EP4649093A2 - Blockade of cd8 expression and chimeric antigen receptors for immunotherapy of t-cell and nk-cell malignancies - Google Patents
Blockade of cd8 expression and chimeric antigen receptors for immunotherapy of t-cell and nk-cell malignanciesInfo
- Publication number
- EP4649093A2 EP4649093A2 EP24712613.9A EP24712613A EP4649093A2 EP 4649093 A2 EP4649093 A2 EP 4649093A2 EP 24712613 A EP24712613 A EP 24712613A EP 4649093 A2 EP4649093 A2 EP 4649093A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- cells
- car
- seq
- immune cell
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/15—Natural-killer [NK] cells; Natural-killer T [NKT] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/31—Chimeric antigen receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/33—Antibodies; T-cell engagers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/421—Immunoglobulin superfamily
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4202—Receptors, cell surface antigens or cell surface determinants
- A61K40/4224—Molecules with a "CD" designation not provided for elsewhere
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2815—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD8
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/80—Immunoglobulins specific features remaining in the (producing) cell, i.e. intracellular antibodies or intrabodies
- C07K2317/81—Immunoglobulins specific features remaining in the (producing) cell, i.e. intracellular antibodies or intrabodies functional in the endoplasmatic reticulum [ER] or the Golgi apparatus
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/04—Fusion polypeptide containing a localisation/targetting motif containing an ER retention signal such as a C-terminal HDEL motif
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/95—Fusion polypeptide containing a motif/fusion for degradation (ubiquitin fusions, PEST sequence)
Definitions
- Chimeric antigen receptors are artificial hybrid proteins that can redirect immune cells and activate them upon engagement of a specifically recognized target molecule.
- CARs are widely used to endow immune cells, such as T lymphocytes or natural killer cells, with the capacity to kill cancer cells
- CARs are typically constituted by a single-chain variable region (scFv) of an antibody linked to a signaling region via a transmembrane domain. When the scFv binds to the corresponding antigen expressed on the surface of target cells, signal transduction is triggered and the process of killing the target cell initiates.
- scFv single-chain variable region
- the present disclosure provides a recombinant nucleic acid molecule encoding an anti-CD8 CAR, wherein the anti-CD8 CAR comprises an antigen binding domain which binds to CD8, a transmembrane domain, and a signaling domain.
- the antigen binding domain is a single-chain variable region (scFv) or a single domain antibody.
- the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID NOs: 1-6, respectively; or (ii) SEQ ID NOs: 7-12 respectively.
- the CD8 binding domain comprises: a) (i) a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13; (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13, or (iii) an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13; and b) (i) a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14, or (iii) an amino acid sequence with 95- 99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
- the CD8 binding domain comprises: (i) an amino acid sequence as set forth in SEQ ID NO: 25, (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 25; or (iii) an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25.
- the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the CD8a, CD8(3, 4-1BB, CD28, CD34, CD4, FceRIy, CD16, 0X40, CD31 CD3e, CD3y, CD35, TCRa, CD32, CD64, VEGFR2, FAS, or FGFR2B.
- the transmembrane domain comprises a sequence of SEQ ID NO: 37 or the transmembrane domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 37, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 37.
- the CD8 binding domain is connected to the transmembrane domain by a hinge region.
- the intracellular signaling domain comprises a sequence encoding a costimulatory domain.
- the intracellular signaling domain comprises a sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41
- the intracellular signaling domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41, or a sequence with 95-99 %identity to an amino acid sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41 .
- the disclosure provides a vector comprising a nucleic acid molecule encoding a CAR, e.g., an anti-CD8 CAR disclosed herein.
- the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, or a retrovirus vector.
- the vector further comprises a promoter, optionally wherein the promoter is selected from a group consisting of an EF-1 promoter, a MSCV promoter, SC40 promoter, a CMV promoter, or a PGK promoter.
- the disclosure provides a method of making a cell comprising transducing a T cell with a vector disclosed herein. In some embodiments, the disclosure provides a method of providing an anti-cancer immunity in a mammal comprising administering to the mammal an effective amount of a cell expressing a CAR molecule, e g., an anti-CD8 CAR molecule disclosed herein.
- the immune cell is an autologous T cell. In some embodiments, the immune cell is an allogeneic T cell.
- the disclosure provides an recombinant nucleic acid molecule encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain linked to an intracellular localizing domain, wherein the intracellular localizing domain comprises a retention sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteosome localizing sequence.
- ER endoplasmic reticulum
- Golgi retention sequence a proteosome localizing sequence
- the anti-CD8 binding domain is a scFv or a single domain antibody
- the scFv comprises a CD8 binding domain comprising: (i) a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13; (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13: or (iii) an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 and iv) a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; (v) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14: or (vi) an amino acid sequence with 95-99% identity to the amino acid sequence of the light
- the CD8 binding domain comprises: i) an amino acid sequence as set forth in SEQ ID NO: 25; ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 25; or iii) an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25.
- the intracellular localizing domain comprises one or more of a Golgi retention sequence, an ER retention sequence, a proteosome localizing sequence.
- the intracellular localizing domain comprises an amino acid sequence as set forth in any of the SEQ ID NOs: 56, 58, 61, 63, 64, 65, 68, 74, or 75.
- the intracellular localizing domain comprises an amino acid sequence as set forth in any of SEQ ID NOs: 56, 58, 61, 63, 64, 66, or 67.
- the intracellular localizing domain comprises one or more of a Golgi retention sequence, an ER retention sequence, a proteosome localizing sequence.
- the ER retention sequence comprises a KDEL sequence and the CD8 blocking polypeptide further comprising a linker between the scFv and the intracellular localizing domain.
- the ER retention sequence comprises a KKXX sequence, wherein X represents any amino acid.
- the Golgi retention sequence comprises YQRL, YGRL, or YKGL.
- the proteosome localizing sequence comprises PEST.
- the disclosure provides a vector comprising a nucleic acid molecule encoding the CD8 blocking polypeptide disclosed herein, e.g., a CD8- PEBL.
- the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, or a retrovirus vector, optionally further comprising a promoter, optionally wherein the promoter is selected from a group consisting of an EF-1 promoter, a MSCV promoter, SC40 promoter, a CMV promoter, or a PGK promoter.
- the disclosure provides a method of modifying a cell comprising transducing or transfecting a cell with a vector disclosed herein.
- an engineered immune cell comprising: a nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered immune cell.
- ER endoplasmic reticulum
- the disclosure provides an engineered immune cell comprising: a nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising an anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR).
- CAR CD8 chimeric antigen receptor
- the disclosure provides an engineered immune cell comprising: (i) a first nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered cell; and (ii) a second nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising the anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR), optionally wherein the CD8 blocking polypeptide remains intracellularly within the engineered immune cell and binds endogenous CD8 within the engineered immune cell [0021]
- the anti-CD8 binding domain is a scFv or a single domain antibody.
- the engineered immune cell is an engineered T cell, an engineered natural killer (NK) cell, an engineered NK/T cell, an engineered monocyte, an engineered macrophage, or an engineered dendritic cell.
- the scFv of the CD8 blocking polypeptide and/or the scFv of the CAR comprises (i) a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13, (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 : or (iii) an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 and iv) a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; (v) an amino acid sequence having at least one, two or three modifications but not more than 0, 20 or
- the scFv of the CD8 blocking polypeptide and/or the scFv of the CAR comprises i) an amino acid sequence as set forth in SEQ ID NO: 25; ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 25; or iii) an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25.
- the scFv of the CD8 blocking polypeptide and/or the scFv of the CAR comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID NOs: 1-6, respectively; or (ii) SEQ ID NOs: 7-12 respectively.
- the ER retention sequence comprises an amino acid sequence selected as set forth in any of the SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 66 or SEQ ID NO: 67.
- the ER retention sequence is selected from the group consisting of SEQ ID NO: 65, SEQ ID NO: 64, SEQ ID NO: 74, SEQ ID NO: 75.
- the proteosome localizing sequence comprises an amino acid sequence as set forth in SEQ ID NO: 68.
- the CD8 blocking polypeptide further comprises a transmembrane domain linked between the scFv and either the ER retention sequence domain comprising EKKMP, wherein the transmembrane domain is a transmembrane domain selected from any one of the group consisting of CD8alpha, CD8beta, 4-1BB, CD28, CD34, CD4, FcsRIgamma, CD16, 0X40, CD3zeta, CD3epsilon, CD3gamma, CD35, TCRalpha, CD32, CD64, VEGFR2, FAS, and FGFR2B, e.g., wherein the transmembrane domain comprises an amino acid sequence of SEQ ID NO: 34.
- the CD8 blocking polypeptide comprises an amino acid sequence having at least 90% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 45-47 and 79-81. In some embodiments, the CD8 blocking polypeptide comprises an amino acid sequence having at least 90% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 95-98.
- the transmembrane domain is selected from an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD1.
- the transmembrane domain is a CD8a transmembrane domain.
- the present disclosure provides an engineered immune cell comprising a recombinant nucleic acid molecule encoding an anti-CD8 chimeric antigen receptor (CAR), wherein the anti-CD8 CAR comprises an antigen binding domain which binds to CD8, a transmembrane domain, and a signaling domain, and wherein the engineered immune cell has reduced expression of endogenous CD8.
- the engineered immune cell has a reduced CD 8 expression.
- the endogenous CD8 of the engineered immune cell is knocked out or knocked down.
- the endogenous CD8 of the engineered immune cell is knocked out via zinc-fmger endonucleases, TALEN, or CRISPR-Cas9. In some embodiments, the endogenous CD8 of the engineered immune cell is knocked down via siRNA or shRNA. In some embodiments, the endogenous CD8 of the engineered immune cell is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence.
- ER endoplasmic reticulum
- the anti-CD8 binding domain is a scFv or a single domain antibody.
- the engineered cell comprises a population of engineered cells, and wherein cytotoxic T cells in the population of engineered cells is at least about 50 times more than cytotoxic T cells otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after transduction and culturing for a period of time. In some embodiments, the period of time is at least about 2 days, at least about 3 days, at least about 5 days or more.
- the engineered cell comprises a population of engineered cells, and wherein viability of cytotoxic T cells in the population of engineered cells is at least about 2 times, at least about 5 times, at least about 10 times, at least about 25 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, or at least about 500 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- cytotoxicity of the engineered immune cell against target cells is at least about 1.2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, or at least about 3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity is tested at an effector-target ratio of 2:1, 1:1, or 1 :2.
- the target cells are CD8- positive cells, e.g., comprising MOLT-4 and/or CCRF-CEM.
- cytotoxicity of the engineered immune cell against target cells is at least about 1 .2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, at least about 3 times, or at least about 4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culturing with the target cells.
- the cytotoxicity is tested at an effector-target ratio of 1:1, 1:2, 1 :4, or 1:8.
- the target cells are CD8-positive cells, e g., comprising MOLT-4 and/or CCRF-CEM
- proliferation of the engineered immune cell in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, or at least about 5 times higher compared to proliferation of the engineered immune cell in the absence of the target cells.
- proliferation of the engineered immune cell in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, or at least about 10 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
- the proliferation of engineered immune cell is tested at an effector-target ratio of 1:1.
- the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days of culturing the engineered immune cell in the presence or absence of the target cells.
- the target cells are CD8-positive cells, e g., comprising MOLT-4 and/or CCRF-CEM.
- the disclosure provides a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and a CD8 chimeric antigen receptor (CAR) comprising an anti-CD8 binding domain, optionally wherein the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell.
- the anti-CD8 binding domain is a scFv or a single domain antibody
- the disclosure provides a pharmaceutical composition
- a pharmaceutical composition comprising the recombinant nucleic acid described herein, the CAR described herein, the CD8 blocking polypeptide described herein, the vector described herein, or an engineered immune cell described herein, optionally further comprising an excipient.
- the disclosure provides a method of treating a disease in a subject in need thereof comprising administering a pharmaceutical composition comprising an immune cell comprising an anti-CD8 CAR comprising a CD8 binding domain, a transmembrane domain, and a signaling domain.
- the disclosure provides a method of providing anti -cancer immunity to a mammal comprising administering to the mammal the recombinant nucleic acid described herein, a CAR described herein, the CD8 blocking polypeptide described herein, the vector described herein, the engineered immune cell described herein, or a pharmaceutical composition described herein.
- the immune cell is engineered to have reduced cell surface expression of CD8.
- the immune cell further comprises a chimeric polypeptide comprising a CD8 binding domain and an intracellular localization domain.
- the disease is a T cell malignancy or a NK cell malignancy.
- the disclosure provides a method of reducing fratricide in a population of immune cells expressing a chimeric antigen receptor comprising a CD8 binding domain, the method comprising expressing a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteosome localizing sequence, and wherein the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell.
- the CD8 binding domain is an scFv or a single domain antibody.
- the disclosure provides a method of treating a cancer in a subject in need thereof comprising administering to the subject an recombinant nucleic acid described herein, a CAR described herein, a CD8 blocking polypeptide described herein, a vector described herein, an engineered immune cell described herein, or a pharmaceutical composition described herein.
- the immune cell is engineered to have reduced cell surface expression of CD8.
- the disclosure provides a method of treating cancer in a subject in need thereof comprising administering a therapeutic amount of a composition comprising an engineered immune cell comprising: (i) a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteosome localizing sequence, and wherein the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell; and (ii) a CAR comprising a CD8 targeting domain, a transmembrane domain, and a signaling domain.
- the CD8 binding domain is an scFv or a single domain antibody.
- the disclosure provides a method of providing an anti-cancer immunity in a mammal comprising administering to the mammal an effective amount of an immune cell expressing a CAR molecule disclosed herein, e g., an anti-CD8 CAR.
- the immune cell is engineered to have reduced cell surface expression of CD8.
- the immune cell is an autologous T cell.
- the immune cell is an allogeneic T cell.
- the disclosure provides use of the recombinant nucleic acid described herein, the CAR described herein, the CD8 blocking polypeptide described herein, the vector of described herein, the engineered immune cell described herein, or the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of a cancer, in a subject in need thereof.
- the disclosure provides a method of reducing and/or preventing fratricide during manufacturing of immune cells expressing an anti-CD8 CAR, comprising functional inhibition of CD8 signaling during the manufacturing process of the cells
- the functional inhibition of CD8 signaling comprises reducing expression of endogenous CD8 of the immune cells.
- the endogenous CD8 of the immune cells is knocked out or knocked down.
- the endogenous CD8 of the immune cells is knocked out via zinc-finger endonucleases, TALEN, or CRISPR-Cas9.
- the endogenous CD8 of the immune cells is knocked down via siRNA or shRNA.
- the endogenous CD8 of the immune cells is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence.
- the anti-CD8 binding domain is a scFv or a single domain antibody.
- viability of cytotoxic T cells among the immune cells is at least about
- cytotoxicity of the immune cells against target cells is at least about
- the cytotoxicity is tested at an effector-target ratio of 2: 1, 1 : 1, or 1 :2.
- the target cells are CD8-positive cells, e g., comprising MOLT-4 and/or CCRF-CEM.
- cytotoxicity of the immune cells against target cells is at least about 1.2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, at least about 3 times, or at least about 4 times higher compared to otherwise identical immune cells and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culturing with the target cells.
- the cytotoxicity is tested at an effector-target ratio of 1 : 1, 1 :2, 1 :4, or 1 :8.
- the target cells are CD8-positive cells, e.g., comprising MOLT-4 and/or CCRF-CEM.
- proliferation of the immune cells in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, or at least about 5 times higher compared to the immune cells in the absence of the target cells as claimed here. In some embodiments, proliferation of the immune cells in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, or at least about 10 times higher compared to otherwise identical immune cells with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
- the immune cells and the target cells are at an effector-target ratio of 1 :1 .
- the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days of culturing the immune cells in the presence or absence of the target cells.
- the target cells are CD8-positive cells, comprising MOLT-4 and/or CCRF-CEM.
- the disclosure provides a method of manufacturing an engineered immune cell comprising (i) transducing an immune cell with a vector comprising a polynucleotide sequence encoding a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain; and (ii) transducing the immune cell with a vector comprising a polynucleotide sequence encoding a CD8 chimeric antigen receptor (anti-CD8 CAR) comprising a CD8 binding domain, a transmembrane domain, and a signaling domain.
- anti-CD8 CAR CD8 chimeric antigen receptor
- the CD8 binding domain of the CD8 blocking polypeptide or the CD8 binding domain of the anti-CD8 CAR comprises an scFv or a single domain antibody.
- the cellular localizing domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteosome localizing sequence.
- the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell.
- the CD8 blocking polypeptide is expressed before the anti-CD8 CAR. In some embodiments, the CD8 blocking polypeptide is expressed about one day before the anti-CD8 CAR.
- the CD8 blocking polypeptide is expressed at least one day before the anti- CD8 CAR. In some embodiments, the CD8 blocking polypeptide is expressed simultaneously with the anti-CD8 CAR. In some embodiments, a bicistronic vector comprises sequences encoding the CD8 blocking polypeptide and the anti-CD8 CAR.
- FIG. 1 illustrates the schematic design of the anti-CD8oi-41BB-CD3 ⁇ construct.
- the anti-CD8 CAR comprises from 5’-3’ a CD8 signal peptide, a CD8 antigen binding domain derived from the humanized scFv sequence from the OKT8 antibody, a CD8 hinge and transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3(j intracellular signaling domain.
- FIG. 2 shows expression of anti-CD8a-41BB-CD3g in NK92 cells.
- Retroviral transduction of the anti-CD8 CAR in CD8-negative NK92 cells resulted in high expression of anti-CD8 CAR in the transduced GFP-positive NK-92 cells compared to the control.
- Dot plots illustrate GFP fluorescence and CAR expression revealed by staining with biotin-conjugated goat anti-mouse F(ab’)2 antibody followed by streptavidin conjugated to APC.
- Fig. 3 shows NK92 expressing anti-CD8a-41BB-CD3ij mediated cytotoxicity against CD8+ cells.
- NK92 cells exerted significantly higher cytotoxicity against the CD8- positive leukemia cell line MOLT-4 when they expressed the anti-CD8 CAR (Fig. 3; left panel) but no gains in cytotoxicity were observed when the target cell was the CD8- negative leukemia cell line Jurkat (Fig. 3; right panel).
- Fig. 4 shows expression of anti-CD8a-41BB-CD3g in human peripheral blood T lymphocytes.
- Peripheral blood T lymphocytes transduced with anti-CD8 CAR show high expression of anti-CD8 CAR 2 days after transduction.
- Dot plots represent flow cytometric analysis of transduced T lymphocytes that were stained with biotin-conjugated goat antimouse F(ab’)2 antibody followed by streptavidin conjugated to APC to detect the CAR.
- Fig. 5 shows expression of anti-CD8 CAR in T lymphocytes induces killing of lymphocytes.
- Anti-CD8 CAR expression in peripheral T lymphocytes was associated with a markedly reduced cell recovery in contrast with T cells transduced with GFP only (“Mock”).
- Fig. 6 shows expression of anti-CD8 CAR in T lymphocytes induced killing of CD8+ lymphocytes. Analysis of expression of CD4 and CD8 in peripheral blood T lymphocytes transduced with anti-CD8 CAR shows CD8 positive cells had largely disappeared and most of the remaining viable cells were CD4-positive two days after transduction. [0043] Fig.
- the first PEBL comprises CD8ot Signal Peptide - OKT8 Light Chain 1 - scFv Linker 1 - OKT8 Heavy Chain 1 - Linker20 (1) - AEKDEL (anti-CD8(20)AEKDEL) (Fig 7; top panel).
- the second PEBL comprises CD8a Signal Peptide - OKT8 Light Chain 1 - scFv Linker 1 - OKT8 Heavy Chain 1 - CD8 Transmembrane 1 - EEKKMP 1 (anti-CD8-EEKMP) (Fig.
- the third PEBL comprises CD8a Signal Peptide 2 - OKT8 Light Chain 3 - scFv Linker 3 - OKT8 Heavy Chain 3 - Linker20 2 - OKT8 Light Chain 4 - scFv Linker 4 - OKT8 Heavy Chain 4 - CD8 Transmembrane 2 - EEKKMP 2 (bi(20)- Anti-CD8-EEKMP) (Fig.7, third from top panel).
- the fourth PEBL comprises CD8a Signal Peptide - OKT8 Light Chain 2 - scFv Linker 2 - OKT8 Heavy Chain 2 - Linker5 - OKT8 Light Chain 1 - scFv Linker 1 - OKT8 Heavy Chain 1 - CD8 Transmembrane 1 - EEKKMP l(bi(5)-AntiCD8-EEKMP) (Fig. 7; fourth from top panel).
- the fifth PEBL comprises CD8a Signal Peptide - OKT8 Light Chain 2 - scFv Linker 2 - OKT8 Heavy Chain 5 - Linker5 - OKT8 Light Chain 1 - scFv Linker 1 - OKT8 Heavy Chain 1 - Linker20 (1) - AEKDEL (bi(5)-AntiCD8(20) AEKDEL) (Fig 7; bottom panel)
- Fig. 8 shows anti-CD8 PEBLs eliminated surface CD8 expression on MOLT-4.
- Fig. 9 shows PEBL expression in transduced MOLT-4 cells confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab’)2 antibody followed by phycoerythrin (PE)-conjugated streptavidin.
- Fig. 10 shows T-lymphocytes transduced with Anti-CD8(20)AEKDEL, bi(5)- Anti-CD8(20)AEKDEL, Anti-CD8-EEKMP PEBL, bi(20)-Anti-CD8-EEKKMP PEBL, or bi(5)-Anti-CD8-EEKKMP PEBL show reduced expression of CD8 on their surface compared to the CD8 expression on T lymphocyte cells transduced with GFP. Surface CD8 expression was reduced by all PEBLs among GFP-expressing CD4-negative T lymphocytes. T lymphocytes were transduced with GFP only (“Mock”), or GFP plus the indicated PEBLs.
- Transduced T lymphocytes were stained with PE-conjugated anti-CD8 antibody, PEcy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody. Symbols indicate CD8 MFI in CD3+/CD4- cells expressing GFP. Mock and Anti-CD8- EEKKMP were transduced in 7 donors. bi(20)-anti-CD8-EEKKMP was transduced in 4 donors. bi(5)-Anti-CD8-EEKKMP was transduced in 6 donors Anti-CD8(20)AEKDEL and bi(5)-Anti-CD8(20)AEKDEL were transduced in 2 donors. (**** P ⁇ 0.0001) [0047] Fig.
- 1 1 shows PEBL expression in transduced T-lymphocytes was confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab’)2 antibody followed by phycoerythrin (PE)-conjugated streptavidin PE after permeabilization with BD Cytofix/Cytoperm. Histograms represent GFP+ cells.
- Fig. 12 shows downregulation of CD8 expression was sustained in MOLT-4 cells and T lymphocytes transduced with an anti-CD8-EEKMP PEBL or bi(5)-Anti-CD8- EEKKMP PEBL. T lymphocytes and MOLT-4 were transduced with the indicated anti- CD8 PEBLs. Following transduction, cells were monitored for up to 23 days for surface CD8 expression by staining with PE-conjugated anti-CD8 antibody, PEcy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody and gated on CD3+ CD4- cells expressing GFP.
- Fig. 13 shows surface CD8 expression according to levels of GFP expression in T lymphocytes transduced with anti-CD8-EEKMP PEBL, bi(20)-Anti-CD8-EEKKMP PEBL, or bi(5)-Anti-CD8-EEKKMP PEBL.
- Fig. 14 shows CAR expression in peripheral blood T lymphocytes that were transduced with either anti-CD8- PEBL (EEKKMP) or a vector containing GFP and then transduced one day later with anti-CD8 CAR.
- T lymphocytes were first transduced with GFP only (“Mock”) or GFP plus anti-CD8-PEBL (EEKKMP).
- Half of the transduced T lymphocytes were sequentially transduced with GFP plus anti-CD8 CAR.
- Transduced cells were stained with biotin-conjugated goat anti-human F(ab’)2 antibody followed by streptavidin conjugated to APC. The CAR was highly expressed regardless of the construct used in the preceding transduction.
- Fig. 15 shows expression of anti-CD8 CAR with or without anti-CD8 PEBL result in reduced CD8 expression in T lymphocytes.
- CD8 expression in peripheral blood T lymphocytes that were transduced with either anti-CD8-EEKKMP or a vector containing GFP and then transduced one day later with anti-CD8 CAR.
- Anti-CD8-EEKKMP reduced CD8 surface expression No CD8 positive cells were observed after transduction with the anti-CD8 CAR.
- Fig. 16 shows PEBL improves cell recovery following transduction with anti- CD8 CAR.
- the number of viable T cells recovered after CAR transduction was considerably higher in cells that had been transduced with both PEBL and CAR compared to cells transduced with a CAR alone.
- Fig. 17 shows that the anti-CD8 CAR T lymphocytes with anti-CD8-EEKKMP mediated better cytotoxicity against CD8-positive MOLT-4.
- Anti-CD8-EEKKMP CAR-T cells exerted significantly higher cytotoxicity against CD8-positive MOLT-4 target cells than T lymphocytes expressing the anti-CD8 CAR but without PEBL transduction and CD8 downregulation. (**** P ⁇ 0.0001, *** P ⁇ 0.001, ** P ⁇ 0.01)
- Fig. 18 shows anti-CD8 PEBL T cells exert TCR-driven cytotoxicity.
- Fig. 19 shows anti-CD8 PEBL T cells are stimulated by TCR engagement.
- Upregulation of CD25 mediated by T2 cells displaying an SI 83 peptide (T2) was similar in T cells expressing TCR with or without an anti-CD8 PEBL. (**** P ⁇ 0.0001)
- Fig. 20 shows CD8 knockout by CRISPR-Cas9 improves recovery of cytotoxic T cells after anti-CD8a-41BB-CD3 CAR transduction.
- Anti-CD8a-41BB-CD3( ⁇ CAR was transduced on T cells which had been subjected to CD8 knockout (CD8KO-CAR), or not (Cas9-CAR).
- CD8 knockout was successful, and in 5 experiments, mean ( ⁇ SD) percentage of CD8+ T cells was 44.7% ( ⁇ 12.8) for Cas9-Only and 1.8% ( ⁇ 1.7) for CD8KO. Bars represent the percentage of CD4-negative cells relative to those initially used for transduction.
- Figs. 21A and 21B show expression of anti-CD8a-41BB-CD3 CAR on CD8 knockout T cells improves cytotoxicity against CD8+ cell lines.
- T cells electroporated with NLS-Cas9 alone (“Cas9”) or a complex of NLS-Cas9 and CD8a gRNA (“CD8KO”) were transduced with either GFP only or anti-CD8a-41BB-CD3 ⁇ CAR and GFP.
- MOLT-4 (Fig. 21 A) and CCRF-CEM (Fig. 21B) cells labelled with calcein-AM red-orange were cocultured with transduced T cells at E:T of 2: 1, 1: 1, and 1 :2 for 4 hours.
- Fig. 21 A shows cytotoxicity of T cells electroporated with NLS-Cas9 alone (“Cas9”), a complex of NLS-Cas9, either GFP only (CD8KO) or anti-CD8a-41BB-CD3 ⁇ CAR and GFP (CD8KO-CAR) using MOLT-4 cell line.
- Cas9 NLS-Cas9 alone
- a complex of NLS-Cas9 either GFP only (CD8KO) or anti-CD8a-41BB-CD3 ⁇ CAR and GFP (CD8KO-CAR) using MOLT-4 cell line.
- FIG. 2 IB shows cytotoxicity of T cells electroporated with NLS-Cas9 alone (“Cas9”), a complex of NLS-Cas9, either GFP only (CD8K0) or anti-CD8a-41BB-CD3/j CAR and GFP (CD8K0-CAR) using CCRF-CEM cell line.
- Figs. 22A and 22B show anti-CD8a-41BB-CD3 ⁇ CAR-T cells with CD8 knockout induces greater long-term cytotoxicity against CD8+ leukemic cell lines than CAR-T cells without CD8 knockout.
- T cells electroporated with NLS-Cas9 alone (“Cas9”) or a complex of NLS-Cas9 with CD8a gRNA (“CD8KO”) were transduced with either GFP only or anti-CD8a-41BB-CD3 ⁇ CAR and GFP.
- Transduced T cells were co-cultured with mCherry-expressing MOLT-4 (Fig. 22A) or CCRF-CEM (Fig.
- Fig. 22A shows cytotoxicity exerted by T cells electroporated with NLS-Cas9 alone (“Cas9”), a complex ofNLS-Cas9 and CD8a guide RNA, either GFP only (CD8KO) or anti-CD8a-41BB-CD3i ⁇ CAR and GFP (CD8KO-CAR) as measured at sequential time-points during co-cul turing with MOLT-4 cell line.
- Cas9 NLS-Cas9 alone
- CD8a guide RNA either GFP only (CD8KO) or anti-CD8a-41BB-CD3i ⁇ CAR and GFP (CD8KO-CAR) as measured at sequential time-points during co-cul turing with MOLT-4 cell line.
- Cas9 NLS-Cas9 alone
- CD8a guide RNA either GFP only (CD8KO) or anti-CD8a-41BB-CD3 ⁇ CAR and GFP (CD8KO-CAR) as measured at sequential timepoints during co-culturing with CCRF-CEM cell line.
- Fig. 23 shows anti-CD8a-41BB-CD3/j CAR-T cells with CD8 knockout proliferate in the presence of CD8+ target cells
- T cells with CD8 knockout were transduced with GFP only or anti-CD8a-41BB-CD3 ⁇ CAR and GFP, and co-cultured with or without lOOGy irradiated MOLT-4 at 1 : 1 in triplicates.
- Each plot represents a separate T cell donor.
- Immunotherapy is becoming a mainstay of modern cancer treatment
- the infusion of genetically engineered immune cells has yielded very promising clinical results, indicating that tumor responses can be achieved even in patients where standard treatment modalities have failed.
- Central to the success of CAR-T cell therapy is the identification of targets that are highly expressed in cancer cells but are not expressed by healthy cells.
- Antigens with these characteristics that are targetable with CARs are rare and are typically associated with tumor peptides expressed in the context of specific HLA molecules.
- Much of the clinical experience with CARs has instead relied on antigens expressed in healthy cells that are temporarily dispensable and/or whose absence can be offset by clinical intervention.
- CD8 as a target for CAR-T cell therapy.
- CD8 is widely expressed in T-cell leukemias and lymphomas.
- CD8 expression has been reported in cases of T-cell prolymphocytic leukemia, T-cell large granular lymphocytic leukemia, peripheral T-cell lymphoma, as well as Epstein-Barr virus (EBV)+ T-cell lymphoproliferative disorders of childhood, including EBV+ hemophagocytic lymphohistiocytosis, systemic EBV+ T-cell leukemia of childhood and primary EBV+ nodal T-cell, or NK-cell lymphoma.
- EBV Epstein-Barr virus
- second-generation anti-CD8 CARs that can be expressed at high levels in the CD8-negative NK cell line NK92.
- second generation anti-CD8 CARs elicited high and specific cell killing of CD8+ leukemic cells.
- the anti-CD8 CARs disclosed herein triggered killing of the T lymphocytes expressing CD8, including those expressing the anti-CD8 CAR. Because CD8+ T cells are the main direct effectors of anti-tumor cytotoxicity, this fratricidal activity can reduce the number of cells that can be recovered for infusion in patients and, hence, impair clinical activity of anti- CD8 CAR T cells.
- the present disclosure provides cells that have downregulated CD8 expression.
- the downregulation occurs using the PEBL technology as described in WO2016/126213.
- Anti-CD8 PEBLs markedly reduced CD8 expression in MOLT-4 cells and T lymphocytes.
- CD8 downregulation might also be achievable with gene editing methods, such as zinc-finger endonucleases, TALEN, and CRISPR-Cas9.
- downregulation occurs via PEBLs that are expressed simultaneously with CARs via bicistronic vectors and allow the desired genetic modifications to occur with one single transduction.
- CD8 is critical for TCR-mediated signaling, as it stabilizes its binding to peptide-loaded HLA and promotes signal transduction. Therefore, the consequences of CD8 downregulation on the function of human peripheral blood T cells engineered with CARs or TCRs were unpredictable.
- This disclosure provides anti-CD8 CAR T cells with downregulated CD8a e.g., through expression of PEBL (e.g., anti-CD8 PEBL) having increased cytotoxic capacity compared to anti-CD8 CAR T cells where CD8a expression is not downregulated.
- PEBL e.g., anti-CD8 PEBL
- downregulation of CD8a with PEBL do not affect TCR-mediated signaling or peptide-HLA specific cytotoxicity.
- the high expression of CAR or TCR in the engineered immune cells can diminish the impact of the CD8 co-receptor on signaling.
- the functional capacity of T cells expressing physiologic levels of TCR can diminish in the absence of CD8 expression.
- downregulation of CD8 with PEBLs, e g., anti-CD8 PEBLs disclosed herein or gene editing technologies can provide a way to silence TCR receptor signaling.
- the infusion of the T cell products, e.g., the engineered immune cells (e.g., allogenic T cells) disclosed herein can suppress TCR receptor signaling.
- the suppression of TCR receptor signaling can reduce the risk of graft-versus-host disease after infusion of the T cell products disclosed herein, e g., the allogeneic T cell products.
- the disclosure provides effective CAR-T cells, e.g., anti-CD8 CAR T cells for CD8+ malignancies.
- the disclosure provides, autologous and/or allogeneic anti-CD8 CAR T cells with downregulated CD8 expression, (e.g., using PEBL technology as described herein) for treating malignancies, e.g., CD8+ malignancies.
- CD8+ malignancies e.g., CD8+ malignancies.
- the term "about” or “approximately” as used herein refers to a measurable value such as an amount, a temporal duration, and the like, refers to being within a statistically meaningful range of variations of ⁇ 20% or in some instances ⁇ 10%, or in some instances ⁇ 5%, or in some instances ⁇ 1%, or in some instances ⁇ 0. 1% from the specified value.
- allogeneic refers to any material derived from an individual that is transplanted into a genetically different recipient of the same species. Two or more individuals are said to be allogeneic to one another when their genes at one or more loci are not identical. In some aspects, allogeneic material from individuals of the same species may be sufficiently unlike genetically to interact antigenically.
- autologous refers to any material derived from the same individual to which it is later to be re-introduced.
- binding domain refers generally to a molecule that binds to a specific molecule and optionally forms a bound complex but does not substantially recognize or bind other molecules in a sample
- binding domain encompasses antibodies and antibody fragments.
- binds refers to a binding which occurs between paired species (e.g., enzyme/substrate, receptor/agonist, antibody/antigen, lectin/carbohydrate) which may be mediated by covalent and/or non-covalent interactions. “Binding” occurs between pairs of species where there is interaction between the two that produces a bound complex. “Specific binding” occurs between two molecules with selective affinity for each other, in contrast to “non-specific binding”, which may result from a non-selective interaction between molecules with compatible charged or hydrophobic surfaces. An antibody that “specifically binds” to an antigen from one species may also bind to a homologous antigen from one or more different species.
- paired species e.g., enzyme/substrate, receptor/agonist, antibody/antigen, lectin/carbohydrate
- an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen.
- the specified antibodies bind to a particular protein at least two times the background and more typically more than 10 to 100 times background. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein.
- an antibody refers to a protein, or polypeptide sequence comprising an immunoglobulin domain which specifically binds with an antigen.
- Antibodies can be polyclonal or monoclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources.
- an antibody comprises at least one heavy chain.
- an antibody comprises at least one light chain.
- an antibody comprises at least one heavy chain and one light chain.
- Each heavy chain is comprised of a heavy chain variable region ("HCVR" or " VH") and a heavy chain constant region (comprised of domains CHI, CH2 and CH3).
- Each light chain is comprised of a light chain variable region ("LCVR or "VL”) and a light chain constant region (CL).
- An "antibody” includes bispecific, multispecific, murine, chimeric, humanized and human antibodies. Tn some embodiments, an antibody can be modified or engineered, e.g., chimeric antibodies, humanized antibodies, multiparatopic antibodies e.g., biparatopic antibodies), and/or multispecific antibodies (e.g., bispecific antibodies). Tn some embodiments, the antibody disclosed herein is a CD8 antibody, e.g., an 0KT8 antibody.
- scFv refers to a fusion protein comprising a variable region of an antibody light chain and a variable region of an antibody heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived.
- An scFv may have the VL and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH, or may comprise VH-linker-VL.
- variable region or “variable domain” of an antibody refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen.
- antibody heavy chain refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.
- antibody light chain refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (K) and lambda ( ) light chains refer to the two major antibody light chain isotypes.
- variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs).
- FRs conserved framework regions
- HVRs hypervariable regions
- a single VH or VL domain may be sufficient to confer antigen-binding specificity.
- the VH and VL regions can be further subdivided into regions of hypervariability, termed hypervariable region (HVR) or complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
- HVR hypervariable region
- CDR complementarity determining regions
- each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy -terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In some embodiments, these CDRs can be distributed between their appropriate framework regions.
- the FRs of the antibody may be identical to the human germline sequences or may be naturally or artificially modified.
- HVR hypervariable region
- CDR complementarity determining region
- antibodies comprise six HVRs: three in the VH (HCDR1, HCDR2, HCDR3), and three in the VL (LCDR1, LCDR2, LCDR3).
- chimeric antigen receptor refers to an engineered cell-surface receptor comprising, at least an extracellular binding domain, a transmembrane domain, and an intracellular signaling domain (alternatively referred to as a "cytoplasmic signaling domain") comprising a functional signaling domain derived from a stimulatory molecule and one or more costimulatory molecules.
- the chimeric antigen receptors of the present disclosure are intended primarily for use with lymphocyte such as T cells and natural killer (NK) cells.
- the binding domain comprises a single-chain variable fragment antibody fragment comprising the VH and VL domains of a CD8 antibody.
- the CAR described herein is an anti-CD8 CAR (sometimes referred to as a CD8 CAR), e.g., a CAR wherein the binding domain binds to CD8.
- the anti-CD8 CAR comprises an scFv comprising the VH and VL domains of a OKT8 antibody.
- the extracellular binding domain of a CAR of the disclosure may exist in a variety of forms where the antigen binding domain is expressed as part of a contiguous polypeptide chain including, for example, a single domain antibody fragment (sdAb), a single chain antibody (scFv), a humanized antibody, or a bispecific antibody.
- sdAb single domain antibody fragment
- scFv single chain antibody
- humanized antibody or a bispecific antibody.
- CD8 refers to the Cluster of Differentiation 8 protein, a transmembrane glycoprotein that serves as a co-receptor for the T-cell receptor (TCR).
- TCR T-cell receptor
- effective amount refers to the minimum amount required to effect a measurable improvement An effective amount disclosed herein may vary according to factors such as the disease state, age, sex, and weight of the patient. An effective amount is also one in which any toxic or detrimental effects of a treatment are outweighed by its therapeutically beneficial effects.
- beneficial or desired results include clinical results such as decreasing one or more symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, enhancing effect of another medication such as via targeting, delaying the progression of the disease, and/or prolonging survival.
- an effective amount of a therapeutic agent may have the effect in reducing the number of cancer cells, reducing the tumor size, inhibiting cancer cell infiltration into peripheral organs, inhibiting tumor metastasis, inhibiting tumor growth, and/or relieving to some extent one or more of the symptoms associated with the disorder.
- express refers to the causing transcription and/or translation of a particular nucleotide sequence into an RNA or a protein. Proteins may be expressed and remain intracellular, become a component of the cell surface membrane, or be secreted into extracellular matrix or medium.
- engineered refers to any composition that has been intentionally changed by human intervention from its natural state
- An “engineered nucleic acid” as used herein refers to a nucleic acid whose sequence has been intentionally changed by human intervention to have a modification, substitution, addition, or deletion of one or more nucleotides.
- engineered immune cell refers to an immune cell that has been genetically modified as compared to a naturally occurring immune cell.
- an engineered T cell produced according to the present methods carries a nucleic acid comprising a nucleotide sequence that does not naturally occur in the T cell from which it was derived.
- the engineered immune cell is an engineered T cell, an engineered natural killer (NK) cell, an engineered NK/T cell, an engineered monocyte, an engineered macrophage, or an engineered dendritic cell.
- NK natural killer
- NK/T an engineered monocyte
- macrophage an engineered macrophage
- dendritic cell an engineered dendritic cell
- an “immune activating receptor” as used herein refers to a receptor that activates an immune response upon binding a cancer cell ligand.
- the immune activating receptor comprises a molecule that, upon binding (ligation) to a ligand (e g., peptide or antigen) expressed on a cancer cell, is capable of activating an immune response.
- the immune activating receptor is a CAR, methods for designing and manipulating a CAR are known in the art.
- flankricide refers to when one cell in the population kills a second cell in the population wherein the first cell and the second cell are of the same type, e.g., both cells are T cells.
- reducing and/or preventing fratricide as used herein relates to the decrease in the occurrence of fratricide in a population of cells as compared to a suitable control population of cells (typically, but not necessarily, a population of identical cells with normal expression of the target of a CAR).
- sequence identity refers to the subunit sequence identity between two polymeric molecules, for example, between two polynucleotide or polypeptide sequences.
- An analysis of sequence identity begins by aligning two sequences. Identical sequences (100% sequence identity) have the same nucleotide or amino acid at each position of the alignment. “Percent sequence identity” is determined by comparing the number of positions that are identical to the total number of subunits in the sequence alignment. Percent sequence identity can be determined over a fraction of the sequences or over the whole of the sequences. Percent sequence identity can be determined using a sequence comparison algorithm.
- Sequence identity is typically measured using sequence analysis software. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat’l. Acad. Sei.
- a BLAST program may be used, with a probability score between e-3 and e-100 indicating a closely related sequence
- BLAST algorithm which is described in Altschul et al., J. Mol. Biol. 215:403 (1990).
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (publicly accessible through the National Institutes of Health NCBI internet server).
- default program parameters can be used to perform the sequence comparison, although customized parameters can also be used.
- the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Nail. Acad. Sci. USA 89: 10915 (1989)).
- sequence identities are determined by Needleman-Wunsch alignment of two sequences with Gap Costs set to Existence: 11 Extension: 1 where percent identity is calculated by dividing the number of identities by the length of the alignment.
- intracellular signaling domain refers to an intracellular (e.g., cytoplasmic) portion of a molecule sufficient to transduce an effector function signal.
- the intracellular signal domain transduces the effector function signal and directs the cell to perform a specialized function.
- isolated refers to altered or removed from the natural state.
- a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
- An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment, e g., a host cell.
- a polynucleotide or a polypeptide is non-naturally occurring (e.g., recombinant, synthetic, etc.).
- nucleotide sequence in reference to a nucleic acid, refer to a contiguous series of nucleotides, e.g., a polynucleotide that are joined by covalent linkages, such as phosphorus linkages (e.g., phosphodi ester, alkyl and aryl-phosphonate, phosphorothioate, phosphotriester bonds), and/or non-phosphorus linkages (e.g., peptide and/or sulfamate bonds).
- covalent linkages such as phosphorus linkages (e.g., phosphodi ester, alkyl and aryl-phosphonate, phosphorothioate, phosphotriester bonds), and/or non-phosphorus linkages (e.g., peptide and/or sulfamate bonds).
- nucleic acid includes, for example, genomic DNA, cDNA, RNA, and DNA-RNA hybrid molecules. Nucleic acid molecules can be naturally occurring, recombinant, or synthetic. In addition, nucleic acid molecules can be single-stranded, double-stranded or triple-stranded. In some embodiments, nucleic acid molecules can be modified. In the case of a double-stranded polymer, “nucleic acid” can refer to either or both strands of the molecule.
- the nucleotide sequence encoding e g., a target-binding molecule linked to a localizing domain is a heterologous sequence (e.g., a gene that is of a different species or cell type origin).
- nucleotide and “nucleotide monomer” refer to naturally occurring ribonucleotide or deoxyribonucleotide monomers, as well as non-naturally occurring derivatives and analogs thereof. Accordingly, nucleotides can include, for example, nucleotides comprising naturally occurring bases (e g., adenosine, thymidine, guanosine, cytidine, uridine, inosine, deoxyadenosine, deoxy thymidine, deoxyguanosine, or deoxy cytidine) and nucleotides comprising modified bases.
- naturally occurring bases e g., adenosine, thymidine, guanosine, cytidine, uridine, inosine, deoxyadenosine, deoxy thymidine, deoxyguanosine, or deoxy cytidine
- nucleic acid encoding and “nucleotide sequence encoding” a polypeptide or an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence and may also include introns that are excised to yield a spliced nucleotide sequence to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s)
- polynucleotide refers to a chain of nucleotides.
- protein expression blockers or “PEBL” as used herein refer to a polypeptide construct containing a target-binding molecule that binds a target (e g., CD8) linked to a localizing domain (e g., an intracellular retention domain) that directs the polypeptide to specific cellular compartments, such as the Golgi, ER, or proteasome, depending on the application.
- a target e g., CD8
- a localizing domain e g., an intracellular retention domain
- host cell refers to a cell which can support the replication or expression of an expression vector.
- Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells, such as yeast, insect cells, amphibian cells, or mammalian cells.
- vector refers to a composition which comprises a polynucleotide which can be used to deliver the polynucleotide to the interior of a cell.
- vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
- the term “vector” includes an autonomously replicating plasmid or a virus.
- the term is construed to further include non- plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, a polylysine compound, liposome, and the like.
- viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
- expression vector refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
- An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
- Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viral vectors (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
- lentivirus refers to a genus of the Retroviridae family that may be used as a gene delivery vector as described herein. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell. HIV, STV, and FTV are all examples of lentiviruses.
- lentiviral vector refers to a vector derived from at least a portion of a lentivirus genome, including especially a self-inactivating lentiviral vector as provided in Milone et al., Mol. Ther. 17(8): 1453-1464 (2009).
- Other examples of lentivirus vectors that may be used in the clinic include but are not limited to, e g., the LENTIVECTOR® gene delivery technology from Oxford BioMedica, the LENTIMAX® vector system from Lentigen, and the like
- Nonclinical types of lentiviral vectors are also available and would be known to one skilled in the art.
- subject refers to any animal, e.g., a mammal or marsupial.
- Subjects of the present invention include but are not limited to humans, nonhuman primates (e.g., rhesus or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, and fowl of any kind. Tn certain embodiments, the subject is a human.
- a “subject in need thereof’ refers to a subject (e.g., patient) who has, or is at risk for developing, a disease or condition that can be treated (e.g., improved, ameliorated, prevented) with, e g., engineered T cells.
- cancer refers to a disease characterized by the uncontrolled growth of aberrant cells Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described herein and include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma leukemia, lung cancer, and the like. As used herein, the term “cancer” includes premalignant as well as malignant cancers. The cancer described herein can be a stage I cancer, a stage II cancer, a stage III cancer, or a stage IV cancer.
- T cell and its grammatical equivalents as used herein can refer to a T cell from any origin.
- a T cell can be a primary T cell, e g., an autologous T cell, an allogenic T cell, a cell line, etc.
- the T cell can also be human or non-human.
- T cell activation or T cell triggering and their grammatical equivalents as used herein can refer to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation, cytokine production and/or detectable effector function. In some cases, “full T cell activation” can be similar to triggering T cell cytotoxicity.
- T cell activation can be measured using various assays known in the art.
- the assays can be an ELISA to measure cytokine secretion, an ELISPOT, flow cytometry assays to measure intracellular cytokine expression, flow cytometry assays to measure proliferation, and cytotoxicity assays (51Cr release assay) to determine target cell elimination.
- the assays typically use controls (non-engineered cells) to compare to engineered cells (CAR T) to determine relative activation of an engineered cell compared to a control.
- the assays can compare engineered cells incubated or put in contact with a target cell not expressing the target antigen.
- the comparison can be an anti-CD8 CAR T cell incubated with a target cell that does not express CD8.
- the terms “treat,” “treating,” or “treatment,” refer to counteracting a medical condition (e.g., a condition related to a T cell malignancy) to the extent that the medical condition is improved.
- a medical condition e.g., a condition related to a T cell malignancy
- CAR CD8 chimeric antigen receptors
- a second agent that downregulates CD8 expression on the effector T cells e.g., CD8 chimeric antigen receptors
- CD8 chimeric antigen receptors
- the present disclosure provides, novel nucleic acid molecules encoding chimeric antigen receptors (CARs) comprising an antibody or antibody fragment that specifically binds to CD8 (e.g., anti-CD8 CAR), a transmembrane domain, and a signaling domain.
- the present disclosure provides, novel nucleic acid molecules encoding CD8 blocking polypeptide comprising a single chain variable fragment (scFv) linked to an intracellular localizing domain.
- a cell e.g., an immune effector cell, e g., T cell or NK cell
- a CAR e.g., an anti-CD8 CAR
- CAR-T CAR-T
- CA NK CA NK
- a cell is transformed with the CAR, e.g., anti-CD8 CAR and the CAR, e.g., anti-CD8 CAR is expressed on the cell surface.
- the disclosure provides chimeric antigen receptors (CARs) comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain (e.g., an anti-CD8 CAR).
- CARs chimeric antigen receptors
- the disclosure provides a polypeptide construct containing a target-binding molecule that binds a target (e g., CD8) to be removed or neutralized.
- the disclosure provides a method to treat a disease, e g., cancer in a subject in need thereof by administering a composition comprising cells expressing an anti-CD8 CAR, e.g., anti-CD8 CAR, optionally in combination with a second agent that downregulates CD8 expression on the effector T cells.
- a disease e.g., cancer
- a composition comprising cells expressing an anti-CD8 CAR, e.g., anti-CD8 CAR, optionally in combination with a second agent that downregulates CD8 expression on the effector T cells.
- the anti-CD8 CAR induces T cells to exert specific cytotoxicity against T cell malignancies. Further, T cell cytotoxicity was shown to be markedly increased when anti-CD8 CAR was used in combination with downregulation of CD8 expression on the effector T cells. As demonstrated herein, downregulation (e.g., elimination, reduction, and/or relocalization) of CD8 prevented the fratricidal effect exerted by the corresponding anti-CD8 CAR, allowing greater T cell recovery after CAR expression as compared to cells that retained the target antigen (e g., CD8), and a more effective cytotoxicity against T leukemia/lymphoma cells.
- target antigen e.g., CD8
- the present disclosure provides, novel nucleic acid molecules encoding chimeric antigen receptors (CARs) comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain (e.g., anti-CD8 CAR).
- CARs chimeric antigen receptors
- the present disclosure provides, novel nucleic acid molecules encoding CD8 blocking polypeptide comprising an antibody or antibody fragment that specifically binds to CD8 linked to an intracellular localizing domain (e.g., CD8-PEBL).
- CD8 is a type I transmembrane glycoprotein which is expressed in a proportion of T-cell ALL cases as well as in mature T cell and NK cell neoplasms.
- CD8 is expressed on the surface of cytotoxic T cells, but can also be found on natural killer cells, cortical thymocytes, and dendritic cells.
- CD8 is an antigenic determinant detectable on some acute lymphocytic leukemia such as T cell lymphoblastic lymphoma and mature T cell and NK cell neoplasms such as hypo-pigmented mycosis fungoides.
- CD8 can be expressed as a heterodimer consisting of a CD8a and a CD8p chain but can also be expressed as a CD8a homodimer.
- CD8 binds to the class I human leukocyte antigen (HLA) on the target.
- CD8 is involved in T cell activation and function.
- CD8 stabilizes the binding of the T-cell receptor (TCR) to the cognate peptide-loaded HLA through binding to a separate site on the HLA, a function that is especially important for low affinity TCRs.
- CD8 recruits the protein tyrosine kinase LCK to the CD3 complex following target binding to TCR.
- the CD8a cytoplasmic domain contains a binding site for LCK, which phosphorylate immunoreceptor tyrosine-based activation motifs (ITAMs) on CD3, transducing the activation signal through a signaling cascade leading to T cell effector functions.
- T cells lacking CD8a or its cytoplasmic domain were unable to exert effector functions following cross-linking with anti-CD3 and anti-CD8 antibody, or in the presence of target cells expressing the cognate HLA.
- the CD8 binding portion of the CAR or the CD8 blocking polypeptide is a scFv antibody fragment.
- the affinity of the CD8-binding domain for CD8 is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 100%, at least 120%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500% of the binding affinity for CD8 of the antibody that it is derived from.
- the antibody that binds CD8 is a single-chain variable fragment derived from an antibody (“scFv”).
- scFv single-chain variable fragment derived from an antibody
- Anti-CD8 antibody can be a scFv or a single domain antibody.
- the anti-CD8 antibody is a CD8 antibody selected from the group consisting of 0KT8, LS-B3914-BCD1, RFT8, FAB1509A, 4B11, EPR21769, CAL66, CAL67, EPR20305, EPR22483-288, CAL38, EPR22331-81, EPR22331-54, OX-8, SP239, C8/144B, EP1150Y, BLR044F, EPR26538-16, rC8/468, YTS169.4, SP16, EP10640(2), EP21769, ab4055, ab288669, EPR223341 -54, EPR22331-81, ab25478, YTC182.20, CA9.ID3, CAL38, IBL-3/25, YTS105.18, ab90965, ab20133,ab225491, RPA-T8,
- the anti-CD8 antibody is 0KT8 In some embodiments, the anti-CD8 antibody is humanized 0KT8. In some embodiments, the anti-CD8 antibody sequence is codon optimized. In some embodiments, the anti-CD8 antibody sequence is changed, e g., to facilitate cloning.
- the single domain antibody can be a single variable domain on a heavy chain (VEIH) antibody, for example caplacizumab, ozoralizumab, and vobarilizumab.
- VIH heavy chain
- the CD8 binding domain of the CAR or the CD8 blocking polypeptide is an anti-CD8 scFv. In some embodiments, the CD8 binding domain of the CAR or the CD8 blocking polypeptide is a murine scFv antibody fragment. In some embodiments, the CD8 binding domain of the CAR or the CD8 blocking polypeptide is a scFv antibody fragment that is humanized compared to the murine sequence of the scFv from which it is derived. In some embodiments, the CD8 binding domain of the CAR or the CD8 blocking polypeptide is a human scFv antibody fragment.
- the scFv comprises an amino acid sequence as set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv comprises an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv comprises an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv is encoded by a polynucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 17, 52, 71, 72, or 101.
- the scFv is encoded by a codon optimized polynucleotide comprising a nucleic acid sequence derived from SEQ ID NO: 17, 52, 71, 72, or 101.
- the scFv is encoded by a modified polynucleotide, e.g., for cloning efficiency comprising a nucleic acid sequence derived from SEQ ID NO: 17, 52, 71 , 72, or 101.
- the scFv is encoded by a polynucleotide comprising a nucleic acid sequence having at least 50%, 60%, 70%, 80%, 90% or 95% sequence identity to SEQ ID NO: 17, 52, 71, 72, or 101.
- the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) having an amino acid sequence as set forth in SEQ ID NO: 13.
- VH heavy chain variable region
- HC CDR1 heavy chain complementary determining region 1
- HC CDR2 heavy chain complementary determining region 2
- HC CDR3 heavy chain complementary determining region 3
- the CD8 binding domain of the CAR can further comprise a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) of any anti-CD8 light chain binding domain having an amino acid sequence as set forth in SEQ ID NO: 14
- VL light chain variable region
- the heavy chain variable region comprises an amino acid sequence with 95- 99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13
- the light chain variable region comprises an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
- the anti-CD8 scFv comprises a variable heavy chain (heavy chain variable region or VH) and a variable light chain (light chain variable region or VL) having an amino acid sequence that each have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NO: 13 and 14, respectively.
- the heavy chain variable region can comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH sequence of SEQ ID NO: 13.
- the light chain variable region can comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VL sequence of SEQ ID NO: 14.
- the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 13. In certain instances, the heavy chain variable region comprise 10 or fewer amino acid (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) substitutions in the sequence set forth in SEQ ID NO: 13. In some instances, the light chain variable region comprise at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 14. In certain instances, the light chain variable region comprise 10 or fewer amino acid (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) substitutions in the sequence set forth in SEQ ID NO: 14.
- Table 1 discloses the amino acid sequences of the VH and VL region of an exemplary anti-CD8 scFv.
- the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the framework region sequence as compared to the amino acid sequence set forth in SEQ ID NO: 13.
- the light chain variable region comprise at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the framework region sequence as compared to the amino acid sequence set forth in SEQ ID NO: 14.
- a nucleic acid sequence encoding a VH comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences as set forth in SEQ ID Nos: 15, 16, 18, 19, and 94.
- a nucleic acid sequence encoding a VL comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences as set forth in SEQ ID Nos: 20-23.
- Table 2 discloses the nucleic acid sequences of the VH and VL region of an exemplary anti-CD8 scFv.
- the anti-CD8 scFv comprises a variable heavy chain (heavy chain variable region or VH) and a variable light chain (light chain variable region or VL) having a sequence that each have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NO: 13 and 14, respectively.
- the heavy chain variable region can comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH sequence of SEQ ID NO: 13.
- the light chain variable region can comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VL sequence of SEQ ID NO: 14.
- the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 13. In certain instances, the heavy chain variable region comprises 10 or fewer amino acid (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) substitutions in the sequence set forth in SEQ ID NO: 13. In some cases, the light chain variable region comprises at least one (e g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 14. In certain cases, the heavy chain variable region comprises 10 or fewer amino acid (e.g., 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10) substitutions in the sequence set forth in SEQ ID NO: 14.
- a nucleic acid sequence encoding a VH comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences as set forth in SEQ ID Nos:15,16, 18, 19 and 94.
- a nucleic acid sequence encoding a VL comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences as set forth in SEQ ID Nos: 20-23.
- the scFv of the present disclosure comprises a variable heavy chain sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to a variable heavy chain sequence of an anti-CD8 antibody.
- the scFv of the present disclosure comprises a variable light chain sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to a variable light chain sequence of an anti-CD8 antibody.
- the anti- CD8 antibody can be any such recognized by one skilled in the art.
- the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3).
- VH heavy chain variable region
- HC CDR1 heavy chain complementary determining region 1
- HC CDR2 heavy chain complementary determining region 2
- HC CDR3 heavy chain complementary determining region 3
- the HC CDR1, HC CDR2, HC CDR3, LC CDR1 , LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID Nos: 1-6, respectively; or (ii) SEQ ID Nos: 7-12 respectively.
- the CD8 binding domain comprises a HCDR1, HCDR2, HCDR3, LCDRl, LCDR2, and LCDR3 comprising amino acid sequences as set forth in Table 3 or Table 4.
- the CD8 binding domain described herein includes:
- HC CDRs chosen from one of the following: (i) a HC CDR1 of SEQ ID NO: 1, HC CDR2 of SEQ ID NO: 2 and HC CDR3 of SEQ ID NO: 3; or (ii) a HC CDR1 of SEQ ID NO: 7, HC CDR2 of SEQ ID NO: 8 and HC CDR3 of SEQ ID NO: 9; and/or (2) one, two, or three Light chain (LC) CDRs chosen from one of the following: (i) a LC CDR1 of SEQ ID NO: 4, LC CDR2 of SEQ ID NO: 5 and LC CDR3 of SEQ ID NO: 6; or (ii) a LC CDR1 of SEQ ID NO: 10, LC CDR2 of SEQ ID NO: 11 and LC CDR3 of SEQ ID NO: 12.
- LC CDR1 of SEQ ID NO: 4 chosen from one of the following: (i) a LC CDR1 of SEQ ID NO: 4, LC CDR
- the CD8 binding domain molecule described herein comprises (i) a heavy chain comprising a HC CDR1 of SEQ ID NO: 1 , HC CDR2 of SEQ ID NO: 2 and HC CDR3 of SEQ ID NO: 3, and (ii) a light chain comprising a LC CDR1 of SEQ ID NO: 4, LC CDR2 of SEQ ID NO: 5 and LC CDR3 of SEQ ID NO: 6; or (i) a heavy chain comprising a HC CDR1 of SEQ ID NO: 7, HC CDR2 of SEQ ID NO: 8 and HC CDR3 of SEQ ID NO: 9; and (ii) a light chain comprising a LC CDR1 of SEQ ID NO: 10, LC CDR2 of SEQ ID NO: 11 and LC CDR3 of SEQ ID NO: 12
- the anti-CD8 binding domain includes a Gly-Ser linker, e g., a linker having an amino acid sequence as set forth in SEQ ID NO: 29, e g , GSTSGGGSGGGSGGGGSS.
- the linker comprises a nucleotide sequence as set forth in any of the SEQ ID Nos: 30-33.
- the light chain variable region and heavy chain variable region of a scFv can be, e.g., in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.
- the disclosure provides, nucleic acid molecules encoding CARs comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain (e.g., anti-CD8 CAR).
- the disclosure provides an anti-CD8 CAR comprising a CD8 targeting domain comprising a single chain variable fragment (scFv) (CD8 binding domain), a transmembrane domain, and a signaling domain (anti-CD8 CAR).
- the CAR molecule e.g., the recombinant CAR molecule described herein, e.g., an anti-CD8 CAR described herein comprises a CD8 binding domain comprising: (1) one, two, or three heavy chain (HC) CDRs chosen from one of the following: (i) a HC CDR1 of SEQ ID NO: 1, HC CDR2 of SEQ ID NO: 2 and HC CDR3 of SEQ ID NO: 3; or (ii) a HC CDR1 of SEQ ID NO: 7, HC CDR2 of SEQ ID NO: 8 and HC CDR3 of SEQ ID NO: 9; and/or (2) one, two, or three Light chain (LC) CDRs chosen from one of the following: (i) a LC CDR1 of SEQ ID NO: 4, LC CDR2 of SEQ ID NO: 5 and LC CDR3 of SEQ ID NO: 6; or (ii) a LC CDR1 of SEQ ID
- the anti-CD8 CAR further comprises a hinge and transmembrane sequence.
- the intracellular signaling domain can comprise a signaling domain and one or more costimulatory domains.
- the hinge and transmembrane sequences suitable for use in the present disclosure are known in the art, and provided in, e.g., publication WO2016/126213, incorporated by reference in its entirety.
- the recombinant CAR molecule comprises a hinge and a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154.
- the hinge and the transmembrane domain comprises an amino acid sequence as set forth in SEQ ID NO: 37.
- the hinge and the transmembrane domain comprises an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 20, 10 or 5 modifications (e.g., substitutions) of an amino acid sequence of SEQ ID NO: 37, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 37.
- the hinge and the transmembrane domain comprises a nucleic acid sequence as set forth in SEQ ID NO: 38.
- the hinge and transmembrane domain of the anti-CD8 CAR can include a signaling domain (e.g., transmembrane domain) from CD8p, 4-1BB, CD28, CD34, CD4, FcsRIy, CD 16, 0X40, CD3L CD3e, CD3y, CD35, TCRa, CD32, CD64, VEGFR2, FAS, FGFR2B, or another transmembrane protein.
- a signaling domain e.g., transmembrane domain from CD8p, 4-1BB, CD28, CD34, CD4, FcsRIy, CD 16, 0X40, CD3L CD3e, CD3y, CD35, TCRa, CD32, CD64, VEGFR2, FAS, FGFR2B, or another transmembrane protein.
- the recombinant CAR molecule, e g , the anti-CD8 CAR molecule further comprises one or more sequences encoding an intracellular signaling domain, e g., an intracellular signaling domain or co-stimulatory domain as described herein.
- the intracellular signaling domain comprises a functional signaling domain of a protein selected from the group consisting of 0X40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD1 la/CD18) and 4-1BB (CD137).
- the intracellular signaling domain comprises an amino acid sequence of SEQ ID NO: 39.
- the intracellular signaling domain comprises an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 20, 10 or 5 modifications (e.g., substitutions) of an amino acid sequence of SEQ ID NO: 39, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 39.
- the intracellular signaling domain comprises a nucleic acid sequence as set forth in SEQ ID NO: 40.
- the intracellular signaling domain of 4- IBB can be replaced by another intracellular signaling domain from a costimulatory molecule such as CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1 , or CD2.
- the intracellular signaling domain of the CAR can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the intracellular signaling domain of CD28, 0X40, TCOS, CD27, GTTR, HVEM, TTM1 , LFA1, or CD2.
- the intracellular signaling domain of 4-1BB can also include another intracellular signaling domain (or a portion thereof) from a co- stimulatory molecule such as CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2.
- a co- stimulatory molecule such as CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2.
- the additional intracellular signaling domain can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the intracellular signaling domain of CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2.
- the additional intracellular signaling domain comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to one or more intracellular signaling domain fragment(s) of CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2.
- the recombinant CAR molecule e.g., the anti-CD8 CAR molecule further comprises a sequence encoding an intracellular signaling domain, e.g., an intracellular signaling domain described herein.
- the intracellular signaling domain comprises a functional signaling domain of 4- IBB and/or a functional signaling domain of CD3 zeta.
- the intracellular signaling domain comprises the sequence of SEQ ID NO: 39 and/or the sequence of SEQ ID NO: 41.
- the intracellular signaling domain comprises an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 20, 10 or 5 modifications (e.g., substitutions) of an amino acid sequence of SEQ ID NO: 39 and/or an amino acid sequence of SEQ ID NO: 41 or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 39 and/or an amino acid sequence of SEQ TD NO: 41 .
- the intracellular signaling domain comprises the sequence of SEQ ID NO: 39 and the sequence of SEQ ID NO: 41, wherein the sequences comprising the intracellular signaling domain are expressed in the same frame and as a single polypeptide chain.
- the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO: 40 and/or the nucleic acid sequence of SEQ ID NO: 42.
- the intracellular signaling domain comprises an immunoreceptor tyrosine-based activation motif (IT AM) or a portion thereof, as long as it possesses the desired function.
- IT AM immunoreceptor tyrosine-based activation motif
- the intracellular signaling domain of the CAR can include a sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to an IT AM.
- the intracellular signaling domain can have at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to FcsRIy, CD4, CD7, CD8, CD28, 0X40 or H2-Kb, as long as it possesses the desired function.
- the recombinant CAR molecule e g., the anti-CD8 CAR molecule further comprises a leader sequence, e g., a leader sequence described herein.
- the leader sequence encodes a CD8a signal peptide.
- the leader sequence comprises an amino acid sequence of SEQ ID NO: 26, or a sequence with 95- 99% identity to an amino acid sequence of SEQ ID NO: 26.
- the leader sequence comprises a nucleic acid sequence as set forth in any of the SEQ ID NOs: 27-28.
- the leader sequence is cleaved off of the mature CAR polypeptide.
- the recombinant CAR molecule e g., the anti-CD8 CAR molecule also includes a VH-VL linker such as but not limited to a peptide linker having an amino acid sequence as set forth in SEQ ID NO: 29.
- the present disclosure relates to an engineered immune cell comprising a nucleic acid that comprises a nucleotide sequence encoding a CAR, comprising an antigen biding domain, e.g., a CD8 antigen binding domain and one or more intracellular signaling domains selected from 4- IBB and CD3( ⁇ .
- the antigen binding domain specifically binds the alpha chain of Cluster of Differentiation 8 (CD8).
- CD8- 41BB-CD3 ⁇ anti-CD8 CAR.
- An exemplary embodiment is depicted in FIG. 1.
- the anti-CD8 CAR comprises an amino acid sequence as set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises a nucleic acid sequence as set forth in SEQ ID NO: 44.
- an “engineered” immune cell includes an immune cell that has been genetically modified as compared to a naturally-occurring immune cell.
- an engineered T cell produced according to the present methods carries a nucleic acid comprising a nucleotide sequence, e.g., a nucleic acid having a nucleotide sequence as set forth in SEQ ID NO: 44 that does not naturally occur in a T cell from which it was derived.
- the disclosure provides an recombinant CAR molecule comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence of SEQ ID NO: 26, or having 95-99% identity thereof, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1 , a LC CDR2 and a LC CDR3 described herein, e g., an anti-CD8 binding domain described in Table 1, 3, or 4, or having a sequence as set forth in SEQ ID NO: 24 or 25, or a sequence with 95-99% identify thereof; a transmembrane and a hinge region, e.g., a transmembrane and a hinge region described herein, e.g., a transmembrane and a hinge region of SEQ ID NO: 37 or having 95-99% identify thereof; a transme
- the intracellular signaling domain comprises, a 4- IBB domain having a sequence of SEQ ID NO: 39, or having 95-99% identity thereof, and/or a primary signaling domain, e.g., a primary signaling domain described herein, e.g., a CD3 zeta stimulatory domain having a sequence of SEQ ID NO: 41 or having 95-99% identity thereof.
- the CAR molecule e.g., the anti-CD8 CAR molecule described herein (e.g., a mature CAR molecule) does not comprise a leader sequence.
- the disclosure provides a nucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 44, encoding an recombinant CAR molecule comprising a leader sequence, e g , a leader sequence described herein, e g., a CD8a signal peptide, e.g., a leader sequence of SEQ ID NO: 26, or having 95-99% identity thereof, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1, a LC CDR2 and a LC CDR3 described herein, e g., an anti-CD8 binding domain described in Table 1, 3, or 4 or SEQ ID NO: 24 or 25, or a sequence with 95-99% identify thereof; a transmembrane and a hinge region, e g., a transmembrane and a
- the disclosure provides an recombinant CAR molecule comprising a leader sequence, e.g., a leader sequence described herein, e g., a leader sequence encoded by a nucleotide having a nucleic acid sequence as set forth in any of the SEQ ID Nos: 27 or 28, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1, a LC CDR2 and a LC CDR3 described herein; e.g., an anti-CD8 binding domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in any of the SEQ ID NOs: 17, 52, 71, 72, or 101, an scFv linker comprising a nucleic acid sequence as set forth in any of the SEQ ID NO: 30-33, a transmembrane and
- the intracellular signaling domain comprises, a 4- IBB domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 40 and/or a primary signaling domain, e.g., a primary signaling domain described herein, e.g., a CD3 zeta stimulatory domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 42.
- Tables 5 and 6 discloses the amino acid and nucleotide sequences of an exemplary anti-CD8 CAR and it various components.
- the present disclosure provides a CAR comprising an amino acid sequence according to Table 5.
- the CAR comprises components having amino acid sequences as disclosed in Table 5.
- an recombinant nucleic acid of the present disclosure comprises a nucleotide sequence that encodes a CAR according to Table 6.
- the nucleic acid comprises a nucleotide sequence that encodes a component of the CAR according to Table 6. Table 5. Amino acid sequences of an exemplary anti-CD8 CAR and select components Table 6. Nucleic acid sequences of an exemplary anti-CD8 CAR and select components
- T cell cytotoxic activity markedly increased when an anti-CD8 CAR was used in combination with downregulation of CD8 expression on the effector T cells.
- downregulation e.g., elimination, reduction, and/or relocalization
- CD8 prevented the fratricidal effect exerted by the corresponding anti-CD8 CAR, allowing greater T cell recovery after CAR expression as compared to cells that retained the target antigen (e g., CD8), and a more effective cytotoxicity against T leukemia/lymphoma cells.
- downregulation of CD8 expression on the effector T cells can be achieved according to a variety of known methods including, for example, “intrabodies” against CD8 (as described in WO2016/126213; e.g., PEBL technology), RNAi against CD8, or gene editing methods such as, e g., meganucleases, TALEN, CRISPR/Cas9, and zinc finger nucleases.
- the CAR can bind to a molecule that is expressed on the surface of a cell including, but not limited to members of the CD1 family of glycoproteins, CD2, CD3, CD4, CD5, CD7, CD8, CD25, CD28, CD30, CD38, CD45, CD45RA, CD45RO, CD52, CD56, CD57, CD99, CD127, and CD137.
- the present disclosure provides, novel nucleic acid molecules encoding CD8 blocking polypeptide comprising an antibody or antibody fragment that specifically binds to CD8 linked to an intracellular localizing domain (e.g., CD8-PEBL).
- an intracellular localizing domain e.g., CD8-PEBL.
- Tn one aspect the present disclosure provides a nucleic acid that comprises a nucleotide sequence encoding a target-binding molecule linked to a localizing domain (or intracellular localizing domain, or localization domain)
- localizing domain, intracellular localizing domain or localization domain can be used interchangeably.
- the “target-binding molecule linked to a localizing domain (or intracellular localizing domain, or localization domain)” is sometimes referred to herein as a protein expression blocker (PEBL) or in some cases, an “intrabody”, as described in WO2016/126213, the teachings of which are incorporated by reference in their entirety. Exemplary embodiments of a PEBL are shown in FIG.7.
- nucleotide sequence encodes a polypeptide, e.g., CD8 blocking polypeptide comprising a target binding domain, e.g., CD8 binding domain and an intracellular localizing domain.
- the target binding domain is a scFv.
- the intracellular localizing domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localizing sequence.
- the retention sequence, retention signal or retention peptide can be used interchangeably.
- the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered cell.
- the target binding molecule further comprises a leader sequence, e.g., a leader sequence described herein.
- the leader sequence encodes a CD8ct signal peptide.
- the leader sequence comprises an amino acid sequence of SEQ ID NO: 26, or a sequence with 95- 99% identity to an amino acid sequence of SEQ ID NO: 26
- the leader sequence comprises a nucleic acid sequence as set forth in any of the SEQ ID NOs: 27-28.
- the PEBL described herein is a CD8-PEBL, e.g., a CD8-PEBL comprising a CD8-binding molecule, linked to a localizing domain or an intracellular retention domain.
- the CD8 binding molecule comprises a singlechain variable fragment antibody fragment comprising the VH and VL domains of a CD8 antibody, e.g., the VH and VL domains of a 0KT8 antibody.
- linked in the context of the protein expression blocker refers to a nucleic acid sequence encoding a target-binding domain directly in frame (e.g., without a linker) adjacent to one or more nucleic acid sequences encoding one or more localizing domains.
- the nucleic acid sequence encoding a target-binding domain may be connected to one or more nucleic acid sequences encoding one or more localizing domains through a linker sequence, e.g., as described in WO2016/126213.
- the nucleic acid sequence encoding a target-binding domain may be connected to one or more nucleic acid sequences encoding a TM domain, e g., for KKXX ER retention. In some embodiments, the nucleic acid sequence encoding a target-binding domain is directly in frame (e.g., without a linker) adjacent to one or more nucleic acid sequences encoding a TM domain, e.g., for KKXX ER retention.
- the target-binding molecule is an antibody that binds CD8. In some embodiments, the target binding molecule is an antigen binding fragment. In some embodiments, the target-binding molecule is a scFv. In some embodiments, the target binding molecule comprises a target binding domain, e g , CD8 binding domain. In some embodiments, the target binding domain is a scFv. In some embodiments, the scFv comprises an amino acid sequence as set forth in SEQ ID NO: 24 or 25 or in Table 1.
- the scFv comprises an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 24 or 25 or in Table 1. In some embodiments, the scFv comprises an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 24 or 25 or in Table 1. In some embodiments, the scFv comprises a nucleic acid sequence as set forth in SEQ ID NO: 17, 52, 71 , 72, or 101 or in Table 2.
- the scFv comprises a VH sequence set forth in SEQ ID NO: 13 and a VL sequence set forth in SEQ ID NO: 14 or in Table 3.
- the scFv comprises a VH and a VL having sequence that each have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NO: 13 and 14, respectively.
- the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) having an amino acid sequence as set forth in SEQ ID NO: 13.
- the CD8 binding domain of the CAR can further comprise a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) of any anti-CD8 light chain binding domain amino acid sequence as set forth in SEQ ID NO: 14.
- the heavy chain variable region comprises an amino acid sequence with 95- 99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 and the light chain variable region comprises an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
- the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3).
- VH heavy chain variable region
- HC CDR1 heavy chain complementary determining region 1
- HC CDR2 heavy chain complementary determining region 2
- HC CDR3 heavy chain complementary determining region 3
- the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID NOs: 1 -6, respectively; or (ii) SEQ ID NOs: 7-12 respectively.
- the CD8 binding domain comprises a HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 comprising amino acid sequences as set forth in Table 3 or Table 4.
- the CD8 binding domain comprises a VH and a VL comprising amino acid sequences as set forth in Table 1.
- the CD8 binding domain is encoded by a nucleic acid having a sequence as set forth in Table 2.
- the target binding molecule described herein e.g., an anti-CD8 PEBL described herein comprises a CD8 binding domain comprising: (i) a heavy chain comprising a HC CDR1 of SEQ ID NO: 1, HC CDR2 of SEQ ID NO: 2 and HC CDR3 of SEQ ID NO: 3; and (ii) a light chain comprising a LC CDR1 of SEQ ID NO: 4, LC CDR2 of SEQ ID NO: 5 and LC CDR3 of SEQ ID NO: 6, or (i) a heavy chain comprising a HC CDR1 of SEQ ID NO: 7, HC CDR2 of SEQ ID NO: 8 and HC CDR3 of SEQ ID NO: 9; and (ii) a light chain comprising a LC CDR1 of SEQ ID NO: 10, LC CDR2 of SEQ ID NO: 11 and LC CDR3 of SEQ ID NO: 12.
- nucleic acid sequence of any of SEQ ID NOs: 15, 16, 18, 19, and 94 encoding an immunoglobulin heavy chain variable region of an anti-CD8 scFv and the nucleic acid sequence of any of SEQ ID NOs: 20-23 encoding an immunoglobulin light chain variable region of an anti-CD8 scFv is used to produce an anti-CD8 protein expression blocker.
- the anti-CD8 binding domain further comprises a Gly- Ser linker, e.g., a linker having an amino acid sequence as set forth in SEQ ID NO: 29, e g., GSTSGGGSGGGSGGGGSS.
- the linker comprises a nucleotide sequence as set forth in any of the SEQ ID NOs: 30-33.
- the light chain variable region and heavy chain variable region of a scFv can be, e.g., in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.
- the target binding molecule comprises at least one, at least two, at least three, at least four, or at least five target binding domains.
- the target binding molecule comprises one target binding domain, e g., a CD8 binding domain.
- the target binding molecule comprises a first target binding domain, e.g., a first CD8 binding domain and a second target binding domain, e g., a second CD8 binding domain.
- the first target binding domain and the second target binding domain are identical. In some embodiments, the first target binding domain and the second target binding domain are different.
- the first target binding domain and the second target binding domain are connected with a linker, e.g., a peptide linker.
- the linker comprises an amino acid sequence as set forth in SEQ ID NO: 51 or 54.
- the linker is encoded by a nucleic acid comprising a sequence as set forth in any of the SEQ ID NOs: 53, 55, or 93.
- the antibody or the antigen binding fragment that binds CD8 in the context of the CAR, as described herein can be different from the antibody or the antigen binding fragment that binds CD8 in the context of the target-binding molecule (the PEBL).
- the antibody or the antigen binding fragment that binds CD8 in the context of the CAR, as described herein can be the same as the antibody or the antigen binding fragment that binds CD8 in the context of the target-binding molecule (the PEBL).
- the localizing domain of the PEBL comprises an ER or Golgi retention sequence; a proteosome localizing sequence; a transmembrane domain sequence derived from CD8a, CD8(3, 4-1BB, CD28, CD34, CD4, FceRFy, CD16, 0X40, CD3 , CD3s, CD3y, CD35, TCRa, CD32, CD64, VEGFR2, FAS, or FGFR2B.
- the localization domain comprises a CD8 hinge and a CD8 transmembrane domain, e g., a CD8 hinge and a CD8 transmembrane domain comprising an amino acid sequence as set forth in SEQ ID NO: 34.
- the transmembrane domain comprises a sequence of an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 34, or a sequence with 95-99 %identity to an amino acid sequence of SEQ ID NO: 34.
- a PEBL can downregulate or reduce surface expression of its target.
- a PEBL further comprises a signal peptide, e g., a signal peptide comprising a sequence as set forth in SEQ ID NO: 26 or having 95-99% identity thereof.
- a PEBL further comprises a transmembrane domain.
- the transmembrane domain contributes to intracellular localization.
- the localizing domain further comprises one or more of ER retention peptide AEKDEL (SEQ ID NO: 56), ER retention peptide (SEQ ID NO: 58), Localization domain KDEL tethered to scFv with myc (“myc KDEL”) (SEQ ID NO: 61), Localization domain “mb DEKKMP” (SEQ ID NO: 63).
- Table 7 provides the amino acid and nucleic acid sequences of some exemplary ER retention peptides and localization domain components.
- Table 7 Amino acid and nucleic acid sequences of exemplary ER retention peptides and localization domain components
- the localizing domain can direct the PEBL to a specific cellular compartment, such as the Golgi or endoplasmic reticulum, the proteasome, or the cell membrane, depending on the application.
- the ER or Golgi retention sequence comprises the amino acid sequence selected from KDEL (SEQ ID NO: 64), YQRL (SEQ ID NO: 65), KKXX where X is any amino acid (SEQ ID No: 66), or KXD/E (such as KXD or KXE) where X is any amino acid (SEQ IN No: 67).
- the proteasome localizing sequence can comprise a PEST (SEQ ID NO: 68) motif.
- proteasome localization is achieved by linking the scFv sequence to a tripartite motif containing 21 (TRIM21) targeting domain sequence and coexpressing the sequence encoding the human TRIM21 E3 ubiquitin ligase protein.
- TRIM21 binds with high affinity to the Fc domains of antibodies and can recruit the ubiquitin-proteosome complex to degrade molecules (e g., proteins and peptides) bound to the antibodies.
- the TRIM21 targeting domain sequence encodes amino acid sequences selected from the group of human immunoglobulin G (TgG) constant regions (Fc) genes such as IgGl, IgG2, or IgG4 and is used to form a fusion protein comprising scFv and Fc domains.
- TgG human immunoglobulin G
- Fc constant regions
- the exogenously expressed TRIM21 protein binds the scFv- Fc fusion protein bound to the target protein (e g , CD8) and directs the complex to the proteasome for degradation.
- the protein expression blocker is any one or more of the PEBL as disclosed in WO2016/126213, the disclosure is herein incorporated by reference in its entirety for all purposes.
- the engineered immune cells described herein can comprise a PEBL (a target-binding molecule linked to a localizing domain) as described in WO2016/126213.
- PEBL a target-binding molecule linked to a localizing domain
- the sequences of the components of PEBLs are described in Figure 2, and Tables 1 and 2 of WO2016/126213.
- Tables 8 and 9 discloses the amino acid and nucleotide sequences of an exemplary anti-CD8 PEBL and its various components.
- the anti- CD8 PEBL comprises an amino acid sequence as set forth in Table 8, e g., any of the SEQ ID NOs: 45-47 and 79-81.
- the anti-CD8 PEBL comprises an amino acid sequence as set forth in Table 8, e g., any of the SEQ ID NOs: 95-98.
- FIG. 7 Exemplary embodiments of anti-CD8 PEBLs are depicted in FIG. 7.
- Table 8 shows amino acid sequences of exemplary anti-CD8 PEBLs and selected components.
- the present disclosure provides a PEBL comprising an amino acid sequence according to Table 8.
- the PEBL comprises components having amino acid sequences as disclosed in Table 8.
- the disclosure provides a CD8 blocking polypeptide comprising an amino acid sequence as set forth in any of the SEQ ID Nos: 45-47, 79-81, or 95-98
- the CD8 polypeptide comprises an amino acid sequence as set forth in any of the SEQ ID Nos: 45-47 or 79-81.
- the CD8 polypeptide comprises an amino acid sequence as set forth in any of the SEQ ID Nos: 95- 98.
- the disclosure provides a CD8 blocking polypeptide comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence of SEQ ID NO: 26, or having 95-99% identity thereof; at least one (e.g., 1, 2) anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1, a LC CDR2 and a LC CDR3 described herein, e g., an anti-CD8 binding domain described in Table 1, 3, or 4, or having a sequence as set forth in SEQ ID NO: 24 or 25, or a sequence with 95-99% identify thereof; an intracellular localizing domain comprising an ER retention sequence comprising an amino acid sequence selected as set forth in any of the SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO:
- the CD8 blocking polypeptide further comprises one or more linkers comprising an amino acid sequence as set forth in any of the SEQ ID NOs: 51 and 54.
- the CD8 blocking polypeptide further comprises a Golgi retention sequence having an amino acid sequence selected from the group consisting of SEQ ID NO: 65, SEQ ID NO: 64, SEQ ID NO: 74, and SEQ ID NO: 75.
- the CD8 blocking polypeptide further comprises a proteosome localizing sequence having an amino acid sequence as set forth in SEQ ID NO: 68
- the disclosure provides a nucleotide comprising a nucleic acid sequence as set forth in any of the SEQ ID NOs: 48-50 or 99-100, encoding a CD8 blocking polypeptide comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence of SEQ ID NO: 26, or having 95-99% identity thereof, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LCDR1, a LC CDR2 and a LC CDR3 described herein, e g., an anti-CD8 binding domain described in Table 1, 3, or 4, or having a sequence as set forth in SEQ ID NO: 24 or 25, or a sequence with 95-99% identify thereof; an intracellular localizing domain comprising an ER retention sequence comprising an amino acid sequence selected as set forth in any of the SEQ ID NO:
- the disclosure provides a CD8 blocking polypeptide comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence encoded by a nucleotide having a nucleic acid sequence as set forth in any of the SEQ ID Nos: 27 or 28, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1, a LC CDR2 and a LC CDR3 described herein; e g., an anti-CD8 binding domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in any of the SEQ ID NOs: 17, 52, 71, 72, or 101 , a transmembrane and a hinge region, e g , a transmembrane and a hinge region described herein, e g.,
- the VH domain of the anti-CD8 scFv of the PEBL comprises the nucleotide sequence as set forth in any of the SEQ ID NOs:15, 16, 18, 19, and 94 and the VL domain of the anti-CD8 scFv of the PEBL comprises the nucleotide sequence as set forth in any of the SEQ ID NOs:20-23.
- the VH domain of the anti-CD8 scFv of the PEBL comprises the nucleotide sequence having at least 90% sequence identity (e.g token 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to any of the SEQ ID NOs: 15, 16, 18, 19, and 94 and the VL domain of the anti-CD8 scFv of the PEBL comprises the nucleotide sequence having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to any of the SEQ ID NOs:20-23.
- sequence identity e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity
- Table 9 shows nucleotide sequences of exemplary anti-CD8 PEBLs and selected components.
- the anti-CD8 PEBL comprises a nucleotide sequence as set forth in Table 9, e g., any of the SEQ ID NOs: 48-50 or 99-100.
- a recombinant nucleic acid of the present disclosure comprises a nucleotide sequence that encodes a PEBL according to Table 9.
- the nucleic acid comprises a nucleotide sequence that encodes a component of the PEBL according to Table 9.
- the CAR e.g., anti-CD8 CAR and/or the CD8 blocking polypeptide, e.g., anti-CD8 PEBL may comprise one or more linkers, e g., peptide linkers.
- Non-limiting examples of a linker include GSTSGGGSGGGSGGGGSS (SEQ ID NO: 29), GGGGS (SEQ ID NO: 54), GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 51) or GGGGSGGGGSGGGGS (SEQ ID NO: 83), GGGGSGGGGS (SEQ ID NO: 84), ((GS)n (SEQ ID NO: 85), (GGS)n (SEQ ID NO: 86), (GlyiSer)n (SEQ ID NO: 87), (Gly 2 SerGly)n (SEQ ID NO: 88), (Gly 2 SerGly 2 )n (SEQ ID NO: 89), or (Gly 4 Ser)n (SEQ ID NO: 90), wherein n is 1,2, 3, 4, 5, 6, 7, 8, 9, or 10.
- the linker is encoded by a nucleic acid having a sequence as set forth in any of the SEQ ID Nos: 30-33, 53, 55, 82, or 93.
- GGCAGCACATCCGGAGGAGGCTCCGGAGGAGGCTCTGGAGGCGGCGGCTCCT CT SEQ ID NO: 30
- GGCTCCACATCCGGCGGAGGCTCTGGCGGTGGATCTGGCGGAGGCGGCTCATC C SEQ ID NO: 31
- GGATCCACATCTGGCGGCGGCTCCGGCGGGGGCTCCGGAGGAGGCGGCTCCT CT SEQ ID NO: 33
- GGCGGCGGCGGCTCTGGAGGCGGCGGAAGCGGAGGAGGAGGAAGCGGCGGC GGCGGCTCT SEQ ID NO: 53
- GGAGGTGGAGGTTCT SEQ ID NO: 55
- GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGCGGCGGCGGCTCCGGTGGTGG TGGATCC SEQ ID NO: 82
- GGCGGCTCT (SEQ ID NO: 93)
- the nucleic acid sequence encoding the localization domain of the anti-CD8 protein expression blocker comprises a sequence selected from SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, or SEQ ID NO: 62, or a codon optimized variant thereof.
- Nucleic acid includes, for example, genomic DNA, cDNA, RNA, and DNA- RNA hybrid molecules. Nucleic acid molecules can be naturally occurring, recombinant, or synthetic. In addition, nucleic acid molecules can be single-stranded, double-stranded or triple-stranded. In certain embodiments, nucleic acid molecules can be modified. In the case of a double-stranded polymer, “nucleic acid” can refer to either or both strands of the molecule. [00175] As will be appreciated by those of skill in the art, in some aspects a nucleic acid comprises regulatory sequences from a plasmid. The nucleic acid sequence can include, for example, one or more of a promoter sequence a selection marker sequence, or a locustargeting sequence.
- Codon usage bias has been reported for numerous organisms, from viruses to eukaryotes. Since the genetic code is degenerate (i.e., each amino acid can be coded by on average three different codons), the DNA sequence can be modified by synonymous nucleotide substitutions without altering the amino acid sequence of the encoded protein. Such synonymous codon optimization has been performed for the purpose of optimizing expression in a desired host, as described in the scientific literature and in patent documents. See U.S. Pat. Nos. 5,786,464 and 6,114,14. In some embodiments, the nucleic acid described herein maybe modified to improve cloning efficiency.
- the nucleic acids described herein are subjected to codon optimization to increase the efficiency of gene expression, e.g., SEQ ID NO: 15, 20, 27, 30, 36, 18, 22, 32, 19, 23, 33, 94, 28, 53, 57, 60 are subjected to codon optimization.
- the CD8 binding domain of the anti-CD8 CAR and/or anti-CD8 PEBL are encoded by a nucleic acid whose sequence has been codon optimized for expression in a mammalian cell
- the anti-CD8 CARs described herein are encoded by nucleic acids that have been codon optimized for expression in a mammalian cell.
- the anti-CD8 PEBLs described herein are encoded by nucleic acids that have been codon optimized for expression in a mammalian cell.
- any of the sequences of the various components disclosed herein can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the specific corresponding sequences disclosed herein.
- the intracellular signaling domain 4-1BB can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to SEQ ID NO: 40, as long as it possesses the desired function.
- the disclosure provides a vector comprising a nucleic acid molecule described herein.
- the vector comprises a nucleic acid molecule encoding a CAR described herein, e.g., an anti-CD8 CAR.
- the vector comprises a nucleic acid molecule encoding a PEBL described herein, e g., a CD8-PEBL.
- the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, or a retrovirus vector.
- the vector is a murine retroviral vector, e g , murine stem cell virus (MSCV) retroviral vector.
- the vector further comprises a promoter.
- the promoter is an EF-1 promoter, a MSCV promoter, SC40 promoter, or a PGK promoter.
- the vector further comprises a poly A tail.
- the promoter is an EF-1 promoter having a nucleic acid sequence as set forth in SEQ ID NO: 77.
- the promoter is an MSCV promoter having a nucleic acid sequence as set forth in SEQ ID NO: 78.
- the disclosure provides a cell, e.g., an engineered immune cell comprising an recombinant nucleic acid, a CAR, e.g., anti-CD8 CAR, a CD8 blocking polypeptide, e.g., an anti-CD8 PEBL, or a vector described herein.
- the engineered immune cell comprises a nucleic acid molecule described herein
- the engineered immune cell comprises a nucleic acid molecule encoding a CAR described herein, e g., an anti-CD8 CAR.
- the engineered immune cell comprises a nucleic acid molecule encoding a PEBL described herein, e.g., a CD8- PEBL.
- the engineered immune cell comprises: (i) a first nucleic acid encoding a CD8 blocking polypeptide comprising a single chain variable fragment (scFv) and an intracellular localizing domain, wherein the scFv binds CD8 (CD8 binding domain), wherein the intracellular localizing domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and (ii) a second nucleic acid encoding an anti-CD8 CAR comprising a CD8 targeting domain comprising a single chain variable fragment (scFv), a transmembrane domain, and a signaling domain (anti-CD8 CAR).
- the engineered immune cell comprises: (i) a CD8 blocking polypeptide comprising a single chain variable fragment (scFv) and an intracellular localizing domain, wherein the scFv binds CD8 (CD8 binding domain), wherein the intracellular localizing domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and (ii) an anti-CD8 CAR comprising a CD8 targeting domain comprising a single chain variable fragment (scFv), a transmembrane domain, and a signaling domain (anti-CD8 CAR).
- the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered cell.
- the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell.
- the engineered immune cell is an engineered T cell, an engineered natural killer (NK) cell, an engineered NK/T cell, an engineered monocyte, an engineered macrophage, or an engineered dendritic cell.
- the engineered immune cell is an engineered T cell.
- the engineered T cell is a CD4 positive T cell, a CD8 positive T cell, a naive T cell, or a memory T cell.
- an engineered immune cell comprising: a nucleic acid that comprises a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4-1BB and CD3(, and an antibody or antigen binding fragment that specifically binds Cluster of Differentiation 8 (CD8), e.g., an anti-CD8 CAR as disclosed herein, and optionally further comprises a second nucleotide sequence encoding a target-binding molecule linked to a localizing domain, wherein the targetbinding molecule is an antibody or antigen binding fragment that binds CD8, and the localizing domain comprises an endoplasmic reticulum retention sequence, e g., anti-CD8 PEBL as disclosed herein.
- CD8 Cluster of Differentiation 8
- the antibody that binds CD8 in the context of the CAR, as well as in the context of the target-binding molecule comprises a CD8 binding domain disclosed herein.
- the antibody that binds CD8 in the context of the CAR can be identical to the antibody that binds CD8 in the context of the target-binding molecule (the protein expression blocker or PEBL), as described herein, e g., having an amino acid sequence as set forth in SEQ ID NO: 25.
- the antibody that binds CD8 in the context of the CAR can be different from the antibody that binds CD8 in the context of the target-binding molecule (the protein expression blocker or PEBL), as described herein.
- the intracellular signaling domain of 4-1BB comprises the sequence set forth in SEQ ID NO: 39.
- the intracellular signaling domain of CD3i ⁇ comprises the sequence set forth in SEQ ID NO: 41.
- the antibody that binds CD8 in the context of the CAR, as well as in the context of the target-binding molecule is a scFv.
- the scFv comprises a VH sequence set forth in SEQ ID NO: 13 and a variable light chain VL sequence set forth in SEQ ID NO: 14.
- the scFv comprises a VH and a VL having sequence that each comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NO: 13 and 14, respectively.
- the CAR, e g., anti- CD8 CAR further comprises a hinge and transmembrane sequence, e.g., as set forth in SEQ ID NO: 37.
- the PEBL, e.g., anti-CD8 PEBL further comprises a hinge and transmembrane sequence e g., as set forth in SEQ ID NO: 34.
- the engineered immune cell further comprises a modified CD8 gene, which modification renders the CD8 gene or protein non-functional.
- the engineered immune cell of the present disclosure further comprises a modified (e.g., non-functional) CD8 gene (modified using, e.g., meganucleases, TALEN, CRISPR/Cas9, or zinc finger nucleases) that prevents or reduces expression of CD8, and/or otherwise impairs (e.g., structurally) the CD8 protein from being recognized by an anti-CD8 CAR.
- a modified e.g., non-functional
- CD8 gene modified using, e.g., meganucleases, TALEN, CRISPR/Cas9, or zinc finger nucleases
- Methods of modifying gene expression using such methods are readily available and well-known in the art.
- the CRISPR/Cas system is a system for inducing targeted genetic alterations (genome modifications).
- Target recognition by the Cas9 protein requires a “seed” sequence within the guide RNA (gRNA) and a conserved multinucleotide containing protospacer adjacent motif (PAM) sequence upstream of the gRNA-binding region.
- the CRISPR/Cas system can thereby be engineered to cleave substantially any DNA sequence by redesigning the gRNA in cell lines, primary cells, and engineered cells.
- the CRISPR/Cas system can simultaneously target multiple genomic loci by co-expressing a single Cas9 protein with two or more gRNAs, making this system uniquely suited for multiple gene editing or synergistic activation of target genes. Examples of a CRISPR/Cas system used to inhibit gene expression are described in U.S. Publication No.
- other endonucleases may also be used, including but not limited to, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl 7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, T7, Fokl, other nucleases known in the art, homologs thereof, or modified versions thereof.
- CRISPR/Cas gene disruption occurs when a gRNA sequence specific for a target gene and a Cas endonuclease are introduced into a cell and form a complex that enables the Cas endonuclease to introduce a double strand break at the target gene
- the CRISPR system comprises one or more expression vectors comprising a nucleic acid sequence encoding the Cas endonuclease and a guide nucleic acid sequence specific for the target gene.
- the guide nucleic acid sequence is specific for a gene and targets that gene for Cas endonuclease-induced double strand breaks.
- the sequence of the guide nucleic acid sequence may be within a loci of the gene.
- the guide nucleic acid sequence is at least 10, I I, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, or more nucleotides in length.
- the guide nucleic acid sequence includes a RNA sequence, a DNA sequence, a combination thereof (a RNA-DNA combination sequence), or a sequence with synthetic nucleotides, such as a peptide nucleic acid (PNA) or Locked Nucleic Acid (LNA).
- PNA peptide nucleic acid
- LNA Locked Nucleic Acid
- the guide nucleic acid sequence can be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence comprises a single guide RNA.
- the engineered immune cell of the present disclosure can be modified via the CRISPR/Cas system to inactivate the human CD8 gene. Details of the genomic structure and sequence of the human CD8 gene can be found, for example, in NCB1 Gene database under GenelD No. 925 or UN1PROT ID NO. P01732.
- kits, gRNA vectors and donor vectors, for knockout of specific target genes are available, for example, from OriGene (Rockville, Md.), GenScript (Atlanta, Ga ), Applied Biological Materials (ABM; Richmond, British Colombia), BioCat (Heidelberg, Germany) or others.
- kits or kit components for knockout of CD8 via CRISPR include, for example, those available as catalog numbers KN201231, KN201231G1, KN201231G2, and KN201231D, each available from OriGene, and those available as catalog numbers sc-4072847, sc-4072847- KO-2, SC-4072847-HDR-2, sc-4072847-NIC, sc-4072847HDR-2, and sc-4072847- NIC - 2, each available from Santa Cruz Biotechnology.
- the chimeric antigen receptor described herein can be introduced into the human CD8 gene locus using the CRISPR/Cas system
- the engineered immune cell of the present disclosure has reduced expression of endogenous CD8
- the reduction of the expression of endogenous CD8 can improve cell recovery of the engineered immune cell (e.g., the engineered immune cell expressing anti-CD8 CAR as described herein).
- the cytotoxic (e.g., CD4-negative T cells) in the population of engineered immune cells can be at least about 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, or more of the initial input cells after a period of incubation or culturing.
- the cytotoxic T cells (e.g., using CD4-negative as a marker) in the population of engineered immune cells can be at least about 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, or more of the initial input cells after incubation or culturing for at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 12 days, at least about 15 days, at least about 20 days, or more.
- cell proliferation of the engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 can proliferate better than an otherwise identical engineered immune cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 can be at least about 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 120 times, 130 times, 140 times, 150 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times or more than an otherwise identical engineered immune cell
- the cytotoxic T cells (e g., as detected by CD4-negative marker) in a population of engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 can be at least about 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 120 times, 130 times, 140 times, 150 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times or more than the cytotoxic T cells in an otherwise identical population of engineered immune cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the engineered cell comprises a population of engineered cells.
- viability of cytotoxic T cells in the population of engineered cells is higher compared to an otherwise identical population of cells expressing the anti- CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 1.1 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 5 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 10 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 25 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 50 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 60 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 70 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 80 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 90 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 100 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 125 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 150 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 175 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 200 times higher compared to an otherwise identical population of cells and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 250 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 300 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 400 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 500 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 600 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 700 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. Tn some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 800 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 900 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 1.1 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 5 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 10 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 25 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 50 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 60 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 70 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 80 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 90 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 100 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 125 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 150 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 175 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 200 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 250 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 300 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 400 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 500 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 600 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 700 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- viability of cytotoxic T cells in the population of engineered cells is at least about 800 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 900 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- cytotoxicity of the engineered immune cell against target cells is higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.1 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.2 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.6 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1 .7 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.8 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.9 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 3.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 4.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 5: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 4: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 3 : 1 . In some embodiments, the cytotoxicity is tested at an effector-target ratio of 2: 1.
- the cytotoxicity is tested at an effector-target ratio of 1 : 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :2. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : . In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :4. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :5. In some embodiments, the target cells are CD8-positive cells.
- the target cells are MOLT-4 In some embodiments, the target cells are CCRF-CEM In some embodiments, cytotoxicity of the engineered immune cell against target cells is higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.1 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 1.2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 1.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 1.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 1.7 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.7 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 3 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 4 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity is tested at an effector-target ratio of 5: 1.
- the cytotoxicity is tested at an effector-target ratio of 4: 1.
- the cytotoxicity is tested at an effector-target ratio of 3: 1.
- the cytotoxicity is tested at an effector-target ratio of 2: 1.
- the cytotoxicity is tested at an effector-target ratio of 1 : 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :2. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 3. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :4. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :5. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.
- the reduction of expression of endogenous CD8 in a population of engineered immune cells expressing anti-CD8 CAR can improve long-term cytotoxicity of the cytotoxic T cells in the population.
- cytotoxicity of the engineered immune cell against target cells is higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after co-culturing with the target cells for a period of time.
- the cytotoxicity is represented by the number of remaining target cells after co-culturing with the engineered immune cell.
- the cytotoxicity of the engineered immune cell against target cells is at least about 1.1 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after of co-culturing with the target cells. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.2 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1 .5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.6 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.7 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.8 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.9 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 2 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 3.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the engineered immune cell is co-cultured with the target cells for 2 hours. Tn some embodiments, the engineered immune cell is co-cultured with the target cells for 5 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 10 hours. In some embodiments, the engineered immune cell is co- cultured with the target cells for 20 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 30 hours.
- the engineered immune cell is co-cultured with the target cells for 40 hours In some embodiments, the engineered immune cell is co-cultured with the target cells for 50 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 60 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 70 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 80 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 90 hours. In some embodiments, the engineered immune cell is co- cultured with the target cells for 100 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 110 hours.
- the engineered immune cell is co-cultured with the target cells for 120 hours. Tn some embodiments, the engineered immune cell is co-cultured with the target cells for 1 week. In some embodiments, the engineered immune cell is co-cultured with the target cells for 2 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 3 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 4 weeks. In some embodiments, the engineered immune cell is cocultured with the target cells for 5 weeks. Tn some embodiments, the engineered immune cell is co-cultured with the target cells for 6 weeks. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 5: 1 .
- the cytotoxicity is tested at an effector-target ratio of 4: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 3:1. In some embodiments, the cytotoxicity is tested at an effectortarget ratio of 2: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:2. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:3. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :4. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 5.
- the cytotoxicity is tested at an effector-target ratio of 1 :6. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :7. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 10. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 12. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 15. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.
- cytotoxicity of the engineered immune cell against target cells is higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after co-culturing with the target cells for a period of time.
- the cytotoxicity is represented by the number of remaining target cells after co-culturing with the engineered immune cell.
- the cytotoxicity of the engineered immune cell against target cells is at least about 1.1 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after of co-culturing with the target cells.
- the cytotoxicity of the engineered immune cell against target cells is 1.2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.3 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 1.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 1.6 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.6 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.7 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.7 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.8 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 1.8 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 3 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
- the cytotoxicity of the engineered immune cell against target cells is 4 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the cytotoxicity of the engineered immune cell against target cells is 5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
- the engineered immune cell is co-cultured with the target cells for 2 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 5 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 10 hours. In some embodiments, the engineered immune cell is co- cultured with the target cells for 20 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 30 hours.
- the engineered immune cell is co-cultured with the target cells for 40 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 50 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 60 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 70 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 80 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 90 hours. In some embodiments, the engineered immune cell is co- cultured with the target cells for 100 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 110 hours.
- the engineered immune cell is co-cultured with the target cells for 120 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 1 week. In some embodiments, the engineered immune cell is co-cultured with the target cells for 2 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 3 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 4 weeks. In some embodiments, the engineered immune cell is co- cultured with the target cells for 5 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 6 weeks. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 5: 1.
- the cytotoxicity is tested at an effector-target ratio of 4: 1 . In some embodiments, the cytotoxicity is tested at an effector-target ratio of 3:1. In some embodiments, the cytotoxicity is tested at an effectortarget ratio of 2: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:2. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:3. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :4. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :5.
- the cytotoxicity is tested at an effector-target ratio of 1 :6. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :7. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 10. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 12. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 15. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.
- proliferation of the engineered immune cell in the presence of target cells is higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.1 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1 .2 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1 .3 times higher compared to the engineered immune cell in the absence of the target cells.
- the proliferation of the engineered immune cell in the presence of target cells is 1.4 times higher compared to the engineered immune cell in the absence of the target cells In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.5 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.6 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.7 times higher compared to the engineered immune cell in the absence of the target cells.
- the proliferation of the engineered immune cell in the presence of target cells is 1.8 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.9 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 2 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 2.5 times higher compared to the engineered immune cell in the absence of the target cells.
- the proliferation of the engineered immune cell in the presence of target cells is 3 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 3.5 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 4 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 4.5 times higher compared to the engineered immune cell in the absence of the target cells.
- the proliferation of the engineered immune cell in the presence of target cells is 5 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is at least about 1 . 1 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
- the proliferation of the engineered immune cell in the presence of target cells is 1.2 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.3 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.4 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
- the proliferation of the engineered immune cell in the presence of target cells is 1.5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.6 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.7 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
- the proliferation of the engineered immune cell in the presence of target cells is 1 .8 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.9 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 2 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
- the proliferation of the engineered immune cell in the presence of target cells is 2.5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 3 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 3.5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
- the proliferation of the engineered immune cell in the presence of target cells is 4 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 4.5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
- the proliferation of the engineered immune cell in the presence of target cells is 10 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 15 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 20 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation is tested at an effectortarget ratio of 5: 1 . In some embodiments, the proliferation is tested at an effector-target ratio of 4:1.
- the proliferation is tested at an effector-target ratio of 3:1. In some embodiments, the proliferation is tested at an effector-target ratio of 2:1. In some embodiments, the proliferation is tested at an effector-target ratio of 1 : 1. In some embodiments, the proliferation is tested at an effector-target ratio of 1 :2. In some embodiments, the proliferation is tested at an effector-target ratio of 1 : 3. In some embodiments, the proliferation is tested at an effector-target ratio of 1 :4. In some embodiments, the proliferation is tested at an effector-target ratio of 1 : 5. In some embodiments, the proliferation is tested at about 2 days of culturing the engineered immune cell in the presence or absence of the target cells.
- the proliferation is tested at about 4 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 6 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 7 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 10 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 12 days of culturing the engineered immune cell in the presence or absence of the target cells.
- the proliferation is tested at about 14 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 16 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 18 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 20 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 25 days of culturing the engineered immune cell in the presence or absence of the target cells.
- the proliferation is tested at about 30 days of culturing the engineered immune cell in the presence or absence of the target cells.
- the target cells are CD8-positive cells.
- the target cells are MOLT-4.
- the target cells are CCRF-CEM.
- the disclosure provides a composition, e.g., a pharmaceutical composition comprising a CAR, e g., anti-CD8 CAR as described herein.
- the composition further comprises a PEBL described herein, e g., an anti-CD8 PEBL.
- the disclosure provides a composition comprising an engineered immune cell as described herein, e.g., an engineered immune cell comprising a nucleic acid encoding a CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e.g., an anti-CD8 PEBL as disclosed herein.
- an engineered immune cell as described herein, e.g., an engineered immune cell comprising a nucleic acid encoding a CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e.g., an anti-CD8 PEBL as disclosed herein.
- the engineered immune cell is manufactured by transducing or transfecting a vector encoding the anti-CD8 CAR and the anti-CD8 protein expression blocker at the same time, or within no more than 1, 2, 3, or 4 hours apart.
- the anti-CD8 CAR and anti-CD8 PEBL are co-expressed using a bicistronic vector.
- the vector encoding the anti-CD8 CAR is transduced or transfected after the vector encoding the anti-CD8 protein expression blocker is expressed, e g., the vector encoding the anti-CD8 CAR is transduced or transfected at least 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, or 40 hours after the vector encoding the anti-CD8 protein expression blocker is transduced or transfected.
- the disclosure provides a method to downregulate CD8 expression by a target binding molecule, e.g., a PEBL, e.g., a CD8-PEBL.
- a target binding molecule e.g., a PEBL, e.g., a CD8-PEBL.
- the target binding molecule e.g., anti-CD8 PEBL downregulates CD8 expression.
- the target binding molecule, e g , anti-CD8 PEBL downregulate CD8a expression.
- the target binding molecule e g., anti-CD8 PEBL downregulates CD8 expression by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or by 100%.
- the target binding molecule e.g., anti-CD8 PEBL downregulates CD8a expression by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or by 100%.
- the target binding molecule e.g., anti-CD8 PEBL, downregulates CD8 expression for at least 6 hours, at least 12 hours, at least 18 hours, at least 24 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 10 days, at least 15 days, at least 20 days, at least 25 days, at least 30 days, or indefinitely.
- the target binding molecule e.g., anti-CD8 PEBL, downregulates CD8a expression for at least 6 hours, at least 12 hours, at least 18 hours, at least 24 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 10 days, at least 15 days, at least 20 days, at least 25 days, at least 30 days, or indefinitely.
- the disclosure provides a method to reduce fratricide by immune cells expressing a CAR disclosed herein, e.g., an anti-CD8 CAR by expressing a target binding molecule, e.g., a CD8-PEBL in the immune cells.
- a CAR disclosed herein e.g., an anti-CD8 CAR by expressing a target binding molecule, e.g., a CD8-PEBL in the immune cells.
- the anti-CD8 CAR and the CD8-PEBL are administered together, e.g., by co-expressing the anti-CD8 CAR and the CD8-PEBL using a bicistronic vector
- the anti-CD8 CAR and the CD8-PEBL are administered sequentially, e.g., a nucleotide sequence encoding the CD8-PEBL is transduced or transfected into the immune cells before transducing or transfecting the nucleotide sequence encoding the anti-CD8 CAR e.g., the nucleotide sequence encoding the anti-CD8 CAR is transduced or transfected at least 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, or 40 hours after the vector encoding the anti-CD8 protein expression blocker is transduced or transfected.
- the present disclosure provides a CAR directed against CD8.
- the expression of the anti-CD8 CAR in immune cells such as effector T cells, induces the T cell to exert specific cytotoxicity against T-cell malignancies.
- This cytotoxic effect was shown to be enhanced when expression of CD8 on the effector T cells was downregulated using an antibody-based molecule (a protein expression blocker or PEBL) that targeted the CD8 for downregulation.
- an antibody-based molecule a protein expression blocker or PEBL
- the present disclosure provides an immunotherapeutic method for treating cancers, e.g., T-cell malignancies.
- a method of killing CD8 positive cells in a subject in need thereof comprising administering a therapeutic amount of an engineered immune cell having any of the embodiments described herein to the subject, thereby treating killing CD8 positive cells in a subject in need thereof.
- the disclosure provides an use of a CAR, (e.g., anti-CD8 CAR), an engineered immune cell (an engineered immune cell comprising a nucleic acid encoding) CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e g , an anti-CD8 PEBL), or an composition comprising an engineered immune cell as disclosed herein in the manufacture of a medicament for killing CD8 positive cells in a subject in need thereof.
- a CAR e.g., anti-CD8 CAR
- an engineered immune cell an engineered immune cell comprising a nucleic acid encoding CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e g , an anti-CD8 PEBL
- an engineered immune cell as disclosed herein in
- a method of treating cancer in a subject in need thereof comprising administering a therapeutic amount of an engineered immune cell having any of the embodiments described herein to the subject, thereby treating cancer in a subject in need thereof.
- the disclosure provides an use of a CAR, (e g., anti-CD8 CAR), an engineered immune cell (an engineered immune cell comprising a nucleic acid encoding a CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e g., an anti-CD8 PEBL), or an composition comprising an engineered immune cell as disclosed herein in the manufacture of a medicament for treating cancer in a subject in need thereof.
- a CAR e g., anti-CD8 CAR
- an engineered immune cell an engineered immune cell comprising a nucleic acid encoding a CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e g., an anti-CD8 PEBL
- the method comprises administering a therapeutic amount of an engineered immune cell comprising a nucleic acid that comprises a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4-1BB and CD3(j, and an antibody that binds CD8, as described herein.
- the method comprises administering a therapeutic amount of an engineered immune cell that further comprises a nucleic acid having a nucleotide sequence encoding a target-binding molecule linked to a localizing domain, as described herein (e.g., an anti-CD8 protein expression blocker).
- the use comprises administering a therapeutic amount of an engineered immune cell or the composition as described herein in a subject in need thereof.
- the cancer is a T-cell malignancy, e g., T-cell leukemia or T-cell lymphoma, such as T-cell acute lymphoblastic leukemia, T-cell prolymphocytic leukemia, T-cell large granular lymphocytic leukemia, enteropathy-associated T-cell lymphoma, hepatosplenic T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, mycosis fungoides, Sezary syndrome, primary cutaneous gamma-delta T-cell lymphoma, peripheral T-cell lymphoma not otherwise specified, angioimmunoblastic T- cell lymphoma, anaplastic large cell lymphoma.
- T-cell leukemia or T-cell lymphoma such as T-cell acute lymphoblastic leukemia, T-cell prolymphocytic leukemia, T-cell large granular lymphocytic leukemia, enteropathy-associated T-cell
- the T cell malignancy is early T-cell progenitor acute lymphoblastic leukemia (ETP-ALL)
- the cancer is a NK-cell malignancy, e.g., NK/T-cell lymphoma, nasal type (ENKL), or aggressive NK-cell leukemia (ANKL).
- the engineered immune cell is autologous to the subject in need of treatment, e.g cancer treatment. Tn other embodiments, the engineered immune cell is allogenic to the subject in need of treatment.
- an engineered immune cell having any of the embodiments described herein for treating cancer, comprising administering a therapeutic amount of the engineered immune cell to a subject in need thereof.
- the cancer is a T-cell malignancy
- the T-cell malignancy is early T-cell progenitor acute lymphoblastic leukemia (ETP -ALL).
- the cancer is a NK-cell malignancy
- a method for producing the engineered immune cell comprising introducing into an immune cell a nucleic acid that comprises a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4- IBB and CD3ij, and an antibody that binds CD8.
- the method further comprises introducing into the immune cell a nucleic acid that comprises a nucleotide sequence encoding a target-binding molecule linked to a localizing domain (e g., anti-CD8 protein expression blocker or anti-CD8 PEBL).
- the nucleotide sequence encoding CAR and the nucleotide sequence encoding the anti-CD8 PEBL are introduced on a single plasmid, e.g., using a bicistronic vector.
- Outlined herein is also a method and kit for producing an engineered immune cell (e.g., T cell, natural killer (NK) cell, NK/T cell, monocyte, macrophage, or dendritic cell) described herein.
- an engineered immune cell e.g., T cell, natural killer (NK) cell, NK/T cell, monocyte, macrophage, or dendritic cell
- the disclosure also sets forth the use of any of the engineered immune cells or the composition outlined herein for treating cancer.
- a method for producing the engineered immune cell described herein can include: introducing into an immune cell a nucleic acid that comprises a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4-1BB and CD3i ⁇ , and an antibody that binds CD8, thereby producing an engineered immune cell.
- the method can further comprises introducing into the immune cell a nucleic acid that comprises a nucleotide sequence encoding a target-binding molecule linked to a localizing domain.
- the method further comprises functional inhibition of CD8 signaling during the manufacturing process of the cells.
- the functional inhibition of CD8 signaling comprises reducing expression of endogenous CD8 of the immune cells.
- the endogenous CD8 of the immune cells is knocked out or knocked down.
- kits for producing an engineered immune cell described herein can be used to produce, T cells, e g , allogeneic or autologous T cells having anti-CD8 CAR-mediated cytotoxic activity.
- the kit is useful for producing allogeneic effector T cells having anti-CD8 CAR-mediated cytotoxic activity.
- the kit is useful for producing autologous effector T cells having anti-CD8 CAR-mediated cytotoxic activity.
- kits comprising a nucleic acid comprising a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4-1BB and CD3( ⁇ , and an antibody that binds CD8, e.g., an anti-CD8 CAR as disclosed herein.
- the nucleotide sequence encoding the anti-CD8 CAR can be designed according to any of the embodiments described herein.
- the kit further comprises a nucleic acid having a nucleotide sequence that encodes a target-binding molecule linked to a localizing domain, as described herein (e g., anti-CD8 PEBL molecules as described herein).
- the nucleotide sequence encoding the target-binding molecule linked to a localizing domain can be designed according to any of the embodiments described herein.
- the nucleotide sequence encoding the anti-CD8 CAR and/or the nucleotide sequence encoding the anti-CD8 PEBL are linked to sequences (e.g., plasmid or vector sequences) that allow, e g., cloning and/or expression.
- sequences e.g., plasmid or vector sequences
- the nucleotide sequence can be provided as part of a plasmid for ease of cloning into other plasmids and/or vectors (expression vectors or viral expression vectors) for, e g., transfection, transduction, or electroporation into a cell (e.g., an immune cell).
- the nucleotide sequence encoding the anti-CD8 CAR and the nucleotide sequence encoding the anti-CD8 PEBL are provided on a single plasmid or vector (e g., a single construct comprising an anti-CD8 CAR and an anti-CD8 PEBL). In certain embodiments, the nucleotide sequences are provided on separate plasmids or vectors (expression vectors or viral expression vectors).
- kits are compartmentalized for ease of use and can include one or more containers with reagents. In certain embodiments, all of the kit components are packaged together. Alternatively, one or more individual components of the kit can be provided in a separate package from the other kits components. The kits can also include instructions for using the kit components. [00217]
- the following examples are provided to further illustrate some embodiments of the present disclosure but are not intended to limit the scope of the disclosure; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.
- T-cell ALL lines Jurkat, CCRF-CEM, and MOLT-4, the lymphoblastic cell line T2, and the NK cell line NK92 were obtained from the American Type Culture Collection (ATCC; Rockville, MD).
- Jurkat, MOLT-4 and T2 were maintained in RPML 1640 (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin- streptomycin.
- FBS fetal bovine serum
- NK92 was maintained in 12.5% FBS, 12.5% horse serum (Sigma-Aldrich, St.
- Cell lines were characterized by the providers for molecular and/or gene expression features. Cell lines were expanded after receipt and cryopreserved. Cells for experiments were obtained from recently thawed vials.
- Peripheral blood mononuclear cells were obtained by separating blood samples through a Lymphoprep density step (Nycomed, Oslo, Norway). Samples were collected from discarded anonymized byproducts provided by the Health Sciences Authority of Singapore Blood Bank. Cells were washed twice in RPML1640 after separation.
- the anti-CD8a scFv was obtained from Genscript (Piscataway, NJ) following the sequence of a humanized scFv derived from the OKT8 antibody.
- the anti-CD8a scFv was joined with the CD8a signal peptide, CD8a hinge and transmembrane domain, and the intracellular domains of 4-1BB and CD3( ⁇ .
- the anti-CD8a scFv was joined with the CD8a signal peptide, CD8a hinge and transmembrane domain conjugated to the ER retention peptide KYKSRRSFIEEKKMP or AEKDEL with a (GGGGS)4 linker.
- PEBLs with two scFv sequences linked with five or twenty amino acids were also generated.
- Retroviral vector-conditioned medium was added to RetroNectin (Takara, Otsu, Japan)-coated polypropylene tubes; after centrifugation and removal of the supernatant, T cells (5 x 10 5 ) previously activated with TransAct (Miltenyi Biotec, Bergisch Gladbach, Germany) were added to the tubes and left at 37°C for 24 hours. In some cases, T cells were electroporated to eliminate expression of CD8 by CRISPR 3 days prior to transduction. The process was repeated a second time. T lymphocytes were then maintained in RPMI-1640 with FBS, antibiotics, and 200 lU/mL IL-2 until the time of the experiments. Control cells were transduced with a MSCV retroviral vector containing GFP only.
- gRNA guide RNA
- NLS-Cas9 nuclear localization signal appended Cas9 nuclease
- RNP ribonucleoprotein
- Day 2 expanded T cells were suspended in electroporation buffer (Lonza, Basel, Switzerland), and mix with just NLS-Cas9 or RNP. Mixture was electroporated using the U-014 program on the Amaxa Nucleofactor II electroporator (Lonza).
- PEBL expression was detected by permeabilizing the cells with the BD Cytofix/Cytoperm (BD Biosciences, San Jose, CA) followed by sequential staining with biotin-conjugated goat anti-human F(ab’)2 antibody (Jackson ImmunoResearch) and streptavidin conjugated to phycoerythrin (PE; Jackson ImmunoResearch).
- BD Cytofix/Cytoperm BD Biosciences, San Jose, CA
- biotin-conjugated goat anti-human F(ab’)2 antibody Jackson ImmunoResearch
- streptavidin conjugated to phycoerythrin PE; Jackson ImmunoResearch
- CD3, CD8, and CD4 were detected with APC-conjugated anti-human CD3 (clone SK7; BD Biosciences,), PE-conjugated antihuman CD8 (clone RPA-T8; BD Pharmingen, San Diego, CA), and PECy7-conjugated anti-human CD4 (clone SK3; BD Biosciences). Stained cells were fixed with 0.5% formaldehyde (Polysciences, Warrington, PA) before analysis using the Fortessa flow cytometer (BD Biosciences). Expression of the SI 83 TCR was detected with a fluorescein isothiocyanate (FITC)-conjugated anti-human TCRv
- FITC fluorescein isothiocyanate
- Cytotoxicity was tested by labelling target cells with calcein AM red-orange (Invitrogen, Carlsbad, CA) and plated into a 96-well round bottom plate (Corning Costar, Corning, NY) at concentration of lx 10 5 cells per well. NK92 or T cells were added to the appropriate effector: target (E:T) ratio and co-cultured with target cells for 4 hours at 37 °C at 5% CO2. After 4 hours, 100 pL of 0.5% formaldehyde was added to each well and the number of viable target cells was counted using the Accuri C6 Plus cytometer (BD Biosciences).
- Transduced T cells were cultured with or without lOOGy gamma-irradiated MOLT -4 at E:T of 1 : 1 in a 96-well flat bottom plate. 120 lU/mL of IL-2 was added thrice weekly. GFP-positive cells representing the transduced T cells were enumerated every 7 days with the Accuri C6 Plus cytometer. Irradiated MOLT-4 was replenished every 7 days to maintain a 1: 1 ratio.
- the hepatitis B virus peptide SI 83 and a TCR construct binding to the peptide in the context of HLA-A2 were gifts from Prof. Antonio Bertoletti (Duke-NUS, Singapore).
- the TCR was expressed in T cells by retroviral vector transduction as described above.
- HLA-A2-expressing T2 cells were pulsed with 1 pg/mL of the SI 83 peptide for 1 hour at 37 °C and co-cultured at 1 : 1 ratio in a 96-well round bottom plate with T cells for 24 hours at 37 °C, in the presence of 200 lU/mL of IL-2.
- T cells were either non transduced, transduced with a vector containing the anti-CD8 PEBL linked with the TCR by an internal ribosomal entry site (IRES), or with a vector containing TCR only. After 24 hours, cells were stained with PE-conjugated anti-CD25 (clone 2A3; BD Biosciences), Peridinin-chlorophyll-protein complex conjugate (PerCP)-conjugated anti- CD3 (clone SK7; BD Biosciences), PECy7-conjugated anti-CD4, and APC-conjugated anti-CD8 (clone BW135/80; Miltenyi Biotec). Stained cells were analyzed using the Fortessa flow cytometer. Killing of T2 cells was measured by flow cytometry after labelling T2 cells with calcein AM-red orange.
- IVS internal ribosomal entry site
- an anti-CD8 CAR was designed by linking the humanized scFv of the anti-CD8a antibody OKT8 with the hinge and transmembrane domain of CD8oc, and the signaling domains of 4-1BB (CD137) and CD3zeta (Fig. 1) using the methods described in Example 1.
- the resulting CAR construct was inserted into an MSCV gamma- retroviral vector together with a DNA sequence encoding GFP. After retroviral transduction into CD8-negative NK92 cells, transduced cells marked by GFP expression also expressed the anti-CD8 CAR (Fig. 2).
- Example 3 Expression of anti-CD8 CAR in NK92 cells induces specific cytotoxicity of CD8-positive target cells
- Cytotoxicity Assay by the methods described in Example 1 was performed using the anti-CD8 CAR of Example 2.
- MOLT-4 (CD8+) and Jurkat (CD8-) target cells were labelled with calcein-AM red orange and co-cultured with NK92 cells transduced with GFP only (“Mock”) or GFP plus anti-CD8a-4 l BB-CD33 CAR at effector to target ratio (E:T) of 1:2, 1 :4, 1:8 for 4 hours at 37 °C. (*** P ⁇ 0.001, **** P ⁇ 0.0001).
- Example 4 Expression of anti-CD8 CAR in T lymphocytes is associated with reduced CD8-positive cell viability
- Peripheral blood T lymphocytes were stimulated with anti-CD3/anti-CD28 antibodies (Transact, Miltenyi Biotec) for 2 days and then transduced with a bicistronic vector to express either GFP only (“Mock”) or GFP plus anti-CD8oi-41BB-CD3 ⁇ CAR. After two days, expression of anti-CD8 CAR was determined by the method outlined in Example 1. The resulting cells expressed both anti-CD8 CAR and GFP (Fig. 4).
- T lymphocytes were with either GFP only (“Mock”) or GFP plus anti-CD8o.-4 l BB-CD33 CAR. Mock and CAR T lymphocytes were harvested and viable cells enumerated 48 hours later
- FIG. 5 In contrast with anti-CD8 CAR expression in NK92 cells, anti-CD8 CAR expression in peripheral T lymphocytes was associated with a markedly reduced cell recovery (Fig. 5). The mean recovery of T cells 48 hours after anti-CD8 CAR viral transduction was 9.6% of that of T cells mock transduced in parallel (Fig. 5). T lymphocytes transduced with GFP only (“Mock”) or anti-CD8 CAR were stained with PE- conjugated anti-CD8 antibody, PECy7-conjugated anti-CD4 antibody, and APC- conjugated anti-CD3 antibody. Flow cytometric plots show CD4 and CD8 expression in GFP+ CD3+ cells. Analysis of expression of CD4 and CD8 after transduction, showed that CD8 positive cells had largely disappeared and most of the remaining viable cells were CD4-positive (Fig. 6). These results demonstrate fratricide among CD8 positive T cells expressing an anti-CD8 CAR.
- Example 5 Identification of an anti-CD8a PEBL that effectively downregulates CD8 expression in T lymphocytes
- PEBLs Protein Expression Blockers
- scFvs linked to peptides that anchor them to the endoplasmic reticulum and/or Golgi apparatus were used.
- Five PEBLs constituted by the scFv of OKT8 linked to the ER retention domain KYKSRRSFIEEKKMP (EEKKMP) and AEKDEL were designed (Fig.
- MOLT-4 cells were transduced with a retroviral vector containing either with GFP alone “Mock”, or GFP plus the indicated PEBLs.
- Transduced MOLT-4 were surface stained with PE-conjugated anti-CD8 antibody, PEcy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody. Dot plots represent GFP+ cells. Following transduction, PEBLs markedly reduced expression of CD8 on the surface of MOLT-4 (Fig
- PEBL expression in transduced MOLT-4 was confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab’)2 antibody followed by phycoerythrin (PE)- conjugated streptavidin conjugated to PE after permeabilization with BD Cytofix/Cytoperm. Histograms show levels of anti-CD8 PEBL expression in GFP-positive cells (Fig 9).
- T lymphocytes were transduced with GFP only (“Mock”), or GFP plus the indicated PEBLs.
- Transduced T lymphocytes were stained with PE-conjugated anti-CD8 antibody, Pecy7-conjugated anti- CD4 antibody, and APC-conjugated anti-CD3 antibody. Symbols indicate CD8 MFI in CD3+/CD4- cells expressing GFP.
- Mock and anti-CD8-EEKKMP were transduced in 7 donors.
- Bi(20)-anti-CD8-EEKKMP was transduced in 4 donors.
- Bi(5)-anti-CD8- EEKKMP was transduced in 6 donors.
- Anti-CD8(20)AEKDEL and bi(5)-Anti- CD8(20)AEKDEL were transduced in 2 donors ( **** P ⁇ 0 0001).
- Surface CD8 expression was reduced by all PEBLs among GFP-expressing CD4-negative T lymphocytes (Fig. 10).
- Anti-CD8 PEBLs were well expressed in T lymphocytes (Fig. 11).
- the anti-CD8-EEKKMP PEBL had the highest expression (Fig 11) and produced the greatest downregulation of CD8 (Fig. 10). Downregulation was sustained for at least 25 days (Fig 12) As the transduction efficiency of PEBLs containing a single or double scFv was different, surface CD8 expression was analyzed according to levels of GFP expression (Fig 13).
- Example 6 Sequential transduction of anti-CD8 PEBL and anti-CD8 CAR suppresses fratricide and improves killing of CD8+ target cells
- the example demonstrates that reducing CD8 surface expression with an anti- CD8 PEBL improves the recovery of anti-CD8 PEBL CAR-T cells and allows them to exert higher cytotoxicity against CD8-positive cells.
- Peripheral blood T lymphocytes were transduced with either anti-CD8-EEKKMP or a vector containing GFP alone (Mock).
- Half of the cells were transduced with an anti-CD8 CAR on the next day and harvested on the third day.
- the CAR was highly expressed regardless of the construct used in the preceding transduction.
- the transduced cells were surface stained with PE-conjugated anti-CD8 antibody, PECy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody and then analyzed by flow cytometry with a gate on GFP+ and CD3+ cells.
- Anti-CD8 CAR expression substantially reduced the percentage of CD8 positive cells, even without expression of the anti-CD8-EEKKMP PEBL (Fig. 15).
- Anti-CD8 CAR expression also substantially reduced the number of viable cells, and this effect was reversed by expressing the anti-CD8-EEKKMP PEBL (Fig. 16).
- these results indicate that the anti-CD8 CAR induced fratricide of CD8 positive T cells, and that fratricide could be prevented by expressing the anti-CD8- EEKKMP PEBL.
- a cytotoxicity assay was performed to determine the effect of the anti-CD8 PEBL on T cell activity.
- T lymphocytes were first transduced with GFP only (“Mock”) or GFP plus anti-CD8-EEKKMP.
- Half of the transduced T lymphocytes were sequentially transduced with GFP plus anti-CD8 CAR.
- Transduced T lymphocytes were co-cultured with calcein-AM red orange labelled CD8 positive MOLT-4 cells at E:T of 2: 1, 1:1, and 1:2 for 4 hours. (* P ⁇ 0.05, ** P ⁇ 0.01, *** P ⁇ 0.001, **** P ⁇ 0.0001).
- the anti-CD8- PEBL (EEKKMP) CAR-T cells exerted significantly higher cytotoxicity against CD8- positive MOLT-4 target cells than T lymphocytes expressing the anti-CD8 CAR but without PEBL transduction and CD8 downregulation (Fig. 17). These results demonstrate that reduced CD8 expression surprisingly enhances the cytotoxic activity of anti-CD8 CAR T cells.
- Example 7 Expression of anti-CD8 PEBL does not impair T cell function driven by the TCR
- T lymphocytes were transduced with either anti-CD8-EEKKMP PEBL linked to the HLA-A201 restricted SI 83 TCR via an internal ribosomal entry site (IRES), or IRES-TCR.
- IRES-TCR internal ribosomal entry site
- T2 target cells were pulsed with the SI 83 peptide and labelled with calcein AM-red orange. Subsequently the labeled T2 cells were co-cultured with non-transduced T cells, T cells expressing TCR only, or with T cells expressing TCR and PEBL.
- Non-transduced, IRES-TCR, or PEBL-IRES-TCR transduced T lymphocytes were co-cultured for 4 hours with T2 cells that were pulsed with the SI 83 peptide and labelled with calcein AM at E:T of 2: 1, 1 : 1, and 1:2. (**** p ⁇ 0.0001). The results showed, T cells expressing TCR with or without PEBL exerted similar cytotoxicity against pulsed T2 target cells (Fig. 18).
- T lymphocytes were transduced with either anti-CD8-EEKKMP linked to the HLA-A201 restricted S183 TCR via an internal ribosomal entry site (IRES), or IRES- TCR with pulsed T2 at a 1 : 1 ratio for 24 hours.
- IRES-TCR, or PEBL- IRES-TCR transduced T lymphocytes were co-cultured for 24 hours with or without T2 that were pulsed with the SI 83 peptide.
- T2 cells displaying the S183 peptide induced CD25 expression (T cell activation) by T cells expressing the HLA-A201 restricted SI 83 TCR, with or without anti-CD8 PEBL, but did not activate control T cells not expressing the SI 83 TCR (Fig. 19), indicating that the anti-CD8 PEBL did not impair T cell activation mediated by TCR.
- Example 8 Expression of anti-CD8 CAR on CDS knockout cells improves their cytotoxicity
- T cells electroporated with NLS-Cas9 alone (“Cas9”) or a complex of NLS-Cas9 and CD8oc gRNA (“CD8KO”) were transduced with either GFP only or anti- CD8 CAR and GFP.
- MOLT-4 (Fig. 21A) and CCRF-CEM (Fig. 21B) cells labelled with calcein-AM red-orange were co-cultured with transduced T cells at E:T of 2:1, 1: 1, and 1:2 for 4 hours.
- CD8-knockout cells that expressing anti-CD8 CAR had a higher cytotoxicity rate against both MOLT-4 and CCRF-CEM cells, as shown in Figs. 21A and 21 B. It suggests that expression of anti-CD8 CAR on CD8 knockout T cells improves cytotoxicity against CD8+ cell lines.
- T cells electroporated with NLS-Cas9 alone (“Cas9”) or a complex of NLS-Cas9 with CD8ot gRNA (“CD8KO”) were transduced with either GFP only or anti-CD8 CAR and GFP.
- Transduced T cells were co-cultured with mCherry- expressing MOLT-4 (Fig. 22A) or CCRF-CEM (Fig 22B) at the indicated ratio in flatbottom 96-well plates.
- CD8-knockout cells Cytotoxicity of CD8-knockout cells was higher than CD8-wildtype counterparts at 40 hour, 80 hours, and 120 hours against both MOLT-4 and CCRF-CEM, as shown in Figs. 22A and 22B. Therefore, anti-CD8 CAR-T cells with CD8 knockout induce greater long-term cytotoxicity against CD8+ leukemic cell lines than CAR-T cells without CD8 knockout.
- T cells with CD8 knockout were transduced with GFP only or anti-CD8 CAR and GFP, and co-cultured with or without lOOGy irradiated MOLT-4 at 1:1 in triplicates.
- CD8-knockout cells that expressed anti-CD8 CAR proliferated faster in the presence of MOLT-4 cells compared to in the absence of MOLT-4 cells, as shown in Fig. 23. It suggests that anti-CD8 CAR-T cells with CD8 knockout proliferate in the presence of CD8+ target cells.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present disclosure provides compositions comprising an anti-CD8 chimeric activating receptor (CAR) and an anti-CD8 protein expression blocker, and methods of using such compositions in cancer therapy. The present disclosure provides cells that have downregulated CD8 expression to reduce fratricide. The CD8 expression can be downregulated using an anti-CD8 antibody (e.g., single-chain variable fragment antibody or single-domain antibody) coupled to an intracellular localization signal. Retention of CD8 in the endoplasmic reticulum can allow T cells expressing an anti-CD8 CAR to grow without compromising their cytotoxic activity against CD8 positive T cells. The T cells described herein can be useful for treating T and/or NK cell associated diseases (e.g., a T-cell malignancy or a NK-cell malignancy) where cancer cells express CD8.
Description
BLOCKADE OF CD8 EXPRESSION AND CHIMERIC ANTIGEN RECEPTORS FOR IMMUNOTHERAPY OF T-CELL AND NK-CELL MALIGNANCIES
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No 63/438,776, filed January 12, 2023, which is incorporated by reference herein in its entirety.
BACKGROUND OF THE DISCLOSURE
[0002] Chimeric antigen receptors (CARs) are artificial hybrid proteins that can redirect immune cells and activate them upon engagement of a specifically recognized target molecule. CARs are widely used to endow immune cells, such as T lymphocytes or natural killer cells, with the capacity to kill cancer cells CARs are typically constituted by a single-chain variable region (scFv) of an antibody linked to a signaling region via a transmembrane domain. When the scFv binds to the corresponding antigen expressed on the surface of target cells, signal transduction is triggered and the process of killing the target cell initiates. Clinical trials with CAR-expressing T lymphocytes targeting CD19 and other B-cell associated antigens have shown remarkable responses in patients with B- cell or plasma cell malignancies, such as acute lymphoblastic leukemia (ALL), nonHodgkin lymphoma (NHL) and multiple myeloma.
[0003] In comparison with the progress made with CAR-T cell therapies in B-cell malignancies, the development of similar technologies to target T-cell and NK-cell malignancies has lagged behind. Cells in these forms of cancer lack expression of CD 19, CD22, BCMA and other common CAR targets. CARs targeting CD5 or CD7 molecules expressed in T cell leukemias and lymphomas have been reported. In many T-cell or NK- cell malignancies, however, CD5 and CD7 are absent, expressed in subset of tumor cells and/or expressed at low levels Novel therapies for T-cell malignancies are needed but progress to date has been slow.
[0004] In sum, there is a significant need for new therapeutic options for patients with T cell and NK-cell malignancies.
SUMMARY OF THE DISCLOSURE
[0005] Recognized herein is a need for an improved therapeutic option for patient with T cell and NK cell malignancies. In one aspect, the present disclosure provides a recombinant nucleic acid molecule encoding an anti-CD8 CAR, wherein the anti-CD8 CAR comprises an antigen binding domain which binds to CD8, a transmembrane domain, and a signaling domain.
[0006] In some embodiments, the antigen binding domain is a single-chain variable region (scFv) or a single domain antibody. In some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID NOs: 1-6, respectively; or (ii) SEQ ID NOs: 7-12 respectively.
[0007] In some embodiments, the CD8 binding domain comprises: a) (i) a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13; (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13, or (iii) an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13; and b) (i) a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14, or (iii) an amino acid sequence with 95- 99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
[0008] In some embodiments, the CD8 binding domain comprises: (i) an amino acid sequence as set forth in SEQ ID NO: 25, (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid
sequence as set forth in SEQ ID NO: 25; or (iii) an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25.
[0009] In some embodiments, the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the CD8a, CD8(3, 4-1BB, CD28, CD34, CD4, FceRIy, CD16, 0X40, CD31 CD3e, CD3y, CD35, TCRa, CD32, CD64, VEGFR2, FAS, or FGFR2B. In some embodiments, the transmembrane domain comprises a sequence of SEQ ID NO: 37 or the transmembrane domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 37, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 37.
[0010] In some embodiments, the CD8 binding domain is connected to the transmembrane domain by a hinge region. In some embodiments, the intracellular signaling domain comprises a sequence encoding a costimulatory domain. In some embodiments, the intracellular signaling domain comprises a sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41 In some embodiments, the intracellular signaling domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41, or a sequence with 95-99 %identity to an amino acid sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41 .
[0011] In some embodiments, the disclosure provides a vector comprising a nucleic acid molecule encoding a CAR, e.g., an anti-CD8 CAR disclosed herein. In some embodiments, the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, or a retrovirus vector. In some embodiments, the vector further comprises a promoter, optionally wherein the promoter is selected from a group consisting of an EF-1 promoter, a MSCV promoter, SC40 promoter, a CMV promoter, or a PGK promoter.
[0012] In some embodiments, the disclosure provides a method of making a cell comprising transducing a T cell with a vector disclosed herein. In some embodiments, the disclosure provides a method of providing an anti-cancer immunity in a mammal comprising administering to the mammal an effective amount of a cell expressing a CAR molecule, e g., an anti-CD8 CAR molecule disclosed herein. In some embodiments, the immune cell is an autologous T cell. In some embodiments, the immune cell is an allogeneic T cell.
[0013] In one aspect, the disclosure provides an recombinant nucleic acid molecule encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain linked to an intracellular localizing domain, wherein the intracellular localizing domain comprises a retention sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteosome localizing sequence. [0014] In some embodiments, the anti-CD8 binding domain is a scFv or a single domain antibody In some embodiments, the scFv comprises a CD8 binding domain comprising: (i) a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13; (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13: or (iii) an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 and iv) a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; (v) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14: or (vi) an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
[0015] In some embodiments, the CD8 binding domain comprises: i) an amino acid sequence as set forth in SEQ ID NO: 25; ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 25; or iii) an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25.
[0016] In some embodiments, the intracellular localizing domain comprises one or more of a Golgi retention sequence, an ER retention sequence, a proteosome localizing sequence. In some embodiments, the intracellular localizing domain comprises an amino acid sequence as set forth in any of the SEQ ID NOs: 56, 58, 61, 63, 64, 65, 68, 74, or 75. In some embodiments, the intracellular localizing domain comprises an amino acid sequence as set forth in any of SEQ ID NOs: 56, 58, 61, 63, 64, 66, or 67. In some embodiments, the intracellular localizing domain comprises one or more of a Golgi retention sequence, an ER retention sequence, a proteosome localizing sequence. In some embodiments, the ER retention sequence comprises a KDEL sequence and the CD8 blocking polypeptide further comprising a linker between the scFv and the intracellular localizing domain. In some embodiments, the ER retention sequence comprises a KKXX
sequence, wherein X represents any amino acid. In some embodiments, the Golgi retention sequence comprises YQRL, YGRL, or YKGL. In some embodiments, the proteosome localizing sequence comprises PEST.
[0017] In some embodiments, the disclosure provides a vector comprising a nucleic acid molecule encoding the CD8 blocking polypeptide disclosed herein, e.g., a CD8- PEBL. In some embodiments, the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, or a retrovirus vector, optionally further comprising a promoter, optionally wherein the promoter is selected from a group consisting of an EF-1 promoter, a MSCV promoter, SC40 promoter, a CMV promoter, or a PGK promoter. In some embodiments, the disclosure provides a method of modifying a cell comprising transducing or transfecting a cell with a vector disclosed herein.
[0018] In one aspect, the disclosure provides, an engineered immune cell comprising: a nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered immune cell.
[0019] In one aspect the disclosure provides an engineered immune cell comprising: a nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising an anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR).
[0020] In one aspect the disclosure provides an engineered immune cell comprising: (i) a first nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered cell; and (ii) a second nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising the anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR), optionally wherein the CD8 blocking polypeptide remains intracellularly within the engineered immune cell and binds endogenous CD8 within the engineered immune cell [0021] In some embodiments, the anti-CD8 binding domain is a scFv or a single domain antibody. In some embodiments, the engineered immune cell is an engineered T cell, an engineered natural killer (NK) cell, an engineered NK/T cell, an engineered monocyte, an engineered macrophage, or an engineered dendritic cell.
[0022] In some embodiments, the scFv of the CD8 blocking polypeptide and/or the scFv of the CAR comprises (i) a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13, (ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 : or (iii) an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 and iv) a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; (v) an amino acid sequence having at least one, two or three modifications but not more than 0, 20 or 10 modifications of the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14: or (vi) an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14. In some embodiments, the scFv of the CD8 blocking polypeptide and/or the scFv of the CAR comprises i) an amino acid sequence as set forth in SEQ ID NO: 25; ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 25; or iii) an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25. In some embodiments, the scFv of the CD8 blocking polypeptide and/or the scFv of the CAR comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID NOs: 1-6, respectively; or (ii) SEQ ID NOs: 7-12 respectively.
[0023] In some embodiments, the ER retention sequence comprises an amino acid sequence selected as set forth in any of the SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 66 or SEQ ID NO: 67. In some embodiments, the ER retention sequence is selected from the group consisting of SEQ ID NO: 65, SEQ ID NO: 64, SEQ ID NO: 74, SEQ ID NO: 75. In some embodiments, the proteosome localizing sequence, comprises an amino acid sequence as set forth in SEQ ID NO: 68.
[0024] In some embodiments, the CD8 blocking polypeptide further comprises a transmembrane domain linked between the scFv and either the ER retention sequence
domain comprising EKKMP, wherein the transmembrane domain is a transmembrane domain selected from any one of the group consisting of CD8alpha, CD8beta, 4-1BB, CD28, CD34, CD4, FcsRIgamma, CD16, 0X40, CD3zeta, CD3epsilon, CD3gamma, CD35, TCRalpha, CD32, CD64, VEGFR2, FAS, and FGFR2B, e.g., wherein the transmembrane domain comprises an amino acid sequence of SEQ ID NO: 34. In some embodiments, the CD8 blocking polypeptide comprises an amino acid sequence having at least 90% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 45-47 and 79-81. In some embodiments, the CD8 blocking polypeptide comprises an amino acid sequence having at least 90% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 95-98. In some embodiments, the transmembrane domain is selected from an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD1. In some embodiments, the transmembrane domain is a CD8a transmembrane domain.
[0025] In one aspect, the present disclosure provides an engineered immune cell comprising a recombinant nucleic acid molecule encoding an anti-CD8 chimeric antigen receptor (CAR), wherein the anti-CD8 CAR comprises an antigen binding domain which binds to CD8, a transmembrane domain, and a signaling domain, and wherein the engineered immune cell has reduced expression of endogenous CD8. In some embodiments, the engineered immune cell has a reduced CD 8 expression. In some embodiments, the endogenous CD8 of the engineered immune cell is knocked out or knocked down. In some embodiments, the endogenous CD8 of the engineered immune cell is knocked out via zinc-fmger endonucleases, TALEN, or CRISPR-Cas9. In some embodiments, the endogenous CD8 of the engineered immune cell is knocked down via siRNA or shRNA. In some embodiments, the endogenous CD8 of the engineered immune cell is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence. In some embodiments, the anti-CD8 binding domain is a scFv or a single domain antibody. In some embodiments, the engineered cell comprises a population of engineered cells, and wherein cytotoxic T cells in the population of engineered cells is at least about 50 times more than cytotoxic T cells otherwise identical population of cells expressing the anti-CD8 CAR without the reduced
expression of endogenous CD8 after transduction and culturing for a period of time. In some embodiments, the period of time is at least about 2 days, at least about 3 days, at least about 5 days or more. In some embodiments, the engineered cell comprises a population of engineered cells, and wherein viability of cytotoxic T cells in the population of engineered cells is at least about 2 times, at least about 5 times, at least about 10 times, at least about 25 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, or at least about 500 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, cytotoxicity of the engineered immune cell against target cells is at least about 1.2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, or at least about 3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 2:1, 1:1, or 1 :2. In some embodiments, the target cells are CD8- positive cells, e.g., comprising MOLT-4 and/or CCRF-CEM. In some embodiments, cytotoxicity of the engineered immune cell against target cells is at least about 1 .2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, at least about 3 times, or at least about 4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culturing with the target cells. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:1, 1:2, 1 :4, or 1:8. In some embodiments, the target cells are CD8-positive cells, e g., comprising MOLT-4 and/or CCRF-CEM In some embodiments, proliferation of the engineered immune cell in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, or at least about 5 times higher compared to proliferation of the engineered immune cell in the absence of the target cells. In some embodiments, proliferation of the engineered immune cell in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, or at least about 10 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of engineered immune cell is tested at an effector-target ratio of 1:1. In some embodiments, the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about
14 days, or about 20 days of culturing the engineered immune cell in the presence or absence of the target cells. Tn some embodiments, the target cells are CD8-positive cells, e g., comprising MOLT-4 and/or CCRF-CEM.
[0026] Tn one aspect, the disclosure provides a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and a CD8 chimeric antigen receptor (CAR) comprising an anti-CD8 binding domain, optionally wherein the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell. In some embodiments, the anti-CD8 binding domain is a scFv or a single domain antibody
[0027] In one aspect, the disclosure provides a pharmaceutical composition comprising the recombinant nucleic acid described herein, the CAR described herein, the CD8 blocking polypeptide described herein, the vector described herein, or an engineered immune cell described herein, optionally further comprising an excipient.
[0028] In one aspect, the disclosure provides a method of treating a disease in a subject in need thereof comprising administering a pharmaceutical composition comprising an immune cell comprising an anti-CD8 CAR comprising a CD8 binding domain, a transmembrane domain, and a signaling domain. In one aspect, the disclosure provides a method of providing anti -cancer immunity to a mammal comprising administering to the mammal the recombinant nucleic acid described herein, a CAR described herein, the CD8 blocking polypeptide described herein, the vector described herein, the engineered immune cell described herein, or a pharmaceutical composition described herein. In some embodiments, the immune cell is engineered to have reduced cell surface expression of CD8. In some embodiments, the immune cell further comprises a chimeric polypeptide comprising a CD8 binding domain and an intracellular localization domain. In some embodiments, the disease is a T cell malignancy or a NK cell malignancy.
[0029] In one aspect, the disclosure provides a method of reducing fratricide in a population of immune cells expressing a chimeric antigen receptor comprising a CD8 binding domain, the method comprising expressing a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteosome localizing sequence, and wherein the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell. In some embodiments, the CD8 binding domain is an scFv or a single domain antibody.
[0030] In one aspect, the disclosure provides a method of treating a cancer in a subject in need thereof comprising administering to the subject an recombinant nucleic acid described herein, a CAR described herein, a CD8 blocking polypeptide described herein, a vector described herein, an engineered immune cell described herein, or a pharmaceutical composition described herein. In some embodiments, the immune cell is engineered to have reduced cell surface expression of CD8.
[0031] In one aspect, the disclosure provides a method of treating cancer in a subject in need thereof comprising administering a therapeutic amount of a composition comprising an engineered immune cell comprising: (i) a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteosome localizing sequence, and wherein the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell; and (ii) a CAR comprising a CD8 targeting domain, a transmembrane domain, and a signaling domain. In some embodiments, the CD8 binding domain is an scFv or a single domain antibody.
[0032] In one aspect, the disclosure provides a method of providing an anti-cancer immunity in a mammal comprising administering to the mammal an effective amount of an immune cell expressing a CAR molecule disclosed herein, e g., an anti-CD8 CAR. In some embodiments, the immune cell is engineered to have reduced cell surface expression of CD8. In some embodiment, the immune cell is an autologous T cell. In some embodiment, the immune cell is an allogeneic T cell.
[0033] In one aspect, the disclosure provides use of the recombinant nucleic acid described herein, the CAR described herein, the CD8 blocking polypeptide described herein, the vector of described herein, the engineered immune cell described herein, or the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of a cancer, in a subject in need thereof.
[0034] In one aspect, the disclosure provides a method of reducing and/or preventing fratricide during manufacturing of immune cells expressing an anti-CD8 CAR, comprising functional inhibition of CD8 signaling during the manufacturing process of the cells In some embodiments, the functional inhibition of CD8 signaling comprises reducing expression of endogenous CD8 of the immune cells. In some embodi ents, the endogenous CD8 of the immune cells is knocked out or knocked down. In some embodiments, the endogenous CD8 of the immune cells is knocked out via zinc-finger
endonucleases, TALEN, or CRISPR-Cas9. In some embodiments, the endogenous CD8 of the immune cells is knocked down via siRNA or shRNA. In some embodiments, the endogenous CD8 of the immune cells is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence. In some embodiments, the anti-CD8 binding domain is a scFv or a single domain antibody. In some embodiments, viability of cytotoxic T cells among the immune cells is at least about
1.1 times, at least about 5 times, at least about 10 times, at least about 25 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, or at least about 500 times higher compared to otherwise identical cytotoxic T cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, cytotoxicity of the immune cells against target cells is at least about
1.2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, or at least about 3 times higher compared to otherwise identical immune cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 2: 1, 1 : 1, or 1 :2. In some embodiments, the target cells are CD8-positive cells, e g., comprising MOLT-4 and/or CCRF-CEM. In some embodiments, cytotoxicity of the immune cells against target cells is at least about 1.2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, at least about 3 times, or at least about 4 times higher compared to otherwise identical immune cells and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culturing with the target cells. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 1, 1 :2, 1 :4, or 1 :8. In some embodiments, the target cells are CD8-positive cells, e.g., comprising MOLT-4 and/or CCRF-CEM. In some embodiments, proliferation of the immune cells in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, or at least about 5 times higher compared to the immune cells in the absence of the target cells as claimed here. In some embodiments, proliferation of the immune cells in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, or at least about 10 times higher compared to otherwise identical immune cells with enforced reduction in
CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the immune cells and the target cells are at an effector-target ratio of 1 :1 . In some embodiments, the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days of culturing the immune cells in the presence or absence of the target cells. In some embodiments, the target cells are CD8-positive cells, comprising MOLT-4 and/or CCRF-CEM.
[0035] In one aspect, the disclosure provides a method of manufacturing an engineered immune cell comprising (i) transducing an immune cell with a vector comprising a polynucleotide sequence encoding a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain; and (ii) transducing the immune cell with a vector comprising a polynucleotide sequence encoding a CD8 chimeric antigen receptor (anti-CD8 CAR) comprising a CD8 binding domain, a transmembrane domain, and a signaling domain. In some embodiments, the CD8 binding domain of the CD8 blocking polypeptide or the CD8 binding domain of the anti-CD8 CAR comprises an scFv or a single domain antibody. In some embodiments, the cellular localizing domain comprises an amino acid sequence selected from the group consisting of an ER retention sequence, a Golgi retention sequence, and a proteosome localizing sequence. In some embodiments, the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell. In some embodiments, the CD8 blocking polypeptide is expressed before the anti-CD8 CAR. In some embodiments, the CD8 blocking polypeptide is expressed about one day before the anti-CD8 CAR. In some embodiments, the CD8 blocking polypeptide is expressed at least one day before the anti- CD8 CAR. In some embodiments, the CD8 blocking polypeptide is expressed simultaneously with the anti-CD8 CAR. In some embodiments, a bicistronic vector comprises sequences encoding the CD8 blocking polypeptide and the anti-CD8 CAR.
INCORPORATION BY REFERENCE
[0036] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] FIG. 1 illustrates the schematic design of the anti-CD8oi-41BB-CD3^ construct. The anti-CD8 CAR comprises from 5’-3’ a CD8 signal peptide, a CD8 antigen binding domain derived from the humanized scFv sequence from the OKT8 antibody, a CD8 hinge and transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3(j intracellular signaling domain.
[0038] Fig. 2 shows expression of anti-CD8a-41BB-CD3g in NK92 cells. Retroviral transduction of the anti-CD8 CAR in CD8-negative NK92 cells resulted in high expression of anti-CD8 CAR in the transduced GFP-positive NK-92 cells compared to the control. Flow cytometric analysis of NK92 cells transduced with either GFP only “Mock” (Fig. 2; left panel) or GFP plus anti-CD8a-41BB-CD3^ (Fig. 2; right panel). Dot plots illustrate GFP fluorescence and CAR expression revealed by staining with biotin-conjugated goat anti-mouse F(ab’)2 antibody followed by streptavidin conjugated to APC.
[0039] Fig. 3 shows NK92 expressing anti-CD8a-41BB-CD3ij mediated cytotoxicity against CD8+ cells. NK92 cells exerted significantly higher cytotoxicity against the CD8- positive leukemia cell line MOLT-4 when they expressed the anti-CD8 CAR (Fig. 3; left panel) but no gains in cytotoxicity were observed when the target cell was the CD8- negative leukemia cell line Jurkat (Fig. 3; right panel).
[0040] Fig. 4 shows expression of anti-CD8a-41BB-CD3g in human peripheral blood T lymphocytes. Peripheral blood T lymphocytes transduced with anti-CD8 CAR show high expression of anti-CD8 CAR 2 days after transduction. Dot plots represent flow cytometric analysis of transduced T lymphocytes that were stained with biotin-conjugated goat antimouse F(ab’)2 antibody followed by streptavidin conjugated to APC to detect the CAR.
[0041] Fig. 5 shows expression of anti-CD8 CAR in T lymphocytes induces killing of lymphocytes. Anti-CD8 CAR expression in peripheral T lymphocytes was associated with a markedly reduced cell recovery in contrast with T cells transduced with GFP only (“Mock”).
[0042] Fig. 6 shows expression of anti-CD8 CAR in T lymphocytes induced killing of CD8+ lymphocytes. Analysis of expression of CD4 and CD8 in peripheral blood T lymphocytes transduced with anti-CD8 CAR shows CD8 positive cells had largely disappeared and most of the remaining viable cells were CD4-positive two days after transduction.
[0043] Fig. 7 shows schematic design of 5 PEBLs comprising the scFv of OKT8 linked to the ER retention domain KYKSRRSFIEEKKMP (EEKKMP) or AEKDEL The first PEBL comprises CD8ot Signal Peptide - OKT8 Light Chain 1 - scFv Linker 1 - OKT8 Heavy Chain 1 - Linker20 (1) - AEKDEL (anti-CD8(20)AEKDEL) (Fig 7; top panel). The second PEBL comprises CD8a Signal Peptide - OKT8 Light Chain 1 - scFv Linker 1 - OKT8 Heavy Chain 1 - CD8 Transmembrane 1 - EEKKMP 1 (anti-CD8-EEKMP) (Fig. 7; second from top panel). The third PEBL comprises CD8a Signal Peptide 2 - OKT8 Light Chain 3 - scFv Linker 3 - OKT8 Heavy Chain 3 - Linker20 2 - OKT8 Light Chain 4 - scFv Linker 4 - OKT8 Heavy Chain 4 - CD8 Transmembrane 2 - EEKKMP 2 (bi(20)- Anti-CD8-EEKMP) (Fig.7, third from top panel). The fourth PEBL comprises CD8a Signal Peptide - OKT8 Light Chain 2 - scFv Linker 2 - OKT8 Heavy Chain 2 - Linker5 - OKT8 Light Chain 1 - scFv Linker 1 - OKT8 Heavy Chain 1 - CD8 Transmembrane 1 - EEKKMP l(bi(5)-AntiCD8-EEKMP) (Fig. 7; fourth from top panel). The fifth PEBL comprises CD8a Signal Peptide - OKT8 Light Chain 2 - scFv Linker 2 - OKT8 Heavy Chain 5 - Linker5 - OKT8 Light Chain 1 - scFv Linker 1 - OKT8 Heavy Chain 1 - Linker20 (1) - AEKDEL (bi(5)-AntiCD8(20) AEKDEL) (Fig 7; bottom panel)
[0044] Fig. 8 shows anti-CD8 PEBLs eliminated surface CD8 expression on MOLT-4. MOLT -4 cells transduced with Anti -CD8(20) AEKDEL (Second panel from Left), bi(5)- Anti-CD8(20)AEKDEL (Third Panel), Anti -CD 8 -EEKKMP PEBL (Fourth Panel), bi(5)Anti-CD8-EEKKMP PEBL (Fifth Panel), or bi(20)-Anti-CD8-EEKKMP (Sixth Panel) show markedly reduced expression of CD8 on the surface of MOLT-4 compared to the CD8 expression on MOLT-4 cells transduced with GFP (First Panel).
[0045] Fig. 9 shows PEBL expression in transduced MOLT-4 cells confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab’)2 antibody followed by phycoerythrin (PE)-conjugated streptavidin.
[0046] Fig. 10 shows T-lymphocytes transduced with Anti-CD8(20)AEKDEL, bi(5)- Anti-CD8(20)AEKDEL, Anti-CD8-EEKMP PEBL, bi(20)-Anti-CD8-EEKKMP PEBL, or bi(5)-Anti-CD8-EEKKMP PEBL show reduced expression of CD8 on their surface compared to the CD8 expression on T lymphocyte cells transduced with GFP. Surface CD8 expression was reduced by all PEBLs among GFP-expressing CD4-negative T lymphocytes. T lymphocytes were transduced with GFP only (“Mock”), or GFP plus the indicated PEBLs. Transduced T lymphocytes were stained with PE-conjugated anti-CD8 antibody, PEcy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody. Symbols indicate CD8 MFI in CD3+/CD4- cells expressing GFP. Mock and Anti-CD8-
EEKKMP were transduced in 7 donors. bi(20)-anti-CD8-EEKKMP was transduced in 4 donors. bi(5)-Anti-CD8-EEKKMP was transduced in 6 donors Anti-CD8(20)AEKDEL and bi(5)-Anti-CD8(20)AEKDEL were transduced in 2 donors. (**** P < 0.0001) [0047] Fig. 1 1 shows PEBL expression in transduced T-lymphocytes was confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab’)2 antibody followed by phycoerythrin (PE)-conjugated streptavidin PE after permeabilization with BD Cytofix/Cytoperm. Histograms represent GFP+ cells.
[0048] Fig. 12 shows downregulation of CD8 expression was sustained in MOLT-4 cells and T lymphocytes transduced with an anti-CD8-EEKMP PEBL or bi(5)-Anti-CD8- EEKKMP PEBL. T lymphocytes and MOLT-4 were transduced with the indicated anti- CD8 PEBLs. Following transduction, cells were monitored for up to 23 days for surface CD8 expression by staining with PE-conjugated anti-CD8 antibody, PEcy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody and gated on CD3+ CD4- cells expressing GFP.
[0049] Fig. 13 shows surface CD8 expression according to levels of GFP expression in T lymphocytes transduced with anti-CD8-EEKMP PEBL, bi(20)-Anti-CD8-EEKKMP PEBL, or bi(5)-Anti-CD8-EEKKMP PEBL.
[0050] Fig. 14 shows CAR expression in peripheral blood T lymphocytes that were transduced with either anti-CD8- PEBL (EEKKMP) or a vector containing GFP and then transduced one day later with anti-CD8 CAR. T lymphocytes were first transduced with GFP only (“Mock”) or GFP plus anti-CD8-PEBL (EEKKMP). Half of the transduced T lymphocytes were sequentially transduced with GFP plus anti-CD8 CAR. Transduced cells were stained with biotin-conjugated goat anti-human F(ab’)2 antibody followed by streptavidin conjugated to APC. The CAR was highly expressed regardless of the construct used in the preceding transduction.
[0051] Fig. 15 shows expression of anti-CD8 CAR with or without anti-CD8 PEBL result in reduced CD8 expression in T lymphocytes. CD8 expression in peripheral blood T lymphocytes that were transduced with either anti-CD8-EEKKMP or a vector containing GFP and then transduced one day later with anti-CD8 CAR. Anti-CD8-EEKKMP reduced CD8 surface expression No CD8 positive cells were observed after transduction with the anti-CD8 CAR.
[0052] Fig. 16 shows PEBL improves cell recovery following transduction with anti- CD8 CAR. The number of viable T cells recovered after CAR transduction was
considerably higher in cells that had been transduced with both PEBL and CAR compared to cells transduced with a CAR alone.
[0053] Fig. 17 shows that the anti-CD8 CAR T lymphocytes with anti-CD8-EEKKMP mediated better cytotoxicity against CD8-positive MOLT-4. Anti-CD8-EEKKMP CAR-T cells exerted significantly higher cytotoxicity against CD8-positive MOLT-4 target cells than T lymphocytes expressing the anti-CD8 CAR but without PEBL transduction and CD8 downregulation. (**** P < 0.0001, *** P < 0.001, ** P < 0.01)
[0054] Fig. 18 shows anti-CD8 PEBL T cells exert TCR-driven cytotoxicity. T cells expressing the HLA-A201 restricted SI 83 TCR with an anti-CD8-EEKKMP PEBL (PEBL-TCR) or without the PEBL (IRES-TCR) exerted similar cytotoxicity against T2 cells displaying an S183 peptide. (**** P < 0.0001)
[0055] Fig. 19 shows anti-CD8 PEBL T cells are stimulated by TCR engagement. Upregulation of CD25 mediated by T2 cells displaying an SI 83 peptide (T2) was similar in T cells expressing TCR with or without an anti-CD8 PEBL. (**** P < 0.0001)
[0056] Fig. 20 shows CD8 knockout by CRISPR-Cas9 improves recovery of cytotoxic T cells after anti-CD8a-41BB-CD3 CAR transduction. Anti-CD8a-41BB-CD3(^ CAR was transduced on T cells which had been subjected to CD8 knockout (CD8KO-CAR), or not (Cas9-CAR). CD8 knockout was successful, and in 5 experiments, mean (± SD) percentage of CD8+ T cells was 44.7% (± 12.8) for Cas9-Only and 1.8% (± 1.7) for CD8KO. Bars represent the percentage of CD4-negative cells relative to those initially used for transduction.
[0057] Figs. 21A and 21B show expression of anti-CD8a-41BB-CD3 CAR on CD8 knockout T cells improves cytotoxicity against CD8+ cell lines. T cells electroporated with NLS-Cas9 alone (“Cas9”) or a complex of NLS-Cas9 and CD8a gRNA (“CD8KO”) were transduced with either GFP only or anti-CD8a-41BB-CD3<^ CAR and GFP. MOLT-4 (Fig. 21 A) and CCRF-CEM (Fig. 21B) cells labelled with calcein-AM red-orange were cocultured with transduced T cells at E:T of 2: 1, 1: 1, and 1 :2 for 4 hours. Bars represent mean (± SD) of triplicate cultures from 3 donors for MOLT-4, and 2 donors for CCRF- CEM. (*** p<0.001, **** p<0.0001). Fig. 21 A shows cytotoxicity of T cells electroporated with NLS-Cas9 alone (“Cas9”), a complex of NLS-Cas9, either GFP only (CD8KO) or anti-CD8a-41BB-CD3^ CAR and GFP (CD8KO-CAR) using MOLT-4 cell line. Fig. 2 IB shows cytotoxicity of T cells electroporated with NLS-Cas9 alone (“Cas9”),
a complex of NLS-Cas9, either GFP only (CD8K0) or anti-CD8a-41BB-CD3/j CAR and GFP (CD8K0-CAR) using CCRF-CEM cell line.
[0058] Figs. 22A and 22B show anti-CD8a-41BB-CD3^ CAR-T cells with CD8 knockout induces greater long-term cytotoxicity against CD8+ leukemic cell lines than CAR-T cells without CD8 knockout. T cells electroporated with NLS-Cas9 alone (“Cas9”) or a complex of NLS-Cas9 with CD8a gRNA (“CD8KO”) were transduced with either GFP only or anti-CD8a-41BB-CD3^ CAR and GFP. Transduced T cells were co-cultured with mCherry-expressing MOLT-4 (Fig. 22A) or CCRF-CEM (Fig. 22B) at the indicated ratio in flat-bottom 96-well plates. Data represent mCherry signal from targets cells expressed as Integrated Red Object Intensity. Fig. 22A shows cytotoxicity exerted by T cells electroporated with NLS-Cas9 alone (“Cas9”), a complex ofNLS-Cas9 and CD8a guide RNA, either GFP only (CD8KO) or anti-CD8a-41BB-CD3i^ CAR and GFP (CD8KO-CAR) as measured at sequential time-points during co-cul turing with MOLT-4 cell line. Fig. 22B shows cytotoxicity exerted by T cells electroporated with NLS-Cas9 alone (“Cas9”), a complex of NLS-Cas9 and CD8a guide RNA, either GFP only (CD8KO) or anti-CD8a-41BB-CD3^ CAR and GFP (CD8KO-CAR) as measured at sequential timepoints during co-culturing with CCRF-CEM cell line.
[0059] Fig. 23 shows anti-CD8a-41BB-CD3/j CAR-T cells with CD8 knockout proliferate in the presence of CD8+ target cells T cells with CD8 knockout were transduced with GFP only or anti-CD8a-41BB-CD3^ CAR and GFP, and co-cultured with or without lOOGy irradiated MOLT-4 at 1 : 1 in triplicates. Each plot represents a separate T cell donor.
DETAILED DESCRIPTION OF THE DISCLOSURE
[0060] Immunotherapy is becoming a mainstay of modern cancer treatment The infusion of genetically engineered immune cells has yielded very promising clinical results, indicating that tumor responses can be achieved even in patients where standard treatment modalities have failed. Central to the success of CAR-T cell therapy is the identification of targets that are highly expressed in cancer cells but are not expressed by healthy cells. Antigens with these characteristics that are targetable with CARs are rare and are typically associated with tumor peptides expressed in the context of specific HLA molecules. Much of the clinical experience with CARs has instead relied on antigens expressed in healthy cells that are temporarily dispensable and/or whose absence can be
offset by clinical intervention. For example, the clinical consequences of agammaglobulinemia resulting from B-cell depletion after anti-CD19 CAR-T cell therapy can be mitigated by periodic supplementation of intravenous immunoglobulins. The identification of other such antigens can widen the application of CAR-T cell therapy and allow its use in forms of cancers that are currently not amenable to cell therapy.
[0061] This disclosure identified CD8 as a target for CAR-T cell therapy. CD8 is widely expressed in T-cell leukemias and lymphomas. For example, CD8 expression has been reported in cases of T-cell prolymphocytic leukemia, T-cell large granular lymphocytic leukemia, peripheral T-cell lymphoma, as well as Epstein-Barr virus (EBV)+ T-cell lymphoproliferative disorders of childhood, including EBV+ hemophagocytic lymphohistiocytosis, systemic EBV+ T-cell leukemia of childhood and primary EBV+ nodal T-cell, or NK-cell lymphoma. Described herein are “second-generation” anti-CD8 CARs that can be expressed at high levels in the CD8-negative NK cell line NK92. When expressed, such “second generation” anti-CD8 CARs elicited high and specific cell killing of CD8+ leukemic cells. However, when expressed in peripheral blood T lymphocytes, the anti-CD8 CARs disclosed herein triggered killing of the T lymphocytes expressing CD8, including those expressing the anti-CD8 CAR. Because CD8+ T cells are the main direct effectors of anti-tumor cytotoxicity, this fratricidal activity can reduce the number of cells that can be recovered for infusion in patients and, hence, impair clinical activity of anti- CD8 CAR T cells.
[0062] To protect CAR-T cells from fratricide, the present disclosure provides cells that have downregulated CD8 expression. In one embodiment, the downregulation occurs using the PEBL technology as described in WO2016/126213. Anti-CD8 PEBLs markedly reduced CD8 expression in MOLT-4 cells and T lymphocytes. CD8 downregulation might also be achievable with gene editing methods, such as zinc-finger endonucleases, TALEN, and CRISPR-Cas9. In some embodiments, downregulation occurs via PEBLs that are expressed simultaneously with CARs via bicistronic vectors and allow the desired genetic modifications to occur with one single transduction.
[0063] CD8 is critical for TCR-mediated signaling, as it stabilizes its binding to peptide-loaded HLA and promotes signal transduction. Therefore, the consequences of CD8 downregulation on the function of human peripheral blood T cells engineered with CARs or TCRs were unpredictable. This disclosure provides anti-CD8 CAR T cells with downregulated CD8a e.g., through expression of PEBL (e.g., anti-CD8 PEBL) having
increased cytotoxic capacity compared to anti-CD8 CAR T cells where CD8a expression is not downregulated. In some embodiments, downregulation of CD8a with PEBL do not affect TCR-mediated signaling or peptide-HLA specific cytotoxicity. In some embodiments, the high expression of CAR or TCR in the engineered immune cells can diminish the impact of the CD8 co-receptor on signaling. In some embodiments, the functional capacity of T cells expressing physiologic levels of TCR can diminish in the absence of CD8 expression. In some embodiments, downregulation of CD8 with PEBLs, e g., anti-CD8 PEBLs disclosed herein or gene editing technologies can provide a way to silence TCR receptor signaling. In some embodiments, the infusion of the T cell products, e.g., the engineered immune cells (e.g., allogenic T cells) disclosed herein can suppress TCR receptor signaling. In some embodiments, the suppression of TCR receptor signaling can reduce the risk of graft-versus-host disease after infusion of the T cell products disclosed herein, e g., the allogeneic T cell products.
[0064] In one aspect, the disclosure provides effective CAR-T cells, e.g., anti-CD8 CAR T cells for CD8+ malignancies. In one aspect, the disclosure provides, autologous and/or allogeneic anti-CD8 CAR T cells with downregulated CD8 expression, (e.g., using PEBL technology as described herein) for treating malignancies, e.g., CD8+ malignancies. [0065] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.
[0066] The term "a" and "an" as used herein refer to one or to more than one (i.e., to at least one) of the grammatical object of the article, e.g., "an element" means one element or more than one element.
[0067] The term "about" or “approximately” as used herein refers to a measurable value such as an amount, a temporal duration, and the like, refers to being within a statistically meaningful range of variations of ±20% or in some instances ±10%, or in some instances ±5%, or in some instances ±1%, or in some instances ±0. 1% from the specified value.
[0068] The term “alleviate” as used herein, in context to a disease refers to reducing the severity of one or more symptoms of the disease.
[0069] The term “allogeneic", as used herein, refers to any material derived from an individual that is transplanted into a genetically different recipient of the same species. Two or more individuals are said to be allogeneic to one another when their genes at one
or more loci are not identical. In some aspects, allogeneic material from individuals of the same species may be sufficiently unlike genetically to interact antigenically.
[0070] The term “autologous” as used herein refers to any material derived from the same individual to which it is later to be re-introduced.
[0071] The term "binding domain" as used herein (e.g., "CD8 binding domain") refers generally to a molecule that binds to a specific molecule and optionally forms a bound complex but does not substantially recognize or bind other molecules in a sample The term "binding domain" encompasses antibodies and antibody fragments.
[0072] The terms “binds” as used herein refers to a binding which occurs between paired species (e.g., enzyme/substrate, receptor/agonist, antibody/antigen, lectin/carbohydrate) which may be mediated by covalent and/or non-covalent interactions. “Binding” occurs between pairs of species where there is interaction between the two that produces a bound complex. “Specific binding” occurs between two molecules with selective affinity for each other, in contrast to “non-specific binding”, which may result from a non-selective interaction between molecules with compatible charged or hydrophobic surfaces. An antibody that “specifically binds” to an antigen from one species may also bind to a homologous antigen from one or more different species. However, such cross-species reactivity does not itself alter the classification of an antibody as specific. Tn another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein at least two times the background and more typically more than 10 to 100 times background. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein.
[0073] The term "antibody" as used herein refers to a protein, or polypeptide sequence comprising an immunoglobulin domain which specifically binds with an antigen. Antibodies can be polyclonal or monoclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources. In some embodiments, an antibody comprises at least one heavy chain. In some embodiments, an antibody comprises at least one light chain. In some embodiments, an antibody comprises at least one heavy chain and one light chain. Each heavy chain is comprised of a heavy chain variable region ("HCVR" or " VH") and a heavy chain constant region (comprised of domains CHI, CH2 and CH3). Each light chain is comprised of a light chain variable region ("LCVR or "VL") and a light chain constant region (CL). An
"antibody" includes bispecific, multispecific, murine, chimeric, humanized and human antibodies. Tn some embodiments, an antibody can be modified or engineered, e.g., chimeric antibodies, humanized antibodies, multiparatopic antibodies e.g., biparatopic antibodies), and/or multispecific antibodies (e.g., bispecific antibodies). Tn some embodiments, the antibody disclosed herein is a CD8 antibody, e.g., an 0KT8 antibody. [0074] The term “scFv” as disclosed herein, refers to a fusion protein comprising a variable region of an antibody light chain and a variable region of an antibody heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. An scFv may have the VL and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH, or may comprise VH-linker-VL.
[0075] The terms "variable region" or "variable domain" of an antibody refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen.
[0076] The term "antibody heavy chain," (VH) refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs. [0077] The term "antibody light chain," (VL) refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (K) and lambda ( ) light chains refer to the two major antibody light chain isotypes.
[0078] The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs). (See, e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007).) A single VH or VL domain may be sufficient to confer antigen-binding specificity. The VH and VL regions can be further subdivided into regions of hypervariability, termed hypervariable region (HVR) or complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). In some embodiments, each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy -terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. In some embodiments, these CDRs can be
distributed between their appropriate framework regions. In certain embodiments of the invention, the FRs of the antibody (or antigen binding fragment thereof) may be identical to the human germline sequences or may be naturally or artificially modified.
[0079] The terms "hypervariable region", "HVR", "complementarity determining region" or "CDR," as used herein, refers to sequences of amino acids within antibody variable regions which are essential for antigen specificity and binding affinity. The precise amino acid sequence boundaries of a given CDR can be determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD ("Kabat" numbering scheme), Al-Lazikani et al., (1997) JMB 273, 927-948 ("Chothia" numbering scheme) and ImMunoGenTics (IMGT) numbering (Lefranc, M.-P., The Immunologist, 7, 132-136 (1999); Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003) ("IMGT" numbering scheme). Generally, antibodies comprise six HVRs: three in the VH (HCDR1, HCDR2, HCDR3), and three in the VL (LCDR1, LCDR2, LCDR3).
[0080] The terms “chimeric antigen receptor” or “CAR” as used herein refers to an engineered cell-surface receptor comprising, at least an extracellular binding domain, a transmembrane domain, and an intracellular signaling domain (alternatively referred to as a "cytoplasmic signaling domain") comprising a functional signaling domain derived from a stimulatory molecule and one or more costimulatory molecules. The chimeric antigen receptors of the present disclosure are intended primarily for use with lymphocyte such as T cells and natural killer (NK) cells. In some embodiments, the binding domain comprises a single-chain variable fragment antibody fragment comprising the VH and VL domains of a CD8 antibody. In some embodiments, the CAR described herein is an anti-CD8 CAR (sometimes referred to as a CD8 CAR), e.g., a CAR wherein the binding domain binds to CD8. In some embodiments, the anti-CD8 CAR comprises an scFv comprising the VH and VL domains of a OKT8 antibody.
[0081] The extracellular binding domain of a CAR of the disclosure may exist in a variety of forms where the antigen binding domain is expressed as part of a contiguous polypeptide chain including, for example, a single domain antibody fragment (sdAb), a single chain antibody (scFv), a humanized antibody, or a bispecific antibody.
[0082] The term “CD8” as used herein refers to the Cluster of Differentiation 8 protein, a transmembrane glycoprotein that serves as a co-receptor for the T-cell receptor (TCR).
[0083] The term "effective amount" as used herein refers to the minimum amount required to effect a measurable improvement An effective amount disclosed herein may vary according to factors such as the disease state, age, sex, and weight of the patient. An effective amount is also one in which any toxic or detrimental effects of a treatment are outweighed by its therapeutically beneficial effects. For therapeutic use, beneficial or desired results include clinical results such as decreasing one or more symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, enhancing effect of another medication such as via targeting, delaying the progression of the disease, and/or prolonging survival. In the case of cancer or a tumor, an effective amount of a therapeutic agent may have the effect in reducing the number of cancer cells, reducing the tumor size, inhibiting cancer cell infiltration into peripheral organs, inhibiting tumor metastasis, inhibiting tumor growth, and/or relieving to some extent one or more of the symptoms associated with the disorder.
[0084] The term “express” as used herein refers to the causing transcription and/or translation of a particular nucleotide sequence into an RNA or a protein. Proteins may be expressed and remain intracellular, become a component of the cell surface membrane, or be secreted into extracellular matrix or medium.
[0085] The term “engineered” used herein refers to any composition that has been intentionally changed by human intervention from its natural state
[0086] An “engineered nucleic acid” as used herein refers to a nucleic acid whose sequence has been intentionally changed by human intervention to have a modification, substitution, addition, or deletion of one or more nucleotides.
[0087] The term “engineered immune cell” as used herein refers to an immune cell that has been genetically modified as compared to a naturally occurring immune cell. For example, an engineered T cell produced according to the present methods carries a nucleic acid comprising a nucleotide sequence that does not naturally occur in the T cell from which it was derived.
[0088] In certain embodiments, the engineered immune cell is an engineered T cell, an engineered natural killer (NK) cell, an engineered NK/T cell, an engineered monocyte, an engineered macrophage, or an engineered dendritic cell.
[0089] In certain embodiments, an “immune activating receptor” as used herein refers to a receptor that activates an immune response upon binding a cancer cell ligand. In some
embodiments, the immune activating receptor comprises a molecule that, upon binding (ligation) to a ligand (e g., peptide or antigen) expressed on a cancer cell, is capable of activating an immune response. In one embodiment, the immune activating receptor is a CAR, methods for designing and manipulating a CAR are known in the art.
[0090] The term "fratricide" as used herein refers to when one cell in the population kills a second cell in the population wherein the first cell and the second cell are of the same type, e.g., both cells are T cells.
[0091] The term "reducing and/or preventing fratricide" as used herein relates to the decrease in the occurrence of fratricide in a population of cells as compared to a suitable control population of cells (typically, but not necessarily, a population of identical cells with normal expression of the target of a CAR).
[0092] The term “sequence identity” as used herein refers to the subunit sequence identity between two polymeric molecules, for example, between two polynucleotide or polypeptide sequences. An analysis of sequence identity begins by aligning two sequences. Identical sequences (100% sequence identity) have the same nucleotide or amino acid at each position of the alignment. “Percent sequence identity” is determined by comparing the number of positions that are identical to the total number of subunits in the sequence alignment. Percent sequence identity can be determined over a fraction of the sequences or over the whole of the sequences. Percent sequence identity can be determined using a sequence comparison algorithm. Test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then aligns the sequences and calculates the percent sequence identity based on the designated program parameters. [0093] Sequence identity is typically measured using sequence analysis software. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat’l. Acad. Sei. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFAST A in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., Current Protocols in Molecular Biology . Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. In an exemplary approach to determining the degree of identity, a
BLAST program may be used, with a probability score between e-3 and e-100 indicating a closely related sequence One example of algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (publicly accessible through the National Institutes of Health NCBI internet server). Typically, default program parameters can be used to perform the sequence comparison, although customized parameters can also be used. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Nail. Acad. Sci. USA 89: 10915 (1989)). In some embodiments, the sequence identities are determined by Needleman-Wunsch alignment of two sequences with Gap Costs set to Existence: 11 Extension: 1 where percent identity is calculated by dividing the number of identities by the length of the alignment. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. [0094] The term “intracellular signaling domain,” as used herein, refers to an intracellular (e.g., cytoplasmic) portion of a molecule sufficient to transduce an effector function signal. In embodiments, the intracellular signal domain transduces the effector function signal and directs the cell to perform a specialized function.
[0095] The term “isolated” as used herein, refers to altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment, e g., a host cell. In some instances, a polynucleotide or a polypeptide is non-naturally occurring (e.g., recombinant, synthetic, etc.).
[0096] The term “nucleotide sequence” in reference to a nucleic acid, refer to a contiguous series of nucleotides, e.g., a polynucleotide that are joined by covalent linkages, such as phosphorus linkages (e.g., phosphodi ester, alkyl and aryl-phosphonate, phosphorothioate, phosphotriester bonds), and/or non-phosphorus linkages (e.g., peptide and/or sulfamate bonds).
[0097] The term “nucleic acid” includes, for example, genomic DNA, cDNA, RNA, and DNA-RNA hybrid molecules. Nucleic acid molecules can be naturally occurring,
recombinant, or synthetic. In addition, nucleic acid molecules can be single-stranded, double-stranded or triple-stranded. In some embodiments, nucleic acid molecules can be modified. In the case of a double-stranded polymer, “nucleic acid” can refer to either or both strands of the molecule. In certain embodiments, the nucleotide sequence encoding, e g., a target-binding molecule linked to a localizing domain is a heterologous sequence (e.g., a gene that is of a different species or cell type origin).
[0098] The terms “nucleotide” and “nucleotide monomer” refer to naturally occurring ribonucleotide or deoxyribonucleotide monomers, as well as non-naturally occurring derivatives and analogs thereof. Accordingly, nucleotides can include, for example, nucleotides comprising naturally occurring bases (e g., adenosine, thymidine, guanosine, cytidine, uridine, inosine, deoxyadenosine, deoxy thymidine, deoxyguanosine, or deoxy cytidine) and nucleotides comprising modified bases.
10099| The terms “nucleic acid encoding” and “nucleotide sequence encoding” a polypeptide or an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence and may also include introns that are excised to yield a spliced nucleotide sequence to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s)
[00100] The term “polynucleotide” as used herein refers to a chain of nucleotides.
[00101] The terms “protein expression blockers” or “PEBL” as used herein refer to a polypeptide construct containing a target-binding molecule that binds a target (e g., CD8) linked to a localizing domain (e g., an intracellular retention domain) that directs the polypeptide to specific cellular compartments, such as the Golgi, ER, or proteasome, depending on the application.
[00102] The term “host cell” as used herein refers to a cell which can support the replication or expression of an expression vector. Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells, such as yeast, insect cells, amphibian cells, or mammalian cells.
[00103] The term “vector” as used herein refers to a composition which comprises a polynucleotide which can be used to deliver the polynucleotide to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. In some embodiments, the term is construed to further include non-
plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, a polylysine compound, liposome, and the like. Examples of viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
[00104] The term “expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viral vectors (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
100105| The term “lentivirus” refers to a genus of the Retroviridae family that may be used as a gene delivery vector as described herein. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell. HIV, STV, and FTV are all examples of lentiviruses.
[00106] The term “lentiviral vector” refers to a vector derived from at least a portion of a lentivirus genome, including especially a self-inactivating lentiviral vector as provided in Milone et al., Mol. Ther. 17(8): 1453-1464 (2009). Other examples of lentivirus vectors that may be used in the clinic, include but are not limited to, e g., the LENTIVECTOR® gene delivery technology from Oxford BioMedica, the LENTIMAX® vector system from Lentigen, and the like Nonclinical types of lentiviral vectors are also available and would be known to one skilled in the art.
[00107] The term “z>? vivo” as used herein refers to inside the body of an organism. The terms “ex vivo” or “in vitro” as used herein refer to outside the body of the organism.
[00108] The term “subject”, as used herein, refers to any animal, e.g., a mammal or marsupial. Subjects of the present invention include but are not limited to humans, nonhuman primates (e.g., rhesus or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, and fowl of any kind. Tn certain embodiments, the subject is a human. A “subject in need thereof’ refers to a subject (e.g., patient) who has, or is at risk for developing, a disease or condition that can be treated (e.g., improved, ameliorated, prevented) with, e g., engineered T cells.
[00109] The term “cancer” as referred herein refers to a disease characterized by the uncontrolled growth of aberrant cells Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described herein and include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma leukemia, lung cancer, and the like. As used herein, the term “cancer” includes premalignant as well as malignant cancers. The cancer described herein can be a stage I cancer, a stage II cancer, a stage III cancer, or a stage IV cancer.
[00110] The term “T cell” and its grammatical equivalents as used herein can refer to a T cell from any origin. For example, a T cell can be a primary T cell, e g., an autologous T cell, an allogenic T cell, a cell line, etc. The T cell can also be human or non-human. |001111 The terms “T cell activation” or “T cell triggering” and their grammatical equivalents as used herein can refer to the state of a T cell that has been sufficiently stimulated to induce detectable cellular proliferation, cytokine production and/or detectable effector function. In some cases, “full T cell activation” can be similar to triggering T cell cytotoxicity. T cell activation can be measured using various assays known in the art. The assays can be an ELISA to measure cytokine secretion, an ELISPOT, flow cytometry assays to measure intracellular cytokine expression, flow cytometry assays to measure proliferation, and cytotoxicity assays (51Cr release assay) to determine target cell elimination. The assays typically use controls (non-engineered cells) to compare to engineered cells (CAR T) to determine relative activation of an engineered cell compared to a control. Additionally, the assays can compare engineered cells incubated or put in contact with a target cell not expressing the target antigen. For example, the comparison can be an anti-CD8 CAR T cell incubated with a target cell that does not express CD8.
[00112] As used herein, the terms “treat,” “treating,” or “treatment,” refer to counteracting a medical condition (e.g., a condition related to a T cell malignancy) to the extent that the medical condition is improved.
[00113] Provided herein are compositions of matter and methods of use for the treatment of a disease such as cancer using cells expressing CD8 chimeric antigen receptors (CAR), e g., anti-CD8 CAR, optionally in combination with a second agent that downregulates CD8 expression on the effector T cells. A description of example embodiments of the disclosure follows.
[00114] In one aspect, the present disclosure provides, novel nucleic acid molecules encoding chimeric antigen receptors (CARs) comprising an antibody or antibody fragment that specifically binds to CD8 (e.g., anti-CD8 CAR), a transmembrane domain, and a signaling domain. Tn one aspect, the present disclosure provides, novel nucleic acid molecules encoding CD8 blocking polypeptide comprising a single chain variable fragment (scFv) linked to an intracellular localizing domain. In one aspect, the disclosure provides a cell (e.g., an immune effector cell, e g., T cell or NK cell) engineered to express a CAR, e.g., an anti-CD8 CAR, wherein the CAR-T cell ("CAR-T") or CA NK (“CAR- NK”) cell exhibits an antitumor property. In one aspect, a cell is transformed with the CAR, e.g., anti-CD8 CAR and the CAR, e.g., anti-CD8 CAR is expressed on the cell surface. In one aspect, the disclosure provides chimeric antigen receptors (CARs) comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain (e.g., an anti-CD8 CAR). In one aspect, the disclosure provides a polypeptide construct containing a target-binding molecule that binds a target (e g., CD8) to be removed or neutralized. In one aspect, the disclosure provides a method to treat a disease, e g., cancer in a subject in need thereof by administering a composition comprising cells expressing an anti-CD8 CAR, e.g., anti-CD8 CAR, optionally in combination with a second agent that downregulates CD8 expression on the effector T cells.
[00115] As described herein, the anti-CD8 CAR induces T cells to exert specific cytotoxicity against T cell malignancies. Further, T cell cytotoxicity was shown to be markedly increased when anti-CD8 CAR was used in combination with downregulation of CD8 expression on the effector T cells. As demonstrated herein, downregulation (e.g., elimination, reduction, and/or relocalization) of CD8 prevented the fratricidal effect exerted by the corresponding anti-CD8 CAR, allowing greater T cell recovery after CAR expression as compared to cells that retained the target antigen (e g., CD8), and a more effective cytotoxicity against T leukemia/lymphoma cells.
[00116] In one aspect, the present disclosure provides, novel nucleic acid molecules encoding chimeric antigen receptors (CARs) comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain (e.g., anti-CD8 CAR). In one aspect, the present disclosure provides, novel nucleic acid molecules encoding CD8 blocking polypeptide comprising an antibody or antibody fragment that specifically binds to CD8 linked to an intracellular localizing domain (e.g., CD8-PEBL).
[00117] CD8 is a type I transmembrane glycoprotein which is expressed in a proportion of T-cell ALL cases as well as in mature T cell and NK cell neoplasms. CD8 is expressed on the surface of cytotoxic T cells, but can also be found on natural killer cells, cortical thymocytes, and dendritic cells. CD8 is an antigenic determinant detectable on some acute lymphocytic leukemia such as T cell lymphoblastic lymphoma and mature T cell and NK cell neoplasms such as hypo-pigmented mycosis fungoides. CD8 can be expressed as a heterodimer consisting of a CD8a and a CD8p chain but can also be expressed as a CD8a homodimer. CD8 binds to the class I human leukocyte antigen (HLA) on the target. CD8 is involved in T cell activation and function. CD8 stabilizes the binding of the T-cell receptor (TCR) to the cognate peptide-loaded HLA through binding to a separate site on the HLA, a function that is especially important for low affinity TCRs. CD8 recruits the protein tyrosine kinase LCK to the CD3 complex following target binding to TCR. The CD8a cytoplasmic domain contains a binding site for LCK, which phosphorylate immunoreceptor tyrosine-based activation motifs (ITAMs) on CD3, transducing the activation signal through a signaling cascade leading to T cell effector functions. T cells lacking CD8a or its cytoplasmic domain were unable to exert effector functions following cross-linking with anti-CD3 and anti-CD8 antibody, or in the presence of target cells expressing the cognate HLA.
[00118] In some embodiments, the CD8 binding portion of the CAR or the CD8 blocking polypeptide (CD8-binding domain) is a scFv antibody fragment. In some embodiments, the affinity of the CD8-binding domain for CD8 is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 100%, at least 120%, at least 150%, at least 200%, at least 300%, at least 400%, or at least 500% of the binding affinity for CD8 of the antibody that it is derived from.
[00119] In some embodiments, the antibody that binds CD8 is a single-chain variable fragment derived from an antibody (“scFv”). For a review of scFv, see Pluckthun (1994) The Pharmacology Of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds. Springer-Verlag, New York, pp. 269-315. See also, PCT Publication No. WO 88/01649 and U.S. Pat. Nos. 4,946,778 and 5,260,203. As would be appreciated by those of skill in the art, various suitable linkers can be designed and tested for optimal function, as provided in the art, and as disclosed herein.
[00120] Anti-CD8 antibody can be a scFv or a single domain antibody. In some embodiments, the anti-CD8 antibody is a CD8 antibody selected from the group consisting
of 0KT8, LS-B3914-BCD1, RFT8, FAB1509A, 4B11, EPR21769, CAL66, CAL67, EPR20305, EPR22483-288, CAL38, EPR22331-81, EPR22331-54, OX-8, SP239, C8/144B, EP1150Y, BLR044F, EPR26538-16, rC8/468, YTS169.4, SP16, EP10640(2), EP21769, ab4055, ab288669, EPR223341 -54, EPR22331-81, ab25478, YTC182.20, CA9.ID3, CAL38, IBL-3/25, YTS105.18, ab90965, ab20133,ab225491, RPA-T8, 53-6.7, 4SM15, 5H10, SP16, AA51-150, ABIN94235, or ABIN94233. In some embodiments, the anti-CD8 antibody is 0KT8 In some embodiments, the anti-CD8 antibody is humanized 0KT8. In some embodiments, the anti-CD8 antibody sequence is codon optimized. In some embodiments, the anti-CD8 antibody sequence is changed, e g., to facilitate cloning. In some embodiments, the single domain antibody can be a single variable domain on a heavy chain (VEIH) antibody, for example caplacizumab, ozoralizumab, and vobarilizumab.
|00121| In some embodiments, the CD8 binding domain of the CAR or the CD8 blocking polypeptide is an anti-CD8 scFv. In some embodiments, the CD8 binding domain of the CAR or the CD8 blocking polypeptide is a murine scFv antibody fragment. In some embodiments, the CD8 binding domain of the CAR or the CD8 blocking polypeptide is a scFv antibody fragment that is humanized compared to the murine sequence of the scFv from which it is derived. In some embodiments, the CD8 binding domain of the CAR or the CD8 blocking polypeptide is a human scFv antibody fragment. In some embodiments, the scFv comprises an amino acid sequence as set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv comprises an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv comprises an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 24 or 25. In some embodiments, the scFv is encoded by a polynucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 17, 52, 71, 72, or 101. In some embodiments, the scFv is encoded by a codon optimized polynucleotide comprising a nucleic acid sequence derived from SEQ ID NO: 17, 52, 71, 72, or 101. In some embodiments, the scFv is encoded by a modified polynucleotide, e.g., for cloning efficiency comprising a nucleic acid sequence derived from SEQ ID NO: 17, 52, 71 , 72, or 101. In some embodiments, the scFv is encoded by a polynucleotide comprising a nucleic acid sequence having at least 50%, 60%, 70%, 80%, 90% or 95% sequence identity to SEQ ID NO: 17, 52, 71, 72, or 101.
[00122] In some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) having an amino acid sequence as set forth in SEQ ID NO: 13. The CD8 binding domain of the CAR can further comprise a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) of any anti-CD8 light chain binding domain having an amino acid sequence as set forth in SEQ ID NO: 14 In some embodiments, the heavy chain variable region comprises an amino acid sequence with 95- 99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 and the light chain variable region comprises an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
[00123] In certain embodiments, the anti-CD8 scFv comprises a variable heavy chain (heavy chain variable region or VH) and a variable light chain (light chain variable region or VL) having an amino acid sequence that each have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NO: 13 and 14, respectively. The heavy chain variable region can comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH sequence of SEQ ID NO: 13. The light chain variable region can comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VL sequence of SEQ ID NO: 14. In some instances, the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 13. In certain instances, the heavy chain variable
region comprise 10 or fewer amino acid (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) substitutions in the sequence set forth in SEQ ID NO: 13. In some instances, the light chain variable region comprise at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 14. In certain instances, the light chain variable region comprise 10 or fewer amino acid (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) substitutions in the sequence set forth in SEQ ID NO: 14. Table 1 discloses the amino acid sequences of the VH and VL region of an exemplary anti-CD8 scFv. In some instances, the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the framework region sequence as compared to the amino acid sequence set forth in SEQ ID NO: 13. In some instances, the light chain variable region comprise at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the framework region sequence as compared to the amino acid sequence set forth in SEQ ID NO: 14.
[00124] In some embodiments, a nucleic acid sequence encoding a VH comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences as set forth in SEQ ID Nos: 15, 16, 18, 19, and 94. In other embodiments, a nucleic acid sequence encoding a VL comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences as set forth in SEQ ID Nos: 20-23. Table 2 discloses the nucleic acid sequences of the VH and VL region of an exemplary anti-CD8 scFv.
[00125] In certain embodiments, the anti-CD8 scFv comprises a variable heavy chain (heavy chain variable region or VH) and a variable light chain (light chain variable region or VL) having a sequence that each have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NO: 13 and 14, respectively. The heavy chain variable region can comprise at least 90%
sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH sequence of SEQ ID NO: 13. The light chain variable region can comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VL sequence of SEQ ID NO: 14.
100126] In some instances, the heavy chain variable region comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 13. In certain instances, the heavy chain variable region comprises 10 or fewer amino acid (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) substitutions in the sequence set forth in SEQ ID NO: 13. In some cases, the light chain variable region comprises at least one (e g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or more) amino acid substitution in the sequence set forth in SEQ ID NO: 14. In certain cases, the heavy chain variable region comprises 10 or fewer amino acid (e.g., 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10) substitutions in the sequence set forth in SEQ ID NO: 14.
[00127] In some embodiments, a nucleic acid sequence encoding a VH comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences as set forth in SEQ ID Nos:15,16, 18, 19 and 94. In other embodiments, a nucleic acid sequence encoding a VL comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to any of the nucleic acid sequences as set forth in SEQ ID Nos: 20-23.
[00128] In some embodiments, the scFv of the present disclosure comprises a variable heavy chain sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94%
sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to a variable heavy chain sequence of an anti-CD8 antibody. In some embodiments, the scFv of the present disclosure comprises a variable light chain sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to a variable light chain sequence of an anti-CD8 antibody. For instance, the anti- CD8 antibody can be any such recognized by one skilled in the art.
Table 1. Amino acid sequences of an exemplary anti-CD8 scFv and the VH and VL regions of the exemplary anti-CD8 scFv
Table 2. Nucleic acid sequences of an exemplary anti-CD8 scFv and the VH regions and VL regions of an exemplary anti-CD8 scFv
[00129] Tn some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3). In some embodiments, the HC CDR1, HC CDR2, HC CDR3, LC CDR1 , LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID Nos: 1-6, respectively; or (ii) SEQ ID Nos: 7-12 respectively. In some
embodiments, the CD8 binding domain comprises a HCDR1, HCDR2, HCDR3, LCDRl, LCDR2, and LCDR3 comprising amino acid sequences as set forth in Table 3 or Table 4.
Table 3. Amino acid sequences of VHCDR regions and VLCDR regions of anti-CD8 scFvs according to the Rabat numbering scheme
Table 4. Amino acid sequences of VHCDR regions and VLCDR regions of anti-CD8 scFvs according to the Chothia numbering scheme
[00130] In certain embodiments, the CD8 binding domain described herein (includes:
(1) one, two, or three heavy chain (HC) CDRs chosen from one of the following: (i) a HC CDR1 of SEQ ID NO: 1, HC CDR2 of SEQ ID NO: 2 and HC CDR3 of SEQ ID NO: 3; or (ii) a HC CDR1 of SEQ ID NO: 7, HC CDR2 of SEQ ID NO: 8 and HC CDR3 of SEQ ID NO: 9; and/or (2) one, two, or three Light chain (LC) CDRs chosen from one of the following: (i) a LC CDR1 of SEQ ID NO: 4, LC CDR2 of SEQ ID NO: 5 and LC CDR3 of SEQ ID NO: 6; or (ii) a LC CDR1 of SEQ ID NO: 10, LC CDR2 of SEQ ID NO: 11 and LC CDR3 of SEQ ID NO: 12.
[00131] In certain embodiments, the CD8 binding domain molecule described herein comprises (i) a heavy chain comprising a HC CDR1 of SEQ ID NO: 1 , HC CDR2 of SEQ ID NO: 2 and HC CDR3 of SEQ ID NO: 3, and (ii) a light chain comprising a LC CDR1 of SEQ ID NO: 4, LC CDR2 of SEQ ID NO: 5 and LC CDR3 of SEQ ID NO: 6; or (i) a heavy chain comprising a HC CDR1 of SEQ ID NO: 7, HC CDR2 of SEQ ID NO: 8 and HC CDR3 of SEQ ID NO: 9; and (ii) a light chain comprising a LC CDR1 of SEQ ID NO: 10, LC CDR2 of SEQ ID NO: 11 and LC CDR3 of SEQ ID NO: 12
[00132] In some embodiments, the anti-CD8 binding domain includes a Gly-Ser linker, e g., a linker having an amino acid sequence as set forth in SEQ ID NO: 29, e g , GSTSGGGSGGGSGGGGSS. In some embodiments, the linker comprises a nucleotide sequence as set forth in any of the SEQ ID Nos: 30-33. The light chain variable region and heavy chain variable region of a scFv can be, e.g., in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.
[00133] In one aspect, the disclosure provides, nucleic acid molecules encoding CARs comprising an antibody or antibody fragment that specifically binds to CD8, a transmembrane domain, and a signaling domain (e.g., anti-CD8 CAR). In one embodiment, the disclosure provides an anti-CD8 CAR comprising a CD8 targeting domain comprising a single chain variable fragment (scFv) (CD8 binding domain), a transmembrane domain, and a signaling domain (anti-CD8 CAR).
[00134] In some embodiments, the CAR molecule, e.g., the recombinant CAR molecule described herein, e.g., an anti-CD8 CAR described herein comprises a CD8 binding domain comprising: (1) one, two, or three heavy chain (HC) CDRs chosen from one of the following: (i) a HC CDR1 of SEQ ID NO: 1, HC CDR2 of SEQ ID NO: 2 and HC CDR3 of SEQ ID NO: 3; or (ii) a HC CDR1 of SEQ ID NO: 7, HC CDR2 of SEQ ID NO: 8 and HC CDR3 of SEQ ID NO: 9; and/or (2) one, two, or three Light chain (LC) CDRs chosen from one of the following: (i) a LC CDR1 of SEQ ID NO: 4, LC CDR2 of SEQ ID NO: 5 and LC CDR3 of SEQ ID NO: 6; or (ii) a LC CDR1 of SEQ ID NO: 10, LC CDR2 of SEQ ID NO: 11 and LC CDR3 of SEQ ID NO: 12.
[00135] Tn some embodiments, the anti-CD8 CAR further comprises a hinge and transmembrane sequence. In some embodiments, the intracellular signaling domain can comprise a signaling domain and one or more costimulatory domains. The hinge and transmembrane sequences suitable for use in the present disclosure are known in the art, and provided in, e.g., publication WO2016/126213, incorporated by reference in its
entirety. In some embodiments, the recombinant CAR molecule comprises a hinge and a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154. Tn some embodiments, the hinge and the transmembrane domain comprises an amino acid sequence as set forth in SEQ ID NO: 37. In some embodiments, the hinge and the transmembrane domain comprises an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 20, 10 or 5 modifications (e.g., substitutions) of an amino acid sequence of SEQ ID NO: 37, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 37. In some embodiments, the hinge and the transmembrane domain comprises a nucleic acid sequence as set forth in SEQ ID NO: 38. In some embodiments, the hinge and transmembrane domain of the anti-CD8 CAR can include a signaling domain (e.g., transmembrane domain) from CD8p, 4-1BB, CD28, CD34, CD4, FcsRIy, CD 16, 0X40, CD3L CD3e, CD3y, CD35, TCRa, CD32, CD64, VEGFR2, FAS, FGFR2B, or another transmembrane protein.
[00136] Tn some embodiments, the recombinant CAR molecule, e g , the anti-CD8 CAR molecule further comprises one or more sequences encoding an intracellular signaling domain, e g., an intracellular signaling domain or co-stimulatory domain as described herein. In some embodiments, the intracellular signaling domain comprises a functional signaling domain of a protein selected from the group consisting of 0X40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD1 la/CD18) and 4-1BB (CD137). In some embodiments, the intracellular signaling domain comprises an amino acid sequence of SEQ ID NO: 39. In some embodiments, the intracellular signaling domain comprises an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 20, 10 or 5 modifications (e.g., substitutions) of an amino acid sequence of SEQ ID NO: 39, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 39. In some embodiments, the intracellular signaling domain comprises a nucleic acid sequence as set forth in SEQ ID NO: 40. In some embodiments, the intracellular signaling domain of 4- IBB can be replaced by another intracellular signaling domain from a costimulatory molecule such as CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1 , or CD2. In some embodiments, the intracellular signaling domain of the CAR can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least
98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the intracellular signaling domain of CD28, 0X40, TCOS, CD27, GTTR, HVEM, TTM1 , LFA1, or CD2.
[00137] Tn some embodiments, the intracellular signaling domain of 4-1BB can also include another intracellular signaling domain (or a portion thereof) from a co- stimulatory molecule such as CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2. In some embodiments, the additional intracellular signaling domain can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the intracellular signaling domain of CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2. In other embodiments, the additional intracellular signaling domain comprises at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to one or more intracellular signaling domain fragment(s) of CD28, 0X40, ICOS, CD27, GITR, HVEM, TIM1, LFA1, or CD2.
[00138] In some embodiments, the recombinant CAR molecule e.g., the anti-CD8 CAR molecule further comprises a sequence encoding an intracellular signaling domain, e.g., an intracellular signaling domain described herein. In some embodiments, the intracellular signaling domain comprises a functional signaling domain of 4- IBB and/or a functional signaling domain of CD3 zeta. In some embodiments, the intracellular signaling domain comprises the sequence of SEQ ID NO: 39 and/or the sequence of SEQ ID NO: 41. In one embodiment, the intracellular signaling domain comprises an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 20, 10 or 5 modifications (e.g., substitutions) of an amino acid sequence of SEQ ID NO: 39 and/or an amino acid sequence of SEQ ID NO: 41 or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 39 and/or an amino acid sequence of SEQ TD NO: 41 . In one embodiment, the intracellular signaling domain comprises the sequence of SEQ ID NO: 39 and the sequence of SEQ ID NO: 41, wherein the sequences comprising the intracellular signaling domain are expressed in the same frame and as a single polypeptide
chain. In some embodiments, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO: 40 and/or the nucleic acid sequence of SEQ ID NO: 42.
[00139] In some instances, the intracellular signaling domain comprises an immunoreceptor tyrosine-based activation motif (IT AM) or a portion thereof, as long as it possesses the desired function. The intracellular signaling domain of the CAR can include a sequence having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to an IT AM. In certain embodiments, the intracellular signaling domain can have at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to FcsRIy, CD4, CD7, CD8, CD28, 0X40 or H2-Kb, as long as it possesses the desired function.
[00140] In some embodiments, the recombinant CAR molecule e g., the anti-CD8 CAR molecule further comprises a leader sequence, e g., a leader sequence described herein. In some embodiments, the leader sequence encodes a CD8a signal peptide. In some embodiments, the leader sequence comprises an amino acid sequence of SEQ ID NO: 26, or a sequence with 95- 99% identity to an amino acid sequence of SEQ ID NO: 26. In some embodiments, the leader sequence comprises a nucleic acid sequence as set forth in any of the SEQ ID NOs: 27-28. In some embodiments, the leader sequence is cleaved off of the mature CAR polypeptide. In some embodiments, the recombinant CAR molecule e g., the anti-CD8 CAR molecule also includes a VH-VL linker such as but not limited to a peptide linker having an amino acid sequence as set forth in SEQ ID NO: 29.
[00141] In some embodiments, the present disclosure relates to an engineered immune cell comprising a nucleic acid that comprises a nucleotide sequence encoding a CAR, comprising an antigen biding domain, e.g., a CD8 antigen binding domain and one or more intracellular signaling domains selected from 4- IBB and CD3(^. In some embodiments, the antigen binding domain specifically binds the alpha chain of Cluster of Differentiation 8 (CD8). The CAR of the present disclosure is sometimes referred to herein as “anti-CD8- 41BB-CD3^” (anti-CD8 CAR). An exemplary embodiment is depicted in FIG. 1. In some embodiments, the anti-CD8 CAR comprises an amino acid sequence as set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises an amino acid
sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 43 or 73. In some embodiments, the anti-CD8 CAR comprises a nucleic acid sequence as set forth in SEQ ID NO: 44. [00142] In some embodiments, an “engineered” immune cell includes an immune cell that has been genetically modified as compared to a naturally-occurring immune cell. In some embodiments, an engineered T cell produced according to the present methods carries a nucleic acid comprising a nucleotide sequence, e.g., a nucleic acid having a nucleotide sequence as set forth in SEQ ID NO: 44 that does not naturally occur in a T cell from which it was derived.
[00143] In some aspects, the disclosure provides an recombinant CAR molecule comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence of SEQ ID NO: 26, or having 95-99% identity thereof, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1 , a LC CDR2 and a LC CDR3 described herein, e g., an anti-CD8 binding domain described in Table 1, 3, or 4, or having a sequence as set forth in SEQ ID NO: 24 or 25, or a sequence with 95-99% identify thereof; a transmembrane and a hinge region, e.g., a transmembrane and a hinge region described herein, e.g., a transmembrane and a hinge region of SEQ ID NO: 37 or having 95-99% identity thereof; an intracellular signaling domain, e g., an intracellular signaling domain described herein. In one embodiment, the intracellular signaling domain comprises, a 4- IBB domain having a sequence of SEQ ID NO: 39, or having 95-99% identity thereof, and/or a primary signaling domain, e.g., a primary signaling domain described herein, e.g., a CD3 zeta stimulatory domain having a sequence of SEQ ID NO: 41 or having 95-99% identity thereof. In some embodiments, the CAR molecule, e.g., the anti-CD8 CAR molecule described herein (e.g., a mature CAR molecule) does not comprise a leader sequence.
[00144] In one aspect, the disclosure provides a nucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 44, encoding an recombinant CAR molecule comprising a leader sequence, e g , a leader sequence described herein, e g., a CD8a signal peptide, e.g., a leader sequence of SEQ ID NO: 26, or having 95-99% identity thereof, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1, a LC CDR2 and a LC CDR3 described herein, e g., an anti-CD8 binding domain described in Table 1, 3, or 4 or SEQ ID NO: 24
or 25, or a sequence with 95-99% identify thereof; a transmembrane and a hinge region, e g., a transmembrane and a hinge region described herein, e.g., a transmembrane and a hinge region of SEQ ID NO: 37 or having 95-99% identity thereof; an intracellular signaling domain, e.g., an intracellular signaling domain described herein Tn some embodiments, the intracellular signaling domain comprises, a 4-1BB domain having a sequence of SEQ ID NO: 39, or having 95-99% identity thereof, and/or a primary signaling domain, e.g., a primary signaling domain described herein, e.g., a CD3 zeta stimulatory domain having a sequence of SEQ ID NO: 41 or having 95-99% identity thereof.
[00145] In one aspect, the disclosure provides an recombinant CAR molecule comprising a leader sequence, e.g., a leader sequence described herein, e g., a leader sequence encoded by a nucleotide having a nucleic acid sequence as set forth in any of the SEQ ID Nos: 27 or 28, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1, a LC CDR2 and a LC CDR3 described herein; e.g., an anti-CD8 binding domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in any of the SEQ ID NOs: 17, 52, 71, 72, or 101, an scFv linker comprising a nucleic acid sequence as set forth in any of the SEQ ID NO: 30-33, a transmembrane and a hinge region, e g , a transmembrane and a hinge region described herein, e.g., a transmembrane and a hinge region encoded by a nucleotide having a nucleic acid sequence as set forth in SEQ ID NO: 38; and an intracellular signaling domain, e g , an intracellular signaling domain described herein. In some embodiments, the intracellular signaling domain comprises, a 4- IBB domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 40 and/or a primary signaling domain, e.g., a primary signaling domain described herein, e.g., a CD3 zeta stimulatory domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in SEQ ID NO: 42. Tables 5 and 6 discloses the amino acid and nucleotide sequences of an exemplary anti-CD8 CAR and it various components. In some embodiments, the present disclosure provides a CAR comprising an amino acid sequence according to Table 5. In some embodiments, the CAR comprises components having amino acid sequences as disclosed in Table 5. In some embodiments, an recombinant nucleic acid of the present disclosure comprises a nucleotide sequence that encodes a CAR according to Table 6. In some embodiments, the nucleic acid comprises a nucleotide sequence that encodes a component of the CAR according to Table 6.
Table 5. Amino acid sequences of an exemplary anti-CD8 CAR and select components
Table 6. Nucleic acid sequences of an exemplary anti-CD8 CAR and select components
100146] As described herein, in some embodiments, T cell cytotoxic activity markedly increased when an anti-CD8 CAR was used in combination with downregulation of CD8 expression on the effector T cells. In some embodiments, downregulation (e.g., elimination, reduction, and/or relocalization) of CD8 prevented the fratricidal effect exerted by the corresponding anti-CD8 CAR, allowing greater T cell recovery after CAR expression as compared to cells that retained the target antigen (e g., CD8), and a more effective cytotoxicity against T leukemia/lymphoma cells. As those of skill in the art would appreciate, downregulation of CD8 expression on the effector T cells can be achieved according to a variety of known methods including, for example, “intrabodies” against CD8 (as described in WO2016/126213; e.g., PEBL technology), RNAi against CD8, or gene editing methods such as, e g., meganucleases, TALEN, CRISPR/Cas9, and zinc finger nucleases.
[00147] In certain aspects of the present disclosure, the CAR can bind to a molecule that is expressed on the surface of a cell including, but not limited to members of the CD1 family of glycoproteins, CD2, CD3, CD4, CD5, CD7, CD8, CD25, CD28, CD30, CD38, CD45, CD45RA, CD45RO, CD52, CD56, CD57, CD99, CD127, and CD137.
|00148| In one aspect, the present disclosure provides, novel nucleic acid molecules encoding CD8 blocking polypeptide comprising an antibody or antibody fragment that specifically binds to CD8 linked to an intracellular localizing domain (e.g., CD8-PEBL). [00149] Tn one aspect the present disclosure provides a nucleic acid that comprises a nucleotide sequence encoding a target-binding molecule linked to a localizing domain (or intracellular localizing domain, or localization domain) Tn the present disclosure, localizing domain, intracellular localizing domain or localization domain can be used interchangeably. The “target-binding molecule linked to a localizing domain (or intracellular localizing domain, or localization domain)” is sometimes referred to herein as a protein expression blocker (PEBL) or in some cases, an “intrabody”, as described in WO2016/126213, the teachings of which are incorporated by reference in their entirety. Exemplary embodiments of a PEBL are shown in FIG.7. In some embodiments, nucleotide sequence encodes a polypeptide, e.g., CD8 blocking polypeptide comprising a target binding domain, e.g., CD8 binding domain and an intracellular localizing domain. In some embodiments, the target binding domain is a scFv. In some embodiments, the intracellular
localizing domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localizing sequence. In the present disclosure, the retention sequence, retention signal or retention peptide can be used interchangeably. In some embodiments, the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered cell. In some embodiment, the target binding molecule further comprises a leader sequence, e.g., a leader sequence described herein. In some embodiments, the leader sequence encodes a CD8ct signal peptide. In some embodiments, the leader sequence comprises an amino acid sequence of SEQ ID NO: 26, or a sequence with 95- 99% identity to an amino acid sequence of SEQ ID NO: 26 In some embodiments, the leader sequence comprises a nucleic acid sequence as set forth in any of the SEQ ID NOs: 27-28. In some embodiments, the PEBL described herein is a CD8-PEBL, e.g., a CD8-PEBL comprising a CD8-binding molecule, linked to a localizing domain or an intracellular retention domain. In some embodiments, the CD8 binding molecule comprises a singlechain variable fragment antibody fragment comprising the VH and VL domains of a CD8 antibody, e.g., the VH and VL domains of a 0KT8 antibody.
[00150] As used herein, “linked” in the context of the protein expression blocker refers to a nucleic acid sequence encoding a target-binding domain directly in frame (e.g., without a linker) adjacent to one or more nucleic acid sequences encoding one or more localizing domains. Alternatively, the nucleic acid sequence encoding a target-binding domain may be connected to one or more nucleic acid sequences encoding one or more localizing domains through a linker sequence, e.g., as described in WO2016/126213. In some embodiments, the nucleic acid sequence encoding a target-binding domain may be connected to one or more nucleic acid sequences encoding a TM domain, e g., for KKXX ER retention. In some embodiments, the nucleic acid sequence encoding a target-binding domain is directly in frame (e.g., without a linker) adjacent to one or more nucleic acid sequences encoding a TM domain, e.g., for KKXX ER retention.
[00151] In some embodiments, the target-binding molecule is an antibody that binds CD8. In some embodiments, the target binding molecule is an antigen binding fragment. In some embodiments, the target-binding molecule is a scFv. In some embodiments, the target binding molecule comprises a target binding domain, e g , CD8 binding domain. In some embodiments, the target binding domain is a scFv. In some embodiments, the scFv comprises an amino acid sequence as set forth in SEQ ID NO: 24 or 25 or in Table 1. In some embodiments, the scFv comprises an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid
sequence as set forth in SEQ ID NO: 24 or 25 or in Table 1. In some embodiments, the scFv comprises an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 24 or 25 or in Table 1. In some embodiments, the scFv comprises a nucleic acid sequence as set forth in SEQ ID NO: 17, 52, 71 , 72, or 101 or in Table 2.
[00152] In some embodiments, the scFv comprises a VH sequence set forth in SEQ ID NO: 13 and a VL sequence set forth in SEQ ID NO: 14 or in Table 3. As described herein, in certain embodiments, the scFv comprises a VH and a VL having sequence that each have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NO: 13 and 14, respectively.
[00153] In some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3) having an amino acid sequence as set forth in SEQ ID NO: 13. The CD8 binding domain of the CAR can further comprise a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3) of any anti-CD8 light chain binding domain amino acid sequence as set forth in SEQ ID NO: 14. In some embodiments, the heavy chain variable region comprises an amino acid sequence with 95- 99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13 and the light chain variable region comprises an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
[00154] In some embodiments, the CD8 binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3). In some embodiments, the HC CDR1, HC CDR2, HC
CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: (i) SEQ ID NOs: 1 -6, respectively; or (ii) SEQ ID NOs: 7-12 respectively. Tn some embodiments, the CD8 binding domain comprises a HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 comprising amino acid sequences as set forth in Table 3 or Table 4. In some embodiments, the CD8 binding domain comprises a VH and a VL comprising amino acid sequences as set forth in Table 1. In some embodiments, the CD8 binding domain is encoded by a nucleic acid having a sequence as set forth in Table 2.
[00155] In some embodiments, the target binding molecule described herein, e.g., an anti-CD8 PEBL described herein comprises a CD8 binding domain comprising: (i) a heavy chain comprising a HC CDR1 of SEQ ID NO: 1, HC CDR2 of SEQ ID NO: 2 and HC CDR3 of SEQ ID NO: 3; and (ii) a light chain comprising a LC CDR1 of SEQ ID NO: 4, LC CDR2 of SEQ ID NO: 5 and LC CDR3 of SEQ ID NO: 6, or (i) a heavy chain comprising a HC CDR1 of SEQ ID NO: 7, HC CDR2 of SEQ ID NO: 8 and HC CDR3 of SEQ ID NO: 9; and (ii) a light chain comprising a LC CDR1 of SEQ ID NO: 10, LC CDR2 of SEQ ID NO: 11 and LC CDR3 of SEQ ID NO: 12.
[00156] Tn some embodiments, the nucleic acid sequence of any of SEQ ID NOs: 15, 16, 18, 19, and 94 encoding an immunoglobulin heavy chain variable region of an anti-CD8 scFv and the nucleic acid sequence of any of SEQ ID NOs: 20-23 encoding an immunoglobulin light chain variable region of an anti-CD8 scFv is used to produce an anti-CD8 protein expression blocker.
[00157] In some embodiments, the anti-CD8 binding domain further comprises a Gly- Ser linker, e.g., a linker having an amino acid sequence as set forth in SEQ ID NO: 29, e g., GSTSGGGSGGGSGGGGSS. In some embodiments, the linker comprises a nucleotide sequence as set forth in any of the SEQ ID NOs: 30-33. The light chain variable region and heavy chain variable region of a scFv can be, e.g., in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.
[00158] In some embodiments, the target binding molecule comprises at least one, at least two, at least three, at least four, or at least five target binding domains. In some embodiments, the target binding molecule comprises one target binding domain, e g., a CD8 binding domain. In some embodiments, the target binding molecule comprises a first target binding domain, e.g., a first CD8 binding domain and a second target binding domain, e g., a second CD8 binding domain. In some embodiments, the first target binding domain and the second target binding domain are identical. In some embodiments, the first
target binding domain and the second target binding domain are different. In some embodiments, the first target binding domain and the second target binding domain are connected with a linker, e.g., a peptide linker. In some embodiments, the linker comprises an amino acid sequence as set forth in SEQ ID NO: 51 or 54. In some embodiments, the linker is encoded by a nucleic acid comprising a sequence as set forth in any of the SEQ ID NOs: 53, 55, or 93.
[00159] In some embodiments, the antibody or the antigen binding fragment that binds CD8 in the context of the CAR, as described herein, can be different from the antibody or the antigen binding fragment that binds CD8 in the context of the target-binding molecule (the PEBL). In some embodiments, the antibody or the antigen binding fragment that binds CD8 in the context of the CAR, as described herein, can be the same as the antibody or the antigen binding fragment that binds CD8 in the context of the target-binding molecule (the PEBL).
[00160] In some embodiments, the localizing domain of the PEBL comprises an ER or Golgi retention sequence; a proteosome localizing sequence; a transmembrane domain sequence derived from CD8a, CD8(3, 4-1BB, CD28, CD34, CD4, FceRFy, CD16, 0X40, CD3 , CD3s, CD3y, CD35, TCRa, CD32, CD64, VEGFR2, FAS, or FGFR2B. In some embodiments the localization domain comprises a CD8 hinge and a CD8 transmembrane domain, e g., a CD8 hinge and a CD8 transmembrane domain comprising an amino acid sequence as set forth in SEQ ID NO: 34. In some embodiments, the transmembrane domain comprises a sequence of an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 34, or a sequence with 95-99 %identity to an amino acid sequence of SEQ ID NO: 34. In some embodiments a PEBL can downregulate or reduce surface expression of its target. In some embodiments, a PEBL further comprises a signal peptide, e g., a signal peptide comprising a sequence as set forth in SEQ ID NO: 26 or having 95-99% identity thereof. In some embodiments, a PEBL further comprises a transmembrane domain. In some embodiments the transmembrane domain contributes to intracellular localization.
[00161] In some embodiments, the localizing domain further comprises one or more of ER retention peptide AEKDEL (SEQ ID NO: 56), ER retention peptide (SEQ ID NO: 58), Localization domain KDEL tethered to scFv with myc (“myc KDEL”) (SEQ ID NO: 61), Localization domain “mb DEKKMP” (SEQ ID NO: 63). Table 7 provides the amino acid
and nucleic acid sequences of some exemplary ER retention peptides and localization domain components.
Table 7: Amino acid and nucleic acid sequences of exemplary ER retention peptides and localization domain components
[00162] The localizing domain can direct the PEBL to a specific cellular compartment, such as the Golgi or endoplasmic reticulum, the proteasome, or the cell membrane, depending on the application. In some embodiments, the ER or Golgi retention sequence comprises the amino acid sequence selected from KDEL (SEQ ID NO: 64), YQRL (SEQ ID NO: 65), KKXX where X is any amino acid (SEQ ID No: 66), or KXD/E (such as KXD or KXE) where X is any amino acid (SEQ IN No: 67). In some embodiments, the proteasome localizing sequence can comprise a PEST (SEQ ID NO: 68) motif.
[00163] In some embodiments, proteasome localization is achieved by linking the scFv sequence to a tripartite motif containing 21 (TRIM21) targeting domain sequence and coexpressing the sequence encoding the human TRIM21 E3 ubiquitin ligase protein.
TRIM21 binds with high affinity to the Fc domains of antibodies and can recruit the ubiquitin-proteosome complex to degrade molecules (e g., proteins and peptides) bound to the antibodies. The TRIM21 targeting domain sequence encodes amino acid sequences selected from the group of human immunoglobulin G (TgG) constant regions (Fc) genes such as IgGl, IgG2, or IgG4 and is used to form a fusion protein comprising scFv and Fc domains. In this embodiment, the exogenously expressed TRIM21 protein binds the scFv- Fc fusion protein bound to the target protein (e g , CD8) and directs the complex to the proteasome for degradation.
[00164] Details of the amino acid sequence of the human TRIM21 E3 ligase protein can be found, for example, in NCBI Protein database under NCBI Ref. Seq. No. NP 003132.2. Details of the nucleic acid sequence encoding the human TR1M21 E3 ligase protein can be found, for example, in NCBI Protein database under NCBI Ref. Seq. No. NM_003141.3. |00165| In certain embodiments, the protein expression blocker is any one or more of the PEBL as disclosed in WO2016/126213, the disclosure is herein incorporated by reference in its entirety for all purposes. Accordingly, the engineered immune cells described herein can comprise a PEBL (a target-binding molecule linked to a localizing domain) as described in WO2016/126213. The sequences of the components of PEBLs are described in Figure 2, and Tables 1 and 2 of WO2016/126213.
[00166] Tables 8 and 9 discloses the amino acid and nucleotide sequences of an exemplary anti-CD8 PEBL and its various components. In some embodiments, the anti- CD8 PEBL comprises an amino acid sequence as set forth in Table 8, e g., any of the SEQ ID NOs: 45-47 and 79-81. In some embodiments, the anti-CD8 PEBL comprises an amino acid sequence as set forth in Table 8, e g., any of the SEQ ID NOs: 95-98.
[00167] Exemplary embodiments of anti-CD8 PEBLs are depicted in FIG. 7. Table 8 shows amino acid sequences of exemplary anti-CD8 PEBLs and selected components. In some embodiments, the present disclosure provides a PEBL comprising an amino acid sequence according to Table 8. In some embodiments, the PEBL comprises components having amino acid sequences as disclosed in Table 8.
Table 8. Amino acid sequences of exemplary anti-CD8 PEBLs and selected components.
[00168] In some aspects, the disclosure provides a CD8 blocking polypeptide comprising an amino acid sequence as set forth in any of the SEQ ID Nos: 45-47, 79-81, or 95-98 In some embodiments, the CD8 polypeptide comprises an amino acid sequence as set forth in any of the SEQ ID Nos: 45-47 or 79-81. In some embodiments, the CD8 polypeptide comprises an amino acid sequence as set forth in any of the SEQ ID Nos: 95- 98. In one aspect the disclosure provides a CD8 blocking polypeptide comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence of SEQ ID NO: 26, or having 95-99% identity thereof; at least one (e.g., 1, 2) anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1, a LC CDR2 and a LC CDR3 described herein, e g., an anti-CD8 binding domain described in Table 1, 3, or 4, or having a sequence as set forth in SEQ ID NO: 24 or 25, or a sequence with 95-99% identify thereof; an intracellular localizing domain comprising an ER retention sequence comprising an amino acid sequence selected as set forth in any of the SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO:
63, SEQ ID NO: 66 or SEQ ID NO: 67, and optionally, a transmembrane domain linked between the scFv and the ER retention sequence domain comprising an amino acid sequence as set forth in SEQ ID NO: 34 or an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 34, or an amino acid sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 34. In some embodiments, the CD8 blocking polypeptide further comprises one or more linkers comprising an amino acid sequence as set forth in any of the SEQ ID NOs: 51 and 54. In some embodiments, the CD8 blocking polypeptide further comprises a Golgi retention sequence having an amino acid sequence selected from the group consisting of SEQ ID NO: 65, SEQ ID NO: 64, SEQ ID NO: 74, and SEQ ID NO: 75. In some embodiments, the CD8 blocking polypeptide further comprises a proteosome localizing sequence having an amino acid sequence as set forth in SEQ ID NO: 68
[00169] In one aspect, the disclosure provides a nucleotide comprising a nucleic acid sequence as set forth in any of the SEQ ID NOs: 48-50 or 99-100, encoding a CD8 blocking polypeptide comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence of SEQ ID NO: 26, or having 95-99% identity thereof, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain comprising a HC CDR1, a HC CDR2, a HC CDR3, a LCDR1, a LC CDR2 and a LC CDR3 described herein, e g., an anti-CD8 binding domain described in Table 1, 3, or 4, or having a sequence as set forth in SEQ ID NO: 24 or 25, or a sequence with 95-99% identify thereof; an intracellular localizing domain comprising an ER retention sequence comprising an amino acid sequence selected as set forth in any of the SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 66 or SEQ ID NO: 67, and optionally, a transmembrane domain linked between the scFv and the ER retention sequence domain comprising an amino acid sequence as set forth in SEQ ID NO: 34 or an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 34, or an amino acid sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 34.
[00170] In one aspect, the disclosure provides a CD8 blocking polypeptide comprising a leader sequence, e.g., a leader sequence described herein, e.g., a leader sequence encoded by a nucleotide having a nucleic acid sequence as set forth in any of the SEQ ID Nos: 27 or 28, an anti-CD8 binding domain described herein, e.g., an anti-CD8 binding domain
comprising a HC CDR1, a HC CDR2, a HC CDR3, a LC CDR1, a LC CDR2 and a LC CDR3 described herein; e g., an anti-CD8 binding domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in any of the SEQ ID NOs: 17, 52, 71, 72, or 101 , a transmembrane and a hinge region, e g , a transmembrane and a hinge region described herein, e g., a transmembrane and a hinge region encoded by a nucleotide having a nucleic acid sequence as set forth in any of the SEQ ID NOs: 35 or 36, and an ER retention sequence domain encoded by a nucleotide comprising a nucleic acid sequence as set forth in any of the SEQ ID NOs: 57, 59 or 60, optionally further comprising one or more linkers encoded by a nucleotide comprising a nucleic acid sequence as set forth in any of the SEQ ID NOs: 30-33, 53, 55, or 93.
100171] In some embodiments, the VH domain of the anti-CD8 scFv of the PEBL comprises the nucleotide sequence as set forth in any of the SEQ ID NOs:15, 16, 18, 19, and 94 and the VL domain of the anti-CD8 scFv of the PEBL comprises the nucleotide sequence as set forth in any of the SEQ ID NOs:20-23. In some embodiments, the VH domain of the anti-CD8 scFv of the PEBL comprises the nucleotide sequence having at least 90% sequence identity (e.g„ 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to any of the SEQ ID NOs: 15, 16, 18, 19, and 94 and the VL domain of the anti-CD8 scFv of the PEBL comprises the nucleotide sequence having at least 90% sequence identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity) to any of the SEQ ID NOs:20-23. Table 9 shows nucleotide sequences of exemplary anti-CD8 PEBLs and selected components. In some embodiments, the anti-CD8 PEBL comprises a nucleotide sequence as set forth in Table 9, e g., any of the SEQ ID NOs: 48-50 or 99-100. In some embodiments, a recombinant nucleic acid of the present disclosure comprises a nucleotide sequence that encodes a PEBL according to Table 9. In some embodiments, the nucleic acid comprises a nucleotide sequence that encodes a component of the PEBL according to Table 9.
Table 9: Nucleotide sequences of exemplary anti-CD8 PEBLs and selected components.
[00172] In some embodiments, the CAR, e.g., anti-CD8 CAR and/or the CD8 blocking polypeptide, e.g., anti-CD8 PEBL may comprise one or more linkers, e g., peptide linkers. Non-limiting examples of a linker include GSTSGGGSGGGSGGGGSS (SEQ ID NO: 29), GGGGS (SEQ ID NO: 54), GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 51) or GGGGSGGGGSGGGGS (SEQ ID NO: 83), GGGGSGGGGS (SEQ ID NO: 84), ((GS)n (SEQ ID NO: 85), (GGS)n (SEQ ID NO: 86), (GlyiSer)n (SEQ ID NO: 87), (Gly2SerGly)n (SEQ ID NO: 88), (Gly2SerGly2)n (SEQ ID NO: 89), or (Gly4Ser)n (SEQ ID NO: 90), wherein n is 1,2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiment, the linker is encoded by a nucleic acid having a sequence as set forth in any of the SEQ ID Nos: 30-33, 53, 55, 82, or 93.
GGCAGCACATCCGGAGGAGGCTCCGGAGGAGGCTCTGGAGGCGGCGGCTCCT CT (SEQ ID NO: 30), GGCTCCACATCCGGCGGAGGCTCTGGCGGTGGATCTGGCGGAGGCGGCTCATC C (SEQ ID NO: 31), GGCTCCACATCTGGAGGAGGATCTGGAGGAGGAAGCGGAGGAGGCGGCTCTA GC( SEQ ID NO: 32), GGATCCACATCTGGCGGCGGCTCCGGCGGGGGCTCCGGAGGAGGCGGCTCCT CT (SEQ ID NO: 33), GGCGGCGGCGGCTCTGGAGGCGGCGGAAGCGGAGGAGGAGGAAGCGGCGGC GGCGGCTCT (SEQ ID NO: 53), GGAGGTGGAGGTTCT (SEQ ID NO: 55), or GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGCGGCGGCGGCTCCGGTGGTGG TGGATCC (SEQ ID NO: 82).
GGCGGCGGCGGCTCTGGAGGAGGAGGCAGCGGCGGAGGAGGCTCCGGAGGG GGCGGCTCT (SEQ ID NO: 93)
[00173] In some embodiments, the nucleic acid sequence encoding the localization domain of the anti-CD8 protein expression blocker comprises a sequence selected from SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 60, or SEQ ID NO: 62, or a codon optimized variant thereof.
[00174] Nucleic acid includes, for example, genomic DNA, cDNA, RNA, and DNA- RNA hybrid molecules. Nucleic acid molecules can be naturally occurring, recombinant, or synthetic. In addition, nucleic acid molecules can be single-stranded, double-stranded or triple-stranded. In certain embodiments, nucleic acid molecules can be modified. In the case of a double-stranded polymer, “nucleic acid” can refer to either or both strands of the molecule.
[00175] As will be appreciated by those of skill in the art, in some aspects a nucleic acid comprises regulatory sequences from a plasmid. The nucleic acid sequence can include, for example, one or more of a promoter sequence a selection marker sequence, or a locustargeting sequence.
[00176] Codon usage bias has been reported for numerous organisms, from viruses to eukaryotes. Since the genetic code is degenerate (i.e., each amino acid can be coded by on average three different codons), the DNA sequence can be modified by synonymous nucleotide substitutions without altering the amino acid sequence of the encoded protein. Such synonymous codon optimization has been performed for the purpose of optimizing expression in a desired host, as described in the scientific literature and in patent documents. See U.S. Pat. Nos. 5,786,464 and 6,114,14. In some embodiments, the nucleic acid described herein maybe modified to improve cloning efficiency. In some embodiments, the nucleic acids described herein are subjected to codon optimization to increase the efficiency of gene expression, e.g., SEQ ID NO: 15, 20, 27, 30, 36, 18, 22, 32, 19, 23, 33, 94, 28, 53, 57, 60 are subjected to codon optimization. In some embodiments, the CD8 binding domain of the anti-CD8 CAR and/or anti-CD8 PEBL are encoded by a nucleic acid whose sequence has been codon optimized for expression in a mammalian cell In some embodiments, the anti-CD8 CARs described herein are encoded by nucleic acids that have been codon optimized for expression in a mammalian cell. In some embodiments, the anti-CD8 PEBLs described herein are encoded by nucleic acids that have been codon optimized for expression in a mammalian cell.
[00177] As those skilled in the art would appreciate, in certain embodiments, any of the sequences of the various components disclosed herein (e g., scFv, intracellular signaling domain, hinge, linker, localizing sequences, and combinations thereof) can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the specific corresponding sequences disclosed herein. For example, in certain embodiments, the intracellular signaling domain 4-1BB can have at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99%
sequence identity, or 100% sequence identity to SEQ ID NO: 40, as long as it possesses the desired function.
[00178] In one aspect, the disclosure provides a vector comprising a nucleic acid molecule described herein. In some embodiments, the vector comprises a nucleic acid molecule encoding a CAR described herein, e.g., an anti-CD8 CAR. In some embodiments, the vector comprises a nucleic acid molecule encoding a PEBL described herein, e g., a CD8-PEBL. In some embodiments, the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, or a retrovirus vector. In some embodiments, the vector is a murine retroviral vector, e g , murine stem cell virus (MSCV) retroviral vector. In some embodiments, the vector further comprises a promoter. In some embodiments, the promoter is an EF-1 promoter, a MSCV promoter, SC40 promoter, or a PGK promoter. In some embodiments, the vector further comprises a poly A tail. In some embodiments, the promoter is an EF-1 promoter having a nucleic acid sequence as set forth in SEQ ID NO: 77. In some embodiments, the promoter is an MSCV promoter having a nucleic acid sequence as set forth in SEQ ID NO: 78.
[00179] CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCAC AGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGA AGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTT TCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTC TTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCC CGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCC ACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTG GGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTG AGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGC GCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCT GCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCT GCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGT CCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAAT CGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGC CGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTT GCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAAT GGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGA AAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGG GCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTA
GGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGA GACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCT TTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTT TTTTCTTCCATTTCAGGTGTCGTGA (SEQ ID NO: 77)
[00180] GGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAAC GCCATTTTGCAAGGCATGGAAAATACATAACTGAGAATAGAGAAGTTCAGAT CAAGGTTAGGAACAGAGAGACAGCAGAATATGGGCCAAACAGGATATCTGTG GTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCG GTCCCGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCA AGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTC GCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCC CTCACTCGGCGCGCCAGTCC (SEQ ID NO: 78).
1001811 In one aspect, the disclosure provides a cell, e.g., an engineered immune cell comprising an recombinant nucleic acid, a CAR, e.g., anti-CD8 CAR, a CD8 blocking polypeptide, e.g., an anti-CD8 PEBL, or a vector described herein. In some embodiments, the engineered immune cell comprises a nucleic acid molecule described herein In some embodiments, the engineered immune cell comprises a nucleic acid molecule encoding a CAR described herein, e g., an anti-CD8 CAR. In some embodiments, the engineered immune cell comprises a nucleic acid molecule encoding a PEBL described herein, e.g., a CD8- PEBL. In some embodiments, the engineered immune cell comprises: (i) a first nucleic acid encoding a CD8 blocking polypeptide comprising a single chain variable fragment (scFv) and an intracellular localizing domain, wherein the scFv binds CD8 (CD8 binding domain), wherein the intracellular localizing domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and (ii) a second nucleic acid encoding an anti-CD8 CAR comprising a CD8 targeting domain comprising a single chain variable fragment (scFv), a transmembrane domain, and a signaling domain (anti-CD8 CAR). In some embodiments, the engineered immune cell comprises: (i) a CD8 blocking polypeptide comprising a single chain variable fragment (scFv) and an intracellular localizing domain, wherein the scFv binds CD8 (CD8 binding domain), wherein the intracellular localizing domain comprises an ER retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and (ii) an anti-CD8 CAR comprising a CD8 targeting domain comprising a single chain variable fragment (scFv), a transmembrane domain, and a signaling domain (anti-CD8 CAR). In some embodiments, the CD8 blocking polypeptide reduces cell surface expression of
endogenous CD8 within the engineered cell. In some embodiments, the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell.
[00182] Tn some embodiments, the engineered immune cell is an engineered T cell, an engineered natural killer (NK) cell, an engineered NK/T cell, an engineered monocyte, an engineered macrophage, or an engineered dendritic cell. In some embodiments, the engineered immune cell is an engineered T cell. In some embodiments, the engineered T cell is a CD4 positive T cell, a CD8 positive T cell, a naive T cell, or a memory T cell. [00183] In one aspect, provided is an engineered immune cell comprising: a nucleic acid that comprises a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4-1BB and CD3(, and an antibody or antigen binding fragment that specifically binds Cluster of Differentiation 8 (CD8), e.g., an anti-CD8 CAR as disclosed herein, and optionally further comprises a second nucleotide sequence encoding a target-binding molecule linked to a localizing domain, wherein the targetbinding molecule is an antibody or antigen binding fragment that binds CD8, and the localizing domain comprises an endoplasmic reticulum retention sequence, e g., anti-CD8 PEBL as disclosed herein. In some embodiments, the antibody that binds CD8 in the context of the CAR, as well as in the context of the target-binding molecule comprises a CD8 binding domain disclosed herein. In some embodiments, the antibody that binds CD8 in the context of the CAR can be identical to the antibody that binds CD8 in the context of the target-binding molecule (the protein expression blocker or PEBL), as described herein, e g., having an amino acid sequence as set forth in SEQ ID NO: 25. In certain embodiments, the antibody that binds CD8 in the context of the CAR can be different from the antibody that binds CD8 in the context of the target-binding molecule (the protein expression blocker or PEBL), as described herein. In certain embodiments, the intracellular signaling domain of 4-1BB comprises the sequence set forth in SEQ ID NO: 39. In certain embodiments, the intracellular signaling domain of CD3i^ comprises the sequence set forth in SEQ ID NO: 41.
[00184] In some embodiments, the antibody that binds CD8 in the context of the CAR, as well as in the context of the target-binding molecule is a scFv. In some embodiments, the scFv comprises a VH sequence set forth in SEQ ID NO: 13 and a variable light chain VL sequence set forth in SEQ ID NO: 14. As described herein, in some embodiments, the scFv comprises a VH and a VL having sequence that each comprise at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93%
sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, or 100% sequence identity to the VH and VL sequences set forth in SEQ ID NO: 13 and 14, respectively. Tn some embodiments, the CAR, e g., anti- CD8 CAR further comprises a hinge and transmembrane sequence, e.g., as set forth in SEQ ID NO: 37. In some embodiments, the PEBL, e.g., anti-CD8 PEBL further comprises a hinge and transmembrane sequence e g., as set forth in SEQ ID NO: 34.
[00185] As noted above, downregulation of CD8 expression on the effector T cells can be achieved according to a variety of other known methods including, for example, gene editing methods with meganucleases, TALEN, CRISPR/Cas9, and zinc finger nucleases. Thus, in certain embodiments, the engineered immune cell further comprises a modified CD8 gene, which modification renders the CD8 gene or protein non-functional. By way of example, the engineered immune cell of the present disclosure further comprises a modified (e.g., non-functional) CD8 gene (modified using, e.g., meganucleases, TALEN, CRISPR/Cas9, or zinc finger nucleases) that prevents or reduces expression of CD8, and/or otherwise impairs (e.g., structurally) the CD8 protein from being recognized by an anti-CD8 CAR. Methods of modifying gene expression using such methods are readily available and well-known in the art.
[00186] Methods of inactivating a target gene in an immune cell using CRISPR/Cas9 technology are described, for example, in US Patent Publication Nos. 2016/0272999, 2017/0204372, and 2017/0119820.
[00187] The CRISPR/Cas system is a system for inducing targeted genetic alterations (genome modifications). Target recognition by the Cas9 protein requires a “seed” sequence within the guide RNA (gRNA) and a conserved multinucleotide containing protospacer adjacent motif (PAM) sequence upstream of the gRNA-binding region. The CRISPR/Cas system can thereby be engineered to cleave substantially any DNA sequence by redesigning the gRNA in cell lines, primary cells, and engineered cells. The CRISPR/Cas system can simultaneously target multiple genomic loci by co-expressing a single Cas9 protein with two or more gRNAs, making this system uniquely suited for multiple gene editing or synergistic activation of target genes. Examples of a CRISPR/Cas system used to inhibit gene expression are described in U.S. Publication No.
2014/0068797 and U.S. Patent Nos. 8,697,359 and 8,771,945. The system induces permanent gene disruption that utilizes the RNA-guided Cas9 endonuclease to introduce DNA double stranded breaks which trigger error-prone repair pathways to result in frame
shift mutations. In some cases, other endonucleases may also be used, including but not limited to, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl 7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, T7, Fokl, other nucleases known in the art, homologs thereof, or modified versions thereof.
[00188] CRISPR/Cas gene disruption occurs when a gRNA sequence specific for a target gene and a Cas endonuclease are introduced into a cell and form a complex that enables the Cas endonuclease to introduce a double strand break at the target gene In some instances, the CRISPR system comprises one or more expression vectors comprising a nucleic acid sequence encoding the Cas endonuclease and a guide nucleic acid sequence specific for the target gene. The guide nucleic acid sequence is specific for a gene and targets that gene for Cas endonuclease-induced double strand breaks. The sequence of the guide nucleic acid sequence may be within a loci of the gene. In some embodiment, the guide nucleic acid sequence is at least 10, I I, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, or more nucleotides in length. The guide nucleic acid sequence includes a RNA sequence, a DNA sequence, a combination thereof (a RNA-DNA combination sequence), or a sequence with synthetic nucleotides, such as a peptide nucleic acid (PNA) or Locked Nucleic Acid (LNA). The guide nucleic acid sequence can be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence comprises a single guide RNA.
[00189] In some embodiments, the engineered immune cell of the present disclosure can be modified via the CRISPR/Cas system to inactivate the human CD8 gene. Details of the genomic structure and sequence of the human CD8 gene can be found, for example, in NCB1 Gene database under GenelD No. 925 or UN1PROT ID NO. P01732.
[00190] Commercially available kits, gRNA vectors and donor vectors, for knockout of specific target genes are available, for example, from OriGene (Rockville, Md.), GenScript (Atlanta, Ga ), Applied Biological Materials (ABM; Richmond, British Colombia), BioCat (Heidelberg, Germany) or others. For example, commercially available kits or kit components for knockout of CD8 via CRISPR include, for example, those available as catalog numbers KN201231, KN201231G1, KN201231G2, and KN201231D, each available from OriGene, and those available as catalog numbers sc-4072847, sc-4072847- KO-2, SC-4072847-HDR-2, sc-4072847-NIC, sc-4072847HDR-2, and sc-4072847- NIC - 2, each available from Santa Cruz Biotechnology.
[00191] In some embodiments, the chimeric antigen receptor described herein can be introduced into the human CD8 gene locus using the CRISPR/Cas system
[00192] In one aspect, the engineered immune cell of the present disclosure has reduced expression of endogenous CD8 The reduction of the expression of endogenous CD8 can improve cell recovery of the engineered immune cell (e.g., the engineered immune cell expressing anti-CD8 CAR as described herein). For example, after transduction of a population of engineered immune cells with the anti-CD8 CAR and CRISPR-Cas9 or PEBL to down-regulate the endogenous CD8, the cytotoxic (e.g., CD4-negative T cells) in the population of engineered immune cells can be at least about 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, or more of the initial input cells after a period of incubation or culturing. In some cases, the cytotoxic T cells (e.g., using CD4-negative as a marker) in the population of engineered immune cells can be at least about 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, or more of the initial input cells after incubation or culturing for at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 12 days, at least about 15 days, at least about 20 days, or more. In some cases, cell proliferation of the engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 can proliferate better than an otherwise identical engineered immune cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. For example, after transduction and incubation for a period of time (e g., at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 12 days, at least about 15 days, at least about 20 days, or more), the engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 can be at least about 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 120 times, 130 times, 140 times, 150 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times or more than an otherwise identical engineered immune cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some cases, the cytotoxic T cells (e g., as detected by CD4-negative marker) in a population of engineered immune cells expressing an anti-CD8 CAR with reduced expression of endogenous CD8 can be at least about 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 120 times, 130 times, 140 times, 150 times, 200
times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times or more than the cytotoxic T cells in an otherwise identical population of engineered immune cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
[00193] Tn some embodiments, the engineered cell comprises a population of engineered cells. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is higher compared to an otherwise identical population of cells expressing the anti- CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 1.1 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 5 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 10 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 25 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 50 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 60 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 70 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 80 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of
engineered cells is at least about 90 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 100 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 125 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 150 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 175 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 200 times higher compared to an otherwise identical population of cells and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 250 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 300 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 400 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 500 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 600 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 700 times higher compared to an otherwise identical
population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. Tn some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 800 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 900 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 1.1 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 5 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 10 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 25 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 50 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 60 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 70 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability
of cytotoxic T cells in the population of engineered cells is at least about 80 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 90 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 100 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 125 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 150 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 175 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 200 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 250 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 300 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 400 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at
least about 500 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 600 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 700 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 800 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, viability of cytotoxic T cells in the population of engineered cells is at least about 900 times higher compared to an otherwise identical population of cells electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
[00194] In some embodiments, cytotoxicity of the engineered immune cell against target cells is higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.1 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.2 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.6 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR
without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1 .7 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.8 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.9 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 3.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 5: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 4: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 3 : 1 . In some embodiments, the cytotoxicity is tested at an effector-target ratio of 2: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :2. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : . In some
embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :4. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :5. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4 In some embodiments, the target cells are CCRF-CEM In some embodiments, cytotoxicity of the engineered immune cell against target cells is higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.1 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.3 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. Tn some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1 .4 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.7 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1 .8 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.9 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In
some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
2.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 3 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
3.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
4.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 5: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 4: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 3: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 2: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :2. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 3. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :4. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :5. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.
[00195] The reduction of expression of endogenous CD8 in a population of engineered immune cells expressing anti-CD8 CAR can improve long-term cytotoxicity of the
cytotoxic T cells in the population. In some embodiments, cytotoxicity of the engineered immune cell against target cells is higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after co-culturing with the target cells for a period of time. In some embodiments, the cytotoxicity is represented by the number of remaining target cells after co-culturing with the engineered immune cell. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is at least about 1.1 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after of co-culturing with the target cells In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.2 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1 .5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.6 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.7 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.8 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.9 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. Tn some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2.5 times higher compared to an otherwise identical cell expressing
the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 3 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. Tn some embodiments, the cytotoxicity of the engineered immune cell against target cells is 3.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4.5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 5 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the engineered immune cell is co-cultured with the target cells for 2 hours. Tn some embodiments, the engineered immune cell is co-cultured with the target cells for 5 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 10 hours. In some embodiments, the engineered immune cell is co- cultured with the target cells for 20 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 30 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 40 hours In some embodiments, the engineered immune cell is co-cultured with the target cells for 50 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 60 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 70 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 80 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 90 hours. In some embodiments, the engineered immune cell is co- cultured with the target cells for 100 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 110 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 120 hours. Tn some embodiments, the engineered immune cell is co-cultured with the target cells for 1 week. In some embodiments, the engineered immune cell is co-cultured with the target cells for 2 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 3 weeks. In some embodiments, the engineered immune cell is co-cultured with
the target cells for 4 weeks. In some embodiments, the engineered immune cell is cocultured with the target cells for 5 weeks. Tn some embodiments, the engineered immune cell is co-cultured with the target cells for 6 weeks. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 5: 1 . In some embodiments, the cytotoxicity is tested at an effector-target ratio of 4: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 3:1. In some embodiments, the cytotoxicity is tested at an effectortarget ratio of 2: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:2. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:3. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :4. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 5. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :6. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :7. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 10. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 12. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 15. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM. In some embodiments, cytotoxicity of the engineered immune cell against target cells is higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after co-culturing with the target cells for a period of time. In some embodiments, the cytotoxicity is represented by the number of remaining target cells after co-culturing with the engineered immune cell. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is at least about 1.1 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after of co-culturing with the target cells. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 1.3 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In
some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1 .4 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.6 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.7 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.8 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
1.9 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. Tn some embodiments, the cytotoxicity of the engineered immune cell against target cells is 2 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
2.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 3 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
3.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is 4 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the cytotoxicity of the engineered immune cell against target cells is
4.5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. Tn some embodiments, the cytotoxicity of the engineered immune cell against target cells is 5 times higher compared to an otherwise identical cell electroporated with Cas9 only and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8. In some embodiments, the engineered immune cell is co-cultured with the target cells for 2 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 5 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 10 hours. In some embodiments, the engineered immune cell is co- cultured with the target cells for 20 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 30 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 40 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 50 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 60 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 70 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 80 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 90 hours. In some embodiments, the engineered immune cell is co- cultured with the target cells for 100 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 110 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 120 hours. In some embodiments, the engineered immune cell is co-cultured with the target cells for 1 week. In some embodiments, the engineered immune cell is co-cultured with the target cells for 2 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 3 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 4 weeks. In some embodiments, the engineered immune cell is co- cultured with the target cells for 5 weeks. In some embodiments, the engineered immune cell is co-cultured with the target cells for 6 weeks. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 5: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 4: 1 . In some embodiments, the cytotoxicity is tested at an effector-target ratio of 3:1. In some embodiments, the cytotoxicity is tested at an effectortarget ratio of 2: 1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:1. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:2. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1:3. In
some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :4. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :5. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :6. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :7. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 :8. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 10. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 12. In some embodiments, the cytotoxicity is tested at an effector-target ratio of 1 : 15. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.
100196] In some embodiments, proliferation of the engineered immune cell in the presence of target cells is higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.1 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1 .2 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1 .3 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.4 times higher compared to the engineered immune cell in the absence of the target cells In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.5 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.6 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.7 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.8 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.9 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 2 times higher compared to the engineered immune cell in the absence of the target
cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 2.5 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 3 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 3.5 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 4 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 4.5 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 5 times higher compared to the engineered immune cell in the absence of the target cells. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is at least about 1 . 1 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.2 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.3 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.4 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.6 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the
engineered immune cell in the presence of target cells is 1.7 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1 .8 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 1.9 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 2 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 2.5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 3 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 3.5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 4 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 4.5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 5 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 10 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the engineered immune cell in the presence of target cells is 15 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation of the
engineered immune cell in the presence of target cells is 20 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR. In some embodiments, the proliferation is tested at an effectortarget ratio of 5: 1 . In some embodiments, the proliferation is tested at an effector-target ratio of 4:1. In some embodiments, the proliferation is tested at an effector-target ratio of 3:1. In some embodiments, the proliferation is tested at an effector-target ratio of 2:1. In some embodiments, the proliferation is tested at an effector-target ratio of 1 : 1. In some embodiments, the proliferation is tested at an effector-target ratio of 1 :2. In some embodiments, the proliferation is tested at an effector-target ratio of 1 : 3. In some embodiments, the proliferation is tested at an effector-target ratio of 1 :4. In some embodiments, the proliferation is tested at an effector-target ratio of 1 : 5. In some embodiments, the proliferation is tested at about 2 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 4 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 6 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 7 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 10 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 12 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 14 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 16 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 18 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 20 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 25 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the proliferation is tested at about 30 days of culturing the engineered immune cell in the presence or absence of the target cells. In some embodiments, the target cells are CD8-positive cells. In some embodiments, the target cells are MOLT-4. In some embodiments, the target cells are CCRF-CEM.
[00197] In some embodiments, the disclosure provides a composition, e.g., a pharmaceutical composition comprising a CAR, e g., anti-CD8 CAR as described herein. In some embodiments, the composition further comprises a PEBL described herein, e g., an anti-CD8 PEBL. In some embodiments, the disclosure provides a composition comprising an engineered immune cell as described herein, e.g., an engineered immune cell comprising a nucleic acid encoding a CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e.g., an anti-CD8 PEBL as disclosed herein.
[00198] In some embodiments, the engineered immune cell is manufactured by transducing or transfecting a vector encoding the anti-CD8 CAR and the anti-CD8 protein expression blocker at the same time, or within no more than 1, 2, 3, or 4 hours apart. In some embodiments, the anti-CD8 CAR and anti-CD8 PEBL are co-expressed using a bicistronic vector. In some embodiments, the vector encoding the anti-CD8 CAR is transduced or transfected after the vector encoding the anti-CD8 protein expression blocker is expressed, e g., the vector encoding the anti-CD8 CAR is transduced or transfected at least 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, or 40 hours after the vector encoding the anti-CD8 protein expression blocker is transduced or transfected.
[00199] In some aspects, the disclosure provides a method to downregulate CD8 expression by a target binding molecule, e.g., a PEBL, e.g., a CD8-PEBL. In some embodiments, the target binding molecule, e g., anti-CD8 PEBL downregulates CD8 expression. In some embodiments, the target binding molecule, e g , anti-CD8 PEBL downregulate CD8a expression. In some embodiments, the target binding molecule, e g., anti-CD8 PEBL downregulates CD8 expression by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or by 100%. In some embodiments, the target binding molecule, e.g., anti-CD8 PEBL downregulates CD8a expression by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% or by 100%. In some embodiments, the target binding molecule, e.g., anti-CD8 PEBL, downregulates CD8 expression for at least
6 hours, at least 12 hours, at least 18 hours, at least 24 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 10 days, at least 15 days, at least 20 days, at least 25 days, at least 30 days, or indefinitely. In some embodiments, the target binding molecule, e.g., anti-CD8 PEBL, downregulates CD8a expression for at least 6 hours, at least 12 hours, at least 18 hours, at least 24 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 10 days, at least 15 days, at least 20 days, at least 25 days, at least 30 days, or indefinitely.
[00200] In some embodiments, the disclosure provides a method to reduce fratricide by immune cells expressing a CAR disclosed herein, e.g., an anti-CD8 CAR by expressing a target binding molecule, e.g., a CD8-PEBL in the immune cells. In some embodiments, the anti-CD8 CAR and the CD8-PEBL are administered together, e.g., by co-expressing the anti-CD8 CAR and the CD8-PEBL using a bicistronic vector In some embodiments, the anti-CD8 CAR and the CD8-PEBL are administered sequentially, e.g., a nucleotide sequence encoding the CD8-PEBL is transduced or transfected into the immune cells before transducing or transfecting the nucleotide sequence encoding the anti-CD8 CAR e.g., the nucleotide sequence encoding the anti-CD8 CAR is transduced or transfected at least 12 hours, 18 hours, 24 hours, 30 hours, 36 hours, or 40 hours after the vector encoding the anti-CD8 protein expression blocker is transduced or transfected.
[00201] The present disclosure provides a CAR directed against CD8. As demonstrated herein, the expression of the anti-CD8 CAR in immune cells such as effector T cells, induces the T cell to exert specific cytotoxicity against T-cell malignancies. This cytotoxic effect was shown to be enhanced when expression of CD8 on the effector T cells was downregulated using an antibody-based molecule (a protein expression blocker or PEBL) that targeted the CD8 for downregulation. Thus, the present disclosure provides an immunotherapeutic method for treating cancers, e.g., T-cell malignancies.
[00202] In other aspects, also provided is a method of killing CD8 positive cells in a subject in need thereof, comprising administering a therapeutic amount of an engineered immune cell having any of the embodiments described herein to the subject, thereby treating killing CD8 positive cells in a subject in need thereof. In some embodiments, the disclosure provides an use of a CAR, (e.g., anti-CD8 CAR), an engineered immune cell (an engineered immune cell comprising a nucleic acid encoding) CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e g , an anti-CD8 PEBL), or an composition comprising an
engineered immune cell as disclosed herein in the manufacture of a medicament for killing CD8 positive cells in a subject in need thereof.
[00203] In other aspects, also provided is a method of treating cancer in a subject in need thereof, comprising administering a therapeutic amount of an engineered immune cell having any of the embodiments described herein to the subject, thereby treating cancer in a subject in need thereof. In some embodiments, the disclosure provides an use of a CAR, (e g., anti-CD8 CAR), an engineered immune cell (an engineered immune cell comprising a nucleic acid encoding a CAR as disclosed herein, e.g., an anti-CD8 CAR, and optionally further comprising a second nucleic acid encoding a CD8 blocking polypeptide, e g., an anti-CD8 PEBL), or an composition comprising an engineered immune cell as disclosed herein in the manufacture of a medicament for treating cancer in a subject in need thereof. [00204] In certain embodiments, the method comprises administering a therapeutic amount of an engineered immune cell comprising a nucleic acid that comprises a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4-1BB and CD3(j, and an antibody that binds CD8, as described herein.
[00205] In certain embodiments, the method comprises administering a therapeutic amount of an engineered immune cell that further comprises a nucleic acid having a nucleotide sequence encoding a target-binding molecule linked to a localizing domain, as described herein (e.g., an anti-CD8 protein expression blocker).
[00206] In certain embodiments, the use comprises administering a therapeutic amount of an engineered immune cell or the composition as described herein in a subject in need thereof.
[00207] In certain embodiments, the cancer is a T-cell malignancy, e g., T-cell leukemia or T-cell lymphoma, such as T-cell acute lymphoblastic leukemia, T-cell prolymphocytic leukemia, T-cell large granular lymphocytic leukemia, enteropathy-associated T-cell lymphoma, hepatosplenic T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, mycosis fungoides, Sezary syndrome, primary cutaneous gamma-delta T-cell lymphoma, peripheral T-cell lymphoma not otherwise specified, angioimmunoblastic T- cell lymphoma, anaplastic large cell lymphoma. In certain embodiments, the T cell malignancy is early T-cell progenitor acute lymphoblastic leukemia (ETP-ALL) In certain embodiments, the cancer is a NK-cell malignancy, e.g., NK/T-cell lymphoma, nasal type (ENKL), or aggressive NK-cell leukemia (ANKL).
[00208] In some embodiments, the engineered immune cell is autologous to the subject in need of treatment, e.g cancer treatment. Tn other embodiments, the engineered immune cell is allogenic to the subject in need of treatment.
[00209] Tn other aspects, also provided is use of an engineered immune cell having any of the embodiments described herein for treating cancer, comprising administering a therapeutic amount of the engineered immune cell to a subject in need thereof. In certain embodiments, the cancer is a T-cell malignancy In certain embodiments, the T-cell malignancy is early T-cell progenitor acute lymphoblastic leukemia (ETP -ALL). In certain embodiments, the cancer is a NK-cell malignancy
[00210] In another aspect, also provided is a method for producing the engineered immune cell having any of the embodiments described herein, the method comprising introducing into an immune cell a nucleic acid that comprises a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4- IBB and CD3ij, and an antibody that binds CD8. In certain embodiments, the method further comprises introducing into the immune cell a nucleic acid that comprises a nucleotide sequence encoding a target-binding molecule linked to a localizing domain (e g., anti-CD8 protein expression blocker or anti-CD8 PEBL). In certain embodiments, the nucleotide sequence encoding CAR and the nucleotide sequence encoding the anti-CD8 PEBL are introduced on a single plasmid, e.g., using a bicistronic vector. Outlined herein is also a method and kit for producing an engineered immune cell (e.g., T cell, natural killer (NK) cell, NK/T cell, monocyte, macrophage, or dendritic cell) described herein. The disclosure also sets forth the use of any of the engineered immune cells or the composition outlined herein for treating cancer.
[00211] In some embodiments, provided herein is a method for producing the engineered immune cell described herein. The method can include: introducing into an immune cell a nucleic acid that comprises a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4-1BB and CD3i^, and an antibody that binds CD8, thereby producing an engineered immune cell. The method can further comprises introducing into the immune cell a nucleic acid that comprises a nucleotide sequence encoding a target-binding molecule linked to a localizing domain. Tn some embodiments, the method further comprises functional inhibition of CD8 signaling during the manufacturing process of the cells. In some embodiments, the functional inhibition of CD8 signaling comprises reducing expression of endogenous CD8 of the immune cells. In
some embodiments, the endogenous CD8 of the immune cells is knocked out or knocked down.
[00212] In various aspects, also provided is a kit for producing an engineered immune cell described herein. The present kit can be used to produce, T cells, e g , allogeneic or autologous T cells having anti-CD8 CAR-mediated cytotoxic activity. In some embodiments, the kit is useful for producing allogeneic effector T cells having anti-CD8 CAR-mediated cytotoxic activity. In certain embodiments, the kit is useful for producing autologous effector T cells having anti-CD8 CAR-mediated cytotoxic activity.
[00213] Accordingly, provided herein is a kit comprising a nucleic acid comprising a nucleotide sequence encoding a CAR, wherein the CAR comprises intracellular signaling domains of 4-1BB and CD3(^, and an antibody that binds CD8, e.g., an anti-CD8 CAR as disclosed herein. The nucleotide sequence encoding the anti-CD8 CAR can be designed according to any of the embodiments described herein.
[00214] In certain embodiments, the kit further comprises a nucleic acid having a nucleotide sequence that encodes a target-binding molecule linked to a localizing domain, as described herein (e g., anti-CD8 PEBL molecules as described herein). The nucleotide sequence encoding the target-binding molecule linked to a localizing domain can be designed according to any of the embodiments described herein.
[00215] In certain embodiments, the nucleotide sequence encoding the anti-CD8 CAR and/or the nucleotide sequence encoding the anti-CD8 PEBL are linked to sequences (e.g., plasmid or vector sequences) that allow, e g., cloning and/or expression. For example, the nucleotide sequence can be provided as part of a plasmid for ease of cloning into other plasmids and/or vectors (expression vectors or viral expression vectors) for, e g., transfection, transduction, or electroporation into a cell (e.g., an immune cell). In certain embodiments, the nucleotide sequence encoding the anti-CD8 CAR and the nucleotide sequence encoding the anti-CD8 PEBL are provided on a single plasmid or vector (e g., a single construct comprising an anti-CD8 CAR and an anti-CD8 PEBL). In certain embodiments, the nucleotide sequences are provided on separate plasmids or vectors (expression vectors or viral expression vectors).
[00216] Typically, the kits are compartmentalized for ease of use and can include one or more containers with reagents. In certain embodiments, all of the kit components are packaged together. Alternatively, one or more individual components of the kit can be provided in a separate package from the other kits components. The kits can also include instructions for using the kit components.
[00217] The following examples are provided to further illustrate some embodiments of the present disclosure but are not intended to limit the scope of the disclosure; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.
EXAMPLES
Example 1: Materials & Methods:
[00218] This example is directed to the materials and methods employed in the experiments disclosed in Examples 2-8.
Cells and culture conditions:
[00219] The T-cell ALL lines Jurkat, CCRF-CEM, and MOLT-4, the lymphoblastic cell line T2, and the NK cell line NK92 were obtained from the American Type Culture Collection (ATCC; Rockville, MD). Jurkat, MOLT-4 and T2 were maintained in RPML 1640 (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin- streptomycin. NK92 was maintained in 12.5% FBS, 12.5% horse serum (Sigma-Aldrich, St. Louis, MO), 1% penicillin-streptomycin, and supplemented with 200 lU/mL IL-2 (Novartis, Basel, Switzerland) thrice weekly Cell lines were characterized by the providers for molecular and/or gene expression features. Cell lines were expanded after receipt and cryopreserved. Cells for experiments were obtained from recently thawed vials.
[00220] Peripheral blood mononuclear cells were obtained by separating blood samples through a Lymphoprep density step (Nycomed, Oslo, Norway). Samples were collected from discarded anonymized byproducts provided by the Health Sciences Authority of Singapore Blood Bank. Cells were washed twice in RPML1640 after separation.
Gene cloning and retroviral transduction:
[00221] The anti-CD8a scFv was obtained from Genscript (Piscataway, NJ) following the sequence of a humanized scFv derived from the OKT8 antibody. For the CAR, the anti-CD8a scFv was joined with the CD8a signal peptide, CD8a hinge and transmembrane domain, and the intracellular domains of 4-1BB and CD3(^. For the Protein Expression Blockers (PEBLs), the anti-CD8a scFv was joined with the CD8a signal peptide, CD8a hinge and transmembrane domain conjugated to the ER retention peptide KYKSRRSFIEEKKMP or AEKDEL with a (GGGGS)4 linker. PEBLs with two scFv sequences linked with five or twenty amino acids were also generated. The murine stem
Ill
cell virus (MSCV) retroviral vector was obtained from the St. Jude Children’ s Research Hospital Vector Development and Production Shared Resource (Memphis, TN). Retroviral vector-conditioned medium was added to RetroNectin (Takara, Otsu, Japan)-coated polypropylene tubes; after centrifugation and removal of the supernatant, T cells (5 x 105) previously activated with TransAct (Miltenyi Biotec, Bergisch Gladbach, Germany) were added to the tubes and left at 37°C for 24 hours. In some cases, T cells were electroporated to eliminate expression of CD8 by CRISPR 3 days prior to transduction. The process was repeated a second time. T lymphocytes were then maintained in RPMI-1640 with FBS, antibiotics, and 200 lU/mL IL-2 until the time of the experiments. Control cells were transduced with a MSCV retroviral vector containing GFP only.
CD8 knockout by CRISPR
[00222] The guide RNA (gRNA) against the CD8a gene and nuclear localization signal appended Cas9 nuclease (NLS-Cas9) were obtained from Genscript. The gRNA and NLS- Cas9 were combined and incubated at room temperature for 10 min to form a ribonucleoprotein (RNP) complex. Day 2 expanded T cells were suspended in electroporation buffer (Lonza, Basel, Switzerland), and mix with just NLS-Cas9 or RNP. Mixture was electroporated using the U-014 program on the Amaxa Nucleofactor II electroporator (Lonza).
Detection of scFv and surface antigens
[00223] Expression of CAR was detected using a biotin-conjugated goat anti-mouse F(ab’)2 antibody (Jackson ImmunoResearch, West Grove, PA) or biotin-conjugated goat anti-human F(ab’)2 antibody (Jackson ImmunoResearch) followed by streptavidin conjugated to allophycocyanin (APC; Jackson ImmunoResearch). PEBL expression was detected by permeabilizing the cells with the BD Cytofix/Cytoperm (BD Biosciences, San Jose, CA) followed by sequential staining with biotin-conjugated goat anti-human F(ab’)2 antibody (Jackson ImmunoResearch) and streptavidin conjugated to phycoerythrin (PE; Jackson ImmunoResearch). Surface expression of CD3, CD8, and CD4 was detected with APC-conjugated anti-human CD3 (clone SK7; BD Biosciences,), PE-conjugated antihuman CD8 (clone RPA-T8; BD Pharmingen, San Diego, CA), and PECy7-conjugated anti-human CD4 (clone SK3; BD Biosciences). Stained cells were fixed with 0.5% formaldehyde (Polysciences, Warrington, PA) before analysis using the Fortessa flow cytometer (BD Biosciences). Expression of the SI 83 TCR was detected with a fluorescein
isothiocyanate (FITC)-conjugated anti-human TCRv|33 antibody (Beckman Coulter, Brea, CA).
Cytotoxicity assay
[00224] Cytotoxicity was tested by labelling target cells with calcein AM red-orange (Invitrogen, Carlsbad, CA) and plated into a 96-well round bottom plate (Corning Costar, Corning, NY) at concentration of lx 105 cells per well. NK92 or T cells were added to the appropriate effector: target (E:T) ratio and co-cultured with target cells for 4 hours at 37 °C at 5% CO2. After 4 hours, 100 pL of 0.5% formaldehyde was added to each well and the number of viable target cells was counted using the Accuri C6 Plus cytometer (BD Biosciences).
[00225] Long-term cytotoxicity was tested by plating 4xl04 mCherry expressing target cells into a 96-well flat bottom plate (Corning Costar). T cells were added to the appropriate E:T and cultured in the Incucyte Zoom imaging system (Essen Bioscience, Ann Arbor, MI) for 120 hours at 37 °C, 5% COz. 120 lU/mL of IL-2 was added thrice weekly. Cultures were imaged every 4 hours, and the mCherry signal emitted from target cells were quantified.
Proliferation assay
[00226] Transduced T cells were cultured with or without lOOGy gamma-irradiated MOLT -4 at E:T of 1 : 1 in a 96-well flat bottom plate. 120 lU/mL of IL-2 was added thrice weekly. GFP-positive cells representing the transduced T cells were enumerated every 7 days with the Accuri C6 Plus cytometer. Irradiated MOLT-4 was replenished every 7 days to maintain a 1: 1 ratio.
TCR activation assay
[00227] The hepatitis B virus peptide SI 83 and a TCR construct binding to the peptide in the context of HLA-A2 were gifts from Prof. Antonio Bertoletti (Duke-NUS, Singapore). The TCR was expressed in T cells by retroviral vector transduction as described above. HLA-A2-expressing T2 cells were pulsed with 1 pg/mL of the SI 83 peptide for 1 hour at 37 °C and co-cultured at 1 : 1 ratio in a 96-well round bottom plate with T cells for 24 hours at 37 °C, in the presence of 200 lU/mL of IL-2. T cells were either non transduced, transduced with a vector containing the anti-CD8 PEBL linked with the TCR by an internal ribosomal entry site (IRES), or with a vector containing TCR only. After 24 hours, cells were stained with PE-conjugated anti-CD25 (clone 2A3; BD Biosciences), Peridinin-chlorophyll-protein complex conjugate (PerCP)-conjugated anti- CD3 (clone SK7; BD Biosciences), PECy7-conjugated anti-CD4, and APC-conjugated
anti-CD8 (clone BW135/80; Miltenyi Biotec). Stained cells were analyzed using the Fortessa flow cytometer. Killing of T2 cells was measured by flow cytometry after labelling T2 cells with calcein AM-red orange.
Example 2: Design and Expression of an Anti-CD8 CAR
[00228] To target CD8, an anti-CD8 CAR was designed by linking the humanized scFv of the anti-CD8a antibody OKT8 with the hinge and transmembrane domain of CD8oc, and the signaling domains of 4-1BB (CD137) and CD3zeta (Fig. 1) using the methods described in Example 1. The resulting CAR construct was inserted into an MSCV gamma- retroviral vector together with a DNA sequence encoding GFP. After retroviral transduction into CD8-negative NK92 cells, transduced cells marked by GFP expression also expressed the anti-CD8 CAR (Fig. 2).
Example 3: Expression of anti-CD8 CAR in NK92 cells induces specific cytotoxicity of CD8-positive target cells
[00229] Cytotoxicity Assay by the methods described in Example 1 was performed using the anti-CD8 CAR of Example 2. MOLT-4 (CD8+) and Jurkat (CD8-) target cells were labelled with calcein-AM red orange and co-cultured with NK92 cells transduced with GFP only (“Mock”) or GFP plus anti-CD8a-4 l BB-CD33 CAR at effector to target ratio (E:T) of 1:2, 1 :4, 1:8 for 4 hours at 37 °C. (*** P < 0.001, **** P < 0.0001).
[00230] The results demonstrate that NK92 cells exerted significantly higher cytotoxicity against CD8-positive MOLT-4 leukemia cells when they expressed the anti- CD8 CAR (Fig. 3; left panel). By contrast, no gains in cytotoxicity were observed with CD8-negative Jurkat leukemia target cells (Fig. 3; right panel).
Example 4: Expression of anti-CD8 CAR in T lymphocytes is associated with reduced CD8-positive cell viability
[00231] Peripheral blood T lymphocytes were stimulated with anti-CD3/anti-CD28 antibodies (Transact, Miltenyi Biotec) for 2 days and then transduced with a bicistronic vector to express either GFP only (“Mock”) or GFP plus anti-CD8oi-41BB-CD3^ CAR. After two days, expression of anti-CD8 CAR was determined by the method outlined in Example 1. The resulting cells expressed both anti-CD8 CAR and GFP (Fig. 4).
Expression of anti-CD8 CAR in T lymphocytes induces killing of lymphocytes. T lymphocytes were with either GFP only (“Mock”) or GFP plus anti-CD8o.-4 l BB-CD33
CAR. Mock and CAR T lymphocytes were harvested and viable cells enumerated 48 hours later
[00232] In contrast with anti-CD8 CAR expression in NK92 cells, anti-CD8 CAR expression in peripheral T lymphocytes was associated with a markedly reduced cell recovery (Fig. 5). The mean recovery of T cells 48 hours after anti-CD8 CAR viral transduction was 9.6% of that of T cells mock transduced in parallel (Fig. 5). T lymphocytes transduced with GFP only (“Mock”) or anti-CD8 CAR were stained with PE- conjugated anti-CD8 antibody, PECy7-conjugated anti-CD4 antibody, and APC- conjugated anti-CD3 antibody. Flow cytometric plots show CD4 and CD8 expression in GFP+ CD3+ cells. Analysis of expression of CD4 and CD8 after transduction, showed that CD8 positive cells had largely disappeared and most of the remaining viable cells were CD4-positive (Fig. 6). These results demonstrate fratricide among CD8 positive T cells expressing an anti-CD8 CAR.
Example 5: Identification of an anti-CD8a PEBL that effectively downregulates CD8 expression in T lymphocytes
100233| To downregulate CD8 expression, Protein Expression Blockers (PEBLs), i.e., scFvs linked to peptides that anchor them to the endoplasmic reticulum and/or Golgi apparatus were used. Five PEBLs constituted by the scFv of OKT8 linked to the ER retention domain KYKSRRSFIEEKKMP (EEKKMP) and AEKDEL were designed (Fig.
7). MOLT-4 cells were transduced with a retroviral vector containing either with GFP alone “Mock”, or GFP plus the indicated PEBLs. Transduced MOLT-4 were surface stained with PE-conjugated anti-CD8 antibody, PEcy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody. Dot plots represent GFP+ cells. Following transduction, PEBLs markedly reduced expression of CD8 on the surface of MOLT-4 (Fig
8). PEBL expression in transduced MOLT-4 was confirmed by intracellular staining with biotin-conjugated goat anti-human F(ab’)2 antibody followed by phycoerythrin (PE)- conjugated streptavidin conjugated to PE after permeabilization with BD Cytofix/Cytoperm. Histograms show levels of anti-CD8 PEBL expression in GFP-positive cells (Fig 9).
[00234] Similar results were observed in T lymphocytes (Figs. 10). T lymphocytes were transduced with GFP only (“Mock”), or GFP plus the indicated PEBLs. Transduced T lymphocytes were stained with PE-conjugated anti-CD8 antibody, Pecy7-conjugated anti- CD4 antibody, and APC-conjugated anti-CD3 antibody. Symbols indicate CD8 MFI in
CD3+/CD4- cells expressing GFP. Mock and anti-CD8-EEKKMP were transduced in 7 donors. Bi(20)-anti-CD8-EEKKMP was transduced in 4 donors. Bi(5)-anti-CD8- EEKKMP was transduced in 6 donors. Anti-CD8(20)AEKDEL and bi(5)-Anti- CD8(20)AEKDEL were transduced in 2 donors ( **** P < 0 0001). Surface CD8 expression was reduced by all PEBLs among GFP-expressing CD4-negative T lymphocytes (Fig. 10). Anti-CD8 PEBLs were well expressed in T lymphocytes (Fig. 11). The anti-CD8-EEKKMP PEBL had the highest expression (Fig 11) and produced the greatest downregulation of CD8 (Fig. 10). Downregulation was sustained for at least 25 days (Fig 12) As the transduction efficiency of PEBLs containing a single or double scFv was different, surface CD8 expression was analyzed according to levels of GFP expression (Fig 13). A regression analysis based on GFP and CD8 MFI among CD3+, CD4- cells expressing GFP was performed. The analysis revealed that, the presence of 1 or 2 scFv in the PEBL produced comparable reduction of surface CD8 (Fig. 13). The results demonstrate that the cells with the highest GFP expression, indicative of high anti-CD8 PEBL expression, also had the greatest reduction in cell surface CD8 levels. The anti- CD8-EEKKMP was used as an exemplary anti-CD8 PEBL for subsequent studies.
Example 6: Sequential transduction of anti-CD8 PEBL and anti-CD8 CAR suppresses fratricide and improves killing of CD8+ target cells
[00235] The example demonstrates that reducing CD8 surface expression with an anti- CD8 PEBL improves the recovery of anti-CD8 PEBL CAR-T cells and allows them to exert higher cytotoxicity against CD8-positive cells. Peripheral blood T lymphocytes were transduced with either anti-CD8-EEKKMP or a vector containing GFP alone (Mock). Half of the cells were transduced with an anti-CD8 CAR on the next day and harvested on the third day. As shown in Fig. 14, the CAR was highly expressed regardless of the construct used in the preceding transduction. To measure the effects of anti-CD8-EEKKMP and anti-CD8 CAR on CD4 positive and CD8 positive T cells, the transduced cells were surface stained with PE-conjugated anti-CD8 antibody, PECy7-conjugated anti-CD4 antibody, and APC-conjugated anti-CD3 antibody and then analyzed by flow cytometry with a gate on GFP+ and CD3+ cells. Anti-CD8 CAR expression substantially reduced the percentage of CD8 positive cells, even without expression of the anti-CD8-EEKKMP PEBL (Fig. 15). Anti-CD8 CAR expression also substantially reduced the number of viable cells, and this effect was reversed by expressing the anti-CD8-EEKKMP PEBL (Fig. 16). In combination, these results indicate that the anti-CD8 CAR induced fratricide
of CD8 positive T cells, and that fratricide could be prevented by expressing the anti-CD8- EEKKMP PEBL.
[00236] A cytotoxicity assay was performed to determine the effect of the anti-CD8 PEBL on T cell activity. T lymphocytes were first transduced with GFP only (“Mock”) or GFP plus anti-CD8-EEKKMP. Half of the transduced T lymphocytes were sequentially transduced with GFP plus anti-CD8 CAR. Transduced T lymphocytes were co-cultured with calcein-AM red orange labelled CD8 positive MOLT-4 cells at E:T of 2: 1, 1:1, and 1:2 for 4 hours. (* P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001). The anti-CD8- PEBL (EEKKMP) CAR-T cells exerted significantly higher cytotoxicity against CD8- positive MOLT-4 target cells than T lymphocytes expressing the anti-CD8 CAR but without PEBL transduction and CD8 downregulation (Fig. 17). These results demonstrate that reduced CD8 expression surprisingly enhances the cytotoxic activity of anti-CD8 CAR T cells.
Example 7: Expression of anti-CD8 PEBL does not impair T cell function driven by the TCR
[00237] The effect of PEBL-mediated downregulation in T cells engineered to express the HLA-A201 restricted S183 TCR was tested. T lymphocytes were transduced with either anti-CD8-EEKKMP PEBL linked to the HLA-A201 restricted SI 83 TCR via an internal ribosomal entry site (IRES), or IRES-TCR. T2 target cells were pulsed with the SI 83 peptide and labelled with calcein AM-red orange. Subsequently the labeled T2 cells were co-cultured with non-transduced T cells, T cells expressing TCR only, or with T cells expressing TCR and PEBL. Non-transduced, IRES-TCR, or PEBL-IRES-TCR transduced T lymphocytes were co-cultured for 4 hours with T2 cells that were pulsed with the SI 83 peptide and labelled with calcein AM at E:T of 2: 1, 1 : 1, and 1:2. (**** p < 0.0001). The results showed, T cells expressing TCR with or without PEBL exerted similar cytotoxicity against pulsed T2 target cells (Fig. 18).
[00238] To investigate the effects of reduced CD8 expression on T cell activation via T cell receptors, T lymphocytes were transduced with either anti-CD8-EEKKMP linked to the HLA-A201 restricted S183 TCR via an internal ribosomal entry site (IRES), or IRES- TCR with pulsed T2 at a 1 : 1 ratio for 24 hours. Non-transduced, IRES-TCR, or PEBL- IRES-TCR transduced T lymphocytes were co-cultured for 24 hours with or without T2 that were pulsed with the SI 83 peptide. The cells were subsequently stained with PE- conjugated anti-CD25, PerCP-conjugated anti-CD3, PECy7-conjugated anti-CD4, and
APC-conjugated anti-CD8 antibodies. Flow cytometric plots and graph show CD25 and CD8 expression in CD3+ CD4- cells. (**** P < 0.0001). T2 cells displaying the S183 peptide induced CD25 expression (T cell activation) by T cells expressing the HLA-A201 restricted SI 83 TCR, with or without anti-CD8 PEBL, but did not activate control T cells not expressing the SI 83 TCR (Fig. 19), indicating that the anti-CD8 PEBL did not impair T cell activation mediated by TCR.
Example 8: Expression of anti-CD8 CAR on CDS knockout cells improves their cytotoxicity
[00239] Recovery of cytotoxic T cells after anti-CD8 CAR transduction was tested. Anti-CD8 CAR was transduced in T cells which had been subjected to CD8 knockout (CD8KO-CAR), or not (Cas9-CAR). Cells were enumerated on days 3, 7, and 10 after transduction. CD4-negative cells were identified by flow cytometry using PE-conjugated anti-human CD8 and PECy7-conjugated anti-human CD4 antibodies. The number of CD8- knockout cells were higher than that of CD8-wildtype cells, as shown in Fig. 20. It suggests that CD8 knockout by CRISPR-Cas9 improves recovery of cytotoxic T cells after anti-CD8<x-41BB-CD3^ CAR transduction.
[00240] To further investigate the effects of CD8 knockout on cytotoxicity against CD8+ cell lines, T cells electroporated with NLS-Cas9 alone (“Cas9”) or a complex of NLS-Cas9 and CD8oc gRNA (“CD8KO”) were transduced with either GFP only or anti- CD8 CAR and GFP. MOLT-4 (Fig. 21A) and CCRF-CEM (Fig. 21B) cells labelled with calcein-AM red-orange were co-cultured with transduced T cells at E:T of 2:1, 1: 1, and 1:2 for 4 hours. CD8-knockout cells that expressing anti-CD8 CAR had a higher cytotoxicity rate against both MOLT-4 and CCRF-CEM cells, as shown in Figs. 21A and 21 B. It suggests that expression of anti-CD8 CAR on CD8 knockout T cells improves cytotoxicity against CD8+ cell lines.
[00241] To test the duration of cytotoxicity of CD8-knockout CAR-expressing cells against CD8+ cells lines, T cells electroporated with NLS-Cas9 alone (“Cas9”) or a complex of NLS-Cas9 with CD8ot gRNA (“CD8KO”) were transduced with either GFP only or anti-CD8 CAR and GFP. Transduced T cells were co-cultured with mCherry- expressing MOLT-4 (Fig. 22A) or CCRF-CEM (Fig 22B) at the indicated ratio in flatbottom 96-well plates. Cytotoxicity of CD8-knockout cells was higher than CD8-wildtype counterparts at 40 hour, 80 hours, and 120 hours against both MOLT-4 and CCRF-CEM, as shown in Figs. 22A and 22B. Therefore, anti-CD8 CAR-T cells with CD8 knockout
induce greater long-term cytotoxicity against CD8+ leukemic cell lines than CAR-T cells without CD8 knockout.
[00242] To test proliferation of CD8-knockout CAR-expressing cells, T cells with CD8 knockout were transduced with GFP only or anti-CD8 CAR and GFP, and co-cultured with or without lOOGy irradiated MOLT-4 at 1:1 in triplicates. CD8-knockout cells that expressed anti-CD8 CAR proliferated faster in the presence of MOLT-4 cells compared to in the absence of MOLT-4 cells, as shown in Fig. 23. It suggests that anti-CD8 CAR-T cells with CD8 knockout proliferate in the presence of CD8+ target cells.
[00243] The teachings of all patents, published applications and references cited herein are incorporated by reference in their entirety.
EQUIVALENTS
[00244] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Some aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A recombinant nucleic acid molecule encoding an anti-CD8 chimeric antigen receptor (CAR), wherein the anti-CD8 CAR comprises: an antigen binding domain which binds to CD8, a transmembrane domain, and an intracellular signaling domain.
2. The recombinant nucleic acid molecule of claim 1, wherein the antigen binding domain is a single-chain variable region (scFv) or a single domain antibody.
3. The recombinant nucleic acid molecule of claim 1 or 2, wherein the antigen binding domain comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region
3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of: i. SEQ ID NOs: 1-6, respectively; or ii. SEQ ID NOs: 7-12 respectively.
4. The recombinant nucleic acid molecule of any one of claims 1-3, wherein the antigen binding domain comprises: a) i. a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13; ii. an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13, or
iii. an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13; and b) i. a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; ii. an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14, or iii an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
5. The recombinant nucleic acid molecule of any one of claims 1-3, wherein the antigen binding domain comprises: i. an amino acid sequence as set forth in SEQ ID NO: 25; ii. an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 25; or iii. an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25
6. The recombinant nucleic acid molecule of any one of claims 1-5, wherein the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the CD8a, CD8 , 4-1BB, CD28, CD34, CD4, FceRIy, CD16, 0X40, CD3i CD3e, CD3y, CD35, TCRa, CD32, CD64, VEGFR2, FAS, or FGFR2B.
7. The recombinant nucleic acid molecule of any one of claims 1-6, wherein the transmembrane domain comprises a sequence of SEQ ID NO: 37.
8. The recombinant nucleic acid molecule of any one of claims 1-7, wherein the transmembrane domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 37, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 37.
9. The recombinant nucleic acid molecule of any one of claims 1 -8, wherein the antigen binding domain is connected to the transmembrane domain by a hinge region.
10. The recombinant nucleic acid molecule of any one of claims 1-9, wherein the intracellular signaling domain comprises a sequence encoding a costimulatory domain.
11. The recombinant nucleic acid molecule of any one of claims 1-10, wherein the intracellular signaling domain comprises a sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41.
12. The recombinant nucleic acid molecule of any one of claims 1 -1 1 , wherein the intracellular signaling domain comprises an amino acid sequence having at least one, two or three modifications but not more than 20, 10 or 5 modifications of an amino acid sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41, or a sequence with 95-99% identity to an amino acid sequence of SEQ ID NO: 39 and/or SEQ ID NO: 41.
13. A CAR encoded by the recombinant nucleic acid of any one of claims 1-12.
14. A vector comprising a nucleic acid sequence encoding the CAR of any one of claims 1-12 or the CAR of claim 13.
15. The vector of claim 14, wherein the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, or a retrovirus vector.
16. The vector of claim 14 or 15, further comprising a promoter, optionally wherein the promoter is selected from a group consisting of an EF-1 promoter, a MSCV promoter, SC40 promoter, a CMV promoter, or a PGK promoter
17. A method of engineering an immune cell comprising transducing the immune cell with the recombinant nucleic acid of any one of claims 1 -12, the CAR of claim 13, or the vector of any one of claims 14-16.
18. The method of claim 17, wherein the immune cell is an autologous T cell.
19. The method of claim 17, wherein the immune cell is an allogeneic T cell.
20. A recombinant nucleic acid molecule encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain linked to an intracellular localizing domain, wherein the intracellular localizing domain comprises a retention sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteosome localizing sequence.
21. The recombinant nucleic acid molecule of claim 20, wherein the anti-CD8 binding domain is a scFv or a single domain antibody.
22. The recombinant nucleic acid molecule of claim 21, wherein the scFv comprises a CD8 binding domain comprising: a) i. a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13;
ii. an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13, or iii. an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13; and b) i. a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; ii. an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14, or iii. an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
23. The recombinant nucleic acid molecule of claim 22, wherein the CD8 binding domain comprises: i) an amino acid sequence as set forth in SEQ ID NO: 25; ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 25; or iii) an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25.
24. The recombinant nucleic acid molecule of any of claims 20-23, wherein the intracellular localizing domain comprises an amino acid sequence as set forth in any one of the SEQ ID NOs: 56, 58, 61, 63, 64, 65, 68, 74, or 75.
25. The recombinant nucleic acid molecule of any of claims 19-24, wherein the intracellular localizing domain comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 56, 58, 61, 63, 64, 66, or 67.
26. The recombinant nucleic acid molecule of any one of claims 20-25, wherein the intracellular localizing domain comprises one or more of a Golgi retention sequence, an ER retention sequence, a proteosome localizing sequence.
27. The recombinant nucleic acid molecule of claim 26, wherein the ER retention sequence comprises a KDEL sequence and the CD8 blocking polypeptide further comprising a linker between the scFv and the intracellular localizing domain.
28. The recombinant nucleic acid molecule of claim 26, wherein the ER retention sequence comprises a KKXX sequence, wherein X represents any amino acid.
29. The recombinant nucleic acid molecule of claim 26, wherein the Golgi retention comprises YQRL (SEQ ID NO: 65), YGRL (SEQ ID NO: 74), or YKGL (SEQ ID NO: 75).
30. The recombinant nucleic acid molecule of claim 26, wherein the proteosome localizing sequence comprises PEST.
31. A CD8 blocking polypeptide encoded by the recombinant nucleic acid of any one of claims 20-30.
32. A vector comprising a nucleic acid molecule encoding the CD8 blocking polypeptide of any one of claims 20-30, or a CD8 blocking polypeptide of claim 31.
33. The vector of claim 32, wherein the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, or a retrovirus vector.
34. The vector of claim 32 or 33, further comprising a promoter, optionally wherein the promoter is selected from a group consisting of an EF-1 promoter, a MSCV promoter, SC40 promoter, a CMV promoter, or a PGK promoter
35. A method of modifying a cell comprising transducing or transfecting a cell with the vector of any one of claims 32-34.
36. An engineered immune cell comprising the recombinant nucleic acid of any one of claims 1-12 or 20-30, the CAR of claim 13, the CD8 blocking polypeptide of claim 31, or the vector of any one of claims 14-16 or 32-34.
37. An engineered immune cell comprising: a nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered immune cell.
38. An engineered immune cell comprising: a nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising an anti- CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR).
39. An engineered immune cell comprising:
(i) a first nucleic acid encoding a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence, and wherein the CD8 blocking polypeptide reduces cell surface expression of endogenous CD8 within the engineered immune cell; and
(ii) a second nucleic acid encoding a CD8 chimeric antigen receptor (CAR) comprising the anti-CD8 binding domain, a transmembrane domain, and a signaling domain (anti-CD8 CAR), optionally wherein the CD8 blocking polypeptide remains intracellularly within the engineered immune cell and binds endogenous CD8 within the engineered immune cell.
40. The engineered immune cell of any one of claims 36-39, wherein the anti-CD8 binding domain is a scFv or a single domain antibody.
41. The engineered immune cell of claim 40, wherein the scFv of the CD8 blocking polypeptide or the scFv of the CAR comprises a heavy chain variable region (VH) comprising a heavy chain complementary determining region 1 (HC CDR1), a heavy chain complementary determining region 2 (HC CDR2), and a heavy chain complementary determining region 3 (HC CDR3), and a light chain variable region (VL) comprising a light chain complementary determining region 1 (LC CDR1), a light chain complementary determining region 2 (LC CDR2), and a light chain complementary determining region 3 (LC CDR3), wherein the HC CDR1, HC CDR2, HC CDR3, LC CDR1, LC CDR2, and LC CDR3 comprise the amino acid sequences of:
(i) SEQ ID NOs: 1-6, respectively; or
(ii) SEQ ID NOs: 7-12 respectively.
42. The engineered immune cell of claim 41, wherein the scFv of the CD8 blocking polypeptide and/or the scFv of the CAR comprises a)
(i) a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13;
(ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13, or
(iii) an amino acid sequence with 95-99% identity to the amino acid sequence of the heavy chain variable region as set forth in SEQ ID NO: 13; and b)
(i) a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14;
(ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14, or
(iii) an amino acid sequence with 95-99% identity to the amino acid sequence of the light chain variable region as set forth in SEQ ID NO: 14.
43. The engineered immune cell of claim 42, wherein the scFv of the CD8 blocking polypeptide or the scFv of the CAR comprises:
(i) an amino acid sequence as set forth in SEQ ID NO: 25;
(ii) an amino acid sequence having at least one, two or three modifications but not more than 30, 20 or 10 modifications of the amino acid sequence as set forth in SEQ ID NO: 25; or
(iii) an amino acid sequence with 95-99% identity to the amino acid sequence as set forth in SEQ ID NO: 25.
44. The engineered immune cell of any one of claims 36-37 or 39-43, wherein i) the ER retention sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 66 and SEQ ID NO: 67; ii) the Golgi retention sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 65, SEQ ID NO: 64, SEQ ID NO: 74, and SEQ ID NO: 75; or iii) the proteosome localizing sequence. Comprises an amino acid sequence as set forth in SEQ ID NO: 68.
45. The engineered immune cell of any one of claims 36-37 or 39-44, wherein the CD8 blocking polypeptide further comprises a transmembrane domain linked between the scFv and the ER retention sequence comprising KKMP, wherein the transmembrane domain is a transmembrane domain selected from the group consisting of CD8 alpha,
CD8 beta, 4-1BB, CD28, CD34, CD4, FceRIgamma, CD16, 0X40, CD3zeta, CD3epsilon, CD3gamma, CD35, TCRalpha, CD32, CD64, VEGFR2, FAS, and FGFR2B.
46. The engineered immune cell of claim 45, wherein the transmembrane domain comprises an amino acid sequence of SEQ ID NO: 34
47. The engineered immune cell of any one of claims 36-37 or 39-46, wherein the CD8 blocking polypeptide comprises an amino acid sequence having at least 90% sequence identity to any one of the sequences selected from the group consisting of SEQ ID NOs: 45-47, 79-81, and 95-98.
48. The engineered immune cell of any one of claims 36-47, wherein the transmembrane domain is selected from an alpha, beta, or zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, GDI 6, CD22, CD33, CD37, CD64, CD80, CD86, 0X40 (CD134), 4-1BB (CD137), and CD1.
49. The engineered immune cell of claim 48, wherein the transmembrane domain is a CD8a transmembrane domain.
50. The engineered immune cell of any of claims 36-49, wherein the engineered immune cell has a reduced CD8 expression.
51. An engineered immune cell comprising a recombinant nucleic acid molecule encoding an anti-CD8 chimeric antigen receptor (CAR), wherein the anti-CD8 CAR comprises an antigen binding domain which binds to CD8, a transmembrane domain, and a signaling domain, and wherein the engineered immune cell has reduced expression of endogenous CD8.
52. The engineered immune cell of any one of claims 36-51, wherein the endogenous CD8 of the engineered immune cell is knocked out or knocked down.
53. The engineered immune cell of any one of claims 36-52, wherein the endogenous CD8 of the engineered immune cell is knocked out via zinc-finger endonucleases, TALEN, or CRISPR-Cas9
54. The engineered immune cell of any one of claims 36-52, wherein the endogenous CD8 of the engineered immune cell is knocked down via siRNA or shRNA.
55. The engineered immune cell of any one of claims 36-52, wherein the endogenous CD8 of the engineered immune cell is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and
wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence.
56. The engineered immune cell of claim 55, wherein the anti-CD8 binding domain is a scFv or a single domain antibody
57. The engineered immune cell of any one of claims 36-56, wherein the engineered cell comprises a population of engineered cells, and wherein cytotoxic T cells in the population of engineered cells is at least about 50 times more than cytotoxic T cells otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after transduction and culturing for a period of time.
58. The engineered immune cell of claim 57, wherein the period of time is at least about 2 days, at least about 3 days, at least about 5 days or more.
59. The engineered immune cell of any one of claims 36-56, wherein the engineered cell comprises a population of engineered cells, and wherein viability of cytotoxic T cells in the population of engineered cells is at least about 2 times, at least about 5 times, at least about 10 times, at least about 25 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, or at least about 500 times higher compared to an otherwise identical population of cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
60. The engineered immune cell of any one of claims 36-56, wherein cytotoxicity of the engineered immune cell against target cells is at least about 1.2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, or at least about 3 times higher compared to an otherwise identical cell expressing the anti- CD8 CAR without the reduced expression of endogenous CD8.
61. The engineered immune cell of claim 60, wherein the cytotoxicity is tested at an effector-target ratio of 2: 1, 1 : 1, or 1 :2.
62. The engineered immune cell of claim 60 or 61, wherein the target cells are CD8- positive cells, comprising MOLT-4 and/or CCRF-CEM.
63. The engineered immune cell of any one of claims 36-57, wherein cytotoxicity of the engineered immune cell against target cells is at least about 1 .2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, at least about 3 times, or at least about 4 times higher compared to an otherwise identical cell expressing the anti-CD8 CAR without the reduced expression of endogenous
CD8 after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culturing with the target cells.
64. The engineered immune cell of claim 63, wherein the cytotoxicity is tested at an effector-target ratio of 1 : 1 , 1 :2, 1 :4, or 1 : 8.
65. The engineered immune cell of claim 63 or 64, wherein the target cells are CD8- positive cells.
66. The engineered immune cell of any one of claims 36-65, wherein proliferation of the engineered immune cell in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, or at least about 5 times higher compared to proliferation of the engineered immune cell in the absence of the target cells.
67. The engineered immune cell of any one of claims 36-65, wherein proliferation of the engineered immune cell in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, or at least about 10 times higher compared to an otherwise identical cell with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
68. The engineered immune cell of claim 66 or 67, wherein the proliferation of engineered immune cell is tested at an effector-target ratio of 1 : 1.
69. The engineered immune cell of any one of claims 66-68, wherein the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days of culturing the engineered immune cell in the presence or absence of the target cells.
70. The engineered immune cell of any one of claims 66-69, wherein the target cells are CD8-positive cells.
71. An engineered immune cell comprising a CD8 blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and a CD8 chimeric antigen receptor (CAR) comprising an anti-CD8 binding domain, optionally wherein the CD8 blocking polypeptide remains intracellularly within the engineered cell and binds endogenous CD8 within the engineered cell.
72. An engineered immune cell of claim 71, wherein the anti-CD8 binding domain is a scFv or a single domain antibody.
73. A pharmaceutical composition comprising the recombinant nucleic acid of any one of claims 1 -12 or 20-30, the CAR of claim 13, the CD8 blocking polypeptide of claim
31, the vector of any one of claims 14-16 or 32-34, or an engineered immune cell of any one of claims 36-72, optionally further comprising an excipient.
74. A method of providing anti -cancer immunity to a mammal comprising administering to the mammal the recombinant nucleic acid of any one of claims 1-12 or 20-30, a CAR of claim 13, the CD8 blocking polypeptide of claim 31, the vector of any one of claims 14-16 or 32-34, the engineered immune cell of any one of claims 36-71, or a pharmaceutical composition of claim 73
75. A method of treating a disease in a subject in need thereof comprising administering a pharmaceutical composition comprising an immune cell comprising a CD8 chimeric antigen receptor (CAR) comprising a CD8 binding domain, a transmembrane domain, and a signaling domain.
76. The method of claim 75, wherein the immune cell is engineered to have reduced cell surface expression of CD8.
77. The method of claim 75 or 76, wherein the immune cell further comprises a chimeric polypeptide comprising a CD8 binding domain and an intracellular localization do in.
78. The method of any one of claims 75-77, wherein the disease is a T cell malignancy or a NK cell malignancy.
79. A method of reducing fratricide in a population of immune cells expressing a chimeric antigen receptor comprising a CD8 binding domain, the method comprising expressing a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an amino acid sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteosome localizing sequence, and wherein the CD8 blocking polypeptide remains intracellularly within the immune cells and binds endogenous CD8 within the immune cells.
80. The method of claim 79, wherein the CD8 binding domain is an scFv or a single domain antibody.
81. A method of treating a cancer in a subject in need thereof comprising administering to the subject an recombinant nucleic acid of any of claims 1-12 or 20-30, a CAR of claim 13, a CD8 blocking polypeptide of claim 31, a vector of any of claims 14-16 or
32-34, an engineered immune cell of any of claims 36-71 , or a pharmaceutical composition of claim 73.
82. The method of claim 81, wherein the immune cell is engineered to have reduced cell surface expression of CD8
83. A method of treating cancer in a subject in need thereof comprising administering a therapeutic amount of a composition comprising an engineered immune cell comprising:
(i) a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain, wherein the intracellular localizing domain comprises an amino acid sequence selected from the group consisting of an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteosome localizing sequence, and wherein the CD8 blocking polypeptide remains intracellularly within the engineered immune cell and binds endogenous CD8 within the engineered immune cell; and
(ii) a chimeric antigen receptor (CAR) comprising a CD8 binding domain, a transmembrane domain, and a signaling domain.
84. A method of claim 83, wherein the CD8 binding domain is a scFv or a single domain antibody.
85. A method of providing an anti-cancer immunity in a mammal comprising administering to the mammal an immune cell expressing a CAR molecule of any one of the preceding claims.
86. The method of claim 85, wherein the immune cell is an autologous T cell.
87. The method of claim 84, wherein the immune cell is an allogeneic T cell.
88. Use of an recombinant nucleic acid of any one of claims 1-12 or 20-30, the CAR of claim 13, the CD8 blocking polypeptide of claim 31, the vector of any one of claims 14-16 or 32-34, the engineered immune cell of any one of claims 36-71, or the pharmaceutical composition of claim 73 in the manufacture of a medicament for the treatment of a cancer, in a subject in need thereof.
89. A method of reducing and/or preventing fratricide during manufacturing of immune cells expressing an anti-CD8 CAR, comprising functional inhibition of CD8 signaling during the manufacturing process of the cells.
90. The method of claim 89, wherein the functional inhibition of CD8 signaling comprises reducing expression of endogenous CD8 of the immune cells.
91. The method of claim 89 or 90, wherein the endogenous CD8 of the immune cells is knocked out or knocked down.
92. The method of any one of claims 89-91, wherein the endogenous CD8 of the immune cells is knocked out via zinc-finger endonucleases, TALEN, or CRTSPR-Cas9.
93. The method of any one of claims 89-92, wherein the endogenous CD8 of the immune cells is knocked down via siRNA or shRNA.
94. The method of claim 89 or 93, wherein the endogenous CD8 of the immune cells is knocked down by using a blocking polypeptide comprising an anti-CD8 binding domain and an intracellular localizing domain, and wherein the intracellular localizing domain comprises an endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, or a proteosome localizing sequence.
95. The method of claim 94, wherein the anti-CD8 binding domain is a scFv or a single domain antibody.
96. The method of any one of claims 89-95, wherein viability of cytotoxic T cells among the immune cells is at least about 1.1 times, at least about 5 times, at least about 10 times, at least about 25 times, at least about 50 times, at least about 75 times, at least about 100 times, at least about 200 times, or at least about 500 times higher compared to otherwise identical cytotoxic T cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
97. The method of any one of claims 89-96, wherein cytotoxicity of the immune cells against target cells is at least about 1.2 times, at least about 1.5 times, at least about 1.7 times, at least about 2 times, at least about 2.5 times, or at least about 3 times higher compared to otherwise identical immune cells expressing the anti-CD8 CAR without the reduced expression of endogenous CD8.
98. The method of claim 97, wherein the cytotoxicity is tested at an effector-target ratio of2:l, 1 : 1, or 1:2.
99. The method of claim 97 or 98, wherein the target cells are CD8-positive cells.
100. The method of any one of claims 89-96, wherein cytotoxicity of the immune cells against target cells is at least about 1.2 times, at least about 1.5 times, at least about 1 .7 times, at least about 2 times, at least about 2.5 times, at least about 3 times, or at least about 4 times higher compared to otherwise identical immune cells and expressing the anti-CD8 CAR without the reduced expression of endogenous CD8 after 20 hours, 40 hours, 80 hours, 120 hours, 1 week, or 2 weeks of co-culturing with the target cells.
101. The method of claim 100, wherein the cytotoxicity is tested at an effector-target ratio of 1 :1, 1 :2, 1 :4, or 1 :8.
102. The method of claim 100 or 101, wherein the target cells are CD8-positive cells.
103. The method of any one of claims 89-102, wherein proliferation of the immune cells in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, or at least about 5 times higher compared to the immune cells in the absence of the target cells as claimed here.
104. The method of any one of claims 89-102, wherein proliferation of the immune cells in the presence of target cells is at least about 1.2 times, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, or at least about 10 times higher compared to otherwise identical immune cells with enforced reduction in CD8 expression but without expression of the anti-CD8 CAR.
105. The method of claim 103 or 104, wherein the immune cells and the target cells are at an effector-target ratio of 1 : 1 .
106. The method of any one of claims 103-105, wherein the proliferation is tested at about 2 days, about 4 days, about 7 days, about 10 days, about 14 days, or about 20 days of culturing the immune cells in the presence or absence of the target cells.
107. The method of any one of claims 103-106, wherein the target cells are CD8-positive cells.
108. A method of manufacturing an engineered immune cell comprising:
(i) transducing an immune cell with a vector comprising a polynucleotide sequence encoding a CD8 blocking polypeptide comprising a CD8 binding domain and an intracellular localizing domain; and
(ii) transducing the immune cell with a vector comprising a polynucleotide sequence encoding a CD8 chimeric antigen receptor (anti-CD8 CAR) comprising a CD8 binding domain, a transmembrane domain, and a signaling domain.
109. The method of claim 108, wherein the CD8 binding domain of the CD8 blocking polypeptide or the CD8 binding domain of the anti-CD8 CAR comprises an scFv or a single domain antibody.
110. The method of claim 108 or 109, wherein the intracellular localizing domain comprises an amino acid sequence selected from the group consisting of an
endoplasmic reticulum (ER) retention sequence, a Golgi retention sequence, and a proteosome localizing sequence
111. The method of any one of claims 108-110, wherein the CD8 blocking polypeptide remains intracellularly within the engineered immune cell and binds endogenous CD8 within the immune engineered cell.
112. The method of any one of claims 109-111, wherein the CD8 blocking polypeptide is expressed before the anti-CD8 CAR.
113. The method of claim 112, wherein the CD8 blocking polypeptide is expressed about one day before the anti-CD8 CAR.
114. The method of claim 113, wherein the CD8 blocking polypeptide is expressed at least one day before the anti-CD8 CAR.
115. The method of any one of claims 108-111, wherein the CD8 blocking polypeptide is expressed simultaneously with the anti-CD8 CAR.
116. The method of claim 115, wherein a bicistronic vector comprises sequences encoding the CD8 blocking polypeptide and the anti-CD8 CAR.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363438776P | 2023-01-12 | 2023-01-12 | |
| PCT/SG2024/050018 WO2024151213A2 (en) | 2023-01-12 | 2024-01-11 | Blockade of cd8 expression and chimeric antigen receptors for immunotherapy of t-cell and nk-cell malignancies |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4649093A2 true EP4649093A2 (en) | 2025-11-19 |
Family
ID=90366534
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24712613.9A Pending EP4649093A2 (en) | 2023-01-12 | 2024-01-11 | Blockade of cd8 expression and chimeric antigen receptors for immunotherapy of t-cell and nk-cell malignancies |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP4649093A2 (en) |
| JP (1) | JP2026502532A (en) |
| KR (1) | KR20250143881A (en) |
| CN (1) | CN120936625A (en) |
| AU (1) | AU2024207657A1 (en) |
| WO (1) | WO2024151213A2 (en) |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US611414A (en) | 1898-09-27 | Ellis r | ||
| WO1988001649A1 (en) | 1986-09-02 | 1988-03-10 | Genex Corporation | Single polypeptide chain binding molecules |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
| US5786464C1 (en) | 1994-09-19 | 2012-04-24 | Gen Hospital Corp | Overexpression of mammalian and viral proteins |
| LT3401400T (en) | 2012-05-25 | 2019-06-10 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| DK3309248T3 (en) | 2013-05-29 | 2021-08-02 | Cellectis | Method for manipulating T cells for immunotherapy using an RNA-guided CAS nuclease system |
| AU2015289644A1 (en) | 2014-07-15 | 2017-02-02 | Juno Therapeutics, Inc. | Engineered cells for adoptive cell therapy |
| US10765699B2 (en) | 2015-02-06 | 2020-09-08 | National University Of Singapore | Methods for enhancing efficacy of therapeutic immune cells |
| GB2557123B (en) | 2015-07-31 | 2021-11-03 | Univ Minnesota | Modified cells and methods of therapy |
| CN116271117A (en) * | 2018-09-28 | 2023-06-23 | 伊麦吉纳博公司 | CD8 imaging constructs and methods of use thereof |
-
2024
- 2024-01-11 CN CN202480018927.XA patent/CN120936625A/en active Pending
- 2024-01-11 EP EP24712613.9A patent/EP4649093A2/en active Pending
- 2024-01-11 JP JP2025540753A patent/JP2026502532A/en active Pending
- 2024-01-11 KR KR1020257026214A patent/KR20250143881A/en active Pending
- 2024-01-11 WO PCT/SG2024/050018 patent/WO2024151213A2/en not_active Ceased
- 2024-01-11 AU AU2024207657A patent/AU2024207657A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024151213A2 (en) | 2024-07-18 |
| WO2024151213A3 (en) | 2024-10-10 |
| JP2026502532A (en) | 2026-01-23 |
| AU2024207657A1 (en) | 2025-07-24 |
| CN120936625A (en) | 2025-11-11 |
| KR20250143881A (en) | 2025-10-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12479914B2 (en) | T cell receptor-deficient chimeric antigen receptor T-cells and methods of use thereof | |
| AU2016216149B2 (en) | Methods for enhancing efficacy of therapeutic immune cells | |
| JP2024045111A (en) | Method for producing and using guidance and navigation control proteins | |
| CN111247242A (en) | Chimeric Antigen Receptors (CARs), compositions and methods of use thereof | |
| CN110573177A (en) | ROR1-specific chimeric antigen receptor (CAR) with a humanized targeting domain | |
| JP2018504144A (en) | CLL1-specific multi-chain chimeric antigen receptor | |
| JP7584299B2 (en) | Blockade of CD2 surface expression and expression of chimeric antigen receptors for immunotherapy of T cell malignancies - Patent Application 20070123333 | |
| US20210214439A1 (en) | Chimeric antigen receptors and gene editing of cd2 for immunotherapy of t-cell malignancies | |
| TW202239768A (en) | Improved immune cell therapy | |
| US20260125644A1 (en) | Engineered immune cells expressing a car and a plurality of protein expression blockers and uses thereof | |
| AU2024207657A1 (en) | Blockade of cd8 expression and chimeric antigen receptors for immunotherapy of t-cell and nk-cell malignancies | |
| US20250325587A1 (en) | Blockade of cd3 expression and chimeric antigen receptors for immunotherapy | |
| KR20260005360A (en) | Coreceptor chimeric antigen receptor | |
| JP2026514993A (en) | Co-receptor chimeric antigen receptor | |
| WO2025006499A2 (en) | Gpc3-targeted molecules and uses thereof | |
| HK40117796A (en) | Immune cell therapy | |
| HK40101850A (en) | Improved immune cell therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250811 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) |