EP4623106A1 - Lnc-znf30-3 as cancer biomarker and therapeutic target - Google Patents

Lnc-znf30-3 as cancer biomarker and therapeutic target

Info

Publication number
EP4623106A1
EP4623106A1 EP23809589.7A EP23809589A EP4623106A1 EP 4623106 A1 EP4623106 A1 EP 4623106A1 EP 23809589 A EP23809589 A EP 23809589A EP 4623106 A1 EP4623106 A1 EP 4623106A1
Authority
EP
European Patent Office
Prior art keywords
znf30
lnc
cancer
expression
expression level
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23809589.7A
Other languages
German (de)
French (fr)
Inventor
Irina GROISMAN
Marina PINSKAYA
Matthieu LE HARS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Curie
Sorbonne Universite
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Curie
Sorbonne Universite
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Institut National de la Sante et de la Recherche Medicale INSERM, Institut Curie, Sorbonne Universite filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP4623106A1 publication Critical patent/EP4623106A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • Lnc-ZNF30-3 as cancer biomarker and therapeutic target
  • the present invention relates to the field of medicine, especially oncology. It provides diagnostic and prognostic biomarkers of cancer and therapeutic treatment of cancer.
  • PCa Prostate cancer
  • AR androgen receptor
  • the Gleason score a grading system based on histomorphological criteria, is currently used for predicting PCa prognosis, albeit it has a limited value.
  • EMT epithelial-to-mesenchymal transition
  • TWIST1 has been detected in several cancers, including PCa, where it promotes the escape of senescence, tumor initiation, metastasis, sternness, and drug resistance.
  • TWIST 1 seems to orchestrate transcriptional programs of both mesenchymal and epithelial genes that drive EMT reprogramming of cancer cells. It has been shown that TWIST 1 expression can be regulated by miRNAs such as miR- 145-5p targeting its 3’UTR (Khanbabaei, Teimoori, and Mohammadi 2016, Tumour Biol 37 (6): 7007-19. https://doi.org/10.1007/sl3277-016-4960-y; Rajabi et al.
  • IncRNAs can regulate miRNA functions. LncRNAs have been reported to be aberrantly expressed in PCa and contribute to tumor initiation and progression (Pinskaya et al. 2019, Life Sci Alliance 2 (6). https://doi.org/10.26508/lsa.201900449; Malik and Feng 2016, Asian J Androl 18 (4): 568-74. https://doi.org/10.4103/1008-682X.177123; Cheng, Zhang, and Wang 2013, Cancer Lett 339 (1): 8-14. https://doi.Org/10.1016/j.canlet.2013.07.008; Smolle et al. 2017, Int J Mol Sci 18 (2).
  • the present invention further relates to a pharmaceutical composition comprising an inhibitor of lnc-ZNF30-3, and optionally a pharmaceutically acceptable excipient; and to an inhibitor of lnc-ZNF30-3 or a pharmaceutical composition comprising said inhibitor for use as a drug, in particular for use in the treatment of cancer. It also relates to the use of an inhibitor of lnc-ZNF30-3 for the manufacture of a medicament for the treatment of cancer. It relates as well to a method for treating a subject having a cancer, wherein the method comprises administrating a therapeutically effective amount of an inhibitor of lnc-ZNF30-3to said patient.
  • FIG. 5A Representative images of cell monolayers at time zero (TO) and 24 hours post-scratch (T24) and quantification of the percentage of an unhealed wound at T24 in PC3a and PNT1A cells, transfected with siSCR or siLNC. White lines delineate wound edges.
  • Figure 5B RT-qPCR quantification of EMT marker expression in PC3a cells transfected with siSCR or siLNC. Each bar corresponds to a mean ⁇ SD relative to ACT1 expression for 3 replicates. *** and * correspond to p-values below 0.001 and 0.05, respectively.
  • Figure 5C Western blot analysis of EMT markers expression in PC3a and PNT1A cells transfected with siSCR or siLNC.
  • a response to treatment includes a reduction in cachexia, increase in survival time, elongation in time to tumor progression, reduction in tumor mass, reduction in tumor burden and/or a prolongation in time to tumor metastasis, time to tumor recurrence, tumor response, complete response, partial response, stable disease, progressive disease, progression free survival, overall survival, each as measured by standards set by the National Cancer Institute and the U.S. Food and Drug Administration for the approval of new drugs. See Johnson et al., J. Clin. Oncol., 2009; 21(7): 1404-1411.
  • nucleic acid molecule refers to an oligonucleotide, nucleotide or polynucleotide.
  • a nucleic acid molecule may include deoxyribonucleotides, ribonucleotides, modified nucleotides or nucleotide analogs in any combination.
  • complementary and complementarity are interchangeable and refer to the ability of polynucleotides to form base pairs with one another.
  • Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions.
  • Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G).
  • 100% complementary refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region.
  • Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can hydrogen bond with each other and can be expressed as a percentage.
  • cDNA complementary DNA
  • quantity may refer to an absolute quantification of a molecule in a sample, or to a relative quantification of a molecule in a sample, i.e., relative to another value such as relative to a reference value as taught herein, or to a range of values for the biomarker. These values or ranges can be obtained from a single patient or from a group of patients.
  • essentially as used herein in connection with any given biological sequence means said biological sequence varies from the reference sequence contained in the sequence listing by up to 10% of the biological sequence length.
  • by “consists essentially of’ is intended that the biological sequence consists of that sequence, but it may also include 1, 2, 3, substitutions, additions, deletions or a mixture thereof, with the proviso that said biological sequence varies from the reference sequence contained in the sequence listing by up to 10% of the biological sequence length.
  • the invention concerns the use of lnc-ZNF30-3 or a fragment thereof of at least 30 nucleotides as a biomarker. It particularly concerns the use of lnc-ZNF30-3 as a biomarker of cancer diagnosis and/or of prognosis for a subject having a cancer.
  • lnc-ZNF30-3 is a long non coding RNA encoded by the lnc-ZNF30-3 gene also known as XLOC_013045, CTC-523E23.5, AC008555.2. It is disclosed in the GeneCards database under ID LINC02965, in the HGNC database under ID 56003, in the Ensembl database under ID ENSG00000269086 and in the GenBank database under 123497957.
  • the lnc-ZNF30-3 gene encodes 8 splicing variants (i.e., isoforms), arising from up to 7 exons as detailed in the following table A. Unless specified otherwise, the term “lnc-ZNF30-3” encompasses any and all the isoforms thereof. lnc-ZNF30-3 expression interferes with miR-145 functions and upregulates TWIST 1, a transcription factor involved in EMT and metastasis, thus contributing to the maintenance of mesenchymal traits by cancer cells.
  • the biomarkers, uses, methods and kits disclosed herein refer to any lnc-ZNF30-3 isoform or fragment thereof, particularly selected from Table A.
  • the lnc-ZNF30-3 envisioned herein has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 34 to 41, optionally with one, two or three nucleic acid modifications, preferably selected from the group consisting of substitution, insertion or deletion, and any combination thereof.
  • the lnc-ZNF30-3 envisioned herein has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 34 to 41 or having 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, respectively.
  • the lnc-ZNF30-3 envisioned herein has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 34 to 41.
  • lnc-ZNF30-3 can be the isoform lnc-ZNF30-3: l, for example such as described under SEQ ID NO: 34.
  • lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:2, for example such as described under SEQ ID NO: 35.
  • lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:3, for example such as described under SEQ ID NO: 36.
  • lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:4, for example such as described under SEQ ID NO: 37.
  • lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:5, for example such as described under SEQ ID NO: 38.
  • lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:6, for example such as described under SEQ ID NO: 39.
  • lnc-ZNF30- 3 can be the isoform lnc-ZNF30-3:7, for example such as described under SEQ ID NO: 40.
  • lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:8, for example such as described under SEQ ID NO: 41.
  • the term lnc-ZNF30-3 encompasses isoforms lnc-ZNF30-3: l, Inc- ZNF30-3:2, lnc-ZNF30-3:4 and lnc-ZNF30-3:7.
  • the term lnc-ZNF30- 3 encompasses isoforms lnc-ZNF30-3: l and lnc-ZNF30-3:2.
  • lnc-ZNF30-3 is the longest isoform, namely lnc-ZNF30-3:2.
  • the terms “IncRNA fragment” or “fragment of IncRNA” refer to a fragment or piece of the IncRNA sequence.
  • a “IncRNA fragment” is a sequence of consecutive nucleotides, generally with a sequence size shorter or smaller than the corresponding IncRNA.
  • a IncRNA fragment is of at least 30 nucleotides, it refers to 30 consecutive nucleotides of the sequence from the corresponding IncRNA. It can be a fragment of any isoform of lnc-ZNF30-3.
  • said lnc-ZNF30-3 fragment has a length of at least 30 nucleotides, preferably of at least 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, 750, or 1000 nucleotides.
  • said fragment has a length of at least 30 nucleotides.
  • the fragment is located in an exonic sequence of lnc-ZNF30-3 and, more preferably in a sequence combining at least two exons.
  • Lnc-ZNF-30-3 as a biomarker, especially for cancer diagnosis, prognosis and monitoring
  • the present invention relates to lnc-ZNF30-3 or a fragment thereof as a biomarker of a cancer, especially of a prostate cancer.
  • the present invention particularly relates to the use of lnc-ZNF30-3 or a fragment thereof as a biomarker of cancer diagnosis or prognosis in a subject.
  • expression level of lnc-ZNF30-3 or a fragment thereof helps to diagnose and/or predict the occurrence of a cancer, such as a prostate cancer.
  • expression level of lnc-ZNF30-3 or a fragment thereof helps to diagnose and/or predict the recurrence of a cancer, in particular a cancer metastasis.
  • expression level of lnc-ZNF30-3 or a fragment thereof helps to diagnose and/or predict advanced or resistant cancer, especially advanced or resistant prostate cancer.
  • increased level of lnc-ZNF30-3 or a fragment thereof is negatively correlated with the survival of patient having a cancer.
  • increased level of Inc- ZNF30-3 or a fragment thereof is correlated with a poor clinical outcome in patient having a cancer
  • lnc-ZNF30-3 or a fragment thereof is upregulated or overexpressed in patients suffering from cancer, in particular upregulated or overexpressed in cancer cells compared to normal cells.
  • the present invention relates to lnc-ZNF30-3 or a fragment thereof for use in a method for determining if a subject has a cancer, especially of a prostate cancer, or for providing information useful for determining if a subject has a cancer.
  • the cancer is an advanced cancer or a resistant cancer, in particular an advanced prostate cancer or a resistant prostate cancer.
  • the determination of the expression level of a IncRNA biomarker or a fragment thereof may consist of the determination of the amount of IncRNA in a biological sample, in particular the number of copies of the IncRNA in the sample.
  • the invention also concerns the use of a kit as disclosed above for (a) determining if a subject is suffering from cancer, (b) predicting the clinical outcome of a subject suffering from cancer, (c) selecting a subject suffering from cancer to benefit from a treatment with an inhibitor of lnc-ZNF30-3 as detailed below or a pharmaceutical composition comprising such.
  • the present invention relates to the targeting or inhibition of lnc-ZNF30- 3 for use in the treatment of cancer.
  • inhibition of lnc-ZNF30-3 helps to treat cancer, in particular advanced or resistant cancer.
  • lnc-ZNF30-3 is particularly a therapeutic target for the treatment of cancer, especially prostate cancer.
  • the invention concerns an anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor or a pharmaceutical composition comprising such an anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor for use in the treatment of cancer, especially of a prostate cancer. It further relates to the use of an anti-lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor for the manufacture of a medicament for the treatment of cancer, especially of a prostate cancer.
  • the present invention also relates to anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor for use in a method for treating a subject having a cancer, especially of a prostate cancer.
  • the present invention also concerns lnc-ZNF30-3 or a fragment thereof for use in a method for identifying or selecting a subject suffering from cancer as susceptible to be treated by a Inc- ZNF-30-3 inhibitor or pharmaceutical composition comprising such an inhibitor.
  • the invention concerns an in vitro method for identifying or selecting a subject suffering from cancer as susceptible to be treated by a lnc-ZNF-30-3 inhibitor or pharmaceutical composition such an inhibitor.
  • a method of the invention is particularly aimed to select and/or treat a subject affected with a cancer or at risk of cancer, especially a subject identified as having a poor outcome, in particular due to high expression level of lnc-ZNF-30- 3, especially due to an expression level of lnc-ZNF-30-3 higher than a reference level.
  • the invention particularly relates to an in vitro method for identifying or selecting a subject having a cancer suitable for treatment with an inhibitor of lnc-ZNF30-3 or a pharmaceutical composition comprising such an inhibitor, said method comprising: a) determining expression level of lnc-ZNF30-3 in a biological sample of the subject, preferably a cancer sample; and b) comparing the expression level determined in step a) with a reference expression level, thereby identifying whether the subject having a cancer is suitable for said treatment.
  • the cancer is suitable for treatment with an inhibitor of lnc-ZNF30-3 if expression of the IncRNA lnc-ZNF30-3 in the biological sample of the subject, preferably a cancer sample, is higher than the reference expression level.
  • the reference expression level is preferably the expression level of lnc-ZNF30-3 in a normal sample as described hereabove.
  • the subject sample and the normal sample preferably provide from the same type of tissue, cell or organ.
  • the method may further comprise a step of administering a lnc-ZNF-30-3 inhibitor alone or in combination with another anti-cancer treatment to the subject having a cancer identified as suitable for said treatment.
  • the invention also relates to a method of treatment of a patient suffering from cancer with an inhibitor of lnc-ZNF30-3 as defined herein, said method comprising: a) determining expression level of lnc-ZNF30-3 in a biological sample of the subject, preferably a cancer sample; b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3; and c) if the expression level of lnc-ZNF30-3 determined in step a) is higher than the reference expression level, administering a therapeutically effective amount of an inhibitor of lnc-ZNF30- 3 to said patient.
  • Such method particularly comprises administering to said subject a therapeutically effective amount of the inhibitor of lnc-ZNF30-3 such as disclosed herein.
  • the reference expression level is preferably the expression level of lnc-ZNF30-3 in a normal sample such as described here above.
  • the subject sample and the normal sample preferably provide from the same type of tissue, cell or organ.
  • the present invention provides a method to assess the efficiency of an anti-cancer treatment in a subject having a cancer comprising the steps of: a) determining the expression level of lnc-ZNF30-3 or a fragment thereof in a biological sample from the subject, said subject having been treated by an anticancer treatment; b) comparing the expression level in the sample to a reference expression level, the reference expression level being the expression of lnc-ZNF30-3 or a fragment in a biological sample, preferably a cancer sample, before the administration of the anticancer treatment; and c) identifying the treatment as efficient when the expression of lnc-ZNF30-3 in the biological sample is equal or less than the reference level.
  • Such method may comprise a first step of administering an anti-cancer treatment, preferably an effective amount of an anti-cancer treatment, to the subject.
  • an anti-cancer treatment is chemotherapy or immunotherapy.
  • the expression level of lnc-ZNF30-3 or a fragment thereof determined in a biological sample obtained after administration of an effective amount of a therapeutic agent may further be compared to the expression level of lnc-ZNF30-3 or a fragment thereof in a sample from the same patient obtained before the treatment, a significant decrease in the expression level of lnc-ZNF30-3 or a fragment thereof being indicative of the efficiency of said anti-cancer treatment.
  • Anti-cancer treatments are more particularly described here below.
  • Inhibitor of lnc-ZNF30-3 and pharmaceutical compositions envisioned in the uses and methods disclosed herein can be any of the inhibitor of lnc-ZNF30-3 and pharmaceutical compositions described here below comprising it.
  • the invention concerns an inhibitor of lnc-ZNF30-3, in particular an inhibitor of lnc-ZNF30-3 expression, an inhibitor of lnc-ZNF30-3 and miR-145-5p interaction or an inhibitor that leads or promotes degradation of LncZNF30-3, especially for use in the treatment of cancer, especially a prostate cancer.
  • the inhibitor is selective, or in other words, specific for the targeted IncRNA expression and/or interaction with miR- 145-5p, in that it does not inhibit, or at least does not substantially inhibit, any other target, in particular other IncRNAs.
  • the inhibitor of lnc-ZNF30-3 is an inhibitor of the expression of lnc-ZNF30-3.
  • an “inhibitor of lnc-ZNF30-3 expression” refers to a molecule or technical means capable of decreasing or even abolishing the expression of lnc-ZNF30-3.
  • Expression can be deregulated (in particular downregulated) on at least two levels: first, at the DNA level, e.g., by absence or disruption of the gene, or lack of transcription taking place (in both instances preventing synthesis of the relevant gene product); second, at the RNA level, e.g., by lack of splicing or lack or decrease in the activity mediated by said IncRNA. Inhibition can be evaluated by any means known to those skilled in the art including, but not limited to, assessing the level of IncRNA transcript using e.g., quantitative PCR.
  • the inhibitor of lnc-ZNF30-3 expression can decrease the expression of one or several isoforms of lnc-ZNF30-3.
  • the inhibition of lnc-ZNF30-3 expression also encompasses the triggering of lnc-ZNF30-3 degradation.
  • An inhibitor inhibiting lnc-ZNF30-3 expression according to the invention is capable of inhibiting the functional expression of the IncRNA in vivo and/or in vitro.
  • the inhibitor may inhibit or decrease the functional expression of the IncRNA by at least about 10%, 15% 20%, or 25%, preferably by at least about 30%, 35%, 40% or 45%, still preferably by at least about 50%, 55%, 60%, or 65%, yet preferably by at least about 70%, 75%, 80%, or 85%, more preferably by at least about 90%, 95% or 99%.
  • each of the inhibitors of expression used in the present invention can preferably be either a nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3, or a genome editing system targeting specifically lnc-ZNF30- 3, in particular a genome editing system comprising a nuclease engineered to target specifically lnc-ZNF30-3.
  • a nucleic acid molecule interfering specifically with the expression of Inc- ZNF30-3 might be preferred should one wish to inhibit functional expression at the RNA level, while a genome editing system targeting specifically lnc-ZNF30-3 might be preferred should one wish to inhibit functional expression at the DNA level.
  • the inhibitor of lnc-ZNF30-3 expression is either a nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3, or is a genome editing system targeting specifically lnc-ZNF30-3, in particular a genome editing system comprising a nuclease engineered to target specifically lnc-ZNF30-3.
  • Preferred nucleic acid molecules interfering specifically with the expression of lnc-ZNF30- 3 are those capable of hybridizing specifically to the gene or transcripts of lnc-ZNF30-3, at least to a part thereof; as such, these are usually non-naturally occurring nucleic acids (i.e., synthetic).
  • hybridization refers to “nucleic acid hybridization”. Nucleic acid hybridization depends on a principle that two single-stranded nucleic acid molecules that have complementary base sequences will form a thermodynamically favored double-stranded structure if they are mixed under the proper conditions. The double-stranded structure will be formed between two complementary single-stranded nucleic acids even if one is immobilized.
  • An antisense nucleic acid is capable of altering the expression of a specific target sequence, either by splicing modification, or by recruiting RNAse H leading to RNA degradation of RNA-DNA duplexes, thus blocking the expression of the target sequence.
  • An antisense nucleic acid is typically short in length, in general 5 to 50 nucleotides in length, such as 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length, more preferably 10, 15, 20, 25, 30, 35 nucleotides in length.
  • the antisense nucleic acid interfering specifically with the expression of lnc-ZNF30-3 inhibits the splicing of the pre-long-non-coding RNA, or in other words, it inhibits the formation of the mature long non-coding RNA lnc-ZNF30-3.
  • An antisense nucleic acid can indeed be designed to block a splice acceptor (SA) site and/or an exon splicing enhancer (ESE) and/or any sequence which could modulate a pre-RNA splicing, i.e., it can be designed to be complementary to a part of the pre-RNA comprising an SA, an ESE, or any sequence which could modulate its splicing.
  • SA splice acceptor
  • ESE exon splicing enhancer
  • RNAi can be used to inhibit the expression of lnc-ZNF30-3.
  • the nucleic acid interfering specifically with the expression of Inc- ZNF30-3 is a ribozyme targeting said IncRNA.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Ribozyme molecules specific for a target (herein a IncRNA, in particular lnc-ZNF30-3) can be designed, produced, and administered by methods commonly known to the art (see e.g., Fanning and Symonds (2006) RNA Towards Medicine (Handbook of Experimental Pharmacology), ed. Springer p. 289-303).
  • the antisense nucleic acid interfering specifically with the expression of lnc-ZNF30-3 is a gapmer targeting said IncRNA.
  • a “gapmer” refers to a nucleic acid molecule comprising an internal segment having a plurality of nucleotides (or nucleosides) that support RNase H cleavage positioned between external segments, each having one or more nucleotides (or nucleosides), wherein the nucleotide (or nucleosides) comprising the internal segment are chemically distinct from the immediately adjacent nucleotide(s) (or nucleoside(s)) comprising the external segments.
  • the internal or central segment may be referred to as the “gap”, “gap segment” or “gap region” (G); while the external segments may be referred to as the “wings”, “flanks”, “wing segments”, “flank segments”, “wing regions” or “flank regions” (F for the 5’ flank region and F’ for the 3’ flank region).
  • the F and F’ regions are composed of modified ribonucleotides (RNA*) which are complementary to a target nucleic acid;
  • the G region is composed of deoxyribonucleotides, i.e., DNA or DNA-like molecules, which is responsible for RNAse H recruitment which ultimately leads to the degradation of the target nucleic acid.
  • Gene editing is a type of genetic engineering in which DNA is inserted, replaced, or removed from a genome using artificially engineered nucleases, also called molecular scissors. Nucleases create specific double-stranded break (DSBs) at desired locations in the genome, and harness the cell's endogenous mechanisms to repair the induced break by natural processes of homologous recombination (HR) or non-homologous end-joining (NHEJ).
  • DSBs double-stranded break
  • HR homologous recombination
  • NHEJ non-homologous end-joining
  • nucleases suitable for genome editing zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), the CRISPR/Cas system in particular the Cas9 system (Mali et al, Nature Methods, 2013 ; 10(10):957-63), or engineered meganucleases re-engineered homing endonucleases.
  • Said nucleases can be delivered to the cells either as DNAs or mRNAs, such DNAs or mRNAs and can be engineered to target IncRNAs genes, in particular the gene encoding lnc-ZNF30-3.
  • the term “genome editing system” also encompass technologies that derive from known genome editing system but do not induce DNA double-strand breaks, such as CRISPRi.
  • Genome editing systems can be selected from the group consisting of CRISPRi, the CRISPR/Cas system, the Zinc-finger nuclease (ZFN) system, the TALEN system, or the meganuclease system.
  • CRISPRi CRISPR/Cas system
  • ZFN Zinc-finger nuclease
  • TALEN TALEN
  • meganuclease system the group consisting of CRISPRi, the CRISPR/Cas system, the Zinc-finger nuclease (ZFN) system, the TALEN system, or the meganuclease system.
  • the genome editing system used to inhibit the functional expression of lnc-ZNF30-3 is the CRISPR/Cas system, preferably the CRISPR/Cas9 system.
  • CRISPR/Cas system (“Clustered Regularly Interspaced Short Palindromic Repeats”) is originally a defense system in bacteria and archaea against foreign DNA. These short fragments corresponding to the infectious agent are inserted into a series of CRISPR repeats and are used as CRISPR RNA guides (crRNA) to target the infectious agent in subsequent infections.
  • This system is essentially based on the association of a CRISPR- associated endonuclease (Cas) and a guide RNA (gRNA or sgRNA) capable of interacting with the CRISPR nuclease and responsible for cleavage site specificity. It leads to DNA doublestrand breaks (DSBs) at the sites targeted by the CRISPR system.
  • Cas CRISPR-associated endonuclease
  • gRNA or sgRNA guide RNA
  • the genome editing system interfering specifically with expression of lnc-ZNF30-3 is a CRISPR/Cas system, in particular a CRISPR/Cas9 system, targeting said IncRNA.
  • a CRISPR/Cas system in particular a CRISPR/Cas9 system, targeting said IncRNA.
  • sgRNA single guide RNA
  • sgRNA single guide RNA
  • CRISPRi can be used to inhibit the expression of lnc-ZNF30-3 (Larson et al., Nature Protocols volume 8, pages2180-2196 (2013)).
  • the CRISPRi system is derived from the CRISPR pathway, requiring only the coexpression of a catalytically inactive Cas protein and customizable sgRNA(s).
  • the Cas-sgRNA complex binds to DNA elements complementary to the sgRNA(s) and causes a steric block that halts transcript elongation by RNA polymerase, resulting in the repression of the target, e.g., lnc-ZNF30-3.
  • the CRISPRi system uses preferably a dead Cas9 nuclease (dCas9) or a dead Cpfl (dCpfl) that is thus unable to induce DNA double-strand breaks.
  • Dead CRISPR associated protein particularly comprises mutation(s) in the nuclease domain.
  • the dCas9 particularly contains mutations in the RuvCl and HNH nuclease domains.
  • a suitable dCpfl comprises for example the D832A mutation such as described in Zhang et al, Cell Discov. 2018; 4: 36.
  • sgRNA single guide RNA
  • sgRNA single guide RNA
  • the genome editing system interferes specifically with Inc- ZNF30-3:2 and optionally an isoform selected from the group consisting of lnc-ZNF30-3: 1, lnc-ZNF30-3:3, lnc-ZNF30-3:4, lnc-ZNF30-3:5, lnc-ZNF30-3:6, lnc-ZNF30-3:7 and Inc- ZNF30-3:8, and any combination thereof.
  • the genome editing system interferes specifically with Inc- ZNF30-3:l, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and/or lnc-ZNF30-3:7; preferably lnc-ZNF30-3:l and/or lnc-ZNF30-3:2, even more preferably lnc-ZNF30-3: l and lnc-ZNF30-3:2.
  • the lnc-ZNF30-3 inhibitor according to the invention interferes, decreases or inhibits the interaction between lnc-ZNF30-3 and natural or endogenous miR-145-5p in a subject or in a clinical sample.
  • interfering, inhibiting or decreasing the interaction between lnc-ZNF30-3 and natural miR-145-5p refers to a molecule or technical means capable of decreasing or even abolishing the interaction of lnc-ZNF30-3 with endogenous miR-145-5p in a subject. Inhibition can be evaluated by any means known to those skilled in the art including, but not limited to, assessing the level of IncRNA transcript using e.g., quantitative PCR. lnc-ZNF30-3 particularly contains five Response Elements (RE) matching with canonical and non-canonical miR-145 seed sequences and interacts with miR-145-5p in a seed sequence-dependent manner.
  • RE Response Elements
  • the lnc-ZNF30-3 inhibitor inhibiting the interaction between Inc- ZNF30-3 and miR-145-5p is a miRNA mimic, such as a miR-145-5p mimic.
  • miR-145-5p refers to a miRNA considered a member of the p53-tumor suppressor network.
  • microRNAs miRNAs
  • miR-145-5p has been found to act as a post-transcriptional regulator of many cancer-related genes. In particular, deregulations of miR-145-5p were observed in various types of human cancers. Sequence of miR-145-5p is for example described in GenBank under Gene ID: 406937.
  • microRNA mimic or “miRNA mimic” means a single-stranded or double-stranded oligonucleotide with the same or substantially similar base composition and sequence (including chemically modified bases) as a particular natural miRNA (e.g., miR-145- 5p) and which is designed to mimic the activity of such miRNA.
  • miRNA mimic excludes a double-stranded oligonucleotide which functions or is designed to function as an inhibitor, in particular such as a siRNA.
  • miR-145-5p mimics are known in the art such as MiR-145-5p mimic (MCI 1480), MiR- 145-5p inhibitor (MH11480). miR-145-5p mimics are also described under SEQ ID NO: 31, 32 and 33.
  • the lnc-ZNF30-3 inhibitor inhibiting the interaction between lnc-ZNF30-3 and miR-145-5p in a subject is not a miR-145-5p mimic.
  • miR-145 and LncZNF30-3 interaction can be distracted by depletion of one or more miR-145-5p Response Elements (RE) in the lncZNF30-3 gene by using genome editing approach, such as CRISPR/Cas methods.
  • the one or more RE element is such as described below in Table B.
  • the one or more RE element targeted by the genome editing approach is selected from Table B.
  • Table B Response Elements (RE) in the lncZNF30-3 gene for the interaction between lncZNF30-3 and miR-145-5p.
  • the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of 1, 2, 3, 4, 5,6 ,7, 8 or 9 Response Elements (RE) in the lncZNF30-3 gene.
  • the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of at least two, at least three, at least four or at least five Response Elements (RE) in the lncZNF30-3 gene.
  • the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of at least two, at least three, at least four or at least five Response Elements (RE) in the lncZNF30-3 gene, the RE having a sequence selected in Table B.
  • the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of one or more Response Elements (RE) in one or more isoform of lncZNF30- 3, in particular selected from the group consisting of lnc-ZNF30-3: l, lnc-ZNF30-3:2, Inc- ZNF30-3:4 and lnc-ZNF30-3:7.
  • the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of Response Elements (RE) of ID NO: 1, 2, 3, 4, 5, 6, 7, 8 and optionally 9, such as described in Table B, in particular in lncZNF30-3 isoforms such as described under SEQ ID NOs: 34-41.
  • RE Response Elements
  • the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of Response Elements (RE) of ID NO: 4, 5, 6, 7, 8 and optionally 9, such as described in Table B, in particular in lncZNF30-3 isoforms such as described under SEQ ID NOs: 34, 35, 37 and 40.
  • RE Response Elements
  • the inhibition of LncZNF30-3 is performed by an inhibitor of LncZNF30-3 expression in combination with an inhibitor of LncZNF30-3 interaction with miR- 145.
  • the invention also provides a method for selecting a suitable lnc-ZNF30-3 inhibitor, such method comprising: a. testing the ability of the inhibitor to i) decrease or abolish lnc-ZNF30-3 expression, in particular in comparison to a reference level, for example using qRT-PCR techniques; or ii) to decrease or abolish lnc-ZNF30-3 interaction with natural miR-145-5p and/or b. testing the ability of the inhibitor to decrease cancer cell migration, in particular in a wound healing assay, in particular such as described in the “Examples” below; and/or c.
  • EMT markers such as mesenchymal vimentin (MIV), TWIST1 and/or ZEB1, for example by RT-qPCR
  • RT-qPCR mesenchymal vimentin
  • testing the ability of the inhibitor to induce a shift in cell identity in vitro, from cancerous cell toward an epithelial phenotype and/or e. testing the ability of the inhibitor to lead to the increase of endogenous miR-145-5p expression, preferably from a subject, for example as determined by RT-qPCR.
  • the inhibitor is considered as a suitable lnc-ZNF30-3 inhibitor, in particular as suitable for the inhibition of lnc-ZNF30-3 for the treatment of cancer.
  • Any of the inhibitors disclosed herein can be incorporated in a pharmaceutical composition and can be used for the treatment of cancer.
  • the invention concerns a pharmaceutical composition
  • a pharmaceutical composition comprising an inhibitor of lnc-ZNF30-3, and optionally a pharmaceutically acceptable excipient or carrier.
  • Such pharmaceutical composition is particularly for use in the treatment of cancer, in particular prostate cancer.
  • the pharmaceutical composition can be formulated in a form suitable for parenteral, oral, transdermal or topical administration, such as a liquid suspension, a solid dosage form (granules, pills, capsules or tablets), or a paste or gel.
  • parenteral administration such as subcutaneous, intradermal, intravenous, transdermal administration; or topical administration.
  • a “pharmaceutically acceptable excipient” means an inactive or inert, and therefore nontoxic, component, as it has no pharmacological action itself, which can be used to improve properties of a composition, such as shelf-life, retention time at the application site, consumer acceptance, etc. It includes, without limitation, surfactants (cationic, anionic, or neutral); surface stabilizers; other enhancers, such as preservatives, wetting or emulsifying agents; solvents; buffers; salt solutions; dispersion medium; isotonic and absorption delaying agents, and the like; that are physiologically compatible.
  • the inhibitor of lnc-ZNF30-3 can be combined with an anti-cancer therapy.
  • the inhibitor of lnc-ZNF30-3 and the anti-cancer therapy can be administered either simultaneously or sequentially.
  • anti-cancer therapy also encompasses androgen ablation/deprivation therapy (ADT).
  • ADT androgen ablation/deprivation therapy
  • the pharmaceutical approaches of ADT include antiandrogens and chemical castration.
  • the inhibitor of lnc-ZNF30-3 is for use in combination with ADT, preferably with antiandrogens, in particular for the treatment of prostate cancer.
  • Antiandrogens includes androgen receptor antagonists, androgen synthesis inhibitors and antigonadotropins.
  • Non Limiting examples of androgen receptor antagonists include cyproterone acetate, megestrol acetate, chlormadinone acetate, spironolactone and oxendolone.
  • Non limiting examples of androgen synthesis inhibitors include the CYP17A1 inhibitors, ketoconazole, abiraterone acetate, and seviteronel.
  • the present invention further relates to a pharmaceutical composition, a kit or a combination comprising an inhibitor of lnc-ZNF30-3 and antiandrogens, such pharmaceutical composition, kit or combination for use as a drug, especially for use in the treatment of cancer, to the use of such pharmaceutical composition, kit or combination for the manufacture of a medicament for use in the treatment of cancer, and to a method for treating a cancer in a subject suffering of a cancer comprising administering an inhibitor of lnc-ZNF30-3 and antiandrogens to said patient, in particular in a therapeutically effective amount.
  • the present invention further relates to a pharmaceutical composition, a kit or a combination comprising an inhibitor of lnc-ZNF30-3 expression and miR-145-5p mimic or a nucleic acid encoding such miRNA, to such pharmaceutical composition, kit or combination for use as a drug, especially for use in the treatment of cancer, to the use of such pharmaceutical composition, kit or combination for the manufacture of a medicament for use in the treatment of cancer, and to a method for treating a cancer in a subject suffering of a cancer comprising administering an inhibitor of lnc-ZNF30-3 expression and miR-145-5p mimic or a nucleic acid encoding it to said patient, in particular in a therapeutically effective amount.
  • the subject may be positive to a digital -rectal examination and/or to a prostate specific antigen (PSA) test.
  • PSA prostate specific antigen
  • the subject carries one or two genetic mutations that are associated with prostate cancer, in particular in Homeobox protein Hox-B13 (H0XB13) and/or Breast cancer type 2 susceptibility protein (BRCA2).
  • H0XB13 Homeobox protein Hox-B13
  • BRCA2 Breast cancer type 2 susceptibility protein
  • advanced prostate cancer mean prostate cancers which have extended through the prostate capsule, and are meant to include stage C disease under the American Urological Association (AU A) system, stage C1-C2 disease under the Whitmore- Jewett system, and stage III and IV and optionally N+ disease under the TNM (tumor, node, metastasis) system.
  • Advanced prostate cancer is generally clinically identified by palpable evidence of induration beyond the lateral border of the prostate, or asymmetry or induration above the prostate base. Advanced prostate cancer can be diagnosed pathologically following radical prostatectomy if the tumor invades or penetrates the prostatic capsule, extends into the surgical margin, or invades the seminal vesicles.
  • metastatic prostate cancer mean prostate cancers which have spread to regional lymph nodes or to distant sites, and are meant to include stage D disease under the AUA system and stage III and IV and M+ under the TNM system.
  • the most common site for prostate cancer metastasis is bone.
  • Other common sites for metastasis include lymph nodes, lung, liver and brain.
  • Metastatic prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, skeletal radiography, and/or bone lesion biopsy.
  • the cancer is a hormone-resistant prostate cancer (HRPC), a castration resistant prostate cancer (CRPC) or a metastatic castration resistant prostate cancer (mCRPC).
  • HRPC hormone-resistant prostate cancer
  • CRPC castration resistant prostate cancer
  • mCRPC metastatic castration resistant prostate cancer
  • Resistant prostate cancer particularly refers to prostate cancer that keeps growing even when the amount of testosterone in the body is reduced to very low levels.
  • patients with metastatic prostate cancer eventually develop an androgen-refractory state, in particular within 12 to 18 months of treatment initiation.
  • a biological sample from a subject is particularly provided.
  • said biological sample is a cancerous sample from a subject such as described hereabove.
  • biological sample or “clinical sample”, as used herein, means any sample containing IncRNAs from the subject.
  • biological samples include fluids such as blood, exosomes, plasma, urine, amniotic fluid, bone marrow, peritoneal fluid, pleural fluid, seminal fluid as well as biopsies, organs, tissues or cell samples.
  • the biological sample can be a healthy or cancerous sample.
  • Biological samples may also include sections of tissues such as frozen sections taken for histological purposes.
  • a “biological sample” may also be referred herein to as a "patient sample” or “subject sample”.
  • the biological sample can, for example, be obtained from a subject by, but not limited to, venipuncture, excretion, biopsy, needle aspirate, lavage sample, scraping, surgical incision, colonoscopy, endoscopy, surgery or, any combination thereof, and the like.
  • nucleic acids and more particularly the ribonucleic acids, contained in the biological sample.
  • these techniques can be adapted in accordance with the type of sample, the sensitivity of the quantification desired, the amount of nucleic acid in the sample, and the like.
  • extraction may rely on lytic enzymes or chemical solutions or can be done with nucleic-acid- binding resins following the manufacturer's instructions.
  • Non-limiting examples of such methods are a phenol/chloroform or Trizol extraction methods.
  • MiR-145-5p is downregulated in advanced and poor prognosis prostate cancer
  • TWIST1 High expression of TWIST1 can be partially explained by amplification in up to 10% of PCa cases of cBioPortal ( Figure 7B).
  • IncRNAs contain response elements and bind miR-145-5p in PCa cells
  • IncRNAs with a capacity to bind miR-145-5p in PCa tissues
  • the inventors carried out gene expression and miRNA seed-match analysis, using their previously published total RNA-sequencing dataset from 16 tumoral and 8 contralateral normal prostate tissues (Pinskaya et al., 2019, Life Sci Alliance 2 (6). https://doi.org/10.26508/lsa.201900449).
  • they isolated 329 IncRNAs that showed higher expression in tumors compared with normal tissues (fold change > 2, and p-value ⁇ 0.01) (Table 3).
  • the inventors found IncRNAs such as PC ATI and PCAT2, already identified in the ceRNA network (Pang et al.
  • RNA-sequencing reads distribution Following manual curation of RNA-sequencing reads distribution, expression strength, genomic position, and fold change between tumor and normal tissues, the inventors selected several IncRNAs for further study.
  • ceRNA candidates were PRNCR1, PCAT5 and LINC02170/ARNCR1, well-known PCa-associated IncRNAs (Ylipaa et al. 2015, Cancer Res 75 (19): 4026-31. https://doi.org/10.1158/0008-5472.CAN-15-0217; Chung et al. 2011, Cancer Science 102 (1): 245-52. https://doi.Org/10. l l l l/j.1349-7006.2010.01737.x; Y. Zhang et al. 2018, Nature Genetics 50 (6): 814-24. https://doi.org/10.1038/s41588-018-0120-
  • FFPE paraffin-embedded paraffin-embedded
  • Streptavidin agarose beads (30 pL per reaction, Thermo Fisher Scientific) were washed in TNT 3 times for 2 min and 2,000 rpm spin at 4°C, then incubated with cellular extracts for 1 hour at room temperature. Beads were washed 3 times for 10 min at 20 rpm in 500 pL PBS and treated with Qiazol for RNA extraction.
  • transcripts were searched for canonical (6mer, UCCAGU) miR-145-5p seed motif matches RE (ACUGGA) (Friedman et al. 2009, Genome Research 19 (1): 92-105. https://doi.org/10.1101/gr.082701.108).
  • Target search and result visualization were carried out using an in-house developed tool in R (R Core Team (2013).
  • the PAIR cohort data for IncRNAs is composed of 24 RNA-seq datasets (16 tumor and 8 normal prostate tissues of prostatectomy origin) and were retrieved from the gene omnibus portal, accession number GSE115414. RNA-seq data and corresponding clinical information were obtained from a publicly available TCGA dataset of the PRAD cohort comprised in total of 424 specimens (52 normal and 372 tumor tissues) (http://cancergenome.nih.gov).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to lnc-ZNF30-3 as biomarker of cancer and its targeting for new therapeutic treatment of cancer.

Description

Lnc-ZNF30-3 as cancer biomarker and therapeutic target
FIELD OF THE INVENTION
The present invention relates to the field of medicine, especially oncology. It provides diagnostic and prognostic biomarkers of cancer and therapeutic treatment of cancer.
BACKGROUND OF THE INVENTION
Prostate cancer (PCa) is the second most common cancer in men and one of the leading causes of cancer-related deaths in developed countries. The androgen receptor (AR) is a driver of cellular differentiation and PCa development, and AR signaling is used as a first-line target in PCa treatment by the androgen-deprivation therapy. However, in a majority of cases, regardless of chemotherapy and hormonal therapy, PCa progresses to a secondary metastatic and lethal form. The Gleason score, a grading system based on histomorphological criteria, is currently used for predicting PCa prognosis, albeit it has a limited value.
Thus, there is an urgent need to identify tumor molecular markers to better stratify patients at risk of progression and to provide new therapeutic strategy. Better understanding of the molecular alterations underlying the metastatic phenotype could pave the way to reach this goal. In particular, identification of new molecular markers that predict the onset and progression of the disease could improve its clinical management.
The activation of the epithelial-to-mesenchymal transition (EMT) program endows epithelial cancer cells with metastatic and chemo-resistant properties. During EMT, the loss of cellular adhesion and remodeling of the extra-cellular matrix, which are important for the maintenance of cell polarity, lead to enhanced cell migration and invasion. These changes in cell properties are orchestrated by core transcription factors, EMT drivers, such as TWIST1/2, ZEB1/2, SNAIL1/2, TGF-pi, and F0XC2. A basic helix-loop-helix transcription factor, TWIST1, is an important regulator of embryogenesis, whereas in adult tissues, its expression is restricted to mesenchymal stem cells. Increased TWIST1 expression has been detected in several cancers, including PCa, where it promotes the escape of senescence, tumor initiation, metastasis, sternness, and drug resistance. Thus, TWIST 1 seems to orchestrate transcriptional programs of both mesenchymal and epithelial genes that drive EMT reprogramming of cancer cells. It has been shown that TWIST 1 expression can be regulated by miRNAs such as miR- 145-5p targeting its 3’UTR (Khanbabaei, Teimoori, and Mohammadi 2016, Tumour Biol 37 (6): 7007-19. https://doi.org/10.1007/sl3277-016-4960-y; Rajabi et al. 2020, Oncotarget 11 (45): 4155-68. https://doi.org/10.18632/oncotarget.27806; Nairismagi et al. 2013, PLoS One 8 (5): e66070. https://doi.org/10.1371/journal.pone.0066070). This miRNA was proposed as a tumor suppressor gene whose downregulation in numerous cancers, including PCa, (Porkka et al. 2007, Cancer Research 67 (13): 6130-35. https://doi.org/10.1158/0008-5472.CAN-07- 0533; Tong et al. 2009, Cancer Gene Therapy 16 (3): 206-16. https://doi.org/10.1038/cgt.2008.77) promotes proliferation, angiogenesis, and metastasis (Cui, Wang, and Chen 2014, J Cell Mol Med 18 (10): 1913-26. https://doi.Org/10. l 111/jcmm.12358.; Watahiki et al. 2011, PloS One 6 (9): e24950. https://doi.org/10.1371/joumal.pone.0024950; Peng et al. 2011, PloS One 6 (5): e20341. https://doi.org/10.1371/journal.pone.0020341; Nanni et al. 2013, PloS One 8 (5): e62522. https://doi.org/10.1371/journal.pone.0062522). Mechanistically, down-regulation of miR-145-5p in epithelial cells can lead to increased TWIST1 expression and the subsequent activation of the EMT program.
Accumulating evidence indicates that IncRNAs can regulate miRNA functions. LncRNAs have been reported to be aberrantly expressed in PCa and contribute to tumor initiation and progression (Pinskaya et al. 2019, Life Sci Alliance 2 (6). https://doi.org/10.26508/lsa.201900449; Malik and Feng 2016, Asian J Androl 18 (4): 568-74. https://doi.org/10.4103/1008-682X.177123; Cheng, Zhang, and Wang 2013, Cancer Lett 339 (1): 8-14. https://doi.Org/10.1016/j.canlet.2013.07.008; Smolle et al. 2017, Int J Mol Sci 18 (2). https://doi.org/10.3390/ijmsl8020473; J. Li et al. 2016, Oncology Research 23 (5): 205-17). One of the documented functions of IncRNAs is to act as miRNA sponges or competing endogenous (ceRNAs), that decoy miRNAs from mRNA targets (J.-H. Li et al. 2014, Nucleic Acids Research 42 (Database issue): D92-97. https://doi.org/10.1093/nar/gktl248; Malik and Feng 2016, supra). Competing endogenous RNAs usually contain several miRNA response elements (REs), binding several miRNA molecules simultaneously and changing their balance in cells, and consequently, expression of their protein-coding gene targets. In cancer, crosstalk between IncRNAs, mRNAs, and miRNAs constitutes a fine-tuning regulatory circuit that controls gene expression and drives tumor growth. Importantly, this operational mode has been proposed for miR-145 and several different IncRNAs in various cancers. In PCa, only PCGEM1 has been experimentally demonstrated to be a sponge for miR-145 (He et al. 2014, Journal of Experimental & Clinical Cancer Research: CR 33 (September): 72. https://doi.org/10.1186/sl3046-014-0072-y).
In conclusion, low expression of miR-145-5p is consistently found in primary tumors and metastases, but the regulatory mechanisms governing the functions of miR-145-5p remain largely unknown. SUMMARY OF THE INVENTION
In the present invention, the inventors identified a set of IncRNAs that are overexpressed in PCa, that contain response elements (REs) for miR-145-5p. In vitro pull-downs with biotinylated miR-145-5p confirmed miR-145 binding to several IncRNAs in PCa cells lysates. Among those, lnc-ZNF30-3 was the most enriched IncRNA. Analysis of the PRAD cohort of The Cancer Genome Atlas data confirmed that low levels of lnc-ZNF30-3 correlate with progression-free survival in PCa patients. The inventors showed that expression of this IncRNA is associated with increased levels of TWIST1 in PCa cells. In addition, Lnc-ZNF30-3 is significantly upregulated in prostate cancer cell lines and tumor tissues, and its high expression is correlated with poor patient prognosis.
Bioinformatics analyses were conducted to identify (1) a set of novels competing endogenous IncRNAs for sponging of miRNA-145-5p in prostate cancer and (2) miR-145-5p and other EMT-related miRNAs response elements in lnc-ZNF30-3. Quantification of miR- 145-5p, lnc-ZNF30-3, and TWIST1 expression levels in tumor tissues in RNA sequencing datasets of TCGA PRAD cohorts revealed a correlation with clinical outcome of prostate cancer patients. Biochemical and cell biology approaches, such as RNA pull-down, Western blot, immunostaining, and wound healing assay were used for evaluation of the impact of TWISTl/miR-145/ lnc-ZNF30-3 interaction on prostate cancer cells altered in miRNA and IncRNA expression. In particular, bioinformatics analysis revealed that, in addition to miR- 145-5p, lnc-ZNF30-3 contains REs for other miRNAs experimentally proven to target TWIST1 in various cancers and cell models. Moreover, lncZNF30-3 matches seed regions of several miRNAs targeting TWIST2, SNAIL1/2 and ZEB 1/2 EMT transcription factors. In particular, the inventors demonstrated that lnc-ZNF30-3 is associated with AGO2 and specifically interacts with the miR-145-5p seed region. Knockdown of lnc-ZNF30-3 results in decreased migration of prostate cancer cells and downregulation of EMT drivers such as TWIST1 and ZEB1 at both the RNA and protein levels. These phenotypic and molecular features of Inc- ZNF30-3 -depleted cells are partially rescued by miR-145-5p inhibition.
Altogether, the inventors’ findings indicate that, high expression of the IncRNA Inc- ZNF30-3 contributes to the activation of the EMT program and to a poor clinical outcome in PCa patients by counteracting the tumor suppressive role of miR-145-5p and other EMT-related miRNAs. Lnc-ZNF30-3 is a competing endogenous IncRNA for miR-145-5p, but also other oncogenic miRNAs that control expression of key EMT transcription factors. Therefore, IncRNA lnc-ZNF30-3 can be used as a cancer biomarker, especially a diagnostic or prognostic biomarker, and it can be targeted for developing new therapeutic treatment of cancer.
Accordingly, the present invention relates to the use of lnc-ZNF30-3 or a fragment thereof of at least 30 nucleotides as biomarker. More particularly, it relates to the use of lnc-ZNF30-3 or a fragment thereof of at least 30 nucleotides as biomarker of cancer diagnosis or of prognosis for a subject having a cancer.
The present invention relates to an in vitro method for predicting the outcome of a subject having a cancer, said method comprising: a) determining expression level of lnc-ZNF30-3 in a biological sample of the subject, preferably a cancer sample; and b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3, thereby predicting the outcome of the subject having a cancer.
More particularly, an increased expression level of lnc-ZNF30-3 is indicative of a poor clinical outcome. On the opposite, a decreased level expression of lnc-ZNF30-3 can be indicative of a good clinical outcome.
The present invention further relates to a pharmaceutical composition comprising an inhibitor of lnc-ZNF30-3, and optionally a pharmaceutically acceptable excipient; and to an inhibitor of lnc-ZNF30-3 or a pharmaceutical composition comprising said inhibitor for use as a drug, in particular for use in the treatment of cancer. It also relates to the use of an inhibitor of lnc-ZNF30-3 for the manufacture of a medicament for the treatment of cancer. It relates as well to a method for treating a subject having a cancer, wherein the method comprises administrating a therapeutically effective amount of an inhibitor of lnc-ZNF30-3to said patient.
Preferably, the inhibitor of lnc-ZNF30-3 is an inhibitor of lnc-ZNF30-3 expression.
Optionally, the inhibitor is either a nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3, or is a genome editing system engineered to target specifically Inc- ZNF30-3. More particularly, the nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3 is an antisense nucleic acid, a RNAi nucleic acid, a gapmer or a ribozyme, preferably is an antisense nucleic acid or a RNAi nucleic acid, even more preferably a RNAi nucleic acid. Optionally, the antisense nucleic interfering specifically with the expression of lnc-ZNF30-3 induces a RNAse H mediated degradation. Alternatively, the genome editing system engineered to target specifically lnc-ZNF30-3 is CRISPRi, the CRISPR/Cas system, the Zinc-finger nuclease (ZFN) system, the TALEN system, or the meganuclease system, preferably is the CRISPR/Cas system such as the CRISPR/Cas9 system.
The pharmaceutical composition comprising the lnc-ZNF30-3 inhibitor of the invention is suitable for the treatment of cancer.
The present invention relates to an in vitro method for identifying a subject having a cancer suitable for a treatment with an inhibitor of lnc-ZNF30-3 as defined herein, said method comprising: a) determining expression level of lnc-ZNF30-3 in a biological sample of the subject, preferably a cancer sample; and b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3, thereby identifying whether the subject having a cancer is suitable for said treatment.
In particular, an increased expression level of lnc-ZNF30-3 or fragment thereof indicates that the subject is suitable for said treatment.
The present invention further relates to a kit comprising at least one reagent capable of specifically targeting or detecting lnc-ZNF30-3 and to the use of this kit for cancer diagnosis or cancer prognosis; or for identifying a subject having a cancer suitable for treatment with an inhibitor of lnc-ZNF30-3.
Preferablty, the cancer is selected from the group consisting of prostate cancer, cholangiocarcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, skin cutaneous melanoma and lung adenocarcinoma.
More specifically, the cancer is a prostate cancer, especially a metastatic, advanced or resistant prostate cancer.
In some cases, the lnc-ZNF30-3 envisioned in the methods, uses, compositions and kits disclosed herein, is an isoform of lnc-ZNF30-3 selected from the group consisting of ZNF30- 3:1, ZNF30-3:2, ZNF30-3:3, ZNF30-3:4, ZNF30-3:5, ZNF30-3:6, ZNF30-3:7 and ZNF30-3:8, preferably from the group consisting of lnc-ZNF30-3: 1, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and lnc-ZNF30-3:7. Preferably, the lnc-ZNF30-3 has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 34 to 41. In some cases, the lnc-ZNF30-3 envisioned in the methods, uses, compositions and kits disclosed herein, is a lnc-ZNF30-3 fragment having a length comprised between 30 and 1000 nucleotides.
DESCRIPTION OF THE FIGURES
Figure 1. Expression patterns of miR-145-5p, TWIST1 and EMT markers is associated with different stages of prostate cancer progression and prognosis. Figure 1A. Expression of miR-145-5p in the epithelial compartment of PCa tissues annotated as Gleason Low (n=4), Gleason Intermediate (n=4) and Gleason High (n=8) grade, relative to normal prostate (n=5). Four patients with Gleason High grade pathology developed metastasis. * P-value < 0.05 (Kruskal-Wallis test; error bars indicate mean +/- sem). Figure IB. Quantification of miR-145- 5p and TWIST 1 mRNA levels in the TCGA PRAD data according to the Gleason score (Chandrashekar et al. 2022). Figure 1C. Survival analysis of the TCGA PRAD cohort based on expression data of miR-145-5p and TWIST1.
Figure 2. Identification of PCa-associated IncRNAs containing REs and interacting with miR-145 in PCa cells. Figure 2A. Summary table representing different types of PCa- associated IncRNAs and a number of RE for the canonical miR-145-5p seed motif (UCCAGU) identified by bioinformatic analysis of seed match. Abbreviations: As-lncRNA: antisense IncRNA, so-lncRNA: sense overlapping IncRNA. Figure 2B. 2D plot of miR-145-5p conventional RE sequence occurrence and the respective fold change of IncRNA expression in prostate cancer (n=16) compared with normal tissues (n=8). LncRNA annotation includes long intergenic noncoding (linc)RNAs and antisense IncRNAs (GENCODE v26). LncRNAs associated with PCa in previous studies are labeled in black, lnc-ZNF30-3 is labeled in grey. Figure 2C-D. RT-qPCR quantification of IncRNAs co-precipitated with biotin-labeled miR- 145 mimics on streptavidin beads from PC3a (C) and 22Rvl (D) cells. Figure 2E. Enrichment of lnc-ZNF30-3 in PCa cell lines LNCaP, 22Rvl, DU145, PC3a and immortalized normal prostate cell line PNT1 A normalized by PNT1 A presented in log2 scale.
Figure 3. Lnc-ZNF30-3 is upregulated in PCa tumor tissues and potentially correlates with poor-prognosis PCa patients. Figure 3A. RNA-seq profiling of lnc-ZNF30-3 in normal and tumor tissues along sense (black) and antisense (grey) strands of chromosome 19. Figure 3B. Violin diagram of log2(RPKM) counts of lnc-ZNF30-3 expression in prostate cancer tumor (grey) and normal (black, )tissues of the TCGA-PRAD cohort. Horizontal bars correspond to a mean value. P-value (9.5X10-18) was calculated using a Wilcoxon test. Figure 3C. Kaplan- Meier estimation of the PCa patients’ survival related to lnc-ZNF30-3 expression, done using the TANRIC platform and TCGA datasets (P -value 0.11385). Figure 3D. Mapping of potential miR-145 REs along the longest lnc-ZNF30-3 isoform of 5,394 nucleotides. Mir-145-5p 6mer refers to conventional RE sequence ACUGGA, 7mer.Al refers to ACUGGAA, 7mer.m8.GU refers to GACUGGA. MiR-145-3p 7mer.m8 refers to GGGAAUC. Figure 3E. Venn diagram representing miRNAs experimentally shown to target TWIST1/2, ZEB 1/2, SNAIL1/2 transcription factors, and putative RE within lnc-ZNF30-3.
Figure 4. MiR-145-5p specifically binds to lnc-ZNF30-3 in PC3a cells. Figure 4A. Dotblot analysis of biotinylated (+) and non-biotinylated (-) miR-145-5p detected in PC3a lysates 24 hours post-transfection in pellet (cell debris), input (total cell lysate), FT (flow through) and pull-down (streptavidin beads). Figure 4B. Western blot analysis of AG02 precipitated by biotinylated (+) or non-biotinylated (-) miR-145-5p primed streptavidin beads; Actine (ACT1) was used as a negative control. Figure 4C. RT-qPCR quantification of TWIST1 and ZEB2 mRNAs, and lnc-ZNF30-3 co-precipitated by streptavidin beads, primed with biotinylated miR-145-5p wt, mut, and scr sequences.
Figure 5. Lnc-ZNF30-3 promotes EMT in PC3a but not PNT1A cells. Figure 5A. Representative images of cell monolayers at time zero (TO) and 24 hours post-scratch (T24) and quantification of the percentage of an unhealed wound at T24 in PC3a and PNT1A cells, transfected with siSCR or siLNC. White lines delineate wound edges. Figure 5B. RT-qPCR quantification of EMT marker expression in PC3a cells transfected with siSCR or siLNC. Each bar corresponds to a mean ± SD relative to ACT1 expression for 3 replicates. *** and * correspond to p-values below 0.001 and 0.05, respectively. Figure 5C. Western blot analysis of EMT markers expression in PC3a and PNT1A cells transfected with siSCR or siLNC.
Figure 6. Inhibition of miR-145-5p in lnc-ZNF30-3 depleted PC3a cells rescues cell migration and TWIST 1 expression levels. Figure 6A. Images of cell monolayers and quantification of wound-healing in PC3a cells 24 hours post-scratch transfected with siSCR or siLNC together with control (CTR-IN) or miR-145 inhibitor (miR-145-IN). Figure 6B. Western blot and quantification of TWIST1 and ZEB1 protein levels in PC3a cells transfected with siSCR or siLNC together with scramble (CTR-IN) or miR-145 inhibitors (miR-145-IN). Figure 6C. Model for miR-145-5p, lnc-ZNF30-3 and TWIST1 crosstalk in regulation of EMT properties of PC3a cells that can contribute to cancer progression and dissemination.
Figure 7. Micro dissected FFPE tissues at different stages of PCa progression used in this study for miR-145 quantification. Figure 7A. Representative images of immunohistochemical staining to assess the expression of E-cadherin (epithelial marker), Vimentin (mesenchymal marker) and Ki67 (proliferation marker) in normal prostates and in PCa tissues at different stages of progression comprising high-grade prostatic intraepithelial neoplasia (E1GPIN), invasive prostate cancer, and lymph node metastases. Hematoxylin and eosin (H&E) staining was applied for microdissection of the epithelial compartment for miRNA expression analysis. Figure 7B. Percentage of copy number alterations affecting the miR-145-5p (left) and TWIST1 (right) locus calculated with the use of cBioPortal across 10 different PCa cohorts (J. Gao et al. 2013). Cohorts: 1, 20 - Prostate Cancer (MSKCC, JCO Precis Oncol 2017); 2, 19 19 - Prostate Adenocarcinoma (MSKCC, PNAS 2014); 3, 13 - Metastatic Prostate Adenocarcinoma (SU2C/PCF Dream Team, PNAS 2019); 4, 11 - Metastatic Prostate Adenocarcinoma (MCTP, Nature 2012); 5, 17 - Prostate Adenocarcinoma (TCGA, PanCancer Atlas); 6, 15 - Prostate Adenocarcinoma (MSKCC, Cancer Cell 2010); 7, 12 - Prostate Adenocarcinoma (Fred Hutchinson CRC, Nat Med 2016); 8, 16 - The Metastatic Prostate Cancer Project (Provisional, June 2021); 9, 14 - Prostate Adenocarcinoma (MSKCC/DFCI, Nature Genetics 2018); 10, 18 - Metastatic Prostate Adenocarcinoma (SU2C/PCF Dream Team, Cell 2015).
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to the identification of a long noncoding RNA (IncRNA) called lnc-ZNF30-3 that can be used as a biomarker, especially a biomarker for diagnosing, prognosing and monitoring a cancer, in particular a prostate cancer, to methods of diagnosing, prognosing and monitoring cancer in a subject, to methods for selecting a subject or stratifying subjects for a cancer treatment, and to new therapeutic treatments targeting lnc-ZNF30-3.
Definitions
Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, nomenclatures used herein, and techniques are those well-known and commonly used in the art.
A “long-non coding RNA” (long ncRNA, or IncRNA) is generally referred as a non-coding RNA that is at least 200 nucleotides in length, and has typically a length/size between 200 nucleotides and 20 kb. A particular class of IncRNA are “long intergenic noncoding RNAs” (lincRNAs), which are sequences of IncRNA transcribed from non-coding DNA sequences between protein-coding genes. A “competing endogenous RNA” (ceRNA) refers to RNA that regulate other RNA transcripts by competing for shared microRNAs (miRNAs). Models for ceRNA regulation describe how changes in the expression of one or multiple miRNA targets alter the number of unbound miRNAs and lead to observable changes in miRNA activity.
The term “antisense IncRNA”, “(as)lncRNA”, and “Natural Antisense Transcripts (NATs)” refers to a subset of long non-coding RNAs being antisense transcripts. An antisense IncRNA is a IncRNA produced from the non-coding strand of a given gene, which means that the sequence of an antisense IncRNA is complementary to the pre-mRNA sequence of the said given gene.
As used herein, the term “splicing” refers to a modification of a pre-RNA transcript in which introns are removed and exons are joined. “Alternative splicing” refers to a particular splicing process that can create a range of unique RNA splicing products from the same pre- RNA. Alternative splicing can occur in many ways, exons can be extended or skipped, or introns can be retained.
As used herein, the term “biomarkers” refers to biological parameters that aid the diagnosis or prognosis of a disease and/or permit the identification of patients suffering from a disease. It is a measurable indicator of the presence of this disease. These biomarkers can be found in the blood, urine, stool, tumor tissue, or other tissues or bodily fluids of some patients with cancer. For example, the presence or the amount of a IncRNA biomarker in a biological sample can be indicative of the presence of a disease or of the outcome or prognosis of the disease. “LncRNA biomarker” can particularly be targeted by primers/probes to detect their presence or measure their amount in a biological sample.
The term "cancer" or “tumor”, as used herein, refers to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, and/or immortality, and/or metastatic potential, and/or rapid growth and/or proliferation rate, and/or certain characteristic morphological features. This term includes early stage, localized cancer, later stage, locally advanced cancer; and metastatic stage cancer in any type of subject. In a particular aspect, the term encompasses prostate cancer at any stage of progression.
As used herein, the term “diagnosis” refers to the determination as to whether a subject is likely to be affected with a disease. The skilled artisan often makes a diagnosis on the basis of one or more diagnosis markers or biomarkers, the presence, absence, expression level or amount of which is indicative of the presence or absence of the disease. By “diagnosis” is also intended to refer to the providing of information useful for diagnosis. As used herein, the term “treatment”, “treat” or “treating” refers to any act intended to ameliorate the health status of patients such as therapy, prevention, prophylaxis and retardation of the disease. Generally speaking, the term “treatment” or “treating” means obtaining a desired physiological or pharmacological effect depending on the degree of severity of the symptom or disorder of interest, or risks thereof, i.e., herein, depending on the degree of severity or risks of developing such symptom or disorder. In the context of cancer, this includes, inter alia, the alleviation of symptoms, the reduction of inflammation, the inhibition of cancer cell growth, and/or the reduction of tumor size. Furthermore, these terms are intended to encompass curing as well as ameliorating at least one symptom of the condition or disease. For example, in the case of cancer, a response to treatment includes a reduction in cachexia, increase in survival time, elongation in time to tumor progression, reduction in tumor mass, reduction in tumor burden and/or a prolongation in time to tumor metastasis, time to tumor recurrence, tumor response, complete response, partial response, stable disease, progressive disease, progression free survival, overall survival, each as measured by standards set by the National Cancer Institute and the U.S. Food and Drug Administration for the approval of new drugs. See Johnson et al., J. Clin. Oncol., 2009; 21(7): 1404-1411.
As used herein, the term “effective amount” or “therapeutic effective amount” refers to a quantity of a pharmaceutical composition which prevents, removes or reduces the deleterious effects of the disease. The amount to be administered can be determined by standard procedures well known by those of ordinary skill in the art. The “effective amount” may vary depending on the agent(s), the disease and its severity, the characteristics of the subject to be treated including age, physical condition, size, gender and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. The amount may also vary according to other components of a treatment protocol (e.g., administration of other medicaments, etc.). These factors are known to those of ordinary skill in the art.
As used herein, the term “nucleic acid molecule” or “nucleic acid” refer to an oligonucleotide, nucleotide or polynucleotide. A nucleic acid molecule may include deoxyribonucleotides, ribonucleotides, modified nucleotides or nucleotide analogs in any combination.
As used herein, the term “nucleotide” refers to a chemical moiety having a sugar (modified, unmodified, or an analog thereof), a nucleotide base (modified, unmodified, or an analog thereof), and a phosphate group (modified, unmodified, or an analog thereof). Nucleotides include deoxyribonucleotides, ribonucleotides, and modified nucleotide analogs including, for example, locked nucleic acids (“LNAs”), peptide nucleic acids (“PNAs”), L-nucleotides, ethylene-bridged nucleic acids (“ENAs”), arabinoside, and nucleotide analogs (including abasic nucleotides).
As used herein, the term “sequence identity” or “identity” refers to an exact nucleotide to nucleotide correspondence of two polynucleotides. Percent of identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100.
As used herein, the term “complementary” and “complementarity” are interchangeable and refer to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G). 100% complementary refers to the situation in which each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region. Less than perfect complementarity refers to the situation in which some, but not all, nucleotide units of two strands or two regions can hydrogen bond with each other and can be expressed as a percentage.
As used herein, the term “amplification” refers to the amplification of a sequence of a nucleic acid. It’s a method for generating large amounts of a target sequence. In general, one or more amplification primers are annealed to a nucleic acid sequence. Using appropriate enzymes, sequences found adjacent to, or in between the primers are amplified.
As used herein, the term “complementary DNA” (cDNA) refers to recombinant nucleic acid molecules synthetized by reverse transcription of a RNA molecule, for example a IncRNA.
As used herein, the term “hybridizing conditions” is intended to mean those conditions of time, temperature, and pH, and the necessary amounts and concentrations of reactants and reagents, sufficient to allow at least a portion of complementary sequences to anneal with each other. As it is well known in the art, the time, temperature, and pH conditions required to accomplish hybridization depend on the size of the oligonucleotide probe or primer to be hybridized, the degree of complementarity between the oligonucleotide probe or primer and the target, the nucleotide type (e.g., RNA, or DNA) of the oligonucleotide probe or primer and the target, and the presence of other materials in the hybridization reaction mixture. The actual conditions necessary for each hybridization step are well known in the art or can be determined without undue experimentation. General parameters for specific (i.e., stringent) hybridization conditions for nucleic acids are described in Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001). One of skills in the art will in particular appreciate that as the oligonucleotides become shorter, it may become necessary to adjust their length to achieve a relatively uniform melting temperature for satisfactory hybridization results.
The terms “quantity,” “amount,” and “level” are used interchangeably herein and may refer to an absolute quantification of a molecule in a sample, or to a relative quantification of a molecule in a sample, i.e., relative to another value such as relative to a reference value as taught herein, or to a range of values for the biomarker. These values or ranges can be obtained from a single patient or from a group of patients.
The term “and/or” as used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, “A and/or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually.
The term “a” or “an” can refer to one of or a plurality of the elements it modifies (e.g., “a reagent” can mean one or more reagents) unless it is contextually clear either one of the elements or more than one of the elements is described.
The term “about” as used herein in connection with any and all values (including lower and upper ends of numerical ranges) means any value having an acceptable range of deviation of up to +/- 10% (e.g., +/- 0.5%, +/-1 %, +/-1 .5%, +/- 2%, +/- 2.5%, +/- 3%, +/- 3.5%, +/- 4%, +/- 4.5%, +/- 5%, +/- 5.5%, +/- 6%, +/- 6.5%, +/- 7%, +/- 7.5%, +/- 8%, +/- 8.5%, +/- 9%, +/- 9.5%). The use of the term “about” at the beginning of a string of values modifies each of the values (i.e., “about 1, 2 and 3” refers to about 1, about 2 and about 3). Further, when a listing of values is described herein (e.g., about 50%, 60%, 70%, 80%, 85% or 86%) the listing includes all intermediate and fractional values thereof (e.g., 54%, 85.4%).
The term “essentially” as used herein in connection with any given biological sequence means said biological sequence varies from the reference sequence contained in the sequence listing by up to 10% of the biological sequence length. In a particular aspect, by “consists essentially of’ is intended that the biological sequence consists of that sequence, but it may also include 1, 2, 3, substitutions, additions, deletions or a mixture thereof, with the proviso that said biological sequence varies from the reference sequence contained in the sequence listing by up to 10% of the biological sequence length. Lnc-ZNF-30-3 and fragment thereof
In a first aspect, the invention concerns the use of lnc-ZNF30-3 or a fragment thereof of at least 30 nucleotides as a biomarker. It particularly concerns the use of lnc-ZNF30-3 as a biomarker of cancer diagnosis and/or of prognosis for a subject having a cancer.
The term “lnc-ZNF30-3”, is a long non coding RNA encoded by the lnc-ZNF30-3 gene also known as XLOC_013045, CTC-523E23.5, AC008555.2. It is disclosed in the GeneCards database under ID LINC02965, in the HGNC database under ID 56003, in the Ensembl database under ID ENSG00000269086 and in the GenBank database under 123497957.
The lnc-ZNF30-3 gene encodes 8 splicing variants (i.e., isoforms), arising from up to 7 exons as detailed in the following table A. Unless specified otherwise, the term “lnc-ZNF30-3” encompasses any and all the isoforms thereof. lnc-ZNF30-3 expression interferes with miR-145 functions and upregulates TWIST 1, a transcription factor involved in EMT and metastasis, thus contributing to the maintenance of mesenchymal traits by cancer cells.
Table A. Examples of lnc-ZNF30-3 isoforms (sequences available on Ensembl and LNCipedia database )
In some embodiments, the biomarkers, uses, methods and kits disclosed herein refer to any lnc-ZNF30-3 isoform or fragment thereof, particularly selected from Table A.
In some aspects, the lnc-ZNF30-3 envisioned herein has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 34 to 41, optionally with one, two or three nucleic acid modifications, preferably selected from the group consisting of substitution, insertion or deletion, and any combination thereof.
In some aspects, the lnc-ZNF30-3 envisioned herein has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 34 to 41 or having 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, respectively.
Preferably, the lnc-ZNF30-3 envisioned herein has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 34 to 41.
In a particular aspect, lnc-ZNF30-3 can be the isoform lnc-ZNF30-3: l, for example such as described under SEQ ID NO: 34. In another particular aspect, lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:2, for example such as described under SEQ ID NO: 35. In another particular aspect, lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:3, for example such as described under SEQ ID NO: 36. In another particular aspect, lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:4, for example such as described under SEQ ID NO: 37. In another particular aspect, lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:5, for example such as described under SEQ ID NO: 38. In another particular aspect, lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:6, for example such as described under SEQ ID NO: 39. In another particular aspect, lnc-ZNF30- 3 can be the isoform lnc-ZNF30-3:7, for example such as described under SEQ ID NO: 40. In another particular aspect, lnc-ZNF30-3 can be the isoform lnc-ZNF30-3:8, for example such as described under SEQ ID NO: 41.
In an embodiment, the term lnc-ZNF30-3 encompasses isoforms lnc-ZNF30-3: l, Inc- ZNF30-3:2, lnc-ZNF30-3:4 and lnc-ZNF30-3:7. In another embodiment, the term lnc-ZNF30- 3 encompasses isoforms lnc-ZNF30-3: l and lnc-ZNF30-3:2.
In an embodiment, lnc-ZNF30-3 is an isoform selected from the group consisting of Inc- ZNF30-3:l, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and lnc-ZNF30-3:7. In another embodiment, Inc- ZNF30-3 is lnc-ZNF30-3: l or lnc-ZNF30-3:2.
In a more preferred aspect, lnc-ZNF30-3 is the longest isoform, namely lnc-ZNF30-3:2.
In a particular embodiment, lnc-ZNF30-3 is the lnc-ZNF30-3:2 isoform, in particular such as described under SEQ ID NO: 35.
In the context of the invention, the terms “IncRNA fragment” or “fragment of IncRNA” refer to a fragment or piece of the IncRNA sequence. Preferably, a “IncRNA fragment” is a sequence of consecutive nucleotides, generally with a sequence size shorter or smaller than the corresponding IncRNA. For example, when a IncRNA fragment is of at least 30 nucleotides, it refers to 30 consecutive nucleotides of the sequence from the corresponding IncRNA. It can be a fragment of any isoform of lnc-ZNF30-3.
In some embodiments, said lnc-ZNF30-3 fragment has a length of at least 30 nucleotides, preferably of at least 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, 750, or 1000 nucleotides. Preferably, said fragment has a length of at least 30 nucleotides.
In some embodiments the lnc-ZNF30-3 fragment has a length shorter than 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides. Preferably said fragment has a length not longer than 300 nucleotides or 200 nucleotides.
In a particular aspect, the lnc-ZNF30-3 fragment has a length comprised between 30 nucleotides and 1000 nucleotides, preferably between 30 nucleotides and 500 nucleotides, even more preferably between 30 nucleotides and 200 nucleotides.
In some aspects, the lnc-ZNF30-3 fragment is an amplicon, for example as the products of natural or artificial amplification events, as in a polymerase chain reaction (PCR).
Preferably, the fragment is located in an exonic sequence of lnc-ZNF30-3 and, more preferably in a sequence combining at least two exons.
Lnc-ZNF-30-3 as a biomarker, especially for cancer diagnosis, prognosis and monitoring
In a first aspect, the present invention relates to lnc-ZNF30-3 or a fragment thereof as a biomarker of a cancer, especially of a prostate cancer. The present invention particularly relates to the use of lnc-ZNF30-3 or a fragment thereof as a biomarker of cancer diagnosis or prognosis in a subject.
In a particular aspect, expression level of lnc-ZNF30-3 or a fragment thereof helps to diagnose and/or predict the occurrence of a cancer, such as a prostate cancer. In some embodiments, expression level of lnc-ZNF30-3 or a fragment thereof helps to diagnose and/or predict the recurrence of a cancer, in particular a cancer metastasis. In some very particular embodiments, expression level of lnc-ZNF30-3 or a fragment thereof helps to diagnose and/or predict advanced or resistant cancer, especially advanced or resistant prostate cancer.
In some aspects, increased level of lnc-ZNF30-3 or a fragment thereof is negatively correlated with the survival of patient having a cancer. Alternatively, increased level of Inc- ZNF30-3 or a fragment thereof is correlated with a poor clinical outcome in patient having a cancer
In some aspects, lnc-ZNF30-3 or a fragment thereof is upregulated or overexpressed in patients suffering from cancer, in particular upregulated or overexpressed in cancer cells compared to normal cells.
Accordingly, the present invention relates to lnc-ZNF30-3 or a fragment thereof for use in a method for determining if a subject has a cancer, especially of a prostate cancer, or for providing information useful for determining if a subject has a cancer.
Accordingly, the present invention also relates to an in vitro method for determining if a subject has a cancer, especially of a prostate cancer, or for providing information useful for determining if a subject has a cancer, especially of a prostate cancer, such method comprising: a) determining expression level of lnc-ZNF30-3 or a fragment thereof in a biological sample of the subject, preferably a cancer sample; and b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3 or fragment thereof, thereby determining if a subject has a cancer, or providing information useful for determining if a subject has a cancer.
In particular, an increased expression level of lnc-ZNF30-3 or fragment thereof in comparison to a reference expression level is indicative of cancer.
In some embodiments, the cancer is an advanced cancer or a resistant cancer, in particular an advanced prostate cancer or a resistant prostate cancer.
The present invention also relates to lnc-ZNF30-3 or a fragment thereof as a biomarker of prognosis of a cancer, in particular of a prostate cancer. In particular, expression level of Inc- ZNF30-3 is a measurable indicator for predicting the clinical outcome of a subject having cancer, especially prostate cancer. In a particular aspect, high expression level of lnc-ZNF30- 3, in particular in a cancer sample, is a biomarker of a poor clinical outcome. On the opposite, in some embodiments, low expression level of lnc-ZNF30-3 in comparison to the reference expression level or the absence of difference of lnc-ZNF30-3 expression level of in comparison to the reference expression level is a biomarker of a favorable clinical outcome.
As used herein, the terms “clinical outcome” and “prognosis” are interchangeable and refer to the determination as to whether a subject is likely to be affected by a cancer, a cancer relapse, cancer recurrence or metastasis, or death. The terms “poor prognosis” or “poor clinical outcome” refer to a decreased patient survival and/or an early disease progression and/or an increased or early disease recurrence and/or the occurrence of metastasis and/or death. On the opposite, the terms “good prognosis”, “favorable clinical outcome” or “good clinical outcome” refer to an increased patient survival and/or a late or absent disease progression and/or a decreased or late disease recurrence and/or the absence of metastasis and/or death.
Accordingly, the present invention relates to lnc-ZNF30-3 or a fragment thereof for use in a method for predicting the outcome of a patient suffering from a cancer, especially a prostate cancer. Especially, the present invention relates to lnc-ZNF30-3 or a fragment thereof for use in a method for predicting the outcome, in particular the poor outcome, of a patient suffering from cancer. In some embodiments, the prediction of the clinical outcome of a patient may be performed after diagnosing if such patient suffers from cancer, for example using a method such as disclosed herein.
Accordingly, the present invention concerns an in-vitro method for predicting the outcome of a subject having a cancer, said method comprising: a) determining expression level of lnc-ZNF30-3 or a fragment thereof in a biological sample of the subject, preferably a cancer sample; and b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3 or a fragment thereof, thereby predicting the outcome of the subject having a cancer.
In particular, an increased expression level of lnc-ZNF30-3 or fragment thereof in comparison to the reference level is indicative of a poor outcome.
In a particular aspect, high expression level of lnc-ZNF30-3, in particular in a cancer sample, is a biomarker of a poor clinical outcome. On the opposite, low expression level of Inc- ZNF30-3 in comparison to the reference expression level or the absence of difference of the expression level of lnc-ZNF30-3 in comparison to the reference expression level is a biomarker of favorable clinical outcome.
In a particular aspect, the method may further comprise a step of administering a therapeutically effective amount of an anticancer treatment and/or cancer resection if the subj ect has a poor outcome, or a step of selecting the subject having a poor outcome as suitable for receiving an anticancer treatment, preferably a therapeutically effective amount of an anticancer treatment.
In some embodiments, the cancer is an advanced cancer or a resistant cancer, in particular an advanced prostate cancer or a resistant prostate cancer. In the methods according to the invention, the determination of the expression level of a IncRNA biomarker or a fragment thereof may consist of the determination of the amount of IncRNA in a biological sample, in particular the number of copies of the IncRNA in the sample.
The term “expression level”, as applied to a IncRNA such as lnc-ZNF30-3, refers particularly herein to the amount or level of said IncRNA expressed in biological sample. The term “level” as used herein refers to an amount (e.g., relative amount or concentration) of a IncRNA that is detectable or measurable in a biological sample. For example, the level can be a relative amount by comparison to a reference expression level. The act of actually “determining the expression level” of a IncRNA in a biological sample refers to the act of actively detecting whether the IncRNA is expressed in said sample or not, optionally measuring the amount of such IncRNA and notably allows to detect whether the expression of the IncRNA is upregulated, downregulated or substantially unchanged when compared to a reference expression level, in particular upregulated or increased when compared to a reference expression level.
A variety of techniques, means and component for nucleic acids quantification, well known by the skilled person, can be used to determine the expression level of IncRNA biomarker from a biological sample, and in particular from the RNAs extracted from said sample. These means, components and techniques can be adapted in accordance with the type of sample, the sensitivity of the quantification desired, the amount of nucleic acid in the sample, and the like.
Methods of determining expression level include ligase chain reaction (LCR), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), quantitative reverse transcription polymerase chain reaction (qRT-PCR), digital polymerase chain reaction (dPCR), transcription-mediated amplification (TMA), strand displacement amplification (SDA), nucleic acid sequence based amplification (NASBA), microarray analysis, ChIP, serial analysis of gene expression (SAGE), next-generation RNA sequencing (e.g., deep sequencing, whole transcriptome sequencing, exome sequencing), gene expression analysis by massively parallel signature sequencing (MPSS), immune-derived colorimetric assays, situ hybridization (ISH) formulations (colorimetric/radiometric) that allow histopathology analysis, mass spectrometry (MS) methods, RNA pull-down and chromatin isolation by RNA purification (ChiRP), and proteomics-based identification (e.g., protein array, immunoprecipitation) of IncRNA. These methods are well known by the skilled person in the art. In some embodiments, the expression level of a IncRNA biomarker such as lnc-ZNF30-3 can be determined indirectly, especially after its conversion to cDNA, preferably by amplification.
In a particular embodiment, the expression level of lnc-ZNF30-3 or a fragment thereof is determined indirectly, especially after its conversion to cDNA, preferably by amplification (RT-PCR), especially a quantitative amplification, more preferably by an amplification method coupled to real-time detection of the amplified products, even more preferably by quantitative RT-PCR.
As used herein, the terms “quantitative RT-PCR”, “qRT-PCR”, “Real time RT-PCR” and “quantitative Real time RT-PCR” are equivalent and can be used interchangeably. Likewise, the terms “quantitative PCR”, “qPCR”, “Real time PCR” and “quantitative real time PCR” are equivalent and can be used interchangeably.
Any of a variety of published quantitative RT-PCR protocols can be used (and modified as needed) in the present method. Suitable quantitative RT-PCR procedures include but are not limited to those presented in U.S. Pat. No. 5,618,703 and in U.S. Patent Application No. 2005/0048542, which are hereby incorporated by reference. Quantitative PCR allows quantification of reaction products for each sample per cycle. Commonly used instrumentation and software products perform the quantification calculations automatically. The PCR process generally consists in the repetition of a sequence of temperature changes (or cycle) conducted by a thermal cycler. Usually, 25 to 50 cycles are needed.
In a particular embodiment, the expression level of lnc-ZNF30-3 or a fragment thereof is determined by digital PCR or droplet digital PCR (Taylor et al., Scientific Reports volume 7, Article number: 2409 (2017)). Digital polymerase chain reaction is a biotechnological refinement of conventional polymerase chain reaction methods that can be used to directly quantify and clonally amplify nucleic acids strands including DNA, cDNA, and RNA. dPCR is particularly useful for absolute quantification of RNA in clinical samples.
In some embodiments, the methods use primers or primer pair that are complementary to lnc-ZNF30-3 or a fragment thereof. In a particular aspect, the primer pair consists of a forward primer and a reverse primer which nucleic acid sequences are complementary to a minus (reverse) and a plus (forward) strand of the double stranded cDNA fragment of interest, respectively. In a particular embodiment, the primer pair for targeting lnc-ZNF30-3, in particular Inc- ZNF30-3 isoforms lnc-ZNF30-3:l, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and/or lnc-ZNF30-3:7, comprises: a forward primer consisting of SEQ ID NO: 17 and a reverse primer consisting of SEQ ID NO: 18; a forward primer consisting of SEQ ID NO: 25 and a reverse primer consisting of SEQ ID NO: 26.
The present invention also provides a Chip or a microarray, for the detection and/or quantification of lnc-ZNF30-3 or a fragment thereof, and optionally a further study based on their expression profile for cancer diagnosis purposes. Such Chip may comprise: a solid support with organized immobilized probes, such probes being specifically complementary to Inc- ZNF30-3 or a fragment thereof.
In some embodiments, the expression level of lnc-ZNF30-3 or a fragment thereof is determined by the Nanostring method. The Nanostring method is a hybridization method that allows to quantify RNA without requiring linear (array) nor exponential (PCR) amplification. Such method necessitates the use of a pair of probes specifically designed for each targeted IncRNA biomarker or fragment thereof. The Nanostring probes hybridize to their IncRNA biomarker target with a part of their nucleotide sequence which is of a length of between about 40 and about 60 nucleotides, preferably of a length of about 30 nucleotides.
In some embodiments, the method further comprises the step of comparing the expression level of IncRNA biomarker in a biological sample to a reference level or control.
By “reference expression level” or “control expression level”, as applied to a IncRNA, it is meant a predetermined expression level of said IncRNA, which can be used as a reference in the method of the invention. For example, a reference expression level can be the expression level of the IncRNA in a biological sample of a healthy subject, or the average or median expression level in a biological sample of a population of healthy subjects.
In particular, the reference level can be the expression level of lnc-ZNF30-3 biomarker in a “normal biological sample”, i.e., a healthy sample or non-cancerous sample.
The normal sample may be obtained from a subject that do not have cancer, from healthy tissue from the subject affected with the cancer or from another subject, preferably a normal or healthy subject, i.e., a subject who does not suffer from a cancer. In an embodiment, the normal sample(s) is patient(s) histologically matched normal sample, so that the normal sample(s) is/are from the same or similar organ, tissue or fluid as the biological sample to which it is compared.
In an embodiment, the reference expression level is an average of lnc-ZNF30-3 expression level obtained with different normal samples from different subjects, preferably subjects that do not have cancer.
In some embodiments, the expression level of lnc-ZNF30-3 or a fragment thereof is normalized by using the amounts obtained with other RNAs which are known to have stable expression. Such normalization can be performed in the normal sample and/or the biological sample from the subject. For example, the normalization can be performed such as disclosed in Mestdagh et al., Genome Biol. 2009; 10(6): R64. For example, small RNA control RNU24, RNU44, RNU58A and/or RNU6B can be used as reference or control, in particular for normalization of the expression level of lnc-ZNF30-3 or of the fragment thereof.
In a further embodiment of the above-mentioned methods, the method further comprises the step of determining whether the expression level of lnc-ZNF30-3 is dysregulated, on the basis of the comparison between the expression level in the biological sample and a reference expression level. A higher expression level of lnc-ZNF30-3 is indicative of the presence of a cancer, a higher susceptibility to have or to develop a cancer, or of a poor clinical outcome of a subject having cancer.
As provided herein the terms “higher susceptibility”, “more susceptible”, “high risk” or “at risk” are interchangeable and refer to an increased likelihood of the occurrence of an undesirable condition related to cancer in a subject (e.g., metastasis, cancer occurrence or recurrence) or an increased likelihood of the presence of such a condition.
The expression level of lnc-ZNF30-3 in a biological sample is considered as significantly different (i.e., increased) compared to the reference level, if, optionally after normalization, differences are in the order of 1.5-fold higher than the reference level or more. Preferably, the expression level of lnc-ZNF30-3 in a biological sample is considered as increased if the expression level is at least 1.5-fold higher, or 3, 3.5, 4, 4.5 or 5-fold higher than the reference level.
In some embodiments, an increased expression level of lnc-ZNF30-3 or a fragment thereof, in particular in comparison to a reference level, is indicative of a cancer, especially a prostate cancer. On the opposite, i) the absence of an increased expression level of lnc-ZNF30-3 or a fragment thereof, in particular in comparison to a reference level, ii) no difference between the expression level of lnc-ZNF30-3 or a fragment thereof and a reference level, or iii) a decreased expression level of lnc-ZNF30-3 or a fragment thereof, in particular in comparison to a reference level; are indicative of the absence of cancer, especially prostate cancer.
In some embodiments, an increased expression level of lnc-ZNF30-3 or a fragment thereof, in particular in comparison to a reference level, is indicative of a poor clinical outcome in a subject suffering from cancer. On the opposite, the absence of an increased expression level of lnc-ZNF30-3 or a fragment thereof, in particular in comparison to a reference level, ii) no difference between the expression level of lnc-ZNF30-3 or a fragment thereof and a reference level, or iii) a decreased expression level of lnc-ZNF30-3 or a fragment thereof, in particular in comparison to a reference level; are indicative of a favorable clinical outcome in a subject suffering from cancer.
In some of the above embodiments and aspects, the determination of lnc-ZNF30-3 expression level comprises or consists of the determination of the expression level of one or more lnc-ZNF30-3 isoforms. In particular, the lnc-ZNF30-3 expression level comprises or consists of the expression level of i) lnc-ZNF30-3: l and/or lnc-ZNF30-3:2; or ii) lnc-ZNF30- 3: 1, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and/or lnc-ZNF30-3:7, preferably i) lnc-ZNF30-3: l and lnc-ZNF30-3:2, or ii) lnc-ZNF30-3:l, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and lnc-ZNF30-3:7. Preferably, the determination of lnc-ZNF30-3 expression level comprises or consists of the determination of the expression level of lnc-ZNF30-3:2, in particular such as disclosed under SEQ ID NO: 35, optionally in combination with one or more other lnc-ZNF30-3 isoforms. Even more preferably, the determination of lnc-ZNF30-3 expression level comprises or consists of the determination of the expression level of lnc-ZNF30-3:2 and optionally an isoform selected from the group consisting of lnc-ZNF30-3: 1, lnc-ZNF30-3:3, lnc-ZNF30-3:4, lnc-ZNF30-3:5, lnc-ZNF30-3:6, lnc-ZNF30-3:7 and lnc-ZNF30-3:8, and any combination thereof.
In some of the above embodiments and aspects, the determination of lnc-ZNF30-3 expression level comprises or consists of the determination of the expression level of one or more sequence of lnc-ZNF30-3 isoforms, in particular selected from the group consisting of SEQ ID NO: 34 to 41, and any combination thereof.
In some of the above embodiments and aspects, the determination of lnc-ZNF30-3 expression level comprises or consists of the determination of the expression level of one or more sequence of lnc-ZNF30-3 fragment, in particular one or more fragment(s) of at least 30 nucleotides of a sequence selected from the group consisting of SEQ ID NO: 34 to 41, and any combination thereof. Preferably, said fragments have a length comprised between 30 and 1000 nucleotides.
In addition to the determination of lnc-ZNF30-3 expression level, the invention may comprise the determination of the expression level of additional biomarkers of cancer, in particular IncRNAs and a further correlation of said expression level to the presence, absence or characteristic of cancer.
The determination of the expression level of lnc-ZNF30-3 or a fragment thereof and other additional cancer markers such as disclosed herein can be carried out in the same or in different reaction mixtures, simultaneously or not.
Embodiments, as described above for determining expression level of lnc-ZNF-30-3, apply mutatis mutandis to the additional IncRNA biomarkers such as described here below.
Additional biomarkers
In any of the uses, methods and kits disclosed herein, at least one additional biomarker may be used in combination with lnc-ZNF30-3 or a fragment thereof, for the diagnosis or prognosis of cancer.
In a particular aspect, the uses, methods and kits disclosed herein relate to a combination of lnc-ZNF30-3 or a fragment thereof with no more than 10 cancer biomarkers or fragments thereof, preferably no more than 5 cancer biomarkers, even more preferably no more than 3 cancer biomarkers.
When the cancer is a prostate cancer, the at least one additional biomarker is preferably a prostate cancer biomarker or a fragment thereof, preferably a IncRNA prostate cancer biomarker or a fragment thereof.
In some embodiments, the additional biomarker(s) is/are specifically expressed by prostate cancer cells or tissue and are not naturally expressed by non-tumoral kidney cells, non-tumoral bladder cells and/or non-tumoral prostate cells.
Non-limiting examples of prostate cancer markers include Prostate-specific antigen (PSA) and other kallikrein family members, GSTP1 (Glutathione S-Transferase Pi-1), AMACR (Alpha-Methyl-Acyl-CoA Racemase), ERG (ETS-Related Gene), gene fusions involving ETS (Erythroblast Transformation-Specific)-related genes, E-cadherin (epithelial marker), Vimentin (mesenchymal marker) and Ki67 (proliferation marker). In some embodiments, the additional biomarker is selected from the group consisting of E- cadherin, Vimentin and Ki67, and any combination thereof.
In some embodiments, the additional biomarker is an additional IncRNA, in particular such as disclosed in Table 1 of Misawa et al., (Cancer Sci November 2017 vol. 108 no. 11) incorporated herein by reference. Particularly, the additional biomarker is a IncRNA selected from the group consisting of Prostate cancer antigen 3 (PCA3), Prostate cancer gene expression marker 1 (PCGEM1), prostate cancer-associated ncRNA transcript PCAT6, PCAT7, PCAT1, PCAT18 and/or PCAT29, second chromosome locus-associated with prostate-1 (SChLAPl), SPRY4 intronic transcript 1 (SPRY4-IT1), Transient receptor potential cation channel, subfamily M, member 2-antisense transcript (TRPM2-AS), Estrogen receptor alpha (ERa), and nuclear enriched abundant 1 (NEAT1) IncRNA, and any combination thereof.
Preferably, the additional biomarker is the PCA3 antisense IncRNA, in particular the human PCA3 antisense IncRNA such as described under the reference Gene ID: 50652 or GenBank: AF103907.1, or a fragment thereof.
Different prostate cancer scores can also be calculated to contribute to the diagnostic of the subject: the prostate specific antigen (PSA) Score, the Myriad Prolaris Assay (MPA) Score, the Oncotype DX Genomic Prostate Score (GPS), the Cancer of the Prostate Risk Assessment (CAPRA) Score, and the Gleason Score.
Kits and uses thereof
In a second aspect, the invention concerns a kit comprising at least one reagent capable of specifically detecting lnc-ZNF30-3 or a fragment thereof or of specifically determining the expression level of lnc-ZNF30-3 or a fragment thereof and optionally an additional cancer biomarker in a biological sample.
The term “reagent capable of specifically determining the expression level”, as applied to a IncRNA such as lnc-ZNF30-3, designates a reagent or a set of reagents which specifically recognizes said IncRNA, and allows for the quantification of the expression level thereof. These reagents can be for example nucleotide probes or primers.
In the context of the present invention, such reagent is said to be “specific” for the IncRNA or “recognizes specifically” the IncRNA if it 1) exhibits a threshold level of hybridization, and/or 2) does not significantly cross-react with other targets. The hybridization capacity and cross-reactivity of a reagent can be easily determined by one skilled in the art, and thus need to be further detailed herein. In particular, the kit may include means and components for determining the expression levels of lnc-ZNF30-3 and optionally an additional cancer biomarker. In some embodiments, the kit comprises components to extract genetic material (e.g., DNA, RNA, mRNA, and the like) from cancer and/or normal cells. Optionally, the kit further comprises an apparatus for collecting a sample from a patient and/or a leaflet providing guidelines to use such a kit.
As determining the expression levels of biomarkers may be carried out by any method such as polymerase chain reaction (PCR), magnetic immunoassay (MIA), microarrays, or any methods known in the art, the content of the kits may vary based on the method to be utilized. The man skilled in the art easily knows the means necessary for designing and assessing such methods. For example, when PCR is the method for determining the expression level of IncRNA(s), the kit may include primers which facilitate amplification.
When determination of the expression level is performed by qRT-PCR, the kit may particularly comprise means for the reverse transcription (RT) of IncRNA in cDNA and means, particularly primers, for the quantitative PCR (Polymerase Chain Reaction) amplification of the cDNA.
Preferably, the kit comprises probes and/or primers capable to specifically hybridize to Inc- ZNF30-3 or a fragment thereof and optionally probes and/or primers capable to specifically hybridize to one or more additional cancer biomarker(s).
The term “probe”, as used herein, means a strand of DNA or RNA of variable length (about 20-1000 bases long) which can be labelled. The probe is used in DNA or RNA samples to detect the presence of nucleotide sequences (the DNA or RNA target) that are complementary to the sequence in the probe.
The term “primer”, as used herein, means a strand of short DNA sequence that serves as a starting point for DNA synthesis. The polymerase starts polymerization at the 3 '-end of the primer, creating a complementary sequence to the opposite strand. “PCR primers” are chemically synthesized oligonucleotides, with a length between 10 and 30 bases long, preferably about 20 bases long.
In one embodiment, the kit comprises at least one primer pair able to specifically hybridize to lnc-ZNF30-3 or to a fragment thereof. Preferably, the at least one primer pair consists in primers that are complementary to exon sequence of the IncRNA, and are obligatory out of exon of the sense-paired pre-mRNA, if said IncRNA is an antisense IncRNA. More preferably, the primers are complementary to two adjacent exon sequences of the IncRNA (positioned upstream and downstream of the exon-exon junction), and are obligatory out of exons of the sense-paired pre-mRNA if said IncRNA is an antisense IncRNA.
Preferably, the primer pair able to specifically hybridize to lnc-ZNF30-3, in particular to lnc-ZNF30-3 isoforms of lnc-ZNF30-3:1, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and/or lnc-ZNF30- 3:7, comprises or consists of: a forward primer consisting of SEQ ID NO: 17 and a reverse primer consisting of SEQ ID NO: 18; a forward primer consisting of SEQ ID NO: 25 and a reverse primer consisting of SEQ ID NO: 26.
In another embodiment, the kit comprises at least two probes, such as:
A capture-probe which comprises a nucleotide sequence hybridizing a first part of Inc- ZNF30-3; and
A reporter-probe which comprises a nucleotide sequence hybridizing a second part of lnc-ZNF30-3 and a detectable label.
Preferably, the detectable label may be a luminescent label. For example, fluorescent labels, bioluminescent labels, chemiluminescent labels, and colorimetric labels may be used in the practice of the invention, more preferably a fluorescent label. The terms “fluorescent label”, “fluorophore”, “fluorogenic dye”, “fluorescent dye” as used herein are interchangeable and designate a functional group attached to a nucleic acid that will absorb energy of a specific wavelength and re-emit energy at a different, but equally specific, wavelength. Fluorescent labels that can be used in the context of this invention include, but are not limited to, fluorescein, a phosphor, a rhodamine, or a polymethine dye derivative. Additionally, commercially available fluorescent labels including, but not limited to, fluorescent phosphoramidites such as FluorePrime (Amersham Pharmacia, Piscataway, N.J.), Fluoredite (Millipore, Bedford, Mass.), FAM (ABI, Foster City, Calif.), and Cy3 or Cy5 (Amersham Pharmacia, Piscataway, N.J.) can be used. The fluorescent label can be made of a combination of fluorescent labels.
In some of the above embodiments and aspects, the primers or probes of the kit according to the invention target one or more lnc-ZNF30-3 isoforms. Preferably, in some of the above embodiments and aspects, the primers or probes of the kit according to the invention target one or more lnc-ZNF30-3 isoforms having a sequence selected from the group consisting of SEQ ID NO : 34-41, and any combination thereof. In particular, the primers or probes of the kit according to the invention target i) lnc-ZNF30-3: l and/or lnc-ZNF30-3:2; or ii) lnc-ZNF30- 3: 1, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and/or lnc-ZNF30-3:7, preferably i) lnc-ZNF30-3: l and lnc-ZNF30-3:2, or ii) lnc-ZNF30-3:l, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and lnc-ZNF30-3:7.
Preferably, the primers or probes of the kit according to the invention are able to target at least lnc-ZNF30-3:2 (i.e., lnc-ZNF30-3:2 and optionally one or more other lnc-ZNF30-3 isoform). Even more preferably, the primers or probes of the kit according to the invention are able to target lnc-ZNF30-3:2 and optionally an isoform selected from the group consisting of lnc-ZNF30-3: l, lnc-ZNF30-3:3, lnc-ZNF30-3:4, lnc-ZNF30-3:5, lnc-ZNF30-3:6, lnc-ZNF30- 3:7 and lnc-ZNF30-3:8, and any combination thereof.
In some of the above embodiments and aspects, the primers or probes of the kit according to the invention target one or more lnc-ZNF30-3 fragment, in particular one or more fragment of at least 30 nucleotides of a sequence selected from the group consisting of SEQ ID NO: 34 to 41, and any combination thereof. Preferably, said fragment(s) have a length comprised between 30 and 1000 nucleotides.
The kit may further comprise additional primers or probes, preferably primers or probes targeting other biomarker helpful in the diagnosis of cancer, preferably primers or probes targeting other IncRNA which are diagnosis marker for cancer, especially prostate cancer.
In some preferred embodiments, the kit may further comprise additional primer pairs or probes targeting other IncRNA which are diagnosis marker for prostate cancer, more preferably primer pairs for PCA3 quantitative amplification.
The kit of may be a diagnostic kit. In some embodiments, the kits are used before and/or after an anticancer treatment.
The invention also relates to the use of the kit according to the invention for cancer diagnosis or cancer prognosis or for identifying a subject having a cancer suitable for treatment with an inhibitor of lnc-ZNF30-3 as detailed below or a pharmaceutical composition comprising such.
In particular, the invention also concerns the use of a kit as disclosed above for (a) determining if a subject is suffering from cancer, (b) predicting the clinical outcome of a subject suffering from cancer, (c) selecting a subject suffering from cancer to benefit from a treatment with an inhibitor of lnc-ZNF30-3 as detailed below or a pharmaceutical composition comprising such.
In particular, the cancer is a prostate cancer, especially a resistant or advanced prostate cancer. Lnc-ZNF-30-3 as a target for the treatment of cancer
In a fourth aspect, the present invention relates to the targeting or inhibition of lnc-ZNF30- 3 for use in the treatment of cancer. In particular, inhibition of lnc-ZNF30-3 helps to treat cancer, in particular advanced or resistant cancer. lnc-ZNF30-3 is particularly a therapeutic target for the treatment of cancer, especially prostate cancer.
Accordingly, the invention concerns an anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor or a pharmaceutical composition comprising such an anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor for use in the treatment of cancer, especially of a prostate cancer. It further relates to the use of an anti-lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor for the manufacture of a medicament for the treatment of cancer, especially of a prostate cancer. It also relates to a method for treating a cancer, especially a prostate cancer, in a subject having such a cancer, comprising administering a therapeutically effective amount of an anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor or a pharmaceutical composition comprising such an anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor to said subject.
More generally, the present invention relates to an anti-lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor for use as a drug or to a pharmaceutical composition comprising an anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor and optionally a pharmaceutically acceptable carrier.
The present invention also relates to anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor for use in a method for treating a subject having a cancer, especially of a prostate cancer.
The present invention also concerns lnc-ZNF30-3 or a fragment thereof for use in a method for identifying or selecting a subject suffering from cancer as susceptible to be treated by a Inc- ZNF-30-3 inhibitor or pharmaceutical composition comprising such an inhibitor.
In another aspect, the invention concerns an in vitro method for identifying or selecting a subject suffering from cancer as susceptible to be treated by a lnc-ZNF-30-3 inhibitor or pharmaceutical composition such an inhibitor. A method of the invention is particularly aimed to select and/or treat a subject affected with a cancer or at risk of cancer, especially a subject identified as having a poor outcome, in particular due to high expression level of lnc-ZNF-30- 3, especially due to an expression level of lnc-ZNF-30-3 higher than a reference level. Then, in a particular aspect, the subject to be treated with an anti -lnc-ZNF30-3 or lnc-ZNF30-3 inhibitor is a subject with a high expression level of lnc-ZNF30-3 compared to the reference expression level. In such methods, the determination of lnc-ZNF30-3 of expression level is preferably such as described hereabove. Embodiments, as described above for diagnosis and prognosis purposes, apply mutatis mutandis to the methods to select and/or treat a subject affected with a cancer such as described here below.
The invention particularly relates to an in vitro method for identifying or selecting a subject having a cancer suitable for treatment with an inhibitor of lnc-ZNF30-3 or a pharmaceutical composition comprising such an inhibitor, said method comprising: a) determining expression level of lnc-ZNF30-3 in a biological sample of the subject, preferably a cancer sample; and b) comparing the expression level determined in step a) with a reference expression level, thereby identifying whether the subject having a cancer is suitable for said treatment.
In particular, the cancer is suitable for treatment with an inhibitor of lnc-ZNF30-3 if expression of the IncRNA lnc-ZNF30-3 in the biological sample of the subject, preferably a cancer sample, is higher than the reference expression level.
In such embodiment, the reference expression level is preferably the expression level of lnc-ZNF30-3 in a normal sample as described hereabove. The subject sample and the normal sample preferably provide from the same type of tissue, cell or organ.
Optionally, the method may further comprise a step of administering a lnc-ZNF-30-3 inhibitor alone or in combination with another anti-cancer treatment to the subject having a cancer identified as suitable for said treatment.
The invention also relates to a method of treatment of a patient suffering from cancer with an inhibitor of lnc-ZNF30-3 as defined herein, said method comprising: a) determining expression level of lnc-ZNF30-3 in a biological sample of the subject, preferably a cancer sample; b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3; and c) if the expression level of lnc-ZNF30-3 determined in step a) is higher than the reference expression level, administering a therapeutically effective amount of an inhibitor of lnc-ZNF30- 3 to said patient.
Such method particularly comprises administering to said subject a therapeutically effective amount of the inhibitor of lnc-ZNF30-3 such as disclosed herein. In such embodiment, the reference expression level is preferably the expression level of lnc-ZNF30-3 in a normal sample such as described here above. The subject sample and the normal sample preferably provide from the same type of tissue, cell or organ.
In a particular aspect, the present invention provides a method to assess the efficiency of an anti-cancer treatment in a subject having a cancer comprising the steps of: a) determining the expression level of lnc-ZNF30-3 or a fragment thereof in a biological sample from the subject, said subject having been treated by an anticancer treatment; b) comparing the expression level in the sample to a reference expression level, the reference expression level being the expression of lnc-ZNF30-3 or a fragment in a biological sample, preferably a cancer sample, before the administration of the anticancer treatment; and c) identifying the treatment as efficient when the expression of lnc-ZNF30-3 in the biological sample is equal or less than the reference level.
Such method may comprise a first step of administering an anti-cancer treatment, preferably an effective amount of an anti-cancer treatment, to the subject. For example, the anti-cancer treatment is chemotherapy or immunotherapy.
Optionally or alternatively, the expression level of lnc-ZNF30-3 or a fragment thereof determined in a biological sample obtained after administration of an effective amount of a therapeutic agent may further be compared to the expression level of lnc-ZNF30-3 or a fragment thereof in a sample from the same patient obtained before the treatment, a significant decrease in the expression level of lnc-ZNF30-3 or a fragment thereof being indicative of the efficiency of said anti-cancer treatment. Anti-cancer treatments are more particularly described here below.
Inhibitor of lnc-ZNF30-3 and pharmaceutical compositions envisioned in the uses and methods disclosed herein can be any of the inhibitor of lnc-ZNF30-3 and pharmaceutical compositions described here below comprising it.
Inhibitors of lnc-ZNF30-3
In another aspect, the invention concerns an inhibitor of lnc-ZNF30-3, in particular an inhibitor of lnc-ZNF30-3 expression, an inhibitor of lnc-ZNF30-3 and miR-145-5p interaction or an inhibitor that leads or promotes degradation of LncZNF30-3, especially for use in the treatment of cancer, especially a prostate cancer.
In the context of the present invention, it shall be understood that the inhibitor is selective, or in other words, specific for the targeted IncRNA expression and/or interaction with miR- 145-5p, in that it does not inhibit, or at least does not substantially inhibit, any other target, in particular other IncRNAs.
Preferably, the inhibitor of lnc-ZNF30-3 is an inhibitor of the expression of lnc-ZNF30-3.
An “inhibitor of lnc-ZNF30-3 expression” refers to a molecule or technical means capable of decreasing or even abolishing the expression of lnc-ZNF30-3. Expression can be deregulated (in particular downregulated) on at least two levels: first, at the DNA level, e.g., by absence or disruption of the gene, or lack of transcription taking place (in both instances preventing synthesis of the relevant gene product); second, at the RNA level, e.g., by lack of splicing or lack or decrease in the activity mediated by said IncRNA. Inhibition can be evaluated by any means known to those skilled in the art including, but not limited to, assessing the level of IncRNA transcript using e.g., quantitative PCR. Optionally, the inhibitor of lnc-ZNF30-3 expression can decrease the expression of one or several isoforms of lnc-ZNF30-3. The inhibition of lnc-ZNF30-3 expression also encompasses the triggering of lnc-ZNF30-3 degradation.
An inhibitor inhibiting lnc-ZNF30-3 expression according to the invention is capable of inhibiting the functional expression of the IncRNA in vivo and/or in vitro. The inhibitor may inhibit or decrease the functional expression of the IncRNA by at least about 10%, 15% 20%, or 25%, preferably by at least about 30%, 35%, 40% or 45%, still preferably by at least about 50%, 55%, 60%, or 65%, yet preferably by at least about 70%, 75%, 80%, or 85%, more preferably by at least about 90%, 95% or 99%.
Given the nature of the targeted RNA, each of the inhibitors of expression used in the present invention can preferably be either a nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3, or a genome editing system targeting specifically lnc-ZNF30- 3, in particular a genome editing system comprising a nuclease engineered to target specifically lnc-ZNF30-3. A nucleic acid molecule interfering specifically with the expression of Inc- ZNF30-3 might be preferred should one wish to inhibit functional expression at the RNA level, while a genome editing system targeting specifically lnc-ZNF30-3 might be preferred should one wish to inhibit functional expression at the DNA level. In some embodiments, the inhibitor of lnc-ZNF30-3 expression is either a nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3, or is a genome editing system targeting specifically lnc-ZNF30-3, in particular a genome editing system comprising a nuclease engineered to target specifically lnc-ZNF30-3.
Preferred nucleic acid molecules interfering specifically with the expression of lnc-ZNF30- 3 are those capable of hybridizing specifically to the gene or transcripts of lnc-ZNF30-3, at least to a part thereof; as such, these are usually non-naturally occurring nucleic acids (i.e., synthetic).
The term “hybridization”, as used herein, refers to “nucleic acid hybridization”. Nucleic acid hybridization depends on a principle that two single-stranded nucleic acid molecules that have complementary base sequences will form a thermodynamically favored double-stranded structure if they are mixed under the proper conditions. The double-stranded structure will be formed between two complementary single-stranded nucleic acids even if one is immobilized.
“A nucleic acid molecule capable of hybridizing” to a target nucleic acid thus means that a stretch of this nucleic acid is capable of forming base pairs to another stretch of the target nucleic acid. It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. Mismatches may be tolerated to some extent, as long as in the circumstances, the stretch of nucleotides is capable of hybridizing to its complementary part.
In a particular aspect, the nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3 is selected from the group consisting of an antisense nucleic acid, a RNAi nucleic acid, a gapmer or a ribozyme, in particular capable of hybridizing specifically to the gene or transcripts of lnc-ZNF30-3, at least to a part thereof.
In a particular embodiment, the nucleic acid molecule interferes with the expression of one or more lnc-ZNF30-3 isoform, in particular lnc-ZNF30-3:2 and optionally an isoform selected from the group consisting of lnc-ZNF30-3: 1, lnc-ZNF30-3:3, lnc-ZNF30-3:4, lnc-ZNF30-3:5, lnc-ZNF30-3:6, lnc-ZNF30-3:7 and lnc-ZNF30-3:8, and any combination thereof.
In a particular embodiment, the nucleic acid molecule interferes with the expression of Inc- ZNF30-3:l, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and/or lnc-ZNF30-3:7; preferably lnc-ZNF30-3:l and/or lnc-ZNF30-3:2, even more preferably lnc-ZNF30-3: l and lnc-ZNF30-3:2.
In a particular aspect, the antisense nucleic acid interfering specifically with the expression of lnc-ZNF30-3 is an antisense nucleic acid. The term “antisense nucleic acid” or “antisense oligonucleotides” (ASO) designates a synthetic single-stranded oligonucleotide of which the sequence is at least partially complementary to a target nucleic acid, such as to the RNA sequence of a target gene (Lee et al., J Cardiovasc Transl Res. 2013; 6(6):969-80; DeVos et al., Neurotherapeutics 2013; 10(3):486-972013). An antisense nucleic acid is capable of altering the expression of a specific target sequence, either by splicing modification, or by recruiting RNAse H leading to RNA degradation of RNA-DNA duplexes, thus blocking the expression of the target sequence. An antisense nucleic acid is typically short in length, in general 5 to 50 nucleotides in length, such as 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length, more preferably 10, 15, 20, 25, 30, 35 nucleotides in length. It is well within the skill of the person in the art to design antisense nucleic acids specific to a target, based on the knowledge of a target sequence such as introns, exons, or 5’CAP (DeVos et al., Neurotherapeutics 2013; 10(3):486-972013). Antisense nucleic acids can be prepared by methods well-known in the art, such as by chemical synthesis and enzymatic ligation reactions.
In one embodiment, the antisense oligonucleotide interfering specifically with the expression of lnc-ZNF30-3 is a modified antisense oligonucleotide. Such ASO may particularly comprise 2'-O-methoxyethylribose (MOE) or locked nucleic acid (LNA) modifications. A “locked nucleic acid” (LNA), also known as bridged nucleic acid (BNA), is particularly a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The modified ASO may comprise 2'-O-(2- methoxyethyl) (2'-0-M0E) ribose sugar modifications on all or a portion of the nucleotides in the antisense sequence.
In a preferred aspect, the antisense nucleic acid interfering specifically with the expression of lnc-ZNF30-3 inhibits the splicing of the pre-long-non-coding RNA, or in other words, it inhibits the formation of the mature long non-coding RNA lnc-ZNF30-3. An antisense nucleic acid can indeed be designed to block a splice acceptor (SA) site and/or an exon splicing enhancer (ESE) and/or any sequence which could modulate a pre-RNA splicing, i.e., it can be designed to be complementary to a part of the pre-RNA comprising an SA, an ESE, or any sequence which could modulate its splicing.
Preferably, the antisense nucleic acid interfering specifically with the expression of Inc- ZNF30-3 induces a RNAse H mediated degradation. RNAse H is a cellular enzyme which recognizes duplex between DNA and RNA, and enzymatically cleaves the RNA molecules. Accordingly, to induce RNAse H mediated degradation, the antisense nucleic acid interfering specifically with the expression of lnc-ZNF30-3 comprises a region that comprises DNA or DNA-like nucleotides complementary to lnc-ZNF30-3 which is responsible for RNAse H recruitment, ultimately leading to the cleavage of the target nucleic acid.
Regardless of its mode of action for inhibiting the expression of lnc-ZNF30-3, the antisense nucleic acid interfering specifically with the expression of lnc-ZNF30-3 is complementary to all or part of lnc-ZNF30-3, preferably to a part thereof, such as any one of its exons or introns.
In another embodiment, RNAi can be used to inhibit the expression of lnc-ZNF30-3.
“RNAi nucleic acid” refers to a nucleic acid that can inhibit expression of a target gene by RNA interference (RNAi) mechanism. By contrast to antisense nucleic acids, RNAi nucleic acids target mature RNA. RNAi nucleic acids are well-known in the art, and include shorthairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA), and single-stranded RNA (ssRNA) (Sohail et al. 2004, Gene Silencing by RNA Interference: Technology and Application 1st Edition, ISBN 9780849321412; WO 99/32619; Wang et al., Pharm Res 2011, 28:2983-2995). RNA interference designates a phenomenon by which dsRNA specifically suppresses expression of a target gene at post-transcriptional level. In normal conditions, RNA interference is initiated by double-stranded RNA molecules (dsRNA) of several thousands of base pair length. In vivo, dsRNA - such as shRNA- introduced into a cell is cleaved by Dicer into a mixture of short interfering RNA called siRNA; the latter will bind to another enzyme (RISC) that will catalyze the cleavage of both the siRNA and target mRNA (Bernstein et al. Nature. 2001;409(6818):363-6). In mammalian cells, the siRNAs that are naturally produced by Dicer are typically 21-23 bp in length, with a 19 or 20 nucleotides duplex sequence, two-nucleotide 3' overhangs and 5 '-triphosphate extremities (Zamore et al. Cell. 2000, 101 (l):25-33 ; Elbashir et al. Genes Dev. 2001, 15(2): 188-200; Elbashir et al. EMBO J. 2001, 20(23):6877-88). The selected siRNA or shRNA target sequence should be subjected to a BLAST search against EST database to ensure that the only desired gene is targeted. Various products are commercially available to aid in the preparation and use of synthetic siRNA or shRNA. The RNAi nucleic acid can be of at least about 10 to 40 nucleotides (or nucleosides) in length, preferably about 15 to 30 base nucleotides (or nucleosides) in length. siRNA or shRNA can comprise naturally occurring RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides (or nucleosides). Such alterations can include addition of non-nucleotide (or non-nucleoside) material, such as to the end of the molecule or to one or more internal nucleotides (or nucleoside) of the RNAi, including modifications that make the RNAi resistant to nuclease digestion, as described above.
Thus, in an embodiment, the nucleic acid molecule interfering specifically with expression of lnc-ZNF30-3 is a RNAi nucleic acid, that is complementary to at least one part of said IncRNA, in particular to at least one exon thereof The RNAi nucleic acid can be a siRNA or shRNA of at least about 10 to 40 nucleotides (or nucleosides) in length, preferably of about 15 to 25 nucleotides (or nucleosides) in length.
In an embodiment, the inhibition of the expression of lnc-ZNF30-3 is performed by a pool of siRNAs, for example siPOOL (Hannus et al., Nucleic Acids Research, 2014, Vol. 42, No. 12 8049-8061). All siRNAs of the pool cooperatively silence the same target, i.e., lnc-ZNF30- 3. SiRNA sequences may particularly be designed and arranged in tandem separated by spacer sequences. In particular, the pool of siRNA comprises at least 5, 10, 15, 20, 25, 30, 35 or 40 siRNAs, preferably between 5 and 40 siRNAs, between 5 and 30 siRNAs, between 5 and 20 siRNAs or between 5 and 10 siRNAs.
In a particular embodiment, the RNAi nucleic acid is a siRNA targeting lnc-ZNF30-3:2 and optionally an isoform selected from the group consisting of lnc-ZNF30-3: 1, lnc-ZNF30- 3:3, lnc-ZNF30-3:4, lnc-ZNF30-3:5, lnc-ZNF30-3:6, lnc-ZNF30-3:7 and lnc-ZNF30-3:8, and any combination thereof.
In a particular embodiment, the RNAi nucleic acid is a siRNA targeting lnc-ZNF30-3: l, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and/or lnc-ZNF30-3:7; preferably lnc-ZNF30-3: l and/or Inc- ZNF30-3:2, even more preferably lnc-ZNF30-3: l and lnc-ZNF30-3:2.
In a particular embodiment, the RNAi nucleic acid is a siRNA having a nucleic acid sequence as set forth in SEQ ID NO: 42.
In another embodiment, the nucleic acid interfering specifically with the expression of Inc- ZNF30-3 is a ribozyme targeting said IncRNA.
"Ribozymes" are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Ribozyme molecules specific for a target (herein a IncRNA, in particular lnc-ZNF30-3) can be designed, produced, and administered by methods commonly known to the art (see e.g., Fanning and Symonds (2006) RNA Towards Medicine (Handbook of Experimental Pharmacology), ed. Springer p. 289-303). In another embodiment, the antisense nucleic acid interfering specifically with the expression of lnc-ZNF30-3 is a gapmer targeting said IncRNA.
A “gapmer” refers to a nucleic acid molecule comprising an internal segment having a plurality of nucleotides (or nucleosides) that support RNase H cleavage positioned between external segments, each having one or more nucleotides (or nucleosides), wherein the nucleotide (or nucleosides) comprising the internal segment are chemically distinct from the immediately adjacent nucleotide(s) (or nucleoside(s)) comprising the external segments. The internal or central segment may be referred to as the “gap”, “gap segment” or “gap region” (G); while the external segments may be referred to as the “wings”, “flanks”, “wing segments”, “flank segments”, “wing regions” or “flank regions” (F for the 5’ flank region and F’ for the 3’ flank region). Typically, the F and F’ regions are composed of modified ribonucleotides (RNA*) which are complementary to a target nucleic acid; whereas the G region is composed of deoxyribonucleotides, i.e., DNA or DNA-like molecules, which is responsible for RNAse H recruitment which ultimately leads to the degradation of the target nucleic acid. A gapmer is therefore a chimeric antisense. Gapmers can typically comprise a gap region (G) of 5 to 15 deoxynucleotides (or deoxynucleosides) flanked by wing regions (F and F’) of 2 to 10 modified nucleotides (or nucleosides) each. Other formats of gapmers are well-known in the art, and can be easily conceived by the skilled practitioner. See for example W02021/152005, incorporated herein in its entirety.
In an embodiment, genome editing can be used to inhibit the functional expression of Inc- ZNF30-3. More specifically, one can use a genome editing system engineered to target Inc- ZNF30-3.
“Genome editing” is a type of genetic engineering in which DNA is inserted, replaced, or removed from a genome using artificially engineered nucleases, also called molecular scissors. Nucleases create specific double-stranded break (DSBs) at desired locations in the genome, and harness the cell's endogenous mechanisms to repair the induced break by natural processes of homologous recombination (HR) or non-homologous end-joining (NHEJ). There are currently four known families of nucleases suitable for genome editing: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), the CRISPR/Cas system in particular the Cas9 system (Mali et al, Nature Methods, 2013 ; 10(10):957-63), or engineered meganucleases re-engineered homing endonucleases. Said nucleases can be delivered to the cells either as DNAs or mRNAs, such DNAs or mRNAs and can be engineered to target IncRNAs genes, in particular the gene encoding lnc-ZNF30-3. In the context of the present invention, the term “genome editing system” also encompass technologies that derive from known genome editing system but do not induce DNA double-strand breaks, such as CRISPRi.
Genome editing systems according to the invention can be selected from the group consisting of CRISPRi, the CRISPR/Cas system, the Zinc-finger nuclease (ZFN) system, the TALEN system, or the meganuclease system.
In one embodiment, the genome editing system used to inhibit the functional expression of lnc-ZNF30-3 is the CRISPR/Cas system, preferably the CRISPR/Cas9 system.
The “CRISPR/Cas system” ("Clustered Regularly Interspaced Short Palindromic Repeats") is originally a defense system in bacteria and archaea against foreign DNA. These short fragments corresponding to the infectious agent are inserted into a series of CRISPR repeats and are used as CRISPR RNA guides (crRNA) to target the infectious agent in subsequent infections. This system is essentially based on the association of a CRISPR- associated endonuclease (Cas) and a guide RNA (gRNA or sgRNA) capable of interacting with the CRISPR nuclease and responsible for cleavage site specificity. It leads to DNA doublestrand breaks (DSBs) at the sites targeted by the CRISPR system.
In a preferred embodiment, the genome editing system interfering specifically with expression of lnc-ZNF30-3 is a CRISPR/Cas system, in particular a CRISPR/Cas9 system, targeting said IncRNA. To do so, one may use one or more single guide RNA (sgRNA) targeting specifically lnc-ZNF30-3, in particular sgRNA of at least 10, 15 or 20 contiguous nucleotides in length having a sequence complementary to lnc-ZNF30-3, preferably to a part thereof, such as any one of its exons or introns.
In an embodiment, CRISPRi can be used to inhibit the expression of lnc-ZNF30-3 (Larson et al., Nature Protocols volume 8, pages2180-2196 (2013)). The CRISPRi system is derived from the CRISPR pathway, requiring only the coexpression of a catalytically inactive Cas protein and customizable sgRNA(s). The Cas-sgRNA complex binds to DNA elements complementary to the sgRNA(s) and causes a steric block that halts transcript elongation by RNA polymerase, resulting in the repression of the target, e.g., lnc-ZNF30-3. The CRISPRi system uses preferably a dead Cas9 nuclease (dCas9) or a dead Cpfl (dCpfl) that is thus unable to induce DNA double-strand breaks. Dead CRISPR associated protein particularly comprises mutation(s) in the nuclease domain. The dCas9 particularly contains mutations in the RuvCl and HNH nuclease domains. A suitable dCpfl comprises for example the D832A mutation such as described in Zhang et al, Cell Discov. 2018; 4: 36. As for the CRISPR/Cas system, in the CRISPRi system, one may use one or more single guide RNA (sgRNA) targeting specifically lnc-ZNF30-3, in particular sgRNA of at least 10, 15 or 20 contiguous nucleotides in length having a sequence complementary to lnc-ZNF30-3, preferably to a part thereof, such as any one of its exons or introns.
In a particular embodiment, the genome editing system interferes specifically with Inc- ZNF30-3:2 and optionally an isoform selected from the group consisting of lnc-ZNF30-3: 1, lnc-ZNF30-3:3, lnc-ZNF30-3:4, lnc-ZNF30-3:5, lnc-ZNF30-3:6, lnc-ZNF30-3:7 and Inc- ZNF30-3:8, and any combination thereof.
In a particular embodiment, the genome editing system interferes specifically with Inc- ZNF30-3:l, lnc-ZNF30-3:2, lnc-ZNF30-3:4 and/or lnc-ZNF30-3:7; preferably lnc-ZNF30-3:l and/or lnc-ZNF30-3:2, even more preferably lnc-ZNF30-3: l and lnc-ZNF30-3:2.
In some aspects, the lnc-ZNF30-3 inhibitor according to the invention interferes, decreases or inhibits the interaction between lnc-ZNF30-3 and natural or endogenous miR-145-5p in a subject or in a clinical sample.
The terms “interfering, inhibiting or decreasing the interaction between lnc-ZNF30-3 and natural miR-145-5p” refers to a molecule or technical means capable of decreasing or even abolishing the interaction of lnc-ZNF30-3 with endogenous miR-145-5p in a subject. Inhibition can be evaluated by any means known to those skilled in the art including, but not limited to, assessing the level of IncRNA transcript using e.g., quantitative PCR. lnc-ZNF30-3 particularly contains five Response Elements (RE) matching with canonical and non-canonical miR-145 seed sequences and interacts with miR-145-5p in a seed sequence-dependent manner.
In an embodiment, the lnc-ZNF30-3 inhibitor inhibiting the interaction between Inc- ZNF30-3 and miR-145-5p is a miRNA mimic, such as a miR-145-5p mimic.
As used herein, the term “miR-145-5p” refers to a miRNA considered a member of the p53-tumor suppressor network. microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miR-145-5p has been found to act as a post-transcriptional regulator of many cancer-related genes. In particular, deregulations of miR-145-5p were observed in various types of human cancers. Sequence of miR-145-5p is for example described in GenBank under Gene ID: 406937.
As used herein, the term “microRNA mimic” or “miRNA mimic” means a single-stranded or double-stranded oligonucleotide with the same or substantially similar base composition and sequence (including chemically modified bases) as a particular natural miRNA (e.g., miR-145- 5p) and which is designed to mimic the activity of such miRNA. For clarity, microRNA mimic excludes a double-stranded oligonucleotide which functions or is designed to function as an inhibitor, in particular such as a siRNA. miR-145-5p mimics are known in the art such as MiR-145-5p mimic (MCI 1480), MiR- 145-5p inhibitor (MH11480). miR-145-5p mimics are also described under SEQ ID NO: 31, 32 and 33.
Alternatively, the lnc-ZNF30-3 inhibitor inhibiting the interaction between lnc-ZNF30-3 and miR-145-5p in a subject is not a miR-145-5p mimic.
In an embodiment, miR-145 and LncZNF30-3 interaction can be distracted by depletion of one or more miR-145-5p Response Elements (RE) in the lncZNF30-3 gene by using genome editing approach, such as CRISPR/Cas methods. In particular, the one or more RE element is such as described below in Table B. Preferably, the one or more RE element targeted by the genome editing approach is selected from Table B.
Table B. Response Elements (RE) in the lncZNF30-3 gene for the interaction between lncZNF30-3 and miR-145-5p.
In an embodiment, the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of 1, 2, 3, 4, 5,6 ,7, 8 or 9 Response Elements (RE) in the lncZNF30-3 gene. Preferably, the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of at least two, at least three, at least four or at least five Response Elements (RE) in the lncZNF30-3 gene. Preferably, the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of at least two, at least three, at least four or at least five Response Elements (RE) in the lncZNF30-3 gene, the RE having a sequence selected in Table B. In an embodiment, the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of one or more Response Elements (RE) in one or more isoform of lncZNF30- 3, in particular selected from the group consisting of lnc-ZNF30-3: l, lnc-ZNF30-3:2, Inc- ZNF30-3:4 and lnc-ZNF30-3:7.
In an embodiment, the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of Response Elements (RE) of ID NO: 1, 2, 3, 4, 5, 6, 7, 8 and optionally 9, such as described in Table B, in particular in lncZNF30-3 isoforms such as described under SEQ ID NOs: 34-41.
In an embodiment, the inhibition of lncZNF30-3 interaction with miR-145-5p is performed by the deletion of Response Elements (RE) of ID NO: 4, 5, 6, 7, 8 and optionally 9, such as described in Table B, in particular in lncZNF30-3 isoforms such as described under SEQ ID NOs: 34, 35, 37 and 40.
In some embodiments, the inhibition of LncZNF30-3 is performed by an inhibitor of LncZNF30-3 expression in combination with an inhibitor of LncZNF30-3 interaction with miR- 145.
The invention also provides a method for selecting a suitable lnc-ZNF30-3 inhibitor, such method comprising: a. testing the ability of the inhibitor to i) decrease or abolish lnc-ZNF30-3 expression, in particular in comparison to a reference level, for example using qRT-PCR techniques; or ii) to decrease or abolish lnc-ZNF30-3 interaction with natural miR-145-5p and/or b. testing the ability of the inhibitor to decrease cancer cell migration, in particular in a wound healing assay, in particular such as described in the “Examples” below; and/or c. testing the ability of the inhibitor to decrease mRNA expression of EMT markers such as mesenchymal vimentin (MIV), TWIST1 and/or ZEB1, for example by RT-qPCR; and/or d. testing the ability of the inhibitor to induce a shift in cell identity in vitro, from cancerous cell toward an epithelial phenotype; and/or e. testing the ability of the inhibitor to lead to the increase of endogenous miR-145-5p expression, preferably from a subject, for example as determined by RT-qPCR.
If the inhibitor is able to perform one or more of such characteristics, the inhibitor is considered as a suitable lnc-ZNF30-3 inhibitor, in particular as suitable for the inhibition of lnc-ZNF30-3 for the treatment of cancer. Any of the inhibitors disclosed herein can be incorporated in a pharmaceutical composition and can be used for the treatment of cancer.
Pharmaceutical compositions, combination therapies and uses thereof
In an aspect, the invention concerns a pharmaceutical composition comprising an inhibitor of lnc-ZNF30-3, and optionally a pharmaceutically acceptable excipient or carrier. Such pharmaceutical composition is particularly for use in the treatment of cancer, in particular prostate cancer.
It is within the skill of the person in the art to formulate pharmaceutical compositions in accordance with standard pharmaceutical practice (see, e.g., Remington: The Science and Practice of Pharmacy (20th ed.), ed. A. R. Gennaro, Lippincott Williams & Wilkins, 2000 and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and J. C. Boylan, 1988-1999, Marcel Dekker, New York). Pharmaceutical compositions according to the invention may notably be formulated to release the inhibitor of lnc-ZNF30-3 immediately upon administration or at any predetermined time or time period after administration.
For example, the pharmaceutical composition can be formulated in a form suitable for parenteral, oral, transdermal or topical administration, such as a liquid suspension, a solid dosage form (granules, pills, capsules or tablets), or a paste or gel.
For the purposes of the invention, a particularly preferred form of administration is parenteral administration, such as subcutaneous, intradermal, intravenous, transdermal administration; or topical administration.
When formulated within a pharmaceutical composition, the inhibitor of lnc-ZNF30-3 can be further combined with a pharmaceutically acceptable excipient or carrier.
As used herein, the term a “pharmaceutically acceptable excipient” means an inactive or inert, and therefore nontoxic, component, as it has no pharmacological action itself, which can be used to improve properties of a composition, such as shelf-life, retention time at the application site, consumer acceptance, etc. It includes, without limitation, surfactants (cationic, anionic, or neutral); surface stabilizers; other enhancers, such as preservatives, wetting or emulsifying agents; solvents; buffers; salt solutions; dispersion medium; isotonic and absorption delaying agents, and the like; that are physiologically compatible.
The amount of inhibitor of lnc-ZNF30-3 which can be combined with a carrier or excipient to produce a single dosage form will vary depending upon the subject being treated and the particular mode of administration. The inhibitor of lnc-ZNF30-3 is particularly provided in a therapeutically effective amount, preferably so as to treat cancer.
In some embodiments, the inhibitor of lnc-ZNF30-3 can be combined with an anti-cancer therapy. The inhibitor of lnc-ZNF30-3 and the anti-cancer therapy can be administered either simultaneously or sequentially.
As used herein, the terms “anti-cancer therapy”, “anti-cancer treatment” and “cancer treatment” are used interchangeably and refer to techniques and compounds known by the man skilled in the art which are used in the treatment of cancer, such as cancer resection (e.g., by surgery), chemotherapy, radiation therapy, hormonal therapy, immunotherapy and palliative care, or any combination thereof.
In the case of cancer, in particular prostate cancer, the term anti-cancer therapy also encompasses androgen ablation/deprivation therapy (ADT). The pharmaceutical approaches of ADT include antiandrogens and chemical castration.
In some aspects, the inhibitor of lnc-ZNF30-3 is for use in combination with ADT, preferably with antiandrogens, in particular for the treatment of prostate cancer. Antiandrogens includes androgen receptor antagonists, androgen synthesis inhibitors and antigonadotropins. Non Limiting examples of androgen receptor antagonists include cyproterone acetate, megestrol acetate, chlormadinone acetate, spironolactone and oxendolone. Non limiting examples of androgen synthesis inhibitors include the CYP17A1 inhibitors, ketoconazole, abiraterone acetate, and seviteronel.
Accordingly, the present invention further relates to a pharmaceutical composition, a kit or a combination comprising an inhibitor of lnc-ZNF30-3 and antiandrogens, such pharmaceutical composition, kit or combination for use as a drug, especially for use in the treatment of cancer, to the use of such pharmaceutical composition, kit or combination for the manufacture of a medicament for use in the treatment of cancer, and to a method for treating a cancer in a subject suffering of a cancer comprising administering an inhibitor of lnc-ZNF30-3 and antiandrogens to said patient, in particular in a therapeutically effective amount.
In a very particular embodiment, the invention provides a combination therapy comprising a miR-145-5p mimic as an inhibitor of lnc-ZNF30-3 interaction and ADT, preferably antiandrogens, in particular for the treatment of prostate cancer. Such combination therapy is particularly for use in the treatment of cancer, such as prostate cancer. In some aspects, the inhibitor of lnc-ZNF30-3 expression is for use in combination with a miR-145-5p mimic or a nucleic acid encoding it in the treatment of cancer. The inhibitor of Inc- ZNF30-3 expression and miR-145-5p mimic can be administered either simultaneously or sequentially. The inhibitor of lnc-ZNF30-3 expression and miR-145-5p mimic may particularly be comprised in a single pharmaceutical composition.
Accordingly, the present invention further relates to a pharmaceutical composition, a kit or a combination comprising an inhibitor of lnc-ZNF30-3 expression and miR-145-5p mimic or a nucleic acid encoding such miRNA, to such pharmaceutical composition, kit or combination for use as a drug, especially for use in the treatment of cancer, to the use of such pharmaceutical composition, kit or combination for the manufacture of a medicament for use in the treatment of cancer, and to a method for treating a cancer in a subject suffering of a cancer comprising administering an inhibitor of lnc-ZNF30-3 expression and miR-145-5p mimic or a nucleic acid encoding it to said patient, in particular in a therapeutically effective amount.
In some embodiments, the treatment with the lnc-ZNF30-3 inhibitor or with the pharmaceutical composition according to the invention is administered regularly, preferably between every day, every week or every month.
The lnc-ZNF30-3 inhibitor or the pharmaceutical composition according to the invention may be provided at a dose range from about 1 ng/kg body weight to about 30 mg/kg body weight, in particular 1 pg/kg to about 20 mg/kg, 10 pg/kg to about 10 mg/kg, or from 100 pg/kg to 5 mg/kg.
Subject and cancer
The uses, methods and kits such as disclosed herein particularly apply to subjects suffering from cancer or susceptible to have or develop a cancer.
As used herein, the terms “subject”, “individual” or “patient” are interchangeable and refer to an animal, preferably to a mammal, even more preferably to a human. However, the term "subject" can also refer to non-human animals, in particular mammals such as dogs, cats, horses, cows, pigs, sheep and non-human primates, among others, that are in need of diagnostic.
In some embodiments, the subject according to the invention is a human, in particular a human at the prenatal stage, a new-born, a child, an infant, an adolescent or an adult, in particular an adult of at least 30 years old or at least 40 years old, preferably an adult of at least 50 years old, still more preferably an adult of at least 60 years old, even more preferably an adult of at least 70 years old. In particular, the cancer is selected from the group consisting of : prostate cancer, bladder cancer, urethra cancer, brain cancer, bone cancer, blood cancer, testis cancer, liver cancer, endometrial cancer, cervical cancer, vulvar cancer, breast cancer, lung cancer, ovarian cancer, gastric cancer, squamous cell cancer, nasopharyngeal cancer, oral cancer, esophageal cancer, head and neck cancer, sarcomas, epithelial cancer, melanoma, glioma, renal cancer, colorectal cancer, intestinal cancer, pancreatic cancer or bladder cancer.
In particular, the cancer is selected from the group consisting of prostate cancer, cholangiocarcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, skin cutaneous melanoma and lung adenocarcinoma.
Preferably, the cancer is prostate cancer.
In some embodiments, the patient suffers from a cancer of stage I, II, III or IV. The TNM system allows establishing the stage of the cancer. Stage 0 means the presence of abnormal cells with the potential to become cancer. Stage I means the cancer has a small size and is present only in one area. This stage is also called early-stage cancer. Stage II and III mean the cancer is larger and has grown into nearby tissues or lymph nodes. Stage IV means the cancer has spread to distant parts of the patient’s body. This stage may also be called advanced or metastatic cancer.
In some embodiments, the cancer is prostate cancer. In some particular embodiments, the cancer is a metastatic or advanced prostate cancer.
In some embodiments, the patient is a long-lived prostate cancer metastatic patient. A long- lived prostate cancer metastatic patient that is still alive 3 years, preferably 7 years, more preferably 10 years, even more preferably 15 years after cancer diagnosis.
In another particular embodiment of the above-mentioned method, the subject has relapse from a previous cancer.
In such embodiments, the subject is preferably a man, preferably an adult man, more preferably a man of at least 50 years old, even more preferably a man of at least 60 years old.
In particular, the subject has a family history of prostate cancer or other risk factors. In this case, the subject can be a man of at least 40 years old.
The subject may be positive to a digital -rectal examination and/or to a prostate specific antigen (PSA) test. In some embodiments, wherein the cancer is prostate cancer, the subject carries one or two genetic mutations that are associated with prostate cancer, in particular in Homeobox protein Hox-B13 (H0XB13) and/or Breast cancer type 2 susceptibility protein (BRCA2).
As used herein, the terms “advanced prostate cancer” mean prostate cancers which have extended through the prostate capsule, and are meant to include stage C disease under the American Urological Association (AU A) system, stage C1-C2 disease under the Whitmore- Jewett system, and stage III and IV and optionally N+ disease under the TNM (tumor, node, metastasis) system. Advanced prostate cancer is generally clinically identified by palpable evidence of induration beyond the lateral border of the prostate, or asymmetry or induration above the prostate base. Advanced prostate cancer can be diagnosed pathologically following radical prostatectomy if the tumor invades or penetrates the prostatic capsule, extends into the surgical margin, or invades the seminal vesicles.
As used herein, the terms “metastatic prostate cancer” mean prostate cancers which have spread to regional lymph nodes or to distant sites, and are meant to include stage D disease under the AUA system and stage III and IV and M+ under the TNM system. The most common site for prostate cancer metastasis is bone. Other common sites for metastasis include lymph nodes, lung, liver and brain. Metastatic prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, skeletal radiography, and/or bone lesion biopsy.
In some embodiments, the cancer is a hormone-resistant prostate cancer (HRPC), a castration resistant prostate cancer (CRPC) or a metastatic castration resistant prostate cancer (mCRPC). Resistant prostate cancer particularly refers to prostate cancer that keeps growing even when the amount of testosterone in the body is reduced to very low levels. Particularly, patients with metastatic prostate cancer eventually develop an androgen-refractory state, in particular within 12 to 18 months of treatment initiation.
In the methods, uses and kits disclosed herein, is particularly provided a biological sample from a subject. Particularly, said biological sample is a cancerous sample from a subject such as described hereabove.
The term “biological sample” or “clinical sample”, as used herein, means any sample containing IncRNAs from the subject. Examples of such biological samples include fluids such as blood, exosomes, plasma, urine, amniotic fluid, bone marrow, peritoneal fluid, pleural fluid, seminal fluid as well as biopsies, organs, tissues or cell samples. The biological sample can be a healthy or cancerous sample. Biological samples may also include sections of tissues such as frozen sections taken for histological purposes. A “biological sample” may also be referred herein to as a "patient sample" or “subject sample”.
The biological sample can, for example, be obtained from a subject by, but not limited to, venipuncture, excretion, biopsy, needle aspirate, lavage sample, scraping, surgical incision, colonoscopy, endoscopy, surgery or, any combination thereof, and the like.
The methods disclosed herein may thus comprise an initial step of obtaining or providing a biological sample from a subject.
The methods disclosed herein may also comprise a step of preparing or extracting the nucleic acids, preferably the ribonucleic acids, from the biological sample.
Several methods and kits are available for the person skilled in the art to extract the nucleic acids, and more particularly the ribonucleic acids, contained in the biological sample. These techniques can be adapted in accordance with the type of sample, the sensitivity of the quantification desired, the amount of nucleic acid in the sample, and the like. For example, extraction may rely on lytic enzymes or chemical solutions or can be done with nucleic-acid- binding resins following the manufacturer's instructions. Non-limiting examples of such methods are a phenol/chloroform or Trizol extraction methods.
EXAMPLES
The present invention will be better understood in the light of the following detailed experiments. Nevertheless, the skilled artisan will appreciate that the present examples are not limitative and that various modifications, substitutions, omissions, and changes may be made without departing from the scope of the invention.
Results
MiR-145-5p is downregulated in advanced and poor prognosis prostate cancer
Analysis of microdissected Formalin Fixed Paraffin Embedded (FFPE) PCa tissues from 16 patients and five normal prostates used as controls revealed significant downregulation in the expression of miR-145-5p in high-grade prostatic intraepithelial neoplasia (HGPIN) and invasive PCa, histologically classified as tumors of Gleason grade High (Figure 1 A, Table 1). Notably, this downregulation was more pronounced in lymph node metastases. MiR-145-5p expression pattern correlated with the activation of the EMT program, as indicated by a concomitant upregulation of the mesenchymal marker Vimentin and the proliferation marker Ki-67, and downregulation of the epithelial marker E-Cadherin (Figure 7A). Analysis of “The Cancer Genome Atlas PRostate Adenocarcinoma” (TCGA PRAD) cohort confirmed that expression of miR-145-5p is progressively downregulated during tumor progression, particularly at advanced stages, and correlates with poor prognosis (Figure IB, 1C). Of note, this change in the miR-145-5p levels is not explained by a copy number loss, since this locus instead appears to be amplified in up to 3% across 10 various PCa cohorts of cBioPortal (J. Gao et al. 2013) (Figure 7B). Conversely, expression of TWIST1, a well-known target of miR-145- 5p, is upregulated during PCa progression, but has limited prognostic value (Figure IB, 1C). High expression of TWIST1 can be partially explained by amplification in up to 10% of PCa cases of cBioPortal (Figure 7B). Collectively, these observations suggest that additional regulatory mechanisms of the miR-145 and TWIST1 axis might be at play during PCa development. Among others, the inventors hypothesized that IncRNAs can counteract the action of miR-145-5p in a control of TWIST1 levels.
Several IncRNAs contain response elements and bind miR-145-5p in PCa cells
To find IncRNAs with a capacity to bind miR-145-5p in PCa tissues, the inventors carried out gene expression and miRNA seed-match analysis, using their previously published total RNA-sequencing dataset from 16 tumoral and 8 contralateral normal prostate tissues (Pinskaya et al., 2019, Life Sci Alliance 2 (6). https://doi.org/10.26508/lsa.201900449). First, they isolated 329 IncRNAs that showed higher expression in tumors compared with normal tissues (fold change > 2, and p-value < 0.01) (Table 3). Among them, the inventors found IncRNAs such as PC ATI and PCAT2, already identified in the ceRNA network (Pang et al. 2019, Oxidative Medicine and Cellular Longevity 2019: 8265958. https://doi.org/10.1155/2019/8265958), but the majority were transcripts with yet unknown roles in PCa biology. The inventors hypothesized that some of these RNAs may interfere with miR-145-5p functions through ceRNA activity, ultimately contributing to PCa progression and aggressiveness. To test this hypothesis, they conducted bioinformatics analysis to isolate 114 transcripts containing at least one miR-145-5p RE from the defined set of 329 PCa-associated IncRNAs (Figure 2A, Table 3). Among them, long intergenic (lincRNAs) and antisense IncRNAs (aslncRNAs) were the most prevalent among various IncRNA types possessing more than one RE (Figure 2B). Following manual curation of RNA-sequencing reads distribution, expression strength, genomic position, and fold change between tumor and normal tissues, the inventors selected several IncRNAs for further study. Among the selected ceRNA candidates were PRNCR1, PCAT5 and LINC02170/ARNCR1, well-known PCa-associated IncRNAs (Ylipaa et al. 2015, Cancer Res 75 (19): 4026-31. https://doi.org/10.1158/0008-5472.CAN-15-0217; Chung et al. 2011, Cancer Science 102 (1): 245-52. https://doi.Org/10. l l l l/j.1349-7006.2010.01737.x; Y. Zhang et al. 2018, Nature Genetics 50 (6): 814-24. https://doi.org/10.1038/s41588-018-0120-
1), but also several IncRNAs of yet unknown function (Table 3).
To verify their predictions, the inventors tested whether a biotinylated miR-145-5p mimic is able to pull-down ceRNA candidates from cell extracts. Two prostate cancer cell lines, PC3a and 22Rvl, were transfected with in vitro biotinylated miR-145 or with a control scramble miRNA, miR-scr, and precipitated on streptavidin beads. In PC3a cells, this experiment revealed miR-145 association with the TWIST 1 mRNA, an experimentally proven miRNA target, but not with ACTB/G1 or GAPDH mRNAs, used as negative controls. Importantly, three IncRNAs, PRNCR1 (6 REs), DLX6-AS1(6 REs), and lnc-ZNF30-3 (5 REs), were significantly enriched in miR-145 pull-downs, as though PCAT5 (3 REs) and ARNCR1 (3 REs) were barely detectable (Figure 2C). Comparable results were obtained in the second 22Rvl cell line (Figure 2D). Lnc-ZNF30-3 showed the strongest enrichment in miR-145 pull-downs. This IncRNA was found to be expressed in all tested PCa cell lines: PC3a, 22Rvl, DU145, and LNCaP at higher levels than in the PNT1A cell line immortalized from normal prostate epithelium (Figure 2E). Hence, the inventors concluded that among tested IncRNAs, lnc-ZNF30-3 containing several miR-145 REs indeed interacts with this miRNA in PCa cells.
Lnc-ZNF30-3 can potentially sponge miR-145, but also other EMT-related miRNAs contributing to poor prostate cancer clinical outcomes.
Lnc-ZNF30-3 is annotated as a long intergenic noncoding RNA gene located in chromosome 19 (ENSG00000269086). Several isoforms are annotated and meet the transcript support level tag in Ensembl database, including the one of 5,394 nucleotides (ENST00000601776.2) hereafter named lnc-ZNF30-3. The latter transcript showed the best RNA-sequencing reads density distribution in prostate tumor tissues of the PAIR cohort (Figure 3A). It was significantly over-expressed in PCa tumors of the PAIR (Pinskaya et al., 2019, supra) (Figure 3 A), and the TCGA PRAD cohorts (Figure 3B). Moreover, high levels of Inc- ZNF30-3 expression correlated with poor clinical outcome in advanced PCa patients of the PRAD cohort (Figure 3C). Hence, miR-145 and lnc-ZNR30-3 collectively, show negative correlation of expression in advanced PCa tumors, reinforcing the idea of its function as ceRNA.
More detailed bioinformatics analysis for miR-145-5p seed matching within the lnc-ZNF30-3 transcript identified one supplementary RE, a 7-mer sequence with an additional GU base pair, alone with four conventional 6-mers, but also four miR-145-3p 7 mer GU REs (Saito and Sastrom 2010 N Biotechnol. 2010 Jul 31;27(3):243-9. doi: 10.1016/j.nbt.2010.02.016) (Figure 3D). In addition to miR-145, TWIST1 has been experimentally proven to be targeted by 35 other miRNAs in various cancers and cell models (Table 4). Hence, the inventors extended their seed match search and found REs for 34 additional miRNAs within the lnc-ZNF30-3 transcript (Figure 3E, Table 4). In addition to TWIST 1 targeting miRNAs, they also curated other miRNAs experimentally proven to control the expression of TWIST2, ZEB 1/2, and SNAIL1/2 transcription factors. The majority of seed-matched sites were shared with lnc-ZNF30-3 (Figure 3E, Table 5). The presence and versatility of such an important number of REs within Inc- ZNF30-3 suggests a complex regulatory network between this IncRNA, miRNAs and transcription factors driving EMT.
Lnc-ZNF30-3 binding to nuR-145-5p depends on miRNA seed element
To further prove the specificity of miR-145-5p and lnc-ZNF30-3 interactions, the inventors carried out a pull-down assay using biotinylated wild-type (wt) or mutant (mut) miR-145-5p sequence with two nucleotide substitutions in the seed element. In addition, these synthetic miRNAs, hereafter named ZATA-miRs, also contained a 2’F modification of the sugar backbone to improve miRNA penetration into cells. A biotinylated synthetic miR-145-5p oligonucleotide and a scramble (miR-scr) were used as controls. Each of the three mimics was annealed to a corresponding non-labeled passenger strain (pas), miR-145-3p. The inventors then transfected ZATA and unmodified miR-145-wt and -mut mimics into PC3a cells and carried out streptavidin-mediated precipitations. To verify the efficiency of transfection and precipitation, they transferred an aliquot of each cell lysate, collected 24 hours posttransfection, to a nitrocellulose membrane for blotting with HRP-conjugated streptavidin. Most of the biotinylated miR-145-wt and -mut mimics were detected in cell lysates and highly enriched in streptavidin pull-downs (Figure 4A). Next, they verified whether the labeled mimics were incorporated into the RISC complex. They carried out a Western blot analysis of miR- 145-5p-primed streptavidin pull-downs with anti-AG02 antibody and found that only the biotin-labeled miR-145-5p, ZATA, or unmodified, co-precipitated with AG02, but not the nonbiotinylated one. No ACTl/Actin co-precipitation with biotinylated mimics was not detected (Figure 4B). These experiments demonstrated that biotin-labeled mimics penetrated into cells and were successfully incorporated into the RISC complex. RT-qPCR quantifications revealed the presence of lnc-ZNF30-3 as well as TWIST1 and ZEB2 (proven miR-145 targets) in both miR-145-wt pull-downs, but not in the miR-145-mut mimics and miR-scr controls (Figure 4C).
This result confirmed a high specificity of interaction between miR-145-5p and Inc- ZNF30-3 requiring the match between miRNA seed and IncRNA RE sequences. Hence, the inventors showed that in PCa cells the lnc-ZNF30-3 interaction with miR-145-5p requires miRNA seed sequence.
Lnc-ZNF30-3 controls TWIST1 expression and mesenchymal traits of PC3a cells
To understand whether lnc-ZNF30-3 has a function in PCa, the inventors used an siRNA- mediated loss-of-function approach. PC3a or PNT1 A cells were transfected with siRNA against lnc-ZNF30-3 (siLNC) 5’ugcaagcaguccagguguauu 3’ (HR1ZN-004520, Dharmacon, SEQ ID NO : 43) or control siRNA (siSCR) (siRNAscr-1 529856, Sigma) and tested for cell migration in a wound-healing assay for a further 48 hours. PNT1 A cells, which do not express lnc-ZNF30- 3, were used as a negative control. Depletion of lnc-ZNF30-3 resulted in decreased migration of PC3a cells, whereas it did not have a significant impact on the wound-healing of PNT1A cells (Figure 5A). Loss of cell motility can result from a change in EMT gene expression. The inventors measured the expression of a set of mesenchymal and epithelial markers at the RNA level by RT-qPCR. Depletion of lnc-ZNF30-3 induced a decrease in mRNA levels of mesenchymal Vimentin (VIM), TWIST 1 and ZEB 1, but not of Fibronectin (FN1) and epithelial E-Cadherin (CHD1) (Figure 5B). They also measured by Western blot protein levels of some EMT markers following lnc-ZNF30-3 depletion. Expression of ZEB 1, TWIST 1, and Vimentin were decreased in PC3a cells but not in PNT1 A cells (Figure 5C). The reduced expression of these mesenchymal genes was consistent with a loss of migration by PC3a depleted of Inc- ZNF30-3, supporting a specific role of this IncRNA in EMT. Notably, it resulted in a partial change in cell identity toward a more pronounced epithelial phenotype.
The inventors tested whether lnc-ZNF30-3 depletion releases miR-145-5p, which in turn would be able to target and diminish TWIST1 levels, affecting cell motility. PC3a cells were transfected with lnc-ZNF30-3 siRNA alone or together with miR-145-5p inhibitors (Ambion MH11480) and used for protein extraction and Western blot and, in parallel, for the woundhealing assay. They observed that miR-145-5p inhibition resulted in partial rescue of downregulation of TWIST1 and ZEB1, and consequently of cell motility upon lnc-ZNF30-3 depletion (Figure 6A, 6B).
Together, the inventors’ results supported a role for lnc-ZNF30-3 as the ceRNA diverting miR-145-5p from its genuine target, TWIST1, in a control of EMT in PCa cells (Figure 6C).
Conclusions
In the present work, the inventors confirmed the association of miR-145-5p downregulation with increasing Gleason grading and poor outcomes in patients with PCa and identified a novel long noncoding RNA lnc-ZNF30-3 having ceRNA activity against miR-145- 5p in PCa cells. This IncRNA is upregulated in PCa tissues and cell lines, compared with normal prostate epithelial tissues and cells. By combining computational predictions with experimental validations, the inventors demonstrated that lnc-ZNF30-3 contains five response elements matching with canonical and non-canonical miR-145 seed sequences and interacts with miR- 145-5p in a seed sequence-dependent manner. Indeed, biotinylated miR-145-5p can pull-down lnc-ZNF30-3 and AG02. This interaction may be dismissed by two-point mutations in the miR- 145-5p seed site, highlighting its specificity. SiRNA-mediated lnc-ZNF30-3 depletion of Inc- ZNF30-3 in PC3a cells results in reduced cell migration. Observed changes in migratory properties of cells are associated with a decrease in expression of mesenchymal transcription factors TWIST1 and ZEB1 at both RNA and protein levels. These findings suggested that Inc- ZNF30-3 knockdown promotes a partial loss of mesenchymal traits in benefit of a more pronounced epithelial phenotype.
In this context of low lnc-ZNF30-3 levels, further inhibition of miR-145-5p allows a rescue of cell motility and upregulation of TWIST 1 and ZEB1. This indicates that the effect of Inc- ZNF30-3 depletion can be related to a release of miR-145-5p and its interaction with various functional targets such as TWIST 1. Computational predictions and literature survey identified REs for 35 out of 36 miRNAs experimentally proven to target and control TWIST 1 expression in various cancers. Dysregulated expression of 11 of these miRNAs was found in PCa, 9 being down-regulated. This observation suggested that lnc-ZNF30-3 potentially works as a sponge for those miRNAs. It is important to mention that upregulation of lnc-ZNF30-3 was comparable to upregulation of TWIST 1 in 7 PCa versus normal tissues. Moreover, TWIST 1 upregulation in PCa tissues from TCGA cohort corelates with down-regulation of miR-145 expression, particularly during late-stage PCa progression. Notably, expression changes in TWIST 1 and miR-145 expression in PCa cannot be fully explained by accumulation of genetic abnormalities during PCa development, leaving room for the involvement of epigenetic regulatory mechanisms. The inventors uncovered for the first time lnc-ZNF30-3 sponge function to be an important regulatory mechanism. Furthermore, lnc-ZNF30-3 can deplete most miRNAs that already been proven to target and control other EMT transcription factors, such as TWIST2, ZEB1, ZEB2, SNAIL1, and SNAIL2 in various cancers. Thus, the inventors’ results suggest that the lnc-ZNF30-3 can have ceRNA function that broadly controls EMT activation by counteracting miR-145-5p and probably other microRNAs.
Lnc-ZNF30-3 expression in PC3a cells is relatively low. Nevertheless, further depletion of IncRNA still had an effect on cell properties. It could be that expression of this IncRNA is heterogeneous among the tumor cell population. Additionally, lnc-ZNF30-3 could be secreted along with miR-145-5p as a part of extracellular vesicles. It has been shown that the miR-145- 5p to be actively transported outside the cells in colorectal (Shinohara et al. 2017, Journal of Immunology (Baltimore, Md.: 1950) 199 (4): 1505-15. https://doi.org/10.4049/jimmunol.1700167), lung (Dimitrova et al. 2016, Cancer Discovery 6 (2): 188-201. https://doi.org/10.1158/2159-8290.CD-15-0854), and prostate (El-Sayed et al. 2017, Cancer Letters 410 (December): 100-111. https://doi.Org/10.1016/j.canlet.2017.09.010) cancers by a mechanism that has not yet been characterized. As a matter of fact, the inventors observed an accumulation of lnc-ZNF30-3 and miR-145-5p outside proliferating and, to a lesser extent, in senescent fibroblasts. Thus, the role of lnc-ZNF30-3 and miR-145-5p in cell-to-cell communication warrants further investigation.
Moreover, bioinformatics analysis revealed that in addition to miR-145, lnc-ZNF30-3 also contains potential binding sites to other miRNAs experimentally proven to target TWIST 1, but also binding sites to most miRNAs that target other mesenchymal transcription factors, such as TWIST2, SNAIL1/2, and ZEB 1/2 in various cancer models. The results presented herein indicate lnc-ZNF30-3 to be a novel endogenous competing IncRNA for miR-145-5p and other miRNAs that target TWIST 1 during in PCa and potentially in the development of other cancers. Overexpression of lnc-ZNF30-3 in prostate cancer tissues is thus of interest for use as a biomarker to predict metastatic behavior. These findings shine a light on lnc-ZNF30-3 as a biomarker for stratification of PCa tumors, support its involvement in EMT and metastasis, and so promotes this IncRNA as a promising candidate for development of alternative PCa therapies.
Materials and Methods
Cell culture
All prostate cell lines: PC3a, PNT1A, 22RV1, and LNCaP, DU145 were obtained from ATCC and cultured in RPMI media (ThermoFisher) with 10% FBS.
FFPE cohort of PCa tissues
Formalin-fixed paraffin-embedded (FFPE) tissues from 16 patients with newly diagnosed PCa, treated by radical prostatectomy and pelvic lymph node dissection (Table 1), and five normal prostates from necropsies of age-matched individuals, were included in this study. Informed consent was obtained in accordance with the Declaration of Helsinki. This study was approved by the Fundacion Santa Fe Institutional Review Board. The median age at the time of diagnosis was 57.5 ± 8.2 (range 42-70) years. Patients were stratified into risk groups according to D’Amico Classification (D’Amico et al. 1998, JAMA 280 (11): 969-74. https://doi.org/10.1001/jama.280. l l.969). Four patients were Low risk; four patients were intermediate risk; and eight patients were high risk, including four who developed lymph node metastases). Histological diagnosis and Gleason scores were recorded according to the consensus criteria (Epstein et al. 2005, Journal of Surgical Pathology 29 (9): 1228-42. https://doi.org/10.1097/01.pas.0000173646.99337.bl). Manual microdissection of all FFPE samples was carried out in order to obtain a pure population of epithelial cells for miRNA expression analysis.
Table 1. Clinicopathological characteristics of the FFPE cohort of PCa tissues. Pathological analyses
Using a microtome, FFPE tissue sections were cut (5pm-thick), and applied to electrostatically-charged microslides. Hematoxylin and eosin (H&E) staining was carried out using standard procedures to examine tissue morphology for diagnosis and to perform microdissection of the epithelial compartment for miRNA expression analysis. In short, tissue sections were deparaffinized in xylene, hydrated gradually in a series of graded alcohols, and washed in deionized water. Slides were stained with Gill’s hematoxylin solution, then washed in an acid alcohol and rinsed with water overnight, after which eosin staining and dehydration were performed. Immunohistochemistry for E-cadherin, Vimentin and Ki-67 was done on deparaffinized sections, using an indirect immunoperoxidase method and Dako antibodies against these markers. In short, for antigen unmasking, slides were treated with a sodium citrate buffer at pH 6.0, heated at 95°C for 5 min, and washed in deionized water. Slides were incubated with HRP-conjugated IgG followed by incubation in a peroxidase substrate and chromogen mixture. Optimal time for staining was determined for each antibody. Images were taken using the Provis-AX-70 microscope at 400x magnification with a 0.344 mm field size.
Transfection of siRNA, miR mimics, and inhibitors
A total of 30 pmol of siRNA or of 30 pmol, or 100 pmol of single or double-stranded biotinylated probes, respectively, were transfected into 3*105 PC3a cells or 6*105 PNT1A cells, using RNAi RNAmax reagent (Qiagen) according to the manufacturer’s instructions. Experiments were carried out 24 hours post-transfection.
MiR-145-5p mimic (MCI 1480), MiR-145-5p inhibitor (MH11480) and miR-scr (AM17010) were purchased from Ambion. The 2’F modified mimics, named ZATA-miRs, were provided by ZATA Pharmaceuticals Inc. Mimics were biotinylated using the 3 ’end Biotinylation Kit (PierceTM) according to manufacturer’s instruction. Biotinylated mimics were annealed with the equimolar amount of a complementary passenger strand by heating to 70°C for 3 min and progressive cooling down to 21 °C.
Sequences of miRNA mimics (5’ -> 3’): wt - wild-type consensus of miR-145-5p, mut - mutated sequence containing two nucleotide substitutions (underlined), pas - passenger miR- 145-3p strand. miR-145-5p (wt) GUC CAG UUU UCC CAG GAA UCC CU (SEQ ID NO: 31) miR-145-5p (mut) GUU CAG UCU UCC CAG GAA UCC CU (SEQ ID NO: 32) miR-145-3p (pas) GGA UUC CUG GAA AUA CUG UUC U (SEQ ID NO: 33) Wound healing assay
The scratch was introduced into a confluent monolayer of cells with a pipette tip and cell migration was measured 24 hours post-scratch. Images were quantified using TScratch software as a wound surface at 24 hours (T24) versus at time zero (TO) post-scratch.
Western blot
Cells were detached from plates by trypsinization, pelleted, and washed once in phosphate- buffered saline (IxPBS, Life Technologies), then resuspended in the lysis buffer (20 mM Hepes-KOH pH 7.8, 100 mM KC1, 5 mM MgC12, 2 mM DTT, 25% NP-40) supplemented with the protease inhibitor cocktail (Roche) and incubated on ice for 15 minutes. The lysate was centrifuged at 13,000 g for 30 minutes and the supernatant recovered. A total of 20 pg of proteins was resolved in Bis-Tris polyacrylamide gel 4-12% (Nu-Page, Invitrogen) and transferred, using the Xcell II blot module (Invitrogen), to a nitrocellulose membrane (Amersham). Membranes were stained using Ponceau Red (Sigma), then washed in PBST (IxPBS, 0.1% Tween-20, Sigma) and blocked in PBST with 5% non-fat milk. Primary antibodies (dilution, reference, supplier): Vimentin (1 : 1000, 9782, Cell Signaling), E-Cadherin (1 : 1000, 9782, Cell Signaling), TWIST1 (1 : 1000, sc-15393, Santa Cruz Biotechnology), ZEB1 (1 : 1000, TA802298, Origene), AGO2 (1 : 1000, Sab42000085V, Sigma), P-Actin (1 :2000, sc- 4778, Santa Cruz Biotechnology) were incubated overnight at 4°C in PBST with 5% non-fat milk. Then membranes were washed 3 times for 10 minutes in PBST and incubated with secondary antibodies in PBST with 5% non-fat milk for 1 hour at room temperature. Signals were revealed using the Chemiluminescence kit (SuperSignal, West Femto, Thermo Scientific) and the ChemiDoc Imaging system (Bio-Rad), and quantified using Imaged software.
Dot blot
Samples were spotted onto a nylon membrane (GE Healthcare) and air-dried. The membrane was then baked in a regular oven at 80°C for 2 hours and exposed to ultraviolet radiation for 2 hours. The membrane was incubated in blocking solution with 5% milk in PBST for 1 hour at room temperature. It was then incubated with HRP-conjugated streptavidin (TSATM KIT, Invitrogen) overnight in 5% milk in PBST and washed 3 times in PBST buffer. The dot blot was developed using a Chemiluminescence kit (SuperSignal, West Femto, Thermo Scientific) and the ChemiDoc imaging system (BioRad). RNA extraction, reverse transcription, and quantitative PCR (RT-qPCR)
Total RNA was extracted from cells using Qiazol (Qiagen) according to the manufacturer’ s instructions. Either 1000 ng of total RNA or 200 ng of DNase-treated total RNA was used for random primed transcription with SuperScriptTM III Reverse transcriptase (Thermo Fisher). cDNAs were quantified by qPCR, using SYBR Green GoTaqR Master Mix (Promega) and the Roche LC480 instrument.
From FFPE samples (20-pm-thick paraffin sections), total RNA was extracted using the Recover All total nucleic acid isolation kit (Ambion). MicroRNA expression was examined via RT-qPCR following the MIQE guidelines (Bustin et al. 2009) and Taqman assays targeting hsa-miR-145-5p and RNU24 as a reference gene (Applied Biosystems). Data were obtained using the LightCycler® 480 Real-time PCR System (Roche Applied Science). Only CT values below 35 were considered for analysis. Fold change was calculated using the 2A(-AACT) method relative to ACTB/G1 for IncRNAs and mRNAs and RNU24 for miRNAs (Schmittgen and Livak 2008). Primer sequences are presented in Table 2. Table 2. Primers used in this study
Cell pellets were incubated with the RIPA buffer (PierceTM) supplemented with the protease inhibitor cocktail (Roche) and Superase In, RNase inhibitor (Thermo Fisher Scientific) for 15 min on ice, then centrifuged for 15 min at 13,000 rpm. Supernatants were collected and supplemented by an equal volume of 2X TNT buffer (50 mM Tris-Cl pH 8.0, 2 mM EDTA, 150 mM NaCl, and 1% Triton X-100). Streptavidin agarose beads (30 pL per reaction, Thermo Fisher Scientific) were washed in TNT 3 times for 2 min and 2,000 rpm spin at 4°C, then incubated with cellular extracts for 1 hour at room temperature. Beads were washed 3 times for 10 min at 20 rpm in 500 pL PBS and treated with Qiazol for RNA extraction.
Bioinformatics search for miR-145 RE in IncRNAs
The transcripts were searched for canonical (6mer, UCCAGU) miR-145-5p seed motif matches RE (ACUGGA) (Friedman et al. 2009, Genome Research 19 (1): 92-105. https://doi.org/10.1101/gr.082701.108). Target search and result visualization were carried out using an in-house developed tool in R (R Core Team (2013).
RNA-sequencing datasets
The PAIR cohort data for IncRNAs is composed of 24 RNA-seq datasets (16 tumor and 8 normal prostate tissues of prostatectomy origin) and were retrieved from the gene omnibus portal, accession number GSE115414. RNA-seq data and corresponding clinical information were obtained from a publicly available TCGA dataset of the PRAD cohort comprised in total of 424 specimens (52 normal and 372 tumor tissues) (http://cancergenome.nih.gov).
Table 3. PCa upregulated LncRNAs with miR-145 REs
Table 4. MiRNAs experimentally proved to bind and regulate expression of TWIST 1, and corresponding REs identified within the lnc-ZNF30-3 transcript. Table 5. Number of REs for miRNAs experimentally proved to bind and regulate expression of EMT factors: TWIST1/2, ZEB 1/2, SNAIL1/2, and putative REs within Inc-
ZNF30-3

Claims

1- Use of lnc-ZNF30-3 or a fragment thereof of at least 30 nucleotides as a biomarker of cancer diagnosis or prognosis in a subject.
2- An in vitro method for predicting the outcome of a subject having a cancer, said method comprising: a) determining expression level of lnc-ZNF30-3 or a fragment thereof of at least 30 nucleotides in a biological sample of the subject, preferably a cancer sample; and b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3 or fragment thereof, thereby predicting the outcome of the subject having a cancer; wherein an increased expression level of lnc-ZNF30-3 or fragment thereof is indicative of a poor outcome.
3- A pharmaceutical composition comprising an inhibitor of lnc-ZNF30-3 expression, and optionally a pharmaceutically acceptable excipient, wherein the inhibitor of lnc-ZNF30-3 expression is a nucleic acid molecule interfering specifically with the expression of lnc-ZNF30- 3, or a genome editing system targeting specifically lnc-ZNF30-3.
4- The pharmaceutical composition according to claim 3, wherein the nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3 is an antisense nucleic acid, a RNAi nucleic acid, a ribozyme or a gapmer, preferably is an antisense nucleic acid or a RNAi nucleic acid, even more preferably a RNAi nucleic acid.
5- The pharmaceutical composition according to claim 3, wherein the genome editing system targeting specifically lnc-ZNF30-3 is selected from the group consisting of CRISPRi, the CRISPR/Cas system, the Zinc-finger nuclease (ZFN) system, the TALEN system, and the meganuclease system, preferably is the CRISPR/Cas system even more preferably is the CRISPR/Cas9 system.
6- The pharmaceutical composition of anyone of claims 3-5, for use in the treatment of cancer.
7- An in vitro method for identifying a subject having a cancer suitable for treatment with the pharmaceutical composition according to anyone of claims 3 to 5, said method comprising: a) determining expression level of lnc-ZNF30-3 or a fragment thereof of at least 30 nucleotides in a biological sample of the subject, preferably a cancer sample; and b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3 or fragment thereof, thereby identifying whether the subject having a cancer is suitable for said treatment, wherein an increased expression level of lnc-ZNF30-3 or fragment thereof indicates that the subject is suitable for said treatment.
8- A kit comprising at least one reagent capable of specifically detecting lnc-ZNF30-3 or a fragment thereof of at least 30 nucleotides, wherein the at least one reagent are primers or probes.
9- Use of a kit according to claim 8, for cancer diagnosis or cancer prognosis or for identifying a subject having a cancer suitable for treatment with a pharmaceutical composition according to anyone of claims 3 to 5.
10- The use according to claim 1 or 9, the pharmaceutical composition for use according to claim 6, or the method according to claim 2 or 7, wherein the cancer is selected from the group consisting of prostate cancer, cholangiocarcinoma, glioblastoma multiforme, head and neck squamous cell carcinoma, kidney renal clear cell carcinoma, pancreatic adenocarcinoma, pheochromocytoma and paraganglioma, skin cutaneous melanoma and lung adenocarcinoma.
11- The use according to claim 1 or 9, the pharmaceutical composition for use according to claim 6, or the method according to claim 2 or 7, wherein the cancer is a prostate cancer.
12- The use according to claim 11, the pharmaceutical composition according to claim 11, or the method according to claim 11, wherein the cancer is a metastatic, advanced or resistant prostate cancer.
13- The use according to anyone of claims 1, 9-12, the pharmaceutical composition according to anyone of claims 3-5, the pharmaceutical composition for use according to anyone of claims 6, 10-12, the kit of claim 8, or the method according to anyone of claims 2, 7, 10-12, wherein the lnc-ZNF30-3 is an isoform of lnc-ZNF30-3 selected from the group consisting of ZNF30-3:l, ZNF30-3:2, ZNF30-3:3, ZNF30-3:4, ZNF30-3:5, ZNF30-3:6, ZNF30-3:7 and ZNF30-3:8, preferably from the group consisting of lnc-ZNF30-3: l, lnc-ZNF30-3:2, Inc- ZNF30-3:4 and lnc-ZNF30-3:7.
14- The use according to anyone of claims 1, 9-12, the pharmaceutical composition according to anyone of claims 3-5, the pharmaceutical composition for use according to anyone of claims 6, 10-12, the kit of claim 8, or the method according to anyone of claims 2, 7, 10-12, wherein the lnc-ZNF30-3 has a nucleic acid sequence selected from the group consisting of SEQ ID NO: 34 to 41.
15- The use according to anyone of claims 1, 9-12, the pharmaceutical composition according to anyone of claims 3-5, the pharmaceutical composition for use according to anyone of claims 6, 10-12, the kit of claim 8, or the method according to anyone of claims 2, 7, 10-12, wherein the lnc-ZNF30-3 fragment has length comprised between 30 and 1000 nucleotides.
16 - A method for treating a cancer in a subject in need thereof, said method comprising: a) determining expression level of lnc-ZNF30-3 in a biological sample of the subject, preferably a cancer sample; b) comparing the expression level determined in step a) with a reference expression level for lnc-ZNF30-3; and c) if the expression level of lnc-ZNF30-3 determined in step a) is higher than the reference expression level, administering a therapeutically effective amount of a pharmaceutical composition comprising an inhibitor of lnc-ZNF30-3 expression according to anyone of claims 3-5.
17. Use of an inhibitor of lnc-ZNF30-3 expression or of a pharmaceutical composition according to anyone of claims 3-5, for the manufacture of a medicament for the treatment of cancer.
18. The use of claim 17, wherein the inhibitor of lnc-ZNF30-3 expression is a nucleic acid molecule interfering specifically with the expression of lnc-ZNF30-3, or a genome editing system targeting specifically lnc-ZNF30-3.
EP23809589.7A 2022-11-22 2023-11-21 Lnc-znf30-3 as cancer biomarker and therapeutic target Pending EP4623106A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22306723 2022-11-22
PCT/EP2023/082551 WO2024110458A1 (en) 2022-11-22 2023-11-21 Lnc-znf30-3 as cancer biomarker and therapeutic target

Publications (1)

Publication Number Publication Date
EP4623106A1 true EP4623106A1 (en) 2025-10-01

Family

ID=84421124

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23809589.7A Pending EP4623106A1 (en) 2022-11-22 2023-11-21 Lnc-znf30-3 as cancer biomarker and therapeutic target

Country Status (2)

Country Link
EP (1) EP4623106A1 (en)
WO (1) WO2024110458A1 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5310652A (en) 1986-08-22 1994-05-10 Hoffman-La Roche Inc. Reverse transcription with thermostable DNA polymerase-high temperature reverse transcription
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
EP3330875B1 (en) 2003-07-10 2021-12-01 Genomic Health, Inc. Expression profile algorithm and test for prognosing breast cancer recurrence
WO2021152005A1 (en) 2020-01-28 2021-08-05 Universite De Strasbourg Antisense oligonucleotide targeting linc00518 for treating melanoma

Also Published As

Publication number Publication date
WO2024110458A1 (en) 2024-05-30

Similar Documents

Publication Publication Date Title
US12129522B2 (en) MicroRNA assay for detection and management of pancreatic cancer precursors
JP5931050B2 (en) Materials and methods associated with mismatch repair and regulation of genomic stability by miR-155
JP2012500389A (en) MicroRNA-based compositions and methods for diagnosis, prognosis and treatment of multiple myeloma
JP2012510813A (en) MicroRNA-based methods and compositions for diagnosis and treatment of ovarian cancer
EP3122905B1 (en) Circulating micrornas as biomarkers for endometriosis
US20140154303A1 (en) Treating cancer by inhibiting expression of olfm4, sp5, tob1, arid1a, fbn1 or hat1
US10030269B2 (en) Biomarkers, methods, and compositions for inhibiting a multi-cancer mesenchymal transition mechanism
US10364470B2 (en) Long non-coding RNA expressed in aggressive cancer
KR20180108820A (en) Genetic profiling of cancer
KR20110015013A (en) Methods of Evaluating Colorectal Cancer and Compositions for Use Here
JP2015508282A (en) Materials and methods for NSAID chemoprevention in colorectal cancer
WO2019052708A1 (en) Mafg as a potential therapeutic target to restore chemosensitivity in platinum-resistant cancer cells
CN110938698A (en) Application of Sox9 in predicting sensitivity of triple-negative breast cancer to CDK7 inhibitor THZ1
WO2016016898A1 (en) Compositions for treatment of acute lymphoblastic leukemia and methods of use thereof
US10294476B2 (en) NEAT1 as a prognostic marker and therapeutic target for prostate cancer
WO2024110458A1 (en) Lnc-znf30-3 as cancer biomarker and therapeutic target
CN106702009B (en) Application of gene related to lung adenocarcinoma
KR102279189B1 (en) Pharmaceutical composition for treat metastasis of colorectal cancer
TWI756634B (en) Biomarker for prognosis of colorectal cancer
EP2199407A1 (en) In vitro methods and compositions for the diagnosis and/or treatment of adenocarcinoma
CN108841964B (en) Application of LOC105370108 in the diagnosis and treatment of rectal adenocarcinoma
JP2013128434A (en) Gastrointestinal stromal tumor marker
WO2017005957A1 (en) Determination of methylation and mirna-7 levels for predicting the response to a platinum-based antitumor compound
HK40049419A (en) Circulating micrornas as biomarkers for endometriosis
Zhou tRNA Fragments: Expression and Function in Ovarian Cancer

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250620

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)