administration of antigens and/or adjuvants, using DC-specific antibodies to deliver an antigen or adjuvant or nanoparticle, and any combinations thereof. [00100] In certain embodiments, the DC-based therapy comprises adoptive transfer of antigen- loaded and activated DCs. In certain embodiments, the antigen-loaded and activated DCs are autologous. [00101] In certain embodiments, the DC-based therapy comprises administration of DC- activating factors. In certain embodiments, the DC-activating factor can be, but is not limited to, adjuvants poly (I:C), or CpG. [00102] In certain embodiments, the DC-based therapy comprises administration of DC- mobilizing agents. In certain embodiments, the DC-mobilizing agent can be, but is not limited to, growth factor GM-CSF, or FLT3L. [00103] In certain embodiments, the DC-based therapy comprises administration of antigens and adjuvants. [00104] In certain embodiments, the DC-based therapy comprises using DC-specific antibodies to deliver antigen/adjuvant or nanoparticles. [00105] In certain embodiments, the immunotherapy is a T-cell-mediated therapy. Non-limiting examples of useful T-cell-mediated therapies include, e.g., chimeric antigen receptor (CAR) T cell therapies, adoptive T cell transfer (ACT) therapies (e.g., wherein the transferred T cells are antigen-specific CD8+ T cells), T cell receptor (TCR) T cell therapies, tumor-infiltrating lymphocyte (TIL) therapies, neoantigen cancer vaccines, and any combinations thereof. In certain embodiments, the immunotherapy is a tumor-infiltrating lymphocyte (TIL) therapy. [00106] In certain embodiments, the immunotherapy is an immune checkpoint blockade therapy. Non-limiting examples of useful immune checkpoint blockade therapies include, e.g., anti- programmed death 1 (anti-PD-1) therapies, anti-programmed death ligand 1 (anti-PD-L1) therapies, anti-lymphocyte activation gene-3 (anti-LAG-3) therapies, anti-cytotoxic T-lymphocyte antigen-4 (anti-CTLA-4) therapies, anti-T-cell immunoglobulin and mucin domain 3 (anti-TIM- 3) therapies, and any combinations thereof. [00107] In certain embodiments, the immune checkpoint blockade therapy can be an anti-CTLA- 4 antibody, a functional fragment thereof or a functional equivalent thereof, or any combinations thereof. CTLA-4 (CD152) is a protein receptor that, functioning as an immune checkpoint, 39 168222090v1 Attorney Docket No.243734.000197 downregulates immune responses. In certain embodiments, the anti-CTLA-4 antibody inhibits CTLA-4 activity or function, thereby enhancing immune responses. In certain embodiments, the anti-CTLA-4 antibody can be, but is not limited to, ipilimumab (Bristol-Myers Squibb), tremelimumab (Pfizer; AstraZeneca) or BN-13 (BioXCell). In certain embodiments, the anti- CTLA-4 antibody can be UC10-4F10-11, 9D9 or 9H10 (BioXCell), or a human or humanized counterpart thereof. [00108] In certain embodiments, the immune checkpoint blockade therapy can be a small molecule drug that is an immune response checkpoint inhibitor. As used herein, the terms “immune response checkpoint inhibitor” or “immune checkpoint inhibitor” refer to any molecule that modulates (e.g., inhibits or activates) the activity or function of one or more checkpoint molecules (e.g., proteins). Checkpoint molecules are responsible for costimulatory or inhibitory interactions of T cell responses. Checkpoint molecules regulate and maintain self-tolerance and the duration and amplitude of physiological immune responses. Generally, there are two types of checkpoint molecules: stimulatory checkpoint molecules and inhibitory checkpoint molecules. [00109] Stimulatory checkpoint molecules serve a role in enhancing the immune response. Numerous stimulatory checkpoint molecules are known, such as for example and without limitation: CD27, CD28, CD40, CD122, CD137, CD137/4-1BB, ICOS, IL-10, OX40, TGF beta, TOR receptor, and glucocorticoid-induced TNFR-related protein GITR. In an embodiment, the small molecule drug is an agonist or superagonist of one or more stimulatory checkpoint molecules. The skilled person will be well aware of small molecule drugs that may be used to modulate stimulatory checkpoint molecules. [00110] Inhibitory checkpoint molecules serve a role in reducing or blocking the immune response (e.g., a negative feedback loop). Numerous inhibitory checkpoint proteins are known, such as for example CTLA-4 and its ligands CD80 and CD86; and PD-1 and its ligands PD-L1 and PD-L2. Other inhibitory checkpoint molecules include, without limitation, adenosine A2A receptor (A2AR); B7-H3 (CD276); B7-H4 (VTCN1); BTLA (CD272); killer-cell immunoglobulin-like receptor (KIR); lymphocyte activation gene-3 (LAG3); V-domain Ig suppressor of T cell activation (VISTA); and T cell immunoglobulin domain and mucin domain 3 (TIM-3); as well as their ligands and/or receptors. In an embodiment, the small molecule drug is an antagonist (i.e., an inhibitor) of one or more inhibitory checkpoint molecules. The skilled 40 168222090v1 Attorney Docket No.243734.000197 person will be well aware of small molecule drugs that may be used to modulate inhibitory checkpoint molecules. [00111] In certain embodiments, an immune response checkpoint inhibitor is an inhibitor of PD- L1, PD-1, CTLA-4 (CD154), PD-L2 (B7-DC, CD273), LAG3 (CD223), TIM3 (HAVCR2, CD366), 41BB (CD137), 2B4, A2aR, B7H1, B7H3, B7H4, B- and T-lymphocyte attenuator (BTLA), CD2, CD27, CD28, CD30, CD33, CD40, CD70, CD80, CD86, CD160, CD226, CD276, DR3, GAL9, GITR, HVEM, ICOS (inducible T cell co-stimulator), Killer inhibitory receptor (KIR), LAG-3, LAIR1, LIGHT, MARCO (macrophage receptor with collageneous structure), phosphatidylserine (PS), OX-40, Siglec 5, Siglec-7, Siglec-9, Siglec-11, SLAM, TIGIT, TIM3, TNF-α, VISTA, VTCN1, or any combinations thereof. [00112] In certain embodiments, an immune response checkpoint inhibitor is an inhibitor of PD- L1, PD-1, CTLA-4, LAG3, TIM3, 41BB, ICOS, KIR, CD27, OX-40, GITR, or PS, or any combinations thereof. Anti-PD1/Anti-PD-L1 [00113] In various embodiments, the immune checkpoint blockade therapy can be an anti-PD-1 or PD-L1 antibody, a functional fragment thereof or a functional equivalent thereof, or any combinations thereof. [00114] PD-1/PD-L1 modulates T cell response. The normal function of PD-1, expressed on the cell surface of activated T cells under healthy conditions, is to down-modulate unwanted or excessive immune responses, including autoimmune reactions. The PD-1 pathway represents a major immune control switch that may be engaged by tumor cells to overcome active T cell immune surveillance, and it is regularly hijacked by tumors to suppress immune control. Tregs that express PD-1 have been shown to have an immune inhibitor response and PD-1/PD-L1 expression is thus thought to play a role in self-tolerance. In the context of cancer, tumor cells overexpress PD-1 and PD-L1 in order to evade recognition by the immune system. Anti-cancer therapy that blocks the PD-L1/PD-1 increases effector T cell activity and decreases suppressive Treg activity which allows recognition and destruction of the tumor by an individual’s immune system. [00115] In some embodiments, the methods described herein involve the use of an anti-PD-1 antibody, a functional fragment thereof or a functional equivalent thereof, or any combinations thereof. PD-1 (CD279) is a cell surface receptor that, functioning as an immune checkpoint, 41 168222090v1 Attorney Docket No.243734.000197 downregulates immune responses and promotes self-tolerance. In an embodiment, the PD1 antibody can be, but is not limited to, nivolumab (OpdivoTM; Bristol-Myers Squibb), pembrolizumab (KeytrudaTM; Merck), pidilizumab (Cure Tech), AMP-224 (MedImmune & GSK), or RMP1-4 or J43 (BioXCell) or a human or humanized counterpart thereof. In certain embodiments, the PD-1 antibody can be pembrolizumab. [00116] In some embodiments, the methods described herein involve the use of an anti-PD-L1 antibody, a functional fragment thereof or a functional equivalent thereof, or any combinations thereof. PD-L1 is a ligand of the PD-1 receptor, and binding to its receptor transmits an inhibitory signal that reduces proliferation of CD8+ T cells and can also induce apoptosis. In an embodiment, the PDL1 antibody can be, but is not limited to, BMS-936559 (Bristol Myers Squibb), atezolizumab (MPDL3280A; Roche), avelumab (Merck & Pfizer), durvalumab (MEDI4736; MedImmune/AstraZeneca), tislelizumab (BeiGene), or cemiplimab (Regeneron). [00117] In other embodiments, and without limitation, the antibody, functional fragment or functional equivalent thereof, may be an anti-PD-1 or anti-PD-L1 antibody, such as for example those disclosed in WO 2015/103602, which is incorporate herein by reference in its entirety for all intended purposes. [00118] In certain non-limiting embodiments, the methods of the present disclosure can also be used for: a) glutamine supplementation combined with immune checkpoint blockade therapy (e.g., anti-PD-1/PD-L1 treatment) to enhance the efficacy of immunotherapies; b) DC vaccines for cancer treatments by targeting lysosomal signaling; c) combination of lysosomal targeting-based DC vaccination with immune checkpoint blockade therapy; d) targeting of SLC38A2 for tumor therapy; e) glutamine supplementation combined with immunotherapy; f) glutamine supplementation combined with inhibiting SLC38A2-mediated glutamine uptake in cancer cells; g) glutamine supplementation combined with inhibiting lysosomal signaling pathway in DCs; h) glutamine supplementation combined with DCs pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors; i) immunotherapy combined with inhibiting lysosomal signaling pathway in DCs; j) immunotherapy combined with DCs pre- incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors; k) DCs pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors; or l) glutamine supplementation combined with immunotherapy, with inhibiting SLC38A2-mediated glutamine uptake in cancer cells, with 42 168222090v1 Attorney Docket No.243734.000197 inhibiting lysosomal signaling pathway in DCs, and/or with DCs pre-incubated in a glutamine- sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. [00119] In certain, non-limiting embodiments, the methods of the present disclosure can be used for treating cancer and related diseases. In certain embodiments, the cancer is characterized by tumors with glutamine deprivation. In certain embodiments, the cancer is selected from colon cancer, melanoma, breast cancer, pancreatic cancer, and lung cancer. EXAMPLES [00120] The present invention is also described and demonstrated by way of the following examples. However, the use of these and other examples anywhere in the specification is illustrative only and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to any particular preferred embodiments described here. Indeed, many modifications and variations of the invention may be apparent to those skilled in the art upon reading this specification, and such variations can be made without departing from the invention in spirit or in scope. The invention is therefore to be limited only by the terms of the appended claims along with the full scope of equivalents to which those claims are entitled. Materials and Methods Mice [00121] C57BL/6, CD45.1+, OT-I, OT-II, Cas9-transgenic, Batf3−/−, Rag1−/−, Cd4Cre, CD11c-Cre and XCR1-Cre mice were purchased from The Jackson Laboratory. Slc38a2fl/fl mice were purchased from INFRAFRONTIER/EMMA. Flcnfl/fl mice were kindly provided by Laura Schmidt44. Tfebfl/fl mice were kindly provided by Andrea Ballabio55. The mice were backcrossed to the C57BL/6 background; sex- and age-matched mice were used throughout the study at 7–12 weeks old, and both male and female mice were used. The genetically modified mice were viable and developed normally. To generate mixed bone marrow chimaeras, bone marrow cells from WT or FlcnΔDC mice were mixed with cells from Batf3−/− mice at a 1:1 ratio and transferred into lethally irradiated (11 Gy) CD45.1+ mice, followed by reconstitution for 6–8 weeks35. In certain experiments, bone marrow cells from wild-type or FlcnΔDC mice were transferred into lethally irradiated (11 Gy) CD45.1+ mice. All mice were maintained in specific pathogen-free conditions in the Animal Resource Center at St. Jude Children’s Research Hospital. Experiments and procedures were approved by and performed in accordance with the Institutional Animal Care and Use Committee of St. Jude Children’s Research Hospital. 43 168222090v1 Attorney Docket No.243734.000197 Cell purification and culture [00122] Mouse spleens were digested with 1 mg/ml collagenase IV (LS004188, Worthington) plus 200 U/ml DNase I (DN25, Sigma) for 45 min at 37°C, and CD11c+ DCs were enriched using CD11c MicroBeads (130-125-835, Miltenyi Biotec) according to the manufacturer’s instructions. Enriched cells were stained and sorted for cDC1 (CD11c+CD8 ^+CD24+TCR ^−CD49b−B220−) and cDC2 (CD11c+CD8 ^−CD24−TCR ^−CD49b−B220−) on a MoFlow (Beckman-Coulter) or Reflection (i-Cyt) cell sorter. Lymphocytes from spleen and peripheral lymph nodes were sorted for naïve OT-II T cells (CD4+CD62LhighCD44lowCD25−) and naïve OT-I T cells (CD8+CD62LhighCD44lowCD25−). Sorted DCs were cultured with specific medium as indicated under Brief Description of the Drawings. Medium with or without individual amino acids was generated with RPMI 1640 powder (R8999-04A, US Biological) by supplementation of individual amino acids. The medium was supplemented with 10% (v/v) dialyzed fetal bovine serum (FBS; A3382001, Thermo Fisher Scientific). For preparation of tumor cell line-derived culture supernatant, MC38 or B16F10 cells were cultured in glutamine-free RPMI 1640 medium (15-040- CV, Corning) supplemented with 10% (v/v) dialyzed FBS plus 1% (v/v) penicillin-streptomycin (15140122, Thermo Fisher Scientific), and different concentrations of glutamine (25030081, Thermo Fisher Scientific) as indicated in the figure legends. Tumor cell culture supernatant was collected 48 h later. In vitro bone marrow-derived DC (BMDC) culture [00123] Bone marrow cells were flushed from mouse tibias and femurs, and red blood cells were lysed using ACK lysis buffer. Cells were then plated in RPMI 1640 medium supplemented with 10% (v/v) FBS, 1% (v/v) penicillin–streptomycin and 55 μM ^-mercaptoethanol (RPMI 1640 complete medium). FLT3L-BMDCs were cultured as previously described35. In brief, bone marrow cells were cultured in RPMI 1640 complete medium with 200 ng/ml FLT3L-Ig (BE0098, Bio X Cell) for 7–9 days. FLT3L-BMDCs were sorted as cDC1 (B220 ^CD11c+CD24+CD172 ^ ^) and cDC2 (B220 ^CD11c+CD24 ^CD172 ^+) for further experiments. iCD103+ BMDCs were generated as previously described67. In brief, bone marrow cells were plated in RPMI 1640 complete medium supplemented with 200 ng/ml FLT3L-Ig and 2 ng/ml mGM-CSF (315-03, Peprotech). Half of the fresh medium was supplemented to the cultures at day 5, and non-adherent cells were collected and replated in fresh medium at day 9. Loosely adherent cells were harvested at days 15–17 for transwell assays. 44 168222090v1 Attorney Docket No.243734.000197 Flow cytometry [00124] For analysis of surface markers, cells were first incubated with Fc block (2.4G2, Bio X Cell) for 10 min in phosphate-buffered saline (PBS) containing 2% (w/v) FBS, and then stained with the appropriate antibodies on ice for appropriate 30 min. For intracellular cytokine detection, cells were stimulated for 4 h with phorbol 12-myristate 13-acetate (PMA) plus ionomycin or OVA257-264 in the presence of monensin before staining with a fixation/permeabilization kit (554774, BD Biosciences) according to the manufacturer’s instructions. Transcription factor staining was performed with FOXP3/transcription factor staining buffer set (00-5523-00, eBioscience) according to the manufacturer’s instructions. Lysotracker staining was performed with LysoTrackerTM Red DND-99 dye (L7528, Invitrogen) according to the manufacturer’s instructions. Flow cytometry data were acquired on LSRII or LSR Fortessa (BD Biosciences) and analyzed using FlowJo software (Tree Star). 7-Aminoactinomycin D (7AAD; A9400, 1:200, Sigma) or fixable viability dye (65-0865-14, 1:1,000, eBioscience) was used for dead-cell exclusion. The following fluorescent conjugate-labeled antibodies were used: PE-Cy7–anti- CD11c (N418, 60-0114, 1:200, Tonbo Biosciences); FITC–anti-FOXP3 (FJK-16s, 11-5773-82, 1:200), PE-Cyanine7–anti-T-bet (4B10, 25-5825-82, 1:100), PerCP-eFluor 710–anti-CD39 (24DMS1, 46-0391-82, 1:400), APC-eFluor 780–anti-MHC-II (M5/114.15.2, 47-5321-82, 1:400), PE-Cyanine7–anti-CD24 (M1/69, 25-0242-82, 1:400), FITC–anti-CD86 (GL1, 11-0862-82, 1:200) (all from eBioscience); Brilliant Violet 510–anti-CD4 (RM4-5, 100559, 1:200), AF700– anti-CD8 ^ (53-6.7, 100730, 1:200), Brilliant Violet 785–anti-TCRβ (H57-597, 109249, 1:200), PE–anti-CD45.2 (104, 109808, 1:400), PE/Dazzle 594–anti-PD-1 (29F.1A12, 135228, 1:400), Alexa Fluor 647–anti-granzyme B (GB11, 515405, 1:100), PE-Cyanine7–anti-IFN ^ (XMG1.2, 505826, 1:200), Brilliant Violet 421–anti-TNF ^ (MP6-XT22, 506328, 1:200), APC–anti-IL-4 (11B11, 504106, 1:200), Pacific Blue–anti-IL-17A (TC11-18H10.1, 506918, 1:200), Brilliant Violet 711–anti-TIM-3 (RMT3-23, 119727, 1:400), Brilliant Violet 650–anti-CD44 (1M7, 103049, 1:400), PE-Cyanine7–anti-CD62L (MEL-14, 104417, 1:400), APC–anti-CD69 (H1.2F3, 104514, 1:200), Brilliant Violet 650–anti-CD11b (M1/70, 101259, 1:200), APC–anti-XCR1 (ZET, 148206, 1:400), Pacific Blue–anti-Ki67 (16A8, 652422, 1:400) (all from BioLegend); PE–anti-IL- 2 (JES6-5H4, 554428, 1:200), Brilliant Violet 605–anti-Ly108 (13G3, 745250, 1:200) (from BD Biosciences); Alexa Fluor 647–anti-TCF1 (C63D9, 6709, 1:100, Cell Signaling Technology). Antigen presentation assays 45 168222090v1 Attorney Docket No.243734.000197 [00125] For in vitro assays, cDC1 and cCD2 were sorted from spleen, pulsed with 200 ^g/ml OVA protein (Low Endo, LS003059, Worthington), 250 pg/ml OVA257–264 peptide (vac-sin, InvivoGen) or 3 ^g/ml OVA323–339 peptide (vac-isq, InvivoGen) for 2 h, then washed twice and cultured with naïve CD44lowCD62Lhigh OT-I or OT-II T cells for three days. For heat-killed Listeria monocytogenes-OVA (HKLM-OVA) antigen cross-presentation assay, sorted cells were cocultured with 1 × 107 HKLM-OVA and OT-I T cells for 3 days as previously described41.3H- thymidine (PerkinElmer) was added to the culture 8 h before cells were harvested to measure proliferation. Where indicated, cDC1 or cDC2 were incubated with OVA protein in RPMI 1640 medium lacking an individual amino acid or amino acid-free medium supplemented with an individual amino acid for 2 h, irradiated and then cocultured with T cells. For treatment with tumor cell culture supernatants, cDC1 or cDC2 were incubated with OVA in the presence of MC38 or B16F10 culture supernatant or tumor cell culture supernatant supplemented with an individual amino acid for 2 h, followed by irradiation and coculture with OT-I or OT-II T cells. For in vivo cross-presentation assay, 1 × 106 CFSE-labeled naïve CD45.1+ OT-I T cells were transferred into mice intravenously, followed by intravenous injection with 20 ^g OVA 24 h later. Three days after OVA immunization, spleens were harvested, and the proliferation of OT-I T cells was examined by CFSE dilution with flow cytometry. ELISA [00126] Culture supernatants from in vitro antigen presentation assays were collected, and the levels of IL-2 and IFN ^ were determined using IL-2 (88-7024-22, Thermo Fisher Scientific) and IFN ^ (88-7314-22, Thermo Fisher Scientific) ELISA kits according to manufacturer’s instructions. DQ-Ovalbumin degradation assay [00127] Splenic cDC1 were sorted from wild-type and Flcn ^DC mice as described above. Sorted cells were incubated with 50 ^g/ml DQ-Ovalbumin (DQ-OVA; D-12053, Thermo Fisher Scientific) for 0, 30, 60 or 120 min. DQ-OVA is a self-quenched OVA conjugate that emits green fluorescence upon hydrolysis by proteases. Cells were washed with PBS at the indicated times and analyzed for DQ-OVA release as assessed positive FITC (FITC+) staining as described previously41. Tumor model and treatments [00128] B16F10 cell line was purchased from ATCC. MC38, MC38-OVA and B16-OVA cell lines were provided by D. Vignali. B16-FLT3L cell line was provided by D. Green. These cell 46 168222090v1 Attorney Docket No.243734.000197 lines are not on the list of commonly misidentified cell lines (International Cell Line Authentication Committee). All cell lines were maintained at 37°C with 5% CO2 in DMEM supplemented with 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin. Mice were injected subcutaneously with 5 × 105 MC38 or B16-OVA cells in the right flank. After tumor inoculation, mice were randomized and assigned to different groups for treatments. Glutamine was injected into tumors at a dose of 200 mg/kg per mouse daily starting from day 5 after tumor inoculation and for ten consecutive days thereafter. Anti-PD-1 antibody (J43, Bio X Cell) or rat IgG2b isotype control (LTF-2, Bio X Cell) was injected intraperitoneally three times at a dose of 200 ^g in 100 ^l PBS at days 7, 10 and 13 after inoculation of MC38 cells. Anti-PD-L1 antibody (10F.9G2, Bio X Cell) or rat IgG2b isotype control (LTF-2, Bio X Cell) was injected intraperitoneally three times at a dose of 200 ^g in 100 ^l PBS at days 9, 12 and 15 after inoculation of B16-OVA cells. Mice with complete tumor rejections from intratumoral glutamine injection and anti-PD-1 combination therapy were rechallenged with 1 × 106 MC38 cells after 60 days. To analyze tumor antigen- specific immune responses, 1 × 106 MC38-OVA cells were injected subcutaneously into mice. Tumor antigen-specific CD8+ T cells were analyzed by H-2Kb-OVA tetrameter staining for 30 min at room temperature. Tumors were measured regularly with digital calipers and tumor volumes were calculated using the formula: length × width × width × ^/6. To prepare intratumoral lymphocytes, tumors were harvested at day 15 after inoculation, excised, minced and digested with 1 mg/ml collagenase IV (Worthington) and 200 U/ml DNase I (Sigma) for 1 h at 37°C. Generation of CRISPR/Cas9 knockout tumor cell lines [00129] MC38 or B16-OVA cells were transduced with lentivirus of pLenti-Cas9-GFP (86145, Addgene). Cas9-expressing (GFP+) cells were sorted, and expression of Cas9 protein was confirmed by immunoblot analysis (see method details below; data not shown). Cas9-expressing MC38 or B16-OVA cells were then transduced with lentivirus expressing Ametrine and control sgRNA (sgNTC: ATGACACTTACGGTACTCGT) (SEQ ID NO: 1) or sgRNA targeting Slc38a2 (sgSlc38a2: ATTAAATACTGACATTCCAA) (SEQ ID NO: 2) as previously described68. After sorting of Ametrine+ cells, cells were expanded, and deletion of SLC38A2 was verified by immunoblot analysis (see details below). For tumor growth, 1 × 106 sgNTC- or sgSlc38a2- transduced, Cas9-expressing MC38 or B16-OVA cells were injected subcutaneously into mice. DC transfer and adoptive T cell transfer for tumor therapy 47 168222090v1 Attorney Docket No.243734.000197 [00130] For DC transfer experiments, freshly isolated splenic cDC1 were used following an established strategy34. In brief, B16-FLT3L cells (2.5 × 106) were injected subcutaneously into both flanks of wild-type mice to expand cDC1. Spleens were harvested 10 days after tumor inoculation, and cDC1 were enriched using CD8+ dendritic cell isolation kit (130-091-169, Miltenyi Biotec). Purified cDC1 were pulsed with 100 ^g/ml OVA protein (low Endo, Worthington) together with 20 ^g/ml poly I:C (InvivoGen) for 2 h in RPMI 1640 medium containing 10% dialyzed FBS with or without glutamine. cDC1 were washed and transferred (1 × 106 cells per mouse) subcutaneously adjacent to the tumors at day 5 after B16-OVA inoculation. [00131] For OT-I T cell transfer experiments, naïve OT-I T cells were isolated using a naïve CD8 ^+ T cell isolation kit (130-096-543; Miltenyi Biotec) according to the manufacturer’s instructions. Purified naïve OT-I T cells were activated using 10 ^g/ml anti-CD3 (2C11; Bio X Cell, BE0001-1) and 5 ^g/ml anti-CD28 (37.51; Bio X Cell, BE0015-1) antibodies. Activated OT- I T cells were then expanded in Click’s medium (Irvine Scientific) containing 10% dialyzed FBS supplemented with or without glutamine in the presence of human recombinant IL-2 (20 IU/ml; PeproTech), mouse IL-7 (12.5 ng/ml; PeproTech) and IL-15 (25 ng/ml; PeproTech) for 2–3 days before adoptive transfer. Where indicated, naïve Cas9-expressing OT-I T cells from Cas9 mice were activated and transduced with sgRNA targeting Slc38a2 or control sgRNA as described above. Ametrine+ transduced cells were sorted before adoptive transfer into recipients. Immunoprecipitation and immunoblot analyses [00132] For FLCN immunoprecipitation, HEK293T cells were starved with glutamine-free medium for 3 h, followed by the addition of 2 mM glutamine for 10 or 15 min. The cells were then lysed in CHAPS buffer (0.3% CHAPS, 10 mM β-glycerol phosphate, 10 mM pyrophosphate, 40 mM HEPES pH 7.4, 2.5 mM MgCl2) supplemented with protease inhibitor cocktail (04693124001, Roche) for 30 min. The cell lysates were cleared by centrifugation and mixed with anti-HA magnetic beads (88837, Thermo Fisher Scientific) at 4°C for 4 h. For immunoprecipitation of GATOR1 or GATOR2 complex, the cleared cell lysates were incubated with anti-DEPCD5 (for GATOR1) and anti-WDR24 (for GATOR2) antibodies and control IgG (3000-0-AP, ProteinTech) at 4°C overnight, followed by a further incubation with protein A/G agarose beads (sc-2003, Santa Cruz) for 2 h. Immunoprecipitated complexes were washed three times with CHAPS buffer and subjected to immunoblot analyses. For immunoblot analysis, cells were harvested and lysed in RIPA buffer (9806, Cell Signaling Technology), resolved in 4–12% Criterion XT Bis-Tris Protein 48 168222090v1 Attorney Docket No.243734.000197 Gel (Bio-Rad) and transferred to PVDF membrane (1620177, Bio-Rad). Membranes were blocked using 5% BSA for 1 h and then incubated with primary antibodies overnight (see below). After washing three times with TBST, the membranes were incubated with 1:5,000-diluted HRP- conjugated anti-mouse IgG (W4021, Promega) for 1 h. Following another 3 washes, the membranes were imaged by ODYSSEY Fc Analyzer (LI-COR). For immunoblot analysis of SLC38A2, cell lysates were treated with PNGase F (P0704S, New England Biolabs) to remove N- linked oligosaccharides according to the manufacturer’s instructions. The following antibodies were used: anti- ^-Actin (3700), anti-GAPDH (D16H11), anti-Lamin B1 (D4Q4Z), anti-HA (3724), anti-MIOS (13557), anti-WDR59 (53385) (all were used at 1:1,000 dilution and from Cell Signaling Technology); anti-Cathepsin D (AF1029, R&D); anti-FLCN (ab124885), anti-DEPDC5 (ab213181), anti-SEH1L (ab218531) (all were used at 1:1,000 and from Abcam); anti-SEC13 (sc- 514308); anti-NPRL2 (sc-376986) (both were used at 1:1,000 and from Santa Cruz); anti-Flag (F1804, 1:1,000, Sigma); anti-TFEB (A303-673A, 1:1,000, Bethyl Laboratories); anti-SLC38A2 (BMP081, 1:1,000, MBL); anti-WDR24 (20778-1-AP, 1:1,000, ProteinTech); and anti-NPRL3 (NBP-97766, 1:1,000, Novus Biologicals). Cytosolic and nuclear cell fractionation [00133] Freshly isolated splenic cDC1 from B16-FLT3L tumor-bearing mice were incubated in glutamine-sufficient medium or starved with glutamine-free medium for 3 h. The cells were washed twice with ice-cold PBS and harvested into cytosol extraction buffer (150 mM NaCl; 50 mM HEPES, pH 7.4; and 0.025% (w/v) digitonin) supplemented with protease and phosphatase inhibitor cocktail (Roche). The samples were incubated on ice for 10 min, following by centrifugation at 980 g for 5 min at 4°C to pellet the nuclei, and the supernatants (cytoplasmic fraction) were further cleared by centrifugation at 13,000 g for 5 min. The nuclear pellet for each sample was washed three times with cytosol extraction buffer and lysed in RIPA buffer supplemented with protease and phosphatase inhibitor cocktail for 40 min on ice. After centrifugation at 14,000 g for 20 min, the resulting supernatant was used as the nuclear fraction. Metabolomics and mass spectrometry for detection of glucose and amino acids [00134] Plasma and tumor interstitial fluid (TIF) were collected as previously described7. In brief, subcutaneous tumor tissues were cut into pieces and then centrifuged through a 0.22 ^m nylon filter (CLS8169, Corning). The flow-through was collected as TIF. The matched blood was collected from the orbital venous plexus, and plasma supernatant was collected by centrifugation. 49 168222090v1 Attorney Docket No.243734.000197 TIF and plasma were flash-frozen with liquid nitrogen and stored at –80°C before analysis. Tumor cell culture supernatants were collected from medium cultured with MC38 cells in RPMI 1640 medium supplemented with 0.6 mM glutamine.1 × 106 sorted splenic cDC1 or cDC2 from wild- type or Slc38a2 ^DC mice were collected. sgNTC- or sgSlc38a2-transduced, Cas9-expressing MC38 cells were cultured in DMEM supplemented with 10% (v/v) FBS and 1% (v/v) penicillin– streptomycin. Then the cells were harvested and washed once with ice-cold PBS, and the metabolites were extracted using 750 ^l of methanol/acetonitrile/water (5:3:2, v/v/v) and the supernatant was dried by lyophilization. Aliquots of 20 ^50 ^l from plasma and TIF were extracted with at least 15-fold excess volume of the methanol/acetonitrile/water solution, and the supernatant was then collected and dried by lyophilization. Dried extracts containing the hydrophilic metabolites were dissolved in 40 ^l of water/acetonitrile (8:2, v/v) and 10 ^l were used in the procedure to derivatize amino acids as described previously69 with some modifications. In brief, the samples were placed into glass autosampler vials and then 35 ^l of sodium borate buffer (100 mM, pH 9.0) was added and mixed by pipetting. Next, 10 ^l of the 6-aminoquinolyl-N- hydroxysuccinimidyl carbamate (AQC, 10 mM in acetonitrile)-derivatizing reagent (Cayman Chemical) was added. The vial was sealed, mixed by vortexing, and then incubated at 55oC for 15 min. The vial was cooled to room temperature and then 1 ^l was analyzed by liquid chromatography with tandem mass spectrometry (LC-MS/MS). An ACQUITY Premier UPLC System (Waters Corp) was used for the LC separations, using a non-linear gradient conditions as follows: 0 ^0.4 min 3% B; 0.4 ^8 min 3 to 96% B (using Curve #8 of the inlet condition in MassLynx™); 8 ^12 min 96% B; 12 ^12.5 min 96 to 3% B; 12.5 ^14 min 3% B. Mobile phase A was water supplemented with 0.15% acetic acid, and mobile phase B was acetonitrile with 0.15% acetic acid. The column used was an Accucore C30 (50 × 2.1 mm, 2.6 ^m) (Thermo Fisher Scientific), operated at 50°C. The flow rate was 300 ^l/min and the injection volume used was 1 ^l. All LC/MS solvents and reagents were the highest purity available (water, acetonitrile, acetic acid, boric acid, sodium hydroxide) and were purchased from Thermo Fisher Scientific. A Xevo TQ-XS Triple Quadrupole Mass Spectrometry (TQ-XS) (Waters Corp) equipped with a multi- mode ESI/APCI/ESCi ion source was employed as detector. The TQ-XS was operated in the positive ion mode using the multiple reaction monitoring mass spec method (MRM). The MRM conditions were set to a minimum of 15 points per peak, with automatic dwell time. The operating 50 168222090v1 Attorney Docket No.243734.000197 conditions of the source were: Capillary Voltage 3.8 kV, Cone Voltage 40 V, Desolvation Temp 550oC, Desolvation Gas Flow 1,000 L/h, Cone Gas Flow 150 L/h, Nebuliser 7.0 Bar, Source Temp 150oC. Authentic amino acids standards were purchased from Sigma-Aldrich (St. Louis, MO, USA) and employed to establish the MRM conditions and calibration curves. The acquired MRM data was processed using the software application Skyline 21.2 (MacCoss Lab Software). Quantification of [13C]-glutamine and total intracellular glutamine [00135] Sorted splenic cDC1 and cDC2 or sgNTC- and sgSlc38a2-transduced Cas9-expresing MC38 cells were washed once with PBS and were then plated into 6-well plates at 1 × 106 cells per well in RPMI 1640 medium containing 10% dialyzed FBS and 2 mM [13C5]-glutamine for 10 min. The cells were subsequently washed once with ice-cold PBS, and the polar metabolites were extracted using 1 ml of methanol/acetonitrile/water (5:3:2, v/v/v) and the supernatant was dried by lyophilization. The dried extracts containing the hydrophilic metabolites were dissolved in 30 ^l of water/acetonitrile (8:2, v/v) and 10 ^l were used for the glutamine-derivatization procedure as described previously69 with minor modifications. Briefly, the samples were placed into glass autosampler vials and then 35 ^l of sodium borate buffer (100 mM, pH 9.0) was added, followed by mixing with pipetting. Next, 10 ^l of the 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC, 10 mM in acetonitrile)-derivatizing reagent (Cayman Chemical) was added. The vial was sealed, mixed by vortexing and incubated at 55oC for 15 min. The vial was cooled to room temperature, and then 15 ^l of the sample was analyzed by LC-MS/MS. A Vanquish Horizon UHPLC (Thermo Fisher Scientific) was used for the LC separations, using a non-linear gradient conditions as follows: 0 ^1 min 3% B; 1 ^22 min 3 to 96% B (using Curve #8, Thermo Scientific SII for Xcalibur); 22 ^25 min 96% B; 25 ^26 min 96 to 3% B; 26 ^30 min 3% B. Mobile phase A was water supplemented with 0.15% acetic acid, and mobile phase B was acetonitrile with 0.15% acetic acid. The column used was an Accucore C30 (250 × 2.1 mm, 2.6 ^m) (Thermo Fisher Scientific), operated at 50°C. The flow rate was 300 ^l/min and the injection volume used was 15 ^l. All LC/MS solvents and reagents were the highest purity available (water, acetonitrile, acetic acid, boric acid, sodium hydroxide) purchased from Thermo Fisher Scientific. A Q Exactive hybrid quadrupole-Orbitrap mass spectrometer (QE-MS) (Thermo Fisher Scientific) equipped with a HESI-II probe was employed as detector. The QE-MS was operated in the positive ion mode using targeted selected ions monitoring followed by a data-dependent MS/MS method (tSIM/dd-MS2). 51 168222090v1 Attorney Docket No.243734.000197 The QE-MS was operated at a resolution of 140,000 (FWHM, at 200 m/z), AGC targeted of 1 × 106, max injection time 100 msec. For the dd-MS2 conditions a resolution of 35,000 was used, AGC targeted of 1 × 105, max injection time 50 msec, loop count 8, MS2 isolation width 0.4 m/z and NCE 35. The operating conditions of the source were: Sheath gas flow 45; aux gas flow 8; sweep gas 1; spray voltage 3.8 kV in positive ion mode; capillary temperature 325oC; S-lenses RF level 55; aux gas heater at 325oC. Authentic unlabeled and [13C5]-glutamine standards were purchased from Sigma-Aldrich. The relative contents of intracellular glutamine [M+0] and [13C5]- glutamine [M+5] were determined from the tSIM/dd-MS2 data as the corresponding parent/daughter ions 317.1230/171.0554 for [M+0] and 322.1663/171.0554 for [M+5]. The data was processed using the Xcalibur™ software (Thermo Fisher Scientific). RNA isolation and gene expression profiling [00136] RNA was isolated and purified from various cell types using the RNeasy Micro Kit (74004, Qiagen) following the manufacturer’s instructions. cDNA synthesis was performed using the High Capacity cDNA Reverse Transcription Kit (4368813, Thermo Fisher Scientific) according to the manufacturer’s instructions. Real-time PCR was performed on the QuantStudio 7 Flex System (Applied Biosystems) using the PowerSYBR Green PCR Master Mix (4367659, Thermo Fisher Scientific). The sequences for mouse Flcn primers were previously described44. The primers for detection of glutamine transporters were listed below: Slc1a5-F: CATCAACGACTCTGTTGTAGACC (SEQ ID NO: 3), Slc1a5-R: CGCTGGATACAGGATTGCGG (SEQ ID NO: 4); Slc6a14-F: GACAGCTTCATCCGAGAACTTC (SEQ ID NO: 5), Slc6a14-R: ATTGCCCAATCCCACTGCAT (SEQ ID NO: ; Slc6a19-F: CAGGTGCTCAGGTCTTCTACT (SEQ ID NO: 7), Slc6a19-R: CGATCACAGAATCCATCTCACAA (SEQ ID NO: 8); Slc38a1-F: AGCAACGACTCTAATGACTTCAC (SEQ ID NO: 9), Slc38a1-R: CCTCCTACTCTCCCGATCTGA (SEQ ID NO: 10); Slc38a2-F: TAATCTGAGCAATGCGATTGTGG (SEQ ID NO: 11), Slc38a2-R: AGATGGACGGAGTATAGCGAAAA (SEQ ID NO: 12); Slc38a3-F: GGAGGGGCTTCTACCAGTG (SEQ ID NO: 13), Slc38a3-R: GGAAAAGGATGATGCCCGTATTG (SEQ ID NO: 14); Slc38a4-F: GCGGGGACAGTATTCAGGAC (SEQ ID NO: 15), Slc38a4-R: 52 168222090v1 Attorney Docket No.243734.000197 GGAACTTCTGACTTTCGGCAT (SEQ ID NO: 16); Slc38a5-F: CTACAGGCAGGAACGCGAAG (SEQ ID NO: 17), Slc38a5-R: GGTTGAACACTGACATTCCGA (SEQ ID NO: 18); Actb-F: GGCACCACACCTTCTACAAT (SEQ ID NO: 19), Actb-R: CTTTGATGTCACGCACGATTTC (SEQ ID NO: 20). For microarray analysis, splenic cDC1 were sort-purified from wild-type (n = 2) and Flcn ^DC mice (n = 3) as described above. RNA was extracted and purified, and 125 ng RNA was used to profile with Affymetrix Mouse Clariom S Assay. For microarray analysis, the gene expression probe signals were quantile normalized and summarized by the RMA algorithm by Affymetrix Expression Console (v1.4.1), then the differential gene expression analysis was performed by R package limma (v3.46.0). False discovery rate (FDR) was estimated by Benjamini–Hochberg method. Heatmaps were generated using ComplexHeatmap (v2.6.2) to show the average expression of genes from biological replicates of the same genotype. Microarray data have been deposited into the GEO series database GSE210155 (access code: yvepsayenbifrgl). ATAC-seq and data analysis Library preparation [00137] The ATAC-seq library was prepared as previously described68. Briefly, splenic cDC1 from wild-type and Flcn ^DC mice (n = 4 per genotype) were isolated as described above. A total of 5 × 104 cells for each sample were used for the ATAC-seq library construction. After lysing in 50 ^l ATAC-seq lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA-630) on ice for 10 min, the resulting nuclei pellet was resuspended in 50 ^l transposase reaction mix (25 ^l 2 ^ TD buffer, 22.5 ^l nuclease-free water, and 2.5 ^l transposase) and incubated for 30 min at 37°C. The tagged DNA was cleaned up using the Qiagen MinElute kit (Qiagen). A first round PCR with 5 cycles was performed to amplify and barcode the tagged DNA. The optimal cycle of further amplification was determined by Real-time PCR (KAPA SYBRFast system; Kapa Biosystems). The final PCR products were purified using AMPure XP beads (Beckman Coulter). The fragment distribution of each library was checked by a TapeStation System (Agilent Technologies) and then sequenced on an Illumina NovaSeq with ~300 million reads per sample. Data analysis [00138] ATAC-seq analysis was performed as described previously68. Briefly, the paired-end fastq files obtained from NovaSeq were trimmed for Nextera adaptor by trimmomatic (v0.36, 53 168222090v1 Attorney Docket No.243734.000197 paired-end mode, with parameter LEADING:10 TRAILING:10 SLIDINGWINDOW:4:18 MINLEN:25). BWA (v0.7.16) was used to align reads to mouse genome mm10 with default parameters. Resulting BAM files were filtered to remove duplicated reads (marked by Picard (v2.9.4)) and to remove mitochondrial reads. After adjustment of Tn5 shift (reads were offset by +4 bp for the sense strand and −5 bp for the antisense strand), the reads were separated into nucleosome-free, mononucleosome, dinucleosome and trinucleosome by fragment size. All samples in this study had approximately 1 × 107 nucleosome-free reads, indicative of good data quality. Next, these nucleosome-free reads were used for peak calling by MACS2 (v2.1.1.20160309, with default parameters with ‘–extsize 200–nomodel’) with a higher cut-off (MACS2 −q 0.05). The consensus peaks for each group were further generated by keeping peaks that were presented in at least 50% of the replicates. The reproducible peaks were merged between WT and FLCN-deficient cDC1 if they overlapped by 100-bp and then were counted from each of the 8 samples by bedtools (v2.25.0). Transcription factor footprinting activity were inferred and visualized using the RGT HINT software (v0.13.2)49. Raw and processed ATAC-seq data have been deposited into the GEO series database GSE210155 (access code: yvepsayenbifrgl). scRNA-seq and data analysis Library preparation [00139] For scRNA-seq analysis in Fig. 1, wild-type mice were challenged with MC38 colon adenocarcinoma cells, and treated with PBS or glutamine daily starting from day 5. DCs (CD45+CD64−CD11c+MHC-II+), CD45+ non-macrophage immune cells (CD45+CD64−), macrophages (CD45+CD64+), and CD45− tumor and other non-immune cells in the tumor tissues were sorted at 15 d after tumor challenge and mixed at a 5:4:1:1 ratio (to ensure that sufficient numbers of the less abundant DCs and non-macrophage immune cells were profiled; n = 2 biological replicates per group). For scRNA-seq analysis in Fig.3, wild-type and Flcn ^DC mice (n = 2 per genotype) were challenged with MC38 cells. CD45+ cells and DCs (CD45+CD64−CD11c+MHC-II+) in the tumor tissues were sorted at 15 d after tumor challenge and mixed at a 2:1 ratio. The cell mixture was centrifuged at 2,000 rpm for 5 min and then resuspended in 1× PBS (Thermo Fisher Scientific) plus 0.04% BSA (Amresco) with a final concentration of 1 × 106 cells/ml. The single-cell suspensions were loaded onto a Chromium Controller and encapsulated into droplets. Chromium Next GEM Single Cell 5' (v2) or Next GEM Single Cell 3' (v3.1) and Gel Bead Kit (10x Genomics) were used for the library preparation following 54 168222090v1 Attorney Docket No.243734.000197 manufacture’s instruction. The final libraries were quality-checked by 2100 Bioanalyzer (Agilent Technologies) and quantified by Qubit Fluorometer (Invitrogen). The resulting libraries were sequenced on NovaSeq (Illumina) with paired-end reads of 26 (for Chromium Next GEM Single Cell 5' kit) or 28 (for Chromium Next GEM Single Cell 3' kit) cycles (for read 1, 90 cycles for read 2 and 10 cycles for index 1 and 2 separately). An average of 500 million reads per sample were obtained. Data preprocessing and quality control [00140] After raw sequencing data were de-multiplexed by bcl2fastq (v2.20.0.422), the Cell Ranger Single-Cell software suite (v6.0; 10x Genomics) was used to process with the scRNA-seq FASTQ files. In brief, the FASTQ files were aligned to the mm10 mouse reference genome (ENSEMBL GRCm38). Gene expression was quantified by reads confidently mapped to the genome and assigned to cells by the cell barcodes. The output from Cell Ranger was imported into R (v4.0.5) and analyzed with Seurat (v4.0.2). Cells with fewer than 200 genes detected, or with low unique molecular identifiers (UMI) counts (potentially dead cells) or unusually high UMI counts (potentially two or more cells in a single droplet) were removed. Cells with high percent (> 5%) of reads mapping to mitochondrial genes (potentially dead cells) were also removed. Genes detected in fewer than three cells were discarded. Clustering and cluster annotation [00141] For unsupervised clustering and visualization, the expression level of each gene was normalized using regularized negative binomial regression with SCTransform built in Seurat pipeline as described previously68. In brief, principal component analysis (PCA) was performed using the top 2,000 highly variable genes. The top 15 principal components were used to build a Shared Nearest Neighbor (SNN) Graph, and cells were clustered using the Louvain algorithm as implemented in a FindClusters function from the Seurat package with resolution as 0.5. The cluster-specific differentially expressed genes were calculated by FindAllMarkers function from Seurat. For the CD8+ T cell subset analysis, the CD8+ T cells were subsetted by gating on the high expression of the CD3 subunit genes (Cd3e or Cd3d) and Cd8b gene and unsupervised clustering was performed using the same graph-based clustering method. The CD8+ T cell subsets were further characterized by the high expression of Tcf7 (encodes TCF1) or Havcr2 (encodes TIM-3). For DCs, cDC cells with high expression of Ptprc and Flt3 were subsetted first. A second-round of dimensionality reduction and unsupervised clustering were then performed. cDC1 cell cluster 55 168222090v1 Attorney Docket No.243734.000197 was characterized by expression of Clec9a and Xcr1. Differential expression (DE) analysis of genes was performed by FindMarkers function from Seurat package. The activity score of gene signatures was calculated by the average normalized expression of all target genes in the gene set. The difference in gene signature activity was examined by non-parametric Wilcoxon rank-sum test and visualized using violin plots. Raw and processed scRNA-seq data have been deposited into the GEO series database GSE210155 (access code: yvepsayenbifrgl). Gene set enrichment analysis and signature curation [00142] Genes were ranked by the fold change generated by the DE analysis. The pre-ranked gene set enrichment analysis (GSEA) was performed as previously described70 against gene sets from KEGG, BIOCARTA, PID, REACTOME, C7 immunological, GO and HALLMARK collections from the Molecular Signatures Database (www.broadinstitute.org/gsea/msigdb/, v7.4) and signatures curated from published papers, as follows. For CD8+ T cells, gene signatures of ‘early activation’, ‘memory precursor’, ‘memory’ and ‘effector/cytokine’ were curated by a previous publication29. For cDCs, the ‘MHC-I antigen presentation’ signature and ‘DC activation’ signature were described in previous publications29, 47. The set of ‘putative TFEB target genes’ signature was derived from a public dataset, which identified TFEB targets by integrating TFEB ChIP-seq analysis and TFEB overexpression52. Public scRNA-seq dataset analysis [00143] To examine the expression of glutamine transporters in tumor cells, DCs and CD8+ T cells from tumor microenvironment, a human melanoma dataset39 (GSE72056) and a mouse tumor scRNA-seq dataset40 (GSE121861, profiling B16F10 melanoma, EMT6 breast mammary carcinoma, LL2 Lewis lung carcinoma, CT26 and MC38 colon carcinoma and Sa1N fibrosarcoma) were analyzed with Seurat (v4.0.2). Tumor cells and CD45+ immune cells from different mouse tumor models were pooled for analysis in GSE121861. Expression of glutamine transporters in the three cell types was visualized by DotPlot function. Statistical analysis for biological experiments [00144] For biological experiment (non-omics) analyses, data were analyzed using Prism 8 software (GraphPad) by two-tailed paired Student’s t-test, two-tailed unpaired Student’s t-test, or one-way ANOVA with Newman–Keuls’s test. Two-way ANOVA was performed for comparing tumor growth curves. The log-rank (Mantel–Cox) test was used for comparing mouse survival 56 168222090v1 Attorney Docket No.243734.000197 curves. Wilcoxon rank sum test was applied for differential expression analysis of scRNA-seq data. P < 0.05 was considered significant. Data are presented as means ± s.e.m. Example 1. Glutamine drives potent anti-tumor immunity in a cDC1-dependent manner [00145] To unbiasedly examine the composition of nutrients in the TME, isolated tumor interstitial fluid (TIF) and matched plasma from mice were challenged with MC38 colon adenocarcinoma or OVA-expressing B16F10 (thereafter called B16-OVA) melanoma cells and performed metabolomics profiling. It was found that glucose and selective amino acids, including glutamine, arginine and cysteine (but not serine, alanine or essential amino acids), were reduced in TIF compared to matched plasma in both tumor models (Fig. 1A, Figs. 5A-5C), suggesting complex nutrient alterations in the TME. The reduction of glutamine was of particular interest, given that blockade of glutamine metabolism by pharmacological treatments of tumor-bearing mice or genetic deletion of glutaminase (encoded by Gls1; the rate-limiting enzyme of glutaminolysis) in tumor cells suppresses cancer cell growth while enhancing the anti-tumor function of CD8+ T cells24, 25. However, glutaminase inhibition also impairs CD8+ T-cell activation and anti-tumor capabilities in the TME26. Given the depletion of glutamine in the TME observed herein, an alternative therapeutic approach was explored by testing whether directly enhancing intratumoral glutamine abundance affects anti-tumor immunity. To this end, daily intratumoral injections of glutamine were performed in mice challenged with MC38 colon adenocarcinoma or B16-OVA melanoma cells starting at day 5 after tumor inoculation. Remarkably, despite the reductions of glucose and other amino acids in the TIF as described above, intratumoral glutamine supplementation alone markedly reduced the growth and weight of MC38 and B16-OVA tumors (Figs.1B, 1C). These effects were not observed in Rag1–/– mice lacking T and B cells27 (Fig.1D), suggesting the importance of adaptive immunity in mediating the anti-tumor effect of glutamine. [00146] Although ICB therapy has achieved remarkable clinical successes, most patients still have poor responses or develop therapeutic resistance to immunotherapy1, 2, which prompted an examination of whether intratumoral glutamine supplementation can increase responses to ICB treatments. To this end, MC38 tumor-bearing mice were treated with a combination of glutamine and anti-PD-1, and observed that glutamine supplementation enhanced the efficacy of anti-PD-1- mediated ICB therapy, with the majority (67%) of mice treated with the combination therapy completely rejecting the tumors and surviving (Fig. 1E). Similar effects on tumor growth were 57 168222090v1 Attorney Docket No.243734.000197 observed in the B16-OVA tumor model treated with ICB (Fig. 5D). Glutamine supplementation also boosted the efficacy of ACT mediated by ovalbumin (OVA)-recognizing, antigen-specific CD8+ (OT-I) T cells in the B16-OVA model (Fig.1F). Finally, to assess whether mice treated with glutamine plus anti-PD-1 combination therapy develop memory responses against tumors, an established assay28 was adopted; specifically, mice were challenged with MC38 cells and treated with a combination of glutamine and anti-PD-1, and after 60 days, tumor-free mice were rechallenged with MC38 cells (and naïve mice were challenged in parallel). In contrast to naïve mice that showed uncontrolled tumor growth, tumors were completely rejected in mice that had received the combination therapy (Fig. 1G), indicative of induction of strong immunological memory. Thus, intratumoral glutamine supplementation represents a means to impede tumor growth and bolster cancer immunotherapy. [00147] Given the requirement of adaptive immunity in glutamine-mediated effects and the impacts on immunotherapy, it was next determined whether glutamine supplementation affects the adaptive immune profiles. Flow cytometry analysis was performed first and an increase in the frequency and number of intratumoral CD8+ T cells was observed, but not in conventional CD4+Foxp3– T cells or Foxp3+ Treg cells, in mice supplemented with glutamine compared to PBS (Fig.1H, Fig. 5E). Similar effects were found in the B16-OVA tumor model (Fig.5F). Next, to unbiasedly identify cellular mechanisms associated with improved anti-tumor immunity, scRNA- seq was performed to profile intratumoral CD45+ immune cells and CD45– non-immune (predominantly tumor) cells from PBS or glutamine-treated MC38 tumors (see methods for details). Unsupervised cluster analysis identified several major immune cell populations, including CD8+ T cells, Foxp3–CD4+ T cells, Treg cells, cDCs, and plasmacytoid dendritic cells (pDCs) (Fig.5G). Given that CD8+ T cells were accumulated in the TME and their important role in anti- tumor immunity, the functional state of intratumoral CD8+ T cells was further examined by calculating the activity of previously established gene signatures related to CD8+ T-cell early activation, memory precursor, memory, and effector/cytokine signaling29. Intratumoral CD8+ T cells from glutamine-treated mice showed a significantly increased activity score of these gene signatures (Fig.1I), indicating possibly enhanced functionality. Consistent with this notion, T-cell activation and effector molecules, including Gzmb (encodes the cytotoxic molecule granzyme B), Prf1, Cd44, Tbx21 and Tnf were upregulated in intratumoral CD8+ T cells based on scRNA-seq analysis (Figs. 5H, 5I). Flow cytometry analysis validated that glutamine supplementation 58 168222090v1 Attorney Docket No.243734.000197 increased the percentage and number of intratumoral CD8+ T cells that expressed IFN ^, TNF ^ or granzyme B (Fig.1J), indicative of enhanced effector function. Recent studies have unveiled the heterogeneity and dynamics of CD8+ T cells in cancer and chronic viral infections, including stem- like cells expressing the transcription factor TCF1, and TCF1– effector-like cells that upregulate expression of TIM-3 (encoded by Havcr2)30, 31. scRNA-seq analysis revealed that intratumoral CD8+ T cells from mice with glutamine supplementation contained a higher proportion of TIM- 3+TCF1– effector-like cells and a corresponding reduction of TIM-3–TCF1+ cell percentage (Fig. 5J). To validate these results, flow cytometry analysis was performed and markedly increased proportion and cellularity of effector-like cells in glutamine-supplemented tumors was found, while stem-like cells were largely unchanged in number, albeit with a reduced frequency (Fig. 1K). Therefore, glutamine supplementation boosts the accumulation and effector function of intratumoral CD8+ T cells, indicative of increased functionality. [00148] It was next determined whether glutamine supplementation exerts T cell-intrinsic or - extrinsic effects on anti-tumor immunity. Activated OT-I T cells were generated that were first expanded in medium lacking glutamine, followed by adoptive transfer into B16-OVA tumor- bearing mice. It was found that these cells retained the ability to control tumor growth (Fig.5K), in line with the notion that glutamine and glutamine metabolism play temporal and subset-specific functions in T cells24, 26, 32. These data raised the possibility that glutamine in the TME may influence intratumoral T-cell function via cell-extrinsic effects. Myeloid cell populations, especially DCs, play central roles in supporting antigen-specific immunity, for example, by presenting tumor-associated antigens to T cells3. Therefore, gene set enrichment analysis (GSEA) was performed to compare the effects of glutamine versus PBS supplementation on cell populations that may serve as antigen-presenting cells for intratumoral T cells, including cDCs, neutrophils, pDCs, macrophages, B cells, and tumor cells. Among these cell types from the scRNA-seq datasets (Fig.5G), cDCs from glutamine-treated mice showed significantly increased activity score of antigen processing and presentation pathway compared to PBS-treated mice (Fig. 1L). An increased activity of previously established MHC-I antigen presentation signature29 was also observed in intratumoral cDCs from glutamine-treated mice compared to PBS-treated controls (Fig.5L). cDCs are composed of cDC1 and cDC2 subsets with distinct phenotypic markers and functional roles4, 5, so flow cytometry analysis was performed next to profile the maturational status of cDC1 and cDC2. It was found that glutamine supplementation enhanced activation of 59 168222090v1 Attorney Docket No.243734.000197 intratumoral cDC1, as evidenced by increased expression of CD40, CD80, CD86 and MHC-II (Fig. 1M). In contrast, cDC2 expressed largely comparable levels of these molecules under the same conditions (Fig. 5M). Thus, glutamine supplementation enhances the maturational state of cDC1 but not cDC2 in the TME. [00149] To establish the functional importance of cDC1 in mediating glutamine effects, intratumoral glutamine supplementation was performed in tumor-bearing Batf3–/– mice that are selectively deficient for cDC133. It was found that glutamine supplementation had no impact on MC38 or B16-OVA tumor growth in Batf3–/– mice (Fig.1N, Fig.5N), indicating that the beneficial effect of glutamine treatment is dependent on cDC1. DC-based vaccines targeting tumor- associated antigens represent a powerful approach to provoke anti-tumor immunity against a variety of cancers3. To test the effect of glutamine on cDC1-mediated vaccine efficacy, a DC transfer model for tumor therapy34 was adopted by pulsing splenic cDC1 with poly I:C and OVA protein in glutamine-sufficient or -deficient medium, followed by washing and injection into B16- OVA tumor-bearing mice. The therapeutic effect of cDC1 was significantly impaired when the pulse stimulation was in glutamine-deficient medium compared to glutamine-sufficient medium (Fig.1O, Fig.5O). Collectively, these findings indicate that glutamine is essential and limiting for enabling the anti-tumor activity of both endogenous and adoptively transferred cDC1, and point to the interplay between glutamine and cDC1 as an important determinant for anti-tumor immunity. Example 2. Glutamine competition between tumors and DCs via SLC38A2 [00150] To establish whether glutamine plays a dominant role in shaping cDC1 function, a comprehensive nutrient screening assay was performed to determine how amino acids impact DC function. Specifically, cDC1 or cDC2 were pulsed with OVA protein in medium lacking each of the 20 common amino acids for 2 h, the cells were washed, and then cocultured cDC1 and cDC2 with OT-I or OT-II (OVA-specific CD4+) T cells in amino acid-sufficient medium for 3 days to induce T-cell priming (using T-cell proliferation and IL-2 and IFN ^ production by OT-I or IL-2 production by OT-II T cells as DC functional readouts35) (Fig.6A). Although asparagine depletion had modest effect in impairing cDC1 function, deprivation of glutamine in cDC1 caused the most pronounced reduction of OT-I or OT-II T-cell proliferation (Figs. 2A, 2B) or IL-2 or IFN ^ production (Figs.6B, 6C) as compared to the removal of other individual essential or non-essential 60 168222090v1 Attorney Docket No.243734.000197 amino acids. Further, glutamine deprivation also lowered the priming capabilities of cDC2, although to a much lesser extent compared to its effect on cDC1 (i.e., a 40-fold versus a 2.8-fold reduction for priming OT-I T cells and a 15.7-fold versus 5-fold reduction for priming OT-II T cells) (Figs. 6D, 6E; compare with Figs. 2A, 2B). Using FLT3L-cultured bone marrow-derived dendritic cells (BMDCs) to generate CD24high cDC1 and CD24low cDC2 in vitro35, 36, it was found that lack of glutamine also impaired the CD8+ T-cell priming function of cDC1 and to a lesser extent cDC2, but had no effect on their ability to promote proliferation of CD4+ T cells (Fig.6F). Thus, there is a preferential requirement for glutamine in supporting cDC1-mediated priming of CD8+ T cells. It was next tested whether glutamine is sufficient in this process by screening for the ability of an individual amino acid to induce cDC-dependent T-cell proliferation. Specifically, cDC1 or cDC2 were incubated with OVA protein in amino acid-free medium supplemented with an individual amino acid, then cocultured cDC1 or cDC2 with OT-I and OT-II T cells (Fig.6G). Glutamine supplementation alone in amino acid-free medium was found to enable cDC1 (and to a lesser extent cDC2)-dependent T-cell proliferation, whereas other amino acids had essentially no effects (Figs. 6H, 6I). Hence, glutamine is both necessary and sufficient for supporting cDC function in mediating T-cell priming, with a preferential effect observed in cDC1 compared to cDC2. [00151] Given these results and the deprivation of glutamine in the TME described above, it was tested whether nutrient interactions between tumor cells and DCs restrict the access of DCs to glutamine and thus their functional capacity. MC38 cells cultured with 0.6 mM glutamine (the physiological concentration of glutamine in the plasma37) showed a drastic reduction of glutamine in the culture supernatant (Fig.6J), consistent with the observations in the TIF from MC38 tumor- bearing mice (Fig. 1A, Fig. 5B). Accordingly, cDC1 cultured with such MC38 cell-derived supernatant (or that derived from MC38 cells cultured with 0.3 mM glutamine) had an impaired capacity to prime OT-I or OT-II T-cell proliferation; remarkably, these effects were rectified when we used supernatant derived from MC38 cells cultured in the presence of 2 mM glutamine (Fig. 2C, Fig.6K). In fact, among all amino acids tested, only glutamine supplementation rectified the defective priming effect of cDC1 cultured with MC38 culture supernatant (Fig. 2D, Fig. 6L). Metabolomics measurement confirmed that intracellular glutamine abundance was reduced in cDC1 treated with MC38 culture supernatant but largely reversed by glutamine supplementation (Fig.6M). Similar as the observations in the MC38 tumor cell system, it was found that B16F10 61 168222090v1 Attorney Docket No.243734.000197 cell culture supernatant also showed glutamine reduction and impaired cDC1 function in a glutamine-dependent manner (Figs. 6N, 6O). Further, cDC1 showed reduced expression of costimulatory molecules CD86 and MHC-II when cultured in the MC38 culture supernatant, which was restored by glutamine supplementation (Fig. 6P). To directly test whether tumor cells may outcompete DCs for glutamine in the TME, a transwell system was utilized wherein in vitro- derived immature DCs were added to the upper chamber in medium containing a physiological (0.6 mM) or supraphysiological (2 mM) concentration of glutamine, followed by coculture with MC38 cells applied to the lower chamber (such a system allowed for only soluble factors to influence DC maturation). In 2 mM glutamine-containing medium, the addition of MC38 tumor cells induced BMDC maturation as indicated by upregulation of CD86; however, this upregulation on DCs was impaired when a physiological concentration (0.6 mM) of glutamine was used (Fig. 2E). An impairment was observed for MHC-II expression, as well (Fig. 2E). Therefore, tumor cells appear to outcompete DCs for glutamine to impair their maturation and function. [00152] To establish the underlying mechanisms, the expression of solute carrier (SLC) family members that have been implicated in glutamine uptake was analyzed next, including SLC1A5, SLC6A14, SLC6A19 (B0AT1), SLC38A1 (SNAT1), SLC38A2 (SNAT2), SLC38A3 (SNAT3), SLC38A4 (SNAT4) and SLC38A5 (SNAT5)38, in tumor cells, DCs and CD8+ T cells using publicly available human melanoma datasets39 and syngeneic mouse tumor datasets40. Among all the glutamine transporters examined, the transcript for SLC38A2 (i.e., SLC38A2 in humans and Slc38a2 in mice) showed the highest expression level in both human and mouse tumor cells (Fig. 2F, Fig.7A). Also, tumor cells expressed higher transcript levels for SLC38A2 compared to DCs and CD8+ T cells (Fig.2F, Fig.7A). In line with this observation, real-time PCR analysis showed that Slc38a2 expression was approximately 10-fold higher in MC38 cells compared to cDC1 (Fig. 7B). Immunoblot analysis also revealed that tumor cells expressed much higher protein levels of SLC38A2 compared to intratumoral cDC1 and CD8+ T cells (Fig. 7C). These results raised the possibility that SLC38A2 represents a putative intercellular metabolic checkpoint for dictating glutamine uptake and downstream functions between tumor cells and cDC1. [00153] To test this hypothesis, the functional importance of SLC38A2 in tumor cells was determined in mediating tumor–immune interactions. Specifically, single guide RNA (sgRNA) targeting Slc38a2 was used to delete SLC38A2 in Cas9-expressing MC38 (MC38-Cas9) cells, with immunoblot analysis showing efficient deletion in MC38-Cas9 cells (Fig.2G). Accordingly, 62 168222090v1 Attorney Docket No.243734.000197 there was a significant reduction of 13C-labeled glutamine and total intracellular glutamine levels in sgSlc38a2-transduced MC38-Cas9 cells compared to those transduced with non-targeting control sgRNA (sgNTC) (Figs.7D, 7E), indicative of impaired glutamine uptake. Next, wild-type (WT) mice were challenged with sgNTC- or sgSlc38a2-transduced MC38-Cas9 cells, and it was found that growth of SLC38A2-deficient MC38 tumors was significantly slower than that of control tumors (Fig.2H). Further, SLC38A2-deficient B16-OVA tumor cells were also generated (Fig.7F) and found that they also showed slower growth than control tumors (Fig.7G). Analysis of intratumoral lymphocytes revealed that sgSlc38a2-transduced MC38-Cas9 tumors contained elevated frequency and number of CD8+ T cells and a modestly increased frequency (but not number) of CD4+Foxp3– T cells (Fig. 2I, Fig. 7H). There were also increased proportion of intratumoral CD8+ T cells that expressed granzyme B, TNF ^ or IFN ^ in sgSlc38a2-transduced MC38-Cas9 tumors (Fig.2J), indicative of improved effector phenotypes. It was therefore tested whether SLC38A2 acts in a tumor-intrinsic manner or requires the immune system for its in vivo effects, by examining the growth of sgSlc38a2-transduced MC38-Cas9 tumors in Batf3–/–33 or Rag1–/–27 hosts that are deficient in cDC1 or lymphocytes, respectively. Importantly, the beneficial anti-tumor effect of SLC38A2 deficiency on MC38-Cas9 cell growth was blocked when inoculated into either Batf3–/– or Rag1–/– mice (Fig.2K, Fig.7I), revealing the importance of cDC1 and lymphocytes in such effects. Collectively, these results show that deficiency of SLC38A2 in tumor cells markedly impairs tumor growth in a cDC1-dependent manner. [00154] To further explore the relationship between SLC38A2, glutamine uptake and cDC1 function, mice bearing DC-specific deletion of SLC38A2 (Slc38a2ΔDC) were also generated by crossing CD11c-Cre transgenic mice with mice bearing floxed Slc38a2 alleles. The deletion efficiency of Slc38a2 was validated in cDC1 and cDC2 but not T or B cells (Fig.8A). Glutamine uptake in DCs was then examined and was found that cDC1 showed higher glutamine uptake than cDC2, while SLC38A2 deficiency resulted in a substantial decrease in glutamine uptake by both cDC1 and cDC2 (Fig. 8B), revealing SLC38A2 as an important glutamine transporter in DCs. Under steady state, Slc38a2ΔDC mice exhibited normal homeostasis of DCs (Figs.8C, 8D) and T cells (Figs. 8E-8G). However, SLC38A2-deficient cDC1 pulsed with OVA had impaired ability to promote in vitro proliferation of OT-I or OT-II T cells (Fig.2L), whereas SLC38A2-deficient cDC2 had no defects (Fig.8H). Further, under these conditions, IL-2 and IFN ^ production by OT- I and IL-2 production by OT-II T cells were decreased when cultured with OVA-pulsed SLC38A2- 63 168222090v1 Attorney Docket No.243734.000197 deficient cDC1 compared to WT cDC1 (Fig. 8I). In contrast, OVA-pulsed SLC38A2-deficient cDC2 showed no defects in inducing IL-2 production by OT-I or OT-II T cells (Fig. 8J). The capacity of SLC38A2-deficient cDC1 to cross-present cell-associated antigens was also examined by incubating them with heat-killed OVA-expressing Listeria monocytogenes (HKLM-OVA)41. SLC38A2-deficient cDC1 were defective in promoting OT-I T-cell proliferation in response to HKLM-OVA, while very little cross-presentation of HKLM-OVA by cDC2 was observed, as expected41 (Fig. 2M). Moreover, following adoptive transfer of OT-I T cells into WT and Slc38a2ΔDC mice and OVA immunization, the in vivo proliferation of OT-I T cells was significantly reduced in Slc38a2ΔDC than WT mice (Fig.2N). These results reveal that SLC38A2 deficiency results in a selective functional defect in cDC1 for activating T-cell immunity in vitro and in vivo. [00155] To assess the role of SLC38A2 in DCs for mediating anti-tumor immunity, WT and Slc38a2ΔDC mice were challenged with MC38 or B16-OVA cells and monitored tumor growth. In both models, tumor growth was enhanced in Slc38a2ΔDC as compared to WT mice (Fig.2O, Fig. 9A). Also, Slc38a2ΔDC mice showed decreased proportion and number of CD8+ T cells (but not conventional CD4+Foxp3– T cells or Foxp3+ Treg cells) in MC38 tumors (Fig. 9B), associated with decreased expression of granzyme B and IFN ^ from intratumoral CD8+ T cells (Fig. 9C). Moreover, glutamine supplementation in tumors had little effect on MC38 tumor growth in Slc38a2ΔDC mice (Fig. 2P), indicating a functional link between glutamine and SLC38A2 expressed by DCs in anti-tumor immunity. To test the effect of SLC38A2 deficiency in DCs on antigen-specific CD8+ T-cell responses, OVA-expressing MC38 cells (MC38-OVA) were inoculated into WT and Slc38a2 ^DC mice, followed by OVA-tetramer staining. Reduced frequency and cellularity of intratumoral OVA-tetramer+ CD8+ T cells in MC38-OVA-bearing Slc38a2 ^DC was observed compared to WT mice (Fig.2Q). Moreover, the production of IFN ^ and TNF ^ was decreased in intratumoral CD8+ T cells upon stimulation with OVA peptide (Fig. 2R), further supporting that SLC38A2 in DCs may be required for intratumoral CD8+ T-cell function. [00156] T cell-intrinsic roles of SLC38A2 in mediating anti-tumor immunity were examined next. First, Cas9-expressing OT-I T cells were transduced with sgRNA targeting Slc38a2, followed by transfer into B16-OVA tumor-bearing mice. It was found that sgNTC- and sgSlc38a2-transduced OT-I T cells showed comparable control of tumor growth (Fig. 9D). Second, mice with T cell- specific deletion of SLC38A2 were generated by breeding Slc38a2 floxed mice with CD4-Cre 64 168222090v1 Attorney Docket No.243734.000197 mice (Cd4CreSlc38a2fl/fl mice) and it was found that deletion of Slc38a2 in T cells had no effect on tumor growth (Fig. 9E). Together, these results show that DCs but not T cells may require SLC38A2 to orchestrate anti-tumor immunity, and suggest that SLC38A2 represents a competitive checkpoint between tumor cells and cDC1 for glutamine acquisition and tumor–immune interactions. Example 3. FLCN deficiency impairs cross-presentation by cDC1 and anti-tumor immunity [00157] Several signaling complexes, including GATOR1, GATOR2 and FLCN–FNIP complex, have been reported to mediate amino acid-induced intracellular signaling42, 43, although it is not fully understood how specific amino acids modulate the activity of these complexes, especially in immune cells. To dissect the downstream signaling pathway of glutamine, it was tested herein whether glutamine could regulate these complexes. It was found that glutamine had no effect on the assembly of GATOR1 (containing DEPDC5, NPRL2 and NPRL3) or GATOR2 complex (containing WDR24, WDR59, MIOS, SEH1L and SEC13)9, 42, as measured by immunoprecipitation of GATOR1 or GATOR2 component followed by immunoblot analyses of components of each complex (Figs.10A, 10B). Also, the interaction between these two complexes was unaltered in the presence or absence of glutamine (Fig.10A). The effects of glutamine on the FLCN–FNIP complex were assessed next by examining the interactions between FLCN and FNIP2 after deprivation or add-back of glutamine. It was found that FLCN and FNIP2 interaction was reduced upon glutamine starvation as compared to no starvation, and glutamine add-back promoted the formation of FLCN–FNIP2 complex (Fig.3A). These results indicate that glutamine availability regulates assembly of the FLCN–FNIP but not GATOR1 or GATOR2 complex. [00158] Given glutamine-dependent regulation of FLCN, the functional importance of FLCN in DC-mediated adaptive immunity and anti-tumor activity was tested. To this end, DC-specific deletion of FLCN was generated by breeding Flcn floxed mice44 with CD11c-Cre mice (FlcnΔDC) and verified the depletion of Flcn mRNA expression specifically in DCs (Fig.11A). DC-mediated T-cell priming in vitro was assessed first, and it was found that FLCN-deficient cDC1 pulsed with OVA showed a pronounced defect in driving OT-I T-cell proliferation (Fig.3B) and IL-2 and IFN ^ production (Fig. 11B). In contrast, FLCN-deficient cDC2 retained function in mediating the proliferation of and IL-2 production by OT-II T cells (Fig.3C, Fig.11C). The cross-presentation ability of FLCN-deficient cDC1 was also examined by using the HKLM-OVA system described 65 168222090v1 Attorney Docket No.243734.000197 above41, and found that FLCN-deficient cDC1 were markedly defective in mediating HKLM- OVA-induced T-cell proliferation (Fig.3D). To examine the role of FLCN in cross-presentation by cDC1 in vivo, Batf3–/–:FlcnΔDC mixed bone marrow (BM) chimaeras (and control mixed BM chimaeras) were generated by following an established strategy35, 45 to selectively restrict FLCN deficiency to cDC1, because Batf3–/– BM cells can give rise to all cell lineages except for cDC133. Specifically, WT or FlcnΔDC BM cells were mixed with Batf3–/– BM cells at a 1:1 ratio and used them to reconstitute C57BL/6 mice, with the resulting Batf3–/–:FlcnΔDC mixed BM chimaeras showing FLCN deficiency restricted to cDC1 but not other BM-derived cells (or in parallel, complete BM chimaeras were generated by reconstitution of either WT or FlcnΔDC BM cells into C57BL/6 mice). OT-I T cells were then adoptively transferred into these chimaeras and immunized with OVA. Compared to Batf3–/–:WT chimaeras, Batf3–/–:FlcnΔDC chimaeras displayed impaired OT-I T-cell proliferation, which was to a similar extent as FlcnΔDC (versus WT) complete chimaeras (Fig.3E), indicating a selective defect of cDC1 lacking FLCN. [00159] To evaluate whether FLCN deficiency in DCs affects anti-tumor responses, WT and FlcnΔDC mice were challenged with MC38 cells or B16-OVA cells. Markedly increased tumor growth in FlcnΔDC was observed compared to WT mice in both tumor models (Fig.3F, Figs.11D, 11E), indicating an important role of FLCN in DCs to restrict tumor growth. To test whether the defect in tumor control is due to loss of FLCN specifically in cDC1, two complementary systems were used. First, the abovementioned Batf3–/–:FlcnΔDC mixed chimaeras were challenged with cDC1-restricted FLCN deficiency with MC38 cells and it was found that these chimaeras showed enhanced tumor growth, similar to FlcnΔDC complete chimaeras (Fig.11F). Second, the XCR1-Cre mouse strain, which expresses Cre-recombinase specifically in cDC146, was crossed with Flcnfl/fl mice to generate mice with conditional deletion of FLCN in cDC1 (Xcr1Cre/+Flcnfl/fl). After challenge with MC38 cells, Xcr1Cre/+Flcnfl/fl mice also exhibited greatly increased tumor growth compared to WT mice (Fig.3G), indicating the selective requirement of FLCN in cDC1 for tumor control. [00160] Next, it was determined whether the beneficial anti-tumor effect of intratumoral glutamine supplementation depends upon FLCN expression in DCs by performing intratumoral injection of glutamine in MC38 tumor-challenged WT and Flcn ^DC mice. Unlike the tumor- inhibitory effect observed in WT mice, FLCN deletion in DCs rendered the mice unresponsive to glutamine supplementation (Fig. 3H). Thus, FLCN expression in DCs is involved in the 66 168222090v1 Attorney Docket No.243734.000197 therapeutic effect of intratumoral glutamine supplementation at reducing tumor growth in vivo. Next, using in vitro systems, it was directly determined whether FLCN mediates the effect of glutamine at promoting cDC1 function. Specifically, it was tested whether FLCN deletion affects the capability of cDC1 or cDC2 in mediating glutamine-dependent T-cell priming, as described above (Fig.2). It was found that glutamine was able to promote WT but not FLCN-deficient cDC1 in mediating OT-I T-cell proliferation, whereas cDC2 responsiveness to glutamine was not affected by FLCN deletion (Fig.11G). Next, WT or FLCN-deficient cDC1 were pulsed with OVA protein in the presence of MC38 culture supernatant supplemented with or without glutamine, and then cocultured them with OT-I T cells. As described above (Fig.2D), MC38 culture supernatant suppressed WT cDC1-induced OT-I T-cell proliferation and glutamine supplementation reversed it, but neither MC38 culture supernatant alone nor glutamine supplementation had additional effects on the capacity of FLCN-deficient cDC1 to prime OT-I T-cell proliferation (Fig. 3I). In contrast, WT and FLCN-deficient cDC2 treated with MC38 culture supernatant were able to respond to glutamine by mediating OT-II T-cell proliferation (Fig. 3J). Altogether, FLCN is selectively required for glutamine to promote cDC1 functions but is dispensable for cDC2 effects, concomitant with its importance in vivo in mediating glutamine-dependent suppression of tumor growth. [00161] To determine the mechanistic basis by which FLCN regulates tumor growth, scRNA-seq was utilized to unbiasedly profile intratumoral CD45+ cells in WT and Flcn ^DC mice challenged with MC38 tumor cells (Figs. 11H, 11I). Specifically, non-DC immune (CD45+) cells and DCs were sorted at day 15 after tumor challenge and mixed for analysis by scRNA-seq. Unsupervised clustering analysis revealed major immune cell populations in intratumoral CD45+ cells with a substantially decreased proportion of CD8+ T cells, whereas other cell populations were unaltered or showed only minor effects (e.g., slightly increased frequency of monocytes/macrophages) (Fig. 11J). Flow cytometry analysis validated the reduction of intratumoral CD8+ T cells from Flcn ^DC mice (Fig.3K). A decreased ratio of CD8+ T cells to Treg cells in tumors from Flcn ^DC mice was also observed (Fig. 3L), indicative of a more immunosuppressive TME. cDC1 were then scored for activation and functional state and it was found that cDC1 from Flcn ^DC tumor-bearing mice had lower activity score of gene signatures related to DC activation47 and MHC-I antigen presentation29 (Figs. 3M, 3N). GSEA also revealed that antigen processing and presentation pathway was downregulated in intratumoral cDC1 from Flcn ^DC mice (Fig.11K), in line with the 67 168222090v1 Attorney Docket No.243734.000197 defective cross-presentation capacity of FLCN-deficient cDC1 described above. Thus, loss of FLCN can lead to impaired DC functional fitness, associated with reduced accumulation of CD8+ T cells in the TME. [00162] The effects of FLCN deletion in DCs on the functional state of intratumoral CD8+ T cells were examined next by integrating scRNA-seq and flow cytometry analyses. scRNA-seq analysis revealed that intratumoral CD8+ T cells from Flcn ^DC mice showed reduced activity score of gene signatures associated CD8+ T-cell early activation, memory precursor, memory, and effector/cytokine29 (Fig. 3O), which was in a reciprocal pattern to the changes in CD8+ T cells from glutamine-supplemented mice (Fig. 1I). These changes were associated with reduced expression of activation markers CD44 and CD69 on intratumoral CD8+ T cells (Figs.12A, 12B), as well as a reduced frequency and number of intratumoral PD-1+ CD8+ T cells from Flcn ^DC mice (Fig. 12C). scRNA-seq and flow cytometry analyses of intratumoral CD8+ T cells also revealed reduced percentage and number of effector-like (TIM-3+TCF1– or CD39+Ly108–30, 31) cells (Fig. 3P, Fig.12D). Moreover, there was decreased expression of effector molecule T-bet (Fig.12E), but similar expression of proliferative marker Ki67 (Fig. 12F) in intratumoral CD8+ T cells. Consistent with these changes, the proportions and numbers of granzyme B+, TNF ^+ and IFNγ+ cells among intratumoral CD8+ T cells were reduced in tumors from Flcn ^DC mice (Fig.3Q, Fig. 12G), suggesting impaired effector function. [00163] To rigorously validate these results and further examine antigen-specific T-cell responses, WT and Flcn ^DC mice were challenged with MC38-OVA cells. It was found that the frequency and cellularity of H-2Kb-OVA-tetramer+ CD8+ T cells were decreased in the MC38- OVA tumors from Flcn ^DC mice (Fig.3R). Moreover, intratumoral CD8+ T cells showed impaired production of IFN ^ and TNF ^ upon stimulation with OVA peptide (Fig. 3S), further supporting dampened effector function of CD8+ T cells upon loss of FLCN in DCs. Altogether, these results from various tumor models indicate that FLCN may be essential for cDC1 to prime CD8+ T cell effector responses in the TME. Example 4. Glutamine impedes TFEB activity via FLCN in cDC1 to modulate anti-tumor immunity [00164] Given the roles of FLCN in regulating multiple metabolic pathways and biological processes48, two unbiased approaches were applied to dissect FLCN-coordinated molecular 68 168222090v1 Attorney Docket No.243734.000197 mechanisms in cDC1. First, an assay for transposase accessible chromatin with high-throughput sequencing (ATAC-seq) using splenic cDC1 from WT and FlcnΔDC mice was performed to assess chromatin state and predict alterations in transcription factor activity. Significant differences in chromatin accessibility between WT and FLCN-deficient cDC1 were observed (Fig. 13A). Further, ATAC-seq followed by differential footprinting analysis49 showed that FLCN-deficient cDC1 exhibited higher activity of the microphthalmia (MiT/TFE) family of transcription factors, such as TFEB and TFE3, which are nutrient and stress-sensitive transcription factors that orchestrate lysosomal biogenesis and function50, 51 (Fig. 4A). Second, gene expression profiling and GSEA were performed, and it was found that the KEGG lysosome pathway and curated TFEB gene targets52 were the most significantly upregulated gene sets in FLCN-deficient cDC1 (Figs. 4B, 4C, 13B, 13C). Consistent with these results, FLCN-deficient cDC1 showed increased TFEB nuclear localization (Fig.13D) and lysosome mass staining (Fig.13E). Within the gene set of the KEGG lysosome pathway, several lysosomal Cathepsin genes (Ctsa, Ctsc, Ctsd, Ctse, Ctsg and Ctsl), which contribute to antigen degradation in DCs51, 53, were highly upregulated in FLCN- deficient cDC1 (Fig. 13F). Immunoblot analysis validated that FLCN-deficient cDC1 had increased expression and maturation of Cathepsin D, which is important for shaping cross- presentation by DCs54 (Fig. 13F). Further, ATAC-seq revealed that FLCN-deficient cDC1 had increased accessibility in the Ctsd promoter and intergenic regions (Fig.13H). In line with these observations, FLCN-deficient cDC1 showed increased DQ-OVA intensity (DQ-OVA emits green fluorescence upon hydrolysis by Cathepsins in the quenching assay41) compared to WT cDC1 (Fig. 4D), indicative of enhanced antigen degradation. These results collectively indicate upregulated TFEB and lysosomal function in the absence of FLCN in cDC1. [00165] To conclusively establish the functional link between FLCN and TFEB, a DC-specific deletion of TFEB was engineered by crossing mice with Tfeb floxed alleles55 with CD11c-Cre mice to generate TfebΔDC mice, which were further crossed with FlcnΔDC mice to delete both FLCN and TFEB in DCs (Flcn/TfebΔDC). Surprisingly, TFEB deletion alone (i.e., on the FLCN-sufficient background) did not affect Cathepsin D expression (Fig. 4E) or lysosomal mass (Fig. 13I), suggesting a largely dispensable role of TFEB in these processes. However, TFEB co-deletion largely reversed the increased lysosomal mass and enhanced expression and maturation of cathepsin D in FLCN-deficient cDC1 (Fig.4E, Fig.13I). The cross-presentation ability of cDC1 was examined next and it was found that TFEB co-deletion restored the defect of FLCN-deficient 69 168222090v1 Attorney Docket No.243734.000197 cDC1 in mediating the proliferation of OT-I T cells (Fig.4F), as well as IL-2 and IFN ^ production by OT-I T cells in vitro (Fig.13J). To test the effects on antigen cross-presentation in vivo, OT-I T cells were adoptively transferred into mice lacking FLCN and TFEB alone or in combination, followed by OVA immunization. TFEB deficiency alone had no effect on the ability of DCs to induce OT-I T-cell proliferation; however, the defective OT-I T-cell proliferation in FlcnΔDC mice was reversed by TFEB co-deletion (Fig. 4G). Altogether, while loss of TFEB expression is compatible with cDC1 function in priming OT-I T cells and lysosomal homeostasis, aberrant TFEB activity may play an important role in driving the phenotypes of FLCN-deficient cells, thereby highlighting the FLCN–TFEB axis as a regulator of cDC1 biology. [00166] Finally, it was explored whether the FLCN–TFEB axis in DCs is involved in anti-tumor immunity. It was found that TFEB co-deletion completely restored the defects of FlcnΔDC mice in controlling MC38 or B16-OVA tumor growth, although tumor growth was not significantly altered in Tfeb ^DC mice (Figs. 4H, 14A, 14B). Associated with these effects, flow cytometry analysis showed that the reduced accumulation of CD8+ T cells in tumors from FlcnΔDC mice was reversed by TFEB co-deletion, whereas CD4+ T-cell accumulation remained largely unaffected in these genetic models (Fig. 14C). It was also found that TFEB co-deletion rescued the impaired generation of effector-like (TIM-3+TCF1– or CD39+Ly108–) cytotoxic CD8+ T cells in tumors from FlcnΔDC mice (Fig.4I). Further, these alterations were associated with increased expression of T-bet (Fig. 4J), as well as enhanced proportions of cells expressing granzyme B, TNF ^ and IFN ^ (Fig. 14D) in intratumoral CD8+ T cells from Flcn/TfebΔDC mice compared to those from FlcnΔDC mice. Therefore, the FLCN–TFEB axis in DCs orchestrates CD8+ T-cell accumulation and function in the TME. [00167] Given these observations and the aforementioned results that FLCN–FNIP2 complex assembly is sensitive to glutamine levels (Fig.3A), it was hypothesized that glutamine availability shapes TFEB activity in an FLCN-dependent manner in cDC1. To this end, gene expression profiling of cDC1 treated with glutamine-free medium or complete medium was performed first, and GSEA showed that the curated gene set containing the 26 TFEB target genes that were upregulated in FLCN-deficient cDC1 (i.e., gene targets controlled by the FLCN–TFEB axis) were significantly enriched in cDC1 treated with glutamine-free medium (Figs. 14E, 14F), with lysosomal Cathepsin genes Ctsa, Ctsb and Ctsd among the leading-edge genes (Fig.14G). Next, WT and FLCN-deficient cDC1 were deprived of glutamine and TFEB activity was examined by 70 168222090v1 Attorney Docket No.243734.000197 its nuclear localization. It was found that glutamine deprivation resulted in increased translocation of TFEB into the nucleus, indicative of enhanced TFEB activity (Fig.4K). Although nuclear TFEB was also elevated in FLCN-deficient cDC1, glutamine deprivation did not further increase the nuclear localization of TFEB in FLCN-deficient cDC1 (Fig. 4K), suggesting that glutamine restricts TFEB activity in an FLCN-dependent manner. To determine the functional effects of this regulation, it was tested whether the dysregulated TFEB activity upon glutamine deprivation is functionally relevant to cDC1 T-cell priming capacity. As described above (Fig.2A), WT cDC1 were defective in mediating proliferation of OT-I T cells in response to OVA protein under the condition of glutamine deprivation. Remarkably, TFEB-deficient cDC1 were largely resistant to glutamine deprivation-induced functional impairment in T-cell priming (Fig. 4L), indicating the dependence of TFEB for mediating such impairment. These findings collectively reveal the important role of FLCN–TFEB axis in orchestrating glutamine signaling in cDC1. [00168] Nutritional alterations are emerging as regulators of immunity in infectious diseases and cancer56, 57. In particular, recent studies have revealed the interplays between nutrients, tumor cells, and immune cells for the regulation of tumor growth and anti-tumor immunity6, 58, 59. Despite the central roles of DCs in bridging innate and adaptive immunity and mediating anti-tumor immunity, whether and how nutrients impact DC subsets and functionality in the TME are largely unknown. These gaps exist partly because DCs, especially cDC1, are rare in the TME and display relatively low proliferation60, whereas nutrients such as glucose and glutamine are frequently needed to support the high proliferative state of tumor or adaptive immune cells. Here, it was discovered that intratumoral glutamine supplementation substantially enhances anti-tumor immunity and immunotherapy efficacy by restoring the cross-presentation capacity of cDC1. The synergistic effects of glutamine supplementation plus ICB suggest that combining checkpoint blockade with glutamine supplementation represents a potential new therapeutic strategy to overcome treatment resistance in patients with poor response to ICB therapy. The present data further indicate that tumor cells and cDC1 both rely on the glutamine transporter SLC38A2 for glutamine uptake and downstream biological effects. Further, expression of SLC38A2 in tumor cells appears to restrict cDC1 access to glutamine, consistent with the notion that tumor cells have the highest uptake of glutamine in the TME7. Importantly, using genetic models, it was established herein that SLC38A2 expression on tumor cells supports tumor growth, whereas SLC38A2 deficiency in DCs, but not T cells, impairs anti-tumor immunity. These results collectively establish that SLC38A2-mediated 71 168222090v1 Attorney Docket No.243734.000197 glutamine acquisition represents an important intercellular metabolic checkpoint for the induction of anti-tumor immunity and restricting tumor growth. These findings also advance the understanding of the immunological basis of DC activation, which has placed much emphasis on PAMP, DAMP and PRR signals, by highlighting the new roles of macronutrients as non-canonical signals that license DC function, especially in the TME. [00169] As the most abundant amino acid found in the body, glutamine has received broad attention for its metabolic effects, including its role in supporting tumor cell-intrinsic metabolism23 as well as serving as the substrate for glutaminolysis in T cells32 and macrophages61. However, the signaling role of glutamine, namely the impacts on intracellular signaling events or protein complexes, is incompletely defined. Here it was shown that glutamine availability reciprocally impacts FLCN–FNIP complex (stimulating) and TFEB activity (inhibitory), and that FLCN and TFEB form an intracellular signaling axis to mediate the effect of glutamine at orchestrating cDC1 cross-presentation and activation of cytotoxic effector-like CD8+ T-cell responses (Fig. 14H). Although FLCN has been shown to act as a suppressor of TFEB activity62, 63, the inventors have established herein a previously unrecognized link between glutamine and FLCN–TFEB signaling pathway in cDC1 and anti-tumor immunity in vivo. Indeed, deletion of FLCN in DCs impairs tumor immunity and abrogates the beneficial anti-tumor effect of intratumoral glutamine supplementation, but co-deletion of TFEB reverses the impaired cDC1 function and anti-tumor immunity in FlcnΔDC mice. Importantly, similar to FLCN deficiency, SLC38A2 deficiency in DCs eliminates the anti-tumor effect of glutamine supplementation, thereby linking this glutamine transporter and FLCN signaling as important drivers of cDC1 function and tumor immunity. The present work provides important insights into the immunostimulatory effects of glutamine in DCs, which contrasts with the immunosuppressive or tolerogenic effects of lipids and indoleamine 2,3- dioxygenase 1 (IDO1)-mediated tryptophan catabolism in modulating DC functions in tumors or inflammatory settings64-66. Collectively, the present findings support the clinical application of targeting glutamine levels in tumors or glutamine-dependent signaling in cDC1 for cancer treatments, including the modulation of glutamine levels as means to enhance the efficacy of DC vaccines and ICB therapies to overcome tumor-mediated immunosuppression in the clinic. 72 168222090v1 Attorney Docket No.243734.000197 References [00170] 1. Kalbasi, A. & Ribas, A. Tumour-intrinsic resistance to immune checkpoint blockade. Nat Rev Immunol 20, 25-39 (2020). [00171] 2. Zou, W., Wolchok, J.D. & Chen, L. PD-L1 (B7-H1) and PD-1 pathway blockade for cancer therapy: Mechanisms, response biomarkers, and combinations. Sci Transl Med 8, 328rv324 (2016). [00172] 3. Wculek, S.K. et al. Dendritic cells in cancer immunology and immunotherapy. Nat Rev Immunol 20, 7-24 (2020). [00173] 4. Anderson, D.A., 3rd, Dutertre, C.A., Ginhoux, F. & Murphy, K.M. Genetic models of human and mouse dendritic cell development and function. Nat Rev Immunol 21, 101-115 (2021). [00174] 5. Cabeza-Cabrerizo, M., Cardoso, A., Minutti, C.M., Pereira da Costa, M. & Reis e Sousa, C. Dendritic Cells Revisited. Annu Rev Immunol 39, 131-166 (2021). [00175] 6. Chapman, N.M. & Chi, H. Metabolic adaptation of lymphocytes in immunity and disease. Immunity 55, 14-30 (2022). [00176] 7. Reinfeld, B.I. et al. Cell-programmed nutrient partitioning in the tumour microenvironment. Nature 593, 282-288 (2021). [00177] 8. Heintzman, D.R., Fisher, E.L. & Rathmell, J.C. Microenvironmental influences on T cell immunity in cancer and inflammation. Cell Mol Immunol 19, 316-326 (2022). [00178] 9. Long, L. et al. CRISPR screens unveil signal hubs for nutrient licensing of T cell immunity. Nature 600, 308-313 (2021). [00179] 10. O'Sullivan, D., Sanin, D.E., Pearce, E.J. & Pearce, E.L. Metabolic interventions in the immune response to cancer. Nat Rev Immunol 19, 324-335 (2019). [00180] 11. Ho, P.C. et al. Phosphoenolpyruvate Is a Metabolic Checkpoint of Anti-tumor T Cell Responses. Cell 162, 1217-1228 (2015). [00181] 12. Chang, C.H. et al. Metabolic Competition in the Tumor Microenvironment Is a Driver of Cancer Progression. Cell 162, 1229-1241 (2015). [00182] 13. Bian, Y. et al. Cancer SLC43A2 alters T cell methionine metabolism and histone methylation. Nature 585, 277-282 (2020). [00183] 14. Wu, J. et al. Asparagine enhances LCK signalling to potentiate CD8(+) T-cell activation and anti-tumour responses. Nat Cell Biol 23, 75-86 (2021). 73 168222090v1 Attorney Docket No.243734.000197 [00184] 15. Geiger, R. et al. L-Arginine Modulates T Cell Metabolism and Enhances Survival and Anti-tumor Activity. Cell 167, 829-842 (2016). [00185] 16. Wculek, S.K., Khouili, S.C., Priego, E., Heras-Murillo, I. & Sancho, D. Metabolic Control of Dendritic Cell Functions: Digesting Information. Front Immunol 10, 775 (2019). [00186] 17. O'Neill, L.A. & Pearce, E.J. Immunometabolism governs dendritic cell and macrophage function. J Exp Med 213, 15-23 (2016). [00187] 18. Du, X., Chapman, N.M. & Chi, H. Emerging Roles of Cellular Metabolism in Regulating Dendritic Cell Subsets and Function. Front Cell Dev Biol 6, 152 (2018). [00188] 19. Spranger, S., Dai, D., Horton, B. & Gajewski, T.F. Tumor-Residing Batf3 Dendritic Cells Are Required for Effector T Cell Trafficking and Adoptive T Cell Therapy. Cancer Cell 31, 711-723 (2017). [00189] 20. Salmon, H. et al. Expansion and Activation of CD103(+) Dendritic Cell Progenitors at the Tumor Site Enhances Tumor Responses to Therapeutic PD-L1 and BRAF Inhibition. Immunity 44, 924-938 (2016). [00190] 21. Sanchez-Paulete, A.R. et al. Cancer Immunotherapy with Immunomodulatory Anti- CD137 and Anti-PD-1 Monoclonal Antibodies Requires BATF3-Dependent Dendritic Cells. Cancer Discov 6, 71-79 (2016). [00191] 22. Bottcher, J.P. & Reis e Sousa, C. The Role of Type 1 Conventional Dendritic Cells in Cancer Immunity. Trends Cancer 4, 784-792 (2018). [00192] 23. Cluntun, A.A., Lukey, M.J., Cerione, R.A. & Locasale, J.W. Glutamine Metabolism in Cancer: Understanding the Heterogeneity. Trends Cancer 3, 169-180 (2017). [00193] 24. Leone, R.D. et al. Glutamine blockade induces divergent metabolic programs to overcome tumor immune evasion. Science 366, 1013-1021 (2019). [00194] 25. Edwards, D.N. et al. Selective glutamine metabolism inhibition in tumor cells improves antitumor T lymphocyte activity in triple-negative breast cancer. J Clin Invest 131, e140100 (2021). [00195] 26. Best, S.A. et al. Glutaminase inhibition impairs CD8 T cell activation in STK11- /Lkb1-deficient lung cancer. Cell Metab 34, 874-887 (2022). [00196] 27. Mombaerts, P. et al. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68, 869-877 (1992). 74 168222090v1 Attorney Docket No.243734.000197 [00197] 28. Canale, F.P. et al. Metabolic modulation of tumours with engineered bacteria for immunotherapy. Nature 598, 662-666 (2021). [00198] 29. Dixon, K.O. et al. TIM-3 restrains anti-tumour immunity by regulating inflammasome activation. Nature 595, 101-106 (2021). [00199] 30. Im, S.J. et al. Defining CD8+ T cells that provide the proliferative burst after PD-1 therapy. Nature 537, 417-421 (2016). [00200] 31. Kallies, A., Zehn, D. & Utzschneider, D.T. Precursor exhausted T cells: key to successful immunotherapy? Nat Rev Immunol 20, 128-136 (2020). [00201] 32. Johnson, M.O. et al. Distinct Regulation of Th17 and Th1 Cell Differentiation by Glutaminase-Dependent Metabolism. Cell 175, 1780-1795 (2018). [00202] 33. Hildner, K. et al. Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T cell immunity. Science 322, 1097-1100 (2008). [00203] 34. Wculek, S.K. et al. Effective cancer immunotherapy by natural mouse conventional type-1 dendritic cells bearing dead tumor antigen. J Immunother Cancer 7, 100 (2019). [00204] 35. Du, X. et al. Hippo/Mst signalling couples metabolic state and immune function of CD8alpha(+) dendritic cells. Nature 558, 141-145 (2018). [00205] 36. Naik, S.H. et al. Cutting edge: generation of splenic CD8+ and CD8- dendritic cell equivalents in Fms-like tyrosine kinase 3 ligand bone marrow cultures. J Immunol 174, 6592-6597 (2005). [00206] 37. Bergstrom, J., Furst, P., Noree, L.O. & Vinnars, E. Intracellular free amino acid concentration in human muscle tissue. J Appl Physiol 36, 693-697 (1974). [00207] 38. Scalise, M., Pochini, L., Galluccio, M., Console, L. & Indiveri, C. Glutamine transporters as pharmacological targets: From function to drug design. Asian J Pharm Sci 15, 207- 219 (2020). [00208] 39. Tirosh, I. et al. Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science 352, 189-196 (2016). [00209] 40. Kumar, M.P. et al. Analysis of Single-Cell RNA-Seq Identifies Cell-Cell Communication Associated with Tumor Characteristics. Cell Rep 25, 1458-1468 (2018). [00210] 41. Theisen, D.J. et al. WDFY4 is required for cross-presentation in response to viral and tumor antigens. Science 362, 694-699 (2018). 75 168222090v1 Attorney Docket No.243734.000197 [00211] 42. Bar-Peled, L. et al. A Tumor suppressor complex with GAP activity for the Rag GTPases that signal amino acid sufficiency to mTORC1. Science 340, 1100-1106 (2013). [00212] 43. Tsun, Z.Y. et al. The folliculin tumor suppressor is a GAP for the RagC/D GTPases that signal amino acid levels to mTORC1. Mol Cell 52, 495-505 (2013). [00213] 44. Baba, M. et al. Kidney-targeted Birt-Hogg-Dube gene inactivation in a mouse model: Erk1/2 and Akt-mTOR activation, cell hyperproliferation, and polycystic kidneys. J Natl Cancer Inst 100, 140-154 (2008). [00214] 45. Mashayekhi, M. et al. CD8alpha(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites. Immunity 35, 249- 259 (2011). [00215] 46. Ferris, S.T. et al. cDC1 prime and are licensed by CD4(+) T cells to induce anti- tumour immunity. Nature 584, 624-629 (2020). [00216] 47. Cheng, S. et al. A pan-cancer single-cell transcriptional atlas of tumor infiltrating myeloid cells. Cell 184, 792-809 (2021). [00217] 48. Schmidt, L.S. & Linehan, W.M. FLCN: The causative gene for Birt-Hogg-Dube syndrome. Gene 640, 28-42 (2018). [00218] 49. Li, Z. et al. Identification of transcription factor binding sites using ATAC-seq. Genome Biol 20, 45 (2019). [00219] 50. Settembre, C. et al. TFEB links autophagy to lysosomal biogenesis. Science 332, 1429-1433 (2011). [00220] 51. Samie, M. & Cresswell, P. The transcription factor TFEB acts as a molecular switch that regulates exogenous antigen-presentation pathways. Nat Immunol 16, 729-736 (2015). [00221] 52. Palmieri, M. et al. Characterization of the CLEAR network reveals an integrated control of cellular clearance pathways. Hum Mol Genet 20, 3852-3866 (2011). [00222] 53. Delamarre, L., Pack, M., Chang, H., Mellman, I. & Trombetta, E.S. Differential lysosomal proteolysis in antigen-presenting cells determines antigen fate. Science 307, 1630-1634 (2005). [00223] 54. Fonteneau, J.F. et al. Characterization of the MHC class I cross-presentation pathway for cell-associated antigens by human dendritic cells. Blood 102, 4448-4455 (2003). [00224] 55. Settembre, C. et al. A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. EMBO J 31, 1095-1108 (2012). 76 168222090v1 Attorney Docket No.243734.000197 [00225] 56. Collins, N. & Belkaid, Y. Control of immunity via nutritional interventions. Immunity 55, 210-223 (2022). [00226] 57. Zitvogel, L. & Kroemer, G. Boosting the immunotherapy response by nutritional interventions. J Clin Invest 132, e161483 (2022). [00227] 58. Kelly, B. & Pearce, E.L. Amino Assets: How Amino Acids Support Immunity. Cell Metab 32, 154-175 (2020). [00228] 59. Kaymak, I., Williams, K.S., Cantor, J.R. & Jones, R.G. Immunometabolic Interplay in the Tumor Microenvironment. Cancer Cell 39, 28-37 (2021). [00229] 60. Merad, M. & Manz, M.G. Dendritic cell homeostasis. Blood 113, 3418-3427 (2009). [00230] 61. Liu, P.S. et al. alpha-ketoglutarate orchestrates macrophage activation through metabolic and epigenetic reprogramming. Nat Immunol 18, 985-994 (2017). [00231] 62. Petit, C.S., Roczniak-Ferguson, A. & Ferguson, S.M. Recruitment of folliculin to lysosomes supports the amino acid-dependent activation of Rag GTPases. J Cell Biol 202, 1107- 1122 (2013). [00232] 63. Napolitano, G. et al. A substrate-specific mTORC1 pathway underlies Birt-Hogg- Dube syndrome. Nature 585, 597-602 (2020). [00233] 64. Cubillos-Ruiz, J.R. et al. ER Stress Sensor XBP1 Controls Anti-tumor Immunity by Disrupting Dendritic Cell Homeostasis. Cell 161, 1527-1538 (2015). [00234] 65. Veglia, F. et al. Lipid bodies containing oxidatively truncated lipids block antigen cross-presentation by dendritic cells in cancer. Nat Commun 8, 2122 (2017). [00235] 66. Gargaro, M. et al. Indoleamine 2,3-dioxygenase 1 activation in mature cDC1 promotes tolerogenic education of inflammatory cDC2 via metabolic communication. Immunity 55, 1032-1050 (2022). [00236] 67. Mayer, C.T. et al. Selective and efficient generation of functional Batf3-dependent CD103+ dendritic cells from mouse bone marrow. Blood 124, 3081-3091 (2014). [00237] 68. Huang, H. et al. In vivo CRISPR screening reveals nutrient signaling processes underpinning CD8(+) T cell fate decisions. Cell 184, 1245-1261 (2021). [00238] 69. Sharma, G. et al. Analysis of 26 amino acids in human plasma by HPLC using AQC as derivatizing agent and its application in metabolic laboratory. Amino Acids 46, 1253-1263 (2014). 77 168222090v1 Attorney Docket No.243734.000197 [00239] 70. Reimand, J. et al. Pathway enrichment analysis and visualization of omics data using g:Profiler, GSEA, Cytoscape and EnrichmentMap. Nat Protoc 14, 482-517 (2019). * * * [00240] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims. It is further to be understood that all values are approximate, and are provided for description. [00241] Patents, patent applications, publications, product descriptions, and protocols are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes. 78 168222090v1

Claims

Attorney Docket No.243734.000197 CLAIMS 1. A method for inhibiting growth of a tumor in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-tumor immunotherapy. 2. A method for enhancing the efficacy of an anti-cancer immunotherapy in a subject in need thereof, comprising administering to the subject said immunotherapy and an effective amount of glutamine. 3. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of an anti-cancer immunotherapy. 4. The method of any one of claims 1-3, wherein the immunotherapy and glutamine are administered simultaneously. 5. The method of any one of claims 1-3, wherein the immunotherapy and glutamine are administered sequentially in any order. 6. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting solute carrier family 38 member 2 (SLC38A2) - mediated glutamine uptake in cancer cells of the subject. 7. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and inhibiting lysosomal signaling pathway in dendritic cells (DCs) of the subject. 8. The method of claim 7, wherein inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor of lysosomal signaling pathway selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, 79 168222090v1 Attorney Docket No.243734.000197 intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. 9. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of glutamine and an effective amount of dendritic cells (DCs), wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. 10. The method of claim 9, wherein said DCs are type-1 conventional dendritic cells (cDC1s). 11. The method of claim 9 or claim 10, wherein the glutamine-sufficient medium comprises 0.6-2 mM glutamine. 12. The method of any one of claims 9-11, wherein the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. 13. The method of any one of claims 9-12, wherein the DCs and glutamine are administered simultaneously. 14. The method of any one of claims 9-12, wherein the DCs and glutamine are administered sequentially in any order. 15. The method of any one of claims 1-14, wherein glutamine is administered in an amount effective for augmenting dendritic cell (DC)-mediated CD8+ T-cell anti-cancer immunity in the subject. 16. The method of any one of claims 1-15, wherein glutamine is administered intratumorally. 80 168222090v1 Attorney Docket No.243734.000197 17. The method of any one of claims 6-16, further comprising administering to the subject an effective amount of an anti-cancer immunotherapy. 18. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and inhibiting lysosomal signaling pathway in dendritic cells (DCs) of the subject. 19. The method of claim 18, wherein inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor of lysosomal signaling pathway selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. 20. The method of claim 19, wherein the immunotherapy and the inhibitor of lysosomal signaling pathway are administered simultaneously. 21. The method of claim 19, wherein the immunotherapy and the inhibitor of lysosomal signaling pathway are administered sequentially in any order. 22. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer immunotherapy and an effective amount of dendritic cells (DCs), wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. 23. The method of claim 22, wherein said DCs are type-1 conventional dendritic cells (cDC1s). 24. The method of claim 22 or claim 23, wherein the glutamine-sufficient medium comprises 0.6- 2 mM glutamine. 25. The method of any one of claims 22-24, wherein the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular 81 168222090v1 Attorney Docket No.243734.000197 acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. 26. The method of any one of claims 22-25, wherein the immunotherapy and the DCs are administered simultaneously. 27. The method of any one of claims 22-25, wherein the immunotherapy and the DCs are administered sequentially in any order. 28. The method of any one of claims 18-27, further comprising administering an effective amount of glutamine to the subject. 29. The method of claim 28, wherein glutamine is administered in an amount effective for augmenting dendritic cell (DC)-mediated CD8+ T-cell anti-cancer immunity in the subject. 30. The method of claim 28 or claim 29, wherein glutamine is administered intratumorally. 31. The method of any one of claims 1-5 and 17-30, wherein the immunotherapy is a dendritic cell (DC)-based therapy, a T-cell-mediated therapy, or an immune checkpoint blockade therapy. 32. The method of claim 31, wherein the immunotherapy a DC-based therapy. 33. The method of claim 32, wherein the DC-based therapy is selected from DC vaccines, adoptive transfer of antigen-loaded or activated DCs, administration of DC-activating factors, administration of DC-mobilizing agents, administration of antigens and/or adjuvants, using DC- specific antibodies to deliver an antigen or adjuvant or nanoparticle, and any combinations thereof. 34. The method of claim 31, wherein the immunotherapy is a T-cell-mediated therapy. 35. The method of claim 34, wherein the T-cell-mediated therapy is selected from a chimeric antigen receptor (CAR) T cell therapy, adoptive T cell transfer (ACT) therapy, T cell receptor 82 168222090v1 Attorney Docket No.243734.000197 (TCR) T cell therapy, tumor-infiltrating lymphocyte (TIL) therapy, neoantigen cancer vaccine, and any combinations thereof. 36. The method of claim 34, wherein the T-cell-mediated therapy is an adoptive T cell transfer therapy. 37. The method of claim 36, wherein the transferred T cells are antigen-specific CD8+ T cells. 38. The method of claim 31, wherein the immunotherapy is an immune checkpoint blockade therapy. 39. The method of claim 38, wherein the immune checkpoint blockade therapy is selected from an anti-programmed death 1 (anti-PD-1) therapy, anti-programmed death ligand 1 (anti-PD-L1) therapy, anti-lymphocyte activation gene-3 (anti-LAG-3) therapy, anti-cytotoxic T-lymphocyte antigen-4 (anti-CTLA-4) therapy, anti-T-cell immunoglobulin and mucin domain 3 (anti-TIM-3) therapy, and any combinations thereof. 40. The method of any one of claims 1-5 and 7-39, further comprising inhibiting solute carrier family 38 member 2 (SLC38A2) - mediated glutamine uptake in cancer cells of the subject. 41. The method of any one of claims 1-6, 9-17 and 22-40, further comprising inhibiting lysosomal signaling pathway in dendritic cells (DCs) of the subject. 42. The method of claim 41, wherein inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. 43. The method of any one of claims 1-8, 15-21 and 31-42, further comprising administering to the subject dendritic cells (DCs), wherein said DCs have been pre-incubated in a glutamine- sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. 83 168222090v1 Attorney Docket No.243734.000197 44. The method of claim 43, wherein said DCs are type-1 conventional dendritic cells (cDC1s). 45. The method of claim 43 or claim 44, wherein the glutamine-sufficient medium comprises 0.6- 2 mM glutamine. 46. The method of any one of claims 43-45, wherein the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. 47. The method of any one of claims 9-14, 22-27 and 43-46, wherein said DCs have been pre- exposed to an antigen associated with said cancer. 48. The method of any one of claims 9-14, 22-27 and 43-47, wherein said DCs are autologous to the subject. 49. The method of any one of claims 2-48, wherein said cancer is characterized by tumors with glutamine deprivation. 50. The method of any one of claims 2-49, wherein said cancer is selected from colon cancer, melanoma, breast cancer, pancreatic cancer, and lung cancer. 51. A method for enhancing anti-tumor CD8+ T-cell immunity in a tumor of a subject in need thereof, comprising administering to the subject intratumorally an effective amount of dendritic cells (DCs), wherein said DCs have been pre-incubated in a glutamine-sufficient medium and/or pre-treated with one or more lysosomal signaling inhibitors. 52. The method of claim 51, wherein said DCs are type-1 conventional dendritic cells (cDC1s). 84 168222090v1 Attorney Docket No.243734.000197 53. The method of claim 51 or claim 52, wherein the glutamine-sufficient medium comprises 0.6- 2 mM glutamine. 54. The method of any one of claims 51-53, wherein the one or more lysosomal signaling inhibitors are selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. 55. The method of any one of claims 51-54, wherein said DCs have been pre-exposed to an antigen associated with said tumor. 56. The method of any one of claims 51-55, further comprising administering to the subject intratumorally an effective amount of glutamine and/or inhibiting solute carrier family 38 member 2 (SLC38A2) -mediated glutamine uptake in tumor cells of the subject and/or inhibiting lysosomal signaling pathway in dendritic cells (DCs) of the subject. 57. The method of claim 56, wherein inhibiting lysosomal signaling pathway in DCs of the subject comprises administering to the subject an effective amount of an inhibitor selected from lysosomal protease inhibitors, vacuolar H+-ATPase inhibitors, intravesicular acidification inhibitors, cysteine protease inhibitors, Cathepsin B inhibitors, Cathepsin L inhibitors, and any combinations thereof. 58. The method of any one of claims 1 and 51-57, wherein said tumor has glutamine deprivation. 59. The method of any one of claims 1-58, wherein the subject is human. 85 168222090v1
EP24750936.7A 2023-02-01 2024-01-31 Use of glutamine for the treatment of cancer and for enhancing the efficacy of an immunotherapy Pending EP4658258A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363482616P 2023-02-01 2023-02-01
PCT/US2024/013761 WO2024163605A1 (en) 2023-02-01 2024-01-31 Use of glutamine for the treatment of cancer and for enhancing the efficacy of an immunotherapy

Publications (1)

Publication Number Publication Date
EP4658258A1 true EP4658258A1 (en) 2025-12-10

Family

ID=92147609

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24750936.7A Pending EP4658258A1 (en) 2023-02-01 2024-01-31 Use of glutamine for the treatment of cancer and for enhancing the efficacy of an immunotherapy

Country Status (2)

Country Link
EP (1) EP4658258A1 (en)
WO (1) WO2024163605A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2009293476B2 (en) * 2008-09-19 2013-01-24 Institut Curie Nutritional support to prevent and/or mitigate bone marrow toxicity from a cancerous tumor
CA2994165A1 (en) * 2015-07-31 2017-02-09 The Johns Hopkins University Methods for cancer and immunotherapy using glutamine analogues, including don

Also Published As

Publication number Publication date
WO2024163605A1 (en) 2024-08-08

Similar Documents

Publication Publication Date Title
Guo et al. SLC38A2 and glutamine signalling in cDC1s dictate anti-tumour immunity
Zhou et al. Blockade of the phagocytic receptor MerTK on tumor-associated macrophages enhances P2X7R-dependent STING activation by tumor-derived cGAMP
Ren et al. P. gingivalis infection upregulates PD-L1 expression on dendritic cells, suppresses CD8+ T-cell responses, and aggravates oral cancer
Hinshaw et al. The tumor microenvironment innately modulates cancer progression
Arroyo Hornero et al. CD70 expression determines the therapeutic efficacy of expanded human regulatory T cells
CN108289903B (en) Cancer therapy using 2-deoxy-2-fluoro-L-fucose in combination with checkpoint inhibitors
US12383575B2 (en) Polyinosinic—polycytidylic acid compositions
GB2626698A (en) Engineered chimeric fusion protein compositions and methods of use thereof
Gardner et al. SIRT1 activation protects against autoimmune T cell-driven retinal disease in mice via inhibition of IL-2/Stat5 signaling
Torrejon et al. Antitumor immune responses in B2M-deficient cancers
She et al. Immune surveillance of brain metastatic cancer cells is mediated by IFITM1
Tan et al. Composition and regulation of the immune microenvironment of salivary gland in Sjögren’s syndrome
Ito et al. Addressing tumor heterogeneity by sensitizing resistant cancer cells to T cell–secreted cytokines
EP4313109A1 (en) Thanotransmission polypeptides and their use in treating cancer
Senent et al. The C5a/C5aR1 axis promotes migration of tolerogenic dendritic cells to lymph nodes, impairing the anticancer immune response
Caner Immune escape mechanism of cancer
Wang et al. A novel role of the scaffolding protein JLP in tuning CD40-induced activation of dendritic cells
Cao et al. Dendritic cells in inflammatory sinonasal diseases
WO2024163605A1 (en) Use of glutamine for the treatment of cancer and for enhancing the efficacy of an immunotherapy
US11873510B2 (en) T-reg cell expansion
Khan et al. Role of USP7 in the regulation of tolerogenic dendritic cell function in type 1 diabetes
Lee et al. Venlafaxine inhibits the development and differentiation of dendritic cells through the regulation of P-glycoprotein
US11883430B2 (en) CD38-NAD+ regulated metabolic axis in anti-tumor immunotherapy
CN107073079A (en) Including the method for the treating cancer for giving PPAR gamma agonists
Yao et al. A CD4+ T lymphocyte–specific TCR/GSDMD/IL-2 axis facilitates antitumor immunity

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250821

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

P01 Opt-out of the competence of the unified patent court (upc) registered

Free format text: CASE NUMBER: UPC_APP_0001766_4658258/2026

Effective date: 20260119

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)