EP4622659A1 - Compositions, methods and uses of teneurin c-terminal associated peptides (tcap) as a peptide antagonist of corticotropin-releasing factor (crf) - Google Patents
Compositions, methods and uses of teneurin c-terminal associated peptides (tcap) as a peptide antagonist of corticotropin-releasing factor (crf)Info
- Publication number
- EP4622659A1 EP4622659A1 EP23892848.5A EP23892848A EP4622659A1 EP 4622659 A1 EP4622659 A1 EP 4622659A1 EP 23892848 A EP23892848 A EP 23892848A EP 4622659 A1 EP4622659 A1 EP 4622659A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- tcap
- crf
- peptide
- seq
- nos
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
Definitions
- TCAP TENEURIN C-TERMINAL ASSOCIATED PEPTIDES
- CRF CORTICOTROPIN-RELEASING FACTOR
- the present invention relates to compositions, methods and uses of Teneurin C- Terminal Associated Peptides (TCAP) (and/or TCAP agonists) as an antagonist of corticotropinreleasing factor (CRF), more particularly to CRF calcium flux activity.
- TCAP Teneurin C- Terminal Associated Peptides
- CRF corticotropinreleasing factor
- the invention provides a method of treating CRF-dependent or CRF-mediated disorders, such as mood disorders, such as anxiogenic and depressive conditions.
- TCAP teneurin C-terminal associated peptides
- TCAP-4 sequences 61, 62, 93 and 94 and their respective nucleic acid coding sequences: SEQ. ID. NOs: 41 , 42, 73, 74, 49, 50, 81 , 82, 57, 58, 89, 90, 65, 6, 97 and 98), the entirety of which is herein incorporated by reference.
- TCAP represents the distal extracellular tip of the teneurin transmembrane proteins (Baumgartner et al., 1994 [6]; Levine et al., 1994 [7]; Lovejoy et al., 2006 [3]).
- the peptide sequence can be located as a region of the larger teneurin proteins. Lovejoy et. al were the first to synthesize the 40-41 mer TCAPs and to identify its activity in isolation of teneurin and to optimize it. To date, a natural free soluble TCAP peptide has not been isolated or detected in any vertebrates or mammals.
- the synthetically prepared peptide is highly efficacious in vitro and in vivo (Woelfle et al., 2015[16] ; Hogg et al., 2018 [14]; Lovejoy and De Lannoy, 2013 [4]) in protochordates (D’Aquila et al., 2016 [99]), fish (Reid et al., 2020 [13]) and mammal (Hogg et al., 2018 [14]) models indicating that that the amino carboxyl terminal modifications utilized in the synthetic version of TCAP-1 is biologically efficacious.
- LPHN receptors are members of the adhesion G-protein coupled receptor (GPCR) family, they possess a phylogenetically conserved peptide binding region (Holz and Habener, 1998 [20]; Krasnoperov et al.
- Adhesion GPCRs are characterized by their highly conserved GPCR autoproteolysis-inducing (GAIN) domain, their large extracellular regions, and their complex signalling mechanisms which remain to be fully elucidated (Vizurraga et al., 2020 [27]).
- LPHN receptors are involved in cell-cell and cell-matrix adhesion (Hamann et al., 2015 [19]), and in a variety to tissue types, receptor activation has been shown to stimulate G-protein signalling and modulation of multiple intracellular signaling pathways (Paavola and Hall, 2012 [24]; Langenhan et al., 2013 [25]; Morgan et al., 2019 [26]; Vizurraga et al., 2020 [27]).
- CRF is recognized as the seminal neuropeptide responsible for the regulation of the organismal stress response in the central nervous systems (CNS), and for initiation of the hypothalamic-pituitary-adrenal/inter-renal (HPA/I) axis in vertebrates (Lovejoy and Balment, 1999 [79]; Hogg et al., 2017[118]; Inda et al., 2017 [90]), which is a main stress response system and neuroendocrine link between perceived stress and physiological reactions to stress (See Dunlavey, C. J. Undergrad Neuroscie Educ 2018 Spring, 16(2). R59 - R60). Elevated CRF signalling and the consequent dysregulation of the HPA/I axis has been implicated in the onset of affective disorders, including major depression and anxiety, panic disorder, and post-traumatic stress disorder.
- HPA/I hypothalamic-pituitary-adrenal/inter-renal
- the CRF1 receptor is primarily expressed in the central nervous system (CNS) with elevated expression in the cortex, cerebellum, hippocampus, amygdala, olfactory bulb, pituitary gland, and spinal cord (Potter et al., 1994 [105]; Chalmers et al., 1996 [106]; Palchaudhuri et al., 1998 [107]; Van Pett et al., 2000 [108]).
- CNS central nervous system
- CRF and the CRF1 receptor system are associated with activation of the sympathetic arousal system (e.g., increased heart rate and glycogenolysis) and inhibition of the parasympathetic system (e.g., growth, feeding and digestion) in vertebrates.
- the sympathetic arousal system e.g., increased heart rate and glycogenolysis
- the parasympathetic system e.g., growth, feeding and digestion
- the present invention provides a TCAP peptide (in some embodiments, teneurin c- terminal associated peptide-1 (TCAP-1 peptide)) and compositions comprising same for methods and uses for acting as a CRF antagonist.
- TCAP-1 peptide teneurin c- terminal associated peptide-1
- the invention provides that CRF antagonist is directed to inhibiting/modulating Ca 2+ flux activity.
- the inhibition/modulation of Ca 2+ flux activity is at one ore of the following: cytostolic, plasma member (PM), endoplasmic reticulum (ER) and/or mitochondrial (MT) Ca 2+ flux activity.
- the invention provides a method for: antagonizing CRF function or activity, such as CRF-1 or CRF-2, or preferably CRF-1 function; antagonizing CRF function or activity (such as CRF-1 or CRF-2, or preferably CRF-1 function or activity) independent of the respective CRF receptor; mediating cytosolic levels, such as decreasing, inhibiting calcium (Ca 2+ ) increase, or increasing calcium (Ca 2+ ) efflux from the cytosol, or in one embodiment, wherein such increase in cytosolic calcium is caused by CRF, such as CRF -1 or CRF-2 activity; mediating mitochondrial calcium (Ca 2+ ) levels, such as increasing, promoting calcium (Ca 2+ ) increase, or increasing calcium (Ca 2+ ) influx into mitochondria, or in one embodiment, wherein such decrease mitochondrial calcium is caused by CRF, such as CRF -1 or CRF-2 activity; and/or antagonizing CRF mediated physiological or organismal stress, comprising administering to
- the invention provides a use of TCAP, or therapeutically effect amount of TCAP or composition comprising same for antagonizing CRF function or activity, such as CRF-1 or CRF-2, or preferably CRF-1 function; antagonizing CRF function or activity (such as CRF-1 or CRF-2, or preferably CRF-1 function or activity) independent of the respective CRF receptor; mediating cytosolic levels, such as decreasing, inhibiting calcium (Ca 2+ ) increase, or increasing calcium (Ca 2+ ) efflux from the cytosol, or in one embodiment, wherein such increase in cytosolic calcium is caused by CRF, such as CRF -1 or CRF-2 activity; mediating mitochondrial calcium (Ca 2+ ) levels, such as increasing, promoting calcium (Ca 2+ ) increase, or increasing calcium (Ca 2+ ) influx into mitochondria, or in one embodiment, wherein such decrease mitochondrial calcium is caused by CRF, such as CRF -1 or CRF-2 activity; and/or antagonizing CRF mediated
- the cytosol or mitochondria is a kidney, pituitary or neuronal cell (such as a hypothalamic cell).
- TCAP brings the cell back to or helps the cell maintain homeostasis calcium cytosolic and/or mitochondrial levels, such as when it is not in the presence of CRF, such as CRF-1 activity.
- the teneurin c-terminal associated peptide-1 , 2, 3, or 4 (TCAP- 1 , TCAP-2, TCAP-3, TCAP-4 peptide), or a pharmaceutical composition comprising same in the methods and/or uses of the invention comprise or consist essentially of :(i) an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 38, 70, and 101 (TCAP-1 , 41mer); 46 and 78 (TCAP-2, 41 mer); 14, 22, 54, 86 (TCAP-3, 41 mer); 30, 62, and 94 (TCAP-4, 41mer) (or preferably SEQ. ID. NOs: 38 or 70); or SEQ. ID.
- TCAP-1 TCAP-1
- TCAP-2 TCAP-2
- TCAP-3 16, 15, 24, 23, 56, 55, 88, and 87
- TCAP- 4 TCAP- 4
- replacing the N- terminal amino acid of the TCAP -1 , 2, 3, or 4 peptide with a pyroglutamic acid such as any one of SEQ. ID. NOs: 7 - 12.
- the TCAP may be a pharmaceutically acceptable salt or ester thereof.
- the invention comprises administering or using a peptide of any one of SEQ. ID. NOs: 38 or 70 or a sequence comprising an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 38 or 70 or a species homolog thereof, wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (such as SEQ. ID NOs: 44 or 72); and/or (b) when the amino terminal amino acid of said TCAP peptide is glutamine, it is in some embodiments in the form of pyroglutamic acid.
- the natural N-terminal amino acid has been modified to be a pyroglutamic acid and in some embodiments is preferably having SEQ. ID. NOs: 7 or 8.
- the use or method is for a composition comprising any one or more of the aforementioned peptides.
- the invention provides a method for treating a condition associated with CRF mediated function, such as comprising: mood disorders, or CRF-dependent anxiogenic and depressive conditions.
- the present invention provides TCAP-1 or compositions comprising same for the therapeutic use in treating or preventing disorders associated with CRF expression and or function.
- the present invention provides a TCAP (e.g., TCAP-1 or TCAP-3 or a modified form thereof, such as SEQ. ID. NOs 7 or 8)) alone in a combination treatment for lessening, balancing or mediating CRF-activity, such as associated with certain disorders, such as mood disorders such as depression, stress or to regulate energy levels.
- CRF activity is the upregulation of Ca 2+ influx into cells and/or increased Ca 2+ in the cytosol of a cell, such as a neuronal cell, and in one embodiment a hypothalamic cell and the use of a TCAP of the present invention can mitigate or lessen or prevent or inhibit said up regulation.
- the CRF activity is the down regulation or decrease of Ca 2+ in the mitochondria or increase efflux of Ca 2+ from the mitochondria
- TCAP can mitigate, increase or prevent said down regulation or decrease of Ca 2+ in the mitochondria, or increase influx of Ca 2+ into the mitochondria.
- TCAP in some preferred embodiments TCAP-1 and TCAP-3 or the peptide of SEQ. ID. NOs 7 or 8, can be used to lessen, balance and/or mitigate the CRF CA 2+ influx response.
- the cells are neuronal cells, in one embodiment a hypothalamic cell.
- the patient or subject is a mammal. In some other embodiments, the mammal is selected from the group consisting of humans, dogs, cats, horses, sheep and cattle. In some embodiments the patient or subject is human.
- Figure 1 is a TCAP sequence summary table for mouse, human and G. Gallus, rainbow trout and zebrafish.
- FIG. 2 Effect of TCAP and Teneurin expression on N38 cells transfected with TCAP-based siRNAs.
- A N38 cells after transfection with either the pLuc negative control, or p270 and p721 siRNA containing plasmids. Scale bar: 50 pM.
- B Expression product of histone H3, TCAP 2, 3, and 4 and teneurin 2, 3, and 4 after transfection.
- FIG. 3 Reporter Activity of the cAMP Response Element (CRE) in 293T human embryonic kidney cells
- T reatments were given 4 hours prior to harvest. Experiment was done in triplicates and figure shown is representative of results from 3 separate experiments. CRF was used as a positive control. The mean ⁇ SEM is indicated. (* p ⁇ 0.05; **p ⁇ 0.01; ***p ⁇ 0.001)
- FIG. 4 Intracellular calcium flux by TCAP-1 and CRF in immortalized neurons.
- FIG. 5 Teneurin C-terminal associated peptide (TCAP)-1 antagonizes Corticotropin-Releasing Hormone (CRH)-mediated increases in cystolic calcium (Ca 2+ ) concentrations.
- B Overlay of summary data shown in A.
- FIG. 6 Teneurin C-terminal associated peptide (TCAP)-1 pre-treatment prevents Corticotropin-Releasing Factor (CRF)-mediated increases in calcium (Ca 2+ ) concentrations.
- B Summary graph of data shown in B for direct comparison of mean traces.
- FIG. 7 TCAP-1 -mediated Ca 2+ channel and transporter actions determined by antagonist interaction.
- A. TCAP-1 treatment (10m; 10nM) are indicated by Fluo-4 Ca 2+ activity in N38 cells with following antagonist treatment: I. Cells pretreated for 20m with ruthedium red (RuR; 50 pM ) followed by 10m treatment with RuR and TCAP-1 (100 nM), II. Cells pre-treated for 20m with benzamil (BZ; 100 pM) followed by 1 m treatment with BZ and TCAP-1 (100 nM), III. Cells pretreated for 20m with thapsigargin (TGX; 100 nM) followed by 10m treatment with TGX and TCAP-1 (100 nM). IV.
- TCAP-1 prevents CRF-induced depolarisation of the MT membrane potential (v).
- A Representative DIG and Rhodamine 123 (Rhod-123) fluorescence images of N38 neurons. Scale bar: 20 pm.
- C Summary graph of data shown in A.
- FIG. 10 TCAP-1 increases intracellular NADH and ATP levels in N38 cells.
- A Summary trace showing change in resorufin fluorescence over time following TCAP-1 (100 nM) or ACSF treatment.
- B Summary graph showing change in the rate of resorufin formation
- TCAPs 1-4 are four paralogous bioactive peptides located at the distal extracellular end of each teneurin transmembrane protein.
- ADGRL Stimulin
- GPCR adhesion G protein-coupled receptor
- the present invention include TCAP (such as TCAP-1 or TCAP-3) in a method or use for independent intracellular calcium actions, including in vitro embodiments.
- Corticotropin-releasing factor is a critical neuroendocrine peptide that regulates both the hypothalamic-pituitary-adrenal (HPA) axis as well as central stress-associated sensory input and integration.
- CRF is phylogenetically ancient, and evolved before the separation of protostomes and deuterostomes, more than 700 million years ago (Ayala et al., 1998 [119]).
- a candidate for this lineage is the ‘teneurin C-terminal associated peptide’ (TCAP) which likely evolved in the earliest basal metazoans.
- TCAP is a soluble peptide that acts on a receptor that is structurally related, but distinct from the CRF receptors. In vitro, TCAP administration blocks the CRF-dependent intracellular calcium flux to regulate mitochondrial activity.
- the present invention indicates that modified amidated TCAP - 1 (pyroglutamic acid at N-Terminal) act as an antagonist to CRF in vivo.
- TCAP-1 reduces cytosolic calcium concentrations by uptake into the mitochondria and efflux through the plasma membrane independently of the teneurins.
- the TCAPs such as TCAP-1 could inhibit the potential ‘stress’ -inducing actions of CRF and thus can be used to develop novel treatments regimes, compositions and methods for treating stress related or mood related disorders.
- the present invention may provide an ability to better manage such disorders, whether they may be mania or depression, by combination therapies that balance TCAP-1 (or TCAP-1 agonists) and CRF (or CRF agonists) in their treatment/management.
- the present invention provides a novel approach of identifying/developing treatments for such conditions, (i.e. by focusing on Ca 2+ flux activity).
- TCAP -1 antagonistic effects on CRF activity is independent of the CRF receptor.
- CRF does not antagonize or compete with TCAP-1 activity.
- TCAP-1 is activating down stream from CRF.
- TCAP teneurin C-terminal associated peptides
- TCAP is derived from the distal extracellular tip of the teneurin transmembrane proteins [3,6,7] which may be liberated auto-catalytically [8,9] or by an independent mRNA [10], Synthetic TCAP is highly efficacious, in vivo, in molluscs [11], protochordates [12], fish [13] and mammals [4, 14-16] to regulate aspects of the stress response.
- LPHN latrophilins
- ADGRL adhesion G-protein coupled receptor
- HBD hormone-binding domain
- LPHN activation stimulates G-protein signalling and modulation of multiple intracellular signaling pathways via their interaction with the teneurins [24-27], Alpha(a)- latrotoxin (aLTX), is a peptide component of the black widow venom that possesses primary structure homology to the Secretin family of peptides [20], By itself, aLTX, is associated with neurotransmitter release by a calcium (Ca 2+ )-dependent mechanism [21 , 28-30], however, it is not clear how this mechanism occurs [31], although it has been also implicated in mitochondrial (MT) function [32], LPHN-1 , is one of the endogenous receptors of aLTX [33,34], Previous studies with the TCAP region of teneurins indicate that it interacts with the HBD of the LPHNs [17,18], Because TCAP also possesses structural similarity to the aLTX and Secretin families of peptides [5], it is likely it also plays a role in intracellular Ca 2+ regulation
- Synthetic TCAP-1 decreases CRF-associated stress behaviours in a variety of studies including acoustic startle response [2], elevated plus-maze and open-field test [36,37] and cocaine reinstatement models [38-40], Moreover, TCAP-1 inhibits the CRF-mediated cfos expression in rat brain limbic regions [41], Recent studies indicate that TCAP-1 regulates MT activity in fish [13] and rodents [14] and stress activity in oysters [11], Together, these studies indicate that a fundamental mechanism of TCAP is to regulate energy metabolism.
- TCAP may interact with these receptors either through binding or regulating the Ca 2+ -associated CRF-mediated activation in hypothalamic neurons that express both the CRF1 and LPHN-1 receptors.
- the present studies of the invention have surprisingly shown that TCAP antagonizes CRF activity, independent of the CRF receptors (e.g., independent of binding with CRF receptors).
- the present invention provides a method/use of TCAP, such as TCAP-1 , to regulate intracellular Ca 2+ metabolism.
- TCAP-1 provides a novel method/use of TCAP-1 as an antagonist of the actions of CRF in neurons, and in particular its activity regarding cytosolic Ca 2+ flux.
- the present invention shows that TCAP-1 plays a role in CRF-associated energy metabolism using this route.
- the present invention in some aspects shows that although TCAP does not act directly with the CRF receptors, it antagonizes the down-stream (signal transduction) CRF-mediated Ca 2+ response, and in doing so, regulates MT (aerobic)-based energy metabolism in cells. This invention also shows that the intracellular actions of TCAP-1 are independent of the teneurins.
- Stress whether physiological, cellular, organismal, or psychological, is an organism's response to a stressor such as an environmental condition. It could be any condition that forces living systems away from their physiological steady state.
- stress is the body's method of reacting to a condition such as a threat, challenge or physical and psychological barrier. Stress can take many forms, and often manifests in changes at the cellular level. At the cellular level, a cellular there are generally four basic types of responses. The stressors can (1) induce cell repair mechanisms, (2) induce cell responses that result in temporary adaptation, (3) induce autophagy or (4) trigger cell death.
- Physiological Stress in one aspect is the disruption in an individual’s internal milieu or any external or internal condition that challenges the homeostasis of a cell or organism. It leads to activation of regulatory mechanisms that serve to restore homestasis. Examples may include starvation, noise, temperature changes and any condition that forces a living system away form a physiological steady state.
- Organismal Stress is the stress of an organism in response to changes in the environment that takes the organism away from homeostasis.
- “Homeostasis” in one aspect is the stae of steady internal, physical, chemical and social conditions maintained by living systems, that are optimal for their function and can include many variables, such as temperature, ionic concentrations (e.g., calcium, potassium, sodium, blood sugar) or fluid balance, or pH. In another aspect, it is mechanism or self-regulating process by which an organism tends to maintain stability while adjusting to conditions that best for its survival.
- ionic concentrations e.g., calcium, potassium, sodium, blood sugar
- fluid balance e.g., sodium, blood sugar
- TCAP Teneurin C-terminal associated peptides which are four (TCAPs-1-4) paralogous bioactive peptides having amino acid sequences located at the distal extracellular end of each teneurin transmembrane protein. They are generally peptides of 40- 41 mer amino acids, first described by Lovejoy et al and described in US Patent No. 8,088,889, which is herein incorporated by reference. In some preferred embodiments, they are the 41 amino acid peptide of the c-terminal end of the mouse or human Teneurin peptides (tenM1 - 4). There is considerable cross-species homology.
- CRF is associated with increased intracellular calcium flux, which is responsible for the release of neurotransmitters and neuromodulators, associated with endoplasmic reticulum stress, and mitochondrial activity as well as potential changes in the plasma membrane and mitochondrial membrane.
- TCAP-1 such as TCAP-1 - 4
- TCAP-1 is required for normal cellular growth and viability, such as in N38 cells.
- the invention provides TCAP for use in a method to maintain some aspects the invention provides TCAP for use in a method to maintain cell health, such as cell growth or cell viability;
- the peptide used is a salt, ester, solvate, polymorph or enantiomers of SEQ. ID. Nos: 38, 70 or 101, preferably SEQ. ID. NO: 38 or 70, or any amidated or pyroglutamic acid or amidated and pyroglutamic acid form thereof, such as SEQ. ID. Nos: 7 to 9, or in some embodiments, preferably SEQ. ID NOs: 7 or 8.
- conservative substitutions or modifications can be made to the peptide sequence which does not affect its structure or function and thus could be used for the present invention, such as various species homologs.
- species homologs such as the mouse, human or G. gallus TCAP-1 sequences (SEQ. ID. NOs. 38. 70 or 101 where the fifth amino acid may be selected from: Gly, Asn or Ser.
- the peptide has 95% identity to any one of SEQ. ID. Nos: 38, 70 or 101 or any one of their pyroglutamic acid N-terminal modified sequences (SEQ. ID. NOs: 7- 9).
- SEQ. ID. NOs: 7- 9 there is considerable cross-species homology.
- the invention is for the use of a nucleic acid molecule that encodes the respective TCAP and the induction of expression of TCAP within a cell comprising same to antagonize CRF activity.
- the teneurin c-terminal associated peptide-1 , 2, 3, or 4 (TCAP- 1 , TCAP-2, TCAP-3, TCAP-4 peptide), or a pharmaceutical composition comprising same in the methods and/or uses of the invention comprise or consist essentially of :(i) an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 38, 70, and 101 (TCAP-1 , 41mer); 46 and 78 (TCAP-2, 41 mer); 14, 22, 54, 86 (TCAP-3, 41 mer); 30, 62, and 94 (TCAP-4, 41mer) (or preferably SEQ. ID. NOs: 38 or 70); or SEQ. ID.
- TCAP-1 , 40mer TCAP-1 , 40mer
- TCAP-2, 40mer SEQ. ID. NOs: 13, 21 , 53 and 85 (TCAP-3, 40mer); 29, 61 and 93 (TCAP-4, 40mer); or, or a species homolog thereof; optionally wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (a TCAP with a c-amidation signal sequence selected from the group consisting of: SEQ. ID.
- TCAP-1 TCAP-1
- TCAP-2 TCAP-2
- TCAP-3 16, 15, 24, 23, 56, 55, 88, and 87
- TCAP- 4 TCAP- 4
- replacing the N- terminal amino acid of the TCAP -1 , 2, 3, or 4 peptide with a pyroglutamic acid such as any one of SEQ. ID. NOs: 7 - 12.
- the TCAP may be a pharmaceutically acceptable salt or ester thereof.
- the invention comprises administering or using a peptide of any one of SEQ. ID. NOs: 38 or 70 or a sequence comprising an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 38 or 70 or a species homolog thereof, wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (such as SEQ. ID NOs: 44 or 72); and/or (b) when the amino terminal amino acid of said TCAP peptide is glutamine, it is in some embodiments in the form of pyroglutamic acid.
- the natural N-terminal amino acid has been modified to be a pyroglutamic acid and in some embodiments is preferably having SEQ. ID. NOs: 7 or 8.
- the use or method is for a composition comprising any one or more of the aforementioned peptides.
- compositions of the invention refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., human).
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia (USP), National Formulary (NF), or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.
- Active Pharmaceutical Ingredients (APIs) of the present invention may be in the form of pharmaceutically acceptable salts.
- “Pharmaceutically acceptable salts” refers to those salts which possess the biological effectiveness and properties of the parent compound and which are not biologically or otherwise undesirable.
- compositions of the present invention may comprise one or more excipients.
- Excipients which may be used include carriers, surface active agents (surfactants), thickening (viscosity) agents, emulsifying agents, binding agents, dispersion or suspension agents, buffering agents, penetration-enhancing agents, solubilizers, colorants, sweeteners, flavoring agents, coatings, disintegrating agents, lubricants, preservatives, isotonic agents, and combinations thereof.
- surfactants surface active agents
- viscosity agents viscosity agents
- emulsifying agents binding agents, dispersion or suspension agents
- buffering agents penetration-enhancing agents
- solubilizers solubilizers
- colorants colorants
- sweeteners flavoring agents
- coatings disintegrating agents
- lubricants preservatives
- isotonic agents and combinations thereof.
- carrier applied to pharmaceutical compositions of the invention refers to a diluent, excipient, or vehicle with which an active compound is administered.
- Such pharmaceutical carriers can be liquids, such as water, saline solutions, aqueous dextrose solutions, aqueous glycerol solutions, and lipids and oils, including those of petroleum, animal, vegetable or synthetic origin. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin, 18. sup. th Edition.
- the composition can comprise TCAP as described herein, such as any one of SEQ. ID. NOs: 7-12 or preferably SEQ. ID. NOs: 7 or 8 and one or more other active therapeutic ingredients (API) for the same or another or analogous condition, such as other anti-stress, anti-depression or other CRF antagonists.
- TCAP as described herein, such as any one of SEQ. ID. NOs: 7-12 or preferably SEQ. ID. NOs: 7 or 8 and one or more other active therapeutic ingredients (API) for the same or another or analogous condition, such as other anti-stress, anti-depression or other CRF antagonists.
- API active therapeutic ingredients
- the dosage form is a subcutaneous dosage form. This differs from direct administration to the brain, amygdala, or Intracerebroventricular (“ICV”). Subcutaneous administration has many advantages over direct administration to the brain.
- the composition dissolves an amidated and pyroglutamic acid form of TCAP in a saline solution and is subcutaneously administered into animals (not ICV or amygdala). This formulation has advantages over prior forms for delivery, i.e., ICV or amygdala, in that it does not require additional sedatives, or the like for administration.
- compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient(s).
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- Compositions of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
- TCAP-1 and the pharmaceutical compositions of the invention are used to antagonize CRF function in an animal, in some embodiments mammals, including but not limited to humans, dogs, cats, horses, sheep, cattle.
- TCAP (such as TCAP-1) and the pharmaceutical compositions comprising same can modulate, or reduce, CRF-induced Ca 2+ influx.
- the TCAP (such as TCAP-1) and pharmaceutical compositions comprising same of the present invention can be used modifying CA 2+ flux. In other embodiments can be used to modify CA 2+ flux in the PM, ER, or MT.
- TCAP-1 can be used alone or in combination with CRF (and/or other CRF Agonists/Antagonists, and/or other TCAP agonists or antagonists to control cytosolic and mitochondrial calcium levels, or to control treatments or to modify of balance treatment regimens of mood disorders, such as anxiogenic or depressive or manic conditions.
- TCAP-1 is a CRF antagonist. Yet, CRF does not affect TCAP-1 activity.
- mice TCAP-1 The sequence of the mouse TCAP-1 was determined by examining the carboxy terminal exon region of mouse teneurin-1 (accession number: NM011855). Synthetic TCAP-1 was synthesised at 95% purity on an automated peptide synthesiser, Model Novayn Crystal (NovaBiochem Ltd, Nottingham, UK) on PEG-PS resin using continuous flow Fmoc chemistry (Calbiochem-Novabiochem Group, San Diego, CA, USA).
- the DMF was purified in-house and used fresh each time as a solvent for the synthesis.
- the cleavage/deprotection of the final peptide was carried out with trifluoroacetic acid (TFA), thioanisole, 1 ,2 ethandithiol, m-cresole, triisopropylsilane and bromotrimethyl silane (SigmaAldrich) at a ratio of 40:10:5:1 :1 :5.
- TFA trifluoroacetic acid
- thioanisole 1,2 ethandithiol
- m-cresole triisopropylsilane
- bromotrimethyl silane SigmaAldrich
- a scrambled TCAP-1 analogue (Sc-TCAP-1) was synthesised (SEQ. ID. NO: 130) using the same process as described above. Both peptides were synthesised by the American Peptide Company (Thermo Fisher Scientific, Sunnyvale, CA, USA).
- the Sc-TCAP-1 peptide contained the same amino acids as rat/mouse TCAP-1 (sequence: pEQLLGTGRVQGYDGYFVLSVEQYLELSDSANNIHFMRQSEI-NH2) (SEQ. ID.
- TCAP- 1 and ScTCAP-1 were dissolved at 1 mg/pL in water with an ammonium hydroxide vapor puff. The scTCAP-1 was added to the vehicle unless otherwise stated.
- siRNA oligonucleotides used to knock down teneurin and TCAP expression are noted in Tables. 1 B.
- the 270 oligonucleotide is designed to knockdown mouse TCAPs 1-4 although has reduced homology with TCAP-3 (SEQ. ID. NOs. 1 - 2).
- the 721 oligonucleotide was designed to be more specific to mouse TCAP-3. (SEQ. ID. NOs: 3 and 4).
- the negative control oligonucleotides. SEQ. ID. NOs: 5 and 6).
- Immortalized mouse embryonic hypothalamic cells (mHipp-E14 and mHypoE-38 cells; Belsham et al., 2004 [45]) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat inactivated foetal bovine serum (FBS;Gibco). Cells were cultured in 100 x15 mm petri dishes and maintained at 60%-70% confluency in a humidified CO2 incubator at 5% CO2 and 37°C. For fluorescence experiments, cells were grown on 6-well laes on poly-D- lysine (50 pg/mL) coated 25 mm round No. 1 glass coverslips (Warner Instruments, Hamden, CT, USA) and cultured for 2-4 days prior to experimentation. Cells were serum starved for 3 hours before the start of experimental treatments;
- Mouse anterior pituitary AtT-20/D16v-F2 cells (ATCC, Manassas, VA, USA) cells were also grown in 6-well plates on poly-D-lysine (50 pg/mL) coated 25 mm round No. 1 glass coverslips and were cultured in DMEM containing 4 mM L-glutamine, 4500 mg/L glucose, 1 mM sodium pyruvate, and 1500 mg/L sodium bicarbonate (ATCC), supplemented with 10% FBS (Gibco) and maintained in a humidified incubator supplied with 5% CO2-95% air at 37°C. The HEK-293T cell line was used for transfection of the CRF receptors.
- SiRNA sequences for TCAP (terminal exon) and the negative controls were synthesized by Genosys Inc., annealed, phosphorylated and cloned into pLKO.I puro (Sigma) (Fig. 1).
- SiRNA 270 was designed to recognize TCAP 2,3,4 and siRNA 721 to TCAP 3. Both siRNAs were co- transfected with a puromycin resistant gene.
- the lentiviruses were packaged in the HEK-293T cells using Mission Lentiviral packaging mix plasmids (Sigma). 48h later, filtered supernatants with viral particles were transferred to N38 cells and incubated with 8pg/ml hexadimethrine bromide (Sigma) for 16h.
- TCAP-1 The agonist and antagonist actions by TCAP-1 on Ca 2+ flux by CRF1 and CRF2 receptors were determined commercially by Millipore Inc. (Sigma-Aldrich Chemical Co.). TCAP- 1 was run in duplicate at final concentrations of 1 pM and 100nM in agonist and antagonist assay modes. The percentage activation was calculated relative to the FLIPR signal with ligand at Emax. Percentage inhibition was calculated relative to ligand induced FLIPR signal at 2x EC50 concentration where the signal to noise ratio of the control ligand in FLIPR assay was greater than 5-fold. The signal was established with 2 x EC50 ligand stimulation, whilst the background was established in buffer with no ligand in both additions.
- Mitochondrial calcium measurements Changes in mitochondrial (MT) Ca 2+ levels were assessed using the fluorescent indicator Rhodamine-2-AM (Rhod-2) (Table 2). N38 cells were loaded with Rhod-2 by incubating coverslips in DMEM containing 4pM Rhod-2 (from a 1 mM stock solution in DMSO with 20% pluronic; Invitrogen - PluronicTM F-127) for 30m at 22°C. It was subsequently washed in fresh dye-free physiological saline for 30 min at RT. Rhod-2 was excited with a wavelength of 552 nm for 100 ms every 30s and fluorescence emission was measured at wavelength of 577 nm.
- Rhod-2 was excited with a wavelength of 552 nm for 100 ms every 30s and fluorescence emission was measured at wavelength of 577 nm.
- Changes in MT Ca 2+ were measured by assessing fluorescent change in a region of interest (ROI) taken from the cell body (not the nucleus). The average change in Rhod- 2 fluorescence of 5 neurons per coverslip were used as a single replicate with 6 coverslips examined.
- ROI region of interest
- NADH turnover in N38 cells was assessed using a resazurin assay.
- N38 cells were seeded at 10,000/well in 96-well plates.
- the resazurin assay began the following day by adding the resazurin solution (525 nM, Sigma) to all the wells. Cells were treated with either vehicle or TCAP-1 (100 nM). Fluorescent readings were measured every 5m over 1 h, with excitation at 530 nm and emission read at 590 nm. Measurements of blank wells that contained no cells were subtracted from all readings.
- TCAP-1 100 nM
- CRF 100 nM
- EXAMPLE 1 siRNA KNOCKDOWN OF TENEURIN AND TCAP
- CRF treatment at 10' 9 M significantly increased activation of the cAMP response element above basal conditions via CRF receptor 1 (R1) (Fig. 3A) and CRF receptor 2 (R2) (Fig. 3B).
- Results were analyzed using a one-way analysis of variance (p ⁇ 0.0001). The results confirm the validity of the assay and that CRF activates the CRE via the CRF receptor.
- TCAP- 1 alone had no effect on CRE activation via CRF R1 or R2 compared to basal conditions and, moreover, when TCAP-1 and CRF were added together , it did not have a modifying action on the CRF-induced CRE response.
- the results suggest that TCAP-1 does not modify the CRF- induced activation of CRE.
- TCAP-1 did not reduce the Ca 2+ response with respect to the FLIPR analyses when administered to the CRF receptors.
- TCAP-1 showed no agonism of the CRF1 receptor with a value of -0.6 ⁇ 0.1% and 0.1 ⁇ 0.6% for the CRF1 receptor at 1 and 100 nm, respectively.
- TCAP-1 TCAP AND CRF MODULATES INTRACELLULAR CALCIUM (Ca 2+ ) FLUX
- TCAP can inhibit the CRF- mediated rise in intracellular Ca 2+
- CRF does not inhibit the TCAP-1-mediated decrease in intracellular Ca 2+ .
- the next goal was to identify the Ca 2+ channels targeted by TCAP.
- the general identification of the Ca 2+ channels targeted by TCAP-1 was established using a number of pharmacological blocking agents (Table 2).
- the endoplasmic reticulum (ER) plays a critical role in cell Ca 2+ regulation and a high ER Ca 2+ concentration is primarily the result of activity of the sarco/endoplasmic reticulum Ca 2+ - ATPase (SERCA) pump.
- SERCA sarco/endoplasmic reticulum Ca 2+ - ATPase
- TCAP-1 could decrease intracellular Ca 2+ by stimulating SERCA pump activity.
- cells were treated with the SERCA pump inhibitor, thapsigargin (TGX), for a total of 20m prior to TCAP-1 treatment (Fig. 7A-III; B,C).
- TCAP-1 may also act on MT Ca 2+ channels in addition to PM sites.
- Rhod-2 was used to determine whether MT Ca 2+ levels change with TCAP-1 .
- Rhod-2 fluorescence increases in intensity when bound to Ca 2+ .
- TCAP-1 can prevent CRF-mediated changes in MT Ca 2+ levels.
- cells were pre-treated with TCAP-1 prior to a 10 min. CRF treatment.
- AtT-20 cells were used as an alternative cell model (see Discussion). AtT-20 cells originate from the anterior pituitary, have been utilized in previous electrophysiology studies, respond to CRF and secrete ACTH (See Discussion). A PCR screen confirmed the presence of CRF1 receptors in these cells along with the expression of teneurins 1-3, TCAPs 3 and 4 and the putative receptors of teneurins and TCAPs, latrophilins-1 and -3 (Fig. 11 A).
- Neurexin I alpha is a major alpha-latrotoxin receptor that cooperates in alpha-latrotoxin action. J Biol Chem 273 (1998):1705-1710. doi: 10.1074/jbc.273.3.1705.
- TCAP corticotropin-releasing factor
- TCAP Teneurin C-terminal associated peptide
- TCAP Teneurin C-terminal associated peptide-1 attenuates corticotropin-releasing factor (CRF)-induced c-Fos expression in the limbic system and modulates anxiety behavior in male Wistar rats.
- CRF corticotropin-releasing factor
- CALHM1 Calcium homeostasis modulator 1
- CALHM1 Calcium homeostasis modulator 1
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Gastroenterology & Hepatology (AREA)
- Public Health (AREA)
- Biochemistry (AREA)
- Marine Sciences & Fisheries (AREA)
- Toxicology (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Biomedical Technology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to compositions, methods and uses of Teneurin C-Terminal Associated Peptide (TCAP) as an antagonist of corticotropin-releasing factor (CRF). In some other embodiments the invention relates to methods and uses of TCAP to regulate cytosolic and mitochondrial calcium levels, such as mediate, control elevated cytosolic calcium levels or low mitochondrial calcium levels or efflux of calcium from the mitochnodria, such as that may be the result of CRF activity. In other aspects the invention provides a method of treating CRF- dependent or mediated conditions or symptoms by using or administering TCAP.
Description
COMPOSITIONS, METHODS AND USES OF TENEURIN C-TERMINAL ASSOCIATED PEPTIDES (TCAP) AS A PEPTIDE ANTAGONIST OF CORTICOTROPIN-RELEASING FACTOR (CRF)
CROSS - REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. provisional patent application Ser. No. 63/428,021 , filed November 25, 2022, which is herein incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to compositions, methods and uses of Teneurin C- Terminal Associated Peptides (TCAP) (and/or TCAP agonists) as an antagonist of corticotropinreleasing factor (CRF), more particularly to CRF calcium flux activity. In other aspects the invention provides a method of treating CRF-dependent or CRF-mediated disorders, such as mood disorders, such as anxiogenic and depressive conditions.
BACKGROUND OF THE INVENTION
[0003] The teneurin C-terminal associated peptides (TCAP) (Qian et al., 2004 [1]; Wang et al., 2005 [2]; Lovejoy et al., 2006 [3]) are 40-41 residues in length and have sequence similarity to the secretin, calcitonin and corticotropin-releasing factor (CRF) families of peptides (Lovejoy et al., 2006 [3], Lovejoy and De Lannoy, 2013 [4]; Michalec et al., 2020 [5]). The TCAP sequences were first identified by Lovejoy et. al. as described in WQ/2003/093305 (PCT/CA03/00622), published on November 13, 2003 (also see Sequence Listing of the publication, SEQ. ID. NOs: 1 - 136, more particularly the teneurin 1 - 4 sequences (SEQ. ID. NOs. 4 - 13) and the 40 and 41 amino acid sequences of TCAPs 1 - 4 (TCAP-1 sequences: SEQ ID. NOs: 37, 38, 69, 70; TCAP -2 sequences: SEQ. ID. NOs: 45, 46, 77 and 78; TCAP-3 sequences: SEQ. ID. NOs. 53, 54, 85 and 86; TCAP-4 sequences: 61, 62, 93 and 94 and their respective nucleic acid coding sequences: SEQ. ID. NOs: 41 , 42, 73, 74, 49, 50, 81 , 82, 57, 58, 89, 90, 65, 6, 97 and 98), the entirety of which is herein incorporated by reference. Unlike the secretin superfamily of peptides, TCAP represents the distal extracellular tip of the teneurin transmembrane proteins (Baumgartner et al., 1994 [6]; Levine et al., 1994 [7]; Lovejoy et al., 2006 [3]). Although the peptide sequence can be located as a region of the larger teneurin proteins, Lovejoy et. al were the first to synthesize the 40-41 mer TCAPs and to identify its activity in isolation of teneurin and to optimize it. To date,
a natural free soluble TCAP peptide has not been isolated or detected in any vertebrates or mammals.
[0004] The synthetically prepared peptide is highly efficacious in vitro and in vivo (Woelfle et al., 2015[16] ; Hogg et al., 2018 [14]; Lovejoy and De Lannoy, 2013 [4]) in protochordates (D’Aquila et al., 2016 [99]), fish (Reid et al., 2020 [13]) and mammal (Hogg et al., 2018 [14]) models indicating that that the amino carboxyl terminal modifications utilized in the synthetic version of TCAP-1 is biologically efficacious.
[0005] Evidence indicates that the physiological actions of TCAP, primarily TCAP-1 and TCAP-3 are transduced by the latrophilin (LPHN) receptors (Husic et al., 2019[17]). LPHN receptors are members of the adhesion G-protein coupled receptor (GPCR) family, they possess a phylogenetically conserved peptide binding region (Holz and Habener, 1998 [20]; Krasnoperov et al. [21], 1999; Silva et al., 2011 [18]; Husic et al., 2019 [ 17]), and they are closely related to the secretin family of GPCRs (Fredricksson et al., 2003 [23]; Lovejoy et al., 2014 [44]; Michalec et al., 2020 [5]). Adhesion GPCRs are characterized by their highly conserved GPCR autoproteolysis-inducing (GAIN) domain, their large extracellular regions, and their complex signalling mechanisms which remain to be fully elucidated (Vizurraga et al., 2020 [27]). LPHN receptors are involved in cell-cell and cell-matrix adhesion (Hamann et al., 2015 [19]), and in a variety to tissue types, receptor activation has been shown to stimulate G-protein signalling and modulation of multiple intracellular signaling pathways (Paavola and Hall, 2012 [24]; Langenhan et al., 2013 [25]; Morgan et al., 2019 [26]; Vizurraga et al., 2020 [27]).
[0006] CRF is recognized as the seminal neuropeptide responsible for the regulation of the organismal stress response in the central nervous systems (CNS), and for initiation of the hypothalamic-pituitary-adrenal/inter-renal (HPA/I) axis in vertebrates (Lovejoy and Balment, 1999 [79]; Hogg et al., 2017[118]; Inda et al., 2017 [90]), which is a main stress response system and neuroendocrine link between perceived stress and physiological reactions to stress (See Dunlavey, C. J. Undergrad Neuroscie Educ 2018 Spring, 16(2). R59 - R60). Elevated CRF signalling and the consequent dysregulation of the HPA/I axis has been implicated in the onset of affective disorders, including major depression and anxiety, panic disorder, and post-traumatic stress disorder.
[0007] Synthetic TCAP has been shown to decrease CRF-associated stress behaviours in a variety of behavioural studies including, acoustic startle response (Wang et al. , 2005 [2]), elevated plus maze and open-field test (Al Chawaf et al., 2007 [36]; Tan et al., 2008 [37]) and cocaine reinstatement models (Kupferschmidt et al., 2011 [39]). However, it was not known what, the mechanistic relationship was, if any, between TCAP and CRF.
[0008] In vertebrates, there are two highly homologous CRF receptor subtypes: the CRF receptor 1 (CRFi) and CRF receptor 2 (CRF2). These receptors belong to the class B family of GPCRs (Dautzenburg and Hauger, 2002 [42]), and even though they are both activated by CRF the two receptors differ in their expression pattern and by their ligand selectivity (Dautzenberg and Hauger, 2002 [42]; Steckler and Dautzenberg, 2006 [43]). An additional component of the CRF system is the secreted CRF-binding protein (CRF-BP). The role of the binding protein is unclear; however, one function might be to modulate the bioavailability of CRF-like peptides (Stinnett et al., 2015 [103]).
[0009] The CRF1 receptor is primarily expressed in the central nervous system (CNS) with elevated expression in the cortex, cerebellum, hippocampus, amygdala, olfactory bulb, pituitary gland, and spinal cord (Potter et al., 1994 [105]; Chalmers et al., 1996 [106]; Palchaudhuri et al., 1998 [107]; Van Pett et al., 2000 [108]). The CRF1 receptor can signal through multiple G-alpha (Go) subunits, including Gs, Goo, Gq/n, Gii/2, and Gz (Grammatopoulos et al., 2001 [109]), however, the Gs (stimulatory) protein subunit and activation of the adenylate cyclase-PKA pathway is the primary signal transduction pathway activated by CRF binding to the CRF1 receptor (Chen et al., 1993 [110]; Olianas et al., 1995 [111]). In general, the action of CRF is associated with cellular and organismal homeostasis with respect to regulation of energy metabolism and the related diuretic requirements of an animal in response to physiological and environmental stress (Lovejoy, 2012 [112]; Janssen and Kozicz, 2013 [113]; Lovejoy and De Lannoy, 2013 [4]).
[0010] Fundamentally, CRF and the CRF1 receptor system are associated with activation of the sympathetic arousal system (e.g., increased heart rate and glycogenolysis) and inhibition of the parasympathetic system (e.g., growth, feeding and digestion) in vertebrates.
[0011] Activation of the CRF1 receptor can stimulate the phospholipase C (PLC)/inositol triphosphate (I P3) and the protein kinase A (PKA)/cyclic AMP signalling pathways (Dautzenberg et al., 2004[114]; Gutknecht et al., 2010 [115]; Riegel and Williams, 2007 [116]). Both these pathways elevate intracellular calcium and can contribute to calcium-mediated vesicular release. LPHN1 receptor activation has also been shown to modulate the PKA pathway, however depending on the cell system and interacting proteins, activation of LPHN signalling can increase (Muller et al., 2015;[117] Silva et al., 2011 [18]), or decrease (Li et al., 2018 [8]) intracellular cAMP. In hypothalamic cells, TCAP decreases intracellular cAMP accumulation by 40% (Wang et al., 2005 [2]).
[0012] There have been interest in corticotropin releasing hormone antagonists for alleviating symptoms of General Anxiety Disorder or suppressing anxiety-associated behaviours and
exploratory behaviour under stressful situations. However, these antagonists which have been directed to block the CRF-1 receptor have had limited results.
[0013] There is a need to better understand the relationship between TCAP and CRF activity (including CRF activity and CRF receptor activity) and actions. Further, there is a need to understand the role of calcium in CRF activity, particularly with its actions on mitochondria and energy regulation. There is a need to know if TCAP could prevent calcium associated CRF- mediated vesicular release in hypothalamic neurons, such as in neurons that express both the CRF1 receptor and LPHN receptors. There is a further need for CRF antagonists and for methods and uses thereof in the design and implementation of treatments of CRF activity-related conditions and/or symptoms.
SUMMARY OF THE INVENTION
[0014] The present invention provides a TCAP peptide (in some embodiments, teneurin c- terminal associated peptide-1 (TCAP-1 peptide)) and compositions comprising same for methods and uses for acting as a CRF antagonist. In some aspects, the invention provides that CRF antagonist is directed to inhibiting/modulating Ca2+ flux activity. In some aspects, the inhibition/modulation of Ca2+ flux activity is at one ore of the following: cytostolic, plasma member (PM), endoplasmic reticulum (ER) and/or mitochondrial (MT) Ca2+ flux activity.
[0015] In some embodiments, the invention provides a method for: antagonizing CRF function or activity, such as CRF-1 or CRF-2, or preferably CRF-1 function; antagonizing CRF function or activity (such as CRF-1 or CRF-2, or preferably CRF-1 function or activity) independent of the respective CRF receptor; mediating cytosolic levels, such as decreasing, inhibiting calcium (Ca2+ ) increase, or increasing calcium (Ca2+) efflux from the cytosol, or in one embodiment, wherein such increase in cytosolic calcium is caused by CRF, such as CRF -1 or CRF-2 activity; mediating mitochondrial calcium (Ca2+ ) levels, such as increasing, promoting calcium (Ca2+ ) increase, or increasing calcium (Ca2+) influx into mitochondria, or in one embodiment, wherein such decrease mitochondrial calcium is caused by CRF, such as CRF -1 or CRF-2 activity; and/or antagonizing CRF mediated physiological or organismal stress, comprising administering to a patient or subject in need thereof TCAP or a therapeutically effective amount of TCAP, or composition comprising same. In another embodiment the invention
provides a use of TCAP, or therapeutically effect amount of TCAP or composition comprising same for antagonizing CRF function or activity, such as CRF-1 or CRF-2, or preferably CRF-1 function; antagonizing CRF function or activity (such as CRF-1 or CRF-2, or preferably CRF-1 function or activity) independent of the respective CRF receptor; mediating cytosolic levels, such as decreasing, inhibiting calcium (Ca2+ ) increase, or increasing calcium (Ca2+) efflux from the cytosol, or in one embodiment, wherein such increase in cytosolic calcium is caused by CRF, such as CRF -1 or CRF-2 activity; mediating mitochondrial calcium (Ca2+ ) levels, such as increasing, promoting calcium (Ca2+ ) increase, or increasing calcium (Ca2+) influx into mitochondria, or in one embodiment, wherein such decrease mitochondrial calcium is caused by CRF, such as CRF -1 or CRF-2 activity; and/or antagonizing CRF mediated cellular, physiological or organismal stress, in a patient or subject in need thereof. In some embodiments, the cytosol or mitochondria is a kidney, pituitary or neuronal cell (such as a hypothalamic cell). In some other embodiments, TCAP brings the cell back to or helps the cell maintain homeostasis calcium cytosolic and/or mitochondrial levels, such as when it is not in the presence of CRF, such as CRF-1 activity.
[0016] In some embodiments, the teneurin c-terminal associated peptide-1 , 2, 3, or 4 (TCAP- 1 , TCAP-2, TCAP-3, TCAP-4 peptide), or a pharmaceutical composition comprising same in the methods and/or uses of the invention comprise or consist essentially of :(i) an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 38, 70, and 101 (TCAP-1 , 41mer); 46 and 78 (TCAP-2, 41 mer); 14, 22, 54, 86 (TCAP-3, 41 mer); 30, 62, and 94 (TCAP-4, 41mer) (or preferably SEQ. ID. NOs: 38 or 70); or SEQ. ID. NOs: 37, 69 and 111 (TCAP-1 , 40mer); 45 and 77 (TCAP-2, 40mer); SEQ. ID. NOs: 13, 21 , 53 and 85 (TCAP-3, 40mer); 29, 61 and 93 (TCAP-4, 40mer); or, or a species homolog thereof; optionally wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (a TCAP with a c-amidation signal sequence selected from the group consisting of: SEQ. ID. NOs: 40, 37, and 71 (TCAP-1); 48, 47, 80, 79 (TCAP-2); 16, 15, 24, 23, 56, 55, 88, and 87 (TCAP-3); 32, 31 , 64, 63, 96 and 95 (TCAP- 4); and/or(b) when the amino terminal amino acid of said TCAP peptide is glutamine, it is in some embodiments in the form of pyroglutamic acid and/or in another embodiment, replacing the N- terminal amino acid of the TCAP -1 , 2, 3, or 4 peptide with a pyroglutamic acid, such as any one
of SEQ. ID. NOs: 7 - 12. In another embodiments administering or using a TCAP of any one of SEQ. ID. NOs: 7 or 8 or 9. In another embodiment, the TCAP may be a pharmaceutically acceptable salt or ester thereof.
[0017] In some other embodiments, the invention comprises administering or using a peptide of any one of SEQ. ID. NOs: 38 or 70 or a sequence comprising an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 38 or 70 or a species homolog thereof, wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (such as SEQ. ID NOs: 44 or 72); and/or (b) when the amino terminal amino acid of said TCAP peptide is glutamine, it is in some embodiments in the form of pyroglutamic acid. In some embodiments the natural N-terminal amino acid has been modified to be a pyroglutamic acid and in some embodiments is preferably having SEQ. ID. NOs: 7 or 8. In another embodiment, the use or method is for a composition comprising any one or more of the aforementioned peptides.
[0018] In some other embodiments, the invention provides a method for treating a condition associated with CRF mediated function, such as comprising: mood disorders, or CRF-dependent anxiogenic and depressive conditions.
[0019] In some other aspects, the present invention provides TCAP-1 or compositions comprising same for the therapeutic use in treating or preventing disorders associated with CRF expression and or function.
[0020] In yet some others aspect, the present invention provides a TCAP (e.g., TCAP-1 or TCAP-3 or a modified form thereof, such as SEQ. ID. NOs 7 or 8)) alone in a combination treatment for lessening, balancing or mediating CRF-activity, such as associated with certain disorders, such as mood disorders such as depression, stress or to regulate energy levels. Wherein the CRF activity is the upregulation of Ca2+ influx into cells and/or increased Ca2+ in the cytosol of a cell, such as a neuronal cell, and in one embodiment a hypothalamic cell and the use of a TCAP of the present invention can mitigate or lessen or prevent or inhibit said up regulation. In another embodiment, the CRF activity is the down regulation or decrease of Ca2+ in the mitochondria or increase efflux of Ca2+ from the mitochondria, and TCAP can mitigate, increase or prevent said down regulation or decrease of Ca2+ in the mitochondria, or increase influx of Ca2+ into the mitochondria. In some preferred embodiments, TCAP, in some preferred embodiments TCAP-1 and TCAP-3 or the peptide of SEQ. ID. NOs 7 or 8, can be used to lessen, balance and/or mitigate the CRF CA2+ influx response.
[0021] In some embodiments the cells are neuronal cells, in one embodiment a hypothalamic cell. In some embodiments, the patient or subject is a mammal. In some other embodiments, the
mammal is selected from the group consisting of humans, dogs, cats, horses, sheep and cattle. In some embodiments the patient or subject is human.
[0022] Additional aspects and advantages of the present invention will be apparent in view of the description which follows. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order that the subject matter may be readily understood, embodiments are illustrated by way of examples in the accompanying drawings, in which:
[0024] Figure 1: is a TCAP sequence summary table for mouse, human and G. Gallus, rainbow trout and zebrafish.
[0025] Figure 2: Effect of TCAP and Teneurin expression on N38 cells transfected with TCAP-based siRNAs. A. N38 cells after transfection with either the pLuc negative control, or p270 and p721 siRNA containing plasmids. Scale bar: 50 pM. B. Expression product of histone H3, TCAP 2, 3, and 4 and teneurin 2, 3, and 4 after transfection. C. Quantification of the data provided in ‘B’. TCAP-1 and teneurin-1 is not expressed by N38 cells. The level of significance was determined using a one-way analysis of variance (ANOVA) using Tukey’s post hoc test. n=4 for all analyses. (* p<0.05; **p<0.01; ***p<0.001)
[0026] Figure 3: Reporter Activity of the cAMP Response Element (CRE) in 293T human embryonic kidney cells A. CRF Receptor 1. B. CRF Receptor 2. T reatments were given 4 hours prior to harvest. Experiment was done in triplicates and figure shown is representative of results from 3 separate experiments. CRF was used as a positive control. The mean ± SEM is indicated. (* p<0.05; **p<0.01; ***p<0.001)
[0027] Figure 4: Intracellular calcium flux by TCAP-1 and CRF in immortalized neurons. A. Dose-response curves showing the acute effect of increasing concentrations of CRF or TCAP- 1 on intracellular Ca2+ as established by Fluo-4 in mHypoE-38 cells where CRF shows dosedependent increase in cytosolic Ca2+ concentrations and TCAP has an opposite action. Data represent the mean ± SEM (n = 4-5 replicates per treatment dose) B. Cells showed normal behaviour after treatment. Representative differential interference contrast (DIC) (left) and Fluo- 4 fluorescence images of N38 neurons (right). The scale bar indicates 20 pm. C-E: TCAP-1 and CRF induce opposing calcium responses in embryonic mouse hypothalamic neurons. C. Superimposed Fluo-4 calcium responses following treatment with I) ACSF, II) CRF (100 nM); III)
sc-TCAP (100 nM), and IV) TCAP (100 nM). The red trace represents the mean of the individual gray traces (n = 5-6 each), and each grey trace represents each of the average calcium response of 5 cells from the same experiment. D. Overlay of summary data shown in C. E. Summary graph showing percent change from baseline from data obtained in B and C, data assessed at the 15 min time point. Data represent the mean ± SEM (n = 5-6 replicates per experiment). **P < .01 , ****P < .0001. One-way ANOVA with Tukey’s post-hoc test was used.
[0028] Figure 5: Teneurin C-terminal associated peptide (TCAP)-1 antagonizes Corticotropin-Releasing Hormone (CRH)-mediated increases in cystolic calcium (Ca2+) concentrations. A. Superimposed fluo-4 calcium measurements in response to a 5 min ORF (100 nM) treatment followed by a 5 min treatment with I. ORF (100 nM); II. Sc-TCAP (100 nM): III. TCAP (100 nM). The red trace represents the average of the individual gray traces (n=5 each), and each grey trace represents the average calcium response of 5 cells from the same experiment. B. Overlay of summary data shown in A. C. Summary graph showing percent change from baseline from data obtained in B and C, summary data assessed at the 15 min time point. Data represent the mean ± SEM (n = 5-6 replicates per experiment). **P < .01 , ***P < .001. Oneway ANOVA with T ukey’s post-hoc test was used.
[0029] Figure 6: Teneurin C-terminal associated peptide (TCAP)-1 pre-treatment prevents Corticotropin-Releasing Factor (CRF)-mediated increases in calcium (Ca2+) concentrations. A. Superimposed Fluo-4 Ca2+ measurements in response to a 5m TCAP-1 (100 nM) treatment followed by a 5 min treatment with I) TCAP (100 nM), II) Sc-TCAP (100 nM); III) CRF (1 nM). The red trace represents the average of the individual gray traces (n=5 each), and each grey trace represents the average calcium response of 5 cells from the same experiment. B. Summary graph of data shown in B for direct comparison of mean traces. C. Quantification indicating percent change from baseline from data obtained in B and C, where the mean data was assessed at the 15m time point. Data represent the mean ± SEM (n = 5-6 replicates per experiment), ns = not significant. One-way ANOVA with Tukey’s post-hoc test.
[0030] Figure 7: TCAP-1 -mediated Ca2+ channel and transporter actions determined by antagonist interaction. A. TCAP-1 treatment (10m; 10nM) are indicated by Fluo-4 Ca2+ activity in N38 cells with following antagonist treatment: I. Cells pretreated for 20m with ruthedium red (RuR; 50 pM ) followed by 10m treatment with RuR and TCAP-1 (100 nM), II. Cells pre-treated for 20m with benzamil (BZ; 100 pM) followed by 1 m treatment with BZ and TCAP-1 (100 nM), III. Cells pretreated for 20m with thapsigargin (TGX; 100 nM) followed by 10m treatment with TGX and TCAP-1 (100 nM). IV. Cells pretreated for 20m VDT (vanadate; 100 nM) followed by a 10m treatment with VDT and TCAP-1 (100 nM). Note: The red trace represents the average of the
individual gray traces (n=5 each), each grey trace represents the average calcium response of 5 cells from the same experiment. B. Summary graph of data shown in A, for comparison this graph includes the TCAP only treatment data shown in Fig 4 A. C. Summary graph showing percent change from baseline from data obtained in B and C, summary data assessed at the 15m time point. Data represent the mean ± SEM (n = 4-6 replicates per experiment). *P < .05, ***P < .001. One-way ANOVA with a Dunnett’s post-hoc test.
[0031] Figure 8: TCAP-1 induces MT Ca2+ uptake and prevents CRF-induced MT Ca2+ release. A. Representative DIG and Rhod-2 fluorescence images of N38 neurons. Scale bar: 20 pm. B. Rhod-2 MT Ca2+ responses following treatment with I) ACSF, II) TCAP-1 (100 nM), CRF (1 nM) and IV) TCAP+CRF (100 nM, 1 nM respectively); cells were pre-treated with TCAP-1 (100 nM) for 20m prior start of experiment. The red trace represents the average of the individual gray traces (n=5-6 each), and each grey trace represents the average Ca2+ response of 5 cells from the same experiment. C. Summary graph of data shown in B. D. Quantification of results obtained in B and C, summary data assessed at the 15 min time point. Data represent the mean ± SEM (n = 4-5 replicates per experiment). *P < .05, **P < .01 , ***P < .001 , ****p < .0001. One-way ANOVA with Tukey’s post-hoc test was used.
[0032] Figure 9: TCAP-1 prevents CRF-induced depolarisation of the MT membrane potential (v). A. Representative DIG and Rhodamine 123 (Rhod-123) fluorescence images of N38 neurons. Scale bar: 20 pm. B. Rhod-123 measurements of changes in i m in N38 cells in response to: B I) ACSF, II) TCAP-1 (100 nM), III) CRF (1 nM), IV) Sc-TCAP (100 nM), and V) TCAP-1 + CRF; cells were pre-treated with TCAP-1 (100 nM) for 20m prior start of experiment. The red trace represents the average of the individual gray traces (n=5 each), each grey trace represents the average calcium response of 5 cells from the same experiment. Cells were loaded/recorded in quench mode and an increase in fluorescence indicates i m depolarization and a decrease in fluorescence indicates i m hyperpolarization. C. Summary graph of data shown in A. D. Quantification of results obtained in A and B, summary data assessed at the 10 min time point. Data represent the mean ± SEM (n = 4-6 replicates per experiment). **P < .01 , ***P < .001 , ****p < .0001. One-way ANOVA with Tukey’s post-hoc test was used.
[0033] Figure 10: TCAP-1 increases intracellular NADH and ATP levels in N38 cells. A. Summary trace showing change in resorufin fluorescence over time following TCAP-1 (100 nM) or ACSF treatment. B. Summary graph showing change in the rate of resorufin formation C. ATP turnover Data represent the mean ± SEM (n = 4-5 replicates per experiment). Data were analyzed by a two-way ANOVA followed by a Sidak post-hoc test (A), and a one-way ANOVA followed by
a Tukey’s post-hoc test (B). Data were considered statistically significant with an a priori hypothesis of P < .05 (*P <0.05, **P < .01 , ****P < .0001).
[0034] Figure 11. Actions of TCAP-1 on AtT20 cells. A. Expression of Teneurins, TCAPs, CRF Receptors, and Latrophilins in AtT-20 Cells. Reverse transcription-polymerase chain reaction (RT-PCR) was performed on total cDNA from AtT-20 cells. Expression of p-actin was used as a positive control. B. Representative current clamp recordings (l=0) of spontaneously firing AtT-20 cells treated as indicated, i) aCSF, ii) TCAP (100 nM), iii) CRF (1 nM), and iv) CRF (100 nM). C. Representative current- voltage curves plotted before (o) and after (•) a 15 min TCAP-1 treatment.
DETAILED DESCRIPTION OF THE INVENTION
[0035] As noted above, Teneurin C-terminal associated peptides (TCAPs 1-4) are four paralogous bioactive peptides located at the distal extracellular end of each teneurin transmembrane protein. First described by Lovejoy et al and described in US Patent No. 8,088,889, which is herein incorporated by reference. TCAP-1 has biological actions distinct from the teneurins, demonstrating functional independence from the full length teneurin protein. ADGRL (Latrophilin), an adhesion G protein-coupled receptor (GPCR), has recently been identified as part of the ligand-receptor complex that binds the teneurin/TCAP system. Previously elucidated in neurons, the teneurin/TCAP-ADGRL complex is associated with glucose metabolism; however, it is not well understood in other tissues. In some embodiments, the present invention include TCAP (such as TCAP-1 or TCAP-3) in a method or use for independent intracellular calcium actions, including in vitro embodiments.
[0036] Herein the present invention provides the first evidence of the role of TCAP -1 as a CRF antagonist. More particularly, in some aspects, the present invention is directed to the use of TCAP-1 to inhibit CRF mediated intracellular or cytosolic Ca2+ increase. In another aspect, TCAP-1 can be used in a method to inhibit CRF mediated Ca2+ efflux or decrease in the mitochondria.
[0037] Corticotropin-releasing factor (CRF) is a critical neuroendocrine peptide that regulates both the hypothalamic-pituitary-adrenal (HPA) axis as well as central stress-associated sensory input and integration. CRF is phylogenetically ancient, and evolved before the separation of protostomes and deuterostomes, more than 700 million years ago (Ayala et al., 1998 [119]). However, comparison of the primary structure of CRF in these two diverse metazoan lineages, indicates sequence conservation suggesting that CRF was associated with an earlier evolving peptide lineage. A candidate for this lineage is the ‘teneurin C-terminal associated peptide’
(TCAP) which likely evolved in the earliest basal metazoans. Like CRF, TCAP is a soluble peptide that acts on a receptor that is structurally related, but distinct from the CRF receptors. In vitro, TCAP administration blocks the CRF-dependent intracellular calcium flux to regulate mitochondrial activity.
[0038] The present invention indicates that modified amidated TCAP - 1 (pyroglutamic acid at N-Terminal) act as an antagonist to CRF in vivo.
[0039] As noted above, Teneurin C-terminal associated peptides (TCAP) are bioactive peptides that possess anxiety-reducing roles in animals, in vivo, and increase cell viability, in vitro. Although these peptides have some primary structural similarity to corticotropin-releasing factor (CRF), they are derived from the distal extracellular region of the teneurin transmembrane protein where they may act as separate soluble peptides after auto-catalytic cleavage from the teneurin protein following interaction with the cognate teneurin receptor, latrophilin (ADGRL), or may be expressed as a separate mRNA. However, although the signal transduction mechanism of TCAP in neurons has not been established, the inventors hypothesized that there is an association with the intracellular calcium flux. The present inventors characterized, for the first time, the TCAP- mediated calcium response in hypothalamic and pituitary cell lines using single-cell calcium imaging and patch-clamping methods with pharmacological antagonists to identify potential calcium channels, in vitro. Under normal circumstances, the present inventors have herein shown that TCAP-1 reduces cytosolic calcium concentrations by uptake into the mitochondria and efflux through the plasma membrane independently of the teneurins. In doing so, the TCAPs, such as TCAP-1 could inhibit the potential ‘stress’ -inducing actions of CRF and thus can be used to develop novel treatments regimes, compositions and methods for treating stress related or mood related disorders. In other embodiments, the present invention may provide an ability to better manage such disorders, whether they may be mania or depression, by combination therapies that balance TCAP-1 (or TCAP-1 agonists) and CRF (or CRF agonists) in their treatment/management. In other aspects, the present invention provides a novel approach of identifying/developing treatments for such conditions, (i.e. by focusing on Ca2+ flux activity).
[0040] The present inventors have also shown that TCAP -1 antagonistic effects on CRF activity is independent of the CRF receptor. CRF does not antagonize or compete with TCAP-1 activity. As such, TCAP-1 is activating down stream from CRF.
The Stress Response, TCAP and CRF
[0041] The regulation of the stress response and metabolism is critical to the survival of all multicellular animals. Over the last couple of decades, the teneurin C-terminal associated
peptides (TCAP) have emerged as a new peptide family associated with the stress response. The TCAPs [1-3] are present in all four of the vertebrate teneurin paralogues, are 40-41 residues in length and have primary sequence similarity to the secretin, calcitonin and corticotropin-releasing factor (CRF) families of peptides [3-5], They are named accordingly (1-4) for each teneurin they are associated with. TCAP is derived from the distal extracellular tip of the teneurin transmembrane proteins [3,6,7] which may be liberated auto-catalytically [8,9] or by an independent mRNA [10], Synthetic TCAP is highly efficacious, in vivo, in molluscs [11], protochordates [12], fish [13] and mammals [4, 14-16] to regulate aspects of the stress response. [0042] The physiological actions of TCAP are transduced, in part, by the latrophilins (LPHN) [17,18], LPHNs are members of the adhesion G-protein coupled receptor (GPCR) family (ADGRL; [19] but possess a phylogenetically conserved hormone-binding domain (HBD) related to that of the CRF and Secretin family receptors [17, 18, 20-22], and are also structurally related to the Secretin family of GPCRs [19,23], LPHNs are involved in cell-cell and cell-matrix adhesion [19], in a variety to tissue types. LPHN activation stimulates G-protein signalling and modulation of multiple intracellular signaling pathways via their interaction with the teneurins [24-27], Alpha(a)- latrotoxin (aLTX), is a peptide component of the black widow venom that possesses primary structure homology to the Secretin family of peptides [20], By itself, aLTX, is associated with neurotransmitter release by a calcium (Ca2+)-dependent mechanism [21 , 28-30], however, it is not clear how this mechanism occurs [31], although it has been also implicated in mitochondrial (MT) function [32], LPHN-1 , is one of the endogenous receptors of aLTX [33,34], Previous studies with the TCAP region of teneurins indicate that it interacts with the HBD of the LPHNs [17,18], Because TCAP also possesses structural similarity to the aLTX and Secretin families of peptides [5], it is likely it also plays a role in intracellular Ca2+ regulation. Moreover, TCAP has been also implicated in MT activity [14,35],
[0043] A number of studies indicate that TCAP regulates the energetic demands of stress physiology and behaviour. Synthetic TCAP-1 decreases CRF-associated stress behaviours in a variety of studies including acoustic startle response [2], elevated plus-maze and open-field test [36,37] and cocaine reinstatement models [38-40], Moreover, TCAP-1 inhibits the CRF-mediated cfos expression in rat brain limbic regions [41], Recent studies indicate that TCAP-1 regulates MT activity in fish [13] and rodents [14] and stress activity in oysters [11], Together, these studies indicate that a fundamental mechanism of TCAP is to regulate energy metabolism. The inventors herein have shown for the first that that TCAP regulates intracellular calcium flux and antagonism with CRF afferent activity.
[0044] In vertebrates, there are two CRF receptor subtypes: the CRF receptor 1 (CRFi) and CRF receptor 2 (CRF2). These receptors belong to the Secretin (previously, class B) Family of GPCRs [23,42], but differ in their expression pattern and by their ligand selectivity [42-44], Both receptor pathways elevate intracellular Ca2+ and contribute to Ca2+-mediated vesicular release. Taken together, these studies indicate that TCAP may interact with these receptors either through binding or regulating the Ca2+-associated CRF-mediated activation in hypothalamic neurons that express both the CRF1 and LPHN-1 receptors. However, the present studies of the invention, have surprisingly shown that TCAP antagonizes CRF activity, independent of the CRF receptors (e.g., independent of binding with CRF receptors).
[0045] In some aspects the present invention provides a method/use of TCAP, such as TCAP-1 , to regulate intracellular Ca2+ metabolism. In other aspects, the present invention provides a novel method/use of TCAP-1 as an antagonist of the actions of CRF in neurons, and in particular its activity regarding cytosolic Ca2+ flux. In yet some other aspects, the present invention shows that TCAP-1 plays a role in CRF-associated energy metabolism using this route. The present invention, in some aspects shows that although TCAP does not act directly with the CRF receptors, it antagonizes the down-stream (signal transduction) CRF-mediated Ca2+ response, and in doing so, regulates MT (aerobic)-based energy metabolism in cells. This invention also shows that the intracellular actions of TCAP-1 are independent of the teneurins.
DEFINITIONS
[0046] “Therapeutically Effective Amount” as used herein when applied to dose or amount refers to that quantity of a compound or pharmaceutical composition that is sufficient to result in a desired activity upon administration to a living animal body. It is understood that a therapeutic amount may vary depending on a number of factors, including but not limited to gender, weight, body mass or body surface area, severity of a condition, age (e.g., child, teen, adult, or senior).
[0047] “Stress” whether physiological, cellular, organismal, or psychological, is an organism's response to a stressor such as an environmental condition. It could be any condition that forces living systems away from their physiological steady state. In one aspect, stress is the body's method of reacting to a condition such as a threat, challenge or physical and psychological barrier. Stress can take many forms, and often manifests in changes at the cellular level. At the cellular level, a cellular there are generally four basic types of responses. The stressors can (1) induce cell repair mechanisms, (2) induce cell responses that result in temporary adaptation, (3) induce autophagy or (4) trigger cell death.
[0048] “Cellular Stress” is the wide range of molecular changes that cells undergo in response to environmental stressors, including but not limited ot extremes of temperature, exposure to toxins, viruses, bacteria, changes in cellular environment, such as ions, peptides/protein expression or exposure and mechanical damage.
[0049] “Physiological Stress” in one aspect is the disruption in an individual’s internal milieu or any external or internal condition that challenges the homeostasis of a cell or organism. It leads to activation of regulatory mechanisms that serve to restore homestasis. Examples may include starvation, noise, temperature changes and any condition that forces a living system away form a physiological steady state.
[0050] “Organismal Stress” is the stress of an organism in response to changes in the environment that takes the organism away from homeostasis.
[0051] “Homeostasis” in one aspect is the stae of steady internal, physical, chemical and social conditions maintained by living systems, that are optimal for their function and can include many variables, such as temperature, ionic concentrations (e.g., calcium, potassium, sodium, blood sugar) or fluid balance, or pH. In another aspect, it is mechanism or self-regulating process by which an organism tends to maintain stability while adjusting to conditions that best for its survival.
[0052] “TCAP” as used herein are Teneurin C-terminal associated peptides which are four (TCAPs-1-4) paralogous bioactive peptides having amino acid sequences located at the distal extracellular end of each teneurin transmembrane protein. They are generally peptides of 40- 41 mer amino acids, first described by Lovejoy et al and described in US Patent No. 8,088,889, which is herein incorporated by reference. In some preferred embodiments, they are the 41 amino acid peptide of the c-terminal end of the mouse or human Teneurin peptides (tenM1 - 4). There is considerable cross-species homology.
DESCRIPTION
[0053] Although TCAP and teneurins have been largely studied in the brain, their roles in CRF antagonists have not been studied. CRF is associated with increased intracellular calcium flux, which is responsible for the release of neurotransmitters and neuromodulators, associated with endoplasmic reticulum stress, and mitochondrial activity as well as potential changes in the plasma membrane and mitochondrial membrane.
[0054] Therefore, the inventors examined the specific role of TCAP-1 in vitro, especially with regard to intracellular calcium flux and by the examples presented herein have shown that:
- TCAP, such as TCAP-1 - 4, in some embodiments, preferably TCAP-1 , is required for normal cellular growth and viability, such as in N38 cells. In some aspects the invention provides TCAP for use in a method to maintain some aspects the invention provides TCAP for use in a method to maintain cell health, such as cell growth or cell viability;
- TCAP, such as TCAP-1 -4, in some embodiments preferably TCAP-1 , does not act on the CRF receptor, but works downstream to antagonize CRF activity or CRF-mediated activity, such as calcium intracellular influx. CRF does affect TCAP activity, such as with regard decreasing, or lessening calcium intracellular calicum influx.
- That the use of TCAP, such as TCAP-1-4, or preferably TCAP-1 (or cellular expression of same), can prevent, inhibit, mitigate or lessen CRF- mediated activity such as increase in intracelluar calcium influx.
[0055] As such, TCAP, such as TCAP-1 -4, or in some embodiments preferably TCAP-1 , or modified TCAP, such as SEQ. ID NOs: 7 - 12, or in some embodiments modified TCAP-1 , such as SEQ. ID. Nos: 7 or 8 or TCAP agonists, such as TCAP-1 agonists) or compositions comprising same, can be used or used in a method for antagonizing CRF activity, such as CRF’s activity in increasing intracellular calcium influx, and/or in the prevention, control, or treatment of CRF activity-mediated symptoms or conditions, such as with regard to cellular or physiciological stress, mood disorders or stress, such as anxiety or such as anxiogenic or depressive or manic conditions. In some aspects, TCAP, such as TCAP-1 -4, or modified TCAP-1 - 4 (SEQ. ID. NOs 7 -12), or in some embodiments preferably TCAP-1 or modified TCAP-1 , such as SEQ. ID. NOs: 7 or 8 or TCAP agonists, such as TCAP-1 agonists) can be used in the treatment (or treatment plans or regimes), or in methods regarding same, for the prevention, control or treatment of cellular or physiciological stress, mood disorders or stress, such as anxiety or such as anxiogenic or depressive or manic conditions. In some embodiments, the invention provides a method or use of TCAP, such as TCAP-1 -4, or modified TCAP 1-4, or in some embodiments preferably TCAP- 1 or modified TCAP-1 (such as SEQ. ID. Nos: 7 of 8 or TCAP-1 agonists) or compositions comprising same, for the cellular or physiological stress, mood disorders or stress, such as anxiety or such as anxiogenic or depressive or manic conditions , comprising administering or enhancing the expression of TCAP, such as TCAP-1 -4, or in some embodiments TCAP-1 (or modified TCAP-1 , such as SEQ. ID. NO. 7 or 8 or TCAP agonists, such as TCAP-1 agonists) a therapeutically effect amount thereof to cells or in patients in need thereof.
Teneurin C-Terminal Associated Peptide-1 (TCAP-1)
[0056] Although, the present invention is not limited to TCAP-1, TCAP-1 as used herein is a peptide that consists of a sequence found at the c-terminal of Teneurin M-1 peptide, more particularly described below. There is considerable cross-species homology.
[0057] In some embodiments the TCAP-1 peptide (“TCAP-1”) is a 41-mer peptide selected from SEQ. ID. NOs 38, 70, 101 (see also Figure 1). In some embodiments it is an amidated peptide, (such as a C-terminal amidated peptide), in some other embodiments the TCAP has a glutamine, glutamic acid or pyroglutamic acid at the N-terminal. In other embodiments it has an amidated C-terminal end. In other embodiments, it has both a pyroglutamic acid at the N-terminal and is amidated at the C-terminal, such as any one of SEQ. ID. NOs: 7 - 9.
[0058] In other embodiments it is a human TCAP-1. In some embodiments it is a 41-mer c- terminal amidated peptide consisting of the following sequence:
Amidated Human TCAP-1 (41 mer): Gin* Gin Leu Leu Ser Thr Gly Arg Vai Gin Gly Tyr Asp Gly Tyr Phe Vai Leu Ser Vai Glu Gin Tyr Leu Glu Leu Ser Asp Ser Ala Asn Asn lie His Phe Met Arg Gin Ser Glu lie - NH2 (SEQ. ID. NO: 70)
* In some embodiments the N-terminal glutamine is a glutamic acid. In another embodiment it is a pyroglutamic acid. (SEQ. ID. NO:8)
[0059] In some other embodiments, the peptide used is a salt, ester, solvate, polymorph or enantiomers of SEQ. ID. Nos: 38, 70 or 101, preferably SEQ. ID. NO: 38 or 70, or any amidated or pyroglutamic acid or amidated and pyroglutamic acid form thereof, such as SEQ. ID. Nos: 7 to 9, or in some embodiments, preferably SEQ. ID NOs: 7 or 8.
[0060] In some other embodiments, conservative substitutions or modifications can be made to the peptide sequence which does not affect its structure or function and thus could be used for the present invention, such as various species homologs. For instance those present in species homologs, such as the mouse, human or G. gallus TCAP-1 sequences (SEQ. ID. NOs. 38. 70 or 101 where the fifth amino acid may be selected from: Gly, Asn or Ser. In some embodiments, the peptide has 95% identity to any one of SEQ. ID. Nos: 38, 70 or 101 or any one of their pyroglutamic acid N-terminal modified sequences (SEQ. ID. NOs: 7- 9). As noted above, there is considerable cross-species homology.
[0061] In other embodiments, the invention is for the use of a nucleic acid molecule that encodes the respective TCAP and the induction of expression of TCAP within a cell comprising same to antagonize CRF activity.
Pharmaceutical Compositions
[0062] The present invention contemplates the administration of TCAP or a pharmaceutical composition comprising TCAP, or in some embodiments TCAP-1 as described herein, (including an amidated and/or pyroglutamic acid form of TCAP-1 or a peptide with 95% identity to same) and optionally a pharmaceutically acceptable carrier or excipient. In another embodiment, the invention may comprise and agonist of TCAP or the use of a nucleotide sequence/molecule expressing TCAP for the methods and uses of the invention.
[0063] In some embodiments, the teneurin c-terminal associated peptide-1 , 2, 3, or 4 (TCAP- 1 , TCAP-2, TCAP-3, TCAP-4 peptide), or a pharmaceutical composition comprising same in the methods and/or uses of the invention comprise or consist essentially of :(i) an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 38, 70, and 101 (TCAP-1 , 41mer); 46 and 78 (TCAP-2, 41 mer); 14, 22, 54, 86 (TCAP-3, 41 mer); 30, 62, and 94 (TCAP-4, 41mer) (or preferably SEQ. ID. NOs: 38 or 70); or SEQ. ID. NOs: 37, 69 and 111 (TCAP-1 , 40mer); 45 and 77 (TCAP-2, 40mer); SEQ. ID. NOs: 13, 21 , 53 and 85 (TCAP-3, 40mer); 29, 61 and 93 (TCAP-4, 40mer); or, or a species homolog thereof; optionally wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (a TCAP with a c-amidation signal sequence selected from the group consisting of: SEQ. ID. NOs: 40, 37, and 71 (TCAP-1); 48, 47, 80, 79 (TCAP-2); 16, 15, 24, 23, 56, 55, 88, and 87 (TCAP-3); 32, 31 , 64, 63, 96 and 95 (TCAP- 4); and/or(b) when the amino terminal amino acid of said TCAP peptide is glutamine, it is in some embodiments in the form of pyroglutamic acid and/or in another embodiment, replacing the N- terminal amino acid of the TCAP -1 , 2, 3, or 4 peptide with a pyroglutamic acid, such as any one of SEQ. ID. NOs: 7 - 12. In another embodiments administering or using a TCAP of any one of SEQ. ID. NOs: 7 or 8 or 9. In another embodiment, the TCAP may be a pharmaceutically acceptable salt or ester thereof.
[0064] In some other embodiments, the invention comprises administering or using a peptide of any one of SEQ. ID. NOs: 38 or 70 or a sequence comprising an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 38 or 70 or a species homolog thereof, wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (such as SEQ. ID NOs: 44 or 72); and/or (b) when the amino terminal amino acid of said TCAP peptide is glutamine, it is in some embodiments in the form of pyroglutamic acid. In some embodiments the natural N-terminal amino acid has been modified to be a pyroglutamic acid and in some embodiments is preferably
having SEQ. ID. NOs: 7 or 8. In another embodiment, the use or method is for a composition comprising any one or more of the aforementioned peptides.
[0065] The phrase “pharmaceutically acceptable”, as used in connection with compositions of the invention, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., human). Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia (USP), National Formulary (NF), or other generally recognized pharmacopeia for use in mammals, and more particularly in humans. Active Pharmaceutical Ingredients (APIs) of the present invention may be in the form of pharmaceutically acceptable salts. “Pharmaceutically acceptable salts” refers to those salts which possess the biological effectiveness and properties of the parent compound and which are not biologically or otherwise undesirable.
[0066] The pharmaceutical compositions of the present invention may comprise one or more excipients. Excipients which may be used include carriers, surface active agents (surfactants), thickening (viscosity) agents, emulsifying agents, binding agents, dispersion or suspension agents, buffering agents, penetration-enhancing agents, solubilizers, colorants, sweeteners, flavoring agents, coatings, disintegrating agents, lubricants, preservatives, isotonic agents, and combinations thereof. The selection and use of suitable excipients is taught in Gennaro, ed., Remington: The Science and Practice of Pharmacy, 20th Ed. (Lippincott Williams & Wilkins 2003), the disclosure of which is incorporated herein by reference.
[0067] The term “carrier” applied to pharmaceutical compositions of the invention refers to a diluent, excipient, or vehicle with which an active compound is administered. Such pharmaceutical carriers can be liquids, such as water, saline solutions, aqueous dextrose solutions, aqueous glycerol solutions, and lipids and oils, including those of petroleum, animal, vegetable or synthetic origin. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin, 18. sup. th Edition.
[0068] In some embodiments, the composition can comprise TCAP as described herein, such as any one of SEQ. ID. NOs: 7-12 or preferably SEQ. ID. NOs: 7 or 8 and one or more other active therapeutic ingredients (API) for the same or another or analogous condition, such as other anti-stress, anti-depression or other CRF antagonists.
[0069] In some embodiments, the dosage form is a subcutaneous dosage form. This differs from direct administration to the brain, amygdala, or Intracerebroventricular (“ICV”). Subcutaneous administration has many advantages over direct administration to the brain.
[0070] In some embodiments as in the composition used in the Examples, the composition dissolves an amidated and pyroglutamic acid form of TCAP in a saline solution and is subcutaneously administered into animals (not ICV or amygdala). This formulation has advantages over prior forms for delivery, i.e., ICV or amygdala, in that it does not require additional sedatives, or the like for administration.
[0071] The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient(s). The pack may, for example, comprise metal or plastic foil, such as a blister pack. Compositions of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
[0072] In some embodiments, TCAP-1 and the pharmaceutical compositions of the invention are used to antagonize CRF function in an animal, in some embodiments mammals, including but not limited to humans, dogs, cats, horses, sheep, cattle.
METHODS AND USES
[0073] In some embodiments TCAP (such as TCAP-1) and the pharmaceutical compositions comprising same can modulate, or reduce, CRF-induced Ca2+ influx.
[0074] In some embodiments the TCAP (such as TCAP-1) and pharmaceutical compositions comprising same of the present invention can be used modifying CA2+ flux. In other embodiments can be used to modify CA2+ flux in the PM, ER, or MT.
[0075] In some other embodiment, TCAP-1 can be used alone or in combination with CRF (and/or other CRF Agonists/Antagonists, and/or other TCAP agonists or antagonists to control cytosolic and mitochondrial calcium levels, or to control treatments or to modify of balance treatment regimens of mood disorders, such as anxiogenic or depressive or manic conditions.
[0076] The present invention is described in the following Examples, which are set forth to aid in the understanding of the invention, and should not be construed to limit in any way the scope of the invention as defined in the claims which follow thereafter.
EXAMPLES
[0077] The following examples illustrate the role of TCAP-1 is a CRF antagonist. Yet, CRF does not affect TCAP-1 activity.
MATERIALS AND METHODS
Peptide Synthesis and Preparaton
[0078] The sequence of the mouse TCAP-1 was determined by examining the carboxy terminal exon region of mouse teneurin-1 (accession number: NM011855). Synthetic TCAP-1 was synthesised at 95% purity on an automated peptide synthesiser, Model Novayn Crystal (NovaBiochem Ltd, Nottingham, UK) on PEG-PS resin using continuous flow Fmoc chemistry (Calbiochem-Novabiochem Group, San Diego, CA, USA). Eight times excess di-isopropyl ethyl amine (Sigma-Aldrich, Oakville, ON, Canada) and four times excess Fmoc-amino acid activated with HATU (O-[7-azabenzotriazol]-1-3, 3-tetramethyluronium hexfluorophosphate; Applied Biosystems, Foster City, CA, USA) at a 1 :1 (mol/mol) ratio were used during the coupling reaction. The reaction time was 1 hour. A solution of 20% piperidine (Sigma-Aldrich) in N,N- dimethylformide (DMF; Caledon Laboratories, Georgetown, ON, Canada) was used for the deprotection step in the synthesis cycle. The DMF was purified in-house and used fresh each time as a solvent for the synthesis. The cleavage/deprotection of the final peptide was carried out with trifluoroacetic acid (TFA), thioanisole, 1 ,2 ethandithiol, m-cresole, triisopropylsilane and bromotrimethyl silane (SigmaAldrich) at a ratio of 40:10:5:1 :1 :5. Finally, it was desalted on a Sephadex G-10 column (Pharmacia, Uppsala, Sweden) using aqueous 0.1 % TFA solution and lyophilized. The TCAP-1 synthesized had SEQ. ID. NO: 7
(pEQLLGTGRVQGYDGYFVLSVEQYLELSDSANNIHFMRQSEI-NH2, wherein “pE” refers to pyroglutamic acid). In some embodiments, it is understood that the sequences for natural TCAP- 1 - 4, can all have their N-terminal amino acid amended to be pyroglutamic acid.
[0079] For use as a negative control, a scrambled TCAP-1 analogue (Sc-TCAP-1) was synthesised (SEQ. ID. NO: 130) using the same process as described above. Both peptides were synthesised by the American Peptide Company (Thermo Fisher Scientific, Sunnyvale, CA, USA). The Sc-TCAP-1 peptide contained the same amino acids as rat/mouse TCAP-1 (sequence: pEQLLGTGRVQGYDGYFVLSVEQYLELSDSANNIHFMRQSEI-NH2) (SEQ. ID. NO: 7) except the amino acids were randomized into a different sequence: pETHSLELRVSLIGEVQQFIGYENQSDQNYGLLAYFDRVGMS-NH2 (SEQ. ID. NO: 130). TCAP- 1 and ScTCAP-1 were dissolved at 1 mg/pL in water with an ammonium hydroxide vapor puff. The scTCAP-1 was added to the vehicle unless otherwise stated.
[0080] The siRNA oligonucleotides used to knock down teneurin and TCAP expression are noted in Tables. 1 B. The 270 oligonucleotide is designed to knockdown mouse TCAPs 1-4
although has reduced homology with TCAP-3 (SEQ. ID. NOs. 1 - 2). The 721 oligonucleotide was designed to be more specific to mouse TCAP-3. (SEQ. ID. NOs: 3 and 4). The negative control oligonucleotides. (SEQ. ID. NOs: 5 and 6).
Cell Lines
[0081] Immortalized mouse embryonic hypothalamic cells (mHipp-E14 and mHypoE-38 cells; Belsham et al., 2004 [45]) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat inactivated foetal bovine serum (FBS;Gibco). Cells were cultured in 100 x15 mm petri dishes and maintained at 60%-70% confluency in a humidified CO2 incubator at 5% CO2 and 37°C. For fluorescence experiments, cells were grown on 6-well laes on poly-D- lysine (50 pg/mL) coated 25 mm round No. 1 glass coverslips (Warner Instruments, Hamden, CT, USA) and cultured for 2-4 days prior to experimentation. Cells were serum starved for 3 hours before the start of experimental treatments;
[0082] Mouse anterior pituitary AtT-20/D16v-F2 cells (ATCC, Manassas, VA, USA) cells were also grown in 6-well plates on poly-D-lysine (50 pg/mL) coated 25 mm round No. 1 glass coverslips and were cultured in DMEM containing 4 mM L-glutamine, 4500 mg/L glucose, 1 mM sodium pyruvate, and 1500 mg/L sodium bicarbonate (ATCC), supplemented with 10% FBS (Gibco) and maintained in a humidified incubator supplied with 5% CO2-95% air at 37°C. The HEK-293T cell line was used for transfection of the CRF receptors. siRNA-Mediated Knockdowns of Teneurin and TCAP
[0083] SiRNA sequences for TCAP (terminal exon) and the negative controls were synthesized by Genosys Inc., annealed, phosphorylated and cloned into pLKO.I puro (Sigma) (Fig. 1). SiRNA 270 was designed to recognize TCAP 2,3,4 and siRNA 721 to TCAP 3. Both siRNAs were co- transfected with a puromycin resistant gene. The lentiviruses were packaged in the HEK-293T cells using Mission Lentiviral packaging mix plasmids (Sigma). 48h later, filtered supernatants with viral particles were transferred to N38 cells and incubated with 8pg/ml hexadimethrine bromide (Sigma) for 16h. The effect of TCAP-1 siRNA 270 and 721 on cell morphology was investigated and compared to a non-transfected N38 cells. All 3 cell lines were grown in 6-well culture plates with 2 mL of Dulbecco’s Modified Eagle Medium (DMEM) containing high glucose, L-glutamate, 25mM HEPES buffer, pyridoxine hydrochloride in the absence of sodium pyruvate and 5ml penicillin with 10% foetal bovine serum (FBS) at pH 7.4 (Gibco- Invitrogen, Burlington, Canada). The cells were washed and incubated in the media for 24h before puromycin selection at 2pg/ml (Sigma). The selection was monitored using the uninfected control
cells. For higher stringency, another subset of the cells was subsequently treated with puromyocin (4mg/ml) 28hrs post-incubation at 80% confluence. In passage 3, the antibiotic concentration was increased to 10 mg/ml and after 72h the cells were harvested at 80-90% confluency. The cells remained in culture, from P0 to harvest in P3 was 13d for control cells luciferase, 17d for 721 and 28d for 270. The cells were harvested and total RNA was isolated using the RNeasy Mini Kit (74124, Qiagen) followed by mRNA purification with Oligotex kit (70022, Qiagen). The quality and quantity of samples were evaluated by spectrophotometer at 260 and 280 nm. The mRNA was submitted to DNase treatment (Turbo DNA-free Kit, Ambion) in order to remove any persistent DNA contamination. Sets of primers were designed for TCAPs, teneurins and histone H3 (Table 1). About 60-80 ng of mRNA from cell cultures were submitted to one-step RT-PCR (OneStep RT-PCR kit, Qiagen) in a 50 pl final volume reaction, containing 400 pM of each dNTP, 10 pl of 5x QIAGEN OneStep RT-PCR buffer, 10 pl of 5x Q-solution, 2 pl of QIAGEN OneStep RT-PCR enzyme mix and 0.2 pM each primer to TCAPs and teneurins or 0.1 pM to histone. The thermal cycler conditions were 30m at 94°C to reverse transcription, then 15m at 95°C for initial denaturaton by 20 to 33 cycles of denaturation (1m at 94°C), annealing (1m at 59°C) and extension (1m at 72°C) followed by a final extension period of 10m at 72°C. The RT-PCR products were examined by 1.5% agarose gel electrophoresis using a UVP System 8000 digital imaging system with the Laboratory Imaging and Analysis System software (Ver. 4) (UVP, Upland, CA, USA).
CRF Receptor Activity by TCAP
[0084] The mouse immortalized neurons, N38, which endogenously express the CRFi and CRF2 receptors (Belsham et al., 2004 [45]), were used to determine TCAP actions on these receptors. The pGL3 luciferase (Luc) expression vector (Promega Corp.) containing either the promoter sequence was used as a reporter gene containing the cAMP-responsive element (CRE) sequence, CAAATTGACGTCATGGTAAAAATTGACGTCATGGTAA (SEQ. ID. NO: 131), was inserted into the pGL3-Luc vector where the vector was modified to contain a TATAA box region following the responsive element. Luciferase studies were conducted using the Luciferase Assay System (Promega Corp). The luciferase assay results were normalized to p-galactosidase (Fermentas Inc.). Transfection efficiency control results and normalized relative to luminescence values presented.
[0085] The agonist and antagonist actions by TCAP-1 on Ca2+ flux by CRF1 and CRF2 receptors were determined commercially by Millipore Inc. (Sigma-Aldrich Chemical Co.). TCAP- 1 was run in duplicate at final concentrations of 1 pM and 100nM in agonist and antagonist assay
modes. The percentage activation was calculated relative to the FLIPR signal with ligand at Emax. Percentage inhibition was calculated relative to ligand induced FLIPR signal at 2x EC50 concentration where the signal to noise ratio of the control ligand in FLIPR assay was greater than 5-fold. The signal was established with 2 x EC50 ligand stimulation, whilst the background was established in buffer with no ligand in both additions. The agonist mode was defined where the compound at 1 M or 100nM induced greater than 15% activation relative to ligand at Emax whereas the antagonist mode was defined where the compound at 1 pM or 100nM caused greater than 50% inhibition of ligand signal at 2x ECso .
Intracellular Calcium Studies
[0086] Changes in intracellular Ca2+ were assessed using the membrane-permeable Cabsensitive fluorescent indicator Fluorophore-4 (Fluo-4) (F-14201 ; Invitrogen, Burlington, ON, Canada) (Table 2). Cells were loaded with Fluo-4 by incubating coverslips in DMEM containing 4 pM Fluo-4 (from a 1 mM stock solution in DMSO) for 30m (37°C) followed by a 15m wash in physiological saline containing: 135 mM NaCI, 4.5 mM KCI, 1 mM MgCh • 6H2O, 10 mM HEPES, 10 mM glucose and 2 mM CaCh, (pH 7.4) with an osmolarity of 300 mOsmol at room temperature (RT). Coverslips with cells were placed in a flow-through bath chamber (RC-40HP, Warner Instruments, Hamden, CT, USA) of an inverted microscope (Axio Observer Z1 , Zeiss, Toronto,
ON, Canada) equipped with a 40x oil immersion objective. Cells were continuously perfused with saline via a gravity drip perfusion system at a rate of 2-3 ml/m at RT. Changes in Fluo-4 fluorescence were imaged using a green fluorescent protein (GFP) filter set (Semrock, Rochester,
NY, USA) and a X-Cite 120 fluorescence illumination system (Excelitas Technologies, Mississauga, ON, Canada), controlled by Velocity 4.0 imaging software (QuorumTechnologies Inc., Guelph, ON, Canada). Fluorescence emissions were detected with an Orca-ER Hamamatsu B/W CCD digital camera (Hamamatsu, Middlesex, NJ, USA). Fluo-4 was excited with a wavelength of 480 nm for 100ms every 30s and fluorescence emission was measured at wavelength of 516 nm. At the end of each experiment, a high Ca2+ saline solution, containing 5 mM CaCh and 10 pM ionomycin, was administered as a positive control to confirm that the fluorescent dye remained responsive. Changes in intracellular Ca2+ were measured by assessing fluorescent change in a region of interest (ROI) taken from the cell body (not the nucleus).
[0087] The average change in Fluo-4 fluorescence of 5 neurons per coverslip were used as a single replicate where 6 coverslips (n=6) were examined. Initially, the acute actions of both TCAP-1 and CRF on Ca2+ flux in N38 cells were investigated by adding TCAP-1 or CRF directly to the cells in order to obtain a direct Ca2+ response. These studies were used to establish the
effective concentration, EC50 and EC100 of each peptide over a dose range of 0.01 to 100 nM. Once this was established, then a second set of studies were performed where the peptide was added to the perfusate solution to obtain a more dynamic understanding to the peptide action. These studies were repeated with a number of pharmacological inhibitors of Ca2+ channels and transporters to determine the potential targets of TCAP-1 (see Table 2). Benzamil (BZ), Ruthedium Red (RuR), thapsigardin (TGX) and vanadate (VDT) were solubilized in saline or DMSO then adjusted to the appropriate concentration in cell growth media. In these studies, following pre-treatment of the antagonist, the baseline was set these conditions before TCAP-1 was added to show the actions of Ca2+ by TCAP-1 after the presence of the antagonist.
Mitochondrial Studies
[0088] Mitochondrial calcium measurements: Changes in mitochondrial (MT) Ca2+ levels were assessed using the fluorescent indicator Rhodamine-2-AM (Rhod-2) (Table 2). N38 cells were loaded with Rhod-2 by incubating coverslips in DMEM containing 4pM Rhod-2 (from a 1 mM stock solution in DMSO with 20% pluronic; Invitrogen - Pluronic™ F-127) for 30m at 22°C. It was subsequently washed in fresh dye-free physiological saline for 30 min at RT. Rhod-2 was excited with a wavelength of 552 nm for 100 ms every 30s and fluorescence emission was measured at wavelength of 577 nm. Changes in MT Ca2+ were measured by assessing fluorescent change in a region of interest (ROI) taken from the cell body (not the nucleus). The average change in Rhod- 2 fluorescence of 5 neurons per coverslip were used as a single replicate with 6 coverslips examined.
[0089] Mitochondrial membrane potential measurements: Changes in mitochondrial (MT) membrane potential were assessed using the fluorescent indicator Rhodamine-123 (Rhod-123) (Table 2), used in quench mode. N38 cells were loaded with Rhod-123 by incubating coverslips in DMEM containing 5 pM Rhod-123 (from a 1 mM stock solution in DMSO) for 30m at 37°C followed by a 15m wash in physiological saline at RT. Rhod-123 was excited with a wavelength of 480 nm for 100 ms every 30s and fluorescence emission was measured at wavelength of 516 nm. MT membrane potential was measured by assessing fluorescent change in the region of interest (ROI). The average change in Rhod-123 fluorescence of 5 neurons per coverslip were used as a single replicate where 6 coverslips were examined.
Intracellular ATP Assay
[0090] Live-cell ATP turnover was determined using a commercial ATP ELISA assay (Promega, Wisconsin, USA) following the manufacturer’s instructions. Briefly, N38 cells were
seeded at 10,000/well in a 96-well plate. The next day, cells were either treated with vehicle or TCAP-1 (100 nM) and lysed at 0, 15, 30 and 60m after treatment. Ultra-Gio™ recombinant luciferase was added to the media to determine ATP levels. Mono-oxygenation of luciferin is catalyzed by luciferase in the presence of magnesium, ATP and molecular oxygen. Thus, increases in luciferin fluorescence directly correlates to an increase in ATP levels. Fluorescence from blank wells were subtracted from all samples to account for any background noise. As the fluorescence signal naturally decays over the course of the experiment, TCAP-1 -treated cells were compared relatively to the vehicle-treated cells for each time point (n=8).
Resazurin NADH Assay
[0091] NADH turnover in N38 cells was assessed using a resazurin assay. N38 cells were seeded at 10,000/well in 96-well plates. The resazurin assay began the following day by adding the resazurin solution (525 nM, Sigma) to all the wells. Cells were treated with either vehicle or TCAP-1 (100 nM). Fluorescent readings were measured every 5m over 1 h, with excitation at 530 nm and emission read at 590 nm. Measurements of blank wells that contained no cells were subtracted from all readings.
Patch-Clamp Studies of Plasma Membrane Ion Flux
[0092] Ion flux across the plasma membrane was examined in spontaneously active AtT-20 corticotropic cells. AtT-20 cells were perfused via a gravity drip perfusion system at a rate of 2- 3 ml/m with physiological saline containing (in mM): 140 NaCI, 5 KCI, 1 MgCh, 25 HEPES, 10 glucose, 2 CaCh (2H2O) (pH 7.4, adjusted with 12N HCI; osmolarity 300 mOsmol (I solution)-1 at 22°C. Amphotericin B (200 pM) perforated patch clamp recordings were made using fire-polished 4-6 MQ borosilicate glass pipettes (Harvard Apparatus Ltd, Holliston, MA, USA). This technique was used because it is less invasive than whole cell patch clamp, and thus the intracellular signalling machinery is less disturbed and the cell is maintained in a metabolically active state (Liang and Shipstone, 2011 [46], [47]). Pipette solution contained (in mM): 135 potassium gluconate, 5 KCI, 2 MgCh, 10 HEPES, 0.01 CaCh (adjusted to pH 7.4 with 12N KOH; osmolarity 300 mOsmol (I solution)-1). A Ag-AgCI electrode connected to a CV-203BU headstage, and an Axon Axopatch 200B Microelectrode Amplifier (Molecular Devices, Sunnyvale, CA, USA) was inserted into pipettes. Recording pipettes were positioned using a motorized patch-clamp micromanipulator (Burleigh, PCS-6000 series, Thorlabs, Newton, NJ, USA). Following formation of a GQ seal and whole-cell capacitance compensation, typical access resistance (Ra) was 25 - 50 MQ. Ra was determined before each measurement and recordings were discarded if Ra
changed by more than 20% or whole-cell leak currents changed by more than 30 pA during the course of the experiment. Current voltage relationships were assessed in voltage clamp configuration by holding neuron membrane potential at -80 mV and stepping the voltage in 10 mV increments lasting 250ms each. Current amplitudes were measured between 200 and 220 ms to avoid any capacitance effects. Spontaneously firing neurons were recorded from in the current clamp configuration with l=0. The resultant data were analyzed using Clampex 10 software (Molecular Devices).
[0093] Following the establishment of the patch, a 60-s recording was made. Measurements of electrophysiological variables were taken during the last 30s of the recording, with the exception of the AP frequency data which were taken over the entire 60s of the recording. Next a 5 m vehicle baseline measurement was established. This was performed to confirm that baseline measurements were not changing and that the patch access had stabilized. As in the initial 60s recording, the data was obtained over the last 30s of the recording, with the exception of the frequency data which was taken over the last 60s. After the 5m vehicle baseline measurements, three 5-m treatment recordings were made. The treatment (TCAP-1 (100 nM) or CRF (100 nM) was initiated at 30s (of the first 5m treatment recording) and as in the 5 m baseline measurement the measurements were made over the last 30s of the recording and frequency data taken over the last 60s of the recording.
Statistical Analyses
[0094] All summary data on graphs are represented as mean +/- SEM. All data were analyzed by a one-way ANOVA followed by a Tukey’s post-hoc test, as described within each figure caption. Mean values were obtained from a minimum of four independent experiments and data were considered statistically significant with an p priori hypothesis of P < 0.05 (***P < 0.001, **P < 0.01 or *P < 0.05).
EXAMPLE 1 : siRNA KNOCKDOWN OF TENEURIN AND TCAP
[0095] Initial experiments, using the N38 hypothalamic cell model, were designed to establish that the TCAPs were essential for normal cellular growth and viability. siRNA oligonucleotides were designed to knockdown TCAP gene expression and cell viability was assessed (Figs. 1 and 2). Both siRNA vectors (p270 and p721) down-regulated TCAP and teneurin expression in N38 cells (Fig. 2A-C). The TCAP-3 and teneurin-3 message was reduced to about 20% of the control values whereas the p270 vector was effective at reducing TCAP-4/teneurin-4 mRNA levels to about 50% of the control values. The p721 vector showed a similar effect at reducing TCAP-4
levels but only reduced teneurin-4 levels to 70% of the control value. TCAP-2 and teneurin-2 mRNA was the least effective with p270 reducing TCAP-2 and teneurin-2 message to about 75 to 90% of the control values, respectively. The p721 vector had no significant effect on the teneurin-2 mRNA but reduced the TCAP-2 level to about 80% of the control value. Although N38 cells do not express either TCAP-1 or teneurin-1 in significant amounts, the inventors have previously shown that TCAP-1 can be used as a structural proxy for the other three TCAPs given the high level of sequence conservation among them.
EXAMPLE 2: ACTIONS OF TCAP ON CRF RECEPTORS
[0096] Having established that the teneurins and TCAP were required for cell viability, the inventors examined whether TCAP could directly modulate CRF receptor action. Although, it was established previously that TCAP’s actions are likely due to its binding and activation of the latrophilins (LPHN) (Husic et al., 2019; Silva et al., 2011 [PHNS, 17, 18]) it was not known whether TCAP can have a direct effect on CRF receptors (Fig. 3). To assess this, the inventors used a CRF receptor cAMP-responsive element (CRE)-containing promoter luciferase reporter assay in which activation of the CRF receptor leads to activation of the CRE and an increase in luminescence. CRF treatment at 10'9M significantly increased activation of the cAMP response element above basal conditions via CRF receptor 1 (R1) (Fig. 3A) and CRF receptor 2 (R2) (Fig. 3B). Results were analyzed using a one-way analysis of variance (p<0.0001). The results confirm the validity of the assay and that CRF activates the CRE via the CRF receptor. However, TCAP- 1 alone had no effect on CRE activation via CRF R1 or R2 compared to basal conditions and, moreover, when TCAP-1 and CRF were added together , it did not have a modifying action on the CRF-induced CRE response. The results suggest that TCAP-1 does not modify the CRF- induced activation of CRE. Similarly, TCAP-1 did not reduce the Ca2+ response with respect to the FLIPR analyses when administered to the CRF receptors. TCAP-1 showed no agonism of the CRF1 receptor with a value of -0.6 ± 0.1% and 0.1 ±0.6% for the CRF1 receptor at 1 and 100 nm, respectively. Similarly, there was also insignificant agonist actions on the CRF2 receptors with - 1.6 ± 0.3% and 1.7 ± 0.1% activity at 1 and 100 nm, respectively. The potential antagonistic actions of TCAP-1 on these receptors rendered a similar insignificant action where the inhibition of the CRF1 response was only 2.3 ± 2.7% and 3.4 ± 1.9% for 1 and 100nM respectively, and for the CRF2 response, a suppression of only 8.3 ± 0.6% and 6.6 ± 3.6%, respectively. They indicated that no significant inhibitory action on the CRF receptors occurred as a result of possible TCAP- 1 interaction. Thus, together both the reporter gene and FLIPR studies indicates that it is unlikely that TCAP-1 binds directly to the CRF receptors.
EXAMPLE 3: TCAP AND CRF MODULATES INTRACELLULAR CALCIUM (Ca2+) FLUX
[0097] Because previous studies indicate that that the CRF1 receptors are associated with anxiety-increasing properties, whereas TCAP-1 had an opposing action, studies to determine the intracellular Ca2+ response were conducted to see if TCAP-1 could antagonize CRF at this signal transduction level. These studies also utilized the N38 neuronal model. Using the Fluo-4, initial dose-response studies established that both TCAP-1 and CRF induced a Ca2+ response at physiological concentrations (Fig. 4A,B). Increasing CRF concentrations from 0.01 nM to 100 nM produced a increasing dose-response curve with a half-maximal effective concentration (ECso) of 0.008 nM and a maximal effective concentration (ECwo) of 100nM. In contrast, increasing TCAP concentrations from 0.01 nM to 100 nM had the opposite action leading to decreases in intracellular Ca2+ that produced an a ECso of -0.1 nM and an ECwo of -1 nM1 . We next assessed the interactive responses of intercellular Ca2+ following CRF and TCAP-1 treatment (Fig. 4C-E). Cells were first perfused with artificial cerebral spinal fluid (ACSF) for 5m until a steady-state fluorescence baseline (Fig. 4C-I). Next, cells were treated for 10m with CRF (Fig. 4 C-ll; 100 nM), sc-TCAP-1 (Fig 4C-III; 100 nM), or TCAP-1 (Fig. 4C-IV; 100 nM). Treatment with either ACSF or Sc-TCAP did not change Fluo-4 fluorescence relative to pre-treatment levels (n = 6 each; P = 0.9184 and P = 0.39874, respectively, paired t-tests; Fig. 4C-I, -III; D,E). However, CRF induced a rapid (30s) increase in fluorescence. Compared to pre-treatment baseline, there was a 27.1 ± 2.4% increase in fluorescence intensity after 10m (n = 5, p = 0.0011 , Fig. 4 C-ll; D,E). Conversely, TCAP-1 treatment decreased fluorescence by 12.1 ± 1.7% compared to pre-treatment baseline (n = 6, p =0.0156, Fig. 4 C-IV; D,E). The time to onset of fluorescence decrease was between 30 and 60s.
EXAMPLE 4: TCAP ANTAGONIZES CRF-MEDIATED INCREASES IN INTRACELLULAR CALCIUM ( Ca2+)
[0098] The previous experiments established that TCAP-1 and CRF differentially modulate intracellular Ca2+ when they were individually applied to N38 cells. This is plausible because CRF1 and LPHN receptors both activate intracellular Ca2+ signalling pathways. However, TCAP- 1 has been shown to antagonize CRF actions in both in vivo and in vitro studies leading to the possibility that cells treated with a combination of CRF and TCAP-1 could have a unique Ca2+ response due to convergence of Ca2+ signalling pathways To investigate this potential interaction, cells were perfused with ASCF for 5m, followed by CRF (1 nM) for 5m, and then by a co-treatment with the second peptide. A double CRF treatment (CRF + CRF, bath and perfusion system, respectively) resulted in a 28.4 ± 1.4% increase in Fluo-4 fluorescence compared to pre-treatment
baseline (p = 0.0001 ; n = 5; Fig. 5A-I; B,C). To confirm that TCAP-1 specifically antagonizes CRF, we next treated cells with CRF followed by a secondary application of TCAP-1. Compared to the CRF + CRF treatment, a secondary perfusion of TCAP-1 decreased the rate of fluorescence increase by 65% relative to the CRF response (P = 0.008 unpaired t-test; n = 5 each; Fig. 5A-II; B,C), and after 5m there was a significant decrease in intracellular Ca2+ fluorescence (p=0.0004), demonstrating an antagonistic effect of TCAP-1 on CRF-mediated Ca2+ signalling. To confirm that TCAP-1 -mediated decreases in Ca2+ were not due to CRF wash off we also treated cells with CRF and the negative control peptide, sc-TCAP-1. Relative to baseline, fluorescence intensity increased by 25.2 ± 1.4%, which is not different from the CRF-mediated change fluorescence (p = 0.5786; n = 5; Fig. 5A-II, III; B,C).
[0099] The previous set of experiments showed that TCAP-1 inhibits CRF-induced intracellular Ca2+ concentrations. The next set of experiments assessed if a pre-treatment with TCAP-1 inhibits the subsequent CRF-mediated Ca2+ actions. Control experiments showed that a TCAP-1 + TCAP-1 experimental protocol led to a 9.14 ± 0.94% decrease in Fluo-4 fluorescence compared to pre-treatment baseline (n = 5; Fig. 6 A-l; B,C). A secondary treatment with scTCAP- 1 also did not change fluorescence compared to the TCAP-1 + TCAP-1 regimen (p = 0.4044) (Fig. 6 A-ll; B,C). These studies indicate that CRF does not antagonize the TCAP-1 mediated decrease in intracellular Ca2+ when the cells are pre-treated with TCAP-1. However, when a 5m perfusion of TCAP-1 was followed by a 5m perfusion of CRF there was only a 10.48 ± 2.1% decrease in Fluo-4 fluorescence compared to baseline (n = 4; Fig. 6 A-lll; B,C). This is not different then the effect of TCAP-1 + TCAP-1 (P = 0.4997; unpaired t-test), indicating TCAP-1 treatment prevents the CRF-mediated Ca2+ increase. Thus, whereas TCAP can inhibit the CRF- mediated rise in intracellular Ca2+, CRF does not inhibit the TCAP-1-mediated decrease in intracellular Ca2+. These data indicate that TCAP-1 and CRF are not competing on the same set of Ca2+ -associated channels.
EXAMPLE 5: TCAP-1 STIMULATES CALCIUM EFFLUX TRHOUGH THE PLASMA MEMBRANCE
[00100] Given these findings, the next goal was to identify the Ca2+ channels targeted by TCAP. The general identification of the Ca2+ channels targeted by TCAP-1 was established using a number of pharmacological blocking agents (Table 2). The first inhibitor used was a general Ca2+channel inhibitor, ruthenium red (RuR) (Fig. 7 A-l; B,C). Similar to previous experiments N38 cells were loaded with Fluo-4 for 30m followed by a 15m wash in ACSF. In cells pre-treated with RuR, although the 10m TCAP-1 exposure (100 nM) increased slightly (1.3 ± 0.4%) relative to the
pre-treatment baseline (p = 0.0424; paired t-test; n = 5; Fig. 7 A-l; B,C), indicating a minor inhibition of the RuR-mediated Ca2+ response, it was vastly reduced from the TCAP-1 response indicated in Fig. 6.
[00101] Next, the possibility that TCAP-1 may be acting on plasma membrane (PM) Ca2+ channels was investigated by treating the cells with benzamil (BZ) which primarily targets the Na+/Ca2+ exchanger (NCX) found in the neural PM. To determine if NCX plays a role in such TCAP-1-mediated Ca2+ actions, the inventors inhibited cellular NCX activity with BZ (10 pM), using the same protocol as the RuR experiments. Again, a 10m treatment with TCAP-1 did not display the expected cytosolic Ca2+ decrease (p = 0.9169; paired t-test; n = 6 each; Fig. 7A-II; B,C) as compared with the profile indicated in Fig. 6AI-II, where the cytosolic TCAP-mediated Ca2+ response was not statistically different from that of the controls. These data confirmed that the RuR studies TCAP-1 was acting on the PM and possibly mitochondrial (MT) Ca2+ channels, although it could not discount the possibility that TCAP-1 may also act on PM Na+ channels.
[00102] The endoplasmic reticulum (ER) plays a critical role in cell Ca2+ regulation and a high ER Ca2+ concentration is primarily the result of activity of the sarco/endoplasmic reticulum Ca2+- ATPase (SERCA) pump. Conceivably, TCAP-1 could decrease intracellular Ca2+ by stimulating SERCA pump activity. To test this, cells were treated with the SERCA pump inhibitor, thapsigargin (TGX), for a total of 20m prior to TCAP-1 treatment (Fig. 7A-III; B,C). When cells were treated with TCAP-1 for 10m there was a 21.7 ± 2.6% decrease in intracellular Fluo-4 fluorescence, a 2- fold larger decrease then TCAP-1 alone (Fig. 7B,C). This is likely due to the combined actions of the initial cytosolic depletion of Ca2+ by the pre-treatment of TGX, and by the TCAP-1 -mediated removal of inhibition of PM-associated Ca2+ efflux and MT-mediated Ca2+ influx suggested by the RuR and BZ studies described above. Thus, this experiment indicates that TCAP-1 does not have a direct action on the SERCA pumps
[00103] Subsequently, the effect of inhibiting Ca2+-ATPases (PMCA) using vanadate (VDT) (500 pM) was examined. It should be noted that VDT can also inhibit the Na+/K+ ATPase (see Discussion). In cells pretreated with VDT, a 10m TCAP-1 treatment resulted in a 19.9 ± 5.5% increase in intracellular Fluo-4 fluorescence, relative to baseline (p = 0.0362; paired t-test; n = 4; Fig. 7A-IV; B,C), indicating that inhibition of PMCAs also partially prevents the TCAP-1 mediated decrease in intracellular Ca2+ by possibly stimulating PMCA action to increase Ca2+ efflux out of the cell.
EXAMPLE 6: TCAP-1 ANTAGONIZES CRF ACTIONS IN MITOCHONDRIA (CRF-MEDIATED INCREASES IN CYTOSOLIC CALCIUM)
[00104] The studies presented above show that TCAP-1 may also act on MT Ca2+ channels in addition to PM sites. To determine whether MT Ca2+ levels change with TCAP-1 , the MT- associated Ca2+ dye, Rhod-2 was used. Rhod-2 fluorescence increases in intensity when bound to Ca2+.
[00105] It was first confirmed that MT-bound Rhod-2 fluorescence was stable under the 15 min. experimental timeline (Fig. 8A;B-I). Following the establishment of the ACSF baseline, a sham switch to a second ACSF treatment did not change Rhod-2 fluorescence (p = 0.1019; n = 4, Fig. 8 B-l).
[00106] Next the effect of TCAP-1 on MT Ca2+ levels was assessed. A 10m treatment with TCAP-1 (100 nM) increased Rhod-2 fluorescence by 12.5 ± 3.1% relative to baseline (p = 0.0423; n = 4; paired t-test; Fig. 8 B-ll; C; D. A 10 min. application of CRF (1 nM) by itself led to a 30 ± 4.3% decrease in Rhod-2 fluorescence relative to pre-treatment baseline (p = 0.003; n = 4; paired t-test; Fig. 8 B-lll; C,D).
[00107] To determine if TCAP-1 can prevent CRF-mediated changes in MT Ca2+ levels, cells were pre-treated with TCAP-1 prior to a 10 min. CRF treatment. A pre-treatment of TCAP-1 followed by a 10 min. CRF treatment resulted in a 3.5 ± 2.2% insignificant increase in Rhod-2 fluorescence relative to baseline (p = 0.1580, n = 5; paired t-test; Fig. 8 B-IV; C,D) indicating that TCAP-1 can prevent CRF-mediated changes in MT Ca2+ and demonstrating that there is an opposing interaction between these two peptide signalling systems at the level of the MT.
[00108] To assess if the TCAP-1 mediated increase in MT Ca2+ modulates MT polarization MT membrane potential (M^m) was next assessed using rhodamine -123 (Rhod-123). For these experiments, Rhod-123 was loaded into cells and analyzed in quench mode (Brand and Nicholls, 2011 [48]). Therefore, an increase in Rhod-123 fluorescence indicates depolarization of the MT membrane potential. In ASCF control experiments, Rhod-123 fluorescence remained unchanged over 15m (p = 0.3424, paired t-test; n = 4, Fig. 9 B-l; C). A 10 min. treatment with TCAP-1 decreased Rhod-123 fluorescence, indicating hyperpolarization of the MT matrix. A maximal decrease of 14.8 ± 2.0% occurred 4.5m after TCAP-1 application started, and was significantly different from baseline values (p = 0.013; paired t-test; n = 5, Fig. 9 B-ll; C,D). Conversely, CRF (1 nM) increased Rhod-123 fluorescence, relative to baseline, with a maximal increase of 15 ± 2.3%, 5.5 min after the start of CRF perfusion (p = 0.0114; paired t-test; n = 4, Fig. 9 B-lll; C,D). Treatment with sc-TCAP-1 did not change fluorescence intensity significantly relative to pretreatment values (p = 0.0654; paired t-test; n = 4, Fig. 9 B-IV; C,D). Repeating this experiment
with a 20 min. TCAP-1 pre-treatment (100 nM) resulted in a fluorescence increase of only 3.6 ± 0.9% at 5.5m, which is not different from baseline (p = 0.1058; paired t-test; Fig. 9 B-V). However, this effect is significantly different from the CRF-only treated cells (p = 0.0123; unpaired t-test), (Fig. 9B-V) indicating that a pre-treatment with TCAP-1 prevented the CRF-induced increase in fluorescence.
EXAMPLE 7: TCAP-1 ENHANCES CELLULAR ENERGY PRODUCTION
[00109] To test if increased MT Ca2+ uptake and the resulting hyperpolarization enhance senergy production, NADH turnover using a resazurin assay was first assessed. Application of TCAP-1 (100 nM) significantly increased resorufin (RSF) fluorescence compared to vehicle- treated cells after about 20m (p<0.01), and after 60m RSF fluorescence was two-fold higher (p<0.0001) in TCAP-1 treated cells (Fig. 10A). CRF also increased RSF fluorescence with a 1.5- fold increase (p<0.0001) over the vehicle baseline at 60m (Fig. 10A), however, the rate of NADH production was significantly higher in TCAP-1 -treated cells than in CRF- or vehicle-treated cells (Fig. 10B). TCAP-1 increases the rate of RSF fluorescence increase over both CRF and vehicle within 20m, where the rate of NADH production remained elevated for more than 50m. To determine whether TCAP-1 -induced NADH turnover translates into increased cellular ATP energy production, intracellular ATP concentration was measured using an ATP ELISA assay. Both peptides showed a maximal ATP increase around 30m where the TCAP-1 mediated response was about twice that of CRF (p<0.05) compared to the vehicle response (Fig. 10C).
EXAMPLE 8: TCAP-1 AND CRF MODULATE AtT-20 ELECTRICAL ACTIVITY
[00110] The previous studies using pharmacological modulators indicate that TCAP-1 regulates plasma membrane (PM) ion channel flux. Therefore, patch-clamp electrophysiology methods were used to further investigate this aspect of TCAP-1. AtT-20 cells were used as an alternative cell model (see Discussion). AtT-20 cells originate from the anterior pituitary, have been utilized in previous electrophysiology studies, respond to CRF and secrete ACTH (See Discussion). A PCR screen confirmed the presence of CRF1 receptors in these cells along with the expression of teneurins 1-3, TCAPs 3 and 4 and the putative receptors of teneurins and TCAPs, latrophilins-1 and -3 (Fig. 11 A).
[00111] Spontaneously active AtT-20 cells, as well as primary corticotropes, exhibit a variety of firing patterns consisting of a mix of action potentials (primarily Na+ conductance) and pseudoplateau bursts (primarily Ca2+ conductance) (Adler et al., 1983 [49]). Thus, in the next set of experiments, AtT-20 cells were passively recorded using spontaneously active AtT-20 cells
following a 15 min. treatment with either vehicle (aCSF), TCAP-1 or CRF- treatment. Under baseline conditions (aCSF), pseudo-plateau burst duration (1692 ± 58 ms to 1545 ± 89 m; n = 4) frequency (0.3 ± 0.1 Hz to 0.3 ± 0.1 Hz; n = 4), and interburst interval (1380 ± 602 ms to 1223 ± 400 ms; n = 4) did not change over the recording period (Fig. 11B-I). A 15m treatment with TCAP- 1 (100 nM) decreased burst duration by 63% (from 2032 ± 570ms to 753 ± 74 msec; n = 6), within 30-60s of treatment onset. Burst frequency increased (from 0.42 ± 0.1 Hz to 0.52 ± 0.2 Hz; n = 6) and there was a decrease in the interburst interval (from 1449 ± 593 ms to 645 ± 277 ms; n = 6) (Fig. 11 B II).
[00112] Subsequently, AtT-20 cells were treated with either a stimulatory (1 nM) CRF dose or an inhibitory (100 nM) CRF dose. A 15m treatment with 1 nM CRF increased the duration of pseudo-plateau bursts by 12% (from 1849 ± 193 ms to 2068 ± 83 ms; n = 4; Fig. 11B III), burst frequency increased by 50% (from 0.4 ± 0.1 Hz to 0.6 ± 0.1 Hz; n = 4), indicating increased intracellular calcium activity (Fig. 11 B III). Treatment with an inhibitory dose of CRF (100 nM), led to a rapid inhibition of pseudo-plateau bursts (Fig. 11- IV). These data indicate that TCAP-1 has the potential to affect PM polarization in a different manner than CRF. In corticotropes, the involvement of Ca2+ in CRF-mediated ACTH release has been well established (see Discussion). [00113] To probe the mechanism of TCAP-1 mediated electrical suppression membrane potential over 15 minutes (“min”) TCAP-1 treatment was assessed. These experiments were performed in electrically quiescent AtT-20 cells which have been reported to have a resting membrane potential (RMP) of -30 to -70 mV (Adler et al., 1983 [49]). Under baseline conditions (aCSF), a sham switch did not modulate RMP which remained steady at about -40 mV (Fig. 11C- I). A 15m TCAP treatment (100 nM) hyperpolarized membrane potential (from -42.1 ± 2.2s to - 54.0 ± 3.2 s; n = 4; Fig. 11 B-III), and membrane potential remained hyperpolarized for at least 10 min following reperfusion with aCSF. Next the effect of TCAP on whole cell current voltage relationship was investigated. A 15 min TCAP-1 treatment increased outward current in the -50 to -20 mV range (Fig. 11C-II).
DISCUSSION
[00114] The following non-limiting discussion of the results is provided.
[00115] The rationale of the studies in the examples was based on two main premises. The first aspect was that TCAP-1 showed antagonism of CRF action in vitro and in vivo. The second element was that CRF, teneurins and aLTX are all implicated in intracellular Ca2+ flux. As such, the present examples show that the TCAP region of the teneurins may have an independent Ca2+ regulating ability, separate from the teneurin proteins. This hypothesis was examined using a
synthetic version of TCAP-1 based on the genomic structure of teneurin-1 that has been used successfully in the past. In this study, it was shown that TCAP-1 is important for cell vitality as it inhibits the Ca2+ response stress-inducing peptide of CRF; and has a specific action on regulating the PM-, ER- and MT-based Ca2+ channels and transporters. Together, these data show that TCAP-1 has a biological action independent from the teneurins and may play a role in the regulation of cell and organismal stress.
[00116] Given that intracellular Ca2+ regulation is essential for cell survival and vitality, the inventors’ attenuated teneurin and TCAP mRNA expression using a set of oligonucleotides designed to target the conserved elements of the mRNA associated with the TCAP region of the teneurin transcripts. To establish that the teneurins and TCAPs play a role in cell vitality in the immortalized hypothalamic N38 cells in this study, the expression of the endogenously expressed TCAPs was inhibited using siRNA oligonucleotides. This resulted in significantly reduced growth characteristics of the cells (Fig. 2). However, although the oligonucleotides, inhibited the expression of the TCAP transcript, they also had an attenuating action on the teneurins. These studies indicated that the TCAP region of the teneurins was important for cell vitality that was previously posited regarding early evolving peptide and protein systems in animals [35] and the importance of teneurin gene in development [6,7],
[00117] Previous studies indicated that TCAP-1 inhibits CRF action in vivo. Intracerebroventricular (ICV) TCAP-1 administration into rats ablates the CRF-mediated cFos protein expression response in the limbic regions [41] and significantly reduces the CRF-mediated actions on the acoustic startle response (ASR) [2,37], open-field, elevated plus-maze [36,37,50,51] and cocaine-seeking [38-40] models of behaviour [52], CRF has been implicated an increase of these behaviours via cAMP and Ca2+ mediated intracellular responses [42-44, 46,47,52-54], It was previously shown that TCAP-1 and -3 has a minor action on cAMP [1 , 2, 36], In this current study, however, there was no TCAP-1- mediated cAMP response due directly to TCAP-1 actions on the CRF receptors.
[00118] Together, these current studies indicated that TCAP-1 was acting on a receptor system distinct from that of the CRF receptors. Thus, the TCAP-1 antagonism of CRF may be related to the attenuating interaction of TCAP-1 and CRF intracellular Ca2+ pathways. Interestingly, TCAP has some sequence similarity to the CRF peptide family and also the calcitonin and secretin peptide families [3,5], The Secretin Family of peptides have a major primary sequence similar to the a-latrotoxins (aLTX) [20] indicating that they may be phylogenetically related. This toxin achieves its actions by inducing a robust intracellular Ca2+ response. The endogenous vertebrate receptor for aLTX was identified as the latrophilins [56] a
G-protein coupled receptor (GPCR) originally thought to be part of the Secretin Family of GPCRs but was established to be part of the Adhesion Family of GPCRs (ADGRL) [19,23] where the Secretin family of receptors likely evolved from an Adhesion-like GPCR ancestor. Since then, it has been established that the teneurins are likely cognate receptors of the latrophins [18,55,56], The latrophilins possess a conserved hormone-binding domain (HBD) originally defined in CRF receptors [22] and found in most Secretin family of GPCRs [19,23],
[00119] There is evidence that TCAP-1 activates the LPHNs [14,17,18] resulting in the regulation of cytosolic Ca2+ concentrations. LPHN-1 was originally discovered as a high-affinity receptor for aLTX [56], Given that the primary structure of the TCAP family of peptides is also similar to that of the Secretin-related peptides [5] and also regulates Ca2+ in neurons [14], it was postulated that TCAP-1 may regulate CRF actions by antagonizing the CRF-associated Ca2+ response. However, given the sequence similarity among the TCAP and CRF paralogues, the possibility that TCAP may act as a competitive antagonist of CRF at the receptor level could not be discounted. The present studies however show that TCAP does not act on the CRF receptor. Because an increase in intracellular Ca2+ is an important down-stream response following activation of the CRF1 receptor, it is likely that there is an interaction between TCAP and CRF at the level of intracellular Ca2+ flux.
[00120] Based on these previous studies, the interaction of TCAP-1 and CRF was examined with respect to intracellular Ca2+ flux in the N38 cell model using Fluo-4 as an indicator of cytosolic Ca2+. Importantly, the cell line shows the validity of this model given that both TCAP-1 and CRF show an ECso activity within a physiological range (Fig. 4), albeit, in opposite directions, whereas CRF increases cytosolic Ca2+ and TCAP significantly reduces its cytosolic concentrations. However, it was not clear form these studies as to how TCAP-1 could block the CRF-mediated cytosolic Ca2+ decrease. Thus, the cells were pretreated with either CRF or TCAP-1 (Figs. 5 and 6). In both situations, the presence of TCAP-1 could significantly reduce the CRF-associated rise in cytosolic Ca2+.
[00121] These studies indicate that TCAP-1 clearly regulates Ca2+ concentrations in the cytosol. Previously, the inventors showed that TCAP-1 activates an IP3-DAG signal transduction pathway associated, in part, with Ca2+, although it was not clear as to which Ca2+ channels and transporters were affected. Previously, it was shown that TCAP-1 regulates Ca2+ concentrations in immortalized neurons [14] although it was not clear which Ca2+ channels and receptors are associated with this mechanism. Therefore, in this current study, a number of pharmacological antagonists were used to probe the identity of the key Ca2+ regulating mechanisms. It is important to note that these studies were performed in unstimulated cells to provide an understanding of
TCAP-1 under basal conditions. Ruthenium red (RuR), an inorganic dye [57], has a number of actions including inhibition of the MT Ca2+ uniporter, and blocking Ca2+ uptake and release from the MT. In addition, RuR inhibits Ca2+ release from ER, prevents Ca2+ release from ryanodinesensitive intracellular ER and MT stores, and inhibits PM Ca2+channels, including channels of the Transient Receptor Potential Vanilloid (TRPV) family [58,59], In the present study, prior treatment with RuR inhibited the TCAP-1 induced reduction in cytosolic Ca2+ concentrations to baseline levels indicating that it was likely inhibiting the Ca2+ efflux sites from the cytosol. This typically includes extrusion from the PM, or importation into the organelles such as the ER or MT but may have a secondary action by inhibiting Ca2+ release from the ER.
[00122] An essential cellular mechanism for removing Ca2+ from the cytosol involves the Na+/Ca2+ exchanger (NCX) [60], NCX exchangers, exchange 1 Ca2+ ion for 3 Na+ ions and, under typical baseline conditions, this removes Ca2+ from cells, but depending on the Na+ gradient, can work in both a forward or reverse direction. The NCX works with the PM Ca2+ ATPase (PMCA) to keep cytosol concentrations of Ca2+ low. The exchanger is expressed in its highest concentration in the PM (NCX transports Ca2+ out of the cell) and MT (NCX transports Ca2+ out of the MT matrix where it helps maintain low MT Ca2+) of excitable cells. To examine this potential action, the cells were treated with benzamil (BZ) a synthetic amiloride-related blocker of NCX and ENaC (epithelial sodium channel) channels [61-63], In this study, this inhibitor again inhibited the TCAP-1 reduction in cytosolic Ca2+ thus corroborating the actions of RuR, suggesting that the primary action of TCAP-1 was on PM and MT Ca2+ channels. However, given the action of BZ on ENaC channels, we could not ignore the possibility that TCAP-1 may also affect Na+ channels (see below).
[00123] These studies indicate that, although TCAP-1 may act via PM and MT Ca2+ channels, both RuR and BZ have limited actions of the Ca2+ channels of the ER and, therefore, this possibility could not be discounted. Thapsigargin (TGX) is a plant-derived non-competitive inhibitor of the SERCA pumps [64] thereby increasing cytosolic Ca2+ concentrations by blocking the SERCA-mediated uptake of Ca2+ [65], In the experimental design of the present application, the N38 cells were first treated with TGX to prevent ER Ca2+ uptake, then treated with TCAP-1. If it is assumed that TCAP-1 reduces cytosolic Ca2+ concentrations by Ca2+ influx into the MT and efflux through PM Ca2+ channels, then this may explain the greater reduction of cytosolic Ca2+ of TGX and TCAP-1 together in comparison to TCAP-1 alone as TCAP-1 was acting, in part, to target Ca2+ uptake in the MT and likely other sites. Previously, ER-stress generated by increased cytosolic Ca2+ concentrations in mouse embryonic fibroblasts increased teneurin-4 (DOC4; downstream of CHOP) transcription [66] suggesting that teneurins and, hence, TCAP-1 , may act in part, to protect the cells against high cytosolic Ca2+ insult by reducing cytosolic Ca2+
concentrations perhaps in the manner indicated by the current data. However, given the time scale of the present study, the possibility that TCAP-1 was inducing increased transcription of additional teneurin genes does not seem likely. In any case, the present study indicates that TCAP-1 actions on SERCA pumps do not have a direct impact.
[00124] Vanadate (VDT) is anionic vanadium complex that inhibits PM Ca2+ ATPases (PMCA) and Na+/K+ ATPases, but not SERCA pumps [67-69], It was postulated that if TCAP-1 acted to stimulate SERCA pumps, then the treatment of VDT may reduce intracellular Ca2+. In fact, this was not the case. The treatment of VDT not only inhibited the TCAP-1 cytosolic depression of Ca2+ concentrations but induced a significant rise well beyond the control levels indicating that VDT was blocking the TCAP-1 mediated Ca2+ via PMCA channels. Thus, the VDT data corroborates the RuR, BZ and TGX studies that TCAP-1 reduces cytosolic Ca2+ concentrations by regulating PM and MT Ca2+ channels.
[00125] Although these studies provide an indication of the various Ca2+ channels and transporters that TCAP-1 may target, they represent the action of TCAP-1 under these in vitro conditions. One of the critical aspects to consider is that these pharmacological analogues are evolutionarily unique to the organism and are likely perceived by the cell as a potential toxic xenochemicals and, therefore, have the potential to induce a cellular stress response. Whilst the present studies provide essential information on how TCAP-1 may regulate Ca2+ in these cells (HEK-293TI; N38; AtT-20), the model more likely suggests the actions of TCAP-1 during a stressful response of these cell lines. Thus, the studies in the current examples identify the Ca2+- based mechanism that TCAP-1 may regulate.
[00126] Previous studies have shown that TCAP-1 increases glucose uptake and oxidative energy production in the CNS and N38 cells [14], In neurons, this glucose increase coincides with a decrease in intracellular lactate and pyruvate, indicating that MT activity is likely increased with TCAP-1. Because MT play a major role as a Ca2+ storage and signalling organelle, where the uptake of Ca2+ is associated with increased cellular energy production, it is possible that TCAP-1 activates MT Ca2+ uptake. Therefore, rhodamine-2 (Rhod-2), an organic dye was used to localize Ca2+ in the MT [70], This study showed that, whereas TCAP-1 increased Ca2+ into the MT, CRF reduced Ca2+ influx into the MT. When TCAP-1 was pre-treated with the cells, it ablated the CRF- mediated decrease in MT Ca2+ concentrations (see Fig. 8) leading to an increase in MT Ca2+ stimulated electron transport chain (ETC) enzyme activity, resulting in increased MT proton (H+) pumping and the subsequent generation of a hyperpolarized MT membrane potential [71], To test the hypothesis that TCAP-1 , by increasing Ca2+ concentrations could also regulate MT membrane potential, Rhod-123 was utilised, the cationic dye that is used as a measure of MT membrane
polarization [72] as Rhod-123 concentrates in membranes in a polarization-dependent manner [73], In the present experiments, TCAP-1 treatment decreased Rhod-123-associated fluorescence indicating hyperpolarization of the MT matrix whereas CRF, increased the fluorescence showing that it induced depolarization. However, when the cells were pretreated with TCAP-1 , the CRF-induced depolarization action was ablated (see Fig. 9). These studies corroborate with those indicated in Fig. 8 (discussed above) that TCAP-1 acts to import Ca2+ into the MT whereas CRF inhibits this uptake. The decrease in Ca2+ by CRF in the current study is consistent with previous studies. TCAP-1 -mediated increases in MT Ca2+ and hyperpolarization of MT membrane to potentiate energy production in N38 cells by stimulation of the ETC. This was examined first using a resazurin assay to measure NADH production. In this assay, non- fluorescent resazurin is reduced to fluorescent resorufin (RFN) by NADH to NADPH [74,75], Although both TCAP-1 and CRF increased RFN-based fluorescence, the TCAP-1 response was greater and more rapid than the CRF response (Fig 10 A,B). A similar situation occurred with ATP production (Fig.lOC). Although it is not clear how this action is translated directly under in vivo conditions, it does further indicate antagonism between TCAP-1- and CRF- mediated actions. [00127] There are few studies to link CRF and its paralogues directly on MT function. In one such study, CRF induced CRF1 receptor activation related MT morphology through an NF-KB associated mechanism [76] although CRF may have a direct role on MT ROS production [77], This could also lead to the dose-dependent increase in ATP production previously reported in the N38 cells [14], Urocortin, a direct paralogue of CRF [78-81], can inhibit Ca2+ uptake in cardiac muscle MT by inhibiting the MT permeability transition pore (MPTP) although the exact mechanism by which this occurs is not known [82],
[00128] The pharmacological data obtained in this study indicate that Na+ and K+ currents along with Ca2+ flux across the plasma membrane may be involved with TCAP-1 action. This was examined in greater detail by patch-clamp analyses. Unfortunately, despite number attempts under different experimental conditions a strong and consistent patch-clamp of the N38 cells was not achieved. As a result, the investigation was continued using AtT-20 cells. This cell line has been used as an immortalized cellular analogue of pituitary corticotropes that secretes ACTH [83] and has been used extensively to understand CRF actions on pituitary ACTH release [84], CRF action on the pituitary corticotropes has been well studied in the past. In corticotropes, activation of the Gs-coupled CRF1 receptor by CRF leads to increases in cAMP production (via adenylate cyclase), activation of the CREB transcription factor and POMC transcription, and increased ACTH production. ACTH secretion can be stimulated by cAMP alone. CRF can be both stimulatory (low physiological dose, ~1 nM) and inhibitory (100 nM) depending on the
concentration. The ion channels and mechanisms controlling corticotrope excitability are still not well understood but they have been shown to involve Ca2+, Na+, and K+ channels [46,47,85,86], The experiments described herein however are the first to examine the TCAP-1 -mediated plasma membrane currents using patch-clamping methods. With respect to the spontaneous action potential (AP) it is not certain if AP’s are only Na+, Ca2+, or a combination of both. Zemkova and associates [86] showed that in corticotropes, with blocked Ca2+ channels fire Na+ spikes, whereas in cells with blocked Na+ channels, fire Ca2+ spikes. Therefore, the increase in TCAP-1- mediated spike frequency could be due to increased Na+ spike firing which might not significantly increase cytosolic Ca2+ levels and ACTH release. Pseudo-plateau bursting is a common firing pattern in many AtT-20 cells and primary corticotrope preparations; however, it is reported [86] and the present findings agree, that there is considerable variation in the frequency and duration of pseudo-plateau bursting events between cells which makes it challenging to assess the effect of a treatment on these events. Typically, ACTH secretion from corticotropes is typically linked to an increase in spike frequency. Due to the large variation in pseudo-plateau bursting durations between cells, data from each recording was normalized to its own baseline (duration of the last 10 events of the first 60s recording).
[00129] The goals of this current study were to identify the cellular targets associated with TCAP-1 action, and secondarily to develop a plausible mechanism to understand the TCAP-1 induced inhibition of the CRF response, in vivo. Discovered in 1994, ablation of the teneurin gene was shown to be embryonic-lethal in Drosophila [6,7], Since then, numerous studies indicated that the teneurins are required for the development and maintenance of the CNS in metazoans and vertebrates [87-89], At the distal extracellular tip, comprising the carboxy-terminus, lies a peptide sequence termed the ‘teneurin C-terminal associated peptide’ (TCAP) [1-3], Synthetic TCAP-1 plays a similar but independent role as the teneurins on neuronal development as indicated by its ability to increase neuronal outgrow, axon development and axon fasciculation in vivo and in vitro [36,50,51],
[00130] CRF is the seminal neuropeptide responsible for the regulation of the organismal stress response in the CNS, and for initiation of the hypothalamic-pituitary-adrenal/inter-renal (HPA/I) axis in vertebrates [14, 79, 80, 90, 91], Elevated CRF signalling and the consequent dysregulation of the HPA/I axis has been implicated in the onset of affective disorders, including major depression and anxiety, panic disorder, and post-traumatic stress disorder [52-54], Phylogenetically, CRF peptides are found throughout the Metazoa where they are present in four paralogous forms in vertebrates as well as orthologues in arthropods and molluscs [35, 79, 80,
92], Their primary structure is conserved throughout the Metazoa. Thus the present inventors identified the synthetic TCAP as a representative of an earlier evolving peptide lineage.
[00131] Although it was herein established that TCAP-1 has the potential to inhibit the CRF- directed cytosolic Ca2+ response, it is not clear how this interaction occurs with respect to specific Ca2+ channels and transporters in the various organelles. The present studies have concentrated on the PM, ER and MT with respect to TCAP action, such as TCAP-1 action. CRF was used as a proxy for its paralogues (urocortins 1-3 in mammals), and TCAP-1 as a model for its paralogues (TCAPs 2-4). The present studies focused on the CRF and the CRF1 receptor as this peptide- ligand system the primary stress-inducing pathway in the CNS and HPA axis [44, 91 , 93, 94], Urocortins -2 and -3, represent a secondary lineage from the CRF-urocortin line [81 , 81 , 95] but possess anti-anxiety actions via interaction with the CRF2 receptor [96-98], The interactive role of TCAP-1 and urocortins -2 and -3 has not been studied in vitro or in vivo. With respect to TCAP- 1 as an independent peptide, this current study and previous studies have shown that this region of the teneurins possesses numerous biological actions in vivo and in vitro actions independent from the teneurins (see above) although it has not been shown that TCAP exists as a free peptide in vertebrates and mammals, the present inventors have shown that synthetic TCAP, that derives from the carboxy terminal region of teneurins have said independent activity, preferably the synthetic TCAP with the N-terminal amino acid being pyrogluatmic acid. Due to structural (and sequence) similarity, the other paralogues of TCAP-1 (TCAPs 2-4) may be similarly active.
[00132] In summary, it is herein shown that CRF and TCAP-1 have opposing actions on the cytosolic Ca2+ response and are due to antagonizing actions of their cognate receptors given the present experimental design. It was also shown that TCAP-1 antagonism of the CRF response is independent of the CRF receptors but occurs downstream by its interaction with the regulation of intracellular Ca2+ flux to ultimately affect the action of MT activity. This study supports the hypotheses that: TCAP can modulate intracellular Ca2+ flux; it can inhibit CRF-associated activity by regulating in part the intracellular Ca2+ response and may regulate MT activity, and therefore, cellular energy metabolism by intracellular Ca2+ mobilization. Specifically, it has herein been established that TCAP modulates PM and MT Ca2+ flux by utilizing pharmacological blockers of Ca2+ channels. Moreover, novel evidence that this mechanism is antagonistic to the actions of CRF with respect to intracellular Ca2+ mobilization is herein provided. Finally, additional evidence is herein provided to support the actions of the MT-associated activation by TCAP-1 to induce increased energy production and the use of TCAP to antagonize CRF activity, especially with respect to cellular and mitochondrial calcium levels.
[00133] While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be appreciated by one skilled in the art, from a reading of the disclosure, that various changes in form and detail can be made without departing from the true scope of the invention in the appended claims.
[00134] All publications, patents, and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.
REFERENCES
1. X. Qian, D. Barsyte-Lovejoy, R.B. Chewpoy, L. Wang, N. Gautam, L. Wang, A. Al Chawaf, D.A. Lovejoy, Characterization of teneurin C-terminal associated peptide (TCAP)-3 from rainbow trout hypothalamus. Gen Comp Endocrinol 137 (2004) 205-216.
2. L. Wang, S. Rotzinger, D. Barsyte-Lovejoy, X. Qian, C.F. Elias, J.C. Bittencourt, A. De Cristofaro, N.C. Wang D. Belsham, F. Vaccarino, D.A. Lovejoy, Teneurin proteins possess a carboxy terminal corticotropin-releasing factor-like sequence that modulates emotionality and neuronal growth. Mol Brain Res 133 (2005) 253-265.
3. D.A. Lovejoy, A. Al Chawaf, A. Cadinouche, Teneurin C-terminal associated peptides: An enigmatic family of neuropeptides with structural similarity to the corticotrophin releasing factor and calcitonin family of peptides. Gen Comp Endocrinol 148 (2006) 299-305.
4. D.A. Lovejoy, L. De Lannoy, Evolution and phylogeny of the corticotropin-releasing factor (CRF) family of peptides: Expansion and specialization in the vertebrates. J Neurochem Anat 54 (2013) 50-56.
5. O.M. Michalec, B. Chang, N. Lovejoy, D.A. Lovejoy, Corticotropin-releasing factor (CRF) and its relationship to an ancient peptide family. Front Endocrinol 11 (2020) 529. doi. 10.3389/fendo.2020.00529.
6. S. Baumgartner, D. Martin, C. Hagios, R. Chiquet-Ehrismann, Tenm, a Drosophila gene related to tenascin, is a new pair-rule gene. EMBO J. 13 (1994) 3728-3740.
7. A. Levine, A. Bashan-Ahrend, O. Budai-Hadrian, D. Gartenberg, S. Menasherow, R. Wides, Odd Oz: a novel Drosophila pair rule gene. Cell 77 (1994) 587-598.
8. J. Li, M. Shalev-Benami, R. Sando, X. Jiang, A. Kibrom, J. Wang, et al., Structural basis for teneurin function in circuit-wiring: a toxin motif at the synapse. Cell 173 (2018) 735-748.
9. V.A. Jackson, D.H. Meijer, M. Carrasquero, L.S. van Bezouwen, E.D Lowe , C. Kleanthous, et al. Structures of Teneurin adhesion receptors reveal an ancient fold for cell-cell interaction. Nat Commun 9 (2018) 1079. doi: 10.1038/s41467-018-03460-0.
10. D. Chand, C.A. Casatti, L. De Lannoy, L. Song, A. Kollara, D. Barsyte- Lovejoy, et al., C- terminal processing of the teneurin proteins: Independent actions of a teneurin C-terminal associated peptide in hippocampal cells. Mol Cell Neurosci 52 (2013) 38-50.
11. T. Abramov, S. A. Saowaros, P. Mirella da Silva, T. Wang, M. Dove, W. O'Connor et al., Teneurin and TCAP phylogeny and physiology: molecular analysis, immune activity, and transcriptomic analysis of the stress response in the Sydney rock oyster (Saccostrea glomerata) hemocytes. Front Endocrinol 13 (2022) 891714. doi: 10.3389/fendo.2022.891714.
12. M. Colacci, R. De Almeida , D. Chand, S.R. Lovejoy , D. Sephton, B. Vercaemer, et al., Characterization of the teneurin C-terminal associated peptide (TCAP) in the vase tunicate, Ciona intestinalis’. A novel peptide system associated with energy metabolism and reproduction. Gen Comp Endocrinol. 15 (2015) 161-170. doi: 10.1016/j.ygcen.2015.01.021.
13. R.M. Reid, A.L. Reid, D.A. Lovejoy, P.R. Biga, Teneurin C-terminal associated peptide (TCAP)-3 increases metabolic activity in zebrafish. Front Mar Sci 7 (2021) 591160. doi.org 10.3389/fmars2020.591160.
14. D.W. Hogg, Y. Chen, A.L. D'Aquila, M. Xu, M. Husic, L.A. Tan, et al., A novel role of the corticotrophin-releasing hormone regulating peptide, teneurin C-terminal associated peptide 1 , on glucose uptake into the brain. J Neuroendocrinol 30 (2018) e12579. doi: 10.1111/jne.12579.
15. G. Trubiani, A. Al Chawaf, D.D. Belsham, D. Barsyte- Lovejoy. D.A. Lovejoy, Teneurin carboxy (C)-terminal associated peptide-1 inhibits alkalosis-associated necrotic cell death by stimulating superoxide dismutase and catalase activity in immortalized mouse hypothalamic cells. Brain Res 1176 (2007) 27-36.
16. R. Woelfle, A.L. D’Aquila, M. Husic ,T. Pavlovic, T, D.A. Lovejoy, Ancient interaction between the teneurin C-terminal associated peptides (TCAP) and latrophilin ligand-receptor coupling: A role in behavior. Front Neurosci 9 (2015) 146. doi: 10.3389/fnins.2015.00146.
17. M. Husic, D. Ba rsyte- Lovejoy, D.A. Lovejoy, Teneurin C-terminal associated peptide (TCAP)- 1 and latrophilin interaction in HEK293 cells: Evidence for modulation for intercellular adhesion. Front Endocrinol 10 (2019) 22. doi: 10.3389/fendo.2019.00022
18. J.P. Silva, V.G. Lelianova, Y.S. Ermolyuk, N. Vysokov, P.G. Hitchen, O. Berninghausen, et al., Latrophilin 1 and its endogenous ligand Lasso/teneurin-2 form a high-affinity transsynaptic receptor pair with signaling capabilities. Proc Natl Acad Sci 108 (2011) 12113-12118.
19. J. Hamann, G. Aust, D. Arae, F.B, Engel, C, Formstone , R. Fredriksson et al., International Union of Basic and Clinical Pharmacology. XCIV. Adhesion G protein-coupled receptors. Pharmacol Rev 67 (2015) 338-367.
20. G.G. Holz, J.F. Habener, Black widow spider alpha-latrotoxin: a presynaptic neurotoxin that shares structural homology with the glucagon-like peptide-1 family of insulin secretagogic hormones. Comp Biochem Physiol B Biochem Mol Biol 121 (1998) 177-184. doi: 10.1016/s0305- 0491 (98)10088-3.
21. V.G. Krasnoperov, M.A Bittner, R. Beavis, Y. Kuang K.V. Salnikow, O.G. Chepurny, Alpha- latrotoxin stimulates exocytosis by the interaction with a neuronal G-protein-coupled receptor. Neuron. 18 (1997) 925-37. doi: 10.1016/s0896-6273(00)80332-3.
22. M.H. Perrin, S. Sutton, D.L. Bain, W.T. Berggren, W.W. Vale, The first extracellular domain of corticotropin releasing factor R1 contains major binding determinants for urocortin and Astressin. Endocrinology 130 (1998) 566-570. doi: 10.1210/en.139.2.566.
23. R. Fredriksson, M.C. Lagerstrdm, L.G., H.B. Schidth, The G-protein-coupled receptors in the human genome form five main families. Phylogenetic analysis, paralogon groups, and fingerprints. Pharmacol Rev 67 (2015) 338-367. doi: 10.1124/pr.114.009647.
24. K. J Paavola , R.A. Hall, Adhesion G protein-coupled receptors: signaling, pharmacology, and mechanisms of activation. Mol Pharmacol 82 (2012) 777-783. doi: 10.1124/mol.112.080309.
25. T. Langenhan, G. Aust, J. Hamann J., Sticky signaling-adhesion class G protein-coupled receptors take the stage. Sci Signal 6( 2013) re3. doi: 10.1126/scisignal.2003825.
26. R.K. Morgan, G.R. Anderson, D. Arag, G. Aust, N. Balenga, A. Boucard et al., The expanding functional roles and signaling mechanisms of adhesion G protein-coupled receptors. Ann N Y Acad Sci. (2019) 1456 (2019) 5-25. doi: 10.1111/nyas.14094.
27. A. Vizurraga , R. Adhikar, J. Yeung, M. Yu, G.G., Mechanisms of adhesion G protein-coupled receptor activation. J Biol Chem 295 (2020) 14065-14083. doi: 10.1074/jbc.REV120.007423.
28. M. Geppert, M. Khvotchev, V. Krasnoperov, Y Goda, M. Missler, R.E. Hammer et al., Neurexin I alpha is a major alpha-latrotoxin receptor that cooperates in alpha-latrotoxin action. J Biol Chem 273 (1998):1705-1710. doi: 10.1074/jbc.273.3.1705.
29. Z.T. Hu, P. Zhao, J. Liu, Z.X. Wu, T. Xu, Alpha-latrotoxin triggers extracellular Ca(2+)- dependent exocytosis and sensitizes fusion machinery in endocrine cells. Acta Biochim Biophys Sin (Shanghai). 38 (2006) 8-14. doi: 10.1111/j.1745-7270.2006.00129.
30. H. Scheer, L. Madeddu, N. Dozio N, G. Gatti, L.M. Vicentini, J. J. Meldolesi, Alpha latrotoxin of black widow spider venom: an interesting neurotoxin and a tool for investigating the process of neurotransmitter release. Physiol (Paris) 79 (1984) 216-221. doi: 10.1146/annurev. neuro.24.1 .933.
31. K. Ichtchenko, M. Khvotchev, N. Kiyatkin, L. Simpson, S. Sugita, T.C. Sudhof, Alpha- latrotoxin action probed with recombinant toxin: receptors recruit alpha-latrotoxin but do not transduce an exocytotic signal. EMBO J. 17 (1998) 6188-6199. doi: 10.1093/emboj/17.21.6188.
32. A. S. Tarasenko, L.G. Storchak, N.H. Himmelreich. alpha-Latrotoxin affects mitochondrial potential and synaptic vesicle proton gradient of nerve terminals. Neurochem Int 52 (2008) 392- 400. doi: 10.1016/j.neuint.2007.07.013.
33. T. C. Sudhof , alpha-Latrotoxin and its receptors: neurexins and Cl RL/latrophilins Annu Rev Neurosci 24 (2001) 933-962. doi: 10.1146/annurev. neuro.24.1.933.
34. Y.A. Ushkaryov . A. Rohou , S. Sugita, alpha-Latrotoxin and its receptors. Handb Exp Pharmacol 184 (2008) 171-206. doi: 10.1007/978-3-540-74805-2_7.
35. D.A. Lovejoy, D.W. Hogg, Information processing in affective disorders: Did an ancient peptide regulating intercellular metabolism become co-opted for noxious stress sensing? BioEssays 2000039 (2020) 1-8. doi: 10.1002/bies.202000039.
36. A. Al Chawaf, K. Xu, L. Tan, F. Vaccarino, D. A. Lovejoy, S. Rotzinger, Corticotropin-releasing factor behaviours are modulated by intravenous administration of teneurin C-terminal associated peptides. Peptides 28 (2007) 1406-1415.
37. L. Tan, K. Xu, F. Vaccarino, D.A. Lovejoy, S. Rotzinger, Repeated intracerebral teneurin C- terminal associated peptide (TCAP)-1 injections produce enduring changes in behavioral responses to corticotropin-releasing factor (CRF) in rat models of anxiety. Beh Brain Res 188 (2008) 195-200.
38. S. Erb, M. McPhee, Z.J. Brown, D.A. Kupferschmidt, L. Song , D.A. Lovejoy, Repeated intravenous administrations of teneurin-C terminal associated peptide (TCAP)-1 attenuates reinstatement of cocaine seeking by corticotropin-releasing factor (CRF) in rats. Beh Brain Res 269 (2014) 1-5. doi: 10.1016/j.bbr.2014.04.013.
39. D. Kupferschmidt, D.A. Lovejoy, S. Rotzinger, S. Erb, Teneurin C-terminal associated peptide (TCAP)-1 blocks the effects of corticotropin-releasing factor (CRF) on the reinstatement of cocaine seeking and expression of cocaine-induced behavioral sensitization Br J Pharmacol 163 (2011) 574-583.
40. D. Kupferschmidt, D.A. Lovejoy, S. Erb, Teneurin C-terminal associated peptide (TCAP)-1 and corticotropin-releasing factor (CRF) interactions in the modulation of cocaine-related behaviour. In ‘The Neuroscience of Cocaine: Mechanisms and Treatment. Editor: V. Preedy. Academic Press (Elsevier). (2017) p 195-203. doi. 10.1016/B 978-0-12-803750-8.00020-8.
41. L.A. Tan, K. Xu, F.J. Vaccarino, D.A. Lovejoy, S. Rotzinger, Teneurin C-terminal associated peptide (TCAP)-1 attenuates corticotropin-releasing factor (CRF)-induced c-Fos expression in the limbic system and modulates anxiety behavior in male Wistar rats. Beh Brain Res 201 (2009) 198-206.
42. F.M. Dautzenberg, R.L. Hauger, The CRF peptide family and their receptors: yet more partners discovered. Trends Pharmacol Sci 23 (2002) 71-77. doi: 10.1016/s0165-6147(02)01946- 6.
43. T. Steckler, F.M. Dautzenberg, Corticotropin-releasing factor receptor antagonists in affective disorders and drug dependence- an update. CNS Neurol Disord Drug Target 5 (2006) 147-65. doi: 10.2174/187152706776359619.
44. D.A. Lovejoy, B. Chang, N. Lovejoy, J. Del Castillo, Molecular evolution and origin of the corticotrophin-releasing hormone receptors. J Mol Endocrinol 52 (2014) 43-60.
45. D.D. Belsham, F. Cai , H. Cui, S.R. Smukler, A.M. F. Salapatek, L. Shkreta. Generation of a phenotypic array of hypothalamic neuronal cell models to study complex neuroendocrine disorders. Endocrinology. 145 (2004) 393-400.
46. P.J. Duncan, S. Sengul, J. Tabak, P. Ruth, R. Bertram, M.J. Shipston. Large conductance Ca2+ -activated K+ channels (BK) promote secretagogue-induced transition from spiking to bursting in murine anterior pituitary corticotrophs. J Physiol 24 (2004) doi: 10.1113/jphysiol.2014.284471.
47. Z. Liang, L. Chen, H. McClafferty, R. Lukowski, D. MacGregor D, J.T. King, et al., Control of hypothalamic-pituitary-adrenal stress axis activity by the intermediate conductance calcium- activated potassium channel, SK4. J Physiol 589 (2011) 5965-5986. doi:
10.1113/jphysiol .2011 .219378.
48. M. D. Brand, D. G. Nicholls, Assessing mitochondrial dysfunction in cells. Biochem J 435 (2011) 297-312. doi: https://doi.org/10.1042/BJ20110162.
49. M. Adler, B.S. Wong, S.l Sabol, N. Busis, M.B. Jackson, F.F. Weight, Action potentials and membrane ion channels in clonal anterior pituitary cells. Proc Natl Acad Sci 80 (1983) 2086-2090.
50. L.A. Tan, A. Al Chawaf, F.J. Vaccarino, J.C. Boutros, D.A. Lovejoy, Teneurin C-terminal associated peptide (TCAP)-1 increases dendritic spine density in hippocampal neurons and decreases anxiety-like behaviors in rats. Physiol Beh 104 (2011) 199-204.
51. L.A. Tan, D. Chand, R. De Almeida, M. Xu, M., Colacci, De Lannoy, L., D.A. Lovejoy, Modulation of neuroplastic changes and corticotropin-releasing factor associated behaviour by a phylogenetically ancient and conserved peptide family. Gen Comp Endocrinol. 176 (2012) 309- 313.
52. S. Rotzinger, D.A. Lovejoy, L. Tan, Behavioral effects of neuropeptide ligands in rodent models of depression and anxiety. Peptides 31 (2010) 736-756.
53. E. B. Binder, C. B. Nemeroff, The CRF system, stress, depression and anxiety-insights from human genetic studies. Mol Psychiatry 15 (2010) 574-88. doi: 10.1038/mp.2009.141.
54. C. M. Hostetler , A. E. Ryabinin, The CRF system and social behavior: a review. Front Neurosci 7 (2013) 92. doi: 10.3389/fnins.2013.00092.
55. R. Sando , T. C Sudhof , Latrophilin GPCR signaling mediates synapse formation. eLife 10 (2021) e65717. doi: 10.7554/eLife.65717.
56. Y.A. Ushkaryov, V. Lelianova, N.V. Vysokov, Catching Latrophilin With Lasso: A Universal Mechanism for Axonal Attraction and Synapse Formation. Front Neurosci 13 (2019)257. doi: 10.3389/fnins.2019.00257.
57. F. Vincent, M.A. Duncton, TRPV4 agonists and antagonists. Curr Top Med Chem. 11 (2011) 2216-2226.
58. Z. Ma, A. P. Siebert, K.H. Cheung, R.J. Lee, B. Johnson, A. S. Cohen, et al., Calcium homeostasis modulator 1 (CALHM1) is the pore-forming subunit of an ion channel that mediates extracellular Ca2+ regulation of neuronal excitability. Proc Natl Acad Sci USA. 109 (2012) E1963- 1971.
59. II. Dreses-Werringloer, V. Vingtdeux, H. Zhao, P. Chandakkar, P. Davies, P. Marambaud, CALHM1 controls Ca2+-dependent MEK/ERK/RSK/MSK signaling in neurons. J Cell Sci 126 (2013) 1199-206. doi:10.1242/jcs.117135.
60. S.P. Yu, D.W. Choi,. "Na(+)-Ca2+ exchange currents in cortical neurons: concomitant forward and reverse operation and effect of glutamate". Eur J Neurosci 9 (1997) 1273- 1281 . doi: 10.1111/j.1460-9568.1997. tbO1482.x.
61. M.L. Chalfant, Regulation of epithelial Na+ channels from M-1 cortical collecting duct cells. Am J Physiol Renal Physiol 271 (1995) f861-f870. doi: 10.1152/ajprenal.1996.271.4.f861.
62. E.P. Gomez-Sanchez, C.E. Gomez-Sanchez, Effect of central infusion of benzamil on Dahl S rat hypertension. Am J Physiol. 269 (1995) H 1044-1047.
63. Y.S. Lee, M.M. Sayeed, R. D. Wurster, Intracellular Ca2+ mediates the cytotoxicity induced by bepridil and benzamil in human brain tumor cells. Cancer Lett 88 (1995) 87- 91. doi: 10.1016/0304-3835(94)03619-T.
64. T.B. Rogers, G. Inesi, R. Wade, W.J. Lederer, Use of thapsigargin to study Ca2+ homeostasis in cardiac cells. Biosci Rep 15 (1995) 341-349. doi: 10.1007/BF01788366.
65. J.D. Malhotra, R.J. Kaufman, The endoplasmic reticulum and the unfolded protein response. Sem Cell Dev Biol. 18 (2007) 716-731. doi:10.1016/j.semcdb.2007.09.003.
66. X. Z. Wang, M. Kuroda, J. Sok, N. Batchvarova, R. Kimmel, P. Chung, et al., Identification of novel stress-induced genes downstream of chop. EMBO J 17(1998) 3619-3630. doi: 10.1093/emboj/17.13.3619.
67. D.R. Davies, R. Hol, G.J. Wim, The power of vanadate in crystallographic investigations of phosphoryl transfer enzymes. FEBS Lett 577 (2004) 315-
321. doi: 10.1016/j.febslet.2004.10.022.
68. W. Kuhlbrandt, Biology, structure and mechanism of P-type ATPases. Nature Rev Mol Cell Biol 5 (2004) 282-295. doi:10.1038/nrm1354.
69. D. Luo, M. Nakazawa, Y. Yoshida, J. Cai, S. Imai, Effects of three different Ca2+ pump ATPase inhibitors on evoked contractions in rabbit aorta and activities of Ca2+ pump ATPases in porcine aorta. General Pharmacology: The Vascular System. 34 (2000) 211-220. doi: 10.1016/S0306- 3623(00)00064-1. PMID 11120383.
70. R. I. Fonteriz , S. de la Fuente, A. Moreno, C. D. Lobaton, M. Montero, J. Alvarez, Monitoring mitochondrial [Ca(2+)] dynamics with rhod-2, ratiometric pericam and aequorin. Cell Calcium 48 (2010) 61-69. doi: 10.1016/j.ceca.2O10.07.001.
71. E. J. Griffiths , G.A. Rutter, Mitochondrial calcium as a key regulator of mitochondrial ATP production in mammalian cells Biochim Biophy Acta (BBA) - Bioenergetics 1787 (2009) 1324- 1333.
72. L. B. Chen. Mitochondrial membrane potential in living cells. Annu Rev Cell Biol. 4 (1988) 155-181.
73. M. Huang, A. K. S. Camara, D. F. Stowe, F. Qi, D. A. Beard. Mitochondrial inner membrane electrophysiology assessed by rhodamine-123 transport and fluorescence. Ann Biomed Eng 35 (2007) 1276-1285. doi: 10.1007/s10439-007-9265-2.
74. J. L Chen, T.W. Steele, D.C. Stuckey. Modeling and application of a rapid fluorescence-based assay for biotoxicity in anaerobic digestion. Environ Sci Technol, 49 (2015) 13463 13471. doi/10.1021/acs.est.5b03050.
75. R.M. Reid, A.L. D'Aquila, P.R. Biga, The validation of a sensitive, non-toxic in vivo metabolic assay applicable across zebrafish life stages. Comp Biochem Physiol C Toxicol Pharmacol 208 (2018) 29-37. doi: 10.1016/j.cbpc.2017.11.004.
76. C. R. Battaglia, S. Cursano, E. Calzia, A. Catanese, T.M. Boeckers, Corticotropin-releasing hormone (CRH) alters mitochondrial morphology and function by activating the NF-kB-DRP1 axis in hippocampal neurons. Cell Death Dis 11 (2020) 1004. doi: 10.1038/s41419-020-03204-3.
77. C. Zhang, R. A. Rissman, Corticotropin-releasing factor receptor-1 modulates biomarkers of
DNA oxidation in Alzheimer’s disease mice. PLoS One 12 (2017)
0181367. doi: 10.1371/journal.pone.0181367.
78. J. Vaughan, C. Donaldson, J.C. Bittencourt, M.H. Perrin, K. Lewis, S. Sutton et al., Characterization of urocortin, a novel mammalian neuropeptide related to fish urotensin-l and to CRF. Nature 378 (1995) 287-292.
79. D.A. Lovejoy, R. J. Balment, Evolution and physiology of the corticotropin-releasing factor (CRF) family of neuropeptides in vertebrates. Gen Comp Endocrinol 115 (1999) 1-22.
80. D.A. Lovejoy, S. Jahan, Phylogeny and Evolution of the corticotropin releasing factor family of peptides. Gen Comp Endocrinol 146 (2006) 1-8.
81. D.A. Lovejoy, Structural evolution of urotensin-l: Retaining ancestral functions before corticotropin-releasing hormone evolution. Gen Comp Endocrinol 164 (2009) 15-19.
82. P.A. Townsend, S. M. Davidson, S. J. Clarke, I. Khaliulin, C. J. Carroll, T. M. Scarabelli, Urocortin prevents mitochondrial permeability transition in response to reperfusion injury indirectly, by reducing oxidative stress Am J Physiol Heart Circ Physiol 293 (2007) H928-H938.
83. Y. Yasamura, A.H. Tashjian, G.H. Sato, Establishment of four functional, clonal strains of animal cells in culture. Science 154 (1966) 1186-1189. doi: 10.1126/science.154.3753.1186.
84. M. D. Woods, M. J. Shipston, E. L. Mullens, F. A. Antoni, Pituitary corticotrope tumor (AtT20) cells as a model system for the study of early inhibition by glucocorticoids. Endocrinology 131 (1992) 2873-80. doi: 10.1210/endo.131.6.1332850.
85. A.K. Ritchie, Y.A. Kuryshev, G.V. Childs, Corticotropin-releasing hormone and calcium signaling in corticotropes. Trends Endocrinol Metab 7 (1996) 365-369.
86. H. Zemkova, M. Tomic, M. Kucka, G. Aguilera, S.S. Stojilkovic, Spontaneous and CRH- Induced excitability and calcium signaling in mice corticotrophs involves sodium, calcium, and cation-conducting channels. Endocrinology. 157 (2016) 1576-1589. doi:10.1210/en.2015-1899.
87. D. Kenzelmann, R. Chiquet- Ehrisman, R.P. Tucker, Teneurins, a transmembrane protein family involved in cell communication during neuronal development. Cell Mol Life Sci 64 (2007) 1452-1456.
88. T.J. Mosca, W. Hong, V. S. Dani, V. Favaloro, L. Luo, Trans-synaptic Teneurin signalling in neuromuscular synapse organization and target choice. Nature 484 (2012) 237-241.
89. R.P. Tucker, R. Chiquet-Ehrismann, Teneurins: a conserved family of transmembrane proteins involved in intercellular signalling during development. Dev Biol 290 (2006) 237-245.
90. C. Inda, N. G. Armando, P. A. Dos Santos Claro, S. Silberstein, Endocrinology and the brain: corticotropin-releasing hormone signaling. Endocr Connect 6 (2017) R99-R120. doi: 10.1530/EC- 17-0111.
91. W. Vale, J. Spiess, C. Rivier, J. Rivier, Characterization of a 41 residue ovine hypothalamic peptide that stimulates secretion of corticotropin and p-endorphin. Science 213 (1981) 1394- 1397.
92. G. M. Coast, Insect diuretic peptides; structures, evolution and actions. Am. Zool. 38 (1998) 442-449.
93. A. J. Dunn, C.W. Berridge, Physiological and behavioural responses to corticotropin-releasing factor administration: Is CRF a mediator of anxiety of stress responses? Brain Res Rev 15 (1990) 71-100.
94. E.B. De Souza, Corticotropin-releasing factor receptors: Physiology, pharmacology, biochemistry, and role in central nervous system and immune disorders. Psychoneuroendocrinology 20 (1995) 789-819.
95. M.J. Endsin, O.M. Michalec, L.A. Manzon, D.A. Lovejoy, R.A. Manzon, CRH peptide evolution occurred in three phases: Evidence from characterizing sea lamprey CRH system members. Gen Comp Endocrinol 240 (2017) 162-173. Doi.10.1016/j.ygcen.2016.10.009.
96. T.M. Reyes, K. Lewis, M.H. Perrin, K.S. Kunitake, J. Vaughan, C.A., et al., Urocortin II: a member of the corticotropin-releasing factor (CRF) neuropeptide family that is selectively bound by type 2 CRF receptors. Proc Natl Acad Sci USA 98 (2001) 2843-2848.
97. K. Lewis, C. Li, M.H. Perrin, A. Blount, K. Kunitake, C. Donaldson, et al., Identification of urocortin III, an additional member of the corticotropin-releasing factor (CRF) family with high affinity for the CRF2 receptor. Proc Natl Acad Sci USA 98 (2001) 7570-7575.
98. S.Y. Hsu, A. J. Hsueh, Human stresscopin and stresscopin-related peptide are selective ligands for the type 2 corticotropin-releasing hormone receptor. Nat Med 7 (2001) 605-611. doi: 10.1038/87936. PMID: 11329063.
99. D’Aquila AL, Hsieh AHR, Hsieh AHM, De Almeida R Lovejoy SR, Lovejoy DA (2016) Expression and actions of corticotropin-releasing factor/diuretic hormone-like peptide (CDLP) and teneurin C-terminal associated peptide (TCAP) in the vase tunicate, Ciona intestinalis’. Antagonism of the feeding response. General and Comparative Endocrinology 246, 105-115, doi: 10.1016/j.ygcen.2016.06.015.
100. D’Aquila AL et al. 2016 Expression and actions of CDLP and TCAP in the vase tunicate, Ciona intestinalis'. Antagonism of the feeding response. Gen. Comp. Endocrinol. 246, 105-115,
101. Hamann J, Vogel B, van Schijndel GM, van Lier RA. The seven-span transmembrane receptor CD97 has a cellular ligand (CD55, D A F). J Exp Med 1996; 184:1185-9; PMID:9064337; http://dx.doi.Org/10.1084/jem.184.3.1185 .
102. Stacey M, Chang GW, Davies JQ, Kwakkenbos MJ, Sanderson RD, Hamann J, Gordon S, Lin HH. The epidermal growth factor-like domains of the human EMR2 receptor mediate cell attachment through chondroitin sulfate glycosaminoglycans. Blood 2003; 102:2916-24; PM I D: 12829604; http://dx.doi.Org/10.1182/blood-2002- 11 -3540.
103. Stinnett, G.S., Westphal, N.J., Seasholtz, A.F., 2015. Pituitary CRH-binding protein and stress in female mice. Physiology & Behavior 150, 16-23.
104. L.W. Swanson, P.E. Sawchenko, J. Rivier, W.W. Vale, Organization of ovine corticotropinreleasing factor immunoreactive cells and fibers in the rat brain: an immunohistochemical study, Neuroendocrinology 36 (1983) 165- 186.
105. E Potter 1, S Sutton, C Donaldson, R Chen, M Perrin, K Lewis, P E Sawchenko, W Vale, Distribution of corticotropin-releasing factor receptor mRNA expression in the rat brain and pituitary, Proc Natl Acad Sci U S A. 1994 Sep 13;91 (19):8777-81. doi: 10.1073/pnas.91.19.8777.
106. Chalmers DT, Lovenberg TW, Grigoriadis DE, Behan DP, De Souza EB, Corticotrophin- releasing factor receptors: from molecular biology to drug design. Trends Pharmacol Sci. 1996 Apr; 17(4): 166-72. doi: 10.1016/0165-6147(96)81594-x.
107. M R Palchaudhuri 1, S Wille, G Mevenkamp, J Spiess, E Fuchs, F M Dautzenberg, Corticotropin-releasing factor receptor type 1 from Tupaia belangeri-cloning, functional expression and tissue distribution. Eur J Biochem.1998 Nov 15;258(1):78-84. doi: 10.1046/j .1432- 1327.1998.2580078.x.
108. Van Pett K, Viau V, Bittencourt JC, Chan RKW, Li H-Y, Arias C, Prins GS, Perrin M, Vale W, Sawchenko PE, Distribution of mRNAs encoding CRF receptors in brain and pituitary of rat and mouse. J Comp Neurol. 2000 428:191-212.
109. Grammatopoulos DK, Randeva HS, Levine MA, Kanellopoulou KA, Hillhouse EW, Rat cerebral cortex corticotropin-releasing hormone receptors: evidence for receptor coupling to multiple G-proteins. J Neurochem. 2001 Jan;76(2):509-19. doi: 10.1046/j.1471-
4159.2001.00067.x.
110. Chen R, Lewis KA, Perrin MH, Vale WW, Expression cloning of a human corticotropin- releasing-factor receptor. Proc Natl Acad Sci U S A. 1993 Oct 1 ;90(19):8967-71. doi: 10.1073/pnas.90.19.8967.
111. Maria C. Olianas, giorgio Lampis, Pierluigi Onali, Coupling of Corticotropin-Releasing Hormone Receptors to Adenylyl Cyclase in Human Y-79 Retinoblastoma Cells. J. of Neruochemistry 1995, Jan. vol 64, Issue 1 , pp 394-401
112. Laura A Tan 1, Dhan Chand, Reuben De Almeida, Mei Xu, Louise De Lannoy, David A Lovejoy, Modulation of neuroplastic changes and corticotropin-releasing factor-associated behavior by a phylogenetically ancient and conserved peptide family Gen Comp Endocrinol. 2012 May 1 ;176(3):309-13. doi: 10.1016/j.ygcen.2011.11.011. Epub 2011 Nov 23.
113. Donny Janssen 1, Tamas Kozicz, Is it really a matter of simple dualism? Corticotropinreleasing factor receptors in body and mental health. Front Endocrinol (Lausanne). 2013 Mar 12;4:28. doi: 10.3389/fendo.2013.00028. eCollection 2013.
114. Frank M. Dautzenberg, Eric Gutknecht, bllse Van derLinden, aJ. Alberto Olivares-Reyes, cFranz Durrenberger Richard LHauger- Cell-type specific calcium signaling by corticotropinreleasing factor type 1 (CRFi) and 2a (CRF2<a)) receptors: phospholipase C-mediated responses in human embryonic kidney 293 but not SK-N-MC neuroblastoma cells, Biochemical Pharmacology, Volume 68, Issue 9, 1 November 2004, Pages 1833-1844
115. Eric Gutknecht, Georges Vaugueln, Frank M. Dautzenberg, Coricotropin-releasing factor receptors induce calcium mobilization through cross-talk with Gq-coupled receptors, Molecular and Cellular Pharmacology .Volume 642, Issues 1-3, 10 September 2010, Pages 1-9
116. AC Riegel, JT Williams, CRF facilitates calcium release from intracellular stores in midbrain dopamine neurons, Neuron 2008 57 (4), 559-570115]).
117. Muller A., Winkler J., Fiedler F., Sastradihardja T., Binder C., Schnabel R., Kungel J., Rothemund S., Hennig C., Schoneberg T. Oriented cell division in the C. elegans embryo is coordinated by G-protein signaling dependent on the adhesion GPCR LAT-1. PLoS Genet. 2015; 11 :e1005624.
118. David W Hogg, Yani Chen, Andrea D'Aquila, Mei Xu, Mia Husic, Laura A Tan, Chris Bull, David A. Lovejoy; A novel role of the corticotrophin-releasing hormone regulating peptide,
teneurin C-terminal associated peptide 1, on glucose uptake into the brain J
Neuroendocrinol 2018 Apr;30(4):e12579. doi: 10.1111/jne.12579
119. FJ Ayala, A Rzhetxsky, F J Ayala, Origin of the metazoan phyla: molecular clocks confirm paleontological estimates, Proc Natl Acad Sci II S A. 1998 Jan 20;95(2):606-11. doi: 10.1073/pnas.95.2.606
Claims
1 . A method for maintaining cell vitality or cell health by administering or inducing expression of TCAP or TCAP agonist in the cell or a composition comprising TCAP or TCAP agonist.
2. The method of claim 1 , wherein the TCAP is teneurin c-terminal associated peptide-1 , 2, 3, or 4 (TCAP-1 , TCAP-2, TCAP-3, TCAP-4 peptide), or a pharmaceutical composition comprising same and an excipient or pharmaceutically acceptable carrier and comprising or consist essentially of :(i) an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 38, 70, and 101 (TCAP-1 , 41mer); 46 and 78 (TCAP-2, 41 mer); 14, 22, 54, 86 (TCAP-3, 41 mer); 30, 62, and 94 (TCAP-4, 41 mer) (or preferably SEQ. ID. NOs: 38 or 70); or SEQ. ID. NOs: 37, 69 and 111 (TCAP-1 , 40mer); 45 and 77 (TCAP-2, 40mer); SEQ. ID. NOs: 13, 21 , 53 and 85 (TCAP-3, 40mer); 29, 61 and 93 (TCAP-4, 40mer); or, or a species homolog thereof; optionally wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (a TCAP with a c-amidation signal sequence selected from the group consisting of: SEQ. ID. NOs: 40, 37, and 71 (TCAP-1); 48, 47, 80, 79 (TCAP-2); 16, 15, 24, 23, 56, 55, 88, and 87 (TCAP-3); 32, 31 , 64, 63, 96 and 95 (TCAP-4); and/or(b) when the amino terminal amino acid of said TCAP peptide is glutamine, it can optionally be in the form of pyroglutamic acid and/or, replacing the N- terminal amino acid of the TCAP -1 , 2, 3, or 4 peptide with a pyroglutamic acid, such as any one of SEQ. ID. NOs: 7 - 12, or a pharmaceutically acceptable salt or ester thereof.
3. The method of claim 2 wherein TCAP is aa peptide comprising or consisting essentionally of of any one of SEQ. ID. NOs: 38 or 70 or a sequence comprising an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 38 or 70 or a species homolog thereof, wherein: (a) the carboxy terminal end of said TCAP peptide is amidated or comprises an amidation signal sequence (such as SEQ. ID NOs: 44 or 72); and/or (b) when the amino terminal amino acid of said TCAP peptide is glutamine, is in the form of pyroglutamic acid or the N-terminal amino acid has been modified to be a pyroglutamic acid, such as SEQ. ID. NOs: 7 or 8.
4. The method of claim 1 , wherein the TCAP is TCAP-1 or TCAP-3, optionally SEQ. ID. NOs:7 or 8.
5. A method of any one of claims 1 - 4 for antagonizing CRF-mediated functions or activity by administering or inducing expression of TCAP in the cell.
6. The method of claim 5, wherein the TCAP is TCAP-1 or TCAP-3, optionally SEQ. ID. NOs. 7 or 8.
7. The method of claims 5 or 6 wherein the CRF-mediated functions or activity is increase in intracellular calcium or intracellular calcium flux.
8. A method for antagonizing CRF-mediated activity, such as intracellular calcium influx in a cell or patient in need thereof comprising administering to said cell or patient in need thereof a therapeutically effective amount of a teneurin c-terminal associated peptide- 1 (TCAP-1 peptide) or a TCAP or TCAP-1 agonist, or a pharmaceutically acceptable salt or ester thereof or a pharmaceutical composition comprising same, wherein the amino acid sequence of said TCAP-1 peptide consists essentially of:
(i) an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 7 -9; optionally wherein:
(a) the carboxy terminal end of said peptide is amidated or comprises an amidation signal sequence; and/or
(b) when the amino terminal amino acid of said peptide is a glutamine, glutamic acid or pyroglutamic acid.
9. The method of claim 8 wherein the glutamine is in the form of glutamic acid.
10. The method of claim 9, wherein the glutamine is a pyroglutamic acid.
11. The method of claim 1 wherein the TCAP is a TCAP-1 peptide consisting of any one of SEQ. ID. NOs: 7 or 8.
12. A use a therapeutically effective amount of a teneurin c-terminal associated peptide-1 (TCAP- 1 peptide), or a pharmaceutically acceptable salt or ester thereof or a pharmaceutical composition comprising same for antagonizing CRF function in a patient or subject in need thereof wherein the amino acid sequence of said TCAP-1 peptide consists essentially of:
(i) an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 7-8; optionally wherein:
(a) the carboxy terminal end of said peptide is amidated or comprises an amidation signal sequence; and/or
(b) when the amino terminal amino acid of said peptide is a glutamine or glutamic acid or a pyroglutamic acid.
13. The use of claim 12 wherein the glutamine is in the form of pyroglutamic acid.
14. The use of claim 12 or 13 wherein the TCAP-1 peptide consists of any one of SEQ. ID. NOs: 4 - 6.
15. The method of claim 8 or use of claim 12, for the treatment of a mood disorder.
16. The method of claim 8 or use of any one of claim 12 wherein the CRF activity is increase in cytosolic Ca2+ flux and the TCAP-1 inhibits said increase.
17. The use of Teneurin C-Terminal Associated Peptide (TCAP) - 1 to antagonize the effects of corticotropin releasing factor (CRF) on cytosolic Ca2+ levels.
18. The use of claim 17 wherein the CRF is CRF-1 or CRF-2
19. The use of claim 18, wherein the CRF is CRF-1.
20. The use of anyone of claims 17 - 19, wherein CRF mediates an increase in cytosolic Ca2+ and TCAP-1 antagonizes the CRF mediated increase in cytosolic Ca2+.
21. The use of claim 20, wherein TCAP-1 enhances the efflux of cytosolic Ca2+.
22. The use of any one of claims 17 - 21 in a neuronal cell.
23. The use of claim 23 wherein the the neuronal cell is a hypothalmic cell.
24. The use of any one of claims 17 - 23, to also mediate the effects of CRF on mitochondrial Ca2+ levels and TCAP-1 antagonizes this effect.
25. The use of claim 24 wherein CRF mediates a decrease in Ca2+ in the mitochondria and TCAP- 1 antagonizes this effect,
26. The use of claim 25 wherein TCAP-1 mediates an increase or lowers the efflux of Ca2+ from the mitochondria.
27. The use of any one of claims 17 - 27, during times of cellular or organismal stress.
28. The use of claim 27, wherein TCAP-1 is used before, during or after cellular or organismal stress.
29. A use a therapeutically effective amount of a teneurin c-terminal associated peptide-1 (TCAP- 1 peptide) or a pharmaceutical composition comprising same for antagonizing CRF function in a patient or subject in need thereof wherein the amino acid sequence of said TCAP-1 peptide consists essentially of:
(i) an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of any one of SEQ ID NOs:7 -9; wherein:
(a) the carboxy terminal end of said peptide is amidated or comprises an amidation signal sequence; and
(b) when the amino terminal amino acid of said peptide is a pyroglutamic acid.
30. The use of claim 27, wherein TCAP-1 is selected from SEQ ID’s NOs: 7-9.
31. The use of any one of claims 1 - 30, wherein the pharmaceutical composition comprising TCAP-1 and an excipient or pharmaceutically acceptable carrier is used.
32. The use of TCAP-1 to prevent CRF-mediated decrease of calcium in the mitochondria.
33. The use of TCAP-1 to antagonize the CRF stress response.
34. The use of TCAP-1 as a non-receptor CRF antagonist.
35. The use of TCAP-1 to enhance plasma membrane calcium efflux.
36. The use of TCAP-1 to inhibit mitochondrial membrane calcium efflux.
37. The use of TCAP-1 to enhance cellular energy production.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263428021P | 2022-11-25 | 2022-11-25 | |
| PCT/CA2023/051587 WO2024108312A1 (en) | 2022-11-25 | 2023-11-27 | Compositions, methods and uses of teneurin c-terminal associated peptides (tcap) as a peptide antagonist of corticotropin-releasing factor (crf) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4622659A1 true EP4622659A1 (en) | 2025-10-01 |
Family
ID=91194897
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP23892848.5A Pending EP4622659A1 (en) | 2022-11-25 | 2023-11-27 | Compositions, methods and uses of teneurin c-terminal associated peptides (tcap) as a peptide antagonist of corticotropin-releasing factor (crf) |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4622659A1 (en) |
| WO (1) | WO2024108312A1 (en) |
-
2023
- 2023-11-27 EP EP23892848.5A patent/EP4622659A1/en active Pending
- 2023-11-27 WO PCT/CA2023/051587 patent/WO2024108312A1/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024108312A1 (en) | 2024-05-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Balment et al. | Arginine vasotocin a key hormone in fish physiology and behaviour: a review with insights from mammalian models | |
| Maj et al. | (−)-PHCCC, a positive allosteric modulator of mGluR4: characterization, mechanism of action, and neuroprotection | |
| Hölscher et al. | New roles for insulin-like hormones in neuronal signalling and protection: new hopes for novel treatments of Alzheimer’s disease? | |
| US9062125B2 (en) | Use of GIP for the treatment of disorders associated with dysfunctional synaptic transmission | |
| Sajadi et al. | CAPA neuropeptides and their receptor form an anti-diuretic hormone signaling system in the human disease vector, Aedes aegypti | |
| Bassani et al. | The GLUR2 subunit of AMPA receptors: synaptic role | |
| Huang et al. | Glucagon-like peptide-1 cleavage product GLP-1 (9–36) reduces neuroinflammation from stroke via the activation of insulin-like growth factor 1 receptor in astrocytes | |
| JP7263667B2 (en) | Centrally acting peptide derivative and pharmaceutical composition | |
| Warne | Cloning and characterization of an arginine vasotocin receptor from the euryhaline flounder Platichthys flesus | |
| Fisher et al. | Distinct omega‐agatoxin‐sensitive calcium currents in somata and axon terminals of rat supraoptic neurones. | |
| JP2018537529A (en) | Protease-activated receptor 2 modulator | |
| Cui et al. | Characterization of four urotensin II receptors (UTS2Rs) in chickens | |
| JP2023509383A (en) | retro-inverso peptide | |
| Yao et al. | Pressor effect of apelin-13 in the rostral ventrolateral medulla: role of NAD (P) H oxidase-derived superoxide | |
| EP4622659A1 (en) | Compositions, methods and uses of teneurin c-terminal associated peptides (tcap) as a peptide antagonist of corticotropin-releasing factor (crf) | |
| Emery et al. | C-terminal amidation of PACAP-38 and PACAP-27 is dispensable for biological activity at the PAC1 receptor | |
| Näreoja et al. | Selective targeting of G‐protein‐coupled receptor subtypes with venom peptides | |
| Toshinai et al. | Neuroendocrine regulatory peptide-1 and-2 (NERPs) inhibit the excitability of magnocellular neurosecretory cells in the hypothalamus | |
| Guan et al. | Cocaine withdrawal enhances long-term potentiation in rat hippocampus via changing the activity of corticotropin-releasing factor receptor subtype 2 | |
| Fornoni et al. | The l-isoform but not d-isoforms of a JNK inhibitory peptide protects pancreatic β-cells | |
| EP3387007A1 (en) | Proteinaceous molecules and methods of use | |
| Brailoiu et al. | State-dependent calcium mobilization by urotensin-II in cultured human endothelial cells | |
| Martínez-Hernández et al. | Inhibition of recombinant N-type and native high voltage-gated neuronal Ca2+ channels by AdGABA: mechanism of action studies | |
| Qi et al. | Characteristics of neurokinin A-induced salivary fluid secretion in perfused rat submandibular gland | |
| Cao | Modification of human Kv4 channels by KChIP1 splice variants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250623 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) |