EP4649161A1 - Phage vector - Google Patents

Abstract

The invention relates to phage vectors, and to novel phage vectors comprising transgenes, in particular conventional mammalian transgene cassettes. The invention extends to the use of such phage vectors as a research tool, and for the delivery of transgenes in a variety of gene therapy applications, DNA and/or peptide vaccine delivery and imaging techniques.

Description

Phage Vector

The present invention relates to phage vectors, and particularly, although not exclusively, to novel phage vectors comprising transgenes, in particular conventional mammalian transgene cassettes. The invention extends to the use of such phage vectors as a research tool, and for the delivery of transgenes in a variety of gene therapy applications, DNA and/or peptide vaccine delivery and imaging techniques.

Bacteriophage (phage) continue to emerge as safe vectors for targeted delivery of transgenes as they have no intrinsic tropism for mammalian cell receptors but can be modified to display tissue-specific ligands on the coat proteins to allow cell entry, without disruption of the virus structure (1-6). However, despite apparent advantages over eukaryotic viruses, tissue-targeted phage vectors have shown limited efficacy as bacteriophage has evolved to infect bacteria only and has no optimised strategy to express transgenes upon entry into eukaryotic cells (2).

The inventor's previous work demonstrated that gene transfer efficacy by the filamentous M13 phage is amenable to evolve, and that one efficient strategy is to combine bacteriophage with the attributes of animal viruses. Importantly, over the last few years, the inventors have designed various strategies that boosted gene delivery by filamentous M13 phage-derived vectors. Indeed, as well as for other viral vectors, the successful gene delivery mediated by M13 phage vectors requires: i) an effective diffusion through the extracellular matrix (ECM) to access the cell surface, ii) binding to its cell surface receptor to allow cellular uptake, iii) endosomal escape and (iv) nuclear entry for initiation of gene expression. It is clear that phage has evolved to infect bacteria only and has no optimised strategies to get through these steps to express transgenes in mammalian cells. Over the past few years, the inventors have designed diverse approaches to overcome these limitations, by reducing the size of the M13 phage particles to boost diffusion through the ECM (7, 8) and incorporating endosomal escape peptides on recombinant rpVIII major coat proteins to enhance phage escape from the endosomal/lysosomal degradative pathway (9, 10). Moreover, to improve gene expression in the nucleus, the inventors previously flanked the mammalian transgene cassette by inverted terminal repeats (ITR) from the adeno-associated virus (AAV2) resulting in enhanced gene delivery efficacy of bacteriophage (6).

Moreover, to enhance therapeutic gene transcription from a vector in the nucleus of cancer cells, the inventors replaced the cytomegalovirus CMV promoter with a tumour-activated and chemotherapy-induced promoter of the glucose-regulated protein, Grp78 (11, 12). The inventors have also combined anti-cancer agents with M13 phage vectors to increase nuclear entry of phage in cancer cells (13).

However, contrary to the conventional viral vectors, the filamentous M13 phage requires the additional conversion of its single-stranded DNA (ssDNA) genome to the double-stranded DNA (dsDNA) form, to be properly recognised by the transcriptional machinery of the cell (14). While the ability of M13 phage to reach the cell nucleus can been successfully addressed, the conversion of single-stranded (ss) to double-stranded (ds) genome is a crucial problem that remains to be solved. In mammalian cells, the ssDNA to dsDNA conversion of M13 phage depends on cellular factors, which is a very low efficient process limiting transduction efficiencies (15).

It is clear that conversion to dsDNA of M13 phage has long been a major challenge for M13 phage-mediated gene delivery to mammalian cells. The requirement for complementary-strand synthesis, or recruitment, is now considered to be a ratelimiting factor in the efficiency of M13 phage vectors. In an attempt to circumvent this limitation, ssDNA to dsDNA conversion has been promoted by genotoxic treatment of human cell lines previously incubated with phagemid particles (15). Unfortunately, such treatments are unsuitable for application into living organisms.

In addition to the above problems associated with filamentous bacteriophages, such as M13 phage, there are also significant problems relating to the rate-limiting step of converting ssDNA to dsDNA in AAV vectors. Furthermore, although the capsid of AAV can carry two self-complementary ssDNA sequences, each containing a transgene cassette, to produce dsAAV DNA upon transduction of cells, the maximum size of each ssDNA cannot exceed 2.3kb. As such, there are problems in packaging cassettes that are any larger than 2.3kb (i.e. a large genome) for producing dsDNA AAV in transduced cells, for use in gene therapy applications.

There is, therefore, the need to provide a novel phage vector for the delivery of transgene cassettes, for example into mammalian cells.

Rather than rely on potentially variable cellular mechanisms to provide a complementary-strand for single-stranded genome phage vectors, the inventors surprisingly found that this problem can be circumvented by designing a single phage vector carrying complementary sequences of the transgene expression cassette.

Thus, according to a first aspect of the invention, there is provided a phage vector comprising at least two single-stranded self-complementary transgene expression cassettes, separated by a linker, which hybridise to form a double-stranded transgene expression cassette.

As discussed in the Examples, the inventors have designed a phage vector carrying complementary sequences of a transgene expression cassette, which hybridise to produce a double-stranded transgene expression cassette. Advantageously, the phage vector of the invention overcomes the problems of single-stranded (ss) to double-stranded (ds) DNA conversion of filamentous phage vectors (such as M13) and also the problems associated with ss to dsDNA conversion of AAV vectors. The invention also overcomes the problem of packaging large genomes for the production of double-stranded AAV vectors. To demonstrate that the phage vector of the invention provides better gene delivery than the prior art, the inventors used reporter genes, such as GFP and luciferase. The inventors then used the cytokine TRAIL to endorse their findings and further prove that the vector of the invention performs surprisingly better for gene delivery. When using genes encoding a cytokine, such as TRAIL, in the expression cassette, the inventors also demonstrated cancer cell death, which shows that the phage vector of the invention can be used to effectively deliver therapeutic genes.

Thus, the phage vector of the invention may be a filamentous phage vector, such as M13, or it may be a hybrid vector of AAV DNA and a filamentous phage capsid.

The inventors performed several experiments in vitro using various cell lines and transgenes and surprisingly observed an increased efficiency of transduction from the phage vector according to the invention over conventional single-stranded DNA phage vectors (3- to 15-fold). Indeed, advantageously, the phage vector of the invention displayed a rapid onset and a higher level of transgene expression in all of the cell lines tested. More importantly, unlike conventional single-stranded phage vectors, inhibitors of DNA replication did not affect transduction from the phage vector of the invention. Additionally, as discussed in the Examples, in vivo studies demonstrated significant enhancement of gene delivery to solid tumours in mice upon systemic administration of the phage vector according to the invention, compared to conventional single-stranded DNA phage particles. All of these biological attributes support the generation and characterisation of a new class of filamentous phage vectors that can deliver double-stranded DNA, which will significantly contribute to the ongoing development of phage-based gene delivery systems.

As a circular phage genome can affect the process of double-stranded DNA formation, the inventors used a phagemid, for example as in the one described in WO 2017/077275, the entirety of the contents of which are included by reference. This involved removing the phage genome and retaining the origin of replication fl only to allow replication and packaging of the transgene cassette in bacteria. The definition of a phagemid is a plasmid DNA containing a replication ori of phage, thus the name phage-mid. Here, the inventors used the phagemid as the DNA backbone to design the new phage genome carrying two transgene cassettes. The produced double stranded vector is a phage particle.

Preferably, therefore, the phage vector is a hybrid phagemid genome encapsulated by phage-derived coat proteins. The hybrid phagemid genome may be referred to as a "phagemid genome" (i.e. a genetic construct containing two origins of replication - one from bacteriophage (e.g. Fl), and one from bacteria (e.g. pUCl)).

Preferably, the genome of the phage vector comprises a packaging signal for enabling replication of the at least two single-stranded self-complementary transgene expression cassettes, which can hybridize in bacteria and subsequently be packaged as double-stranded transgene expression cassettes into the phage vector inside a prokaryotic host. The packaging signal may preferably comprise a bacteriophage origin of replication. For example, the origin of replication preferably comprises an Fl ori, more preferably from an Fl bacteriophage. The DNA sequence of one embodiment of the Fl ori is represented herein as SEQ ID No: 1, as follows:

ACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGC CAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGT CAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAAC TTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGA GTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCT TTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTA AC G C GAAT T T T AAC AAAAT AT T AAC GT T T AC AAT T T

[SEQ ID NO: 1] Preferably, the genome of the phage vector comprises an origin of replication for enabling replication of the at least two single-stranded self-complementary transgene expression cassettes inside a prokaryotic host. Preferably, the origin of replication enables high copy number replication of the vector inside the host. Preferably, the origin of replication comprises a bacterial origin of replication.

Preferably, the origin of replication comprises a pUC ori (for molecular cloning). The DNA sequence of one embodiment of the pUC ori is represented herein as SEQ ID No: 2, as follows:

TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTT TGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAA ATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCT CGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCA AGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGG AGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGG GAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGG GGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGAT GCTCGTCAGGGGGGCGGAGCCTATGGAAA

[SEQ ID NO: 2]

Alternatively, in another embodiment, the phage vector may be designed such that it integrates into the genome of a host cell. In this case, nucleic acid sequences, which favour targeted integration (e.g. by homologous recombination) of the vector's genome are envisaged. Hence, the genome of the phage vector may comprise one or more DNA sequence, which enables targeted integration into a host genome.

In one embodiment, the phage vector may be used as an experimental research tool and used ex vivo or in vitro.

In another embodiment, preferably the phage vector may be used for the delivery of the at least two self-complementary transgene expression cassettes to a tissuespecific target, irrespective of whether the vector is administered systemically or locally to a subject in vivo, applied to a mixture of cells in vitro, or applied to an organ ex vivo. Preferably, the at least two self-complementary transgene expression cassettes comprise viral transgene expression cassettes. More preferably, the at least two self-complementary transgene expression cassettes comprise mammalian viral transgene expression cassettes. For example, the at least two self-complementary transgene expression cassettes may, in one preferred embodiment, comprise lentivirus transgene expression cassettes. The at least two self-complementary transgene expression cassettes are preferably adeno- associated virus (AAV) transgene expression cassettes.

The at least two self-complementary transgene expression cassettes may comprise any nucleic acid encoding an agent, which may have therapeutic or industrial utility in a target cell or tissue. In one embodiment of the invention, the nucleic acid may be DNA, which may be genomic DNA or cDNA. Non-naturally occurring cDNA may be preferred in some embodiments. In another embodiment, the nucleic acid may be RAIA, such as antisense RNA or shRNA.

The agent encoded by the nucleic acid may be a polypeptide or protein. For example, in embodiments where the phage vector of the first aspect is used to treat cancer, the transgene may encode the Herpes simplex virus thymidine kinase gene, which may subsequently exert a therapeutic effect on a target tumour cell. The transgene may encode a cytokine, for example TRAIL. The vector may be used to treat any cancer, such as bone cancer.

However, it will be appreciated that the type of cell, which is targeted by the phage vector depends on the type of cel I -targeting ligand expressed on the surface of the vector. For example, the cell-targeting ligand may comprise RGD, such as RGD4C.

The at least two transgene expression cassettes may comprise one or more functional elements required for expression of the nucleic acid in the target cell. For example, preferably the at least two transgene expression cassettes each comprise a promoter, for driving expression of the transgene. A suitable promoter may be the CMV promoter. The DNA sequence of one embodiment of the CMV promoter is represented herein as SEQ ID No: 3, as follows:

ACGCGTGGAGCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCC GCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAAT AATGACGTATGTTCCCATAGTAACGTCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGG TAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACG GTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTA CGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTT GACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGCACCAAAATCAACG GGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAG GTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACC T C C ATAGAAGACAC C G GGAC C GAT C GAG C CT C C

[SEQ ID NO: 3] In another preferred embodiment, the at least two transgene expression cassettes each comprise a grp78 promoter. The nucleic acid sequence of one embodiment of the grp78 promoter is represented herein as SEQ ID No: 4, as follows:

CCCGGGGGCCCAACGTGAGGGGAGGACCTGGACGGTTACCGGCGGAAACGGTTTCCAGGTGAGAGGTCAC

CCGAGGGACAGGCAGCTGCTCAACCAATAGGACCAGCTCTCAGGGCGGATGCTGCCTCTCATTGGCGGCC

GTTAAGAATGACCAGTAGCCAATGAGTCGGCTGGGGGGCGCGTACCAGTGACGTGAGTTGCGGAGGAGGC

CGCTTCGAATCGGCAGCGGCCAGCTTGGTGGCATGAACCAACCAGCGGCCTCCAACGAGTAGCGAGTTCA

CCAATCGGAGGCCTCCACGACGGGGCTGCGGGGAGGATATATAAGCCGAGTCGGCGACCGGCGCGCTCGA

TACTGGCTGTGACTACACTGACTTGGAC

[SEQ ID NO: 4]

Alternatively, in another preferred embodiment, the at least two transgene expression cassettes each comprise a tumour-specific promoter, or a tissue-specific promoter. Tissue-specific promoters can be used to target transcription and gene expression with a phage vector displaying ligands for delivery to these specific tissues.

Preferably, the at least two transgene expression cassettes each comprise a nucleic acid for a polyA tail. Preferably, the polyA tail is located at the end of the transgene cassette, i.e. at the 5'or 3' end of the transgene cassette. The DNA sequence of one embodiment of the nucleic acid for encoding a polyA tail is represented herein as SEQ ID No: 5, as follows:

ACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCAC CAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGG TGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGG AACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCT CCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTT TGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCAC CTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTT

[SEQ ID NO: 5]

Accordingly, in a preferred embodiment, the at least two single-stranded self- complementary transgene expression cassettes each comprise a promoter (preferably CMV), a nucleic acid encoding an agent (e.g. a therapeutic agent), and a polyA tail.

Preferably, the phage vector comprises at least two single-stranded self- complementary transgene expression cassettes, separated by a linker, which hybridise to form a double-stranded transgene expression cassette. Alternatively, the phage vector may comprise four single-stranded complementary transgene expression cassettes (i.e. two pairs of self-complementary cassettes), separated by a linker, which hybridise to form two double-stranded transgene expression cassettes.

As illustrated in Figure 2, in order for the single-stranded self-complementary transgene expression cassettes to hybridise with one another, they must be positioned in the phage vector in opposite orientations, i.e. a first cassette extends in the 5' to 3' direction, whereas a corresponding second cassette extends in the 3' to 5' direction. It will be appreciated that the cassettes are substantially the same in terms of their sequence, but extend in opposite or anti-parallel directions, either side of the linker which separates them. Therefore, in a preferred embodiment, the two single-stranded self-complementary transgene expression cassettes are positioned in an opposite orientation in the phage vector.

It will be appreciated that for the at least two single-stranded self-complementary transgene expression cassettes to successfully hybridise to form a double-stranded transgene expression cassette, their sequences should be similar if not identical to each other, albeit extending in opposite directions. However, it is not essential that their sequences are identical, and provided that there is sufficient sequence identity along a sufficient length or lengths of each cassette then hybridisation will occur.

The percentage sequence identity between the first and second cassette may be at least 65%, 70% or 75%. Preferably, the percentage sequence identity between the first and second cassette is at least 80%, 85% or 90%. Preferably, the percentage sequence identity between the first and second cassette is at least 92%, 94% or 95%. Preferably, the percentage sequence identity between the first and second cassette is at least 96%, 97% or 98%. Preferably, the percentage sequence identity between the first and second cassette is at least 99% or 100%.

Preferably, the linker separating the at least two self-complementary transgene expression cassette is an Inverted Terminal Repeat (ITR). Preferably, the phage vector comprises a second ITR. More preferably, the second ITR flanks one of the at least two self-complementary transgene expression cassettes.

Alternatively, in another preferred embodiment, the linker separating the at least two self-complementary transgene expression cassettes is an unrelated DNA segment. Preferably, the linker or unrelated DNA segment is between 60 bp and 300 bp, between 80 bp and 280 bp, between 100 bp and 260 bp, between 120 bp and 240 bp, between 140 bp and 220 bp, or between 160 bp and 200 bp in length. Most preferably, the linker or unrelated DNA segment is 180 bp in length.

By "unrelated DNA segment" is meant DNA with low or no sequence identity with the first and second single-stranded self-complementary cassettes. For example, the percentage sequence identity between the linker and the first and second cassettes is less than 50%, 45% or 40%. Preferably, the percentage sequence identity between the linker and the first and second cassette is less than 35%, 30% or 25%. Preferably, the percentage sequence identity between the linker and the first and second cassette is less than 20%, 15% or 10%. Preferably, the percentage sequence identity between the first and second cassette is at least 8% or 5%.

Preferably, the first and/or second ITRs are AAV ITRs. An ITR can be specific to an AAV-2 or another AAV serotype, and can be any sequence, so long as it forms a hairpin loop in its secondary structure. For example, the AAV serotype may be AAV1-9, but is preferably AAV1, AAV2, AAV5, AAV6 or AAV8. The DNA sequence of one embodiment (left ITR from a commercially available AAV plasmid) of the ITR is represented herein as SEQ ID No: 6, as follows:

CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGG CCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT

[SEQ ID NO: 6]

The DNA sequence of another embodiment (right ITR from a commercially available AAV plasmid) of the ITR is represented herein as SEQ ID No: 7, as follows:

AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACC AAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAG G

[SEQ ID NO: 7]

Preferably, the phage vector comprises only two ITRs. Preferably, the phage vector comprises fewer than three ITRs.

Preferably, the genome of the phage vector comprises a selection marker, which will depend on the host cell in which the vector is harboured, for example for conferring antibiotic (e.g. ampicillin) resistance in a host cell, preferably a bacterium. The marker provides selection pressure during production of the vector in the host cell. Accordingly, in a preferred embodiment, the phage vector comprises an ampicillin resistant gene.

Preferably, the phage vector comprises one or more capsid minor coat protein. The phage vector may comprise a pill capsid minor coat protein that is configured to display a cell-targeting ligand for enabling delivery of the vector to the target cell. Preferably, the phage vector comprises one or more capsid major coat protein. The phage vector may comprise at least one pVIII capsid major coat protein that is configured to display a foreign peptide thereon.

The phage vector may comprise a modification of the capsid structure, for example by treatment, or chemical or biochemical conjugation. Examples of suitable modifications may include cross-linking peptide residues on to the phage particle. In another embodiment, the phage vector may comprise one or functional peptide attached to the capsid thereof. For example, a functional peptide may comprise a nuclear translocation signal or an endosomal escape peptide. The phagemid particle may therefore be multifunctional, and use features disclosed in WO 2014/184528, the contents of which are included herein by way of reference.

In another embodiment, the phage vector may be combined with a cationic polymer to form a complex having a net positive charge, as described in WO 2014/184529, the contents of which are included herein by way of reference. The cationic polymer may be selected from a group consisting of: chitosan; poly-D-lysine (PDL); diethylaminoe]thyl (DEAE); diethylaminoethyl-dextran (DEAE.DEX); polyethyleneimine (PEI); polybrene; protamine sulphate; and a cationic lipid. Preferably, the cationic lipid is selected from the group consisting of fugene®, lipofectamine ®, and DOTAP (N-[l-(2,3-Dioleoyloxy)propyl]-N,N,N- trimethylammonium methyl-sulfate). Preferably, the cationic polymer comprises DEAE, more preferably DEAE.DEX.

Preferably, the phage vector comprises a genome which substantially lacks the phage genome from which the vector is derived. Preferably, the genome of the phage vector lacks at least 60%, more preferably at least 70%, and even more preferably at least 80% of the bacteriophage genome from which it is derived. More preferably, the genome of the phage vector lacks at least 90%, more preferably at least 95%, and even more preferably at least 99% of the bacteriophage genome from which it is derived. Preferably, the genome of the phage vector lacks all of the bacteriophage genome from which it is derived. As discussed above, however, the genome of the phage vector may, in some embodiments, comprise the bacteriophage origin of replication for enabling replication of the single-stranded DNA in the host bacteria, i.e. Fl bacteriophage ori.

Preferably, the phage vector lacks bacteriophage structural genes in its genome required for the formation, packaging or extrusion of the particle from a prokaryotic host. Such structural genes encode the capsid proteins etc. Hence, preferably the phage vector lacks structural genes that encode bacteriophage capsid proteins. Preferably, the phage vector comprises a genome which lacks a gene encoding a minor or major coat protein from which the vector is derived. Preferably, the phage vector comprises a genome which lacks a pill capsid minor coat protein, or which lacks a pVIII capsid major coat protein. Most preferably, the phage vector comprises a genome which lacks both a pill capsid minor coat protein, and a pVIII capsid major coat protein.

Thus, the phage vector preferably comprises a replication-deficient, virus-like- particle or virion constructed from, and displaying, the structural components, including but not limited to proteins and other conjugated compounds, derived from a bacteriophage, despite the genome of the vector not containing the structural genes of a bacteriophage from which it is derived.

Accordingly, given that the genome of the phage vector of the first aspect lacks the much of the derivative phage genome, including the structural genes, an alternative system is required in order to provide the necessary structural (i.e. capsid) genes that are required to package the phage vector genome in a bacteriophage capsid to produce the phage vector of the invention. Accordingly, the inventors have devised a system for producing the vector of the first aspect, involving the use of a separate so-called "helper virus" vector. In effect, therefore, the phage vector of the first aspect is a hybrid phagemid vector, which includes cis genetic components of a phagemid and a eukaryotic virus e.g., AAV ITRs.

Hence, in a second aspect, there is provided a system for producing a phage vector from a prokaryotic host, the system comprising :-

(i) a first vector configured to persist inside a prokaryotic host, and comprising at least two single-stranded self-complementary transgene expression cassettes separated by a linker, which hybridise to form a double-stranded transgene expression cassette, and a packaging signal for enabling replication of the at least two single-stranded self-complementary transgene expression cassettes; and (ii) a second vector comprising nucleic acid encoding structural proteins required for packaging the double-stranded transgene expression cassette, resulting in the formation and extrusion of a phage vector from the prokaryotic host.

The system of the second aspect is preferably capable to package the genome of eukaryotic viruses (such as AAV or lentivirus), which is provided by the first vector, into a prokaryotic virus capsid (i.e. bacteriophage), which is provided by the second vector.

Advantageously, separating the reproductive elements of the phage vector into the first "therapeutic" vector carrying the transgene expression cassettes, and the second separate "helper" vector carrying the viral packaging structural genes substantially decreases the genome/vector size, and thereby significantly increases transgene capacity. In embodiments in which the phage vector is used therapeutically, this is a particularly useful advantage for gene therapy applications. Consequently, this results in an enhanced production yield, gene transduction efficiency and flexibility of the vector system for other applications.

Preferably, the system of the second aspect is used to produce the phage vector according to the first aspect. Preferably, the first vector therefore comprises the genome of the phage vector. The packaging signal of the first vector may preferably comprise an origin of replication, preferably a bacteriophage origin of replication. Preferably, the origin of replication in the first vector comprises an Fl ori, more preferably from an Fl bacteriophage ori.

Preferably, the first vector comprises a second origin of replication for enabling replication of the at least two single-stranded self-complementary transgene expression cassettes inside a prokaryotic host, for molecular cloning. Preferably, the origin of replication enables high copy number replication of the vector inside the host for molecular cloning. Preferably, the origin of replication comprises a pUC ori. Alternatively, the first vector may comprise one or more DNA sequence, which favours targeted integration into a host genome, thus removing the requirement for any origin of replication. The at least two single-stranded self-complementary transgene expression cassettes comprise a viral transgene expression cassette, more preferably a mammalian viral transgene expression cassette. For example, the at least two transgene expression cassettes may comprise an AAV transgene expression cassette or a lentivirus transgene expression cassette. An AAV transgene expression cassette is preferred.

Preferably, the linker of the first vector is an ITR, more preferably an AAV ITR, preferably an AAV2 ITR. Alternatively, in another preferred embodiment, the linker of the first vector is an unrelated DNA segment. Preferably, the linker is as described above for the phage vector of the first aspect.

In a preferred embodiment, the first vector comprises a second ITR. Preferably, the second ITR flanks one of the at least two self-complementary transgene expression cassettes. Preferably, the first and/or second ITRs are AAV ITRs. Preferably, the first vector comprises only two ITRs. Preferably, the first vector comprises less than three ITRs.

The second vector or "helper phage" is preferably a bacteriophage engineered specifically for rescuing the genome of the first vector from prokaryotic hosts. The second vector (i.e. the helper phage) is therefore provided to lend its proteins and polypeptides to the first vector, or any other DNA entity that contains a functional packaging signal and/or a single stranded origin or replication. The second vector is most preferably replication-defective. Preferably, the second vector comprises a disrupted packaging signal, which significantly deters its ability to package itself into phage particles. Preferably, the second vector comprises a disrupted origin of replication. In one embodiment, the disrupted origin of replication is a medium copy number origin, such as pl5a. In another embodiment, the disrupted origin of replication is a low copy number origin, such as a pMBl. Preferably, the first vector (i.e. the phage vector's genome) is configured to outcompete with the second vector (i.e. the helper phage) in both replication and packaging.

The genome of the second vector may be engineered to give the resultant phage vector targeting properties (or multifunctional properties as described in WO 2014/184528). Hence, it provides the structural capsid proteins for phage vector assembly. Preferably, the second vector comprises nucleic acid encoding one or more capsid minor coat proteins, or one or more capsid major coat proteins. All capsid proteins may either be wild type or recombinant, present in single or multiple copies, and modified to display chimeric or synthetic peptides. This includes the display of antigens of other viruses for peptide vaccine delivery or as an adjuvant in the case that a DNA vaccine (delivered by the phagemid particle of the first aspect) is desired.

In one embodiment, therefore, the second vector may comprise a first nucleic acid sequence encoding a pill capsid minor coat protein that is configured to display a cell-targeting ligand for enabling delivery of the phage vector to a target cell (e.g. a tumour). Therefore, it may be desired to induce a 9-amino acid mutation in the pill minor coat protein of the recombinant phagemid particle in order to confer its specificity to tumour cells and angiogenic tumour-associated endothelial cells that express a_v03 and a_v05 integrins. Thus, the genome of the second vector may comprise the RGD4C targeting peptide (CDCRGDCFC - SEQ ID No: 8).

In another embodiment, the second vector may comprise a second nucleic acid sequence encoding at least one pVIII capsid major coat protein that is configured to display a foreign peptide thereon. Thus, it may be desired to induce a mutation in the wild pVIII major coat protein of the phage vector in order to display a short peptide, for example less than 10 amino acids long. The short peptide may be a targeting moiety or have inherent biological/chemical functionality in vivo or in vitro. For example, immune stimulation in vivo via antigen display, or binding to nanoparticles (e.g., gold) in vitro via displaying a gold-binding peptide.

The first vector may be a member of the Retroviridae family, or of the Orthoretrovirinae Sub-family. The first vector may be a member of the Lentivirus genus. Preferably, the first vector is a member of the Parvoviridae family or subfamily. Preferably, the first vector is a member of the Dependoparvovirus, or adeno-associated virus species.

Once the first vector (i.e. the phage vector's genome) and the second vector (i.e. the helper phage) have been constructed, they are used together to produce, in a prokaryotic host, the phage vector of the first aspect. It will be appreciated that the packaging signal (e.g. the origin of replication) of the first vector, which is for enabling replication of the phage vector genome, functions to signal the second vector (i.e. the helper phage) structural proteins to package the genome (i.e. they work together in trans in the host) to create the particle of the first aspect. In a third aspect, there is provided a method for producing a phage vector from a prokaryotic host, the method comprising

(i) introducing, into a prokaryotic host cell, a first vector configured to persist inside a prokaryotic host, and comprising at least two singlestranded self-complementary transgene expression cassettes separated by a linker, which hybridise to form a double-stranded transgene expression cassette, and a packaging signal for enabling replication of the at least two single-stranded self-complementary transgene expression cassettes;

(ii) introducing, into the host, a helper phage comprising nucleic acid encoding bacteriophage structural proteins; and

(iii) culturing the host under conditions which result in the double-stranded transgene expression cassette, being packaged by the structural proteins to form and extrude a phage vector carrying the double-stranded transgene expression cassette from the prokaryotic host.

Advantageously, this results in very high yields of phage vectors. The first vector (i.e. the phage vector's genome) may be introduced into the host cell, for example by infection. The host cell may then be transformed with the helper phage, which results in the production of the phage vector. Preferably, the method comprises a purification step following the culturing step. Purification may comprise centrifugation and/or filtration.

In a fourth aspect, there is provided a method for producing a recombinant phagemid particle from a prokaryotic host, the method comprising :-

(i) introducing into a prokaryotic host cell: (a) a first vector configured to persist inside a prokaryotic host, and comprising at least two singlestranded self-complementary transgene expression cassettes separated by a linker, which hybridise to form a double-stranded transgene expression cassette, and a packaging signal for enabling replication of the at least two single-stranded complementary transgene expression cassettes, and (b) a second vector comprising nucleic acid encoding structural proteins required for packaging the double-stranded transgene expression cassette; and (ii) culturing the host under conditions which result in the double-stranded transgene expression cassette being packaged by the structural proteins to form and extrude a phage vector from the prokaryotic host.

Advantageously, this results in improved safety. The second vector (i.e. the helper phage) may be introduced into the host cell, for example by infection. The host cell may then be transformed with the first vector (i.e. the phage vector's genome), which results in the production of the phage vector. Preferably, the method comprises a purification step following the culturing step. Purification may comprise centrifugation and/or filtration.

In a fifth aspect, there is provided use of a helper phage comprising nucleic acid encoding viral vector structural proteins to produce the phage vector according to the first aspect from a prokaryotic host.

In a sixth aspect, there is provided a host cell comprising the first and/or second vector as defined in the second aspect.

The host cell is preferably prokaryotic, more preferably a bacterial cell. Examples of suitable host cells include: (i) TGI (Genotype: K-12 supE thi-1 A(lac-proAB) A(mcrB-hsdSM)5, (rn'mic'), Plasmids: F’ [traD36 proAB⁺ lacl^q lacZAM15]), (ii) DH5oF 'IQ™ (Genotype: F-q>80lacZAM15 A(lacZYA-argF) U169 recAl endAl hsdR17 (rk-, mk+) phoA supE44 A- thi-1 gyrA96 relAl, Plasmids: F' proAB-i- ladqZAM15 zzf: :Tn5 [KmR]; and (iii) XLl-Blue MRF ' (Genotype: A(mcrA)183 A(mcrCB- hsdSMR-mrr)173 endAl supE44 thi-1 recAl gyrA96 relAl lac, Plasmids: F' proAB ladqZAM15 TnlO (Tetr).

In another aspect, there is provided the phage vector according to the first aspect, or the system according to the second aspect, for use as an experimental research tool.

For example, the vector or system can be used ex vivo or in vitro.

Preferably, however, the vector is used therapeutically or in diagnostic methods, preferably in vivo. Thus, in a seventh aspect, there is provided the phage vector according to the first aspect, or the system according to the second aspect, for use in therapy or diagnosis.

The invention may be used for the treatment of a wide variety of diseases due to the target-specific nature and transduction efficiency of the phage vector of the invention. Consequently, the therapeutic opportunities of recombinant bacteriophages used in gene therapy may be significantly increased by the invention due to its ability to provide the host bacteria with two self-complementary transgene expression cassettes, which hybridise to form a double-stranded transgene expression cassette during phage particle manufacturing in the host bacteria. The invention may be used prophylactically to prevent disease, or after the development of a disease, to ameliorate and/or treat it.

Hence, in an eighth aspect, there is provided a phage vector according to the first aspect, or the system according to the second aspect, for use in a gene therapy technique.

In a ninth aspect, there is provided a method of treating, preventing or ameliorating a disease in a subject using a gene therapy technique, the method comprising administering, to a subject in need of such treatment, a therapeutically effective amount of the phage vector according to the first aspect or the system according to the second aspect.

It will be appreciated that the invention may be used to create a variety of different phage vectors that can be used for the treatment and/or diagnosis of a variety of diseases depending on the nature of the vectors and the displayed foreign proteins. For example, in an embodiment where the phage vector comprises a tumourtargeting ligand and/or which comprises a transgene expressing an anti-tumour gene (e.g. the HSVtk gene), then it may be used to treat cancer in combination with ganciclovir (GCV). The target cell in the gene therapy technique is preferably eukaryotic, and preferably mammalian.

The gene therapy technique therefore is preferably used to treat, prevent or ameliorate cancer. Tumours may be in the brain, e.g. medulloblastoma, glioblastoma, or diffuse intrinsic pontine glioma (DIPG). The phage vector may be used in combination with conventional treatments, such as chemotherapeutic drugs (i.e. doxorubicin, temozolomide, lomustine), radiation therapy, immune check point inhibitors (i.e. inhibitors of PD-1, PD-L1 or CTLA4) or other drugs/xenobiotic compound, including but not limited to inhibitors of histone deacetylases (HDAC inhibitors), proteasome inhibiting drugs and anticancer products from natural and dietary sources (i.e. genistein).

The inventors believe that the phage vector of the invention will have a significant commercial value in the delivery of peptide and/or DNA and/or adjuvant vaccines.

Thus, in a tenth aspect, there is provided a vaccine comprising the phage vector according to the first aspect or the system according to the second aspect.

In an eleventh aspect, there is provided the phage vector according to the first aspect, or the system according to the second aspect, for use in vaccine delivery to a subject.

Preferably, the vaccine is a peptide vaccine. The vaccine is preferably a DNA vaccine. The vaccine preferably comprises a suitable adjuvant. In an embodiment, the phage vector may be used to carry a transgene or DNA cassette (i.e. the at least two single-stranded self-complementary transgene expression cassettes which hybridise to form one double-stranded transgene expression cassette) encoding an antigen to stimulate the body's immune system. The phage vector may also be used to directly display and express the antigen of interest on the major pVIII coat proteins, thus providing an efficient platform for the simultaneous delivery, by a single phage particle, of numerous antigens as vaccine DNA vaccines, or proteins, or adjuvants readily expressed on the phage surface. The subject may be mammalian and is preferably human.

In a twelfth aspect, therefore, there is provided the phage vector according to the first aspect, or the system according to the second aspect, for use in delivering and targeting a foreign antigen to a tumour in a vaccinated subject.

Animals will first be vaccinated against foreign antigens, or already vaccinated against the antigen used, then the tumour-targeted vector will be administered to the vaccinated animals to deliver the foreign antigens to tumours, in order to induce an immune attack against these tumours. The inventors also believe that the phage vector of the invention can also be used in a variety of different genetic-molecular imaging techniques, such as positron emission tomography (PET), Ultrasound (US), SPECT imaging, functional magnetic resonance imaging, or bioluminescence imaging.

Hence, in a thirteenth aspect, there is provided use of the phage vector according to the first aspect, or the system according to the second aspect, in a genetic- molecular imaging technique.

The transgene harboured by the phagemid particle may encode HSVtk and/or the sodium/iodide symporter (NIS), and the particle is preferably used in combination with a radiolabelled substrate. For example, the human sodium/iodide symporter NIS) imaging gene is preferably used in combination with I¹²⁴ for clinically applicable positron emission tomography (PET) imaging, or with I¹²⁵/^99mTc- pertechnetate for clinically applicable SPECT imaging.

Alternatively, the HSVtk gene is preferably used in combination with radiolabelled nucleoside analogues such as the 20-[18F]-fluoro-20-deoxy-l-b-D-arabino- furanosyl-5-ethyluracil ([18F]FEAU).

It will be appreciated that the phage vectors and systems according to the invention (i.e. referred to hereinafter as "agents") may be used in a medicament which may be used in a monotherapy, or as an adjunct to, or in combination with, known therapies for treating, ameliorating, or preventing disease, such as cancer. For example, a combined therapeutic approach using the phage particles and systems of the invention with existing chemotherapeutics, such as Temozolamide, Doxorubicin or Genistein, is preferred.

In another preferred embodiment, therapy may comprise the combination of the phage vector and system of the invention with an extracellular matrix degrading agent, such as enzyme or losartan. The inventors believe that extracellular matrix degrading agents should enhance phage vector diffusion in the subject being treated, and especially within a solid tumour.

The agents according to the invention (i.e. the phage vector of the first aspect, or the system according to the second aspect) may be combined in compositions having a number of different forms depending, in particular, on the manner in which the composition is to be used. Thus, for example, the composition may be in the form of a powder, tablet, capsule, liquid etc., or any other suitable form that may be administered to a person or animal in need of treatment. It will be appreciated that the vehicle of medicaments according to the invention should be one which is well-tolerated by the subject to whom it is given.

Medicaments comprising the agents according to the invention may be used in a number of ways. For instance, oral administration may be required, in which case the agents may be contained within a composition that may, for example, be ingested orally in the form of a tablet, capsule or liquid. Compositions comprising agents of the invention may be administered by inhalation (e.g. intranasally). Compositions may also be formulated for topical use. For instance, creams or ointments may be applied to the skin.

Agents according to the invention may also be incorporated within a slow- or delayed-release device. Such devices may, for example, be inserted on or under the skin, and the medicament may be released over weeks or even months. The device may be located at least adjacent the treatment site. Such devices may be particularly advantageous when long-term treatment with agents used according to the invention is required and which would normally require frequent administration (e.g. at least daily injection).

In a preferred embodiment, agents and compositions according to the invention may be administered to a subject by injection into the blood stream or directly into a site requiring treatment. Injections may be intravenous (bolus or infusion), subcutaneous (bolus or infusion), intradermal (bolus or infusion), intraperitoneal or enhanced by convention (convection enhanced delivery - relevant to local injections at disease site).

It will be appreciated that the amount of the agent that is required is determined by its biological activity and bioavailability, which in turn depends on the mode of administration, the physiochemical properties of the agent (i.e. the phage vector or the system), and whether it is being used as a monotherapy, or in a combined therapy. The frequency of administration will also be influenced by the half-life of the agent within the subject being treated. Optimal dosages to be administered may be determined by those skilled in the art, and will vary with the particular agent in use, the strength of the pharmaceutical composition, the mode of administration, and the advancement of the disease. Additional factors depending on the particular subject being treated will result in a need to adjust dosages, including subject age, weight, gender, diet, and time of administration.

Generally, a daily dose of between O.Olpg/kg of body weight and 500mg/kg of body weight of the agent according to the invention may be used. More preferably, the daily dose is between O.Olmg/kg of body weight and 400mg/kg of body weight, and more preferably between O.lmg/kg and 200mg/kg body weight.

The agent may be administered before, during the or after the onset of disease. For example, the agent may be administered immediately after a subject has developed a disease. Daily doses may be given systemically as a single administration (e.g. a single daily injection). Alternatively, the agent may require administration twice or more times during a day. As an example, the agent may be administered as two (or more depending upon the severity of the disease being treated) daily doses of between 25mg and 7000 mg (i.e. assuming a body weight of 70 kg). A patient receiving treatment may take a first dose upon waking and then a second dose in the evening (if on a two dose regime) or at 3- or 4-hourly intervals thereafter.

Alternatively, a slow release device may be used to provide optimal doses of agents according to the invention to a patient without the need to administer repeated doses.

Known procedures, such as those conventionally employed by the pharmaceutical industry (e.g. in vivo experimentation, clinical trials, etc.), may be used to form specific formulations comprising the vectors or systems according to the invention and precise therapeutic regimes (such as daily doses of the agent and the frequency of administration).

Hence, in a fourteenth aspect of the invention, there is provided a pharmaceutical composition comprising the phage vector according to the first aspect, or the system according to the second aspect, and a pharmaceutically acceptable vehicle.

The composition can be used in the therapeutic amelioration, prevention or treatment of any disease in a subject that is treatable with gene therapy, such as cancer. The invention also provides, in a fifteenth aspect, a process for making the pharmaceutical composition according to the twelfth aspect, the process comprising contacting a therapeutically effective amount of the phage vector according to the first aspect, or the system according to the second aspect, with a pharmaceutically acceptable vehicle.

A "subject" may be a vertebrate, mammal, or domestic animal. Hence, agents, compositions and medicaments according to the invention may be used to treat any mammal, for example livestock (e.g., a horse or a dog), pets, or may be used in other veterinary applications. Most preferably, however, the subject is a human being.

A "therapeutically effective amount" of agent (i.e., phage vector) is any amount which, when administered to a subject, is the amount of drug that is needed to treat the target disease, or produce the desired effect, e.g. result in effective delivery of the transgene to a target cell or tissue, such as result in tumour killing.

For example, the therapeutically effective amount of agent used may be from about 0.01 mg to about 800 mg, and preferably from about 0.01 mg to about 500 mg.

A "pharmaceutically acceptable vehicle" as referred to herein, is any known compound or combination of known compounds that are known to those skilled in the art to be useful in formulating pharmaceutical compositions.

In one embodiment, the pharmaceutically acceptable vehicle may be a solid, and the composition may be in the form of a powder or tablet. A solid pharmaceutically acceptable vehicle may include one or more substances which may also act as flavouring agents, lubricants, solubilisers, suspending agents, dyes, fillers, glidants, compression aids, inert binders, sweeteners, preservatives, dyes, coatings, or tablet-disintegrating agents. The vehicle may also be an encapsulating material. In powders, the vehicle is a finely divided solid that is in admixture with the finely divided active agents according to the invention. In tablets, the active agent (e.g. the particle or system of the invention) may be mixed with a vehicle having the necessary compression properties in suitable proportions and compacted in the shape and size desired. The powders and tablets preferably contain up to 99% of the active agents. Suitable solid vehicles include, for example calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidine, low melting waxes and ion exchange resins. In another embodiment, the pharmaceutical vehicle may be a gel and the composition may be in the form of a cream or the like.

However, the pharmaceutical vehicle may be a liquid, and the pharmaceutical composition is in the form of a solution. Liquid vehicles are used in preparing solutions, suspensions, emulsions, syrups, elixirs and pressurized compositions. The particles or system according to the invention may be dissolved or suspended in a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats. The liquid vehicle can contain other suitable pharmaceutical additives such as solubilisers, emulsifiers, buffers, preservatives, sweeteners, flavouring agents, suspending agents, thickening agents, colours, viscosity regulators, stabilizers or osmoregulators. Suitable examples of liquid vehicles for oral and parenteral administration include water (partially containing additives as above, e.g. cellulose derivatives, preferably sodium carboxymethyl cellulose solution), alcohols (including monohydric alcohols and polyhydric alcohols, e.g. glycols) and their derivatives, and oils (e.g. fractionated coconut oil and arachis oil). For parenteral administration, the vehicle can also be an oily ester such as ethyl oleate and isopropyl myristate. Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration. The liquid vehicle for pressurized compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.

Liquid pharmaceutical compositions, which are sterile solutions or suspensions, can be utilized by, for example, intramuscular, intrathecal, epidural, intraperitoneal, intravenous and particularly subcutaneous injection. The vector or system may be prepared as a sterile solid composition that may be dissolved or suspended at the time of administration using sterile water, saline, or other appropriate sterile injectable medium.

The phage vector, system and pharmaceutical compositions of the invention may be administered orally in the form of a sterile solution or suspension containing other solutes or suspending agents (for example, enough saline or glucose to make the solution isotonic), bile salts, acacia, gelatin, sorbitan monoleate, polysorbate 80 (oleate esters of sorbitol and its anhydrides copolymerized with ethylene oxide) and the like. The particles and system according to the invention can also be administered orally either in liquid or solid composition form. Compositions suitable for oral administration include solid forms, such as pills, capsules, granules, tablets, and powders, and liquid forms, such as solutions, syrups, elixirs, and suspensions. Forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.

It will be appreciated that adeno-associated virus (AAV) is often the vector of choice for gene therapy. As a gene delivery vector, lentiviral vectors also have key several advantages over other systems. Firstly, they have a large packaging capacity of at least 8 Kb of DNA, which is an important feature when packaging sizeable expression cassettes of tissue-specific promoters and transgenes.

Secondly, they differ from simpler retroviruses not only in the genome organisation, but also in that they are able to transduce non-dividing cells, which is a very useful quality when considering application as a gene therapy vector to non-proliferating tissues such as muscle, neurons and haematopoietic stem cells. In addition, lentivectors have reduced immunogenicity compared to adenoviral vectors, making it possible to consider systemic delivery routes. However, barrier of using AAV or lentivirus for laboratory and clinical research include their extremely high production cost and low yields.

In addition to exhibiting useful applications in gene therapy, imaging and vaccine delivery, the phage vector of the invention can also be used to produce recombinant viral vectors, such as AAV or lentivirus, in vitro or in vivo (including in situ). Phage-guided AAV production utilizes the ability of the phage vectors to package large amounts of single-stranded ssDNA. A typical AAV production system consists of three major elements: rAAV, rep-cap and adenohelper genes, which function together to produce rAAV particles.

Thus, in a sixteenth aspect, there is provided use of the phage vector according to the first aspect or the system according to the second aspect, to produce a recombinant viral vector comprising or derived from the viral genome within the genome of the phage vector. In a seventeenth aspect, there is provided a method for producing a recombinant viral vector, the method comprising introducing into, a eukaryotic host cell, the phage vector according to the first aspect, or the system according to the second aspect, and allowing the host cell to produce the recombinant viral vector.

Preferably, the recombinant viral vector is a recombinant mammalian virus, a rAAV, a recombinant self-complementary AAV vector, or a recombinant lentivirus vector. In other words, the recombinant viral vector may be a conventional AAV vector or the self-complementary AAV vector of the first aspect. Preferably, the phage vector according to the first aspect, or the system according to the second aspect is used in cis and/or trans together with the delivery and/or presence of other genetic elements required for the production of mammalian viruses, as determined by the phage vector's genome, inside the eukaryotic host cell. The method used to assist or enhance gene transfer to the host cell by the phagemid particle includes those described in WO 2014/184528 (i.e. multifunctional) and WO 2014/184529 (i.e. combination with a cationic polymer to form a complex having a net positive charge).

The eukaryotic host cell may be mammalian. The host cell may comprise or be derived from Human Embryonic Kidney Cells (HEK293), Spodoptera frugiperda pupal ovarian tissue (Sf9), or Chinese Hamster Ovary (CHO). Insect cells are also envisaged.

In one embodiment, the host cell may be transformed with one or more phage vector genome carrying genes selected from the group consisting of: rAAV, lentivirus, capsid, replication, helper protein encoding genes, and any other genes required for the expression and packaging of mammalian viruses.

For example, in phage vector-guided rAAV/scAAV production, the rAAV gene or self-complementary AAV sequences may be carried by the phage vector according to the first aspect, and the adenohelper and rep-cap genes may be carried on separate vectors, or be integrated into the eukaryotic host genome. Any combinations of the rAAV, rep-cap and adenohelper genes may be carried on one or more vectors, i.e. in cis or trans configurations. Alternatively, rep-cap or adenohelper proteins, in the context of rAAV production, could also be integrated or introduced into the eukaryotic host as a stably expressed accessory DNA (e.g. a plasmid), whereby the phage vector supplies the recombinant viral genome for packaging into a recombinant virus, as determined by the transgene cassette inside the phage vector's genome.

The method may be carried out in vivo, in vitro, ex vivo, or in situ. For in situ production, the phage vectors preferably comprise a targeting moiety for the target eukaryotic cell that is the designated eukaryotic host. Preferably, in the context of in situ, ex vivo and in vivo virus production, the designated eukaryotic host cell type is a diseased cell. Preferably, the diseased cell is a malignant or benign tumour. In the context of in vitro virus production, preferably the eukaryotic host is a derivative of any of the eukaryotic hosts listed above. The application of the phage vectors and genetic elements required for the production of recombinant virus (as determined by the transgene cassette in the phage vector), could be in any fashion as indicated earlier, either in cis-acting or trans-acting combinations, inside the eukaryotic host cell.

It will be appreciated that the invention extends to any nucleic acid or peptide or variant, derivative or analogue thereof, which comprises substantially the amino acid or nucleic acid sequences of any of the sequences referred to herein, including functional variants or functional fragments thereof. The terms "substantially the amino acid/polynucleotide/polypeptide sequence", "functional variant" and "functional fragment", can be a sequence that has at least 40% sequence identity with the amino acid/polynucleotide/polypeptide sequences of any one of the sequences referred to herein, for example 40% identity with the nucleic acids identified herein.

Amino acid/polynucleotide/polypeptide sequences with a sequence identity which is greater than 65%, more preferably greater than 70%, even more preferably greater than 75%, and still more preferably greater than 80% sequence identity to any of the sequences referred to is also envisaged. Preferably, the amino acid/polynucleotide/polypeptide sequence has at least 85% identity with any of the sequences referred to, more preferably at least 90% identity, even more preferably at least 92% identity, even more preferably at least 95% identity, even more preferably at least 97% identity, even more preferably at least 98% identity and, most preferably at least 99% identity with any of the sequences referred to herein.

The skilled technician will appreciate how to calculate the percentage identity between two amino acid/polynucleotide/polypeptide sequences. In order to - ‘2^ - calculate the percentage identity between two amino acid/polynucleotide/polypeptide sequences, an alignment of the two sequences must first be prepared, followed by calculation of the sequence identity value. The percentage identity for two sequences may take different values depending on:- (i) the method used to align the sequences, for example, ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, for example, local vs global alignment, the pair-score matrix used (e.g. BLOSUM62, PAM250, Gonnet etc.), and gap-penalty, e.g. functional form and constants.

Having made the alignment, there are many different ways of calculating percentage identity between the two sequences. For example, one may divide the number of identities by: (i) the length of shortest sequence; (ii) the length of alignment; (iii) the mean length of sequence; (iv) the number of non-gap positions; or (iv) the number of equivalenced positions excluding overhangs. Furthermore, it will be appreciated that percentage identity is also strongly length dependent. Therefore, the shorter a pair of sequences is, the higher the sequence identity one may expect to occur by chance.

Hence, it will be appreciated that the accurate alignment of protein or DNA sequences is a complex process. The popular multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et al., 1997, Nucleic Acids Research, 24, 4876-4882) is a preferred way for generating multiple alignments of proteins or DNA in accordance with the invention. Suitable parameters for ClustalW may be as follows: For DNA alignments: Gap Open Penalty = 15.0, Gap Extension Penalty = 6.66, and Matrix = Identity. For protein alignments: Gap Open Penalty = 10.0, Gap Extension Penalty = 0.2, and Matrix = Gonnet. For DNA and Protein alignments: ENDGAP = -1, and GAPDIST = 4. Those skilled in the art will be aware that it may be necessary to vary these and other parameters for optimal sequence alignment.

Preferably, calculation of percentage identities between two amino acid/polynucleotide/polypeptide sequences is then calculated from such an alignment as (N/T)*100, where N is the number of positions at which the sequences share an identical residue, and T is the total number of positions compared including gaps and either including or excluding overhangs. Preferably, overhangs are included in the calculation. Hence, a most preferred method for calculating relative percentage identity between two sequences comprises (i) preparing a sequence alignment using the ClustalW program using a suitable set of parameters, for example, as set out above; and (ii) inserting the values of N and T into the following formula:- Sequence Identity = (N/T)*100.

Alternative methods for identifying similar sequences will be known to those skilled in the art. For example, a substantially similar nucleotide sequence will be encoded by a sequence which hybridizes to a nucleic acid sequence described herein, or their complements under stringent conditions. By stringent conditions, we mean the nucleotide hybridises to filter-bound DNA or RIMA in 3x sodium chloride/sodium citrate (SSC) at approximately 45°C followed by at least one wash in 0.2x SSC/0.1% SDS at approximately 20-65°C. Alternatively, a substantially similar polypeptide may differ by at least 1, but less than 5, 10, 20, 50 or 100 amino acids from the sequences shown herein.

Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence could be varied or changed without substantially affecting the sequence of the protein encoded thereby, to provide a functional variant thereof. Suitable nucleotide variants are those having a sequence altered by the substitution of different codons that encode the same amino acid within the sequence, thus producing a silent change. Other suitable variants are those having homologous nucleotide sequences but comprising all, or portions of, sequence, which are altered by the substitution of different codons that encode an amino acid with a side chain of similar biophysical properties to the amino acid it substitutes, to produce a conservative change. For example small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large non-polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine. The polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine. The positively charged (basic) amino acids include lysine, arginine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be appreciated which amino acids may be replaced with an amino acid having similar biophysical properties, and the skilled technician will know the nucleotide sequences encoding these amino acids.

All of the features described herein (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined with any of the above aspects in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.

For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:-

Figure 1 shows schematic representations of the DNA constructs of prior art M13 phage-derived single-stranded DNA vectors, i.e. adeno-associated virus/phage ("AAVP") and prior art phagemid adeno-associated virus ("PAAV") vectors, compared to the new self-complementary phage particle according to the invention ("self-complementary phage", hereinafter referred to as "self-complementary phage particle or "scPhagemid"), which may be M13 or AAV. In the invention, a phagemid carrying two single-stranded self-complementary transgene expression cassettes is used as the DNA backbone to induce hybridization of the transgene cassettes, in the host bacteria, subsequently producing a double-stranded transgene cassette to be packaged by a phage capsid. The definition of a "phagemid" is a plasmid DNA containing a replication ori of phage, thus the name Phagemid. Here, the inventors used the phagemid as the DNA backbone to design the new phage genome carrying two transgene cassettes. The produced double stranded vector is a phage particle. Prior art AAVP contains the full phage genome and a single mammalian transgene cassette flanked by the ITR sequences derived from the AAV2 virus (6). Prior art PAAV particles, on the other hand, are based on a phagemid design in which the single transgene cassette is included, and a helper phage is required to provide the structural genes during production (8). By contrast, the latest generation phage vector according to the invention (i.e. the "self-complementary phage particle", or "scPhagemid"), carries an additional transgene cassette compared to the AAVP and PAAV. The two cassettes are the same and separated by an inverted terminal repeat (ITR) linker from AAV, but are disposed in opposite orientations, i.e. the first cassette extends in the 5' to 3' direction, whereas the second cassette extends in the 3' to 5' direction as shown in Figure 1. As can be seen, the cassettes are the same but extend in opposite or anti-parallel directions, either side of the ITR which separates them. A second AAV ITR is included to flank one transgene cassette. In the same way as for PAAV, a helper phage provides the structural genes to "singlestranded complementary phage" for it to replicate. Figure 2 illustrates how the single-stranded self-complementary phagemid of the invention, "scPhagemid" or"scPP", enables hybridization between the two complementary transgene expression cassettes either side of the ITR linker, thereby creating a dsDNA of the transgene expression cassette resembling a hairpin loop structure.

Figure 3 shows the cloning strategy used to produce the phagemid backbone carrying complementary transgene expression cassettes for the production of scPP delivering a green fluorescent protein (GFP). The full GFP transgene expression cassette from promoter to poly A signal was amplified from a phagemid by PCR using primers containing Pcil restriction sites. The insert was then cloned in the Pcil site of the same phagemid. The final phagemid contains two complementary GFP transgene expression cassettes and two AAV2-ITRs, one left ITR linking the two transgene cassettes and the second right ITR flanking one cassette. As can be seen, the cassettes are the same but extend in opposite or anti-parallel directions, either side of the left ITR, and hybridization can occur between the two complementary transgene expression cassettes either side of the ITR linker, thereby creating dsDNA.

Figure 4 shows GFP expression of B16-F1 cells at day five following transduction with targeted RGD4C.scPP (i.e. the phage vector according to the invention having formed a dsDNA hairpin loop structure) or RGD4C.PAAV vectors (i.e. the single stranded phage vector used as control for comparison). A) Microscopic imaging of cells using a fluorescent microscope; B) quantification of GFP-positive cells by FACS analysis.

Figure 5 summarises the constructs used to assess gene delivery efficacy, i.e. PAAV, scPP (the phage vector according to the invention), and cwPP. PAAV illustrates a phage vector having one copy of an expression cassette flanked by AAV ITRs, scPP illustrates the phage particle vector of the invention with two expression cassettes in opposite orientations, which would form dsDNA, and cwPP illustrates a control phage particle carrying the two Lucia transgene cassette in the same orientation, i.e. clockwise (cw), such that the cassettes cannot hybridise to form dsDNA. Particles carrying the reporter genes Lucia or GFP, as well as the therapeutic genes TNFo, IL15 and TRAIL were used. Figure 6 is a comparison of Lucia gene expression between targeted RGD4C.scPP- Lucia (i.e. the phage vector of the invention) and targeted RGD4C.PAAV. -Lucia in B16-F1 melanoma cells. Various doses of vectors: 25.000, 50.000, 100.000, 500.000 and 10⁶ TU/cell were used to transduce cells. Error bars represent standard error of the mean (SEM). One-way ANOVA was used for statistical analysis for each day and construct followed by selected multiple comparisons: compared by pairs double-stranded vs single-stranded vectors. Cells treated with non-targeted vectors (scPP-Lucia or PAAV-Lucia), lacking RGD4C, and untreated cells were also included in the experiments. Data are show as Relative Luminescent Units (RLU). Experiments were repeated several times, at least n=5 biological repeats, each with n=3 technical repeats.

Figure 7 shows confirmation of the superiority of the scPP vector (i.e. the phage vector according to the invention) in B16-F1 cells at 100.000 TU/cell, compared to single-stranded PAAV batches prepared by two different researchers.

Figure 8 illustrates examples of data on B16-F1 cells from four experiments using vectors at a dose of 10⁶ TU/cell.

Figure 9 shows the comparison of Lucia gene expression in B16-F1 melanoma cells at various doses as in Figure 6. Error bars represent SEM. One-way ANOVA was used for statistical analysis for each day and construct, followed by selected multiple comparisons: compared by pairs ds vs ss vectors. Cells treated with nontargeted vectors scPP or PAAV, lacking RGD4C, and untreated cells were also included in the experiments. Data are show as RLU. Experiments were repeated several times, at least n=5 biological repeats, each with n=3 technical repeats.

Figure 10 shows the comparison of Lucia gene expression in human HEK293 cells at various doses: 100.000, 500.000 and 10⁶ TU/cell. Error bars represent SEM. One-way ANOVA was used for statistical analysis for each day and construct followed by selected multiple comparisons: compared by pairs ds vs ss vectors. Cells treated with non-targeted vectors scPP or PAAV, lacking RGD4C, and untreated cells were also included in the experiments. Data are show as RLU. Experiments were repeated several times, at least n=5 biological repeats, each with n=3 technical repeats. Figure 11 shows the comparison of Lucia gene expression in RMS metastatic cancer cells at 100.000, 500.000 and 10⁶ TU/cell. Error bars represent SEM. Oneway ANOVA was used for statistical analysis for each day and construct followed by selected multiple comparisons: compared by pairs ds vs ss vectors. Cells treated with scPP or PAAV, lacking RGD4C, and untreated cells were also included in the experiments. Data are show as RLU. Experiments were repeated several times, at least n = 5 biological repeats, each with n=3 technical repeats.

Figure 12 shows the comparison of Lucia gene expression in human A549 lung carcinoma cells at 500.000 and 10⁶ TU/cell. Error bars represent SEM. One-way ANOVA was used for statistical analysis for each day and construct followed by selected multiple comparisons: compared by pairs ds vs ss vectors. Cells treated with non-targeted vectors scPP or PAAV, lacking RGD4C, and untreated cells were also included in the experiments. Data are show as RLU. Experiments were repeated several times, at least n=5 biological repeats, each with n=3 technical repeats.

Figure 13 illustrates confirmation of the data on Lucia gene expression in human A549 lung carcinoma cells at 100.000 and 10⁶ TU/cells, by a different researcher.

Figure 14 is a comparison of Lucia gene expression in human MCF7 breast cancer cells at 100.000 TU/cell. Error bars represent SEM. One-way ANOVA was used for statistical analysis for each day and construct followed by selected multiple comparisons: compared by pairs ds vs ss vectors. Cells treated with non-targeted vectors scPP or PAAV, lacking RGD4C, and untreated cells were also included in the experiments. Data are shown as RLU. Experiments were repeated several times, at least n = 5 biological repeats, each with n=3 technical repeats.

Figure 15 illustrates ELISA quantification of secreted TNFo at days 4 (D4) and 6 (D6) post transduction of B16-F1 cells with scPP (i.e. the phage vector according to the invention) or PAAV carrying the TNFo gene at 500,000 (500k), IxlO⁶ (IM) or 4xl0⁶ (4M) TU/cell. One-way ANOVA was used for statistical analysis for each day and construct followed by selected multiple comparisons: compared by pairs ds vs ss vectors. Cells treated with non-targeted vectors scPP or PAAV, lacking RGD4C, and untreated cells were also included in the experiments. Figure 16 illustrates ELISA quantification of secreted IL15 at day 4 post transduction of B16-F1 cells with RGD4C.scPP (i.e. the phage vector according to the invention) or RGD4C.PAAV carrying the IL15 gene at 500.000 (500k), 10⁶ (IM) and 4xl0⁶ (4M) TU/cell. One-way ANOVA was used for statistical analysis for each day and construct followed by selected multiple comparisons: compared by pairs ds vs ss vectors. Cells treated with non-targeted vectors (M13) and untreated cells were also included in the experiments.

Figure 17 illustrates ELISA quantification of secreted IL15 at day 4 post transduction of B16-F10 melanoma cells with RGD4C.scPP (i.e. the phage vector according to the invention) or RGD4C.PAAV carrying the IL15 gene at 500.000 (500k), 10⁶ (IM) and 4xl0⁶ (4M) TU/cell. One-way ANOVA was used for statistical analysis for each day and construct followed by selected multiple comparisons: compared by pairs ds vs ss vectors. Cells treated with non-targeted vectors scPP or PAAV, lacking RGD4C, and untreated cells were also included in the experiments.

Figure 18 illustrates ELISA quantification of secreted TRAIL at day 4 post transduction of human osteosarcoma cells with RGD4C.scPP (i.e. the phage vector according to the invention) or RGD4C.PAAV carrying a secreted form of TRAIL gene at 500.000 TU/cell. Cells treated with empty RGD4C.scPP vector (no TRAIL or mock) and untreated cells were also included in the experiments. RGD4C.scPP vector carrying a transmembrane form of TRAIL (RGD4C.scPP-TRAIL) was also used to transduce cells.

Figure 19 compares gene delivery to subcutaneous solid tumours, human osteosarcoma, in immunodeficient mice following intravenous administration of RGD4C.scPP (i.e. the phage vector according to the invention) and RGD4C.PAAV vectors at 5xlO¹⁰ TU/mouse. Tumours and healthy tissues were harvested at day 7 post vector administration. Non-targeted vectors, scPP or PAAV, lacking RGD4C, and untreated mice were included in the experiment.

Figure 20 illustrates phage diffusion in Matrigel. scPP and PAAV vectors were labelled with FITC and inoculated into Matrigel at 5mg/ml. Images were taken with a fluorescence microscope at inoculation (t=0) and after 18h (t=18). Figure 21 illustrates internalisation of phage particles in B16-F1 cells. A) FACS analysis of cells using an anti-phage antibody; B) qPCR using primers for the ampicillin gene, located outside the transgene cassette, in the vectors.

Figure 22 compares transduction efficiency between scPP (i.e. the phage vector according to the invention) and controls cwPP, and awPP vectors. A) Schematic representation of the three vectors used. The ITRs are represented in blue and the transgenes with their orientation. B) B16F1 cells were transduced with Lucia encoding vectors at 10⁶ TU per cell. The graph shows a representative experiment (n=3) of two replicates and indicates the luminescence measures corresponding to day 4 post transduction are shown. One-way ANOVA was used to report statistical differences assuming an o=0.05.

Figure 23 compares transduction efficiency between scPP (i.e. the phage vector according to the invention) and a mixture of cwPP, and awPP. A) Schematic representation of the transductions and possible hybridizations. The ITRs are represented in blue and the transgenes in their orientation. B) B16F1 cells were transduced with Lucia encoding vectors at 10⁶ TU per cell or a mixture of 5xl0⁵ TU/cell of cwPP + 5xl0⁵ TU/cell of awPP. The graph shows a representative experiment (n=3) of two replicates and indicates the luminescence measures corresponding to day 4 post transduction are shown. One-way ANOVA was used to report statistical differences assuming an o=0.05.

Figure 24 shows phage particle measurement from TEM images. A) TEM images of the different phage particles. B) Size quantification of phage particles. Two different stocks were imaged for each type of particle and a total of 100 particle quantified for each phage. Statistical differences were calculated using One-way ANOVA between the four samples. Only shown are the pairs with no statistical difference.

Figure 25 shows analysis of scPP, PAAV and helper phage vectors to determine their particle size. A) Two different preparations were analysed for each type of vector and a total of 100 particles measured from acquired TEM images. B) Whole phage particles were loaded onto an agarose gel under native conditions.

Figure 26 illustrates self-hybridisation of the transgene cassette during production of scPP (i.e. the phage vector according to the invention) in bacteria. A) Schematic presentation of the hypothesis. The hypothesized intramolecular hybridization form of the scPP genome is presented. This would create a dsDNA target for BamHI digestion within the transgene (orange box). The digested genome should produce a 1,898 bp ds DNA fragment, which, if denatured, would result in a 3,796b ssDNA band. B) Comparison between BamHI-digested and undigested scP-Lucia genome samples. C) Migration analysis of the denatured Ikb Plus DNA ladder. Aliquots of Ikb Plus DNA Ladder and linearized pAAV GFP plasmid (5,378bp) were run in their native and denatured forms on IM Urea denaturing agarose gel. The 5,000bp DNA ladder band transforms into a double band when the ladder sample is denatured. D) Proof of the ability of the scPP-Lucia phage genome to form a ds DNA fragment. The l,898bp digested fragment obtained after BamHI digestion of the phage genome was run either in its native (left) or denatured (right) form alongside the Ikb Plus DNA ladder treated in the same way. The denatured sample ran at the same speed as the 4OOObp DNA ladder band.

Figure 27 shows how hydroxyurea supresses gene expression from the PAAV vector. A) Time course Lucia gene expression in B16-F1 cells transduced with vectors in the presence of hydroxyurea (HU). B) A control experiment was also performed side-by-side where cells received water instead of HU. C) graph shows Lucia gene expression data at day 6 post transduction of B16-F1 in the presence of HU. D) Graph shows Lucia gene expression in the absence of HU at day 6 post transduction.

Figure 28 shows a comparison of Lucia reporter gene delivery to metastatic human osteosarcoma 143B cells, between PAAV and scPP over a time course from day 1 to day 3, following treatment with increasing doses of vectors. Lucia expression is presented as relative luminescent unit (RLU). The vectors were targeted to tumour cells using the RGD4C ligand. Non-targeted vectors (NT) were used as controls.

Figure 29 shows a comparison of delivery of the secreted cytokine TRAIL (i.e. soluble TRAIL (sTRAIL)) to metastatic human osteosarcoma 143B cells, between PAAV and scPP. Shown are ELISA data used to quantify the release of the sTRAIL protein into the media of cancer cells upon treatment with vectors.

Figure 30 shows the induction of osteosarcoma cell death, in vitro, following treatment with the scPP-sTRAIL encoding the secreted sTRAIL. Figure 31 shows an assessment of toxicity. No increase of the toxicity biomarker LDH (lactate dehydrogenase) in mice with established osteosarcoma following administration of the RGD4C.scPP vector encoding the sTRAIL.

Figure 32 shows biodistribution of sTRAIL delivery in tumour-bearing mice with established osteosarcoma, following systemic treatment with PAAV and scPP encoding the sTRAIL.

Figure 33 shows immunofluorescence staining of tumours showing expression of the sTRAIL protein following treatment with the RGD4C.PAAV and RGD4C.scPP encoding the sTRAIL. Higher sTRAIL production was detected in tumours of mice receiving the RGD4C.scPP.

Figure 34 shows hematoxylin and eosin staining of tumours showing extensive tumour damage following systemic treatment with the RGD4C.scPP-sTRAIL as compared to untreated group of mice, or mice injected with the non-targeted NT vector.

The inventors set out to provide a novel phage vector comprising a self- complementary sequence of a transgene expression cassette to achieve hybridisation during production in the host bacteria, or upon transduction of mammalian cells, subsequently delivering a double-stranded DNA of the mammalian transgene cassette. The novel phage vector addresses the problems associated with working with double stranded phages due to their capsid and large genomes, and also overcomes problems associated with AAVs. This novel phage vector is referred to throughout the examples as a self-complementary phage particle or scPP. To prove that the scPP provides better gene delivery than the prior art, the inventors used reporter genes, such as GFP and luciferase. The inventors then used TRAIL or soluble TRAIL (sTRAIL) to endorse their findings and further prove that the scPP particle performs surprisingly better for gene delivery. When using genes, such as TRAIL, the inventors also demonstrated cancer cell death, which shows that the vector can be used to deliver therapeutic genes.

Materials and Methods

Molecular cloning of constructs The green fluorescent protein (GFP) transgene cassette from promoter to polyadenylation signal, and flanked by AAV2 ITRs, was amplified from the pAAV- GFP plasmid (Cell Biolabs) by PCR with primers containing the Pcil restriction sites. The plasmid backbone and the PCR insert were then digested with Pcil (NEB, UK) and ligated overnight with T4 ligase (NEB, UK). The construct was then transformed into DH5o Escherichia coli (E. coli). Subsequently, plasmids were extracted from different bacterial colonies by Miniprep (Qiagen) and validated by restriction enzyme digestion and DNA sequencing (Eurofins). The correct clone was then transformed into TGI Mix&Go competent E. coli (Zymo research, USA) for phage vector production. A schematic representation of the cloning strategy is represented in Figure 3. To generate phage particles carrying TNFo, TRAIL or IL15 transgenes, GFP was replaced by the corresponding DNA encoding sequences.

TGI Mix&Go (Zymo research, USA) was transformed with the backbone DNA constructs of vectors. Double tandem vectors (control phage particles which encode both transgene copies in the same orientation, either clockwise (cw) or anticlockwise (aw)) were grown in 2xYT broth until ODeoonm reached a value of 0.3-0.6, indicative of bacterial exponential growth phase. At this point the bacterial culture was infected with the appropriate helper phage (whether targeted - displaying RGD4C - or non-targeted (NT) M13phage), and the culture was incubated 15 min at 37°C. After this time, the cultures were added to 2xYT broth supplemented with 50pg/ml kanamycin and lOOpg/ml carbenicillin antibiotics and grown overnight at 32°C and 160rpm. The following day, cultures were spun down at 6,000g during 15 min at 4°C. The supernatant was collected and mixed with 0.4 volumes of 21mM PEG (MW8000) I 3.36M NaCI I 1% Triton X-100 and left overnight at 4°C. The solution was then centrifuged 30 min at 10,000g at 4°C. The pellet was resuspended in PBS and mixed with 0.5 volumes of 21mM PEG/ 3.36M NaCI and left overnight at 4°C. A new centrifugation step was carried at 10,000g during 30 min at 4°C and the pellet was resuspended in a small volume of phosphate buffer saline (PBS) by gentle shaking at 37°C during 3h at 120rpm. Residual bacterial contamination was eliminated from the dissolved pellet by a 10 min centrifugation step at 10,000g at room temperature and the resulting supernatant filtered through a 0.45pm filter cartridge. The purity of the produced phages in terms of targeting was then checked with a PCR to confirm the presence of the RGD4C encoding sequence in the pill capsid protein gene, and further analysed with a 2% agarose gel. Titration of the phage particles

Phage particles were quantified in prokaryotic hosts. Serial dilutions of phage were made in PBS and used to infect TGI E. coli grown to log phase in 2xYT medium, which were subsequently incubated at 37°C. After 20 minutes incubation at 37°C in a water bath, the particles/bacteria mixture was mixed well again, and was plated on solid agar medium with selective antibiotics. The phage particles contain an ampicillin resistant gene, so TYE top agar with lOOpg/ml ampicillin was used. Whereas the helper phage contains a kanamycin resistant gene, so TYE top agar with 50|jg/ml kanamycin was used. The bacteria were plated on TYE top agar in the presence of ampicillin to determine the concentration of scPP particles and kanamycin to determine the concentration of helper phage present in the sample by colony counting. Phage particles are expressed as bacterial transducing units TU/ul.

Intramolecular self-hybridization of the transqene cassettes in the self- scPP was first treated with DNAse-I, then its genome was extracted. Briefly, the sample was treated with lOOmM Tris-HCI 25mM EDTA pH8 and phage capsids lysed with 4% SDS at 70°C during 10 min. The sample was then mixed with 3M potassium acetate at pH5.5 and centrifuged at 12,000g during 10 min at room temperature to precipitate the phage capsid proteins. An anion-exchange column (Midiprep Qiagen kit) was equilibrated with 0.1 M Sodium acetate, pH 5.0 0.6 M NaCI 0.15% (v/v) Triton X-100. The supernatant from the centrifugation step was then loaded into the column allowing the solution to drain by gravity flow. The column was then washed twice with 0.1 M Sodium acetate, pH5.0 825 mM NaCI. The sample was eluted with QF elution buffer (Qiagen). The resulting sample was further purified with Isopropanol-ethanol precipitation and resuspended in TE buffer (Qiagen).

The concentration of the extracted phage genome was measured assuming a ssDNA sample (1 OD260 Unit = 33 pg/ml ssDNA). The genome was then digested with BamHI (NEB, UK) and run on an agarose gel. The 2,000bp band was gel extracted with a gel extraction kit (Qiagen) and isopropanol-ethanol precipitated. The extracted DNA band and an aliquot of the Ikb Plus DNA ladder (Thermo Fisher) were then mixed with 0.5 mg/ml bromophenol blue, 8M urea, 1% (v/v) Triton X- 100 and ImM Tris pH 8. Half of each of the samples (extracted band and ladder) were then denatured at 80°C for 5 min. Denatured and undenatured forms of both the DNA ladder and the extracted band were then loaded in a denaturing IM urea 1.2% agarose gel and run during 4h at 55V on ice. The gel was stained for 2h in a solution of 0.5ug/|jl ethidium bromide in TAE buffer at room temperature.

As the DNA ladder size-reference bands migrate differently in native and denatured conditions, an additional control was used to confirm the migration of these reference bands. For this, denatured samples of the linearized scPP-GFP plasmid (5,378bp) and ladder were run side by side in a urea denaturing gel.

Transduction of cells and lucia expression

Adherent cells were seeded in well plates/tissue culture dishes of preferred sizes to achieve 70-80% confluence 48 hours after seeding. On the day of transduction, the average number of cells per well/dish culture was determined and used for calculating the amount of phage particles to add to the cells. The transduction mixture is then prepared by diluting the appropriate amount of the particles stock solution in serum-free medium, then mixing thoroughly. The recommended volume of transduction mixture used per well/dish is the minimum volume required to completely cover the cell monolayer. To transduce cells, medium was discarded and the transduction mixture was added to the cells for 6-12 hours at 37°C 5% CO2 before supplementation with an equal volume of complete medium. After 24 hours, the whole medium was discarded and replaced with fresh medium. The transduced cells were maintained in culture until analysis.

Quantification of secreted luciferase expression in the culture medium

At specified time points post-transduction with phage particles carrying the Lucia DNA sequence, lOuL of culture medium was collected from wells and transferred in to opaque 96-microwell plates. Luciferase activity was quantified using QUANTI- Luc, a luciferase substrate was prepared according to the manufacturer's protocol (Invivogen, France) and added to the microwell plate. Luciferase activity was measured using a GloMax Discover Microplate Luminometer (Promega, UK). For these experiments, the culture medium was not changed at any time point.

GFP expression in transduced cells

Cells transduced with scPP-GFP, and the proportion of transduced cells were analysed either by FACS or fluorescence microscopy. Transmission electron microscopy (TEM)

Carbon film-coated copper mesh grids were glow discharged to induce hydrophilicity. Phage particles were applied on the grids, left to incubate for 10-15 minutes and removed by blotting on absorbent paper. The grids were then washed with sterile-filtered deionised water, blotted on absorbent paper twice and dried for 15 minutes. 1% uranyl acetate solution was applied on the grid to negatively stain the particles for 30 seconds, and subsequently washed twice with sterile-filtered deionised water and dried. The grids were imaged using a scanning electron microscope (JEOL JEM-2010, UK) and analysed using ImageJ software.

Gel agarose analysis of phage

Phage stocks were analysed by nanodrop to determine 30ug of phage sample.

These were then mixed 1: 1 with 2x sample buffer (126 mM Tris-HCI, pH 6.8, 15% Ficoll® Type 400 and 0.002% Bromophenol Blue) and loaded into a 0.8% agarose gel. Samples were run for 5h at 50V, the gel was then fixed overnight with a 10% acetic acid, and 50% Methanol solution. The following day, the gel was fixed with Coomassie blue staining solution for 3h and de-stained with 20% Methanol and 5% acetic acid overnight. Bands were detected with a BioRad gel reader.

Phage particle fluorochrome labelling

Phage particles were labelled with FITC. 50 mL of particles (5xlOⁿ TU, total) were added into 200 uL containing 5 mg/ml FITC (Sigma, UK), then mixed by rotating for 1 hour at room temperature in the dark. Subsequently, the particles were precipitated by addition of PEG/NaCI 25-30 % total concentration at 4°C, overnight. The solution was centrifuged at 13000 rpm for 15 min to obtain the pellet of particles. The pellet was resuspended in 250 uL PBS and re-precipitated with PEG/NaCI until free FITC was completely removed. Finally, FITC-conjugated phage particles were resuspended in PBS and titers were quantified using the E. coli bacterial infection and colony counting method.

Matrigel diffusion assay of phage particles

200 pl of Matrigel from Engelbreth-Holm-Swarm murine sarcoma (Sigma, UK) at

2.5 mg/ml were added to a 48-well plate, then transferred at 37°C. In the meantime FITC-labelled particles were prepared at a concentration of 5 pg/ml. 5 pl of each particle solution were pipetted in gel loading pipette tip, which was inserted at a fixed position into the Matrigel and left to diffuse. Fluorescent images were taken using a fluorescent microscope (Nikon Eclipse TE2000U, Japan) and analysed by Openlab imaging software at 0 and 18 hours intervals thereafter.

Particle internalisation

Cells were transduced using l- 10⁶TU/cell or 5-10⁵TU/cell of FITC labelled particles. 6 hours post-transduction cells were washed with PBS and detached using 2mg/ml of ice-cold pronase during 10' on ice. 20% FBS was used to block the pronase and cells were centrifuged 5' at 200g at room temperature. The pellet was again resuspended in 20% FBS followed by another centrifugation step. The pellet was resuspended in 4% paraformaldehyde and incubated 10' at room temperature. Following incubation cells were centrifuged for 5' at 300g at room temperature and blocked with a solution made of 0.1% saponin and 2% BSA during 30' at room temperature. Cells were pelleted at 300g during 5' at room temperature and stained with rabbit anti-fd-phage antibody (sigma 086k4860; 1: 1000 dilution) in a 0.1% saponin 1% BSA-PBS solution for 1 hour at room temperature. After the incubation, cells were pelleted under the same conditions and washed with 0.1% saponin in 1% BSA-PBS. This washing step was repeated 3 times. Cells were labelled with a goat anti-rabbit AlexaFluor-647 (Invitrogen 21245; 1:500 dilution) in 0.1% saponin in 1% BSA-PBS and incubated protected from light for Ih at room temperature. Cells were washed twice with 0.1% saponin-PBS and resuspended in the final step in PBS.

Next, flow cytometry analysis of intracellular phage particles was performed. FACS was carried out using a BD FACscalibur Flow cytometer (BD Biosciences) equipped with an argon-ion laser (488nm) and red-diode laser (635nm). The mean fluorescence intensity and % was measured for at least 10,000 gated cells per triplicate well. The FACScalibur software was used to gate and analyse the cell populations.

SDS-PAGE

Samples were supplemented with loading dye (Laemmli buffer and 0- mercaptoethanol) and loaded into a mini-PROTEAN TGX Stain-Free™ gel 4-15%. Tris-Glycine-SDS (Sigma) lOx and NEB Protein Colour standard were used as running buffer and protein ladder respectively. Determination of helper phage contamination

Phage samples were pre-treated with DNAse-I for 30 min at 37°C. The DNAse-I was then inactivated for 10 min at 65°C with 50mM EDTA, and the phage capsids were opened in the presence of 1% SDS by heating at 95°C for 10 min. After a gradual reduction of the temperature by decrements of 3°C to 23°C, SDS was then captured with 1% Triton X-100 and the samples were diluted 1:250 in DEPC water. scPAAV and Helper phage plasmids were used to create the standard curves from 2-10⁸ to 2-10³ plasmids/uL.

TN Fa ELISA

Cells were transduced with phage particles, 24 hours after transduction the medium was changed to fresh complete medium. Conditioned medium was collected at day 4 post transduction, replaced with fresh medium, and collected again at day 6 post transduction.

Enzyme-linked immunosorbent assay (ELISA)

Production of IL15 in the supernatant after transduction was quantified using a mouse IL15 duoset ELISA (R&D systems, UK).

TNFa concentration in the conditioned medium was quantified with the ELISA MAX™ Standard Set kit following manufacturer's instructions.

For TRAIL ELISA, we coated the plate with a capture antibody. Next, the plate was washed two times with washing buffer (0.05% Tween20 in PBS) and blocked by adding 1% BSA in PBS at room temperature for 1 hour. The plate was washed two times with washing buffer and samples were added into the plate and incubated at room temperature for 2 hours. Next, a detection antibody was incubated at room temperature for 1 hour. Then, avidin-HRP D was added to each well followed by a substrate solution.

Results backbone for of two self¬ cassettes

Referring to Figures 1 and 2, there are shown schematic representations of a known adeno-associated virus/phage ("AAVP") vector (on the left), and also a known phagemid adeno-associated virus ("PAAV") vector (centre), both derived from the single-stranded M13 filamentous phage. AAVP contains the full phage genome and a single mammalian transgene cassette flanked by the ITR sequences derived from the AAV2 virus, whereas PAAVs are based on a phagemid design in which the ITR- flanked single transgene cassette is included, and a helper phage is required to provide the structural genes during production. A problem with AAVP and PAAV is that, upon treatment of mammalian cells, these two vectors deliver a singlestranded DNA of the transgene cassette, which must convert into a double-stranded DNA for gene expression and transduction to occur. This process, which relies on mammalian cellular factors, is not efficient, resulting in delayed initiation of gene expression, followed by a slow and less efficient increase of gene delivery over time.

The inventors previously showed that transducing cells with two phage vectors carrying complementary sequences of the mammalian transgene expression cassette did not enhance gene delivery. Therefore, the inventors sought to provide a complementary sequence of the transgene cassette in a single phage vector (Figure 1), in other words to design a phage vector carrying both a transgene cassette and its complementary sequence in order to induce hybridisation (i) upon transduction of cells, or (ii) during production and manufacturing in the bacteria host (Figure 2).

Figures 1 and 2 (on the right) show the single-stranded (SS) self-complementary phagemid backbone used for phage production according to the invention ("self- complementary phage particle or scPP"). Indeed, the self-complementary phagemid backbone provides the ability of the two single-stranded self-complementary transgene cassettes to hybridise and form a double-stranded transgene cassette. Whereas AAVP and PAAV contain only one copy of an expression cassette, the scPP of this invention carries an additional transgene cassette compared to the AAVP and PAAV. The two cassettes are identical and separated by an inverted terminal repeat (ITR) linker, but their sequences read in opposing directions, i.e. the first cassette extends in the 5' to 3' direction, whereas the second cassette extends in the 3' to 5' direction as shown in Figure 1. As shown in Figure 2, the phagemid of the invention enables hybridization between the two self-complementary transgene expression cassettes either side of the ITR linker, thereby creating dsDNA resembling a hairpin loop structure. A second AAV ITR is included to flank one of the transgene cassettes.

To avoid the circular phage genome that can affect the process of double-stranded DNA formation, the inventors used a phagemid, instead of a phage, in order to remove the phage genome and retain the origin of replication fl only to allow replication of the transgene cassette in bacteria and its packaging (Figures 1 and 2). Since there is no phage genome, a helper phage was used to infect bacteria to provide the structural genes required for encoding the coat proteins for packaging required for it to replicate (Figures 1 and 2). Phage has no tropism for mammalian cells, thus, to allow entry of the vector into cells, the inventors displayed on the helper phage a double cyclic RGD4C ligand (Figures 1 and 2), that has been extensively characterised and used for gene delivery by phage. This ligand allows phage entry into mammalian cells by binding to a av[33 integrin heterodimer receptor, mainly expressed on the surface of cancer cells. The inventors used RGD4C/avg3 as the ligand receptor system to show proof-of-concept of the new platform technology.

In this novel design, the two complementary mammalian transgene cassettes were linked using the ITR from AAV2 (Figures 1 and 2). The inventors also included a second ITR to flank the parental transgene cassette, in order to preserve it upon transduction of cells and improve its persistence over time (Figures 1 and 2).

2 - scPP shows a considerable increase in to a

PAAV

As a first set of experiments, the inventors sought to investigate gene delivery by the newly designed phage vector (scPP), to check whether a scPP vector can perform better in mammalian cells than a corresponding single-stranded phage vector control (PAAV). Thus, the inventors compared gene expression from scPP side-by-side with PAAV. To transduce cells, the inventors generated tumour- targeted phage particles, displaying the double cyclic RGD4C in the pill gene of the filamentous M13KO7 helper phage. The RGD4C ligand binds to av[33 integrin heterodimer receptor, overexpressed on tumour cells and tumour blood vessels but barely detectable on healthy tissues. This ligand has been extensively used to allow entry of M13 phage vectors into mammalian cells. Non-targeted vectors, lacking RGD4C, were also included and added to the cells, as negative controls.

First, the inventors used vectors expressing a reporter gene of the green fluorescent protein (GFP) (Figure 3) and treated murine melanoma B16-F1 cells since they express the ovg3 receptor of RGD4C ligand. At day 4 post transduction, microscopic analysis of GFP expression showed extensive GFP production in B16-F1 tumour cells transduced by RGD4C.scPP-GFP, distinctly higher than that of cells treated with the RGD4C.PAAV-GFP (Figure 4A). Moreover, analysis of GFP expression by FACS showed that the RGD4C.scPP-GFP generated a dose dependent GFP expression reaching beyond 35% GFP-positive cells at 10⁶ TU/cell, compared to RGD4C.PAAV-GFP that produced less than 5% GFP positive cells a 10⁶ TU/cell (Figure 4B). Importantly, no GFP expression was detected in cells treated with the non-targeted phage particles (NT), lacking RGD4C ligand, proving gene delivery by targeted particles remains selective to integrin-expressing cells and mediated by the RGD4C ligand (Figure 4B).

Next, to validate these data, the inventors performed a comprehensive quantitative analysis of gene delivery by using particles carrying a reporter gene encoding a secreted Gaussia luciferase Lucia) (8, 16) (Figure 5). Gene expression was quantified by analysis of luciferase activity in the growth media. The inventors tested varying doses of particles and evaluated gene expression over a time course of a few days. Moreover, the inventors assembled a panel of tumour cell lines from different species and histological origins, in order to rule out the possibility that the observed gene delivery efficacy of the RGD4C.scPP is either species or histologically specific. Transduction was carried out using mouse melanoma B16-F1 and B16-F10, and RMS metastatic melanoma cells. The inventors also included human MCF7 breast cancer cells and A549 lung carcinoma cells as well as human osteosarcoma cells. Additionally, the inventors tested the vectors on the human embryonic kidney HEK293 cells, since these cells have been extensively used for general gene delivery, viral and non-viral transduction and DNA transfection purposes and have also previously been used as a standard in vitro model for phage-mediated gene delivery. The data revealed gene expression from the RGD4C.scPP particles was detected as early as 1 to 2 days following treatment and increased gradually over time, with all doses tested (Figures 6-14). In contrast, initiation gene expression by RGD4C.PAAV was delayed and was consistently and significantly lower than that of RGD4C.scPP across all time points, doses and cell lines tested (Figures 6-14). Control non-targeted particles did not show any gene expression (Figures 6-14). These findings indicate that the enhancement of gene expression observed may be a consequence of earlier induction as well as a greater number of successfully transduced cells, or perhaps a combination of these two non-mutually exclusive events.

Finally, to confirm that this superiority of gene delivery by the scPP is not restricted to the reporter genes, GFP or Lucia, and can also be applied to therapeutic genes, the inventors constructed vectors carrying the cytokines tumour necrosis factor alpha (TNFo), and interleukin (IL15), used in cancer immunotherapy (8).

Expression of these two cytokines was measured at the protein levels in the medium of cells by ELISA following phage transduction. Similarly, the data show that the newly designed scPP particle expressed significantly higher levels of both TNFo and IL15 in the media of cells compared to PAAV (Figures 15-17). The inventors also constructed vectors carrying another cytokine Tumor necrosis factor- related apoptosis-inducing ligand (TRAIL) and confirmed again that the scPP produced substantially higher levels of TRAIL in the supernatant of human osteosarcoma cells compared to cells treated with the PAAV (Figure 18).

Example 3 - Comparison of in vivo gene delivery to solid tumours in mice upon systemic administration

To translate these findings to in vivo studies, the inventors compared gene delivery between scPP and PAAV following intravenous administration to tumour-bearing mice. The inventors used vectors delivering TRAIL and injected immunodeficient mice with established human subcutaneous xenografts, osteosarcoma. For this, tumour-bearing mice were treated with 5xlO¹⁰ TU/mouse, as the dose used previously for phage-based vectors, then RT-qPCR was applied to identify the expression of TRAIL mRNA transcripts in the tumours (Figure 19). A biodistribution investigation was also performed of the scPP side-by-side with PAAV in tumourbearing mice to analyse gene delivery in tumours versus key internal organs. These biodistribution experiments were performed to ensure that gene expression is selective to tumours established in mice after intravenous administration of the RGD4C.scPP particles without any expression in healthy tissues that can lead to off- target effects. Significantly higher expression of the TRAIL mRNA transcript was detected in the tumours of mice injected with RGD4C.scPP compared to RGD4C.PssAAV (Figure 19). Moreover, TRAIL expression in the healthy tissues was insignificant and similar to control groups showing that RGD4C.scPP efficiently and systemically targets the tumours while sparing other key internal organs. Nontargeted particles did not show significant expression in the tumours or any of the organs studied.

To understand the molecular mechanisms of scPP-mediated transgene expression and its superiority to PAAV, the inventors investigated the extracellular and intracellular fate of the particles following treatment of mammalian cells and compared scPP side-by-side with the PAAV, for various steps of gene delivery.

Diffusion through the ECM

The diffusion efficiency was evaluated with FITC labelled particles and their migration capacity in a matrigel support (Figure 20). No apparent differences were detected between both constructs, which suggests a similar diffusion profile through the extra cellular matrix (ECM). This is consistent with previous studies reporting that diffusion of M13 phage vectors is dictated by the particle size (8). Indeed, ECM analysis of scPP and PAAV shows the two particles do not exhibit differences in their size.

Internalisation

Next, the inventors sought to investigate phage entry in transduced cells. Thus, B16-F1 cells were transduced and processed 6 hours after transduction using two different approaches. In the first one, particles were stained with anti-fd phage and quantified by flow cytometry (Figure 21A). In the second one, DNA was purified and quantified by qPCR using the ampicillin gene present in the phagemid as a target (Figure 21B). Again, no differences were detected between the two particles.

Example 5 - Increased gene delivery efficacy of scPP is not due to the presence of two transgene expression cassettes

Since the two vectors did not show any differences in ECM diffusion and cell entry, and to gain further insight into the mechanisms behind the differences between scPP and PAAV, the inventors investigated whether the gene delivery advantage of scPP occurred because this vector carries an additional transgene expression cassette. Hence, the inventors produced a control vector containing two copies of the transgene cassette but in the same orientation, clockwise (cw), to avoid any sequence complementarity and hybridisation. This vector was named cw phage particle or cwPP (Figure 22A). To account for any potential influences of the specific orientation of the two transgene cassettes, a second control vector was constructed to include both transgene expression cassettes in an anticlockwise (aw) direction, named awPP (Figure 22A). Then, side-by-side transductions with scPP and the control vectors showed improved efficiency of the scPP vector over both cwPP and awPP controls (Figure 22B). Moreover, to investigate whether intermolecular hybridisation between the complementary transgene sequences provided in separate vectors was able to replicate the scPP efficiency, the inventors carried out simultaneous transduction with cwPP and awPP vectors (Figure 23A). While this simultaneous transduction enhanced the efficiency over cwPP and awPP alone, it was still lower than that of scPP (Figure 23B). Overall, these data suggest that the improved efficiency observed for scPP vector is associated with its ability to accomplish successful intramolecular hybridisation.

Example 6 - Particle size

The similarities between scPP and PAAV particles in diffusion and internalisation suggest that the two particles do not vary in their size as recently reported (8). The inventors therefore hypothesised that the scPP should package a compacted genome resulting in particle size similar to PAAV particles. As an initial investigation, the inventors analysed both scPP and PAAV particles by transmission electron microscopy (TEM) and quantified the length of individual phage particles (Figure 24). Helper phage was also analysed to help identify the helper phage population in the scPP and PAAV preparations. Importantly, TEM imaging revealed very similar size between scPP and PAAV particles (Figure 24). To further corroborate these findings, the inventors also analysed the size of the cwPP particles by EM and found the cwPP vectors have increased in size compared to the scPP (Figure 24). These results were confirmed in parallel with an agarose gel electrophoresis of the whole phage particles (Figure 25).

To recap, these findings show that scPP is a more efficient vector than PAAV. Since no differences have been detected in diffusion and cell entry, it is likely that the difference is linked to their distinct genomic design. This is supported by the similar particle size between the two vectors, which could be explained by a more compact genome being packaged by the self-complementary phage particles (scPP) that could be the result of self-hybridization between the two complementary transgenes expression cassettes. Indeed, the fact that control particles encoding two copies of the transgene cassettes in the same orientation are unable to replicate the scPP transduction efficiency, suggests that the presence of a double transgene cassette load is not directly responsible for the improvement, neither individually nor in combination, but rather supports that self-hybridization formation of doublestranded DNA transgene cassette, during phage production, as the mechanism behind the scPP superiority.

Example 7 - scPP capsid packages a double-stranded transgene DNA cassette To prove the potential of scPP genomes to form dsDNA structures and to get packaged by the phage capsid as dsDNA, the inventors extracted the scPP genome from the phage capsid/particles, then digested with BamHI, a dsDNA digestion enzyme which has a target seguence within the transgene cassette. In other words, successful digestion by BamHI can only occur in the presence of dsDNA (Figure 26A). As expected, a 1,898 bp band was detected in the digested samples while absent in the undigested control (Figure 26B). To further prove that this band was indeed produced by a unigue ssDNA molecule self-hybridization, the inventors predicted that under denaturing conditions, which cause DNA de-hybridization, this molecule would unfold and run as a 3,796 kb band (Figure 26A).

Under denaturing conditions, the 5,000bp DNA ladder band generated two different bands (due to the separation of its complementary strands) (Figure 26C), indicating that the 4,OOObp reference band corresponds to the sixth band in the denatured ladder. As hypothesized, the extracted band in its denatured form, expected to be 3,796b long, ran around the same speed as the 4,OOObp band present in the denatured ladder (Figure 26D).

These findings provide strong evidence that the phage capsid packages a dsDNA transgene cassette during production in bacteria, which results from selfhybridization of the two complementary transgene cassettes of scPP during its manufacturing in the host bacteria.

Example 8 - scPP particle delivers a double-stranded transgene expression cassette upon transduction of mammalian cells

Next, the inventors sought to investigate whether the scPP vector delivers a double stranded transgene expression cassette that does not reguire host-cell synthesis of the complementary strand of the transgene cassette for transduction and gene expression to occur. Indeed, the inventors predicted that these vectors would obviate the role of host-cell DNA synthesis in transduction if they can deliver a double stranded transgene cassette upon entry into mammalian cells.

The inventors compared the scPP-Lucia vector and the PAAV-Lucia in B16-F1 cells pre-treated with hydroxyurea (HU) 24 hours before transduction to inhibit host cell DNA synthesis. Hydroxyurea treatment was continued and uninterrupted at the same concentrations following transduction and was maintained on the cells until Lucia expression was measured. Importantly, unlike conventional single-stranded phage vectors, PAAV, inhibitors of DNA replication, hydroxyurea, did not affect transduction from scPP vector (Figure 27). In contrast, hydroxyurea suppressed gene expression from the PAAV (Figure 27). These data demonstrate that transduction by scPP is independent of DNA synthesis and subsequently of ss to ds conversion of the transgene cassette.

Referring to Figure 28, there is shown a comparison of Lucia reporter gene delivery to metastatic human osteosarcoma 143B cells, between PAAV and scPP over a time course from day 1 to day 3, following treatment with increasing doses of vectors. No expression of the Lucia gene was observed in controls groups (untreated and NT) on day 1 and 2 post-transduction. However, expression of the Lucia gene can be observed on day 1 post transduction in the RGD4C.scPP treatment group at 500,000 and 1,000,000 TU/cell but not in PAAV treatment group. This confirms the efficacy of self-complementary scPP vector for instant expression of the transgene. At days 2 and 3 post-transduction, RGD4C.scPP treatment group (from 100,000 to 1,000,000 TU/cell) shows higher expression of lucia than the RGD4C.PAAV treatment group.

Method:

143B cells were seeded in 96 wells format culture plate to achieve 60-70% confluence 48 hours after seeding. The average number of cells per well or plate culture was calculated the day of transduction and was used to calculate tumour targeted RGD4C-PAAV or scPP particle carrying secreted luciferase (lucia) gene to add to the culture. Non-targeted (NT) phage carrying the same gene and untreated cells were used as controls. The appropriate amount of the particle stock solution is then diluted in 10% DMEM medium, and thoroughly mixed to prepare the - _5i - transduction mixture. The concentration of the transduction mixture varies from 100,000 to 1,000,000 transduction unit (TU) per cell. The smallest amount required to completely cover the cell monolayer (50 ul) is the suggested volume of transduction mixture used per well. 24 hours after the transduction, the medium is topped up with 10% DMEM medium to 150uL. The transduced cells were cultured until they were analyzed (from day 1 to day 3).

For evaluation and quantification of gene expression, phage (PAAV or scPP) particles carrying the secreted luciferase reporter gene, each day after transduction, lOptl of medium was taken to measure luciferase activity by mixing the sample with 25pil of QUANTI-Luc™ (InvivoGen, USA) reagent for 5 minutes and subjected to the GloMax® Navigator Microplate Luminometer (Promega Corporation, USA) with an integration time of 0.1 seconds.

Example 9 - Comparison of delivery of the secreted cytokine sTRAIL to metastatic human osteosarcoma 143B cells

Referring to Figure 29, there is shown sTRAIL gene expression in the cultured media of metastatic human osteosarcoma 143B cells transfected with PAAV or scPP DNA construct. Untreated cells and transfection reagent treated cells were used as controls. The level of sTRAIL protein (pg/ml) was measured by TRAIL ELISA kit. The experiment was performed in three biological replications. For statistical analysis, independent t test, one-way ANOVA, Tukey's HSD post hoc test was used. All results are shown as mean ± SEM. ***P < 0.01 and ****P < 0.001. The data show that cells transfected with the scPP-sTRAIL DNA construct expressed higher level of sTRAIL in the cultured medium than P/ M-sTRAIL DNA construct.

Method:

143B cells were seeded into 6 wells format culture plates and grown for 24 hours to reach 80% confluence. Culture medium was change to reduced-serum medium for 2 hours (Opti-MEM, Thermofisher UK) prior transfection. The transfection mixture was prepared by using 2pg PAM-sTRAIL or scPP-sTRAIL DNA construct to 6pl of FuGENE® HD (Promega, UK) in reduced-serum medium. The mixture was incubated for 20-25 minutes at room temperature. Next, the mixture was added dropwise to the culture plate containing cells in reduced-serum medium. Then, the cells were returned to the incubator for 48 hours. Finally, the culture medium was collected to quantify TRAIL level by ELISA. *sTRAIL = secreted TRAIL. The level of sTRAIL secreted in the supernatant was measured using a Human TRAIL/TNFSF10 DuoSet ELISA (R&D systems, UK). The assays were performed in accordance with the manufacturer's procedures.

Example 10 - Induction of osteosarcoma cell death, in vitro, following treatment with the scPP-sTRAIL encoding the secreted sTRAIL

Referring to Figure 30, there is shown that the RGD4C.scPP-sTRAIL particle treated group has lower cell viability in a dose dependent manner. The data is presented as percent cell viability comparing to untreated cells. The experiment was performed in three biological replications. For statistical analysis, one-way ANOVA, Tukey's HSD post hoc test was used. All results are shown as mean ± SEM. **P < 0.05.

Method:

143B cells were seeded in 6 wells format culture plate to achieve 60-70% confluence 48 hours after seeding. The average number of cells per well was calculated the day of transduction and was used to calculate tumour targeted RGD4C.scPP particle carrying secreted TRAIL (sTRAIL) gene to add to the culture. Non-targeted (NT) phage carrying the same gene and untreated cells were used as controls. The appropriate amount of the particle stock solution is then diluted in 10% DMEM medium, and thoroughly mixed to prepare the transduction mixture. The concentration of transduction mixture varies from 500,000 to 1,000,000 transduction unit (TU) per cell (displayed in the graph as 0.5 and 1.0 respectively). The smallest amount of transduction mixture reguired to completely cover the cell monolayer (1 ml) is the suggested volume of transduction mixture used per well. 24 hours after the transduction, the medium will be topped up with 10%DMEM medium to 2 mL. The transduced cells were cultured for another 3 days. Cell viability assay was performed to evaluate cell death.

CellTiter-Glo Luminescent Cell Viability Assay: CellTiter-Glo Reagent (Promega, UK) was added egual volume to culture media present in the culture well containing transduced cells and then induced cell lysis by mixing for two minutes on an orbital shaker to induce. Next, allowed the mixture incubated at room temperature for 10 minutes to stabilize the luminescent signal and transferred to a plate-reading luminometer. The signal was detected using GloMax Navigator Microplate Luminometer (Promega, UK). . No increase of the biomarker LDH

Referring to Figure 31, there is shown that both scPP-sTRAIL and PA -sTRAIL particle treated mice do not increase serum LDH level when compared to untreated mice. This data suggests that both PAAV and scPP are safe for in vivo treatment. The LDH data was shown as a relative value comparing to untreated group. The experiment was performed in three biological replicates. For statistical analysis, one-way ANOVA, Tukey's HSD post hoc test was used. No statistical significance in this experiment.

Method:

Athymic mice (BALB/c nu/nu 8-10 weeks old) were acquired from Charles River, United Kingdom. Human OS cells were subcutaneously established in athymic mice using the 143B cells at 2 x 10⁶ cells per mouse. Tumor-bearing mice were intravenously injected with targeted (RGD4C) or non-targeted (NT) phage (PAAV or scPP) particles carrying the sTRAIL gene at a dose of 5 x IO¹⁰ TU per mouse on day 3, 5 and 9 of the experiment. At the end of the experiment (daylO), mice were sacrificed by terminal perfusion through the heart. Next, whole blood was from heart and serum samples were prepared by centrifugation at 1,600g for 15 minutes. LDH level in serum was measured to evaluate toxicity of phage treatment. CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega, UK) was used in this experiment. The assays were performed in accordance with the manufacturer's procedures.

Example 12 - Biodistribution of sTRAIL delivery in tumour-bearing mice with established osteosarcoma

Referring to Figure 32, the data show relative expression (to untreated group) of human TRAIL gene from different organs of mice after treatment with PAAV or scPP particle carrying sTRAIL gene. RGD4C.scPP-sTRATL particle shows the most effectively targets and delivers gene to the tumours follow by RGD4C.PAAV- sTRAIL. Non-targeted particles exhibited no significant expression in the tumours or any other organs. The experiment was performed in three biological replicates. For statistical analysis, two-way ANOVA, with multiple comparison t-test was used. All results are shown as mean ± SEM. ***p < 0.01.

Method: Athymic mice (BALB/c nu/nu 8-10 weeks old) were acquired from Charles River, United Kingdom. Human OS cells were subcutaneously established in athymic mice using the 143B cells at 2 x 10⁶ cells per mouse. Tumor-bearing mice were intravenously injected with targeted (RGD4C) or non-targeted (NT) phage (PAAV or scPP) particles carrying the sTRAIL gene at a dose of 5 x IO¹⁰ TU per mouse on day 3, 5 and 9 of the experiment. At the end of the experiment (day 10), mice were sacrificed by terminal perfusion through the heart. Tumour and normal organs including lungs, liver, spleen, heart, kidneys, pancreas, and brain were collected. Total RNA was extracted from those organs and detection of human TRAIL expression was measured by RT-qPCR.

Example 13 - Immunofluorescence staining of tumours showing expression of the sTRAIL protein following treatment with the RGD4C.PAAV and RGD4C.scPP encoding the sTRAIL

Referring to Figure 33, confocal microscopic analysis showed that the TRAIL expression (Green) was only detected in the tumour of RGD4C. PAAV. sTRAIL and RGD4C. scPP. sTRAIL treated group. Higher expression of TRAIL was observed in the scPP treated tumour. The findings demonstrate that RGD4C. scPP. sTRAIL effectively and comprehensively targets the tumours. Non-targeted (NT) phage particles exhibited no appreciable TRAIL expression in the tumours.

Method:

Athymic mice (BALB/c nu/nu 8-10 weeks old) were acquired from Charles River, United Kingdom. Human OS cells were subcutaneously established in athymic mice using the 143B cells at 2 x 10⁶ cells per mouse. Tumor-bearing mice were intravenously injected with targeted (RGD4C) or non-targeted (NT) phage (PAAV or scPP) particles carrying the sTRAIL gene at a dose of 5 x IO¹⁰ TU per mouse on day 3, 5 and 9 of the experiment. At the end of the experiment (daylO), mice were sacrificed by terminal perfusion through the heart. Tumours were collected and treated for frozen sections. Human TRAIL expression in the tumour mass was measured by immunofluorescence staining. TRAIL expression was assessed on the optimal cutting temperature compound (OCT) frozen sections, 6 pm, of tissues by using antibodies against human TRAIL. The sections were fixed for 15 minutes at room temperature in 4% paraformaldehyde (Merck, Darmstadt, Germany). The sections were then incubated for 1 hour with 5% normal goat serum in TBS (Tris- Buffered Saline) containing 0.3% Triton-X before being incubated with primary antibodies (rabbit anti-human TRAIL polyclonal antibody, (Thermo Fisher Scientific, UK). The tissue sections were subsequently incubated with Alexa Fluor® 488 conjugated goat anti-rabbit IgG in TBS with 1% filtered BSA and 0.3% Triton-X for 30 minutes. After three washes with PBS, slides were mounted with Prolong Gold anti-fade mountant (Life Technoligies, UK). A DMi8 advanced confocal fluorescence microscope was used to image the cells sections (Leica Microsystems, Wetzlar, Germany). in and eosin staining of tumours extensive tumour ic treatment

Referring to Figure 34, there is shown hematoxylin and eosin staining of tumours showing extensive tumour damage following systemic treatment with the RGD4C.scPP-sTRAIL as compared to untreated group of mice, or mice treated with the non-targeted (NT) vector.

Method:

Athymic mice (BALB/c nu/nu 8-10 weeks old) were acquired from Charles River, United Kingdom. Human OS cells were subcutaneously established in athymic mice using the 143B cells at 2 x 10⁶ cells per mouse. Tumor-bearing mice were intravenously injected with targeted (RGD4C) or non-targeted (NT) phage (PAAV or scPP) particles carrying the sTRAIL gene at a dose of 5 x IO¹⁰ TU per mouse on day 3, 5 and 9 of the experiment. At the end of the experiment (daylO), mice were sacrificed by terminal perfusion through the heart. Tumour was collected and treated for frozen section. The optimal cutting temperature compound (OCT) frozen sections, 6 pm, of tissues was prepared and was proceeded for haematoxylin and eosin staining.

Conclusions

The inventors have generated a novel phage vector comprising a complementary single-stranded sequence of the transgene expression cassette, in order to induce hybridisation upon transduction of cells, or during production and manufacturing in the bacteria host. The inventors performed experiments in vitro using various cell lines and transgenes and observed a surprising increase in the efficiency of transduction from the self-complementary phage particle (scPP) according to the invention over conventional exclusively ssDNA phage vectors (3- to 15-fold). Indeed, the self-complementary phage vectors displayed a rapid onset and a higher level of transgene expression in all of the cell lines tested. More importantly, unlike conventional single stranded phage vectors, inhibitors of DNA replication did not affect transduction from the self-complementary phage vector. Additionally, in vivo studies demonstrated significant enhancement of gene delivery to solid tumours in mice upon systemic administration, over the ss DNA phage particle. All of these biological attributes support the generation and characterisation of a new class of filamentous phage vectors comprising self-complementary single-stranded DNA, which hybridises such that the transgene cassette is delivered as double-stranded DNA, which should significantly contribute to the ongoing development of phagebased gene delivery systems.

The technology described herein has various unique features, including packaging of the hybridisable self-complementary ssDNA (i.e. dsDNA) of the transgene cassettes, by the M13 phage capsid. Also, the system allows the packaging of large genomes by using two ITRs instead of three ITRs, as compared to existing technologies. Moreover, the technology allows rapid initiation of gene expression in mammalian cells by M13 phage when compared to existing phage vectors. This is also the first demonstration of the hybridization between hybridisable self- complementary ssDNA (i.e. dsAAV) genomes and phage capsid. In other words, it is the first hybrid vector between a phage capsid and hybridisable complementary ssDNA (i.e. ds rAAV). Moreover, this is the first report of the ability to package and deliver hybridisable complementary ssDNA transgene cassettes (i.e. a ds transgene cassette), ready for gene expression initiation in mammalian cells. Moreover, because the inventors used transgene cassettes flanked by AAV ITRs, this is the first report to show packaging of ds AAV DNA (from the hybridisable complementary ssDNA) and its delivery to mammalian cells using a phage capsid, as there is no AAV capsid.

In addition, the phage vector of the invention allows a faster initiation of gene expression by the phage in mammalian cells over existing phage vectors. Furthermore, the delivery of ds AAV vectors is expensive, whereas using the phage capsid to deliver ds AAV DNA, as in the invention, is highly cost-effective since the production of this delivery system occurs in bacteria and exploits the economic production and purification process of phage vectors in prokaryotic hosts, which are compatible with industrial-scale reactors and separation systems. This also results in scaling up the production which should directly reduce the cost.

The inventors used soluble TRAIL (sTRAIL) to endorse their findings demonstrated that the scPP particle performs surprisingly better for gene delivery. For example, when using genes, such as TRAIL, the inventors demonstrated cancer cell death, which shows that the scPP vector can be used to deliver therapeutic genes in vivo or in vitro.

The inventors believe that this technology will impact the phage gene delivery field as well as AAV gene therapy and systemic delivery in general. This delivery platform can be applied for systemic gene therapy of cancer and other human diseases since the phage capsid has no tropism for human tissues, and thus it can be delivered systemically to target a disease tissue via a ligand displayed on the phage capsid to allow entry and delivery of the therapeutic DNA.

References

1- Ivanenkov V., Felici F., Menon A. G. "Uptake and Intracellular fate of phage display vectors in mammalian cells" Biochim. Biophys. Acta 1999, 1448 ; 450-462.

2- Di Giovine M.. Saione B., Martina Y., Amati V., Zambrano G., Cundari E., Failla C. M.. Saggio I. "Binding properties, cell delivery, and gene transfer of adenoviral penton base displaying bacteriophage" Virology 2004, 282: 102-112.

3- Piersanti S., Cherubini G., Martina Y., Saione B., Avitabile D., Grosso F., Cundari E., Di Zenzo G., Saggio I "Mammalian cell transduction and internalization properties of lambda phages displaying the full-length adenoviral penton base or its central domain" 3. Mol. Med. 2004, 82: 467-476.

4- Larocca D., Witte A., Johnson W., Pierce G. F., Baird A. "Targeting bacteriophage to mammalian ceil surface receptors for gene delivery" Hum. Gene. Ther. 1998, 9: 2393-2.399

5- Hart S. L., Knight A. M., Harbottie R. P., Mistry A.. Hunger H. D., Cutler D. F., Williamson R., Coutelie C. "Cell binding and internalization by filamentous phage displaying a cyclic Arg-Gly-Asp-containing peptide" J. Biol. Chem. 1994, 269 ; 12468-12474.

6- Hajitou A., Trepel M., Lilley C. E., Soghomonyan S., Alauddin M. M., Marini F. C., 3rd, Restel B. H., Ozawa M. G., Moya C. A., Rangel R., Sun Y., Zaoui K., Schmidt M., von Kalle C., Weitzman M. D., Gelovani J. G., Pasqualini R., Arap W. "A hybrid vector for ligand-directed tumor targeting and molecular imaging" Cell 2006, 125: 385-398.

7- Yata, T., Lee, E.L.Q., Suwan, K., Syed, N., Asavarut, P. and Hajitou A. "Modulation of Extracellular Matrix in Cancer is Associated with Enhanced Tumor Cell Targeting by Bacteriophage Vectors" Mol. Cancer 2015, 14: 110.

8- Asavarut A., Waramit S., Suwan K., Marais G.J.K., Chongchai A., Benjathummarak S., Al-Bahrani M., Vila-Gomez P., Williams M., Kongtawelert P., Yata T. and Hajitou A. "Systemically targeted Cancer Immunotherapy and Gene Delivery using Transmorphic Particles" EMBO Mol. Med. 2022, 14: el5418.

9- Stoneham, C.A., Hollinshead, M.. and Hajitou A. "Clathrin-Mediated Endocytosis and Subsequent Endo-lysosomal Trafficking of Adeno-associated Virus/phage" J. Biol. Chem. 2012, 287: 35849-35859.

10- Suwan K., Yata T., Waramit S., Przystal J.M., Stoneham C.A., Bentayebi K., Asavarut P., Chongchai A., Pothachareon P., Lee K.Y., Topanurak S., Smith T.L., Gelovani J.G., Sidman R.L., Pasqualini R., Arap W. and Hajitou A. "Next-generation of targeted AAVP vectors for systemic transgene delivery against cancer" Proc Natl. Acad. Sci. USA. 2019, 116: 18571-18577.

11- Kia, A., Przystal, J.M., Nianiaris, N., Mazarakis, N.D., Mintz, P.J., and Hajitou A. "Dual Systemic Tumor Targeting with Ligand-directed Phage and Grp78 Promoter Induces Tumor Regression" Mol. Cancer Ther. 2012, 11 : 2566-2577.

12- Przystal J.M., Waramit S., Pranjol M.Z.I., Yan W., Chu G., Chongchai A., Samarth G., Olaciregui N.G., Tabatabai G., Carcaboso A.M., Aboagye E.O., Suwan K. and Hajitou A. "Efficacy of systemic temozolomide-activated phage-targeted gene therapy in human glioblastoma" EMBO. Mol. Med. 2019, 11 : e8492.

13- Tsafa E., Bentayebi K., Topanurak S., Yata T., Przystal J., Fongmoon D., Hajji N., Waramit S., Suwan K. and Hajitou A. "Doxorubicin Improves Cancer Cell Targeting by Filamentous Phage Gene Delivery Vectors" Int. J. Mol. Sci. 2020, 21 : 7867.

14- Monaci P., Urbanelli L. and Fontana L. "Phage as gene delivery vectors" Curr. Opin. Mol. Ther. 2001, 3: 159-169.

15- Burg M.A., Jensen-Pergakes K., Gonzalez A.M., Ravey P., Baird A., Larocca D. "Enhanced phagemid particle gene transfer in camptothecin-treated carcinoma cells" Cancer Res. 2002, 62 : 977-981.

16- Wurdinger T., Badr C., Pike L., de Kleine R., Weissleder R., Breakefield X.O., Tannous B.A. "A secreted luciferase for ex vivo monitoring of in vivo processes" Nat Methods 2008, 5: 171-173.

Claims

Claims

1. A phage vector comprising at least two single-stranded self-complementary transgene expression cassettes, separated by a linker, which hybridise to form a double-stranded transgene expression cassette.

2. The phage vector according to claim 1, wherein the phage vector comprises a packaging signal for enabling replication of the at least two single-stranded self- complementary transgene expression cassettes, which can hybridize in bacteria and subsequently be packaged as double-stranded transgene expression cassettes into the phage vector inside a prokaryotic host.

3. The phage vector according to claim 2, wherein the packaging signal comprises a bacteriophage origin of replication, optionally an Fl ori.

4. The phage vector according to any preceding claim, wherein the phage vector comprises a bacterial origin of replication, optionally a pUC ori.

5. The phage vector according to any preceding claim, wherein the phage vector comprises one or more DNA sequence, which enables targeted integration into a host genome.

6. The phage vector according to any preceding claim, wherein the at least two self-complementary transgene expression cassettes comprise viral transgene expression cassettes, preferably mammalian viral transgene expression cassettes.

7. The phage vector according to any preceding claim, wherein the at least two self-complementary transgene expression cassettes comprise lentivirus transgene expression cassettes, or adeno-associated virus (AAV) transgene expression cassettes.

8. The phage vector according to any preceding claim, wherein the at least two self-complementary transgene expression cassettes comprise any nucleic acid encoding an agent, which may have therapeutic or industrial utility in a target cell or tissue, optionally wherein the nucleic acid is DNA, genomic DNA, cDNA, RAIA, antisense RNA or shRNA.

9. The phage vector according to claim 8, wherein the agent encoded by the nucleic acid is polypeptide or protein.

10. The phage vector according to any preceding claim, wherein the at least two transgene expression cassettes each comprise a promoter, optionally wherein the promoter is a CMV promoter, a grp78 promoter, a tumour-specific promoter, or a tissue-specific promoter.

11. The phage vector according to any preceding claim, wherein the at least two transgene expression cassettes each comprise a nucleic acid for a polyA tail.

12. The phage vector according to any preceding claim, wherein the phage vector comprises four single-stranded self-complementary transgene expression cassettes, separated by a linker, which hybridise to form two double-stranded transgene expression cassettes.

13. The phage vector according to any preceding claim, wherein the two singlestranded self-complementary transgene expression cassettes are positioned in an opposite orientation in the phage vector, preferably wherein a first transgene expression cassette extends in the 5' to 3' direction, whereas a corresponding second transgene expression cassette extends in the 3' to 5' direction.

14. The phage vector according to any preceding claim, wherein the percentage sequence identity between the first and second transgene expression cassette is at least 65%, 70% or 75%, or wherein the percentage sequence identity between the first and second transgene expression cassette is at least 80%, 85%, 90% or 95%.

15. The phage vector according to any preceding claim, wherein the linker separating the at least two self-complementary transgene expression cassettes is an Inverted Terminal Repeat (ITR).

16. The phage vector according to claim 15, wherein the phage vector comprises a second ITR, wherein the second ITR flanks one of the at least two complementary transgene expression cassettes.

17. The phage vector according to either claim 15 or 16, wherein the first and/or second ITRs are AAV ITRs. - 6o -

18. The phage vector according to any one of claims 15-17, wherein the phage vector comprises only two ITRs, preferably wherein the phage vector comprises fewer than three ITRs.

19. The phage vector according to any one of claims 1-14, wherein the linker separating the at least two self-complementary transgene expression cassettes is an unrelated DNA segment, wherein the percentage sequence identity between the linker and the first and second cassettes is less than 50%, 45% or 40%, preferably less than 35%, 30% or 25%, optionally wherein the unrelated DNA segment is between 60 bp and 300 bp, between 80 bp and 280 bp, between 100 bp and 260 bp, between 120 bp and 240 bp, between 140 bp and 220 bp, or between 160 bp and 200 bp in length.

20. The phage vector according to any preceding claim, wherein the phage vector comprises a selection marker, optionally wherein the selection marker is an ampicillin resistant gene.

21. The phage vector according to any preceding claim, wherein the phage vector comprises one or more capsid minor coat protein, optionally wherein the phage vector comprises a pill capsid minor coat protein that is configured to display a cell-targeting ligand for enabling delivery of the vector to the target cell, and/or wherein the phage vector comprises one or more capsid major coat protein, optionally wherein the phage vector comprises at least one pVIII capsid major coat protein that is configured to display a foreign peptide thereon.

22. The phage vector according to any preceding claim, wherein the phage vector comprises a genome which substantially lacks the phage genome from which the vector is derived, optionally wherein the genome of the phage vector lacks at least 60%, more preferably at least 70%, and even more preferably at least 80% of the bacteriophage genome from which it is derived.

23. The phage vector according to any preceding claim, wherein the phage vector lacks bacteriophage structural genes in its genome required for the formation, packaging or extrusion of the particle from a prokaryotic host.

24. A system for producing a phage vector from a prokaryotic host, the system comprising:-

(i) a first vector configured to persist inside a prokaryotic host, and comprising at least two single-stranded self-complementary transgene expression cassettes separated by a linker, which hybridise to form a double-stranded transgene expression cassette, and a packaging signal for enabling replication of the at least two single-stranded self-complementary transgene expression cassettes; and

(ii) a second vector comprising nucleic acid encoding structural proteins required for packaging the double-stranded transgene expression cassette, resulting in the formation and extrusion of a phage vector from the prokaryotic host.

25. The system according to claim 24, wherein the system is used to produce the phage vector according to any one of claims 1-23.

26. The system according to claim 24 or 25, wherein the first vector comprises the genome of the phage vector.

27. The system according to any one of claims 24-26, wherein the packaging signal of the first vector comprises a bacteriophage origin of replication, preferably an Fl ori.

28. The system according to any one of claims 24-27, wherein the first vector comprises a second origin of replication, preferably a pUC ori.

29. The system according to any one of claims 24-28, wherein the linker of the first vector is an ITR, optionally an AAV ITR.

30. The system according to any one of claims 24-29, wherein the second vector is a bacteriophage engineered specifically for rescuing the genome of the first vector from prokaryotic hosts, preferably wherein the second vector is replicationdefective.

31. The system according to any one of claims 24-29, wherein the second vector comprises a disrupted packaging signal, which significantly deters its ability to package itself into phage particles, preferably wherein the second vector comprises a disrupted origin of replication.

32. The system according to claim 31, wherein the disrupted origin of replication is a medium copy number origin, optionally pl5a, or a low copy number origin, optionally a pMBl.

33. The system according to any one of claims 24-32, wherein the second vector comprises a first nucleic acid sequence encoding a pill capsid minor coat protein that is configured to display a cell-targeting ligand for enabling delivery of the phage vector to a target cell, and/or a second nucleic acid sequence encoding at least one pVIII capsid major coat protein that is configured to display a foreign peptide thereon.

34. A method for producing a phage vector from a prokaryotic host, the method comprising:-

(i) introducing, into a prokaryotic host cell, a first vector configured to persist inside a prokaryotic host, and comprising at least two singlestranded self-complementary transgene expression cassettes separated by a linker, which hybridise to form a double-stranded transgene expression cassette, and a packaging signal for enabling replication of the at least two single-stranded self-complementary transgene expression cassettes;

(ii) introducing, into the host, a helper phage comprising nucleic acid encoding bacteriophage structural proteins; and

(iii) culturing the host under conditions which result in the double-stranded transgene expression cassette, being packaged by the structural proteins to form and extrude a phage vector carrying the double-stranded transgene expression cassette from the prokaryotic host.

35. A method for producing a recombinant phagemid particle from a prokaryotic host, the method comprising :-

(i) introducing into a prokaryotic host cell: (a) a first vector configured to persist inside a prokaryotic host, and comprising at least two singlestranded self-complementary transgene expression cassettes separated by a linker, which hybridise to form a double-stranded transgene expression cassette, and a packaging signal for enabling replication of the at least two single-stranded self-complementary transgene expression cassettes, and (b) a second vector comprising nucleic acid encoding structural proteins required for packaging the double-stranded transgene expression cassette; and

(ii) culturing the host under conditions which result in the double-stranded transgene expression cassette being packaged by the structural proteins to form and extrude a phage vector from the prokaryotic host.

36. Use of a helper phage comprising nucleic acid encoding viral vector structural proteins to produce the phage vector according to any one of claims 1-23 from a prokaryotic host.

37. A host cell comprising the first and/or second vector as defined in any one of claims 24-33.

38. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, for use as an experimental research tool, optionally ex vivo or in vitro use.

39. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, for use in therapy or diagnosis.

40. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, for use in a gene therapy technique.

41. The phage vector or the system, for use according to either claim 39 or claim 40, wherein the gene therapy technique is used to treat, prevent or manage cancer.

42. A vaccine comprising the phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33.

43. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, for use in vaccine delivery to a subject.

44. The phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, for use in delivering and targeting a foreign antigen to a tumour in a vaccinated subject.

45. Use of the phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, in a genetic-molecular imaging technique.

46. A pharmaceutical composition comprising the phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, and a pharmaceutically acceptable vehicle.

47. A process for making the pharmaceutical composition according to claim 46, the process comprising contacting a therapeutically effective amount of the phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, with a pharmaceutically acceptable vehicle.

48. Use of the phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, to produce a recombinant viral vector comprising or derived from the viral genome within the genome of the phage vector.

49. A method for producing a recombinant viral vector, the method comprising introducing into, a eukaryotic host cell, the phage vector according to any one of claims 1-23, or the system according to any one of claims 24-33, and allowing the host cell to produce the recombinant viral vector.

50. The use of claim 48, or the method of claim 49, wherein the recombinant viral vector is a recombinant mammalian virus, a rAAV, a recombinant self- complementary AAV vector, or a recombinant lentivirus vector.