EP4622666A1 - Attenuated african swine fever virus and use thereof in vaccine compositions - Google Patents

Attenuated african swine fever virus and use thereof in vaccine compositions

Info

Publication number
EP4622666A1
EP4622666A1 EP23809585.5A EP23809585A EP4622666A1 EP 4622666 A1 EP4622666 A1 EP 4622666A1 EP 23809585 A EP23809585 A EP 23809585A EP 4622666 A1 EP4622666 A1 EP 4622666A1
Authority
EP
European Patent Office
Prior art keywords
asfv
gene
strain
ep153r
animals
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23809585.5A
Other languages
German (de)
French (fr)
Inventor
Erwin VAN DEN BORN
María Luisa ARIAS NEIRA
Carmina GALLARDO FRONTAURA
Jovita FERNÁNDEZ PINERO
Zoltán ZÁDORI
István MÉSZÁROS
Ferenc Olasz
José Manuel SÁNCHEZ-VIZCAÍNO RODRÍGUEZ
Sandra BARROSO ARÉVALO
José Ángel BARASONA GARCÍA-ARÉVALO
Aleksandra KOSOWSKA
Paloma Rueda Pérez
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gold Standard Diagnostics Madrid SA
Consejo Superior de Investigaciones Cientificas CSIC
Universidad Complutense de Madrid
Allatorvostudomanyi Kutatointezet
Intervet International BV
Original Assignee
Gold Standard Diagnostics Madrid SA
Consejo Superior de Investigaciones Cientificas CSIC
Universidad Complutense de Madrid
Allatorvostudomanyi Kutatointezet
Intervet International BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gold Standard Diagnostics Madrid SA, Consejo Superior de Investigaciones Cientificas CSIC, Universidad Complutense de Madrid, Allatorvostudomanyi Kutatointezet, Intervet International BV filed Critical Gold Standard Diagnostics Madrid SA
Publication of EP4622666A1 publication Critical patent/EP4622666A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C12N7/04Inactivation or attenuation; Producing viral sub-units
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5254Virus avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/54Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A61K2039/541Mucosal route
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/55Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552Veterinary vaccine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/57Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/12011Asfarviridae
    • C12N2710/12021Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/12011Asfarviridae
    • C12N2710/12034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/12011Asfarviridae
    • C12N2710/12061Methods of inactivation or attenuation
    • C12N2710/12062Methods of inactivation or attenuation by genetic engineering
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/12011Asfarviridae
    • C12N2710/12071Demonstrated in vivo effect

Definitions

  • the present invention relates to African Swine Fever attenuated viruses wherein genes have been inactivated, which can be used as a vaccine.
  • the attenuated viruses protects pigs against subsequent challenge with virulent virus.
  • the present invention also relates to the use of such attenuated viruses to treat and/or prevent African Swine Fever.
  • African swine fever is a devastating haemorrhagic disease of domestic pigs and wild suids caused by a large double-stranded DNA virus, African swine fever virus (ASFV).
  • ASFV African swine fever virus
  • ASFV is the only member of the Asfarviridae family and replicates predominantly in the cytoplasm of cells. Virulent strains of ASFV can kill domestic pigs within about 5-14 days of infection with a mortality rate approaching 100%.
  • ASFV can infect and replicate in warthogs (Phacochoerus sp.), bushpigs (Potamocherus sp.) and soft ticks of the Ornithodoros species (which are thought to be a vector), but in these species few if any clinical signs are observed and long-term persistent infections can be established.
  • ASFV was first described after European settlers brought pigs into areas endemic with ASFV and, as such, is an example of an “emerging infection”. The disease is currently endemic in many sub-Saharan countries, and in several European and Southeast Asian regions. Vaccination is considered the most efficient strategy and solution for disease control. However no vaccine is available for ASF so far. In the past, some countries reached eradication by using several strategies that included widespread culling and improvements of biosecurity in farms.
  • ligand-binding domain formed by amino acids 1-203 of the EP402R gene
  • ligand-binding domain is essential for an efficient gene expression. Mutations of one or more nucleotides in the ligand-binding domain may disrupt folding of the EP402R protein. However, disruption of folding may mean that the EP402R protein folds differently and is expressed more slowly but correctly.
  • the EP402R mutation described at nucleotide position 393, that is in the ligand-binding domain in ASFV Lv17/WB/Rie1 could result in a non-functional protein, it has not been demonstrated in vitro whether this mutation prevents expression of the EP402R protein (CD2v) during infection with the non-HAD Lv17/WB/Rie1 virus. Therefore, the Lv17/WB/Rie1 isolate can be considered a field strain with a point mutation within the EP402R gene that confers non-HAD characteristics that appear to be related to the attenuation of the field strain.
  • Petrovan Vlad et al. (Journal of Virology, 2022, 96, 1) describes a virulent ASFV strain (Benin97) of genotype I, comprising deletions in the DP148R, EP153R and EP402R genes.
  • Petrovan Vlad et al. describes that additional deletion of EP153R (BeninADP148RAEP153RAEP402R) further attenuated the virus after immunization, but decreased protection and detection of moderate levels of challenge virus in blood were observed.
  • deletion of EP153R alone from the BeninADP148R strain did not result in further attenuation of the virus and did not reduce the period of virus persistence in the blood.
  • the document CA3170058 A1 describes an attenuated ASFV strain designated GeorgiaAK145RAEP153RCD2vQ96R in which the K145R and EP153R genes were deleted and the EP402R/CD2v protein was mutated to comprise the Q96R amino acid substitution, which appears to reduce HAD activity but not provide a complete inactivation of the gene.
  • the strain comprises functional versions of several MGF genes.
  • the inventors of the present invention have found that the inactivation of two genes in the naturally attenuated ASFV Lv17/WB/Rie1 strain, as disclosed in the patent application W02020/049194, leads to a further attenuated strain of the virus which, when used as an immunogenic composition/vaccine, provide excellent protection against a virus challenge both in pigs as well as in wild boars without reverting to the HAD phenotype. This strain is expected to be safe for pregnant sows as well.
  • a first aspect of the present invention relates to a live attenuated African swine fever virus (ASFV) characterized in that it comprises a modified form of the genome of the ASFV Lv17/WB/Rie1 strain in which the EP153R gene and the EP402R gene have been inactivated.
  • ASFV African swine fever virus
  • Another aspect of the present invention relates to an immunogenic composition or a vaccine composition
  • an immunogenic composition or a vaccine composition comprising the attenuated ASFV according to the invention and a pharmaceutically suitable carrier or excipient.
  • a further aspect relates to a recombinant ASFV according to the invention for use in the prevention or treatment of a disease caused by the infection of ASFV.
  • Yet another aspect relates to a polynucleotide comprising a first, second and third region, wherein the first region comprises an expression cassette comprising an ASFV heterologous gene, wherein the first region is flanked by the second and third regions and wherein said second and third regions are the ASFV genomic regions which naturally flank the ASFV EP402R gene in the ASFV genome of Lv17/WB/Rie1 strain.
  • Another aspect relates to a vector comprising the polynucleotide according to the invention.
  • a further aspect relates to a host cell comprising the polynucleotide according to the invention, or the vector according to the invention.
  • One more aspect of the present invention relates to a method for producing a recombinant African swine fever virus (ASFV) according to the invention, the method comprising:
  • step (ii) maintaining the target cells under conditions adequate for the double-strand DNA break in the ASFV genome to take place and to allow homologous recombination between the ASFV genome containing the DNA break and the second and third regions of the polynucleotide thereby resulting in the replacement of the region encoding the EP402R and EP153R genes by the first region within the polynucleotide introduced in step (i), and
  • Figure 12 Averages of rectal temperature for wild boar orally vaccinated with 10 4 (solie line) and 10 2 (dotted line) of ASFV Lv17/WB/Rie1-ACD after challenge.
  • Figure 15 Average of viremia expressed in cycles of quantification (Cq) values of realtime PCR carried out for wild boar orally vaccinated with 10 4 (squares, dash line) and 10 3 (circles, dotted line) of ASFV Lv17/WB/Rie1 , non-immunized (diamonds, solid line) and control (crosses, dash-dotted line).
  • Figure 16 Average of viremia expressed in cycles of quantification (Cq) values of realtime PCR carried out for wild boar orally vaccinated with 10 4 (solid line) and 10 2 (dashed lined) of ASFV Lv17/WB/Rie1-ACD.
  • Figure 17 Average observed daily of clinical scores in animals vaccinated with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2).
  • Figure 18 Average of the severity of clinical signs showed by animals after immunization with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2).
  • Figure 19 Average of rectal temperatures throughout the study of animals immunized with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2).
  • Figure 20 Survival chart of pigs immunized with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2) after vaccination.
  • Figure 21 Viremia, virus in blood, detected by PCR in pigs immunized with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2) before challenge.
  • Figure 22 Antibody response raised in pigs after immunization with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2).
  • Figure 23 Average of the clinical score showed by pigs after vaccination and after challenge with the virulent Arm07 ASFV. Control pigs after challenge died at 7 days post challenge (data not included).
  • Figure 24 Average of the severity of the individual parameters used to determine the clinical scores of pigs vaccinated with the mutant vaccine strain or with the parental strain, after challenge with high virulent Arm07 virus. Control pigs after challenge died at 7 days post challenge (data not included).
  • Figure 25 Survival chart comprising the whole study, representing animals surviving after vaccination and after challenge. All the animals that were alive at the time of challenge survived the infection with the high virulent ASF Arm07 virus. No or only mild anorexia, fever and recumbence were observed in any of the groups.
  • Figure 26 Viremia, virus in blood as detected by PCR, in animals immunized with Lv17/WB/Rie1 (top) and Lv17/WB/Rie1-ACD (bottom) after vaccination and after challenge with the high virulent ASF Arm07 virus.
  • the present invention relates to a live attenuated African swine fever virus (ASFV) characterized in that it comprises a modified form of the genome of the ASFV Lv17/WB/Rie1 strain in which the EP153R gene and the EP402R gene have been inactivated.
  • ASFV strain of the invention The strain will be referred from here onwards as “ASFV strain of the invention”.
  • African swine fever virus of its acronym “ASFV” as used herein refers to the causative agent of African swine fever (ASF).
  • ASFV is a large, icosahedral, double-stranded DNA virus with a linear genome containing at least 150 genes. The number of genes differs slightly between different isolates of the virus.
  • ASFV has similarities to the other large DNA viruses, e.g., poxvirus, iridovirus and mimivirus.
  • the main target cells for replication are those of monocyte, macrophage lineage.
  • the genome of the ASFV strain of the invention is a modified form of the genome of a genotype II ASFV.
  • the ASFV strain of the invention comprises a modified form of the genome of the ASFV Lv17/WB/Rie1 strain which is defined as SEQ ID NO: 1.
  • the genome of the ASFV is a modified form of the genome of the Lv17/WB/Rie1 strain having the sequence according to SEQ ID NO: 1 in which the EP153R gene and the EP402R gene have been inactivated.
  • the genome of the recombinant ASFV Lv17/WB/Rie1 strain comprises the sequence of SEQ ID NO: 2.
  • live refers to the fact that the ASFV of the invention relates to a live virus capable of replication in its natural host cell.
  • attenuated refers to a virus with compromised or abolished virulence in the intended recipient, i.e. swine.
  • the goal of creating an attenuated virus is to produce a virus that does not produce infection symptoms, or very light infection symptoms, as to when used as a vaccine it stills is able to produce an immune response as to create immunogenic protection when the animal is infected with a wild type virus.
  • wildtype indicates that the virus existed (at some point) in the field, and was isolated from a natural host, such as a domestic pig, tick or warthog.
  • the level of attenuation of a virus can be measured by the haemadsorption assay.
  • haemadsorption refers to a phenomenon whereby cells infected with ASFV adsorb erythrocytes (red blood cells) on their surface.
  • the degree of haemadsorption induced by an ASFV may be measured using a haemadsorption assay such as described herein. For example, cells may be transfected with a protein or infected with an ASFV, then red blood cells added and the degree of haemadsorption detected by imaging.
  • the level of attenuation of the ASFV strain of the invention is measured by haemadsorption and the ASFV strain of the invention has reduced haemadsorption when compared to the wild type Lv17/WB/Rie1 strain.
  • the haemadsorption capacity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% when compared the wild type Lv17/WB/Rie1 strain.
  • EP402R gene refers to the ASFV gene which encodes the CD2v protein, a glycoprotein with a relative molecular weight of about 105 kDa that is responsible for the haemadsorption phenotype of ASFV infected cells in vitro.
  • This ASFV protein is the viral homolog (CD2v) of cellular T-lymphocyte surface adhesion receptor CD2 proteins. Based on sequence data and hydropathy profiles, ASFV CD2v protein resembles typical (CD2) class III transmembrane proteins.
  • the nucleotide sequence of the EP402R gene in the Lv17/WB/Rie1 corresponds to the sequence from position 74339 to position 75420 of the Lv17/WB/Rie1 strain genome with the sequence according to SEQ ID NO: 1.
  • the gene EP402R comprises the sequence according to SEQ ID NO: 3.
  • the EP402R gene comprises a sequence with at least at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to SEQ ID NO: 3.
  • identity in the context of two or more amino acid or nucleotide sequences, refer to two or more sequences or fragments of said sequences that are the same or have a specified percentage of nucleotide residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative substitutions as part of the sequence identity.
  • percent identity can be measured using sequence comparison software or algorithms or by visual inspection.
  • sequence comparison software or algorithms or by visual inspection.
  • Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences. Publicly available software programs can be used to align sequences. Appropriate parameters for maximal alignment by particular alignment software can be determined by one skilled in the art.
  • the default parameters of the alignment software are used.
  • the percentage identity “X” of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y/Z), where Y is the number of nucleotide residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the second sequence is longer than the first sequence, then the global alignment taken the entirety of both sequences into consideration is used, therefore all letters and gaps in each sequence must be aligned. In this case, the same formula as above can be used but using as Z value the length of the region wherein the first and second sequence overlaps, said region having a length, which is substantially the same as the length of the first sequence.
  • the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
  • the nucleotide sequence of the EP153R gene corresponds to the sequence from position 73793 to position 74269 of the Lv17/WB/Rie1 strain genome with the sequence according to SEQ ID NO: 1.
  • the gene EP153R comprises the sequence according to SEQ ID NO: 4.
  • the EP153R gene comprises a sequence with at least at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to SEQ ID NO: 4.
  • said inactivation may be determined by determining the hemadsorption of the virus with EP402R inactivated since, the product of the EP402R gene is the main responsible for the adsorption to red blood cells, as detailed previously.
  • Gene inactivation can be accomplished by several methods well known to the skilled person in the art such as random mutagenesis by transposon insertion mutagenesis and UV irradiation, and targeted mutagenesis such as homologous recombination and CRISP/Cas9 technology (see Examples section). Both techniques allow for the inactivation of a gene by either inserting extra nucleotide sequence into the coding sequence of the gene or, on the contrary, by deleting fragments or the entirety of the gene. In both cases, the result may be a non-functional or non-existent transcription of the gene and therefore a lack of the gene product.
  • the inactivation of the EP402R gene and of the EP153R gene results from at least one mutation such that the genes are not transcribed and/or translated.
  • said at least one mutation is selected from a group consisting of a deletion of part or the complete gene or genes, an insertion of nucleotide sequences, one or more single polynucleotide polymorphisms, a duplication event, or any combination thereof.
  • the EP402R gene and the EP153R gene are deleted and or interrupted such that the EP402R gene and the EP153R gene are not transcribed and/or translated.
  • the deletion of EP402R gene affects the complete EP402R gene.
  • the EP153R deletion affects the complete EP153R gene.
  • the inactivation of the EP402R gene and the inactivation of the EP153R gene results from a single deletion in the genome of the ASFV Lv17/WB/Rie1 strain.
  • interrupted refers to a mutation that leads to the open reading frame of the gene in question to be interrupted such that no functional gene product is derived from said open reading.
  • the interruption may lead to an absence of products or to the presence of two or more smaller products of the open reading frame, wherein said two or more products are not functional or are not capable of reconstitute de function of the original product obtained from an uninterrupted open reading frame.
  • the live attenuated ASFV strain of the invention carries a deletion of both the EP402R gene and the EP153R gene as a result from a single deletion in the genome of the ASFV Lv17/WB/Rie1 strain.
  • the inactivation of the EP402R gene and/or EP153R gene results from a deletion of the nucleotide sequence from position 73812 to position 75385 of the Lv17/WB/Rie1 strain genome with the sequence according to SEQ ID NO: 1.
  • the inactivated genes of the ASFV strain of the invention may be replaced by a heterologous gene, i.e. a gene that does not exist naturally in ASFV. Therefore, in a particular embodiment of the ASFV strain of the invention the EP402R gene and/or the EP153R gene is/are replaced by a heterologous gene.
  • the ASFV strain of the invention contains at least one heterologous gene or genes.
  • the ASFV strain of the invention contains at least two heterologous genes wherein the heterologous genes are the same or distinct.
  • at least one heterologous gene is a reporter gene.
  • D148R refers to a gene of unknown function which is located between positions 183187 and 184012 of the genome of the ASFV Georgia 2007/1 strain (GenBank accession no. NC044959, version 2 of December 20 th , 2020). Deletions of this gene are known to not affect virus replication but affect virus infection.
  • 9GL/B119L refers to the gene which encodes for a FAD- linked sulfhydryl oxidase located between positions 95936 and 96295 of the genome of the ASFV Georgia 2007/1 strain. Deletions of this gene are known to not affect virion maturation, viral growth in macrophages and viral virulence in swine.
  • MGF_360-12L refers to the genes present in the multigene family 360, whose function can affect the host's immune response mechanism and have host specificity.
  • the genes MGF_360-12L, MG_360-13L and MG_360-14L are located between positions 30355 and 33887 of the genome of the ASFV Georgia 2007/1 strain.
  • the recombinant ASFV strain of the invention can be used for the generation of immunogenicity in porcine through immunogenic compositions or vaccine compositions. Therefore, another aspect of the invention relates to an immunogenic composition or a vaccine composition, from here onwards the immunogenic composition of the invention, comprising the attenuated ASFV strain of the invention and a pharmaceutically suitable carrier or excipient.
  • protection against African swine fever refers to a response against African swine fever (virus) generated by administration of the recombinant ASFV of the invention, that results in fewer deleterious effects than would be expected in a non-immunized mammal that has been exposed to African swine fever (virus). That is, the severity of the deleterious effects of the ASFV infection is lessened in a vaccinated mammal. Infection may be reduced, slowed, or possibly fully prevented, in a vaccinated mammal.
  • complete prevention of infection is meant, it is specifically stated. If complete prevention is not stated, then the term includes partial prevention.
  • the term “increased protection” means, but is not limited to, a statistically significant reduction of one or more clinical symptoms, which are associated with infection by a wild-type ASFV, in a vaccinated group of mammals versus a non-vaccinated control group of mammals.
  • the term “statistically significant reduction of clinical symptoms” as used herein refers to, without limitation, that the incidence of at least one clinical symptom in the vaccinated group of mammals is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% lower than in the non-vaccinated control group after the challenge with the wild-type ASFV.
  • long- lasting protection shall refer to improved efficacy that persists for at least 3 weeks, at least 3 months, at least 6 months, or at least 1 year. In the case of livestock, it is most preferred that the long-lasting protection shall persist until the average age at which animals are marketed for meat.
  • an immune response refers to the development of a cellular and/or antibody-mediated immune response to the recombinant ASFV of the invention or immunogenic composition of the invention.
  • an immune or immunological response includes, one or more of the following effects: the production or activation of antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the recombinant ASFV strain of the invention.
  • the host will display either a therapeutic or a protective immunological (memory) response, such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced.
  • Such protection will be demonstrated by either a reduction in number of symptoms, severity of symptoms, or the lack of one or more of the symptoms associated with the infection of wild-type ASFV, a delay in the of onset of viremia, reduced viral persistence, a reduction in the overall viral load and/or a reduction of viral excretion.
  • the immunogenic composition of the invention further comprises a pharmaceutically acceptable carrier or excipient.
  • a pharmaceutically acceptable carrier includes any solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, and the like.
  • the immunogenic composition of the invention comprises stabilizing agents for lyophilization or storing the virus suspension in liquid form.
  • the immunogenic composition of the present invention contains an adjuvant.
  • Adjuvants can include aluminum hydroxide and aluminum phosphate, saponins e.g., Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsion, oil-in- water emulsion, and water-in-oil-in-water emulsion.
  • the emulsion can be based in particular on light liquid paraffin oil (European Pharmacopeia type); isoprenoid oil such as squalane or squalene; a-tocopherol acetate; oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di-(caprylate/caprate), glyceryl tri- (caprylate/caprate) or propylene glycol di oleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters.
  • light liquid paraffin oil European Pharmacopeia type
  • isoprenoid oil such as squalane or squalene
  • a-tocopherol acetate oil resulting from the oligomerization of alkenes, in particular of isobut
  • the oil is used in combination with emulsifiers to form the emulsion.
  • the emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (e.g. anhydromannitol oleate), of glycol, of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or hydroxy stearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular the Pluronic products, especially L 121.
  • an adjuvant is a compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of maleic anhydride and alkenyl derivative.
  • Advantageous adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyalcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996).
  • Adjuvants can also be acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms.
  • the preferred radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups.
  • the unsaturated radicals may themselves contain other substituents, such as methyl.
  • the products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly appropriate. They are cross-linked with an allyl sucrose or with allyl pentaerythritol. Among then, there may be mentioned Carbopol 974P, 934P and 971 P. Most preferred is the use of Cabopol 971 P.
  • copolymers of maleic anhydride and alkenyl derivative are the copolymers EMA (Monsanto), which are copolymers of maleic anhydride and ethylene.
  • suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), Block copolymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from E.
  • coli recombinant or otherwise
  • cholera toxin IMS 1314 or muramyl dipeptide
  • IMS 1314 or muramyl dipeptide naturally occurring or recombinant cytokines or analogs thereof or stimulants of endogenous cytokine release, among many others.
  • the term "diluents" can include water, saline, dextrose, ethanol, glycerol, and the like.
  • Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others.
  • Stabilizers include albumin and alkali salts of ethylendiamintetracetic acid, among others.
  • the immunogenic composition of the invention is formulated to be administrated intranasal, orally, subcutaneously, intradermal or intramuscularly, preferably intramuscularly.
  • the immunogenic composition of the invention is formulated to be administrated orally, preferably via bate. In an even more particular embodiment of the immunogenic composition of the invention, the immunogenic composition of the invention is formulated to be administrated intradermally.
  • the immunogenic composition of the invention is formulated to be administrated to wild boars intramuscular vaccination, by intradermal vaccination or by oral vaccination, preferably via bate. In an even more particular embodiment of the immunogenic composition of the invention, the immunogenic composition of the invention is formulated to be administrated to wild boars by oral vaccination, preferably via bate.
  • the ASFV strain of the invention finds use in the prevention or treatment of diseases directly caused by ASFV. Therefore, another aspect of the present invention relates to the ASFV strain of the invention or the immunogenic composition of the invention for use in the prevention or treatment of a disease caused by the infection of ASFV, from here onwards the treatment use of the invention.
  • prevention relates to the capacity to prevent, minimize, or hinder the onset or development of a disease or condition before its onset.
  • treatment refers to therapeutic treatment, the purpose of which is to reverse, reduce, suppress, delay or stop the progression or severity of the condition associated with the disease or disorder.
  • treatment includes reducing or alleviating at least one adverse effect or condition of a condition, a disease or disorder, such as an infection. Treatment is usually “effective” when one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if disease progression is delayed or halted. That is, “treatment” includes not only the improvement of symptoms or markers, but also the interruption of at least a condition that indicates the progression or worsening of symptoms that would be expected in the absence of treatment.
  • the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated intranasal, orally, subcutaneously, intradermally or intramuscularly, preferably intramuscularly.
  • the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated orally, preferably via bate.
  • the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated intradermally.
  • therapeutic effective dose refers to an amount of an active agent (i.e., an ingredient such as ASFV of the invention) high enough to deliver the desired benefit, either the treatment or prevention of the disease, but low enough to avoid serious side effects within the scope of medical/veterinary judgment.
  • the particular dose administered according to this invention will of course be determined by the particular circumstances surrounding the case, such as the route of administration, the age of the animals, and the similar considerations.
  • the therapeutic effective dose is between about 10 median tissue culture infectious dose (TCID50) to about 10 5 TCID50.
  • the therapeutic effective dose in swine is between about 50 median tissue culture infectious dose (TCID50) to about 200 TCID50, preferably about 100 TCID50.
  • the therapeutic effective dose in wild boar is between about 10 2 TCID50 to about 10 4 TCID50.
  • the therapeutic effective dose is between about 50 TCID50 to about 200 TCID50 and the therapeutic effective dose in wild boar is between about 10 2 TCID50 to about 10 4 TCID50.
  • tissue culture infectious dose refers to the measure of infectious virus titer. It refers to an endpoint dilution assay which quantifies the amount of virus required to kill 50% of infected hosts or to produce a cytopathic effect in 50% of inoculated tissue culture cells. This assay may be more common in clinical research applications where the lethal dose of virus must be determined or if the virus does not form plaques.
  • tissue culture host cells are plated and serial dilutions of the virus are added. After incubation, the percentage of cell death (i.e.
  • TCID50 infected cells
  • the therapeutic effect can be accomplished in several types of dosage, wherein the timing of multiple doses can be between 1 day to several days, weeks, months or year. It is preferred that said effect be obtained by administering a single dose of the recombinant ASFV strain of the invention. Therefore, in a particular embodiment of the use of the invention the recombinant ASFV is administered in a one, two, three, four or five doses, preferably one dose. In another particular embodiment of the use of the invention the recombinant ASFV is administered in a single dose.
  • An aspect of the present invention relates to a polynucleotide comprising a first, second and third regions, from here onwards the polynucleotide of the invention, wherein the first region comprises an expression cassette comprising an ASFV heterologous gene, wherein the first region is flanked by the second and third regions and wherein said second and third regions are the regions of the genome of the ASFV Lv17/WB/Rie1 strain which naturally flank the region of the ASFV genome comprising the EP402R gene and EP153R genes.
  • expression cassette refers to a distinct component of DNA which comprises a gene and a regulatory sequence, such as a promoter, which allows the expression cassette to produce RNA and protein when present in the desired host cell.
  • the heterologous gene encodes a fluorescent protein.
  • the heterologous gene is a fluorescent protein selected from a group consisting of: GFP, BFP, CFP, YFP, Venus, mOrange, dTomato, DsRed, RFP, mCherry and any of their variants.
  • the heterologous gene is eGFP.
  • the heterologous gene is under the control of a constitutive promoter, preferably the ASFV p72 promoter comprising the sequence according to SEQ ID NO: 5.
  • second and third regions are the regions of the genome of the ASFV Lv17/WB/Rie1 strain which naturally flank the region of the ASFV genome comprising the EP402R gene and EP153R genes” in the polynucleotide of the invention refers to the nucleotide sequence which is before the position 73793 (second region) and after the position 75420 (third region) of the genome of the Lv17/WB/Rie1 strain having the sequence according to SEQ ID NO: 1 .
  • the second region comprises the nucleotide sequence between positions 71793 and 73793, or a fragment thereof, of the genome of the Lv17/WB/Rie1 strain having the sequence according to SEQ ID NO: 1.
  • the third region comprises the nucleotide sequence between positions 75420 and 77420, or a fragment thereof, of the genome of the Lv17/WB/Rie1 strain having the sequence according to SEQ ID NO: 1.
  • the second and third regions consist of about 2000 bp, about 1900 bp, about 1800 bp, about 1700 bp, about 1600 bp, about 1500 bp, about 1400 bp, about 1300 bp, about 1200 bp, about 1100 bp, about 1000 bp, about 900 bp, about 800 bp, about 700 bp, about 600 bp, or about 500 bp, preferably 1000 bp.
  • the polynucleotide of the invention can be comprised in a vector.
  • another aspect of the present invention relates to a vector comprising the polynucleotide of the invention, from here onwards the vector of the invention.
  • vector refers to a vehicle through which a polynucleotide or a DNA molecule can be manipulated or introduced into a cell.
  • the vector can be a linear or circular polynucleotide or it can be a larger polynucleotide or any other type of construction such as the DNA or RNA of a viral genome, a virion or any other biological construct that allows the manipulation of DNA or its introduction in a cell. It is understood that the terms "recombinant vector”, “recombinant system” can be used interchangeably with the term vector.
  • suitable vectors include expression vectors in prokaryotes such as pET (such as pET14b), pUC18, pUC19, Bluescript and their derivatives, mp18, mp19, pBR322, pMB9, ColEI, pCRI, RP4, phages and shuttle vectors such as pSA3 and pAT28, expression vectors in yeasts such as vectors of the type of 2 micron plasmids, integration plasmids, YEP vectors, centromeric plasmids and the like, expression vectors in insect cells such as the pAC series and pVL series vectors, expression vectors in plants such as vectors of expression in plants such as pl Bl, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series vectors and the like and expression vectors in superior eukaryotic cells based on viral vector
  • the vector of the invention can be used to transform, transfect, or infect cells that can be transformed, transfected or infected by said vector.
  • Said cells can be prokaryotic or eukaryotic.
  • Said vector can be obtained by conventional methods known by the persons skilled in the art (Sambrook et al., 2001 , “Molecular cloning, to Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory Press, N.Y. Vol 1-3 a).
  • Another aspect of the invention relates to a host cell comprising the polynucleotide of the invention or the vector of the invention, from here onwards the host cell of the invention.
  • Host cells suitable for comprising the first polynucleotide of the invention, or the vector of the invention include, without being limited to, mammal, plant, insect, fungal and bacterial cells.
  • Bacterial cells include, without being limited to, Gram-positive bacterial cells such as species of the Bacillus, Streptomyces, Listeria and Staphylococcus genus and Gram-negative bacterial cells such as cells of the Escherichia, Salmonella and Pseudomonas genera.
  • Fungal cells preferably include cells of yeasts such as Saccharomyces cerevisiae, Pichia pastoris and Hansenula polymorpha.
  • Insect cells include, without being limited to, Drosophila and Sf9 cells.
  • Plant cells include, among others, cells of crop plants such as cereals, medicinal, ornamental or bulbous plants.
  • Suitable mammal cells in the present invention include epithelial cell lines (human, ovine, porcine, etc.), osteosarcoma cell lines (human, etc.), neuroblastoma cell lines (human, etc.), epithelial carcinomas (human, etc.), glial cells (murine, etc.), hepatic cell lines (from monkey, etc.), CHO (Chinese Hamster Ovary) cells, COS cells, BHK cells, HeLa cells, 911 , AT1080, A549, 293 or PER.C6, NTERA-2 human ECC cells, D3 cells of the mESC line, human embryonic stem cells such as HS293, BGV01 , SHEF1 , SHEF2, HS181 , NIH3T3 cells, 293T, REH and MCF-7 and hMSC cells.
  • epithelial cell lines human, ovine, porcine
  • the ASFV strain of the invention can be obtained by several methods known to the skilled person in the field such as CRISPR/Cas, TALEN, and Zn-finger nuclease.
  • step (ii) maintaining the target cells under conditions adequate for the double-strand DNA break in the ASFV genome to take place and to allow homologous recombination between the ASFV genome containing the DNA break and the second and third regions of the polynucleotide thereby resulting in the replacement of the region encoding the EP402R and EP153R genes by the first region within the polynucleotide introduced in step (i), and
  • Steps (i) Step (i) of the method of the invention refers to the process of introducing into the target cell all the components necessary to create an ASFV virus strain wherein the EP402R and the EP153R gene are inactivated.
  • the target cells refers to cells which are naturally infected by the ASFV.
  • the target cells in step (i) are mammalian cells, such as macrophage cells, COS cells, BHK cells, HeLa cells, 911 , AT1080, A549, 293 or PER.C6, NTERA-2 human ECC cells.
  • the target cells is a macrophage.
  • the introduction of a polynucleotide in the target cells can be accomplished by several methods well known by the skilled person in the art such as transformation, transfection or infection of cells by conventional methods known by persons skilled in the art (Sambrook et al., 2001 , mentioned above).
  • the introduction of the polypeptide of the invention in step (i) is done by transfection.
  • the expression cassette forming part of the first region comprises a heterologous gene which encodes a fluorescent protein.
  • the heterologous gene is under the control of a constitutive promoter.
  • step (i) of the method of the invention “means capable of creating a double strand DNA break in the genome of said attenuated ASFV strain within or at the vicinity of the region comprising the EP402R gene and EP153R gene” refers to techniques which permit the cleavage of the bounds between adjacent nucleotides in a double strand of DNA.
  • One such means of creating a double strand DNA break is the CRISPR/Cas9 technique.
  • the means capable of creating a double strand break in the genome of said ASFV strain within or at the vicinity of the region encoding the EP402R and EP153R genes comprise a CRISPR/Cas system.
  • CRISPR/Cas9 system refers to the Class 2 Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems, which form an adaptive immune system in bacteria, and which have been modified for genome engineering.
  • Engineered CRISPR systems contain two components: a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas protein).
  • gRNA guide RNA
  • Cas protein CRISPR-associated endonuclease
  • the gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-defined ⁇ 20 nucleotide spacer that defines the genomic target to be modified.
  • gRNA guide RNA
  • Cas protein CRISPR-associated endonuclease
  • CRISPR was originally employed to knock out target genes in various cell types and organisms, but modifications to various Cas enzymes have extended CRISPR to selectively activate/repress target genes, purify specific regions of DNA, image DNA in live cells, and precisely edit DNA and RNA. Furthermore, the ease of generating gRNAs makes CRISPR one of the most scalable genome editing technologies. This advantage makes CRISPR perfect for genome-wide screens. Fully functional CRISPR/Cas enzymes will introduce a doublestrand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often lead to frameshifts, creating loss of function alleles.
  • NHEJ non-homologous end joining
  • ssDNA or dsDNA repair templates with 1) homology to the DNA flanking the DSB and 2) a specific edit close to the gRNA PAM site.
  • Step (ii) of the method of the invention relates to the process of maintain the target cells at ideal temperatures, cell number and carbon dioxide (CO2) concentration as for the double strand system to be able to function properly and create double strands in desired locations.
  • cells in step (ii) are maintained in a culture medium that comprises 2 mM l-glutamine, nonessential amino acids, an antibiotic, such as gentamicin, and supplements such as fetal bovine serum.
  • the target cells are maintained at between about 32°C and 40°C, preferably 37°C in an about 3% to about 10% CO2 atmosphere, preferably 5% CO2 atmosphere, saturated with water vapor for about 12 hours to 36 hours, preferably 24 hours post transfection.
  • EXAMPLE 1 PRODUCING THE LV17/WB/RIE1-ACD ASFV MUTANT
  • the Lv17/WB/Rie1-ACD ASFV mutant was created by deleting the EP153R and EP402R genes (73812-75385 nts.; all numbering in this example corresponds to the Lv17/WB/Rie1 sequence) from Lv17/WB/Rie1 and substituting with eGFP (enhanced green fluorescent protein gene) under the control of the p72 promoter of ASFV.
  • the virus expresses fluorescent eGFP reporter gene in the infected cells but does not express the C-type lectin-like and the CD2-like (CD2v) protein products of the deleted viral genes (EP153R and EP402R, respectively).
  • a linearized pUC19 vector was used as a backbone (Thermo Fischer Scientific, Waltham MA, USA) for pDel-cd2v-eGFP.
  • the recombination cassette contains the 969 bp (72843-73811) left recombination arm, upstream of the target ORFs, followed by p72 promoter (TATTTAATAAAAACAATAAATTATTTTTATAACATTATATA) (SEQ ID NO: 5), the eGFP gene, and the 989 bp (75386-76374) long right recombination arm downstream of the targeted ORFs.
  • the pDel-cd2v-eGFP was assembled from three overlapping PCR fragments (Table 2) and the linearized pUC19 vector with the help of GeneArtTM Seamless PLUS Cloning and Assembly Kit (Thermo Fischer Scientific, Waltham MA, USA).
  • the two gRNA plasmids were created cloning one upstream and one downstream double-stranded protospacer oligos gRNAinsI and gRNAins2 into the Bbsl digested pX330- DNLS1_2-NeoR plasmid resulting the pXCD2v/1 and pXCD2v/2 vectors respectively (Hubner et al. 2018, Sci Rep. Jan 23;8(1):1449).
  • Pog macrophages were plated at a density of 5 x 10 6 /well in 6-well plates and allowed to attach overnight.
  • plates (including cells and supernatants) were frozen to -70 °C, and stored until ready to use.
  • group 1 six animals were orally vaccinated with 10 4 TCI D50 dose of the Lv17/WB/Rie1- ACD mutant in a single dose model and challenged at 30 days post-vaccination (dpv) with 10 HAD50 of Armenia/07 (Arm07) via the IM route. The experimental period lasted 62 days.
  • the challenge material contained a calculated amount of 10 HAD50 per dose of 1ml.
  • Arm07 was diluted to 10 HADso/ml shortly before the challenge.
  • the challenge material was applied at ambient temperature.
  • Microbiological status Free of ASFV, Aujeszky virus, Mycobacterium bovis, classical swine fever virus, swine vesicular disease virus, Mycoplasma hyopneumoniae, porcine reproductive and respiratory syndrome virus and porcine circovirus type 2
  • Wild boar were housed in separate boxes. Drinking water was available ad libitum as well as maintenance feed formulation (commercial animal feed for piglets). For animal welfare purposes, several toys specifically designed for wild boar, such as balls and biting chains were placed per pen. Cleaning of pens was conducted three times per week.
  • ASFV detection by real-time PCR DNA was extracted from blood and tissue samples using the High Pure PCR Template Preparation kit (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) according to FE-002-SUAT/04-4 (Standard Operating Procedures; VISAVET, UCM).
  • This CS considers nine parameters (rectal temperature, behaviour, body condition, skin alterations, ocular/nasal discharge, joint swelling, respiratory symptoms, digestive symptoms, and neurological symptoms), the degree of severity of which is measured from 0 to 4 (most severe).
  • groups 3 and 4 parental virus
  • groups 3 and 4 show higher values as compared to those in groups 1 and 2 (mutant vaccine strain).
  • Transient viremias were detected in the survivor animals vaccinated with the parental Lv17/WB/Rie1 strain (groups 3 and 4) after the challenge (mean Cg value of 36.4 ⁇ 2.0 in group 3 and 37.4 ⁇ 2.0 in group 4). Only one animal from group 3 maintained constant viremia from 4 dpc until the end of the experiment, with a mean Cg value of 25.5 ⁇ 0.8. In the case of the two animals from group 4 that did not survive the challenge, the Cg values were lower (19.3 ⁇ 2.3).
  • the mutant strain Lv17/WB/Rie1-ACD was safe to administer to wild boar and was safer in comparison to the wildtype parental strain Lv17/WB/Rie1 , as the clinical signs observed during the vaccination period in animals vaccinated with the mutant were slighter than those observed in the groups vaccinated with the parental virus.
  • EXAMPLE 3 IN VIVO SAFETY STUDIES IN PIGS USING THE LIVE AFRICAN SWINE FEVER (ASF) VIRUS VACCINE STRAIN LV17/WB/RIE1-AEP402R-AEP153R
  • ASFV-free and ASFV antibody-free 12-week-old pigs were available for this study.
  • Five animals each in group 1 and 2 received 100 TCID50 per animal of the vaccine via the intramuscular (IM) route.
  • Group 1 was immunized with Lv17/WB/Rie1-ACD and group 2 with the parental strain Lv17/WB/Rie1.
  • Three animals in group 3 served as unvaccinated controls.
  • animals in all 3 groups were challenged with 100 HAD50 of Armenia/07 (Arm07) via the IM route. See Table 5 for an overview of the groups and their treatment.
  • Blood samples were taken just before vaccination, and at 7, 12, 14, 19, 21 , and 28 days post vaccination, as well as just before challenge and 3, 6, 10, 13, 17, 20, 24, 27 and 31 days post challenge. Blood samples were investigated for the presence of ASFV by qPCR, and ASFV-specific antibodies by indirect immunoperoxidase test (I PT). Clinical signs were recorded daily and expressed with a quantitative clinical score obtained by adding values for eight clinical signs recorded on a daily basis.
  • I PT indirect immunoperoxidase test
  • Microbiological status Free of ASFV, Porcine reproductive and respiratory syndrome virus, and Pseudorabies virus. ASFV antibody-free. Animals were vaccinated 30 days after birth against Mycoplasma hyopneumoniae and Porcine circovirus (PCV2)
  • mice were homogeneously distributed into experimental groups. Subsequently, animals were randomly identified using individually numbered ear-tags
  • Pigs were housed in three separate boxes with five pigs per pen. Three unvaccinated pigs were included in an additional box. Drinking water was available ad libitum and growingfinishing pig feed formulation (commercial animal feed) was provided once per day @ 1.20kg of pig feed per animal. This feeding regime was done to quantify the feed consumption per group after both: vaccination and challenge. For animal welfare purposes, several toys specifically designed for swine, such as gumballs and biting chains were placed per pen. Cleaning of pens was conducted once per day according to internal SOP (“Procedimiento de cuidado de los animales, limpieza y desinfeccion de boxes”).
  • IM route (see Table 1) in the left side of the neck.
  • NSAIDs non-steroidal anti-inflammatory drugs
  • MEL IM route
  • DNN percutaneous route
  • FM Flunixin meglumine
  • Clinical signs were recorded daily and expressed with a quantitative clinical score obtained by adding values for eight clinical signs recorded on a daily basis; fever parameters, anorexia, recumbence, skin haemorrhage or cyanosis, joint swelling, respiratory distress, ocular discharge, and digestive findings were assigned points on a severity scale of 0 to 3 (most severe). The sum of the points was recorded as the clinical score (CS), which was also used to define humane endpoints (see Table 7).
  • CS clinical score
  • Plasma samples were collected from each animal. Samples were taken just before vaccination, and at 7, 12, 14, 19, 21 and 28 days post vaccination, as well as just before challenge and 3, 6, 10, 13, 17, 20, 24, 27 and 31 days post challenge. Samples were collected according to the SOP of the European Union reference laboratory for ASF (EURL): SOP/CISA/ASF/SAMPLES/1/ (https://asf- referencelab.info/asf/images/ficherosasf/PROTOCOLOS-EN/SOP-ASF-SAMPLES- 1_REV5_2021.pdf) 3.2.4.3. Destination of the animals at the end of the study
  • mice were euthanized between 31 to 38 post challenges by pentobarbital sodium (300 mg/mL) as is described in Table 8.
  • Blood-EDTA, sera and twenty-one different types of tissues and organs were obtained from each necropsied animal. Tissues included liver, spleen, tonsil, heart, lung, kidney, submandibular, retropharyngeal, inguinal, popliteal, mesenteric, mediastinal, gastro-hepatic, splenic and renal lymph nodes, bone marrow, diaphragmatic muscle, and intra-articular tissues of joints.
  • the carcasses of the dead animals were disposed of in accordance with standard procedures for animals housed at the biosecurity level required for this experiment.
  • Amplification of the ASFV genomic DNA using undiluted extracted DNA for each sample was done using the Universal Probe Library (UPL) real-time PCR included in Chapter 3.9.1 of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (OIE 2021) and described in the EURL-SOP/CISA/ASF/PCR3.
  • UPL Universal Probe Library
  • the ASFV antibody titters were determined in all positive samples by end-point dilution.
  • a score of 1 indicates a mild discomfort
  • 2 a moderate discomfort
  • a score of 3 indicates a sever discomfort to the animals.
  • the severity of discomfort is more in case of the animals in group 2 as compared to those in group 1.
  • Figure 19 represents the average rectal temperatures of animals per group per time point during the study. It is seen that while animals vaccinated with parental strain Lv17/WB/Rie1 (group 2) had increased rectal temperatures starting 2dpv, those vaccinated with the mutant strain did not show such an increase. In case of the animals vaccinated with parental strain, the temperatures gradually dropped after 14dpv and remained in the normal range thereafter even after challenge. Post challenge, only the unvaccinated animals had temperature readings beyond normal. These animals did not survive the study.
  • Severity of the individual parameters used to determine the clinical scores was also found to vary between the mutant vaccine strain and parental strain as seen in Figure 24. No or only mild anorexia, fever and recumbence were observed in any of the groups. Digestive findings were only observed in the group vaccinated with the mutant vaccine strain (group 1). Skin reddening, joint swelling, respiratory distress, and ocular discharge were more pronounced in the animals vaccinated with Lv17/WB/Rie1-ACD (group 1) followed by those vaccinated with Lv17/WB/Rie1 (group 2). The most pronounced distress was caused by the swelling of joints where the stress level was between mild to moderate in case of the mutant vaccine strain. Overall, it was seen that the severity of symptoms was less in the animals vaccinated with Lv17/WB/Rie1 than in those vaccinated with the mutant vaccine strain.
  • the mutant vaccine strain Lv17/WB/Rie1-ACD was safe to administer to domestic pigs and was safer in comparison to the wildtype parental strain Lv17/WB/Rie1 .
  • the mutant vaccine showed a significant decrease of the side effects after vaccination compared to the wildtype parental strain even at overdose as compared to the parental attenuated strain.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Oncology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Communicable Diseases (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to African Swine Fever (ASF) attenuated viruses wherein the genes EP402R and EP153R have been inactivated, which can be used as a vaccine. The attenuated viruses protect pigs against subsequent challenge with virulent virus. The present invention also relates to the use of such attenuated viruses to treat and/or prevent ASF.

Description

ATTENUATED AFRICAN SWINE FEVER VIRUS AND USE THEREOF IN VACCINE COMPOSITIONS
TECHNICAL FIELD OF THE INVENTION
The present invention relates to African Swine Fever attenuated viruses wherein genes have been inactivated, which can be used as a vaccine. The attenuated viruses protects pigs against subsequent challenge with virulent virus. The present invention also relates to the use of such attenuated viruses to treat and/or prevent African Swine Fever.
BACKGROUND OF THE INVENTION
African swine fever (ASF) is a devastating haemorrhagic disease of domestic pigs and wild suids caused by a large double-stranded DNA virus, African swine fever virus (ASFV). ASFV is the only member of the Asfarviridae family and replicates predominantly in the cytoplasm of cells. Virulent strains of ASFV can kill domestic pigs within about 5-14 days of infection with a mortality rate approaching 100%.
ASFV can infect and replicate in warthogs (Phacochoerus sp.), bushpigs (Potamocherus sp.) and soft ticks of the Ornithodoros species (which are thought to be a vector), but in these species few if any clinical signs are observed and long-term persistent infections can be established. ASFV was first described after European settlers brought pigs into areas endemic with ASFV and, as such, is an example of an “emerging infection”. The disease is currently endemic in many sub-Saharan countries, and in several European and Southeast Asian regions. Vaccination is considered the most efficient strategy and solution for disease control. However no vaccine is available for ASF so far. In the past, some countries reached eradication by using several strategies that included widespread culling and improvements of biosecurity in farms.
Despite this ASFV has seen a resurgence in the last few decades, most significantly in Georgia where in 2007 it spread from the Back Sea port of Poti to the Caucasus region into the Russian Federation and Eastern Europe, and as far west as Belgium and east the People’s Republic of China, spreading quickly to Southeast Asia and the Pacific. As a general view ASF has been reported in seventy four countries since 2005 to date. Several reappearances have been reported in China, the RF, Moldova, and Ukraine, and North Macedonia, Thailand and Italy main land as recently as 2022. These recent events highlight an extremely disconcerting pattern of continuous spread of ASFV.
Pork meat is one of the primary sources of animal proteins, accounting for more than 35% of the global meat intake. Hence, this disease poses a serious problem for food security worldwide. This disease is also a concern for biodiversity and the balance of ecosystems, as it affects not only domestic farmed pigs, but also wild boars, including native breeds.
Attempts to vaccinate animals using classical approaches such as infected cell extracts, supernatants of infected pig peripheral blood leukocytes, purified and inactivated virions, infected glutaraldehyde-fixed macrophages, or detergent-treated infected alveolar macrophages failed to induce protective immunity. Other approaches based on DNA vaccines or a combination of specific ASFV proteins and DNA (heterologous prime-boost vaccine) have been also assayed without success. Homologous protective immunity does develop in pigs surviving viral infection. Pigs surviving acute infection with moderately virulent or attenuated variants of ASFV develop long-term resistance to homologous, but rarely to heterologous, virus challenge. Due to the severity of the infection and the huge economic losses, importantly in the worldwide pig industry, mechanisms for the prevention of the infection by ASFV are required.
W02020/049194 and Gallardo Carmina et al., (Veterinary Medicine, 2019, 1399-1404) describe the ASFV strain Lv17/WB/Rie1 , an attenuated genotype ll-non-haemadsorbing (HAD) ASFV isolated in Europe, Latvia 2017. Sequence analysis of the EP402R gene, which encodes the CD2-like protein responsible for the HAD phenomenon, revealed a single adenosine deletion at position 73,763 of the genome of the non-HAD ASFV Lv17/WB/Rie1 that generates a truncated protein. The N-terminal extracellular domain of the EP402R protein, "ligand-binding domain" (formed by amino acids 1-203 of the EP402R gene) is essential for an efficient gene expression. Mutations of one or more nucleotides in the ligand-binding domain may disrupt folding of the EP402R protein. However, disruption of folding may mean that the EP402R protein folds differently and is expressed more slowly but correctly. Although the EP402R mutation described at nucleotide position 393, that is in the ligand-binding domain in ASFV Lv17/WB/Rie1 , could result in a non-functional protein, it has not been demonstrated in vitro whether this mutation prevents expression of the EP402R protein (CD2v) during infection with the non-HAD Lv17/WB/Rie1 virus. Therefore, the Lv17/WB/Rie1 isolate can be considered a field strain with a point mutation within the EP402R gene that confers non-HAD characteristics that appear to be related to the attenuation of the field strain.
Petrovan Vlad et al., (Journal of Virology, 2022, 96, 1) describes a virulent ASFV strain (Benin97) of genotype I, comprising deletions in the DP148R, EP153R and EP402R genes. Petrovan Vlad et al. describes that additional deletion of EP153R (BeninADP148RAEP153RAEP402R) further attenuated the virus after immunization, but decreased protection and detection of moderate levels of challenge virus in blood were observed. Furthermore, deletion of EP153R alone from the BeninADP148R strain did not result in further attenuation of the virus and did not reduce the period of virus persistence in the blood. The document CA3170058 A1 describes an attenuated ASFV strain designated GeorgiaAK145RAEP153RCD2vQ96R in which the K145R and EP153R genes were deleted and the EP402R/CD2v protein was mutated to comprise the Q96R amino acid substitution, which appears to reduce HAD activity but not provide a complete inactivation of the gene. In addition the strain comprises functional versions of several MGF genes.
Accordingly, there is a need in the art for improved live attenuated non-HAD ASFV strains that can provide an efficient protection of animals against ASF while being safe by not reverting to the HAD phenotype.
SUMMARY OF THE INVENTION
The inventors of the present invention have found that the inactivation of two genes in the naturally attenuated ASFV Lv17/WB/Rie1 strain, as disclosed in the patent application W02020/049194, leads to a further attenuated strain of the virus which, when used as an immunogenic composition/vaccine, provide excellent protection against a virus challenge both in pigs as well as in wild boars without reverting to the HAD phenotype. This strain is expected to be safe for pregnant sows as well.
Therefore, a first aspect of the present invention relates to a live attenuated African swine fever virus (ASFV) characterized in that it comprises a modified form of the genome of the ASFV Lv17/WB/Rie1 strain in which the EP153R gene and the EP402R gene have been inactivated.
It was surprisingly found that inactivation of these two genes in the strain Lv17/WB/Rie1 leads to a live attenuated virus with an excellent balance between safety and efficacy. Since the background strain is a field isolate, isolated from wild boars, it was expected that further attenuating this strain (not being disease causing in wild boars) would lead to a low efficacy, especially in wild boars. However, this is not the case. The new vaccine appears to be suitable for effectively and safely vaccinating wild boars as well as domesticated pigs, even at a relatively low dose and after one vaccination shot only.
Another aspect of the present invention relates to an immunogenic composition or a vaccine composition comprising the attenuated ASFV according to the invention and a pharmaceutically suitable carrier or excipient.
A further aspect relates to a recombinant ASFV according to the invention for use in the prevention or treatment of a disease caused by the infection of ASFV.
Yet another aspect relates to a polynucleotide comprising a first, second and third region, wherein the first region comprises an expression cassette comprising an ASFV heterologous gene, wherein the first region is flanked by the second and third regions and wherein said second and third regions are the ASFV genomic regions which naturally flank the ASFV EP402R gene in the ASFV genome of Lv17/WB/Rie1 strain. Another aspect relates to a vector comprising the polynucleotide according to the invention.
A further aspect relates to a host cell comprising the polynucleotide according to the invention, or the vector according to the invention.
One more aspect of the present invention relates to a method for producing a recombinant African swine fever virus (ASFV) according to the invention, the method comprising:
(i) modifying target cells by introducing a polynucleotide according to the invention, infecting the cells with the ASFV Lv17/WB/Rie1 strain, and introducing means capable of creating a double strand DNA break in the genome of said attenuated ASFV strain within or at the vicinity of the region comprising the EP402R gene and EP153R gene,
(ii) maintaining the target cells under conditions adequate for the double-strand DNA break in the ASFV genome to take place and to allow homologous recombination between the ASFV genome containing the DNA break and the second and third regions of the polynucleotide thereby resulting in the replacement of the region encoding the EP402R and EP153R genes by the first region within the polynucleotide introduced in step (i), and
(iii) recovering the recombinant ASFV from the supernatant and/or from the whole cell extract and selecting the ASFV virions which contain the reporter gene.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Averages of clinical sign (CS) score for wild boar orally vaccinated with 104 (squares, dashed lines) and 103 (circles, dotted lines) of ASFV Lv17/WB/Rie1 , non-immunized (crosses, dash-dotted lines) and non-survivors (diamonds, solid lines).
Figure 2. Averages of clinical sign (CS) score for wild boar orally vaccinated with 104 (squares, solid lines) and 102 (diamonds, dotted lines) of ASFV Lv17/WB/Rie1-ACD and nonsurvival (circles, dashed lines).
Figure 3. Averages of rectal temperature for wild boar orally vaccinated with 104 (squares, dashed lines) and 103 (circles, dotted lines) of ASFV Lv17/WB/Rie1 , non-immunized (crosses, dash-dotted lines) and non-survivors (diamonds, solid lines).
Figure 4. Averages of rectal temperature for wild boar orally vaccinated with 104 (solid line) and 102 (dotted line) of ASFV Lv17/WB/Rie1-ACD.
Figure 5. Average of viremia expressed in cycles of quantification (Cq) values of realtime PCR carried out for wild boar orally vaccinated with 104 (squares, dashed lines) and 103 (circles, dotted lines) of ASFV Lv17/WB/Rie1 and non-survivors (diamonds, solid lines). Figure 6. Average of viremia expressed in cycles of quantification (Cq) values of realtime PCR carried out for wild boar orally vaccinated with 104 (solid line) and 102 (dotted line) of ASFV Lv17/WB/Rie1-ACD.
Figure 7. Percentage of wild boar with positive antibody response (ELISA) after oral vaccination with 104 (circles, solid line) and 103 (squares, dotted line) of ASFV Lv17/WB/Rie1.
Figure 8. Percentage of wild boar with positive antibody response (ELISA) after oral vaccination with 104 (circles, solid line) and 102 (squares, dotted line) of ASFV Lv17/WB/Rie1- ACD.
Figure 9. Averages of clinical sign (CS) score for wild boar orally vaccinated with 104 (squares, dashed lines) and 103 (circles, dashed lines) of ASFV Lv17/WB/Rie1 , nonimmunized (crosses, dash-dotted lines), and control animals (diamonds, solid lines) of challenge.
Figure 10. Averages of rectal temperature for wild boar orally vaccinated with 104 (dark blue) and 103 (circles, dotted lines) of ASFV Lv17/WB/Rie1 , non-immunized (crosses, dash- dotted lines), and control animals of challenge (diamonds, solid lines)
Figure 11. Averages of clinical sign (CS) score for wild boar orally vaccinated with 104 (squares, solid lines) and 102 (diamonds, dotted lines) of ASFV Lv17/WB/Rie1-ACD and nonsurvival (circles, dashed lines) after challenge.
Figure 12. Averages of rectal temperature for wild boar orally vaccinated with 104 (solie line) and 102 (dotted line) of ASFV Lv17/WB/Rie1-ACD after challenge.
Figure 13. Kaplan-Meier curve showing the data of the survival time of the wild boar orally vaccinated with 104 (solid line) and 103 (dot-dashed line) of ASFV Lv17/WB/Rie1 and controls (dashed line) after challenge.
Figure 14. Kaplan-Meier curve showing the data of the survival time of the wild boar orally vaccinated with 104 (solid line) and 102 (dot-dashed line) of ASFV Lv17/WB/Rie1-ACD.
Figure 15. Average of viremia expressed in cycles of quantification (Cq) values of realtime PCR carried out for wild boar orally vaccinated with 104 (squares, dash line) and 103 (circles, dotted line) of ASFV Lv17/WB/Rie1 , non-immunized (diamonds, solid line) and control (crosses, dash-dotted line).
Figure 16. Average of viremia expressed in cycles of quantification (Cq) values of realtime PCR carried out for wild boar orally vaccinated with 104 (solid line) and 102 (dashed lined) of ASFV Lv17/WB/Rie1-ACD.
Figure 17. Average observed daily of clinical scores in animals vaccinated with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2).
Figure 18. Average of the severity of clinical signs showed by animals after immunization with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2). Figure 19. Average of rectal temperatures throughout the study of animals immunized with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2).
Figure 20. Survival chart of pigs immunized with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2) after vaccination.
Figure 21. Viremia, virus in blood, detected by PCR in pigs immunized with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2) before challenge.
Figure 22. Antibody response raised in pigs after immunization with the virus vaccine strain (group 1 : ACD) and the parental virus (group 2).
Figure 23. Average of the clinical score showed by pigs after vaccination and after challenge with the virulent Arm07 ASFV. Control pigs after challenge died at 7 days post challenge (data not included).
Figure 24. Average of the severity of the individual parameters used to determine the clinical scores of pigs vaccinated with the mutant vaccine strain or with the parental strain, after challenge with high virulent Arm07 virus. Control pigs after challenge died at 7 days post challenge (data not included).
Figure 25. Survival chart comprising the whole study, representing animals surviving after vaccination and after challenge. All the animals that were alive at the time of challenge survived the infection with the high virulent ASF Arm07 virus. No or only mild anorexia, fever and recumbence were observed in any of the groups.
Figure 26. Viremia, virus in blood as detected by PCR, in animals immunized with Lv17/WB/Rie1 (top) and Lv17/WB/Rie1-ACD (bottom) after vaccination and after challenge with the high virulent ASF Arm07 virus.
DETAILED DESCRIPTION OF THE INVENTION
The inventors of the present invention have discovered that the inactivation of the EP153R and EP402R genes in the ASFV Lv17/WB/Rie1 strain known from the patent application W02020/049194 and which encode respectively for the C-type lectin-like and for the CD2-like (CD2v) protein leads to attenuated strains of the virus which when used as an immunogenic composition/vaccine provide excellent protection in virus challenging tests. Furthermore, the vaccine composition containing the inactivated ASFV Lv17/WB/Rie1 strain is expected to be safe for pregnant sows.
These results are unexpected as there is controversy in the prior as to the connection between EP402R and EP153R proteins and virulence. For instance, it has been reported that deletion of the EP402R gene from the genome of virulent viruses Malawi LH20/1 (Borca et al- 1998, J Virol. 72:2881-9), Georgia/07 (Borca et al, 2020, Sci Rep. 2020; 10:494) or Congo (Koltsov et al, 2023, Animals (Basel). 2023, 13:2002) did not reduce the virulence of these viruses in pigs. Similarly, comparative in vivo experiments using BA71ACD2EP153R recombinant viruses demonstrated that deletion of EP153R from BA71ACD2f decreases vaccine efficacy and does not improve safety (Lopez et al, 2021 , Viruses, 13(9):1678). In addition, it has been shown that single deletion of the EP153R gene from the non-HAD and attenuated NH/P68 strain of genotype I (Gallardo et al., 2017, Vaccine; 36:2694-2704), and from the virulent Malawi ASFV (Neilan et al., 1998 J. Gen. Viro.l 80:2693-2697) failed to reduce virulence of the virus for pigs or lost efficacy.
Recombinant ASFV strain
In a first aspect, the present invention relates to a live attenuated African swine fever virus (ASFV) characterized in that it comprises a modified form of the genome of the ASFV Lv17/WB/Rie1 strain in which the EP153R gene and the EP402R gene have been inactivated. The strain will be referred from here onwards as “ASFV strain of the invention”.
The term “African swine fever virus” of its acronym “ASFV” as used herein refers to the causative agent of African swine fever (ASF). ASFV is a large, icosahedral, double-stranded DNA virus with a linear genome containing at least 150 genes. The number of genes differs slightly between different isolates of the virus. ASFV has similarities to the other large DNA viruses, e.g., poxvirus, iridovirus and mimivirus. In common with other viral haemorrhagic fevers, the main target cells for replication are those of monocyte, macrophage lineage. Based on sequence variation in the C-terminal region of the B646L gene encoding the major capsid protein p72, 24 ASFV genotypes (l-XXII) have been identified. All ASFV p72 genotypes have been circulating in eastern and southern Africa, and only a few genotypes can be found outside these regions. Currently, genotype II is the only genotype that is present globally.. In a preferred embodiment of the ASFV strain of the invention, the genome of the ASFV strain of the invention is a modified form of the genome of a genotype II ASFV. The ASFV strain of the invention comprises a modified form of the genome of the ASFV Lv17/WB/Rie1 strain which is defined as SEQ ID NO: 1. In a preferred embodiment of the ASFV strain of the invention, the genome of the ASFV is a modified form of the genome of the Lv17/WB/Rie1 strain having the sequence according to SEQ ID NO: 1 in which the EP153R gene and the EP402R gene have been inactivated. In another particular embodiment of the ASFV strain of the invention, the genome of the recombinant ASFV Lv17/WB/Rie1 strain comprises the sequence of SEQ ID NO: 2.
It will be understood that those ASFV strains of the invention containing a genome which is a modification of the genome as defined in SEQ ID NO: 1 is still characterized by the inactivation of the EP402R and the EP153R genes.
The term “live” as used herein refers to the fact that the ASFV of the invention relates to a live virus capable of replication in its natural host cell. The term “attenuated” as used herein refers to a virus with compromised or abolished virulence in the intended recipient, i.e. swine. The goal of creating an attenuated virus is to produce a virus that does not produce infection symptoms, or very light infection symptoms, as to when used as a vaccine it stills is able to produce an immune response as to create immunogenic protection when the animal is infected with a wild type virus. The term “wildtype” indicates that the virus existed (at some point) in the field, and was isolated from a natural host, such as a domestic pig, tick or warthog.
The level of attenuation of a virus can be measured by the haemadsorption assay. The term “haemadsorption” as used herein refers to a phenomenon whereby cells infected with ASFV adsorb erythrocytes (red blood cells) on their surface. The degree of haemadsorption induced by an ASFV may be measured using a haemadsorption assay such as described herein. For example, cells may be transfected with a protein or infected with an ASFV, then red blood cells added and the degree of haemadsorption detected by imaging.
In a particular embodiment, the level of attenuation of the ASFV strain of the invention is measured by haemadsorption and the ASFV strain of the invention has reduced haemadsorption when compared to the wild type Lv17/WB/Rie1 strain. In a particular embodiment of the ASFV strain of the invention the haemadsorption capacity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% when compared the wild type Lv17/WB/Rie1 strain.
The term “EP402R gene” as used herein refers to the ASFV gene which encodes the CD2v protein, a glycoprotein with a relative molecular weight of about 105 kDa that is responsible for the haemadsorption phenotype of ASFV infected cells in vitro. This ASFV protein is the viral homolog (CD2v) of cellular T-lymphocyte surface adhesion receptor CD2 proteins. Based on sequence data and hydropathy profiles, ASFV CD2v protein resembles typical (CD2) class III transmembrane proteins. Generally, the full-length ASFV CD2v protein contains four different sections: (i) a hydrophobic leader at the N-terminal side of the protein, (ii) a hydrophilic, extracellular domain comprising a multitude of potential N-linked glycosylation sites, (iii) a hydrophobic stretch of amino acids that act as a transmembrane domain, and (iv) a C-terminal hydrophilic, cytoplasmic domain which contains a large number of typical, imperfect repeats of the hexa peptide (PPPKPC).
The nucleotide sequence of the EP402R gene in the Lv17/WB/Rie1 corresponds to the sequence from position 74339 to position 75420 of the Lv17/WB/Rie1 strain genome with the sequence according to SEQ ID NO: 1. In a particular embodiment the gene EP402R comprises the sequence according to SEQ ID NO: 3. In another particular embodiment the EP402R gene comprises a sequence with at least at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to SEQ ID NO: 3.
The terms “identity”, “identical” or “percent identity” in the context of two or more amino acid or nucleotide sequences, refer to two or more sequences or fragments of said sequences that are the same or have a specified percentage of nucleotide residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences. Publicly available software programs can be used to align sequences. Appropriate parameters for maximal alignment by particular alignment software can be determined by one skilled in the art. In certain embodiments, the default parameters of the alignment software are used. In certain embodiments, the percentage identity “X” of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y/Z), where Y is the number of nucleotide residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the second sequence is longer than the first sequence, then the global alignment taken the entirety of both sequences into consideration is used, therefore all letters and gaps in each sequence must be aligned. In this case, the same formula as above can be used but using as Z value the length of the region wherein the first and second sequence overlaps, said region having a length, which is substantially the same as the length of the first sequence.
For instance, 95% identical to a reference sequence according to the present invention, the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
The term “EP153R gene” as used herein refers to the ASFV gene which down-regulates MHC-I expression by impairing the appropriate configuration or presentation into the plasma membrane of the latter (also known as Lectin-like protein EP153R).
The nucleotide sequence of the EP153R gene corresponds to the sequence from position 73793 to position 74269 of the Lv17/WB/Rie1 strain genome with the sequence according to SEQ ID NO: 1. In a particular embodiment the gene EP153R comprises the sequence according to SEQ ID NO: 4. In another particular embodiment the EP153R gene comprises a sequence with at least at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to SEQ ID NO: 4. The term “inactivated” as used herein refers to a gene whose sequence or a sequence implicated in its expression or its regulation is modified as to not express a product or express a non-functional product. In the present invention, the inactivation is of genes EP153R and EP402R. In order to determine the inactivation of the gene EP153R in ASFV strain of the invention, several methods can be used, namely the hemadsorption phenomenon induced in ASF virus-infected cells, as previously describe, and further detailed in Galindo et al., (2000, Virology 266, 2, 340-351), by measuring the increase level of Caspase-3 and cell death in virus sensitive cells as described in Hurtado et al. (2004, Virology;326(1): 160-70) or by the lack of down-regulation of MHC-I expression in porcine and human cells infected with viruses as detailed in Hurtado et al., (2011 , Archives of Virology volume 156, 219-234). Regarding the determination of the inactivation of the gene EP402R, said inactivation may be determined by determining the hemadsorption of the virus with EP402R inactivated since, the product of the EP402R gene is the main responsible for the adsorption to red blood cells, as detailed previously.
Gene inactivation can be accomplished by several methods well known to the skilled person in the art such as random mutagenesis by transposon insertion mutagenesis and UV irradiation, and targeted mutagenesis such as homologous recombination and CRISP/Cas9 technology (see Examples section). Both techniques allow for the inactivation of a gene by either inserting extra nucleotide sequence into the coding sequence of the gene or, on the contrary, by deleting fragments or the entirety of the gene. In both cases, the result may be a non-functional or non-existent transcription of the gene and therefore a lack of the gene product.
In a particular embodiment of the ASFV of the invention, the inactivation of the EP402R gene and of the EP153R gene results from at least one mutation such that the genes are not transcribed and/or translated. In a particular embodiment said at least one mutation is selected from a group consisting of a deletion of part or the complete gene or genes, an insertion of nucleotide sequences, one or more single polynucleotide polymorphisms, a duplication event, or any combination thereof. In another particular embodiment of the ASFV of the invention, the EP402R gene and the EP153R gene are deleted and or interrupted such that the EP402R gene and the EP153R gene are not transcribed and/or translated.
In a particular embodiment of the ASFV strain of the invention, the inactivation of the EP402R gene and/or EP153R gene results from a deletion of at least part of the EP402R and/or EP153R gene. In a more preferred embodiment the deletion of the EP402R and/or EP153R gene is a deletion of at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 base pairs.
In another particular embodiment of the ASFV strain of the invention, the deletion of EP402R gene affects the complete EP402R gene. In yet another particular embodiment of the ASFV strain of the invention, the EP153R deletion affects the complete EP153R gene.
In one more particular embodiment of the ASFV strain of the invention the inactivation of the EP402R gene and the inactivation of the EP153R gene results from a single deletion in the genome of the ASFV Lv17/WB/Rie1 strain.
The term “interrupted” as used herein refers to a mutation that leads to the open reading frame of the gene in question to be interrupted such that no functional gene product is derived from said open reading. The interruption may lead to an absence of products or to the presence of two or more smaller products of the open reading frame, wherein said two or more products are not functional or are not capable of reconstitute de function of the original product obtained from an uninterrupted open reading frame.
In one embodiment, the live attenuated ASFV strain of the invention carries a deletion of both the EP402R gene and the EP153R gene as a result from a single deletion in the genome of the ASFV Lv17/WB/Rie1 strain. In another particular embodiment of the ASFV strain of the invention, the inactivation of the EP402R gene and/or EP153R gene results from a deletion of the nucleotide sequence from position 73812 to position 75385 of the Lv17/WB/Rie1 strain genome with the sequence according to SEQ ID NO: 1.
The inactivated genes of the ASFV strain of the invention may be replaced by a heterologous gene, i.e. a gene that does not exist naturally in ASFV. Therefore, in a particular embodiment of the ASFV strain of the invention the EP402R gene and/or the EP153R gene is/are replaced by a heterologous gene. In another particular embodiment of the ASFV strain of the invention contains at least one heterologous gene or genes. In another particular embodiment of the ASFV strain of the invention contains at least two heterologous genes wherein the heterologous genes are the same or distinct. In another particular embodiment at least one heterologous gene is a reporter gene.
The term “reporter gene” refers to a polynucleotide that encodes a molecule that can be detected readily, either directly or by its effect on the host cell (phenotype). Exemplary reporter genes encode enzymes, for example the ADE2 or ADE3 gene products, [beta]-galactosidase and LIRA3, luminescent or fluorescent proteins, such as Green Fluorescent Protein (GFP) and variants thereof, antigenic epitopes (for example Glu-tags), mRNA of distinct sequences, and the like.
In another particular embodiment of the ASFV strain of the invention at least one heterologous gene is a fluorescence protein selected from a group consisting of: GFP, blue fluorescence protein (BFP), cyan fluorescence protein (CFP), yellow fluorescence protein (YFP), Venus, mOrange, dTomato, DsRed, Red fluorescence protein (RFP) and mCherry.
In another particular embodiment of the ASFV strain of the invention the EP402R gene and the EP153R are both replaced by the eGFP (enhanced GFP) gene. For the reporter genes to be detected, they must express a product which is detectable when produced, such as a polypeptide or protein. For the reporter gene to be expressed, it must be under the control of a promoter. The term “promoter” as used herein refers to a region of DNA upstream of a gene where relevant proteins (such as RNA polymerase and transcription factors) bind to initiate transcription of that gene.
In a particular embodiment of the ASFV strain of the invention the live attenuated ASFV contains at least one heterologous gene and wherein heterologous gene is under the control of a promoter of an ASFV gene. In another particular embodiment of the ASFV strain of the invention, the attenuated ASFV contains at least one heterologous gene and wherein said heterologous gene is under the control of a promoter of a late ASFV gene. In a particular embodiment the reporter gene is under the control of a promoter of an ASFV gene. In another particular embodiment the reporter gene is under the control of a promoter of a late ASFV gene. The term “late ASFV gene” in the present context refers to genes that are expressed at later stages of the virus gene expression during cell infection. Promoter sequences are generally short and A+ T rich and they are recognized by virus-encoded transcription factors specific for the different stages of virus gene expression; early, intermediate and late gene classes have been defined. These are expressed in a cascade with early gene expression occurring from partially uncoated cores using enzymes and other factors packaged in the virus particles. In a particular embodiment of the ASFV strain of the invention, the promoter is the promoter of the p72 gene. In another particular embodiment of the ASFV strain of the invention, the promoter of the p72 gene comprises SEQ ID NO: 5.
The term “p72 gene”, also known as “B646L gene”, as used herein refers to the gene which encodes for the protein p72, the major capsid protein, which is the most dominant structural component of the virion and constitutes about ~31 %-33% of the total mass of the virion, making it one of the major antigens detected in infected pigs.
Besides the modifications of the ASFV strain of the invention mentioned in Table 1 , the ASFV strain of the invention is devoid of other mutations and/or modifications that alter the function of genes, specifically of the genes DP148R, 9GL/B119L, MGF_360-12L, MGF_360- 13L and MGF_360-14L. In a particular embodiment of the ASFV strain of the invention the starting strain has functional versions of one or more of the genes DP148R, 9GL/B119L, MGF_360-12L, MGF_360-13L and MGF_360-14L genes. The term “starting strain” as used herein refers to the ASFV strain Lv17/WB/Rie1 wherein no further mutations have bene introduced in order to obtain the ASFV strain of the invention wherein the genes EP420R and EP153R are inactivated.
The term “DP148R” as used herein refers to a gene of unknown function which is located between positions 183187 and 184012 of the genome of the ASFV Georgia 2007/1 strain (GenBank accession no. NC044959, version 2 of December 20th, 2020). Deletions of this gene are known to not affect virus replication but affect virus infection.
The term “9GL/B119L” as used herein refers to the gene which encodes for a FAD- linked sulfhydryl oxidase located between positions 95936 and 96295 of the genome of the ASFV Georgia 2007/1 strain. Deletions of this gene are known to not affect virion maturation, viral growth in macrophages and viral virulence in swine.
The terms “MGF_360-12L”, “MGF_360-13L” and “MGF_360-14L”, as used herein, refer to the genes present in the multigene family 360, whose function can affect the host's immune response mechanism and have host specificity. The genes MGF_360-12L, MG_360-13L and MG_360-14L are located between positions 30355 and 33887 of the genome of the ASFV Georgia 2007/1 strain.
Uses of the recombinant ASFV strain in immunogenic compositions and vaccines
The recombinant ASFV strain of the invention can be used for the generation of immunogenicity in porcine through immunogenic compositions or vaccine compositions. Therefore, another aspect of the invention relates to an immunogenic composition or a vaccine composition, from here onwards the immunogenic composition of the invention, comprising the attenuated ASFV strain of the invention and a pharmaceutically suitable carrier or excipient.
In the context of the present invention, the term “immunogenic composition" refers to a composition that can elicit a cellular and/or humoral immune response but does not necessarily confer full or partial immune protection against African swine fever in mammals. For the avoidance of doubt, however, such immunogenic composition may confer full or partial protection against African swine fever in mammals and this is also preferred. In contrast, a “vaccine" in the context of the present invention does confer full or partial, but at least partial immune protection against African swine fever in mammals.
The terms "protection against African swine fever", "protective immunity", "functional immunity" and similar phrases as used herein refer to a response against African swine fever (virus) generated by administration of the recombinant ASFV of the invention, that results in fewer deleterious effects than would be expected in a non-immunized mammal that has been exposed to African swine fever (virus). That is, the severity of the deleterious effects of the ASFV infection is lessened in a vaccinated mammal. Infection may be reduced, slowed, or possibly fully prevented, in a vaccinated mammal. Herein, where complete prevention of infection is meant, it is specifically stated. If complete prevention is not stated, then the term includes partial prevention.
The term "increased protection" means, but is not limited to, a statistically significant reduction of one or more clinical symptoms, which are associated with infection by a wild-type ASFV, in a vaccinated group of mammals versus a non-vaccinated control group of mammals. The term "statistically significant reduction of clinical symptoms" as used herein refers to, without limitation, that the incidence of at least one clinical symptom in the vaccinated group of mammals is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% lower than in the non-vaccinated control group after the challenge with the wild-type ASFV. In the context of the present invention, the term "long- lasting protection" shall refer to improved efficacy that persists for at least 3 weeks, at least 3 months, at least 6 months, or at least 1 year. In the case of livestock, it is most preferred that the long-lasting protection shall persist until the average age at which animals are marketed for meat.
In the context of the present invention, the term "immune response" or "immunological response" refers to the development of a cellular and/or antibody-mediated immune response to the recombinant ASFV of the invention or immunogenic composition of the invention. Usually, an immune or immunological response includes, one or more of the following effects: the production or activation of antibodies, B cells, helper T cells, suppressor T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the recombinant ASFV strain of the invention. Preferably, the host will display either a therapeutic or a protective immunological (memory) response, such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction in number of symptoms, severity of symptoms, or the lack of one or more of the symptoms associated with the infection of wild-type ASFV, a delay in the of onset of viremia, reduced viral persistence, a reduction in the overall viral load and/or a reduction of viral excretion.
The immunogenic composition of the invention further comprises a pharmaceutically acceptable carrier or excipient. In the context of the present invention, the term "a pharmaceutically acceptable carrier" includes any solvents, dispersion media, coatings, adjuvants, stabilizing agents, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, and the like. In a particular embodiment, the immunogenic composition of the invention comprises stabilizing agents for lyophilization or storing the virus suspension in liquid form. In another particular embodiment, the immunogenic composition of the present invention contains an adjuvant. "Adjuvants" as used herein, can include aluminum hydroxide and aluminum phosphate, saponins e.g., Quil A, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL), water-in-oil emulsion, oil-in- water emulsion, and water-in-oil-in-water emulsion. The emulsion can be based in particular on light liquid paraffin oil (European Pharmacopeia type); isoprenoid oil such as squalane or squalene; a-tocopherol acetate; oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di-(caprylate/caprate), glyceryl tri- (caprylate/caprate) or propylene glycol di oleate; esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, of mannide (e.g. anhydromannitol oleate), of glycol, of polyglycerol, of propylene glycol and of oleic, isostearic, ricinoleic or hydroxy stearic acid, which are optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, in particular the Pluronic products, especially L 121. A further instance of an adjuvant is a compound chosen from the polymers of acrylic or methacrylic acid and the copolymers of maleic anhydride and alkenyl derivative. Advantageous adjuvant compounds are the polymers of acrylic or methacrylic acid which are cross-linked, especially with polyalkenyl ethers of sugars or polyalcohols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Adjuvants can also be acrylic polymers cross-linked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced by unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are those containing from 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyl. The products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly appropriate. They are cross-linked with an allyl sucrose or with allyl pentaerythritol. Among then, there may be mentioned Carbopol 974P, 934P and 971 P. Most preferred is the use of Cabopol 971 P. Among the copolymers of maleic anhydride and alkenyl derivative, are the copolymers EMA (Monsanto), which are copolymers of maleic anhydride and ethylene. Further suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), Block copolymer (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophosphoryl lipid A, Avridine lipid-amine adjuvant, heat-labile enterotoxin from E. coli (recombinant or otherwise), cholera toxin, IMS 1314 or muramyl dipeptide, or naturally occurring or recombinant cytokines or analogs thereof or stimulants of endogenous cytokine release, among many others.
In the context of the present invention, the term "diluents" can include water, saline, dextrose, ethanol, glycerol, and the like. Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol, and lactose, among others. Stabilizers include albumin and alkali salts of ethylendiamintetracetic acid, among others. In a particular embodiment of the immunogenic composition of the invention, the immunogenic composition of the invention is formulated to be administrated intranasal, orally, subcutaneously, intradermal or intramuscularly, preferably intramuscularly. In a more particular embodiment of the immunogenic composition of the invention, the immunogenic composition of the invention is formulated to be administrated orally, preferably via bate. In an even more particular embodiment of the immunogenic composition of the invention, the immunogenic composition of the invention is formulated to be administrated intradermally.
In another particular embodiment of the immunogenic composition of the invention, the immunogenic composition of the invention is formulated to be administrated to swine by intramuscular vaccination, by intradermal vaccination or by oral vaccination preferably via bate.
In yet another particular embodiment of the immunogenic composition of the invention, the immunogenic composition of the invention is formulated to be administrated to wild boars intramuscular vaccination, by intradermal vaccination or by oral vaccination, preferably via bate. In an even more particular embodiment of the immunogenic composition of the invention, the immunogenic composition of the invention is formulated to be administrated to wild boars by oral vaccination, preferably via bate.
The ASFV strain of the invention finds use in the prevention or treatment of diseases directly caused by ASFV. Therefore, another aspect of the present invention relates to the ASFV strain of the invention or the immunogenic composition of the invention for use in the prevention or treatment of a disease caused by the infection of ASFV, from here onwards the treatment use of the invention.
The term “prevention”, as used herein, relates to the capacity to prevent, minimize, or hinder the onset or development of a disease or condition before its onset.
As used herein, the terms "treat", "treatment", "treatment", or "amelioration". The term refers to therapeutic treatment, the purpose of which is to reverse, reduce, suppress, delay or stop the progression or severity of the condition associated with the disease or disorder. The term "treatment" includes reducing or alleviating at least one adverse effect or condition of a condition, a disease or disorder, such as an infection. Treatment is usually "effective" when one or more symptoms or clinical markers are reduced. Alternatively, treatment is "effective" if disease progression is delayed or halted. That is, "treatment" includes not only the improvement of symptoms or markers, but also the interruption of at least a condition that indicates the progression or worsening of symptoms that would be expected in the absence of treatment. The beneficial or desirable clinical outcome, whether detectable or not, is a reduction in one or more symptoms, a reduction in the extent of the disease, a stable (i.e. , not aggravated) condition of the disease. These include, but are not limited to, delayed or slowed progression, amelioration or alleviation of the disease state, and remission (partial or total). The term "treatment" of a disease also includes providing relief from symptoms or side effects of the disease (including symptomatic treatment).
In a particular embodiment of the treatment use of the invention the recombinant ASFV is used for the treatment of an infection by ASFV in swine, in wild boar, or in any other swine species that can be affected by ASF. The term “swine” as used herein refers to a pig (Sus domesticus), also called hog, or domestic pig when distinguishing from other members of the genus Sus. Swine is an omnivorous, domesticated, even-toed, hoofed mammal.
The term “wild boar” as used herein refers to the species Sus scrofa, also known as the wild swine, common wild pig, Eurasian wild pig, or simply wild pig. Wild boar is a suid native to much of Eurasia and North Africa, and has been introduced to the Americas and Oceania.
In a particular embodiment of the treatment use of the invention, the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated intranasal, orally, subcutaneously, intradermally or intramuscularly, preferably intramuscularly. In a more particular embodiment of the treatment use of the invention, the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated orally, preferably via bate. In an even more particular embodiment of the treatment use of the invention, the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated intradermally.
In another of the treatment use of the invention, the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated to swine by intramuscular vaccination, by intradermal vaccination or by oral vaccination preferably via bate.
In yet another particular embodiment of the treatment use of the invention, the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated to wild boars intramuscular vaccination, by intradermal vaccination or by oral vaccination, preferably via bate. In an even more particular embodiment of the treatment use of the invention, the ASFV strain of the invention of the immunogenic composition of the invention is formulated to be administrated to wild boars by oral vaccination, preferably via bate. The skilled artisan will recognize that the ASFV of the invention or the immunogenic composition of the invention may also be administered in one, two or more doses, as well as, by other routes of administration. For example, such other routes include intracutaneously, intravenously, intravascularly, intraarterially, intraperitoneally, intrathecally, intratracheally, intracardially, intralobally, intramedullarly, intrapulmonarily and intravaginally. Depending on the desired duration and effectiveness of the treatment, the ASFV strain of the invention or the immunogenic composition of the invention may be administered once or several times, also intermittently, for instance daily for several days, weeks or months and in different dosages. In a particular embodiment of the use of the invention, the ASFV strain of the invention or the immunogenic composition of the invention is administrated in a therapeutically effective dose. The expression “therapeutic effective dose” as used herein refers to an amount of an active agent (i.e., an ingredient such as ASFV of the invention) high enough to deliver the desired benefit, either the treatment or prevention of the disease, but low enough to avoid serious side effects within the scope of medical/veterinary judgment. The particular dose administered according to this invention will of course be determined by the particular circumstances surrounding the case, such as the route of administration, the age of the animals, and the similar considerations. In a particular embodiment of the use of the invention the therapeutic effective dose is between about 10 median tissue culture infectious dose (TCID50) to about 105 TCID50.
In a particular embodiment of the use of the invention the therapeutic effective dose in swine is between about 50 median tissue culture infectious dose (TCID50) to about 200 TCID50, preferably about 100 TCID50. In another particular embodiment of the use of the invention the therapeutic effective dose in wild boar is between about 102 TCID50 to about 104 TCID50. In one more particular embodiment of the use of the invention the therapeutic effective dose is between about 50 TCID50 to about 200 TCID50 and the therapeutic effective dose in wild boar is between about 102 TCID50 to about 104 TCID50.
In the context of the present invention, “median tissue culture infectious dose”, or its acronym "TCID", refers to the measure of infectious virus titer. It refers to an endpoint dilution assay which quantifies the amount of virus required to kill 50% of infected hosts or to produce a cytopathic effect in 50% of inoculated tissue culture cells. This assay may be more common in clinical research applications where the lethal dose of virus must be determined or if the virus does not form plaques. When used in the context of tissue culture, host cells are plated and serial dilutions of the virus are added. After incubation, the percentage of cell death (i.e. infected cells) is manually observed and recorded for each virus dilution, and results are used to mathematically calculate a TCID50 result. Two methods commonly used to calculate TCID50 are the Spearman-Karber method and the Reed-Muench method.
It will be clear to the expert in the field that the therapeutic effect can be accomplished in several types of dosage, wherein the timing of multiple doses can be between 1 day to several days, weeks, months or year. It is preferred that said effect be obtained by administering a single dose of the recombinant ASFV strain of the invention. Therefore, in a particular embodiment of the use of the invention the recombinant ASFV is administered in a one, two, three, four or five doses, preferably one dose. In another particular embodiment of the use of the invention the recombinant ASFV is administered in a single dose.
Methods and reagents for obtaining the ASFV of the invention All previous aspects and their embodiments where applicable are also comprised in the following aspects and their embodiments. All the previous definitions of terms and expressions are equally applied to the current aspects and embodiments, except is specifically stated otherwise.
An aspect of the present invention relates to a polynucleotide comprising a first, second and third regions, from here onwards the polynucleotide of the invention, wherein the first region comprises an expression cassette comprising an ASFV heterologous gene, wherein the first region is flanked by the second and third regions and wherein said second and third regions are the regions of the genome of the ASFV Lv17/WB/Rie1 strain which naturally flank the region of the ASFV genome comprising the EP402R gene and EP153R genes.
The term “expression cassette” as used herein refers to a distinct component of DNA which comprises a gene and a regulatory sequence, such as a promoter, which allows the expression cassette to produce RNA and protein when present in the desired host cell.
In a particular embodiment of the polynucleotide of the invention the heterologous gene encodes a fluorescent protein. In another particular embodiment of the polynucleotide of the invention the heterologous gene is a fluorescent protein selected from a group consisting of: GFP, BFP, CFP, YFP, Venus, mOrange, dTomato, DsRed, RFP, mCherry and any of their variants. In a more particular embodiment of the polynucleotide of the invention the heterologous gene is eGFP.
In another particular embodiment of the polynucleotide of the invention the heterologous gene is under the control of a constitutive promoter, preferably the ASFV p72 promoter comprising the sequence according to SEQ ID NO: 5.
The expression “second and third regions are the regions of the genome of the ASFV Lv17/WB/Rie1 strain which naturally flank the region of the ASFV genome comprising the EP402R gene and EP153R genes” in the polynucleotide of the invention refers to the nucleotide sequence which is before the position 73793 (second region) and after the position 75420 (third region) of the genome of the Lv17/WB/Rie1 strain having the sequence according to SEQ ID NO: 1 . In a more particular embodiment of the first polynucleotide of the invention the second region comprises the nucleotide sequence between positions 71793 and 73793, or a fragment thereof, of the genome of the Lv17/WB/Rie1 strain having the sequence according to SEQ ID NO: 1. In another particular embodiment of the polynucleotide of the invention the third region comprises the nucleotide sequence between positions 75420 and 77420, or a fragment thereof, of the genome of the Lv17/WB/Rie1 strain having the sequence according to SEQ ID NO: 1. In another particular embodiment of the polynucleotide of the invention the second and third regions consist of about 2000 bp, about 1900 bp, about 1800 bp, about 1700 bp, about 1600 bp, about 1500 bp, about 1400 bp, about 1300 bp, about 1200 bp, about 1100 bp, about 1000 bp, about 900 bp, about 800 bp, about 700 bp, about 600 bp, or about 500 bp, preferably 1000 bp.
The polynucleotide of the invention can be comprised in a vector. As such, another aspect of the present invention relates to a vector comprising the polynucleotide of the invention, from here onwards the vector of the invention.
The term “vector”, as used herein, refers to a vehicle through which a polynucleotide or a DNA molecule can be manipulated or introduced into a cell. The vector can be a linear or circular polynucleotide or it can be a larger polynucleotide or any other type of construction such as the DNA or RNA of a viral genome, a virion or any other biological construct that allows the manipulation of DNA or its introduction in a cell. It is understood that the terms "recombinant vector", "recombinant system" can be used interchangeably with the term vector. A person skilled in the art will understand that there is no limitation as regards the type of vector, which can be used because said vector can be a cloning vector suitable for propagation and for obtaining the polynucleotides or suitable gene constructs or expression vectors in different heterologous organisms suitable for purifying the polynucleotides of the invention. Thus, suitable vectors according to the present invention include expression vectors in prokaryotes such as pET (such as pET14b), pUC18, pUC19, Bluescript and their derivatives, mp18, mp19, pBR322, pMB9, ColEI, pCRI, RP4, phages and shuttle vectors such as pSA3 and pAT28, expression vectors in yeasts such as vectors of the type of 2 micron plasmids, integration plasmids, YEP vectors, centromeric plasmids and the like, expression vectors in insect cells such as the pAC series and pVL series vectors, expression vectors in plants such as vectors of expression in plants such as pl Bl, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series vectors and the like and expression vectors in superior eukaryotic cells based on viral vectors (adenoviruses, viruses associated to adenoviruses as well as retroviruses and lentiviruses) as well as non-viral vectors such as pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1/hyg pHCMV/Zeo, pCR3.1 , pEFI/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6A/5-His, pVAXI, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1 , pML2d and pTDTI.
The vector of the invention can be used to transform, transfect, or infect cells that can be transformed, transfected or infected by said vector. Said cells can be prokaryotic or eukaryotic. Said vector can be obtained by conventional methods known by the persons skilled in the art (Sambrook et al., 2001 , “Molecular cloning, to Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory Press, N.Y. Vol 1-3 a).
Another aspect of the invention relates to a host cell comprising the polynucleotide of the invention or the vector of the invention, from here onwards the host cell of the invention.
The host cell of the invention can be obtained by transformation, transfection or infection of cells by conventional methods known by persons skilled in the art (Sambrook et al., 2001 , mentioned above). In a particular embodiment, said host cell is an animal cell transfected or infected with a suitable vector.
Host cells suitable for comprising the first polynucleotide of the invention, or the vector of the invention include, without being limited to, mammal, plant, insect, fungal and bacterial cells. Bacterial cells include, without being limited to, Gram-positive bacterial cells such as species of the Bacillus, Streptomyces, Listeria and Staphylococcus genus and Gram-negative bacterial cells such as cells of the Escherichia, Salmonella and Pseudomonas genera. Fungal cells preferably include cells of yeasts such as Saccharomyces cerevisiae, Pichia pastoris and Hansenula polymorpha. Insect cells include, without being limited to, Drosophila and Sf9 cells. Plant cells include, among others, cells of crop plants such as cereals, medicinal, ornamental or bulbous plants. Suitable mammal cells in the present invention include epithelial cell lines (human, ovine, porcine, etc.), osteosarcoma cell lines (human, etc.), neuroblastoma cell lines (human, etc.), epithelial carcinomas (human, etc.), glial cells (murine, etc.), hepatic cell lines (from monkey, etc.), CHO (Chinese Hamster Ovary) cells, COS cells, BHK cells, HeLa cells, 911 , AT1080, A549, 293 or PER.C6, NTERA-2 human ECC cells, D3 cells of the mESC line, human embryonic stem cells such as HS293, BGV01 , SHEF1 , SHEF2, HS181 , NIH3T3 cells, 293T, REH and MCF-7 and hMSC cells.
The ASFV strain of the invention can be obtained by several methods known to the skilled person in the field such as CRISPR/Cas, TALEN, and Zn-finger nuclease.
A further aspect of the present invention relates to a method for producing a recombinant ASFV according to the invention, from here onwards the method of the invention, comprising:
(i) modifying target cells by introducing a polynucleotide of the invention, infecting the cells with the Lv17/WB/Rie1 strain, and introducing means capable of creating a double strand DNA break in the genome of said attenuated ASFV strain within or at the vicinity of the region comprising the EP402R gene and EP153R gene,
(ii) maintaining the target cells under conditions adequate for the double-strand DNA break in the ASFV genome to take place and to allow homologous recombination between the ASFV genome containing the DNA break and the second and third regions of the polynucleotide thereby resulting in the replacement of the region encoding the EP402R and EP153R genes by the first region within the polynucleotide introduced in step (i), and
(iii) recovering the recombinant ASFV from the supernatant and/or from the whole cell extract and selecting the ASFV virions which contain the reporter gene.
Steps (i) Step (i) of the method of the invention refers to the process of introducing into the target cell all the components necessary to create an ASFV virus strain wherein the EP402R and the EP153R gene are inactivated. The target cells refers to cells which are naturally infected by the ASFV. In a particular embodiment of the method of the invention, the target cells in step (i) are mammalian cells, such as macrophage cells, COS cells, BHK cells, HeLa cells, 911 , AT1080, A549, 293 or PER.C6, NTERA-2 human ECC cells. In a more particular embodiment the target cells is a macrophage.
The introduction of a polynucleotide in the target cells can be accomplished by several methods well known by the skilled person in the art such as transformation, transfection or infection of cells by conventional methods known by persons skilled in the art (Sambrook et al., 2001 , mentioned above). In a particular embodiment of the method of the invention, the introduction of the polypeptide of the invention in step (i) is done by transfection. In another particular embodiment of the method of the invention, the expression cassette forming part of the first region comprises a heterologous gene which encodes a fluorescent protein. In a more particular embodiment, the heterologous gene is under the control of a constitutive promoter.
The expression of step (i) of the method of the invention “means capable of creating a double strand DNA break in the genome of said attenuated ASFV strain within or at the vicinity of the region comprising the EP402R gene and EP153R gene” refers to techniques which permit the cleavage of the bounds between adjacent nucleotides in a double strand of DNA. One such means of creating a double strand DNA break is the CRISPR/Cas9 technique. In a particular embodiment of the method of the invention, the means capable of creating a double strand break in the genome of said ASFV strain within or at the vicinity of the region encoding the EP402R and EP153R genes comprise a CRISPR/Cas system.
The term “CRISPR/Cas9 system” as used herein refers to the Class 2 Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) systems, which form an adaptive immune system in bacteria, and which have been modified for genome engineering. Engineered CRISPR systems contain two components: a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas protein). The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-defined ~20 nucleotide spacer that defines the genomic target to be modified. Thus, one can change the genomic target of the Cas protein by simply changing the target sequence present in the gRNA.
CRISPR was originally employed to knock out target genes in various cell types and organisms, but modifications to various Cas enzymes have extended CRISPR to selectively activate/repress target genes, purify specific regions of DNA, image DNA in live cells, and precisely edit DNA and RNA. Furthermore, the ease of generating gRNAs makes CRISPR one of the most scalable genome editing technologies. This advantage makes CRISPR perfect for genome-wide screens. Fully functional CRISPR/Cas enzymes will introduce a doublestrand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism which frequently causes insertions or deletions (indels) in the DNA. Indels often lead to frameshifts, creating loss of function alleles.
To introduce specific genomic changes, researchers use ssDNA or dsDNA repair templates with 1) homology to the DNA flanking the DSB and 2) a specific edit close to the gRNA PAM site.
Step (ii)
Step (ii) of the method of the invention relates to the process of maintain the target cells at ideal temperatures, cell number and carbon dioxide (CO2) concentration as for the double strand system to be able to function properly and create double strands in desired locations. In a preferred embodiment of the method of the invention, cells in step (ii) are maintained in a culture medium that comprises 2 mM l-glutamine, nonessential amino acids, an antibiotic, such as gentamicin, and supplements such as fetal bovine serum.
In another particular embodiment of the method of the invention the target cells are maintained at between about 32°C and 40°C, preferably 37°C in an about 3% to about 10% CO2 atmosphere, preferably 5% CO2 atmosphere, saturated with water vapor for about 12 hours to 36 hours, preferably 24 hours post transfection.
Step (Hi)
Step (iii) of the method of the invention relates to the process of obtaining the recombinant ASFV of the invention, i.e., a strain where the EP402R gene is inactivated. The selection of said virions makes use of the first heterologous gene present in the ASFV of the invention. In a particular embodiment of the method of the invention, the heterologous gene forming part of the first polynucleotide of the invention of the invention is a reporter gene.
The process of recovering recombinant and selecting virions is well known in the art and is exemplified in the Examples section of this description.
The invention will be described by way of the following examples which are to be considered as merely illustrative and not limitative of the scope of the invention.
EXAMPLES
EXAMPLE 1 : PRODUCING THE LV17/WB/RIE1-ACD ASFV MUTANT
To evaluate whether the Lv17/WB/Rie1 field strain could revert to a HAD phenotype, the in vitro stability of the strain was analyzed by subsequent passages in a primary cell culture using porcine blood monocytes (PBM), the target cells of ASFV. Through consecutive passages of Lv17/WB/Rie1 in PBM, the random appearance between passage 6 and 9 of non-typical and unstable HADs were observed. Deep sequencing (using amplicon-based NGS strategy) of the EP402R and EP153R genes, both involved in the HAD phenomenon, was performed to identify possible changes in the sequence that could be related to the instability of the non-HAD phenotype observed when Lv17/WB /Riel is passaged in cell culture. No relevant findings were identified that could explain this behaviour. All sequenced passages, including HADs, showed the presence of the adenosine deletion at position 393 of the EP402R gene identified in the original isolate. The recovered HAD-virus was tested for virulence in pigs in parallel with the non-HAD phenotype version. The HAD isolate showed higher virulence and was highly transmissible; infection with 10 TCID50 dose was partially lethal and caused acute or sub-acute disease, whereas 10 TCID50 dose of the non-HAD caused non-lethal, sub- clinical or chronic disease, as previously described in D1.
Based on these findinds, the Lv17/WB/Rie1-ACD ASFV mutant was created by deleting the EP153R and EP402R genes (73812-75385 nts.; all numbering in this example corresponds to the Lv17/WB/Rie1 sequence) from Lv17/WB/Rie1 and substituting with eGFP (enhanced green fluorescent protein gene) under the control of the p72 promoter of ASFV. The virus expresses fluorescent eGFP reporter gene in the infected cells but does not express the C-type lectin-like and the CD2-like (CD2v) protein products of the deleted viral genes (EP153R and EP402R, respectively).
To generate the Lv17/WB/Rie1-ACD mutant virus CRISPR/Cas9-mediated homologous recombination was used as described in the literature (Borca et al. 2018, Sci Rep. Feb 16;8(1):3154; Hubner et al. 2018, Sci Rep. Jan 23;8(1):1449).
First a recombinant transfer vector plasmid (pDel-cd2v-eGFP) and two gRNA expression vector plasmids (pXCD2v/1 and pXCD2v/2) were constructed.
A linearized pUC19 vector was used as a backbone (Thermo Fischer Scientific, Waltham MA, USA) for pDel-cd2v-eGFP. The recombination cassette contains the 969 bp (72843-73811) left recombination arm, upstream of the target ORFs, followed by p72 promoter (TATTTAATAAAAACAATAAATTATTTTTATAACATTATATA) (SEQ ID NO: 5), the eGFP gene, and the 989 bp (75386-76374) long right recombination arm downstream of the targeted ORFs. The pDel-cd2v-eGFP was assembled from three overlapping PCR fragments (Table 2) and the linearized pUC19 vector with the help of GeneArt™ Seamless PLUS Cloning and Assembly Kit (Thermo Fischer Scientific, Waltham MA, USA).
Table 2: PCR fragments
The two gRNA plasmids were created cloning one upstream and one downstream double-stranded protospacer oligos gRNAinsI and gRNAins2 into the Bbsl digested pX330- DNLS1_2-NeoR plasmid resulting the pXCD2v/1 and pXCD2v/2 vectors respectively (Hubner et al. 2018, Sci Rep. Jan 23;8(1):1449).
After creating the plasmids, the following Infection/Transfection protocol was executed to generate and isolate the mutant:
1 . Pog macrophages were plated at a density of 5 x 106/well in 6-well plates and allowed to attach overnight.
2. Each well was inoculated with Lv17/WB/Rie1 ASFV (MOI of 1) in 2 ml of RPMI, followed by incubation at 37 °C under 5% CO2 for 1 h.
3. 1.5 pg of donor plasmid (pDel-cd2v-eGFP) and 0.75-0.75 pg of gRNA plasmids (pXCD2v/1 and pXCD2v/2) were carefully mixed into 150 pl of serum and antibiotics- free RPMI in Eppendorf tubes. Subsequently, 10 pl of Fugene HD transfection reagent (Promega Corporation, Madison, Wisconsin, USA) was added and mixed immediately, and incubated for 10 min at room temperature.
4. The above mix was added dropwise to the plated macrophages. Cells were incubated at 37 °C in 5% CO2 for 24 h.
5. After determining the percentage of fluorescent cells, plates (including cells and supernatants) were frozen to -70 °C, and stored until ready to use.
6. After thawing, cell debris was removed by centrifugation at 5000 x g at 10 min.
7. Supernatant was diluted ten-fold serially in 100 pl complete RPMI and plated to 96- well plates containing macrophages (104/well). 8. Plates were monitored under a fluorescent microscope for the presence of cells expressing eGFP in every 24 h until 3 days. Fluorescent cells were isolated with a pipettor and pooled in RPMI.
9. Steps 7 and 8 were repeated 5 times, until the resulted Lv17/WB/Rie1-ACD virus stock was considered to be homogeneous and free of the parental virus.
10. Homogeneity of the Lv17/WB/Rie1-ACD virus stock was confirmed by NGS sequencing as described in the literature (Olasz et al. 2019, Viruses Dec 6;11(12):1129).
Example 2: IN VIVO SAFETY STUDIES IN WILD BOAR USING A LIVE AFRICAN SWINE FEVER (ASF) VIRUS VACCINE STRAIN: Lv17/WB/Rie1-ACD; AND EFFICACY STUDIES AGAINST ARMENIA07 (ARM07) VIRULENT ASF VIRUS CHALLENGE
2.1. Study design
Twenty-five ASFV-free and ASFV antibody-free wild boar piglets aged 3-4 months were available for this study. Four groups were established: groups 1 and 2 evaluated the mutant vaccine strain, while groups 3 and 4 evaluated the parental virus.
In group 1 , six animals were orally vaccinated with 104 TCI D50 dose of the Lv17/WB/Rie1- ACD mutant in a single dose model and challenged at 30 days post-vaccination (dpv) with 10 HAD50 of Armenia/07 (Arm07) via the IM route. The experimental period lasted 62 days.
Group 2 (six animals) was orally immunized with 102TCID5o of Lv17/WB/Rie1-ACD and revaccinated with 1O4TCIDso at 30 dpv, being subsequently challenged with Arm07 at 44 dpv via the IM route. The experimental period lasted 62 days.
Group 3 (seven animals) and 4 (six animals) were orally immunized with the parental strain Lv17/WB/Rie1 at a dose of 103 TCIDso and 1O4TCID5o, respectively, with revaccination at 18 dpv. Animals from groups 3 and 4 were challenged with Arm07 at 42 dpv via the IM route. The experimental period lasted 74 days.
See Table 3 for an overview of the groups and their treatment.
Table 3: Overview of the experiment groups, periods and their treatment
The serum samples were assayed using a commercial ELISA test to detect specific antibodies against ASFV-p72 (INGEZIM PPA Compac K3, Ingenasa, Madrid, Spain), following the procedure described by the manufacturer. A High Pure PCR Template Preparation kit (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) was used to extract DNA from EDTA-blood samples. The ASF viral genome obtained from blood (viremia) was amplified by employing the Universal Probe Library (UPL) real-time PCR protocol, using undiluted extracted DNA for each sample (Fernandez-Pinero et al., 2012). The results were expressed in Cq values (equivalent to cycle threshold, CT), and were considered positive when Cq was < 40.0. Clinical signs were recorded daily and expressed with a quantitative clinical score obtained by adding values for nine clinical signs recorded on a daily basis (Cadenas-Fernandez et al., 2020).
2.2. MATERIALS AND METHODS
2.2.1. Test articles and challenge material
2.2.1.1. Live ASFV vaccine strains
Name strain 1 : Lv17/WB/Rie1-ACD
Batch no. or reference: Obtained from Dr. Z. Zadori, Veterinary Medical Research Institute (VMRI), Budapest, Hungary
Titre: 4.8x107 TCID50/ml
Storage conditions: -80°C
Name strain 2: Lv17/WB/Rie1
Titre: 2.82x106 TCI D50/m I
Storage conditions: -80°C
2.2.2. Preparation of inoculum
Dosing form: The vaccines contained a calculated amount of 102/103/104 TCID50 per dose of 1 ml PBS. Preparation: The vaccine strains were diluted in PBS shortly before vaccination and kept at ambient temperature until use. The vaccines were applied at ambient temperature.
2.2.3. ASFV challenge strain
Name: Armenia/07 (Arm07)
Batch no.: Arm07 batch L12
Titre: 2.11x106 HAD50/ml
Storage conditions: -80°C
2.2.4. Preparation of challenge material
Dosing form: The challenge material contained a calculated amount of 10 HAD50 per dose of 1ml.
Preparation: Arm07 was diluted to 10 HADso/ml shortly before the challenge. The challenge material was applied at ambient temperature.
2.2.5. Test system
2.2.5.1. Animals
Species: Wild boar (Sus scrofa)
Gender: Female
Age at vaccination: 3-5 months
Breed: Farmed Iberian wild boar
Number: 25
Microbiological status: Free of ASFV, Aujeszky virus, Mycobacterium bovis, classical swine fever virus, swine vesicular disease virus, Mycoplasma hyopneumoniae, porcine reproductive and respiratory syndrome virus and porcine circovirus type 2
Source of pigs: Certified farm, Sevilla, Spain
Table 4. Clinical signs and scoring specific parameters for ASFV infection in wild boar
(Cadenas-Fernandez et al., 2020).
2.2.5.2. Acclimatisation period
Wild boar had two weeks of acclimatization between transportation to the animal facility and vaccination. 2.2.5.3. Inclusion and exclusion criteria
A veterinarian examination was conducted prior introduction of animals into BSL3 facilities verifying the correct sanitary status of the animals. Afterward, another veterinarian exploration was thoroughly conducted in order to identify any clinical signs and/or injuries {e.g., due to transportation. Only healthy animals were included in the study after acclimatisation period.
2.2.5.4. Identification and assignment to the treatment groups
Based on hierarchical behaviours and veterinary criteria, animals were homogeneously distributed into experimental groups. Subsequently, animals were randomly identified using individually numbered ear-tags. 2.2.5.5. Husbandry
Wild boar were housed in separate boxes. Drinking water was available ad libitum as well as maintenance feed formulation (commercial animal feed for piglets). For animal welfare purposes, several toys specifically designed for wild boar, such as balls and biting chains were placed per pen. Cleaning of pens was conducted three times per week.
2.3. Treatment
After arrival animals received a metaphylactic treatment with ivermectin (Ivomec S, Merial GmbH) in order to eliminate parasites.
Animals in groups 1 , 2, 3, and 4 were vaccinated orally with the corresponding vaccine at the corresponding dose (see Table 3).
All the animals were challenged with 10 HAD50 of strain Arm07 via the IM route (see Table 3).
2.4. Animal experimental procedures
2.4.1. Daily observations, rectal temperature measurements, and clinical signs
A clinical evaluation was performed on a daily basis in order to examine any clinical signs of development during the vaccination and challenge periods to evaluate the respective attenuation and effectivity of the vaccine prototype. The animals were observed on each day of the experiment utilizing a 24-h video camera and in situ wildlife-specialist veterinarian visits in order to record their daily clinical signs.
These clinical signs were expressed in terms of a quantitative CS following the specific guidelines for ASF clinical disease evaluation in wild boar previously described by Cadenas- Fernandez et al. (2020. Pathogens; 9(3):171). This CS includes rectal temperature, behaviour, body condition, skin alterations, ocular/nasal discharge, joint swelling, respiratory signs, digestive signs, and neurological signs. The only clinical parameter that was not taken daily was that of rectal temperature in order to minimize the management of animals, and it was, therefore, measured only twice a week and in animals with any severe signs. Fever was defined as a rectal temperature above 40.0°C.
2.4.2. Sampling of blood
Blood-EDTA and serum samples were collected from each animal. Samples were taken prior to vaccination, and twice per week during the vaccination and challenge period.
2.4.3. Destination of the animals at the end of the study
Surviving animals were anesthetized between 30 to 32 days post challenge by intramuscular injection of an anesthetic combination of tiletamine-zolazepam (Zoletil® 100 mg/ml, Virbac, France, target dose 3 mg/kg) and medetomidine (Medetor®, Virbac, France, target dose 0.05 mg/kg; complete protocol described in Barasona et al., 2013 BMC Vet Res. 9: 107), then euthanized by intravenous injection of an overdose of narcotic substances (T61®, Laboratorios Intervet S.A., Salamanca, Spain).
Blood-EDTA, sera, and twenty-one different types of tissues and organs were obtained from each necropsied animal. Tissues included liver, spleen, tonsil, heart, lung, kidney, mandibular, retropharyngeal, inguinal, popliteal, mesenteric, mediastinal, gastro-hepatic, splenic and renal lymph nodes, bone marrow, diaphragmatic muscle, and intra-articular tissues of joints. The carcasses of the dead animals were disposed of in accordance with standard procedures for animals housed at the biosecurity level required for this experiment.
2.5. Humane endpoints
The evolution of the disease was expressed in terms of a quantitative clinical score (CS) specific for ASFV infection in wild boar (Table 4). The CS was established following Gallardo et al. (2017. Transbound Emerg Dis. 2019; 66: 1399-1404) and Galindo-Cardiel et al. (2013 Virus Res; 173: 180-190) clinical evaluation guidelines for domestic pigs, but with slight modifications were established by four wildlife-specialist veterinarians based on previous and current studies (Cadenas-Fernandez et al. 2020 Pathogens. ;9(3):171), in order to obtain a more accurate and sensitive clinical observation of ASFV infection course in wild boar. This CS considers nine parameters (rectal temperature, behaviour, body condition, skin alterations, ocular/nasal discharge, joint swelling, respiratory symptoms, digestive symptoms, and neurological symptoms), the degree of severity of which is measured from 0 to 4 (most severe). All clinical observations were daily recorded, except temperature in order to minimize animal handling and stress.
Clinical evaluations were also substantial to ensure the welfare of the animals. The humane endpoint was pre-defined as animals with a CS > 18, and animals with severe clinical signs (level 4) of fever, behaviour, body condition, and respiratory and digestive signs for more than two consecutive days were also included, following the standards described (Cadenas- Fernandez et al. 2020 Pathogens. ;9(3):171). In addition, any animals undergoing unacceptable suffering without reaching the pre-defined humane endpoint were also euthanized based on veterinarian criteria.
2.6. Laboratory experimental procedures
2.6.1. Processing of samples
Samples were processed according to PE/002/SUAT-7 Standard Operating Procedure (VISAVET Intranet, UCM).
2.6.2. ASFV detection by real-time PCR DNA was extracted from blood and tissue samples using the High Pure PCR Template Preparation kit (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) according to FE-002-SUAT/04-4 (Standard Operating Procedures; VISAVET, UCM).
Amplification of the ASFV genomic DNA using undiluted extracted DNA for each sample was done using the Universal Probe Library (UPL) real-time PCR included in Chapter 3.9.1 of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (OIE 2021) and described in the FE-002-SUAT/05-7(Standard Operating Procedures; VISAVET, UCM).
2.6.3. Antibody detection by enzyme-linked immunosorbent assay (ELISA)
Detection of ASFV-specific antibodies was performed in serum a commercial ELISA test to detect specific antibodies against ASFV-p72 (INGEZIM PPA Compac K3, Ingenasa, Madrid, Spain).
2.7. Evaluation and interpretation of results
Descriptive statistics (means, standard deviations) were used to summarise the data.
For this, exploratory analyses of temperature, clinical sign (CS) values, antibody response, the load of ASF viral genome (viremia; Cq values) in blood was performed in order to calculate average ranges per group and sampling period and at 95% confidence intervals. The variations in these parameters between groups and among different periods were studied using the Mann-Whitney U test and the Kruskal-Wallis test, respectively. Relationships among continuous parametric variables, temperature, CS and Cq values were statistically performed using Spearman’s rank correlations. Outcomes were considered statistically significant at p < 0.05.
To assess the safety of the vaccine candidates, the CS score, survival rate, and viremia after vaccination and until challenge were used as key parameters.
To assess the efficacy of the vaccine candidates, the CS score, survival rate, and viremia from the challenge onwards were used as key parameters.
2.8. Validity of the test
The test was valid, because:
None of the animals had ASFV-specific antibodies on the day of vaccination.
- Animals in the control group demonstrated ASFV-related clinical signs and died post-challenge.
2.9. RESULTS
2.9.1. Safety
2.9.1.1. Clinical signs Clear differences were observed in study groups 1 , 2 and 3, 4 concerning clinical sign scores, as described in Figure 1. In the case of animals vaccinated with parental strain Lv17/WB/Rie1 (groups 3 and 4), light/mild clinical signs were observed. Concretely, in group 3 (animals vaccinated with the parental virus at 103), after the prime vaccination, two of the seven animals (28.6%) developed a slight fever (40.45 ± 0.35°C) and slight lethargy from 11 and 18 dpv, respectively. After the revaccination, these two, plus three more animals from this group, subsequently had a slight fever (40.50 ± 0.29°C) at 12 days post revaccination (25 - 39 dpv). Two of these animals had a slight fever on two consecutive sampling days, during which time slight lethargy was also observed in addition to fever. In group 4 (animals vaccinated with the parental virus at 104), after prime vaccination, three out of six animals (50%) developed a slight fever (40.15 ± 0.10°C) from 11 dpv, and this was observed on two consecutive sampling days. After the revaccination, one of these animals and another had a slight fever (40.10 ± 0.14°C) at 10 days post revaccination (25 - 32 dpv), and one of them also had slight lethargy (Figure 1). Moreover, one wild boar from this group had a high fever (41.5°C) at 14 days post revaccination (32 dpv) and had to be euthanized during the vaccination period, although the death of this animal was triggered after a highly aggressive fight inside the pen (as detailed in the next section).
In the case of both groups vaccinated with the mutant vaccine strain, clinical signs were no observed in the animals except for a slight fever (40.15 ± 0.10°C) on punctual days (Figure 2 and 4).
This CS considers nine parameters (rectal temperature, behaviour, body condition, skin alterations, ocular/nasal discharge, joint swelling, respiratory symptoms, digestive symptoms, and neurological symptoms), the degree of severity of which is measured from 0 to 4 (most severe). In terms of these parameters, groups 3 and 4 (parental virus) show higher values as compared to those in groups 1 and 2 (mutant vaccine strain).
2.9.1.2. Rectal temperatures
Figure 3 and Figure 4 represent the average rectal temperatures of animals per group during the study. While animals vaccinated with the parental virus showed slight increases of rectal temperature (values above 40.5°C), animals vaccinated with the mutant vaccine strain presented more stable temperatures.
2.9.1.3. Survival after vaccination
In groups 1 , 2 (vaccinated with the mutant vaccine strain) and 3 (vaccinated with the parental strain at low dose, 103) all the animals survived during the vaccination period. On the contrary, in group 4 (vaccinated with the parental virus at high dose, 104), one out of six animals died during the vaccination period as a consequence of a highly aggressive fight inside the pen. This fight resulted in multiple external injuries and the dislocation of the animal’s right hip. After this fight, the animal was treated in the pen in order to aid its recovery, but began to show signs of fever followed by lethargy and finally anorexia, until its euthanasia at 21 days post revaccination (39 dpv), with an ASF CS value of 10. The analysis of the samples obtained revealed the presence of ASFV viral DNA in blood and tissues.
2.9.1.4. Viremia
In the case of animals from groups 3 and 4 (vaccinated with the parental virus) two transient peaks of ASF viral genome detection in blood were generally observed in all the animals. The first peak was observed after the prime vaccination in five of the 13 animals (38.5%), while the second was observed after revaccination in 11 animals, which is in 84.6% of them (Figure 5). Furthermore, a direct correlation was observed between the viremia peaks and the increase in rectal temperature (Spearman’s rank, p< 0.05, r = - 0.37).
In the case of animals from group 1 (vaccinated with the mutant vaccine strain at 104) four out of six animals showed the presence of viremia with a peak at 12 dpv. In all the animals that presented viremia during the vaccination period, the virus was cleared off by 26 dpv (Figure 6).
In the animals from group 2 (vaccinated with the mutant strain at 102 and revaccinated with 104), three out of six animals presented punctual viremia with high Cq values (39.05 ± 0.5) after the prime vaccination. Five days after revaccination, three out of six animals presented viremia with a Cq value of 37.6 ± 2.3 that continued until the challenge. Another animal also showed viremia during this sampling (Figure 6).
2.9.1.5. Antibody response
In the case of animals vaccinated with the parental virus, antibody production seemed to be dependent on revaccination in the majority of the cases. Only two out seven animals from group 3 and one animal from group 4 presented antibodies in blood before revaccination. In group 3 (vaccinated with the parental virus at 103), all the animals showed antibodies in blood before the challenge, while only four out of six animals from group 4 (vaccinated with the parental virus at 104) did (Figure 7). There was a clear direct correlation between the start of a positive antibody response and the first detection of ASF viral genome (Spearman’s rank, r = 0.99; p< 0.05). Indeed, the animals from the group 4 in which viremia was not detected coincided with the two animals in this group in which no antibody response was detected.
In the case of the animals from group 1 (vaccinated with the mutant vaccine strain at 104), five out of six animals showed an antibody response before the challenge, starting between 9 and 16 dpv. The animal that did not have antibodies was the only animal that did not survive the challenge.
In animals from group 2 (vaccinated with the mutant strain at 102 and revaccinated with 104), only one animal presented antibodies before revaccination (starting at 12 dpv). Eleven days after revaccination with a higher dose, all the animals from this group presented antibodies (Figure 8). 2.10. Efficacy (post challenge)
2.10.1. Clinical Signs
During the challenge period, the average clinical scores and temperature were similar for all groups compared (Figure 9, 10, 11 and 12), although a slight increase of temperature was found in most animals from group 1 (vaccinated with the mutant strain at 104) at 5-7 days post-challenge. The challenge infection did not cause a clear increase in clinical sign scores in immunized animals, and they decline gradually towards the end of study.
2.10.2. Mortality Post Challenge
All the animals from group 3 (vaccinated with the parental virus at 103) were fully protected and survived the challenge with Arm07 10 HAD50 at 32 dpc (100% protective efficacy). However, two animals from group 4 (vaccinated with the parental virus at 104) did not have a positive antibody response during the vaccination period and did not survive after the challenge (60% protective efficacy in this group), and had ASF-compatible signs. The protection outcome for both groups of wild boar orally vaccinated and revaccinated with the parental Lv17/WB/Rie1 ASFV was, overall, 83.3%.
In contrast, five out of six animals in group 1 (vaccinated with the mutant vaccine strain at 104) and all the animals from group 2 (vaccinated with the mutant vaccine strain at 102 and revaccinated with 104) survived after challenge at 30/44dpv, achieving an 83.3% protective efficacy in group 1 and 100% in group 2. The overall protection for both groups vaccinated with the mutant vaccine strain was 91.66%. The percentage survival is depicted in Figure 13 and Figure 14.
2.10.3. Viremia
There were differences in the level of virus detected in blood post challenge within the study groups.
Results for individual groups are presented in Figures 15 and 16.
Transient viremias were detected in the survivor animals vaccinated with the parental Lv17/WB/Rie1 strain (groups 3 and 4) after the challenge (mean Cg value of 36.4 ± 2.0 in group 3 and 37.4 ± 2.0 in group 4). Only one animal from group 3 maintained constant viremia from 4 dpc until the end of the experiment, with a mean Cg value of 25.5 ± 0.8. In the case of the two animals from group 4 that did not survive the challenge, the Cg values were lower (19.3 ± 2.3).
In the case of animals from group 1 (vaccinated with the mutant vaccine strain at 104), constant viremias with low Cg values were detected in all the survivor animals after the challenge (mean Cg value of 24.06 ± 1.6), while only two animals from group 2 (vaccinated with the mutant vaccine strain at 102 and revaccinated with 104) showed viremia after challenge. In this group, one of them only had viremia on one day (Cq value of 35.91) while the other one had constant viremia (mean Cq of 31 .76 ± 4.9).
2.11. CONCLUSIONS
The following conclusions can be drawn from this study.
1. The mutant strain Lv17/WB/Rie1-ACD was safe to administer to wild boar and was safer in comparison to the wildtype parental strain Lv17/WB/Rie1 , as the clinical signs observed during the vaccination period in animals vaccinated with the mutant were slighter than those observed in the groups vaccinated with the parental virus.
2. The overall protection upon Arm07 challenge was slightly higher in animals vaccinated with the mutant vaccine strain, although animals vaccinated with a singledose of the mutant at 104 displayed constant viremias with low Cq values in comparison with the rest of the groups, including animals inoculated with the parental virus.
3. Overall, of the two different vaccination models evaluated with the mutant vaccine strain, vaccination with a low dose and revaccination with a higher dose seems to be the most promising vaccination model. However, further studies with different vaccination models should be conducted.
EXAMPLE 3: IN VIVO SAFETY STUDIES IN PIGS USING THE LIVE AFRICAN SWINE FEVER (ASF) VIRUS VACCINE STRAIN LV17/WB/RIE1-AEP402R-AEP153R
3.1. Study design
Thirteen (13) ASFV-free and ASFV antibody-free 12-week-old pigs were available for this study. Five animals each in group 1 and 2 received 100 TCID50 per animal of the vaccine via the intramuscular (IM) route. Group 1 was immunized with Lv17/WB/Rie1-ACD and group 2 with the parental strain Lv17/WB/Rie1. Three animals in group 3 served as unvaccinated controls. At 30dpi, animals in all 3 groups were challenged with 100 HAD50 of Armenia/07 (Arm07) via the IM route. See Table 5 for an overview of the groups and their treatment.
Blood samples were taken just before vaccination, and at 7, 12, 14, 19, 21 , and 28 days post vaccination, as well as just before challenge and 3, 6, 10, 13, 17, 20, 24, 27 and 31 days post challenge. Blood samples were investigated for the presence of ASFV by qPCR, and ASFV-specific antibodies by indirect immunoperoxidase test (I PT). Clinical signs were recorded daily and expressed with a quantitative clinical score obtained by adding values for eight clinical signs recorded on a daily basis.
Table 5: Overview of the groups and their treatment
3.2. MATERIALS AND METHODS
3.2.1. Test articles and challenge material
3.2.1.1. Live ASFV vaccine strains
Name strain 1 : Lv17/WB/Rie1-ACD
Titre: 4.8x107 TCID50/ml
Storage conditions: -80°C
Name strain 2: Lv17/WB/Rie1
Batch no. or reference: Na 15-F-20.B 2P PAM
Information: Barasona et al., 2019; Gallardo et al., 2019
Titre: 2.8x106 TCID50/ml
Storage conditions: -80°C
3.2.1.2. Preparation of inoculum
Dosing form: The challenge material contained a calculated amount of 100 HAD50 per dose of 1ml.
Preparation: Arm07 was diluted to 100 HADso/ml shortly before challenge. The challenge material was applied at ambient temperature.
3.2.2. Test system
3.2.2.1. Animals
Species: Pigs
Gender: Female
Age at vaccination: 12 weeks
Breed: European hybrid pigs
Number: 13
Microbiological status: Free of ASFV, Porcine reproductive and respiratory syndrome virus, and Pseudorabies virus. ASFV antibody-free. Animals were vaccinated 30 days after birth against Mycoplasma hyopneumoniae and Porcine circovirus (PCV2)
Source of pigs: Agropecuaria Divina Pastora Sat, Madrid, Spain
3.2.2.2. Acclimatisation period
Pigs had seven days of acclimatization between transportation to the animal facility and vaccination.
3.2.2.3. Inclusion and exclusion criteria
According to internal SOP, (SSB/02/ANIMALARIO/NCB3 and “Procedimiento animalario recep on animales”) a veterinarian examination was conducted prior introduction of animals into NCB3 facilities verifying the correct sanitary status of the animals. Afterwards, another veterinarian exploration was thoroughly conducted in order to identify any clinical signs and/or injuries (e.g., due to transportation. Only healthy animals were included in the study.
3.2.2.4. Identification and assignment to the treatment groups
Based on animal size and veterinary criteria, animals were homogeneously distributed into experimental groups. Subsequently, animals were randomly identified using individually numbered ear-tags
3.2.2.5. Husbandry
Pigs were housed in three separate boxes with five pigs per pen. Three unvaccinated pigs were included in an additional box. Drinking water was available ad libitum and growingfinishing pig feed formulation (commercial animal feed) was provided once per day @ 1.20kg of pig feed per animal. This feeding regime was done to quantify the feed consumption per group after both: vaccination and challenge. For animal welfare purposes, several toys specifically designed for swine, such as gumballs and biting chains were placed per pen. Cleaning of pens was conducted once per day according to internal SOP (“Procedimiento de cuidado de los animales, limpieza y desinfeccion de boxes”).
3.2.3. Treatment
After arrival, animals were treated with marbofloxacin at a dose of 8 mg/kg body weight in one shot by intramuscular (IM) route.
Animals in-group 1 and 2 were vaccinated with 100 TCID50 in the muscle on the right side of the neck with the corresponding vaccine (see Table 1).
At 30 days post vaccination all animals were challenged with 100 HAD50 of strain Arm07 via the IM route (see Table 1) in the left side of the neck. During the experiment and relative to the clinical signs, animals received non-steroidal anti-inflammatory drugs (NSAIDs), such as meloxicam, 0.4 mg/kg, IM route (MEL), diclofenac, 70 mg/animal, percutaneous route (DFN) or Flunixin meglumine, 2.2 mg/kg, IM, route (FM), the most common type of analgesic given to food animals to alleviate pain derived from joint inflammation and to treat pyrexia. Table 6 summarizes the treatment of pigs.
Table 6: Treatment schedule
3.2.4. Animal experimental procedures
3.2.4.1. Daily observations, rectal temperature measurements and clinical signs
Starting 1 day before vaccination until the end of the animal trial, each individual animal was observed daily for general health and ASFV-specific clinical signs. Clinical signs were recorded daily and expressed with a quantitative clinical score obtained by adding values for eight clinical signs recorded on a daily basis; fever parameters, anorexia, recumbence, skin haemorrhage or cyanosis, joint swelling, respiratory distress, ocular discharge, and digestive findings were assigned points on a severity scale of 0 to 3 (most severe). The sum of the points was recorded as the clinical score (CS), which was also used to define humane endpoints (see Table 7).
Table 7. List of clinical signs used to create the ASF clinical score
3.2.4.2. Sampling of blood
Blood-EDTA and serum samples were collected from each animal. Samples were taken just before vaccination, and at 7, 12, 14, 19, 21 and 28 days post vaccination, as well as just before challenge and 3, 6, 10, 13, 17, 20, 24, 27 and 31 days post challenge. Samples were collected according to the SOP of the European Union reference laboratory for ASF (EURL): SOP/CISA/ASF/SAMPLES/1/ (https://asf- referencelab.info/asf/images/ficherosasf/PROTOCOLOS-EN/SOP-ASF-SAMPLES- 1_REV5_2021.pdf) 3.2.4.3. Destination of the animals at the end of the study
Surviving animals were euthanized between 31 to 38 post challenges by pentobarbital sodium (300 mg/mL) as is described in Table 8. Blood-EDTA, sera and twenty-one different types of tissues and organs were obtained from each necropsied animal. Tissues included liver, spleen, tonsil, heart, lung, kidney, submandibular, retropharyngeal, inguinal, popliteal, mesenteric, mediastinal, gastro-hepatic, splenic and renal lymph nodes, bone marrow, diaphragmatic muscle, and intra-articular tissues of joints. The carcasses of the dead animals were disposed of in accordance with standard procedures for animals housed at the biosecurity level required for this experiment.
Table 8: Euthanasia schedule
3.2.5. Humane endpoints
Based on the severity of the clinical signs, zero to three score points were awarded per parameter described in the Table 7. The sum of points was recorded as the clinical score (CS). Animals reaching the humane endpoint of three subsequent days with severe fever or anorexia, prostration, respiratory distress, or digestive findings, or with sum of the eight CS >18, or were suffering unacceptably without reaching the endpoint score, were slaughtered.
3.2.6. Laboratory experimental procedures
3.2.6.1. Processing of samples
Samples were processed according to EURL- SOP/CISA/ASF/SAMPLES/1 (https://asf-referencelab.info/asf/images/ficherosasf/PROTOCOLOS-EN/SOP-ASF-
SAMPLES-1_REV5_2021.pdf)
3.2.6.2. ASFV detection by real time PCR
DNA was extracted from blood and tissue samples using the High Pure PCR Template Preparation kit (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) according to EURL-SOP /CISA/ASF/DNA EXTRACTION/1
(https://asf referencelab. info/asf/images/ficherosasf/PROTOCOLOS-
EN/2021_UPDATE/SOP-ASF-DNA-EXT RACTION-1_REV52021.pdf).
Amplification of the ASFV genomic DNA using undiluted extracted DNA for each sample was done using the Universal Probe Library (UPL) real-time PCR included in Chapter 3.9.1 of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (OIE 2021) and described in the EURL-SOP/CISA/ASF/PCR3.
(https://asf-referencelab.info/asf/images/ficherosasf/PROTOCOLOS- EN/2021_UPDATE/SOP-ASF- PCR-3-2021.pdf)
3.2.6.3. Antibody detection by indirect immunoperoxidase test (IPT)
Detection of ASFV-specific antibodies was performed in serum using the IPT included in Chapter 3.9.1 of the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (OIE 2021) and described in the EURL-SOP/CISA/ASF/IPT1
(https://asf-referencelab.info/asf/images/ficherosasf/PROTOCOLOS-EN/SOP-IPT- PLATES-1_rev2018.pdf).
The ASFV antibody titters were determined in all positive samples by end-point dilution.
3.2.7. Evaluation and interpretation of results
Descriptive statistics (means, standard deviations) were used to summarise the data.
To assess the safety of the vaccines, the clinical signs score, survival rate and ASFV viremia after vaccination and until challenge were used as parameters.
To assess the efficacy of the vaccines, the clinical signs score, survival rate and ASFV viremia from challenge onwards were used as parameters.
3.2.8. Validity of the test
The test was valid, because:
- None of the animals had ASFV-specific antibodies at the day of vaccination.
- Animals in the control group demonstrated ASFV-related clinical signs and died post challenge.
3.3. RESULTS
3.3.1. Safety (pre challenge)
3.3.1.1. Clinical signs
Clear differences were observed in the study groups 1 and 2 with respect to clinical signs and scores, as seen in Figure 17. In case of animals vaccinated with parental strain Lv17/WB/Rie1 (group 2), the clinical signs appeared at 5 dpi and increased to 13 points by day 12 post inoculation, and gradually reduced thereafter. In case of the mutant vaccine strain, animals were without clinical signs until 7dpi, after which they started showing a gradual but slow increase of clinical signs, but at 12 dpi scores reached only 3 in case of Lv17/WB/Rie1- ACD (group 1). While the parental strain had an average daily clinical score of 5.2, the mutant vaccine strain Lv17/WB/Rie1-ACD had an average clinical score of 2.46, indicating that was safer than the parental strain.
The severity of clinical signs per parameter is depicted in Figure 18. A score of 1 indicates a mild discomfort, 2 a moderate discomfort and a score of 3 indicates a sever discomfort to the animals. In terms of fever, anorexia, recumbence, swelling of joints, and respiratory distress, the severity of discomfort is more in case of the animals in group 2 as compared to those in group 1.
3.3.1.2. Rectal temperatures
Figure 19 represents the average rectal temperatures of animals per group per time point during the study. It is seen that while animals vaccinated with parental strain Lv17/WB/Rie1 (group 2) had increased rectal temperatures starting 2dpv, those vaccinated with the mutant strain did not show such an increase. In case of the animals vaccinated with parental strain, the temperatures gradually dropped after 14dpv and remained in the normal range thereafter even after challenge. Post challenge, only the unvaccinated animals had temperature readings beyond normal. These animals did not survive the study.
3.3.1.3. Survival after vaccination
Of the 5 animals in group 2, vaccinated with the parental strain, 1 pig died at 10dpi and one more at 18dpi, resulting in a survival rate of 60%. In contrast, all animals in groups 1 survived until they were challenged at 30dpi. The percentage survival is depicted in Figure 20.
3.3.1.4. Viremia
All 5 animals in group 2 vaccinated with the parental strain Lv17/WB/Rie1 had presence of virus in blood at 7dpi. At 7dpi the viremia was at its peak and the virus was gradually cleared from the animals such that there was no viremia at 28dpi (Figure 21a).
In case of animals in group 1 , vaccinated with mutant vaccine strain Lv17/WB/Rie1- ACD, only 2 of the 5 animals showed presence of viremia with a peak at 14 dpi. The reduction in viral load post 14dpi corresponded to the onset of ASFV-specific antibodies in blood. In both the animals, virus was cleared off by 28dpi (Figure 21b).
3.3.1.5. Antibody response
All domestic pig seroconverted at day 7 (parental) and at day 14 (mutant) (figures 22a and 22b).
3.3.2. Efficacy (post challenge)
3.3.2.1. Clinical Signs
At the time of challenge, the average clinical scores for group 2, vaccinated with the parental strain Lv17/WB/Rie1 , were lower as compared to those in animals vaccinated with mutant strain (Figure 23). The challenge infection did not cause a clear increase in clinical sign scores, and they decline gradually towards the end of study.
Severity of the individual parameters used to determine the clinical scores was also found to vary between the mutant vaccine strain and parental strain as seen in Figure 24. No or only mild anorexia, fever and recumbence were observed in any of the groups. Digestive findings were only observed in the group vaccinated with the mutant vaccine strain (group 1). Skin reddening, joint swelling, respiratory distress, and ocular discharge were more pronounced in the animals vaccinated with Lv17/WB/Rie1-ACD (group 1) followed by those vaccinated with Lv17/WB/Rie1 (group 2). The most pronounced distress was caused by the swelling of joints where the stress level was between mild to moderate in case of the mutant vaccine strain. Overall, it was seen that the severity of symptoms was less in the animals vaccinated with Lv17/WB/Rie1 than in those vaccinated with the mutant vaccine strain.
3.3.2.2. Mortality Post Challenge
In case of group 2, vaccinated with the parental strain, only 3 animals were challenged whereas in case of animals vaccinated with the mutant vaccine strain all the 5 animals in the group were challenged. All the challenged animals in these groups survived until the end of the study (Figure 25). In case of the control group (group 3), all animals were dead at 7dpc.
3.3.2.3. Viremia
There were differences in the level of virus detected in blood post challenge within the study groups. Results for individual groups are presented in Figure 26. Whereas no virus was detected post challenge in case of animals vaccinated with the parental strain, 4 of the 5 animals vaccinated in the group vaccinated with Lv17/WB/Rie1-ACD displayed viremia post Arm07 challenge.
3.4. CONCLUSIONS
The following conclusions can be drawn from this study.
1. The mutant vaccine strain Lv17/WB/Rie1-ACD was safe to administer to domestic pigs and was safer in comparison to the wildtype parental strain Lv17/WB/Rie1 . The mutant vaccine showed a significant decrease of the side effects after vaccination compared to the wildtype parental strain even at overdose as compared to the parental attenuated strain.
2. All both strains provided 100% protection upon Arm07 challenge, but animals vaccinated with the mutant displayed more (chronic) clinical signs (slight to mild) after challenge, and a peak of Arm07 viremia (1 out of the five pigs ) as compared to animals vaccinated with the parental strain.

Claims

1 . A live attenuated African swine fever virus (ASFV) characterized in that it comprises a modified form of the genome of the ASFV Lv17/WB/Rie1 strain in which the EP153R gene and the EP402R gene have been inactivated.
2. The attenuated ASFV according to claim 1 , wherein the inactivation of the EP402R gene results from a deletion of at least part of the EP402R gene.
3. The attenuated ASFV according to claim 2 wherein the deletion of EP402R gene affects the complete EP402R gene.
4. The attenuated ASFV according to any of claims 1 to 3 wherein the inactivation of the EP153R gene results from a deletion of at least part of the EP153R gene.
5. The attenuated ASFV according to claim 4 wherein the deletion of EP153R gene affects the complete EP153R gene.
6. The attenuated ASFV according to any of claims 1 to 5 wherein the inactivation of the EP402R gene and the inactivation of the EP153R gene results from a single deletion in the genome of the ASFV Lv17/WB/Rie1 strain.
7. The attenuated ASFV according to claim 6 wherein the inactivation of the EP402R gene and the inactivation of the EP153R gene results from a deletion from position 73812 to position 75385 of SEQ ID NO: 1 .
8. The attenuated ASFV according to any one of claims 1 to 7 wherein the EP153R gene and/or the EP402R gene are replaced by at least one heterologous gene.
9. The attenuated ASFV according to any one of previous claims, wherein the attenuated ASFV contains at least one heterologous gene or genes and wherein said at least one heterologous gene or genes is/are under the control of a promoter of an ASFV gene.
10. The attenuated ASFV according to claim 9 wherein the promoter is the promoter of the p72 gene.
11 . The attenuated ASFV according to any of claims 1 to 10 wherein the sequence of the genome of the ASFV Lv17/WB/Rie1 strain comprises the sequence of SEQ ID NO: 1.
12. The attenuated ASFV according to any of claims 1 to 11 wherein the genome of the recombinant ASFV comprises the sequence of SEQ ID NO: 2.
13. An immunogenic composition or a vaccine composition comprising the attenuated ASFV according to any of claims 1 to 12 and a pharmaceutically suitable carrier or excipient.
14. The immunogenic composition according to claim 13 wherein the immunogenic composition is formulated to be administrated intranasal, orally, subcutaneously, intradermal or intramuscularly, preferably intramuscularly.
15. A recombinant ASFV according to any claim 1 to 14 for use in the prevention or treatment of a disease caused by the infection by ASFV.
16. The recombinant ASFV for use according to claim 15 wherein the recombinant ASFV is used for the treatment of an infection by ASFV in swine or in wild boar.
17. The recombinant ASFV for use according to claim 15 or 16 wherein the recombinant ASFV is administered in a single dose.
18. The recombinant ASFV for use according to any of claims 15 to 17 wherein the effective dose is between about 10 median tissue culture infectious dose (TCIDso) to about 105 TCIDso.
19. The recombinant ASFV for use according to any of claims 15 to 18 wherein the effective dose in wild boars is between about 102 TCIDsoto about 104 TCID50.
20. The recombinant ASFV for use according to any of claims 15 to 18 wherein the effective dose in swine is between about 50 TCIDso to about 200 TCIDso, preferably about 100 TCIDso.
21. The recombinant ASFV for use according to any of claims 15 to 20 wherein the recombinant ASFV is administrated via intranasal, orally, subcutaneously, intradermal or intramuscularly. A polynucleotide comprising a first, second and third regions, wherein the first region comprises an expression cassette comprising an ASFV heterologous gene, wherein the first region is flanked by the second and third regions and wherein said second and third regions are the regions of the genome of the ASFV Lv17/WB/Rie1 strain which naturally flank the region of the ASFV genome comprising the EP402R gene and EP153R genes. The polynucleotide according to claim 22 wherein the second and/or third regions consist of about 1000 bp. The polynucleotide according to claims 22 or 23 wherein the heterologous gene is the eGFP gene. The polynucleotide according to any of claims 22 to 24 wherein the heterologous gene is under the control of the ASFV p72 promoter. A vector comprising the polynucleotide according to any one of claims 22 to 25. A host cell comprising the polynucleotide according to any one of claims 22 to 25, or the vector according to claim 26. A method for producing a recombinant African swine fever virus (ASFV) according to any of claims 1 to 14, the method comprising:
(i) modifying target cells by introducing a polynucleotide as defined in any of claims 22 to 25, infecting the cells with the Lv17/WB/Rie1 strain, and introducing means capable of creating a double strand DNA break in the genome of said attenuated ASFV strain within or at the vicinity of the region comprising the EP402R gene and EP153R gene,
(ii) maintaining the target cells under conditions adequate for the doublestrand DNA break in the ASFV genome to take place and to allow homologous recombination between the ASFV genome containing the DNA break and the second and third regions of the polynucleotide thereby resulting in the replacement of the region encoding the EP402R and EP153R genes by the first region within the polynucleotide introduced in step (i), and
(iii) recovering the recombinant ASFV from the supernatant and/or from the whole cell extract and selecting the ASFV virions which contain the reporter gene.
29. The method according to claim 28, wherein the target cell is a mammalian cell line.
30. The method according to claim 29 wherein the mammalian cell line is a macrophage.
31. The method according to any one of claims 28 to 30, wherein the means capable of creating a double strand break in the genome of said ASFV strain within or at the vicinity of the region comprising the EP402R and EP153R genes comprise a CRISPR/Cas system.
32. The method according to any of claims 28 to 31 , wherein the expression cassette forming part of the first region comprises a reporter gene which encodes a fluorescent protein.
33. The method according to claim 32, wherein the reporter gene is under the control of a constitutive promoter.
EP23809585.5A 2022-11-22 2023-11-21 Attenuated african swine fever virus and use thereof in vaccine compositions Pending EP4622666A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22462011 2022-11-22
PCT/EP2023/082518 WO2024110451A1 (en) 2022-11-22 2023-11-21 Attenuated african swine fever virus and use thereof in vaccine compositions

Publications (1)

Publication Number Publication Date
EP4622666A1 true EP4622666A1 (en) 2025-10-01

Family

ID=84982285

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23809585.5A Pending EP4622666A1 (en) 2022-11-22 2023-11-21 Attenuated african swine fever virus and use thereof in vaccine compositions

Country Status (3)

Country Link
EP (1) EP4622666A1 (en)
CN (1) CN120897756A (en)
WO (1) WO2024110451A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020049194A1 (en) 2018-09-03 2020-03-12 Universidad Complutense De Madrid (Ucm) Sus scrofa vaccine virus against african swine fever (armenia/07) and genotype ii derivatives)
PH12022552084A1 (en) * 2020-03-06 2024-02-26 Univ Kumamoto Vaccine against african swine fever virus infection

Also Published As

Publication number Publication date
WO2024110451A1 (en) 2024-05-30
CN120897756A (en) 2025-11-04

Similar Documents

Publication Publication Date Title
JP6763956B2 (en) Vaccine composition and its manufacturing method and use
CN106459931B (en) Attenuated African Swine Fever Vaccine
KR20210092762A (en) Immunogenic composition against African swine fever virus
TWI781962B (en) Vaccine against porcine parvovirus
JP7206383B2 (en) 4/91 IBV Vaccine with Heterologous Spike Protein
TW201610161A (en) CD2 deficient african swine fever virus as live attenuated or subsequently inactivated vaccine against african swine fever in mammals
US11013798B2 (en) Orf virus-based platform for vaccine delivery
JP7350864B2 (en) H52 IBV vaccine with heterologous spike protein
TW201828982A (en) Vaccine against porcine small virus and porcine reproductive and respiratory syndrome virus and preparation method thereof
AU2025267386A1 (en) Porcine circovirus type 3 (PCV3) vaccines, and production and uses thereof
TW202026010A (en) Intranasal vector vaccine against porcine epidemic diarrhea
CN119698293A (en) Recombinant porcine coronavirus
JP7046607B2 (en) Pestivirus vaccine against congenital tremor
EP3960850A1 (en) Attenuated african swine fever virus with deleted gene and use of same as vaccine
WO2024110451A1 (en) Attenuated african swine fever virus and use thereof in vaccine compositions
RU2725952C1 (en) Hev vaccine
JP7715831B2 (en) Pseudorabies virus vaccine
CN107164252A (en) A kind of RHDV subunit vaccine
JP2023543033A (en) Attenuated porcine epidemic diarrhea virus
WO2025073910A1 (en) A vaccine for protecting a piglet against african swine fever
TWI361695B (en) Pcv-2 vaccine
JP2026500740A (en) Live attenuated pseudorabies virus vaccine for pigs containing a deletion of gene UL23

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250520

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)