EP4619519A1 - Protoplast screening assay - Google Patents
Protoplast screening assayInfo
- Publication number
- EP4619519A1 EP4619519A1 EP23889894.4A EP23889894A EP4619519A1 EP 4619519 A1 EP4619519 A1 EP 4619519A1 EP 23889894 A EP23889894 A EP 23889894A EP 4619519 A1 EP4619519 A1 EP 4619519A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- pgt21
- protein
- plant
- library
- protoplasts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1055—Protein x Protein interaction, e.g. two hybrid selection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1086—Preparation or screening of expression libraries, e.g. reporter assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8209—Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
- C12N15/821—Non-antibiotic resistance markers, e.g. morphogenetic, metabolic markers
- C12N15/8212—Colour markers, e.g. beta-glucoronidase [GUS], green fluorescent protein [GFP], carotenoid
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B20/00—Methods specially adapted for identifying library members
- C40B20/04—Identifying library members by means of a tag, label, or other readable or detectable entity associated with the library members, e.g. decoding processes
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
- C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5097—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
Definitions
- the present invention provides a library screening method for identifying protein-protein interactions, or protein-polynucleotide interactions, in a plant protoplast.
- Protoplasts are produced based on the isolation of individual cells from plant tissue, such as leaves, by digesting the surrounding cell walls with the help of fungal enzymes such as cellulase and pectinase. The resulting protoplasts can then be transfected with DNA encoding the proteins of interest.
- the present inventors have identified a method for high-throughput screening of pooled gene libraries in plant cells. Whereas prior art relies on screening individual genes or gene combinations one by one, or sequential screening of library subsets, the method presented here enables rapid screening of large, complex libraries in a single pass.
- the present invention provides a method of identifying a protein-protein interaction in a plant protoplast, the method comprising i) transforming a pool of plant protoplasts with a library of vectors encoding a first protein which is a member of a library of proteins expressed by the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector encoding a second protein, b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector encoding the second protein, or c) the protoplasts endogenously produce the second protein, and ii) screening the pool of plant protoplasts for an interaction between a first protein and the second protein.
- Figure 16 provides an overview of the pathogen effector library screening workflow of an embodiment of the invention.
- the number copies of each different vector of the library per protoplast used in step i) is between about 2 million and about 0.001 million.
- the number copies of each different vector of the library per protoplast used in step i) is between about 0.7 million and about 0.01 million.
- the number copies of each different vector of the library per protoplast used in step i) is between about 0.7 million and about 0.07 million.
- the number copies of each different vector of the library per protoplast used in step i) is about 0. 14 million.
- protein-protein interactions examples include, but are not limited to, pathogen effector protein/plant protein interactions (such as plant receptor protein) interactions, Avirulence (Avr) protein/plant protein (such as plant receptor protein) interactions, fungal pathogen Avirulence (Avr) protein/plant fungal resistance protein (such as plant receptor protein) interactions, transcription factor subunit interactions, protein/receptor binding interactions and protein kinase/substrate interactions.
- pathogen effector protein/plant protein interactions such as plant receptor protein
- Avirulence (Avr) protein/plant protein such as plant receptor protein
- fungal pathogen Avirulence (Avr) protein/plant fungal resistance protein such as plant receptor protein
- transcription factor subunit interactions such as protein/receptor binding interactions
- protein/receptor binding interactions examples include, but are not limited to, pathogen effector protein/plant protein interactions (such as plant receptor protein) interactions, Avirulence (Avr) protein/plant protein (such as plant receptor protein) interactions, fungal pathogen Avirulence (Avr) protein
- the method does not rely on the presence of a detectable marker (reporter) such as luciferase or a fluorescent protein.
- a detectable marker such as luciferase or a fluorescent protein.
- the protein-protein interaction in the plant protoplast results in programmed cell death (PCD) which is used to detect the protein-protein interaction.
- PCD programmed cell death
- the library of vectors encode a library of candidate effector proteins or fragments thereof from a plant pathogen some of which may interact directly or indirectly with a plant protein, or a combination thereof.
- the second protein is a candidate plant protein or a fragment thereof which may interact directly or indirectly with a pathogen effector protein.
- the library of vectors encode a library of candidate effector proteins or fragments thereof from a plant pathogen some of which may interact directly or indirectly with a plant receptor protein (such as a plant immune receptor protein), or a combination thereof.
- a plant receptor protein such as a plant immune receptor protein
- the second protein is a candidate plant receptor protein or a fragment thereof which may interact directly or indirectly with a pathogen effector protein.
- the library of vectors encode a library of plant proteins or fragments thereof some of which may interact directly or indirectly with a plant pathogen effector protein, or a combination thereof.
- the second protein is a candidate plant pathogen effector protein or a fragment thereof which may interact directly or indirectly with a plant protein.
- the plant protein is a plant receptor protein or fragment thereof.
- the interaction is direct.
- the plant protein such as a plant receptor protein
- the plant protein is a candidate or known plant pathogen resistance protein.
- the plant protein is a candidate or known rust resistance protein.
- the pathogen is a fungus, virus or bacteria. In an embodiment, the pathogen is a fungus. In an embodiment, the fungus causes rust, mildew, blight or rot. In an embodiment, the fungus causes rust.
- the vector encoding the second protein further encodes a detectable marker (reporter) such as luciferase or a fluorescent protein. In an embodiment, the vector encoding the second protein does not encode a detectable marker (reporter).
- a detectable marker such as luciferase or a fluorescent protein.
- the vector encoding the second protein does not encode a detectable marker (reporter).
- step ii) comprises extracting mRNA from a pool of live protoplasts and quantifying the level of mRNA encoding the proteins expressed by the library, wherein mRNA under-represented from the extraction is mRNA encoding a protein which interacts with the second protein.
- step ii) comprises screening for expression of a detectable marker (reporter) and selecting protoplasts for the presence or absence of marker expression.
- the marker is a fluorescent protein.
- the interaction between a first protein and the second protein results in marker gene expression from a vector.
- the interaction between a first protein and the second protein decreases marker gene expression from a vector such as when the interaction results in cell death.
- the number copies of the vector encoding the second protein per protoplast used in part b) is between about 10 million and about 150 million.
- the vectors are plasmid vectors or viral vectors.
- the present invention provides a method of identifying a protein- polynucleotide interaction in a plant protoplast, the method comprising i) transforming a pool of plant protoplasts with a library of vectors encoding a first protein which is a member of a library of proteins expressed by the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector comprising or encoding a polynucleotide of interest, b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector comprising or encoding a polynucleotide of interest, or c) the protoplasts endogenously comprise a polynucleotide of interest, and ii) screening the pool of plant protoplasts for an interaction between a first protein and the polynucleotide of interest.
- the polynucleotide of interest is a promoter operably linked to an open reading frame encoding a second protein.
- the protoplast further comprises a third protein, wherein upon expression of the second protein the third protein binds the second protein which results in programmed cell death (PCD) which is used to, indirectly, detect the protein- polynucleotide interaction.
- the second protein is a fungal pathogen A virulence (Avr) protein and the third protein is a plant fungal resistance protein (such as plant receptor protein), or vice versa, as described herein.
- the present invention provides a method of identifying a protein- polynucleotide interaction in a plant protoplast, the method comprising i) transforming a pool of plant protoplasts with a library of vectors comprising or encoding a polynucleotide which is a member of a library of polynucleotides comprised in, or expressed by, the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector encoding a first protein, b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector encoding a first protein, or c) the protoplasts endogenously comprise the first protein, and ii) screening the pool of plant protoplasts for an interaction between a polynucleotide and the first protein.
- the library of vectors encode a library of candidate or known transcription factors or a combination thereof.
- the transcription factor may be a transcription activator or a transcription repressor.
- the library may comprise transcription activators, transcription repressor, or a combination thereof, whether known or candidates thereof.
- the polynucleotide can be a candidate or known promoter.
- the present invention provides a method of determining the phenotypic effect in a plant, or part thereof, of a protein-protein interaction or protein- polynucleotide interaction identified by a method of the invention, the method comprising, i) modifying the expression of one of the proteins or polynucleotides in a plant or part thereof, and ii) examining the effects of the modification on the phenotype of the plant, or part thereof.
- the protein is a candidate pathogen resistance protein and the phenotype is resistance to the pathogen.
- the pathogen is a fungus, virus or bacteria. In an embodiment, the pathogen is a fungus.
- the plant part is a plant leaf or part thereof.
- the leaf or part thereof is a Nicotianci sp. leaf such as a Nicotianci tabcicum or Nicotianci benthamiana leaf or part thereof.
- the plant, or part thereof is genetically modified to express or comprise the protein or polynucleotide.
- the plant, or part thereof is genetically modified to reduce expression of the protein or polynucleotide.
- the genetic modification can be transient.
- the plant or part thereof does not endogenously produce the protein or polynucleotide.
- the present invention provides a method of producing a library of plant protoplasts, the method comprising transforming a pool of plant protoplasts with a library of vectors encoding a library of proteins, wherein the number copies of each different vector of the library per protoplast used in the transformation is between about 2 million and about 0.001 million, between about 0.7 million and about 0.01 million, between about 0.7 million and about 0.07 million, or about 0.14 million.
- the present invention provides a composition comprising a library of vectors encoding at least 100 different predicted pathogen effector proteins or fragments thereof which may interact with a plant protein, or a combination thereof, and a suitable carrier.
- the library of vectors encodes at least 200, at least 500, least 600, least 700, least 1,000, least 2,000, between 100 and 10,000, between 100 and 5,000, between 100 and 2,000, between 500 and 10,000, between 500 and 5,000, or between 500 and 2,000, different predicted pathogen effector proteins or fragments thereof which may interact with a plant protein, or a combination thereof.
- the present inventors have identified new effector protein families, referred to herein as AvrSrl3 and AvrSr22.
- the present invention provides a method of identifying a molecule that confers resistance to a pathogen expressing an AvrSrl3 or AvrSr22 effector protein, the method comprising a) identifying a molecule that binds the effector protein, and b) determining if the molecule confers resistance to the pathogen.
- the pathogen is a plant pathogen
- the molecule is a polypeptide
- step b) comprises expressing the polypeptide in a plant.
- composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
- Figure 1 Vector diagram of the YFP reporter construct pTA22-YFP.
- FIG. 1 Flow cytometric assay for PCD in wheat protoplasts.
- the YFP reporter construct (pTA22-YFP) was co-transformed with either an Avr gene construct (pTA22- AvrSr50-PBS, pTA22-AvrSr27-2-PBS, or pTA22-AvrSr35-PBS), an R gene construct (pTA22-Sr50, pTA22-Sr27, or pTA22-Sr35), a non-matching R-Avr pair, or a matching R-Avr pair (Sr50-AvrSr50, Sr27-AvrSr27-2, or Sr35-AvrSr35).
- FIG. 3 Flow cytometric assessment of single construct transformation frequency at different MOT.
- the MOT is defined as the number of plasmid copies per cell in the transformation reaction.
- the YFP reporter construct (pTA22-YFP) was co-transformed with the RFP reporter construct (pTA22-mRuby3) and the empty vector (pTA22).
- pTA22-YFP and pTA22-mRuby3 were delivered in equimolar amounts at a range of MOT’s (0, 0.07, 0.7, 3.6, 18, 36), while the amount of pTA22 was varied such that the MOT of all constructs combined remained constant at 72.
- Data points in the bottom right (rectangular) quadrant represent cells that express YFP only
- data points in the top left (rectangular) quadrant represent cells that express RFP only
- data points in the top right (square) quadrant represent cells that express both YFP and RFP.
- FIG. 4 Optimisation of Avr gene MOT using the flow cytometric assay for PCD in wheat protoplasts.
- the MOT is defined as the number of plasmid copies per cell in the transformation reaction.
- the YFP reporter construct (pTA22-YFP) was co-transformed with the Sr50 construct (pTA22-Sr50) and the AvrSr50 construct (pTA22-AvrSr50- PBS).
- pTA22-YFP and pTA22-Sr50 were each delivered at an MOT of 36 M (million plasmid copies per cell), while pTA22-AvrSr50-PBS was delivered at a range of MOT’s (0, 0.07, 0.14, 0.7, 36).
- FIG. 5 Screening of a mock effector library in protoplasts.
- the mock library is comprised of AvrSr50 (MOT 0.14) and AvrSr27-2 (MOT 0.14) spiked into a background of AvrSr35 (MOT 100).
- the mock library was screened against Sr50 and Sr27, with the empty vector (EV) pTA22 serving as a negative control.
- AvrSr50 and AvrSr27-2 transcripts per million (TPM) were normalised to AvrSr35 TPM.
- n 3. Error bars represent the standard deviation.
- FIG. 6 Screening of the pooled effector library Pgt21-0_EL_0001-0718 in wheat protoplasts.
- the library is comprised of 696 predicted effectors from stem rust, each represented by a data point on each volcano plot.
- the library was screened against two positive control R genes (Sr50 and Sr27) whose matching effectors are known and present in the library, as well as six R genes of interest (Srl3c, Sr21, Sr22, Sr26, Sr33, and Sr61) whose matching effectors are unknown.
- the screen was performed twice, and Sr27 was not included in the first screen.
- RNA-seq reads derived from the effector(s), which is indicated by a pronounced negative Log2 fold change and higher -Logic adjusted P value.
- Recognised effectors (labelled with their library ID number) are therefore spatially separated from the population of unrecognised effectors that coalesces around the zero point.
- FIG. 7 Validation of AvrSrl3 and AvrSr22 candidates (0336 and 0100, respectively) using the flow cytometric assay for PCD in wheat protoplasts.
- the YFP reporter construct (pTA22-YFP) was co-transformed with an Avr gene construct (pTA22-0336- PBS, pTA22-0100-PBS, pTA22-AvrSr50-PBS, or pTA22-AvrSr27-2-PBS), and an R gene construct (pTA22-Srl3c, pTA22-Sr22, or pTA22-Sr27) or the pTA22 empty vector (pEV).
- FIG. 8 Validation of the AvrSrl3 candidate (0336) using the flow cytometric assay for PCD in wheat protoplasts derived from different cultivars.
- KR is cv. Kronos, which carries Srl3a in its native context.
- FL Srl3c is a transgenic cv. Fielder line carrying Srl3c.
- FL is cv. Fielder, which does not carry any Srl3 allele.
- the YFP reporter construct (pTA22-YFP) was co-transformed with an Avr gene construct (pTA22-0336- PBS or pTA22-AvrSr50-PBS).
- FIG. 9 Validation of the AvrSr22 candidate (0100) using the flow cytometric assay for PCD in wheat protoplasts derived from different cultivars.
- SB is cv. Schomburgk, which carries Sr22 in its native context.
- FL Sr22 is a transgenic cv. Fielder line carrying Sr22. Big 5 is a transgenic cv. Robin line carrying five R genes including Sr22.
- FL is cv. Fielder, which does not carry Sr22.
- the YFP reporter construct (pTA22-YFP) was co-transformed with an Avr gene construct (pTA22-0100-PBS, pTA22-AvrSr27-2-PBS, or pTA22-AvrSr50-PBS). Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. Vertical bars indicate the mean of three replicates (grey dots). Statistical analysis was performed using the two-sample /-test assuming equal variances. **** p ⁇ 0.0001.
- Figure 10 Validation of candidates for AvrSrl3 (0336) and AvrSr22 (0100) via agroinfiltration of N. tabacum leaves.
- Leaf sectors express combinations of Sr27, Srl3c or Sr22 C-terminally fused to YFP along with AvrSrl3, AvrSr22, or AvrSr27 N- terminally fused to YFP, or with YFP alone.
- Recognition of the Avr protein by the R protein results in PCD, which is visible as light brown necrotic tissue.
- FIG. 11 Validation of candidates for AvrSrl3 (0336) and AvrSr22 (0100) via agroinfiltration of N. benthamiana leaves.
- Leaf sectors express combinations of Sr27, Srl3c or Sr22 C-terminally fused to YFP along with AvrSrl3, AvrSr22, or AvrSr27 N- terminally fused to YFP, or with YFP alone.
- Recognition of the Avr protein by the R protein results in PCD, which is visible as discoloured necrotic tissue.
- FIG. 12 Validation of Srl3 allele recognition specificity for AvrSrl3 (0336) using the flow cytometric assay for PCD in wheat protoplasts.
- the YFP reporter construct (pTA22-YFP) was co-transformed with the AvrSrl3 construct (pTA22-0336-PBS) or an empty vector (pTA22), and an R gene construct (pTA22-Srl3c or pTA22-Srl3 SI) or the empty vector.
- Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP- positive. Vertical bars indicate the mean of three replicates (grey dots).
- Statistical analysis was performed using the two-sample /-test assuming equal variances. ****, p ⁇ 0.0001; **,p ⁇ 0.01; EV, empty vector.
- FIG. 13 Validation of Sr22 recognition specificity for AvrSr22 alleles using the flow cytometric assay for PCD in wheat protoplasts.
- the YFP reporter construct (pTA22- YFP) was co-transformed with the AvrSr22 (0100) or AvrSr22b construct (pTA22- 0100-PBS and pTA22-AvrSr22b-PBS, respectively) or an empty vector (pTA22), and the Sr22 construct (pTA22-Sr22) or empty vector.
- Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. Vertical bars indicate the mean of three replicates (grey dots).
- Statistical analysis was performed using the two-sample /-test assuming equal variances. **** p ⁇ 0.0001; EV, empty vector.
- Figure 14 Validation of Sri 3c and Sr22 recognition specificity for AvrSrl3 and AvrSr22 alleles, respectively, via agroinfiltration of N. tabacum leaves.
- Leaf sectors express combinations of Sri 3c or Sr22 C-terminally fused to YFP along with AvrSrl3, AvrSrl3b, AvrSr22, or AvrSr22b N-terminally fused to YFP, or with YFP alone.
- Recognition of the Avr protein by the R protein results in PCD, which is visible as light brown necrotic tissue.
- Figure 15 Validation of Sri 3c and Sr22 recognition specificity for AvrSrl3 and AvrSr22 alleles, respectively, via agroinfiltration of N. benthamiana leaves.
- Leaf sectors express combinations of Sri 3c or Sr22 C-terminally fused to YFP along with AvrSrl3, AvrSrl3b, AvrSr22, or AvrSr22b N-terminally fused to YFP, or with YFP alone.
- Recognition of the Avr protein by the R protein results in PCD, which is visible as discoloured necrotic tissue.
- Figure 16 Workflow for high-throughput screening of a pooled effector library in plant protoplasts.
- FIG. Assay for PCD using Sr50 with an inducible AvrSr50 activated by the transcription factor GAL4-VP16.
- FIG. 18 Flow cytometric assay for PCD in wheat protoplasts for validation of using the platform to screen for transcription factors mediating activation of a target promoter element.
- the YFP reporter construct (pTA22-YFP) was co-transformed with the Avr gene, AvrSr50 either constitutively expressed using the Ubiquitin promoter (Ubi- AvrSr50; pTA22-AvrSr50-PBS) or the yeast GAL4 minimal upstream activation sequence (UAS-AvrSr50; AvrSr50-pDONR207), the Sr50 R gene construct (pTA22- Sr50), the transcriptional activator GAL4-VP16 (Ubi-GAL4-VP16; pTA22-GAL4- VP16-PBS), UAS-AvrSr50 with Sr50, Ubi-AvrSr50 with Sr50, or UAS-AvrSr50, Sr50 with Ubi-
- SEQ ID NO: 28 Ubi-26 (GAL4-VP16) polynucleotide used in Example 16.
- the Ubi promoter region spans nucleotides 7 to 2003.
- the GAL4-VP16 open reading frame spans nucleotides 2053 to 2748.
- SEQ ID NO: 29 - UAS-AvrSr40 polynucleotide used in Example 16.
- the UAS promoter region spans nucleotides 435 to 552.
- the AvrSr50 open reading frame spans nucleotides 622 to 957.
- the term about refers to +/- 10%, more preferably +/- 5%, more preferably +/- 1%, of the designated value.
- the term "library” is used herein to refer to, for example, a collection of proteins, or a collection of polynucleotides encoding the proteins, or a collection of polynucleotides which are known and/or candidate promoters, or a collection of vectors comprising the polynucleotides, or a collection of protoplasts comprising the vectors expressing the proteins.
- the library can have at least 30, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1,000, at least 1,500, at least 2,000, at least 5,000, at least 10,000 or more different members.
- the different members of the library may be represented more than once in the library, particularly in a library of protoplasts.
- one or more or all of the proteins encoded by a polynucleotide of the library are 30 to 3,000, 50 to 3,000, 50 to 2,000, 50 to 1,500, 100 to 3,000, 100 to 2,000, 100 to 1,500, 250 to 3,000, 250 to 2,000, 250 to 1,500, 500 to 3,000, 500 to 2,000 or 500 to 1,500 amino acids in length.
- the library of protoplasts are in a single container.
- protoplast refers to a cell (a plant cell in the context of the present invention) that has had its cell wall removed, with the lipid bilayer membrane thereof naked.
- a “pool of protoplasts” or similar refers to a plurality protoplasts which may be the same, or have one or members which are the same, in a location such as a vessel. The protoplasts will be the same if they have not been transformed with a library of vectors as described herein.
- a pool of protoplasts comprises 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 1,000,000, 10,000,000 or more plant protoplasts, such as about 50,000 protoplasts.
- protein includes a singular polypeptide, plural polypeptides, and fragments thereof. This term refers to a molecule comprised of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds).
- fragment refers to a portion of a full length protein. As the skilled person is aware, many proteins have a domain(s) that bind the same protein as the full length protein, and hence such fragments comprising such domains can be used in the methods of the invention.
- effector protein refers to a protein produced by a pathogen, typically secreted by the pathogen, that alter plant cells to suppress host defense mechanisms, and facilitate infection by the pathogen.
- the effector protein is an avirulence protein (Avr).
- an “avirulence” protein is a protein produced by a plant pathogen, such as a fungal pathogen which subvert host cell biology upon infection.
- Avrs are typically small proteins which are recognized by the host cell resistance proteins.
- Avrs are effectors involved in pathogenicity. Examples of Avr proteins include, but are not limited to, AvrSr50, AvrSr27-2, AvrSr35 and AvrSr22b.
- a “rust resistance” (R) protein is a polypeptide that confers at least some degree resistance to a rust(s) which are plant diseases caused by pathogenic fungi typically of the order Pucciniales (previously known as Uredinales) such as Puccinia sp..
- the R protein has a nucleotide-binding domain leucine-rich repeat (NLR).
- NLRs represent the predominant immune receptors in plants and contain three distinct domains; a variable N-terminal signalling domain (coiled-coil (CC) or toll -interleukin- 1 receptor (TIR)), a central nucleotide binding (NB) domain, and a C-terminal leucine-rich (LRR) repeat domain (Lolle et al., 2020).
- NLR effector detection occurs either directly or indirectly by sensing effector-induced modifications of other host proteins.
- Domain swap experiments in NLRs have highlighted that recognition specificity is often determined by the LRR domain (Dodds et al., 2001), while structure determination of avirulence proteins has implicated surface exposed residues in mediating recognition (Wang et al., 2007).
- rust resistance proteins include, but are not limited to, Lr34, Lrl, Lr3, Lr2a, Lr3ka, LrlO, Lrl l, Lrl3, Lrl6, Lrl7, Lrl8, Lr21, Lr22a, LrB, Lr67, Sr50, Sr33, Srl3, Srl3c, Sr21, Sr22, Sr60, Sr61, Sr26, Sr2, Sr27 Sr35, Sr43, Sr45, Sr46, Yr36, Yr7, Yr5, YrSP, Yrl5, YrAS2388, Yr27 and YrUl.
- An R gene variant library could be generated using a single R gene that has been mutated into many variants, rather than screening many different R genes.
- the improved neural network-based prediction software AlphaFold2 (Jumper et al., 2021) and AlphaFold-Multimer (Evans et al., 2021) provide substantial guidance in understanding effector function and recognition, and in silico engineering of designer resistance genes.
- Marchal et al. (2022) summarised principles for engineering structure guided variants of an R gene. Mutations can be generated using site directed mutagenesis or other known methods for conducting random mutagenesis.
- the term “candidate” refers to a molecule to be screened.
- the candidate may or may not be known to have a particular function.
- polynucleotide As used herein, the terms “polynucleotide”, “nucleic acid”, and “nucleic acid molecule” are used interchangeably, and may encompass a singular nucleic acid; plural nucleic acids; a nucleic acid fragment, variant, or derivative thereof, and nucleic acid construct (e.g., messenger RNA (mRNA) and plasmid DNA (pDNA)).
- mRNA messenger RNA
- pDNA plasmid DNA
- a polynucleotide or nucleic acid may contain the nucleotide sequence of a full length cDNA sequence, or a fragment thereof, including untranslated 5' and/or 3' sequences and coding sequence(s).
- a polynucleotide or nucleic acid may be comprised of any polyribonucleotide or poly deoxyribonucleotide, which may include unmodified ribonucleotides or deoxyribonucleotides or modified ribonucleotides or deoxyribonucleotides.
- a polynucleotide or nucleic acid may be comprised of single- and double-stranded DNA; DNA that is a mixture of single- and doublestranded regions; single- and double stranded RNA; and RNA that is mixture of single- and double -stranded regions.
- Hybrid molecules comprising DNA and RNA may be single-stranded, double -stranded, or a mixture of single- and double-stranded regions.
- the foregoing terms also include chemically, enzymatically, and metabolically modified forms of a polynucleotide or nucleic acid.
- promoter refers to a DNA sequence capable of controlling the expression of a nucleic acid coding sequence or functional RNA.
- a promoter may be derived in its entirety from a native gene, a promoter may be comprised of different elements derived from different promoters found in nature, or a promoter may even comprise rationally designed DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different cell types, or at different stages of development, or in response to different environmental or physiological conditions. Examples of all of the foregoing promoters are known and used in the art to control the expression of heterologous nucleic acids.
- Promoters that direct the expression of a gene in most cell types at most times are commonly referred to as "constitutive promoters". Furthermore, while those in the art have (in many cases unsuccessfully) attempted to delineate the exact boundaries of regulatory sequences, it has come to be understood that DNA fragments of different lengths may have identical promoter activity. The promoter activity of a particular nucleic acid may be assayed using techniques familiar to those in the art. Promoters for expressing proteins in plant protoplasts are well known in the art.
- the terms "detectable marker” or “reporter” or variations thereof shall mean an operative system in which a nucleic acid comprises a gene that encodes a product that when expressed produces a reporter signal that is a readily measurable, e.g., by biological assay, immunoassay, or by colorimetric, Anorogenic, chemiluminescent or other methods.
- genes include, without limitation, p- glucuronidase (GUS), luciferase (LUC), chloramphenicol fransacetylase (CAT), yellow Huorescent protein (YFP), green Huorescent protein (GFP), and -galactosidase.
- the nucleic acid may be either RNA or DNA, linear or circular, single or double stranded, antisense or sense polarity, and is operatively linked to the necessary control elements for the expression of the reporter gene product.
- the required control elements will vary according to the nature of the reporter system and whether the reporter gene is in the form of DNA or RNA, but may include, but not be limited to, such elements as promoters, enhancers, translational control sequences, poly A addition signals, transcriptional termination signals and the like.
- the protoplast will comprise a gene encoding the reporter as part of a vector in the protoplast.
- resistance is a relative term in that the presence of a molecule such as a polypeptide (i) reduces the disease symptoms of a plant comprising the molecule that confers resistance, relative to a plant lacking the molecule, and/or (ii) reduces pathogen reproduction or spread on a plant or within a population of plants comprising the molecule. Resistance as used herein is relative to the “susceptible” response of a plant to the same pathogen. Typically, the presence of the molecule improves at least one production trait of a plant when infected with the pathogen, such as grain yield, when compared to a corresponding plant infected with the pathogen but lacking the molecule.
- a molecule does not necessarily confer complete pathogen resistance, for example when some symptoms still occur or there is some pathogen reproduction on infection but at a reduced amount within a plant or a population of plants. Resistance may occur at only some stages of growth of the plant, for example in adult plants (fully grown in size) and less so, or not at all, in seedlings, or at all stages of plant growth. Enhanced resistance can be determined by a number of methods known in the art such as analysing the plants for the amount of pathogen and/or analysing plant growth or the amount of damage or disease symptoms to a plant in the presence of the pathogen, and comparing one or more of these parameters to a corresponding control plant.
- the term “AvrSrl3” relates to a protein family which share high primary amino acid sequence identity, for example at least 60%, at least 70%, least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identity with the amino acid sequences provided as SEQ ID NO:24 and/or SEQ ID NO:25.
- the present inventors have determined that at least some variants of the AvrSrl3 protein family are effector proteins produced by at least one strain of Puccinia graminis.
- the term “AvrSr22” relates to a protein family which share high primary amino acid sequence identity, for example at least 60%, at least 70%, least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identity with the amino acid sequences provided as SEQ ID NO:26 and/or SEQ ID NO:27.
- the present inventors have determined that at least some variants of the AvrSrl3 protein family are effector proteins produced by at least one strain of Puccinia graminis.
- the cell wall of plants cells may be disrupted and removed mechanically (e.g. via homogenization, blending), the cell wall may be digested enzymatically, or the cell wall may be removed using a combination of mechanical and enzymatic methods, for example homogenization followed by treatment with enzymes for digestion of the cell wall.
- Protoplasts may also be obtained from cultured plant cells, for example liquid cultured plant cells, or solid cultured plant cells.
- Enzymes useful for digesting or degrading plant cell walls for release or protoplasts are known to one of skill in the art and may include cellulase (EC 3.2.1.4), pectinase (EC 3.2.1.15), xylanase (EC 3.2.1.8), chitinases (EC 3.2.1.14), hemicellulase, or a combination thereof.
- Non-limiting examples of suitable enzymes includes a multicomponent enzyme mixture comprising cellulase, hemicellulase, and pectinase, for example MACEROZYME R-10TM (containing approximately: Cellulase: 0.1 U/mg, Hemicellulase: 0.25 U/mg, and Pectinase: 0.5 U/mg) (also see Introduction to Plant Tissue Culture, by MK Razdan 2 nd Ed., Science Publishers, 2003).
- MACEROZYME R-10TM containing approximately: Cellulase: 0.1 U/mg, Hemicellulase: 0.25 U/mg, and Pectinase: 0.5 U/mg
- Alternate names, and types of cellulases include endo-l,4-p-D-glucanase; p-1,4- glucanase; p-l,4-endoglucan hydrolase; cellulase A; cellulosin AP; endoglucanase D; alkali cellulase; cellulase A 3; celludextrinase; 9.5 cellulase; avicelase; pancellase SS and 1,4-(1,3;1,4)- p-D-glucan 4-glucanohydrolase.
- pectinases include pectin depolymerase; pectinase; endopolygalacturonase; pectolase; pectin hydrolase; pectin polygalacturonase; endopolygalacturonase; poly-a-l,4-galacturonide glycanohydrolase; endogalacturonase; endo-D-galacturonase and poly(l,4- a-D-galacturonide) glycanohydrolase.
- xylanases include hemicellulase; endo-l,4-xylanase; xylanase; p- 1,4-xylanase; endo-l,4-xylanase; endo-P-l,4-xylanase; endo-l,4-p-D-xylanase; 1,4-p- xylan xylanohydrolase; P-xylanase; P-l,4-xylan xylanohydrolase; endo-l,4-p-xylanase; 3-D-xylanase.
- chitinases include chitodextrinase; 1,4-p- poly-N-acetylglucosaminidase; poly-p-glucosaminidase; p-l,4-poly-N-acetyl glucosamidinase; poly[l,4-(N-acetyl-P-D-glucosaminide)] glycanohydrolase.
- Choice of a particular enzyme or combination of enzymes, and concentration and reaction conditions may depend on the type of plant tissue used from which the protoplast is obtained.
- a mixture of cellulase, hemicellulase and pectinase, for example, a pectinase MACEROZYMETM or Multifect may be used in a concentration ranging from 0.01% to 2.5% (v/v), for example 0.01, 0.02, 0.04, 0.06, 0.08, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5% (v/v), or any amount therebetween.
- MACEROZYMETM or Multifect may be used alone, or in combination with other enzymes, e.g cellulase, pectinase, hemicellulase, or a combination thereof.
- Cellulase may be used in a concentration ranging from 0.1% to 5%, for example 0.1, 0.25, 0.5, 0.75, 1.0, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75. 3.0. 3.25, 3.5, 3.75, 4.0, 4.25, 4.5, 4.75, 5.0% (w/v) or any amount therebetween.
- the enzyme solution (alternately referred to as a cell wall degrading composition, digesting solution) will generally comprise a buffer or buffer system, an osmoticum, and one or more than one salts, divalent cations or other additives.
- the buffer or buffer system is selected to maintain a pH in the range suitable, for example, within the range of about pH 5.0 to about 8.0, or any value therebetween such as 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.2, 6.4, 6.6, 6.8, 7.0, 7.2, 7.4, 7.6, 7.8, 8.0.
- buffers or buffer systems include, but are not limited to, MES, phosphate, citrate and the like.
- One or more buffers or buffer systems may be combined in an enzyme solution (digesting solution); the one or more buffers may be present at a concentration from 0 mM to about 200 mM, or any amount therebetween, for example 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180 or 190 mM or any amount therebetween.
- an osmoticum component can be added if desired. The osmoticum and its concentration are selected to raise the osmotic strength of the enzyme solution.
- osmoticum examples include mannitol, sorbitol or other sugar alcohols, polyethylene glycol (PEG) of varying polymer lengths, and the like. Concentration ranges of osmoticum may vary depending on the plant species, the type of osmoticum used, and the type of plant tissue selected (species or organ of origin e.g. leaf or stem) generally the range is from 0M to about 0.8 M, for example 0.05, 0.1, 0.15, 0.2, 0.25, 0.3.
- osmoticum 0.35, 0.4, 0.5, 0.6, 0.7, or 0.75 M, or any amount therebetween, for example, 0, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600 nM mannitol, or any amount therebetween.
- concentration of osmoticum may also be expressed as a percentage (w/v).
- the osmoticum can also be omitted during digestion.
- Temperature may be controlled if desired during the digestion process. Useful temperature range should be between 4°C and 40°C or any temperature therebetween, for example from about 4°C to about 15 °C, or any amount therebetween, or from about 4°C to about 22°C, or any temperature therebetween. Depending to the temperature chosen, the other digestion experimental parameters may be adjusted to maintain optimal extraction conditions.
- Cations, salts or both may be added to improve plasma membrane stability, for example divalent cations, such as Ca 2+ , or Mg 2+ , at 0.5-50 mM, or any amount therebetween, salts, for example CaCh, NaCl, CuSC>4, KNOs, and the like, from about 0 to about 750 mM, or any amount therebetween, for example 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700 or 750 mM.
- divalent cations such as Ca 2+ , or Mg 2+
- salts for example CaCh, NaCl, CuSC>4, KNOs, and the like, from about 0 to about 750 mM, or any amount therebetween, for example 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700 or 750 mM.
- additives may also be added including a chelator for example, but not limited to, EDTA, EGTA, from about 0 to about 200 mM, or any amount therebetween, for example 5, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200 mM, or any amount therebetween, a reducing agent to prevent oxidation such as, but not limited to, sodium bisulfite or ascorbic acid, at 0.005-0.4% or any amount therebetween, for example 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4%, or any amount therebetween, specific enzyme inhibitors (see below), and if desired, an inhibitor of foliar senescence, for example, cycloheximide, kinetin, or one or more polyamines.
- a chelator for example, but not limited to, EDTA, EGTA, from about 0 to about 200 mM
- the digestion solution may also comprise one or more of mannitol from about 0 to about 600 mM, NaCl from about 0 to about 500 mM, EDTA from about 0 to about 50 mM, cellulose from about 1% to about 2% v/v, pectinase from about 0 to about 1% v/v, sodium metabisulfite from about 0.03 to about 0.04%, citrate from about 0 to about 125 mM orNaPC from about 0 to 75 mM.
- the plant matter may be treated to enhance access of the enzymes or enzyme composition to the plant cell wall.
- the epidermis of the leaf may be removed or 'peeled' before treatment with an enzyme composition.
- the plant matter may be cut into small pieces (manually, or with a shredding or cutting device such as an Urschel slicer); the cut up plant matter may be further infiltrated with an enzyme composition under a partial vacuum (Nishimura and Beevers 1978; Newell et al., 1998).
- Mechanical perturbation of the plant matter may also be applied to the plant tissues before or during treatment with an enzyme composition.
- cultured plant cells either liquid or solid cultures, may be used to prepare protoplasts.
- any suitable method of mixing or agitating the plant matter in the enzyme composition may be used.
- the plant matter may be gently swirled or shaken in a tray or pan or via a rotary shaker, tumbled in a rotating or oscillating drum.
- Precaution should be taken in order to minimize the protoplast damage until they are removed form the digestion soup.
- the digestion vessel should be selected accordingly.
- an enzyme composition comprising 1.5% cellulase (Onozuka R-10) and 0.375% MACEROZYMETM in 500 mM mannitol, 10 m CaCh and 5 mM MES (pH 5.6) may be used for protoplast production from some Nicotiana tissues.
- the concentration of mannitol may also be varied from about 0 to about 500 mM, or any amount therebetween.
- One of skill in the art, provided with the information disclosed herein, will be able to determine a suitable enzyme composition for the age and strain of the Nicotiana sp, or for another species.
- plant protoplasts can be produced from a variety of different plant cell types including, but not limited to, callus, leaf cells, stem cells, root cells, cotyledon, hypocotyls, mesophyll cells from in vitro leaves and somatic embryos.
- the protoplasts are not genetically modified.
- the protoplasts are genetically modified.
- the protoplasts have been genome edited such as described by Yue et al. (2021).
- the methods of the current invention can be practiced using protoplasts from a wide variety of plants.
- Non-limiting examples include, but are not limited to, monocots and dicots such as com (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B.
- juncea particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago saliva), rice (Oryza saliva), rye (Secale cereale), sorghum (Sorghum hicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana), sunflower (Helianthus annum), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tahacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), Sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea
- Vegetables include tomatoes (Solanum lycopersicum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
- tomatoes Solanum lycopersicum
- lettuce e.g., Lactuca sativa
- green beans Phaseolus vulgaris
- lima beans Phaseolus limensis
- peas Lathyrus spp.
- members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
- Ornamentals include azalea (Rhododendron spp ), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp ), tulips (Tulipa spp ), daffodils (Narcissus spp ), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pukherrima), and chrysanthemum.
- Conifers include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotil), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), Monterey pine (Pinus radiata), Douglas-fir (Pseudotsuga menziesii), Western hemlock (Tsuga canadensis), Sitka spruce (Picea glauca), redwood (Sequoia sempervirens), true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea), and cedars such as western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis).
- pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotil), ponde
- the plant is grape (Vitis sp.).
- the plant is a berry such as (Fragaria x ananassa), blueberry (Cyanococcus sp.), raspberry (Rubus idaeus), blackberry (some Rubus sp.) or cranberry (Oxycoccus sp.).
- the plant protoplast is a cereal plant protoplast such as wheat, barley, or rice.
- the plant protoplast is an oilseed plant protoplast such as canola, cotton or soy.
- At least one protein being screened in the protoplast is from the same plant species as the protoplast.
- the methods described herein include transforming a vector(s) into a plant protoplast.
- transforming is intended to mean presenting to the plant protoplasts the vector in such a manner that the vector gains access to the interior of the cell.
- the methods herein do not depend on a particular method for introducing a vector to a plant protoplast, only that the nucleic acid gains access to the interior of at least one protoplast.
- Methods for introducing nucleic acids into plant protoplasts are known in the art including, but not limited to, stable transformation methods, transient transformation methods, microinjection, and virus-mediated methods.
- transformation is by polyethylene glycol (PEG)-mediated transformation.
- the steps in the methods of the present invention may be performed manually or by automation.
- the methods are automated.
- one or more steps are automated.
- One embodiment of the current invention provides high throughput automated handling for protoplast isolation and/or transformation. Use of robots and other automated devices in the laboratory is common in the art (see, for example, Dlugosz et al, 2016).
- a high throughput automated method a plurality of plant protoplasts are transformed with a plurality of nucleic acids to produce a plurality of transformed plant protoplasts.
- the method is used to identify a protein-polynucleotide interaction.
- An example of how such interactions have been analysed using a different method relying on the use of protoplasts in the past is described by Wang et al. (2020).
- the vector is a viral vector such as a member of Geminiviridae family, particularly members of the Mastrevirus genus including Wheat dwarf virus, or Bean yellow dwarf virus.
- the vector is a plasmid vector. Examples of such vectors for transforming protoplast are well known in the art and are described in, for instance, Amdell et al. (2019), Yoo et al. (2007), Deng et al. (2022), Saur et al. (2019), Luo et al. (2021), Xing and Wang (2015), Ehlert et al. (2006), Hsu et al. (2010), Bottner et al. (2009), Bethke et al. (2009), Long et al. (2018), Li et al. (2019b), Menzel et al. (2019), Ortiz et al. (2022) and Ye et al. (2019).
- the method does not rely on the presence of a detectable marker (reporter) such as luciferase or a fluorescent protein.
- a detectable marker such as luciferase or a fluorescent protein.
- the protein-protein interaction in the plant protoplast results in programmed cell death which is used to detect the protein-protein interaction.
- the protoplasts comprising the molecules to be screened are centrifuged such that intact protoplasts are collected at the bottom of the centrifugation tube and dead cells and cell debris remain in the supernatant and are discarded.
- the living protoplasts are then subjected to RNA-seq analysis with mRNA matching the effector (for example) to which the R protein bound (for example) (second protein) being depleted in the protoplasts representing effector protein(s) (encoded by the mRNA) which bind the R protein.
- the first protein is not a fusion protein.
- the second protein is not a fusion protein.
- the first protein and the second protein are not fusions proteins.
- the first protein and the second protein do not have portions of the same protein.
- a protoplast two hybrid system is used to detected protein-protein interactions.
- the library of first proteins can be expressed as fusion proteins with a first component
- the second protein can be expressed as fusion protein with a second component
- a detectable signal such as driving expression of a reporter gene
- BD GAL4 DNA-binding domain
- AD activating domain
- the two components are co-located to produce a detectable signal such as driving expression of a reporter gene.
- GAL4 DNA-binding domain (BD) and activating domain (AD) as the two components. Interaction is measured using a reporter such as luciferase, GUS or a fluorescent protein.
- the cells can be sorted using, for example, fluorescence-activated cell sorting.
- a detectable marker is used to detect the interaction. For instance, when detecting if a candidate transcription factor binds a candidate promoter polynucleotide, the promoter is operably linked to a reporter gene, such as encoding a luciferase or fluorescent protein.
- the protoplasts may be sorted using a FACs machine, to select and separate the positive (fluorescent) protoplasts in a single FACS run. The selected protoplasts can then be sequence analysed to identify the transcription factorpromoter interaction in the positive population.
- MOT Multiplicity of Transfection
- the optimal MOT is going to depend on many factors, such as transformation efficiency, and in some cases perhaps the particular interaction, e.g. the R-Avr pair or transcription factorpromoter to be examined.
- the 0.7M - 0.00 IM range will cover the optimal MOT for most systems in which this kind of library screening might be performed.
- the lower ranges are preferable and may include lower than 0.07M. The lower the better.
- the number copies of each different vector of the library per protoplast used in the transformation is between about 2 million and about 0.001 million. In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is between about 0.7 million and about 0.01 million. In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is between about 0.7 million and about 0.07 million. In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is between about 0.3 million and about 0.1 million. In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is about 0. 14 million.
- the vector encoding the second protein can be transformed into the protoplasts at levels commonly used in the art. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 10 million and about 150 million. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 20 million and about 100 million. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 30 million and about 60 million. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 30 million and about 50 million. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 40 million. Pathogens and Plant Resistance
- the present invention may be used to identify a pathogen effector protein which binds a plant pathogen resistance protein of interest, or to identify a plant pathogen resistance protein which binds a pathogen effector protein of interest.
- the method is suitable for investigating a plant pathogen that manipulate the plants own programmed cell death (PCD) pathway or pathogens that induce a plant response that causes PCD.
- PCD programmed cell death
- examples are species from the orders eg. Uredinales (rusts), Ustilaginales (i.e. smuts such as ustilago maydis), Erysiphales (Powdery mildews), Oomycetes, Magnaporthales (e.g. Magnaporthe and Pyricularia or blasts), Dothideomycetes includes many of the other ascomycete pathogens (clado, zymo, stago, lepto).
- pathogen examples may be bacterial, Pseudomonas spp, Xanthomonas spp, Ralstonia spp (e.g. wilts).
- pathogen examples include Oomycetes (eg blights).
- Further pathogen examples include viruses, such as yellow dwarf virus, mosaic viruses of wheat, barley, oats, beans, and soybean dwarf virus (Luteoviridae family).
- the one or more fungal pathogen(s) is selected from, but not limited to, Puccinia sp., Blumeria sp., Fusarium sp., Magnaporthe sp., Bipolaris sp., Oidium sp., Gihherella sp., Cochlioholus sp., Exserohilum sp., Uredo sp.
- Microdochium sp. Helminthosporium sp., Monographella sp., Colletotrichum sp., Uromyces sp., Erysiphe sp., Ustilago sp., Zymoseptoria sp., Stagonospora sp., Septoria sp., Pyrenophora sp., Cladosporium sp., Leptospheria sp., Venturia sp. and Phakospsora sp..
- the one or more Oomycetes pathogen(s) is selected from, but not limited to, Phytophthora sp and Hyaloperonospora sp.
- the one or more bacteria pathogen(s) is selected from, but not limited to, Pseudomonas spp, Xanthomonas sp and Ralstonia sp.
- Plant pathogen resistance is determined by immune receptors that recognize appropriate ligands (i.e. pathogen-associated molecular patterns (PAMPs) or effector proteins) to activate defence molecules (which may be PRR (pattern recognition receptors) or R protein).
- PAMPs pathogen-associated molecular patterns
- effectors which may be PRR (pattern recognition receptors) or R protein.
- a resistance receptor /effector interaction usually induces PCD in a process termed the hypersensitive response (HR), thought to be a means of controlling pathogen spread.
- HR hypersensitive response
- the pathogen may inhibit PCD and/or induce the plant cell PCD.
- Resistance gene of the embodiments of the method described herein includes any NLR type protein, receptor kinases are another class of R genes and includes several types, LRR receptor kinases, LRR receptor like proteins, LysM receptor kinases, wall-associated receptor kinases (WAK), lectin receptor kinases (see, for example, Saintenac et al., 2018; Zhou and Yang, 2016).
- pTA22-YFP ( Figure 1) (SEQ ID NO: 1) is a high-copy (pUC19 origin of replication) plasmid containing the coding sequence for Venus yellow fluorescent protein (YFP) flanked by the maize ubiquitin 1 promoter (including first intron) and a 35S:NOS double terminator.
- the negative control empty vector pTA22 (SEQ ID NO: 2) was created by digestion of pTA22-YFP with KpnI-SacI followed by blunting and self-ligation, to remove the YFP coding sequence.
- the destination vectors pTA22-GW (SEQ ID NO: 3) and pTA22- GW-PBS (SEQ ID NO: 4) were created by replacing the YFP coding sequence in pTA22-YFP with a synthesised Gateway cassette via restriction/ligation (KpnI-SacI).
- pTA22-GW-PBS is identical to pTA22-GW with the exception that pTA22-GW-PBS also contains a reverse primer binding site (PBS) between the Gateway cassette and the 35S:NOS double terminator.
- the coding sequence of the wheat stem rust resistance gene Sr50 (SEQ ID NO: 5) and the open reading frames including introns of the wheat stem rust resistance genes Sr27 (SEQ ID NO: 6), Sr35 (SEQ ID NO: 7), Srl3c (SEQ ID NO: 8), Sr21 (SEQ ID NO: 9), Sr22 (SEQ ID NO: 10), Sr26 (SEQ ID NO: 11), Sr33 (SEQ ID NO: 12) and Sr61 (SEQ ID NO: 13) were cloned into pTA22-GW via Gateway LR reaction to create the expression vectors pTA22-Sr50, pTA22-Sr27, pTA22-Sr35, pTA22-Srl3c, pTA22- Sr21, pTA22-Sr22, pTA22-Sr26, pTA22-Sr33, and pTA22-Sr61, respectively.
- Avr gene open reading frames (AvrSr50 (SEQ ID NO: 14), AvrSr27-2 (SEQ ID NO: 15), AvrSr35 (SEQ ID NO: 16), AvrSr22b (SEQ ID NO: 17)) were cloned into pTA22- GW-PBS via Gateway LR reaction to create the expression vectors pTA22-AvrSr50- PBS, pTA22-AvrSr27-2-PBS, pTA22-AvrSr35-PBS, and pTA22-AvrSr22b-PBS, respectively.
- pTA22-AvrSrl3b-PBS was created via site directed mutagenesis (inverse PCR) of pTA22-0336-PBS to introduce the amino acid substitution R82C (primers AvrSrl3a-R102 C-F and AvrSrl3a-R102 C-R, Table 1).
- the Avr gene expression vectors were confirmed correct by diagnostic restriction enzyme digest.
- the coding sequences of AvrSrl3 and AvrSr22 were cloned into the pDONR207 vector from the library constructs pTA22- 0336-PBS and pTA22-0100-PBS, respectively, via Gateway BP reaction (Invitrogen).
- the predicted coding sequences of Srl3c, Sr22 and AvrSr22b were synthesized and subcloned into pDONR207 similarly.
- R and Avr gene sequences were then transferred into the binary vectors pAM-35s-GWY-YFPv and pAM-35s-YFPv-GWY, respectively, by Gateway LR reaction as previously described by Bemoux et al. (2008).
- Pgt Puccinia graminis fsp tritici
- Candidates for inclusion in the Pgt effector library were selected based on the following filtering criteria: present in secreted protein gene expression clusters 2, 3 or 7 (1588 candidates), length ⁇ 1000 nt after removal of the signal peptide encoding region (937 candidates), expression level in haustoria >5 transcripts per million (TPM; 760 candidates), SignalP3.0 signal peptide prediction probability >0.5 (738 candidates), unique translated protein sequence in candidate set (718 candidates).
- the coding sequences of the 718 putative effectors were codon-optimised for wheat using GeneOptimizer.
- the 696 effector library constructs were individually resuspended in 100 pL IDTE buffer (10 mM Tris, 0.1 mM EDTA, pH 7.5) and then pooled in equimolar amounts (150 finol per construct) using a JANUS G3 automated liquid handling workstation.
- the pooled library was named Pgt21 -0 EL 0001 -0718.
- Plasmid DNA isolation pTA22-YFP was isolated using the MACHEREY NAGEL NucleoBond Xtra Maxi Plus EF kit. All other plasmids were isolated using the MACHEREY NAGEL NucleoBond Xtra Midi Plus EF kit. The pooled library was isolated using the QIAGEN EndoFree Plasmid Giga kit. Isolated plasmid DNA was resuspended at a concentration of 1 pg/uL (measured on NanoDrop).
- Wheat (Triticum aestivum) seeds were planted in 13 cm pots (12 seeds per pot) containing Martins Seed Raising and Cutting Mix supplemented with 3 g/L osmocote. Seedlings were grown in a growth cabinet at 24°C on a cycle of 12 hours light (-100 pmol m' 2 s' 1 ) and 12 h dark, for 7-8 days. Wheat cultivar Fielder was used unless otherwise stated.
- Protoplast isolation and transformation was carried out as described previously (Amdell et al., 2019), with minor modifications.
- the abaxial epidermis of the primary leaf was peeled off and discarded. Peeled leaves were placed abaxial side down in a petri dish (ten leaves per dish) containing 0.6 M mannitol for 30 min.
- Leaves were then placed abaxial side down in a petri dish containing 10 mL of enzyme solution (20 mM MES-KOH (pH 5.7), 1.5% (wt/vol) cellulase Onozuka RS, 0.75% (wt/vol) macerozyme R10, 0.6 M mannitol, 10 mM KC1, 10 mM CaCh, 0.1% (wt/vol) BSA) and incubated at 25 °C for 3 hours in the dark with rotation at 50 RPM.
- enzyme solution 20 mM MES-KOH (pH 5.7), 1.5% (wt/vol) cellulase Onozuka RS, 0.75% (wt/vol) macerozyme R10, 0.6 M mannitol, 10 mM KC1, 10 mM CaCh, 0.1% (wt/vol) BSA
- the protoplast concentration was determined by cell counting on a hemocytometer, and subsequently adjusted to 2.5 x 10 5 cells/mL using MMG solution.
- 3 pmol of each vector was mixed with 200 pL of protoplasts (50,000 protoplasts) and 230 pL of PEG solution (40% (wt/vol) polyethylene glycol-4000, 0.2 M mannitol, 100 mM CaCh) in a 2 mL tube.
- the DNA/protoplast/PEG mixture was homogenised by gently flicking the tube, and then incubated for 15-30 min at room temperature.
- the transformation reaction was stopped by adding 940 pL of W5 solution and gently inverting the tube to mix.
- Transformed protoplasts were centrifuged for 2 min at 100 x g and the supernatant was removed.
- Protoplasts were resuspended in 650 pL W5 solution, transferred to 12- well cell culture plates and incubated at 23°C for 24 hours in the dark.
- transformation reactions were scaled up 8-1 Ox in 25 mL tubes, and transformed protoplasts were incubated in cell culture flasks. Transformations were performed in triplicate for all treatments and controls.
- protoplasts were transferred to 2 mL tubes, stained with propidium iodide (10 pg/mL) and then subjected to flow cytometry using the Invitrogen Attune NxT Flow Cytometer to detect fluorescence properties of individual cells.
- Propidium iodide fluorescence (excitation 561 nm, emission filter 620/15 nm) was measured as an indicator for living protoplasts (no fluorescence), and YFP fluorescence (excitation 488 nm, emission filter 530/30 nm) was measured as an indicator of the reporter gene expression.
- the percentage of YFP -positive protoplasts in the living (propidium iodide -negative) population was used to assess the transformation efficiency and the strength of programmed cell death (PCD).
- PCD programmed cell death
- Cycling conditions were as follows: 55°C for 10 min (inactivation of ezDNase and first strand cDNA synthesis), 98°C for 2 min (inactivation of reverse transcriptase and initial denaturation), 98°C for 10 sec (denaturation), 61°C for 10 sec (annealing), 72°C for 35 sec (extension), 72°C for 5 min (final extension). Eighteen cycles of denaturation, annealing and extension were performed.
- the PCR product was column purified using the QIAGEN QIAquick PCR Purification Kit, following the manufacturer’s protocol. DNA was eluted with 35 pL of elution buffer and the concentration determined using the Qubit IX dsDNA HS Assay Kit with the Invitrogen Qubit 4 Fluorometer. Concentrations ranged from -8-21 ng/pL.
- Illumina libraries were constructed using the Illumina DNA Prep Kit and IDT for Illumina DNA/RNA UD Indexes, following the manufacturer’s protocol with minor modifications. Around 120-220 ng of dsDNA from the cDNA synthesis / PCR was used as input to achieve on-bead normalisation. Right side library clean up with purification beads was carried out as per the Illumina protocol, while a 1.8x bead ratio was used for the left side clean up in order to retain smaller amplicons. Illumina library concentrations were measured using the Qubit IX dsDNA HS Assay Kit with the Invitrogen Qubit 4 Fluorometer. Concentrations ranged from -22-29 ng/pL.
- RNA-seq Quality control of library size was carried out using the Agilent TapeStation 2200 with High Sensitivity DI 000 ScreenTapes and Reagents. Illumina libraries were pooled in equimolar amounts for RNA-seq. RNA-seq
- RNA sequencing reads were cleaned using fastp 0.22.0 (Chen et al., 2018) (— length_required 20) specifying the UTR sequences common to all library transcripts as well as the Illumina DNA Prep adapter sequence as adapters.
- the clean reads were aligned to the coding sequences of the 696 cloned effector candidates with HISAT2 2.2.1 (Kim et al., 2015) (-very-sensitive; — sp 1,1; — no-spliced-alignment). Mappings where the read pairs map to different transcripts were dismissed.
- Salmon 1.8.0 (Patro et al., 2017) was used to quantify expression from the HISAT2 alignments.
- the effector candidates are, with reference to the Pgt21-0 genome, PGT21_028576, PGT21_028868, PGT21_023609, PGT21_028678, PGT21_022139, PGT21 024112, PGT21_007472, PGT21_018726, PGT21_028020, PGT21_029366, PGT21_003600, PGT21_018850, PGT21_005355, PGT21_006653, PGT21_019255, PGT21 021104, PGT21_032884, PGT21_016232, PGT21_003096, PGT21_005562, PGT21_035026, PGT21_037229, PGT21_027360, PGT21 011841, PGT21_022880, PGT21_025607, PGT21_004329, PGT21_003782, PGT21_029864, PGT21_033443, PGT21
- N. tabcicum and N. benthamiana plants were grown in a growth chamber at 23 °C with a 16-hour light period.
- Agrobacterium tumefaciens cultures containing the expression vectors of each construct were grown overnight at 28°C in LB media with appropriate antibiotic selections.
- the cells were pelleted and resuspended in infdtration mix (10 mM MES pH 5.6, lO mM MgCh, 1500 pM acetosyringone) to an optical density (OD600) of 0.2 or 0.5, followed by incubation at room temperature for two hours.
- Cultures were infiltrated into leaves of four-week-old plants with a 1 mL syringe. For documentation of cell death, leaves were photographed or scanned 2- 5 days after infiltration.
- Illumina genome sequence data derived from Pgt isolate 09ETH8-3 were obtained from NCBI BioProject PRJNA164531. Reads were cleaned with fastp 0.22.0 and default parameters and aligned to the Pgt21-0 genome reference with bwa mem 0.7.17. The reads that aligned to the chromosome 1A region that encodes PGT21_021053 were assembled with Trinity 2.13.2 (- jaccard clip — gcnomc giiidcd bam — gcnomc guidcd max intron 3000). Proteins were predicted from the assembled transcripts with TransDecoder 5.5.0 (TransDecoder.LongOrfs and TransDecoder. Predict) (https ://github .com/TransDecoder/TransDecoder) . The predicted protein was designated AvrSrl3b.
- a flow cytometric assay for PCD in transiently transformed protoplasts was established.
- the inventors and others used a luciferasebased assay for PCD in transiently transformed protoplasts (Saur et al., 2019; Luo et al., 2021; Ortiz et al., 2022).
- luciferase-based assay protoplasts are cotransformed with an R gene, a candidate Avr gene, and a luciferase reporter.
- luciferase expression is strong and therefore measured luminescence is high.
- MOT multiplicity of transfection
- MOT refers to the number of input copies of a given plasmid construct per cell in the transformation reaction.
- MOT is expressed in units of million plasmid copies (rounded, except for MOT 0) per cell.
- Single transformation where each cell receives only one library construct, is ideal for pooled library screening because it results in differential expression of individual library genes between individual cells within the transformed population (that is, it results in a variable population). By contrast, if the entire library is transformed into each cell, then screening likely will not be possible due to the transformed cell population being uniform.
- the frequency of single gene transformation would increase relative to the frequency of double transformation as MOT decreased.
- the YFP reporter construct pTA22-YFP was co-transformed with the RFP reporter construct pTA22-mRuby3 and the empty vector pTA22.
- pTA22-YFP and pTA22-mRuby3 were delivered in equimolar amounts at a range of MOT’s (36, 18, 3.6, 0.7, 0.07 or 0), while the amount of pTA22 was varied such that combined MOT for all three constructs remained constant at 72.
- MOT MOT
- six mock libraries were produced, where pTA22-YFP and pTA22-mRuby3 each represented a single library construct, and pTA22 represented all other library constructs with a constant total amount of plasmid.
- MOT MOT
- 0 and 36 are negative and positive controls, respectively. As shown in Figure 3, at higher MOT’s most transformed cells were double transformed, while at lower MOT’s most transformed cells were singly transformed. At lower MOT’s, expression levels were lower but still well above background levels. This result demonstrated that pooled library screening in protoplasts may be feasible, on the basis that vector delivery at the low MOT required for library screening produces predominantly singly transformed cells that express the vector gene at moderate levels.
- MOT multiplicity of transfection
- the MOT is a critical consideration for pooled library delivery for two main reasons: 1) There is a practical limit to the total amount of plasmid DNA that can be delivered to protoplasts and therefore it is not possible to deliver a pooled library using the same amount of each construct as used in single gene assays; and 2) delivering a pooled effector library at an MOT that is too high or too low could result in PCD that is too strong or too weak, respectively. This could potentially cause downstream processing or data analysis to fail e.g. due to low mRNA yields (too few living cells due to strong PCD) or inability to detect an effect in the RNA-seq data (no differential expression due to weak PCD).
- the ideal solution is to deliver the pooled library at the lowest MOT that consistently produces a detectable effect. However, it was unknown whether PCD would be detectable when the PCD-triggering Avr gene is delivered at low MOT.
- the R-Avr pair Sr50-AvrSr50 was used.
- Sr50 was delivered to protoplasts in the standard amount (MOT 36), while AvrSr50 was delivered at a range of MOT’s (36, 0.7, 0.14, 0.07 or 0).
- AvrSr35 was also delivered in varying amounts so that the combined MOT for AvrSr50 and AvrSr35 was 36.
- AvrSr50 and AvrSr35 in different amounts produced five mock libraries, where AvrSr50 represented a single library construct and AvrSr35 represented all other library constructs with a constant total amount of plasmid.
- a mock library was screened against the R genes Sr50 and Sr27 in protoplasts.
- the mock library consisted of AvrSr50 at MOT 0.14, AvrSr27-2 at MOT 0.14, and AvrSr35 at MOT 100 [0.14 x (718 - 2)].
- the mock library imitated a pooled library comprised of 718 constructs, where AvrSr50 and AvrSr27-2 each represented a single library construct and AvrSr35 represented the other 716 library constructs.
- Sr50, Sr27, or an empty vector (negative control) was delivered in the standard amount (MOT 36).
- RNA-seq reads were mapped to the mock library coding sequences and and the transcripts per million (TPM) was calculated for each Avr gene. It was hypothesised that only a proportion of transformed cells would receive the PCD- triggering Avr gene (AvrSr50 when screening against Sr50; AvrSr27-2 when screening against Sr27), and that only those cells would undergo PCD, resulting in depletion of mRNA and associated RNA-seq reads for that Avr gene only and identified by a decrease in TPM.
- the effector candidates in the library were selected from the Pgt21-0 reference genome annotation (Li et al., 2019a) as genes encoding secreted proteins with expression patterns similar to known Avr genes (Upadhyaya et al., 2021) as described in Example 1.
- the screening approach was the same as in Example 5 above, with the pooled effector library delivered at MOT 0.14 and RNA- Seq reads mapped to the effector library coding sequences.
- the library screen was performed a first time (screen 1) with Sr50 and the six R genes of interest. To ensure reproducibility, the library screen was then repeated from the beginning (screen 2) with Sr50, Sr27, and the six R genes of interest. Sr27 was used in screen 2 as an additional positive control to see whether all five known variants of AvrSr27 could be correctly identified.
- a single effector construct (#0100) showed significantly reduced expression in the presence of Sr22, and represents a candidate for AvrSr22. This result demonstrated that the experimental approach described in this example can successfully identify known and novel Avr genes by high-throughput screening of pooled effector libraries in protoplasts for recognition by specific R genes.
- Example 2 the flow cytometric assay for PCD described in Example 2 was used to independently validate the AvrSrl3 and AvrSr22 candidates that were identified in Example 6.
- co-transformation of Srl3c and the AvrSrl3 candidate (effector 0336) resulted in a substantial decrease in the percent YFP+ protoplasts, as did co-transformation of Sr22 and the AvrSr22 candidate (effector 0100), compared to co-expression of Sri 3c or Sr22 with another effector (AvrSr50), or expression of either candidate Avr alone.
- the flow cytometric assay for PCD described in Example 2 was used to further validate the AvrSrl3 candidate in protoplasts derived from wheat cv. Kronos (which carries Srl3a in its native context) and a transgenic wheat line (cv. Fielder) carrying Srl3c.
- transformation of effector 0336 alone (no R gene co-transformed) into cv. Kronos and the transgenic cv. Fielder line resulted in a decrease in the percent YFP+ protoplasts compared to the negative control line Fielder, although the decrease was moderate in both cases, possibly due to weak expression of Srl3a and Srl3c in cv. Kronos and the transgenic cv. Fielder line, respectively.
- This result further confirmed that effector 0336 is indeed AvrSrl3.
- Example 2 the flow cytometric assay for PCD described in Example 2 was used to further validate the AvrSr22 candidate in protoplasts derived from wheat cv. Schomburgk (which carries Sr22 in its native context), a transgenic wheat line (cv. Fielder) carrying Sr22, and a transgenic wheat line (cv. Robin) carrying a five gene stack (‘Big 5’) including Sr22 (Luo et al., 2021).
- effectors 0336 and 0100 are AvrSrl3 and AvrSr22, respectively.
- Example 2 the flow cytometric assay for PCD described in Example 2 was used to test the recognition specificity of Srl3c (Zhang et al., 2017; Gill et al., 2021) against two AvrSrl3 alleles: AvrSrl3 and AvrSrl3b.
- AvrSrl3 (library effector 0336) is encoded by PGT21_021053 on chromosome 1A in the Pgt21-0 genome reference (Li et al., 2019a).
- a BLAST search revealed no homologous sequence on the homologous chromosome IB of Pgt21-0, and a single identical gene copy in the Ug99 (race TTKSK) reference sequence, PGTUg99_007363 (Li et al., 2019a).
- both Pgt21-0 and Ug99 are heterozygous for AvrSrl3.
- An allelic variant of AvrSrl3, with a single amino acid substitution R82C was identified from Illumina genome sequence data derived from Pgt isolate 09ETH8-3 (race JRCQC) obtained from NCBI BioProject PRJNA164531, and designated AvrSrl3b. Gill et al. (2021) reported that Srl3c gave resistance to Ug99 and race JRCQC.
- the flow cytometric assay for PCD described in Example 2 was used to test the recognition specificity of Sr22 against two AvrSr22 alleles (AvrSr22 and AvrSr22b).
- AvrSr22 (library effector 0100) is encoded by PGT21_017626 on chromosome 16B in the Pgt21-0 genome reference (Li et al., 2019a).
- a BLAST search revealed a related sequence on the homologous chromosome 16A of Pgt21-0 that was not annotated but could encode a mature protein with nine amino acid differences from AvrSr22.
- RNA-seq reads corresponding to the sequence were present in sequence derived from infected tissues (Li et al., 2019a) suggesting that this allele is expressed, and it was designated AvrSr22b.
- the Ug99 reference genome contains sequences identical to both AvrSr22 (chromosome 16C, PGTUg99_032354) and AvrSr22b (chromosome 16A, not annotated).
- Sr22 recognised both AvrSr22 alleles based on the decrease in the percent YFP+ protoplasts. This result indicated that both Pgt21-0 and Ug99 are likely homozygous for AvrSr22.
- EXAMPLE 16 Flow cytometric assays for PCD using Sr50 with an inducible AyrSr50 activated by the transcription factor GAL4-VP16
- a flow cytometric assay for PCD was performed as described in Example 2 to determine whether transcriptional activation of an Avr effector and subsequent interaction with an R protein could be detected and quantified.
- the inventors assessed the capacity for recognition between a corresponding Avr and R protein via constitutive expression with both components driven by the Ubiquitin promoter (ubi).
- ubi Ubiquitin promoter
- the inventors assessed the capacity of a chimeric transcription factor GAL4-VP16 protein containing the yeast GAL4 DNA-binding domain and the Herpes simplex virus VP16 transcription activation domain (Sadowski et al., 1988) (encoded by SEQ ID NO:28) to bind to activate transcription of the AvrSr50 construct containing a minimal GAL4 upstream activator sequence (UAS; Brand & Perrimon, 1993) leading to expression of the AvrSr50 protein and induction of cell death in the presence of Sr50 (schematically represented in Figure 17).
- Example 6 In a high throughput library approach, the pooled rust effector library described in Example 6 was supplemented with the GAL4-VP16-PBS construct at the same molar concentration. For this experiment, co-transformation of Sr50 with the library act as a positive control becasue the AvrSr50 (corresponding Avr) is present, as well as UAS-AvrSr50 with Sr50 to detect GAL4-VP16 activation of AvrSr50.
- RNA-Seq reads mapped to library coding sequences.
- the anticipated result would be a depletion of both AvrSr50 and GAL4-VP16 transcripts as protoplasts that have taken up Sr50, UAS-AvrSr50 and GAL4-VP16 would undergo PCD.
- a synthesised library of candidate transcription factor genes can be screened against a specific promoter element controlling expression of an Avr gene co-expressed with a corresponding resistance gene to identify a transcription factor(s) acting on the promoter element to activate transcription.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Analytical Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Botany (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a library screening method for identifying protein- protein interactions, or protein-polynucleotide interactions, in a plant protoplast.
Description
PROTOPLAST SCREENING ASSAY
FIELD OF THE INVENTION
The present invention provides a library screening method for identifying protein-protein interactions, or protein-polynucleotide interactions, in a plant protoplast.
BACKGROUND OF THE INVENTION
Elucidating the in planta function of proteins is key in the process of understanding plant biology. This task often involves generating transgenic plants which is time-consuming, laborious and cannot easily be applied in large-scale screening approaches. The use of transient gene expression in protoplasts is an alternative technique that offers many advantages such as a high-throughput, cost effectiveness and great flexibility towards the components to be tested (Eeckhaut et al., 2013; Gillard et al., 2021).
Protoplasts are produced based on the isolation of individual cells from plant tissue, such as leaves, by digesting the surrounding cell walls with the help of fungal enzymes such as cellulase and pectinase. The resulting protoplasts can then be transfected with DNA encoding the proteins of interest.
Despite the known advantages of protoplasts for identifying a protein-protein, or protein-polynucleotide, interaction, there is a need for methods of increased throughput without increasing costs in time and materials.
SUMMARY OF THE INVENTION
The present inventors have identified a method for high-throughput screening of pooled gene libraries in plant cells. Whereas prior art relies on screening individual genes or gene combinations one by one, or sequential screening of library subsets, the method presented here enables rapid screening of large, complex libraries in a single pass.
Thus, in a first aspect the present invention provides a method of identifying a protein-protein interaction in a plant protoplast, the method comprising i) transforming a pool of plant protoplasts with a library of vectors encoding a first protein which is a member of a library of proteins expressed by the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector encoding a second protein,
b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector encoding the second protein, or c) the protoplasts endogenously produce the second protein, and ii) screening the pool of plant protoplasts for an interaction between a first protein and the second protein.
Figure 16 provides an overview of the pathogen effector library screening workflow of an embodiment of the invention.
In an embodiment, the number copies of each different vector of the library per protoplast used in step i) is between about 2 million and about 0.001 million.
In an embodiment, the number copies of each different vector of the library per protoplast used in step i) is between about 0.7 million and about 0.01 million.
In an embodiment, the number copies of each different vector of the library per protoplast used in step i) is between about 0.7 million and about 0.07 million.
In an embodiment, the number copies of each different vector of the library per protoplast used in step i) is about 0. 14 million.
Examples of protein-protein interactions that can be analysed using a method of the invention include, but are not limited to, pathogen effector protein/plant protein interactions (such as plant receptor protein) interactions, Avirulence (Avr) protein/plant protein (such as plant receptor protein) interactions, fungal pathogen Avirulence (Avr) protein/plant fungal resistance protein (such as plant receptor protein) interactions, transcription factor subunit interactions, protein/receptor binding interactions and protein kinase/substrate interactions.
In an embodiment, the method does not rely on the presence of a detectable marker (reporter) such as luciferase or a fluorescent protein. For instance, in an embodiment, the protein-protein interaction in the plant protoplast results in programmed cell death (PCD) which is used to detect the protein-protein interaction.
In an embodiment, the library of vectors encode a library of candidate effector proteins or fragments thereof from a plant pathogen some of which may interact directly or indirectly with a plant protein, or a combination thereof. In an embodiment, the second protein is a candidate plant protein or a fragment thereof which may interact directly or indirectly with a pathogen effector protein.
In an embodiment, the library of vectors encode a library of candidate effector proteins or fragments thereof from a plant pathogen some of which may interact directly or indirectly with a plant receptor protein (such as a plant immune receptor protein), or a combination thereof. In an embodiment, the second protein is a candidate
plant receptor protein or a fragment thereof which may interact directly or indirectly with a pathogen effector protein.
In an embodiment, the library of vectors encode a library of plant proteins or fragments thereof some of which may interact directly or indirectly with a plant pathogen effector protein, or a combination thereof. In an embodiment, the second protein is a candidate plant pathogen effector protein or a fragment thereof which may interact directly or indirectly with a plant protein. In an embodiment, the plant protein is a plant receptor protein or fragment thereof.
In an embodiment, the interaction is direct.
In an embodiment, the plant protein, such as a plant receptor protein, is a candidate or known plant pathogen resistance protein. In an embodiment, the plant protein is a candidate or known rust resistance protein.
In an embodiment, the pathogen is a fungus, virus or bacteria. In an embodiment, the pathogen is a fungus. In an embodiment, the fungus causes rust, mildew, blight or rot. In an embodiment, the fungus causes rust.
In an embodiment, the vector encoding the second protein further encodes a detectable marker (reporter) such as luciferase or a fluorescent protein. In an embodiment, the vector encoding the second protein does not encode a detectable marker (reporter).
In an embodiment, step ii) comprises extracting mRNA from a pool of live protoplasts and quantifying the level of mRNA encoding the proteins expressed by the library, wherein mRNA under-represented from the extraction is mRNA encoding a protein which interacts with the second protein.
In an embodiment, step ii) comprises screening for expression of a detectable marker (reporter) and selecting protoplasts for the presence or absence of marker expression. In an embodiment, the marker is a fluorescent protein.
In an embodiment, the interaction between a first protein and the second protein results in marker gene expression from a vector.
In an embodiment, the interaction between a first protein and the second protein decreases marker gene expression from a vector such as when the interaction results in cell death.
In an embodiment, the number copies of the vector encoding the second protein per protoplast used in part b) is between about 10 million and about 150 million.
In an embodiment, the vectors are plasmid vectors or viral vectors.
In one aspect, the present invention provides a method of identifying a protein- polynucleotide interaction in a plant protoplast, the method comprising
i) transforming a pool of plant protoplasts with a library of vectors encoding a first protein which is a member of a library of proteins expressed by the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector comprising or encoding a polynucleotide of interest, b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector comprising or encoding a polynucleotide of interest, or c) the protoplasts endogenously comprise a polynucleotide of interest, and ii) screening the pool of plant protoplasts for an interaction between a first protein and the polynucleotide of interest.
In an embodiment of the above aspect, the polynucleotide of interest is a promoter operably linked to an open reading frame encoding a second protein. In an embodiment, the protoplast further comprises a third protein, wherein upon expression of the second protein the third protein binds the second protein which results in programmed cell death (PCD) which is used to, indirectly, detect the protein- polynucleotide interaction. In an example, the second protein is a fungal pathogen A virulence (Avr) protein and the third protein is a plant fungal resistance protein (such as plant receptor protein), or vice versa, as described herein.
In one aspect, the present invention provides a method of identifying a protein- polynucleotide interaction in a plant protoplast, the method comprising i) transforming a pool of plant protoplasts with a library of vectors comprising or encoding a polynucleotide which is a member of a library of polynucleotides comprised in, or expressed by, the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector encoding a first protein, b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector encoding a first protein, or c) the protoplasts endogenously comprise the first protein, and ii) screening the pool of plant protoplasts for an interaction between a polynucleotide and the first protein.
In an embodiment, the library of vectors encode a library of candidate or known transcription factors or a combination thereof. The transcription factor may be a transcription activator or a transcription repressor. The library may comprise transcription activators, transcription repressor, or a combination thereof, whether known or candidates thereof.
In an embodiment, the polynucleotide can be a candidate or known promoter.
In a further aspect, the present invention provides a method of determining the phenotypic effect in a plant, or part thereof, of a protein-protein interaction or protein- polynucleotide interaction identified by a method of the invention, the method comprising, i) modifying the expression of one of the proteins or polynucleotides in a plant or part thereof, and ii) examining the effects of the modification on the phenotype of the plant, or part thereof.
In an embodiment, the protein is a candidate pathogen resistance protein and the phenotype is resistance to the pathogen. In an embodiment, the pathogen is a fungus, virus or bacteria. In an embodiment, the pathogen is a fungus.
In an embodiment, the plant part is a plant leaf or part thereof. In an embodiment, the leaf or part thereof is a Nicotianci sp. leaf such as a Nicotianci tabcicum or Nicotianci benthamiana leaf or part thereof.
In an embodiment, the plant, or part thereof, is genetically modified to express or comprise the protein or polynucleotide. In an alternate embodiment, the plant, or part thereof, is genetically modified to reduce expression of the protein or polynucleotide. The genetic modification can be transient.
In an embodiment, the plant or part thereof does not endogenously produce the protein or polynucleotide.
In another aspect, the present invention provides a method of producing a library of plant protoplasts, the method comprising transforming a pool of plant protoplasts with a library of vectors encoding a library of proteins, wherein the number copies of each different vector of the library per protoplast used in the transformation is between about 2 million and about 0.001 million, between about 0.7 million and about 0.01 million, between about 0.7 million and about 0.07 million, or about 0.14 million.
In another aspect, the present invention provides a composition comprising a library of vectors encoding at least 100 different predicted pathogen effector proteins or fragments thereof which may interact with a plant protein, or a combination thereof, and a suitable carrier.
In an embodiment, the library of vectors encodes at least 200, at least 500, least 600, least 700, least 1,000, least 2,000, between 100 and 10,000, between 100 and 5,000, between 100 and 2,000, between 500 and 10,000, between 500 and 5,000, or between 500 and 2,000, different predicted pathogen effector proteins or fragments thereof which may interact with a plant protein, or a combination thereof.
The present inventors have identified new effector protein families, referred to herein as AvrSrl3 and AvrSr22.
Thus, in a further aspect the present invention provides a method of identifying a molecule that confers resistance to a pathogen expressing an AvrSrl3 or AvrSr22 effector protein, the method comprising a) identifying a molecule that binds the effector protein, and b) determining if the molecule confers resistance to the pathogen.
The skilled person would understand that any procedure for identifying whether a molecule binds a protein can be used for the present invention.
In an embodiment, the pathogen is a plant pathogen, the molecule is a polypeptide and step b) comprises expressing the polypeptide in a plant.
Any embodiment herein shall be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise.
The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.
Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.
The invention is hereinafter described by way of the following non-limiting Examples and with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
Figure 1. Vector diagram of the YFP reporter construct pTA22-YFP.
Figure 2. Flow cytometric assay for PCD in wheat protoplasts. The YFP reporter construct (pTA22-YFP) was co-transformed with either an Avr gene construct (pTA22- AvrSr50-PBS, pTA22-AvrSr27-2-PBS, or pTA22-AvrSr35-PBS), an R gene construct (pTA22-Sr50, pTA22-Sr27, or pTA22-Sr35), a non-matching R-Avr pair, or a matching R-Avr pair (Sr50-AvrSr50, Sr27-AvrSr27-2, or Sr35-AvrSr35). Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. Vertical bars indicate the
mean of three replicates (grey dots). Statistical analysis was performed using the two- sample /-test assuming equal variances. ****,/> < 0.0001; ***,/> < 0.001.
Figure 3. Flow cytometric assessment of single construct transformation frequency at different MOT. The MOT is defined as the number of plasmid copies per cell in the transformation reaction. The YFP reporter construct (pTA22-YFP) was co-transformed with the RFP reporter construct (pTA22-mRuby3) and the empty vector (pTA22). pTA22-YFP and pTA22-mRuby3 were delivered in equimolar amounts at a range of MOT’s (0, 0.07, 0.7, 3.6, 18, 36), while the amount of pTA22 was varied such that the MOT of all constructs combined remained constant at 72. Data points in the bottom right (rectangular) quadrant represent cells that express YFP only, data points in the top left (rectangular) quadrant represent cells that express RFP only, and data points in the top right (square) quadrant represent cells that express both YFP and RFP.
Figure 4. Optimisation of Avr gene MOT using the flow cytometric assay for PCD in wheat protoplasts. The MOT is defined as the number of plasmid copies per cell in the transformation reaction. The YFP reporter construct (pTA22-YFP) was co-transformed with the Sr50 construct (pTA22-Sr50) and the AvrSr50 construct (pTA22-AvrSr50- PBS). pTA22-YFP and pTA22-Sr50 were each delivered at an MOT of 36 M (million plasmid copies per cell), while pTA22-AvrSr50-PBS was delivered at a range of MOT’s (0, 0.07, 0.14, 0.7, 36). Recognition of AvrSr50 by Sr50 results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. Vertical bars indicate the mean of three replicates (grey dots). Statistical analysis was performed using the two-sample /-test assuming equal variances. *,p < 0.05.
Figure 5. Screening of a mock effector library in protoplasts. The mock library is comprised of AvrSr50 (MOT 0.14) and AvrSr27-2 (MOT 0.14) spiked into a background of AvrSr35 (MOT 100). The mock library was screened against Sr50 and Sr27, with the empty vector (EV) pTA22 serving as a negative control. Recognition of Avr50 by Sr50, and recognition of AvrSr27-2 by Sr27, results in PCD and a consequent depletion of RNA-seq reads derived from AvrSr50 and AvrSr27-2 transcripts, respectively. AvrSr50 and AvrSr27-2 transcripts per million (TPM) were normalised to AvrSr35 TPM. n = 3. Error bars represent the standard deviation.
Figure 6. Screening of the pooled effector library Pgt21-0_EL_0001-0718 in wheat protoplasts. The library is comprised of 696 predicted effectors from stem rust, each
represented by a data point on each volcano plot. The library was screened against two positive control R genes (Sr50 and Sr27) whose matching effectors are known and present in the library, as well as six R genes of interest (Srl3c, Sr21, Sr22, Sr26, Sr33, and Sr61) whose matching effectors are unknown. The screen was performed twice, and Sr27 was not included in the first screen. Recognition of a particular library effector(s) by the R protein results in PCD and a consequent depletion of RNA-seq reads derived from the effector(s), which is indicated by a pronounced negative Log2 fold change and higher -Logic adjusted P value. Recognised effectors (labelled with their library ID number) are therefore spatially separated from the population of unrecognised effectors that coalesces around the zero point. P values of zero (-Logic adjusted P = infinity) are converted to the machine-lowest possible value such that - Logic adjusted P is slightly greater than 300 (AvrSr50 in both screens; 0100 and the five variants of AvrSr27 in screen 2).
Figure 7. Validation of AvrSrl3 and AvrSr22 candidates (0336 and 0100, respectively) using the flow cytometric assay for PCD in wheat protoplasts. The YFP reporter construct (pTA22-YFP) was co-transformed with an Avr gene construct (pTA22-0336- PBS, pTA22-0100-PBS, pTA22-AvrSr50-PBS, or pTA22-AvrSr27-2-PBS), and an R gene construct (pTA22-Srl3c, pTA22-Sr22, or pTA22-Sr27) or the pTA22 empty vector (pEV). Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. Vertical bars indicate the mean of three replicates (grey dots). Statistical analysis was performed using the two-sample /-test assuming equal variances.
< 0.0001; EV, empty vector.
Figure 8. Validation of the AvrSrl3 candidate (0336) using the flow cytometric assay for PCD in wheat protoplasts derived from different cultivars. KR is cv. Kronos, which carries Srl3a in its native context. FL Srl3c is a transgenic cv. Fielder line carrying Srl3c. FL is cv. Fielder, which does not carry any Srl3 allele. The YFP reporter construct (pTA22-YFP) was co-transformed with an Avr gene construct (pTA22-0336- PBS or pTA22-AvrSr50-PBS). Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. Vertical bars indicate the mean of three replicates (grey dots). Statistical analysis was performed using the two-sample /-test assuming equal variances. ****. ?
0.0001.
Figure 9. Validation of the AvrSr22 candidate (0100) using the flow cytometric assay for PCD in wheat protoplasts derived from different cultivars. SB is cv. Schomburgk, which carries Sr22 in its native context. FL Sr22 is a transgenic cv. Fielder line carrying Sr22. Big 5 is a transgenic cv. Robin line carrying five R genes including Sr22. FL is cv. Fielder, which does not carry Sr22. The YFP reporter construct (pTA22-YFP) was co-transformed with an Avr gene construct (pTA22-0100-PBS, pTA22-AvrSr27-2-PBS, or pTA22-AvrSr50-PBS). Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. Vertical bars indicate the mean of three replicates (grey dots). Statistical analysis was performed using the two-sample /-test assuming equal variances. **** p < 0.0001.
Figure 10. Validation of candidates for AvrSrl3 (0336) and AvrSr22 (0100) via agroinfiltration of N. tabacum leaves. Leaf sectors express combinations of Sr27, Srl3c or Sr22 C-terminally fused to YFP along with AvrSrl3, AvrSr22, or AvrSr27 N- terminally fused to YFP, or with YFP alone. Recognition of the Avr protein by the R protein results in PCD, which is visible as light brown necrotic tissue.
Figure 11. Validation of candidates for AvrSrl3 (0336) and AvrSr22 (0100) via agroinfiltration of N. benthamiana leaves. Leaf sectors express combinations of Sr27, Srl3c or Sr22 C-terminally fused to YFP along with AvrSrl3, AvrSr22, or AvrSr27 N- terminally fused to YFP, or with YFP alone. Recognition of the Avr protein by the R protein results in PCD, which is visible as discoloured necrotic tissue.
Figure 12. Validation of Srl3 allele recognition specificity for AvrSrl3 (0336) using the flow cytometric assay for PCD in wheat protoplasts. The YFP reporter construct (pTA22-YFP) was co-transformed with the AvrSrl3 construct (pTA22-0336-PBS) or an empty vector (pTA22), and an R gene construct (pTA22-Srl3c or pTA22-Srl3 SI) or the empty vector. Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP- positive. Vertical bars indicate the mean of three replicates (grey dots). Statistical analysis was performed using the two-sample /-test assuming equal variances. ****, p < 0.0001; **,p < 0.01; EV, empty vector.
Figure 13. Validation of Sr22 recognition specificity for AvrSr22 alleles using the flow cytometric assay for PCD in wheat protoplasts. The YFP reporter construct (pTA22-
YFP) was co-transformed with the AvrSr22 (0100) or AvrSr22b construct (pTA22- 0100-PBS and pTA22-AvrSr22b-PBS, respectively) or an empty vector (pTA22), and the Sr22 construct (pTA22-Sr22) or empty vector. Recognition of the Avr protein by the R protein results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. Vertical bars indicate the mean of three replicates (grey dots). Statistical analysis was performed using the two-sample /-test assuming equal variances. **** p < 0.0001; EV, empty vector.
Figure 14. Validation of Sri 3c and Sr22 recognition specificity for AvrSrl3 and AvrSr22 alleles, respectively, via agroinfiltration of N. tabacum leaves. Leaf sectors express combinations of Sri 3c or Sr22 C-terminally fused to YFP along with AvrSrl3, AvrSrl3b, AvrSr22, or AvrSr22b N-terminally fused to YFP, or with YFP alone. Recognition of the Avr protein by the R protein results in PCD, which is visible as light brown necrotic tissue.
Figure 15. Validation of Sri 3c and Sr22 recognition specificity for AvrSrl3 and AvrSr22 alleles, respectively, via agroinfiltration of N. benthamiana leaves. Leaf sectors express combinations of Sri 3c or Sr22 C-terminally fused to YFP along with AvrSrl3, AvrSrl3b, AvrSr22, or AvrSr22b N-terminally fused to YFP, or with YFP alone. Recognition of the Avr protein by the R protein results in PCD, which is visible as discoloured necrotic tissue.
Figure 16. Workflow for high-throughput screening of a pooled effector library in plant protoplasts.
Figure 17. Assay for PCD using Sr50 with an inducible AvrSr50 activated by the transcription factor GAL4-VP16.
Figure 18. Flow cytometric assay for PCD in wheat protoplasts for validation of using the platform to screen for transcription factors mediating activation of a target promoter element. The YFP reporter construct (pTA22-YFP) was co-transformed with the Avr gene, AvrSr50 either constitutively expressed using the Ubiquitin promoter (Ubi- AvrSr50; pTA22-AvrSr50-PBS) or the yeast GAL4 minimal upstream activation sequence (UAS-AvrSr50; AvrSr50-pDONR207), the Sr50 R gene construct (pTA22- Sr50), the transcriptional activator GAL4-VP16 (Ubi-GAL4-VP16; pTA22-GAL4- VP16-PBS), UAS-AvrSr50 with Sr50, Ubi-AvrSr50 with Sr50, or UAS-AvrSr50, Sr50
with Ubi-GAL4-VP16. Recognition of AvrSr50 protein by Sr50 when constitutively expressed or activated by inclusion of the transcriptional activator GAL4-VP16 with the UAS-AvrSr50 construct results in PCD, which is indicated by a decrease in the percentage of living protoplasts that are YFP-positive. The vertical bars are the mean of two biological replicates and errors bars represent the standard deviation. Statistical analysis was performed using an ANOVA test; ****, p < 0.0001.
KEY TO THE SEQUENCE LISTING SEQ ID NO 1 - pTA22-YFP SEQ ID NO 2 - pTA22 SEQ ID NO 3 - pTA22-GW SEQ ID NO 4 - pTA22-GW-PBS SEQ ID NO 5 - Sr50 open reading frame SEQ ID NO 6 - Sr27 open reading frame SEQ ID NO 7 - Sr35 open reading frame SEQ ID NO 8 - Sri 3c open reading frame SEQ ID NO 9 - Sr21 open reading frame SEQ ID NO 10 - Sr22 open reading frame SEQ ID NO 11 - Sr26 open reading frame SEQ ID NO 12 - Sr33 open reading frame SEQ ID NO 13 - Sr61 open reading frame SEQ ID NO 14 - AvrSr50 open reading frame SEQ ID NO 15 - AvrSr27-2 open reading frame SEQ ID NO 16 - AvrSr35 open reading frame SEQ ID NO 17 - AvrSr22b open reading frame
SEQ ID NOs 18 to 21 - Oligonucleotide primers
SEQ ID NOs 22 and 23 - Additional sequences designed to facilitate synthesis and cloning
SEQ ID NO: 24 - AvrSrl3 (minus signal sequence)
SEQ ID NO: 25 - AvrSrl3b (minus signal sequence)
SEQ ID NO: 26 - AvrSr22 (minus signal sequence)
SEQ ID NO: 27 - AvrSr22b (minus signal sequence)
SEQ ID NO: 28 - Ubi-26 (GAL4-VP16) polynucleotide used in Example 16. The Ubi promoter region spans nucleotides 7 to 2003. The GAL4-VP16 open reading frame spans nucleotides 2053 to 2748.
SEQ ID NO: 29 - UAS-AvrSr40 polynucleotide used in Example 16. The UAS promoter region spans nucleotides 435 to 552. The AvrSr50 open reading frame spans nucleotides 622 to 957.
DETAILED DESCRIPTION OF THE INVENTION
General Techniques and Definitions
Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in protoplast production, cell culture and transformation, molecular genetics, protein chemistry, and biochemistry).
The term “and/or”, e.g., “X and/or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.
As used herein, the term about, unless stated to the contrary, refers to +/- 10%, more preferably +/- 5%, more preferably +/- 1%, of the designated value.
Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
The term "library" is used herein to refer to, for example, a collection of proteins, or a collection of polynucleotides encoding the proteins, or a collection of polynucleotides which are known and/or candidate promoters, or a collection of vectors comprising the polynucleotides, or a collection of protoplasts comprising the vectors expressing the proteins. The library can have at least 30, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, at least 1,000, at least 1,500, at least 2,000, at least 5,000, at least 10,000 or more different members. The different members of the library may be represented more than once in the library, particularly in a library of protoplasts. In an embodiment, one or more or all of the proteins encoded by a polynucleotide of the library are 30 to 3,000, 50 to 3,000, 50 to 2,000, 50 to 1,500, 100 to 3,000, 100 to 2,000, 100 to 1,500, 250 to 3,000, 250 to 2,000, 250 to 1,500, 500 to 3,000, 500 to 2,000 or 500 to 1,500 amino acids in length. In an embodiment, the library of protoplasts are in a single container.
The term "protoplast," as used herein, refers to a cell (a plant cell in the context of the present invention) that has had its cell wall removed, with the lipid bilayer membrane thereof naked.
As used herein, a “pool of protoplasts” or similar refers to a plurality protoplasts which may be the same, or have one or members which are the same, in a location such as a vessel. The protoplasts will be the same if they have not been transformed with a library of vectors as described herein. In an embodiment, a pool of protoplasts comprises 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 1,000,000, 10,000,000 or more plant protoplasts, such as about 50,000 protoplasts.
As used herein, the term "protein" includes a singular polypeptide, plural polypeptides, and fragments thereof. This term refers to a molecule comprised of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term “fragment” refers to a portion of a full length protein. As the skilled person is aware, many proteins have a domain(s) that bind the same protein as the full length protein, and hence such fragments comprising such domains can be used in the methods of the invention.
As used herein, the term “effector protein” or variation thereof refers to a protein produced by a pathogen, typically secreted by the pathogen, that alter plant cells to suppress host defense mechanisms, and facilitate infection by the pathogen. In an embodiment, the effector protein is an avirulence protein (Avr).
As used herein, an “avirulence” protein (Avr) is a protein produced by a plant pathogen, such as a fungal pathogen which subvert host cell biology upon infection. Avrs are typically small proteins which are recognized by the host cell resistance proteins. Avrs are effectors involved in pathogenicity. Examples of Avr proteins include, but are not limited to, AvrSr50, AvrSr27-2, AvrSr35 and AvrSr22b.
As used herein, a “rust resistance” (R) protein, or variations thereof, is a polypeptide that confers at least some degree resistance to a rust(s) which are plant diseases caused by pathogenic fungi typically of the order Pucciniales (previously known as Uredinales) such as Puccinia sp.. In one example, the R protein has a nucleotide-binding domain leucine-rich repeat (NLR). NLRs represent the predominant immune receptors in plants and contain three distinct domains; a variable N-terminal signalling domain (coiled-coil (CC) or toll -interleukin- 1 receptor (TIR)), a central nucleotide binding (NB) domain, and a C-terminal leucine-rich (LRR) repeat domain (Lolle et al., 2020). NLR effector detection occurs either directly or indirectly by sensing effector-induced modifications of other host proteins. Domain swap experiments in NLRs have highlighted that recognition specificity is often determined by the LRR domain (Dodds et al., 2001), while structure determination of avirulence proteins has implicated surface exposed residues in mediating recognition (Wang et al.,
2007). Examples of rust resistance proteins include, but are not limited to, Lr34, Lrl, Lr3, Lr2a, Lr3ka, LrlO, Lrl l, Lrl3, Lrl6, Lrl7, Lrl8, Lr21, Lr22a, LrB, Lr67, Sr50, Sr33, Srl3, Srl3c, Sr21, Sr22, Sr60, Sr61, Sr26, Sr2, Sr27 Sr35, Sr43, Sr45, Sr46, Yr36, Yr7, Yr5, YrSP, Yrl5, YrAS2388, Yr27 and YrUl. An R gene variant library could be generated using a single R gene that has been mutated into many variants, rather than screening many different R genes. The improved neural network-based prediction software AlphaFold2 (Jumper et al., 2021) and AlphaFold-Multimer (Evans et al., 2021) provide substantial guidance in understanding effector function and recognition, and in silico engineering of designer resistance genes. Marchal et al. (2022) summarised principles for engineering structure guided variants of an R gene. Mutations can be generated using site directed mutagenesis or other known methods for conducting random mutagenesis.
As used herein, the term “candidate” refers to a molecule to be screened. The candidate may or may not be known to have a particular function.
As used herein, the terms "polynucleotide", "nucleic acid", and "nucleic acid molecule" are used interchangeably, and may encompass a singular nucleic acid; plural nucleic acids; a nucleic acid fragment, variant, or derivative thereof, and nucleic acid construct (e.g., messenger RNA (mRNA) and plasmid DNA (pDNA)). A polynucleotide or nucleic acid may contain the nucleotide sequence of a full length cDNA sequence, or a fragment thereof, including untranslated 5' and/or 3' sequences and coding sequence(s). A polynucleotide or nucleic acid may be comprised of any polyribonucleotide or poly deoxyribonucleotide, which may include unmodified ribonucleotides or deoxyribonucleotides or modified ribonucleotides or deoxyribonucleotides. For example, a polynucleotide or nucleic acid may be comprised of single- and double-stranded DNA; DNA that is a mixture of single- and doublestranded regions; single- and double stranded RNA; and RNA that is mixture of single- and double -stranded regions. Hybrid molecules comprising DNA and RNA may be single-stranded, double -stranded, or a mixture of single- and double-stranded regions. The foregoing terms also include chemically, enzymatically, and metabolically modified forms of a polynucleotide or nucleic acid.
The term "promoter" refers to a DNA sequence capable of controlling the expression of a nucleic acid coding sequence or functional RNA. A promoter may be derived in its entirety from a native gene, a promoter may be comprised of different elements derived from different promoters found in nature, or a promoter may even comprise rationally designed DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different cell types, or at
different stages of development, or in response to different environmental or physiological conditions. Examples of all of the foregoing promoters are known and used in the art to control the expression of heterologous nucleic acids. Promoters that direct the expression of a gene in most cell types at most times are commonly referred to as "constitutive promoters". Furthermore, while those in the art have (in many cases unsuccessfully) attempted to delineate the exact boundaries of regulatory sequences, it has come to be understood that DNA fragments of different lengths may have identical promoter activity. The promoter activity of a particular nucleic acid may be assayed using techniques familiar to those in the art. Promoters for expressing proteins in plant protoplasts are well known in the art.
As used herein, the terms "detectable marker" or "reporter" or variations thereof shall mean an operative system in which a nucleic acid comprises a gene that encodes a product that when expressed produces a reporter signal that is a readily measurable, e.g., by biological assay, immunoassay, or by colorimetric, Anorogenic, chemiluminescent or other methods. Such genes include, without limitation, p- glucuronidase (GUS), luciferase (LUC), chloramphenicol fransacetylase (CAT), yellow Huorescent protein (YFP), green Huorescent protein (GFP), and -galactosidase. The nucleic acid may be either RNA or DNA, linear or circular, single or double stranded, antisense or sense polarity, and is operatively linked to the necessary control elements for the expression of the reporter gene product. The required control elements will vary according to the nature of the reporter system and whether the reporter gene is in the form of DNA or RNA, but may include, but not be limited to, such elements as promoters, enhancers, translational control sequences, poly A addition signals, transcriptional termination signals and the like. Typically, the protoplast will comprise a gene encoding the reporter as part of a vector in the protoplast.
As used herein, “resistance” is a relative term in that the presence of a molecule such as a polypeptide (i) reduces the disease symptoms of a plant comprising the molecule that confers resistance, relative to a plant lacking the molecule, and/or (ii) reduces pathogen reproduction or spread on a plant or within a population of plants comprising the molecule. Resistance as used herein is relative to the “susceptible” response of a plant to the same pathogen. Typically, the presence of the molecule improves at least one production trait of a plant when infected with the pathogen, such as grain yield, when compared to a corresponding plant infected with the pathogen but lacking the molecule. Thus, the terms “resistance” and “enhanced resistance” are generally used herein interchangeably. Furthermore, a molecule does not necessarily confer complete pathogen resistance, for example when some symptoms still occur or
there is some pathogen reproduction on infection but at a reduced amount within a plant or a population of plants. Resistance may occur at only some stages of growth of the plant, for example in adult plants (fully grown in size) and less so, or not at all, in seedlings, or at all stages of plant growth. Enhanced resistance can be determined by a number of methods known in the art such as analysing the plants for the amount of pathogen and/or analysing plant growth or the amount of damage or disease symptoms to a plant in the presence of the pathogen, and comparing one or more of these parameters to a corresponding control plant.
As used herein, the term “AvrSrl3” relates to a protein family which share high primary amino acid sequence identity, for example at least 60%, at least 70%, least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identity with the amino acid sequences provided as SEQ ID NO:24 and/or SEQ ID NO:25. The present inventors have determined that at least some variants of the AvrSrl3 protein family are effector proteins produced by at least one strain of Puccinia graminis.
As used herein, the term “AvrSr22” relates to a protein family which share high primary amino acid sequence identity, for example at least 60%, at least 70%, least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identity with the amino acid sequences provided as SEQ ID NO:26 and/or SEQ ID NO:27. The present inventors have determined that at least some variants of the AvrSrl3 protein family are effector proteins produced by at least one strain of Puccinia graminis.
Protoplasts
To produce plant protoplasts the cell wall of plants cells may be disrupted and removed mechanically (e.g. via homogenization, blending), the cell wall may be digested enzymatically, or the cell wall may be removed using a combination of mechanical and enzymatic methods, for example homogenization followed by treatment with enzymes for digestion of the cell wall. Protoplasts may also be obtained from cultured plant cells, for example liquid cultured plant cells, or solid cultured plant cells.
Examples of standard techniques for plant tissue culture, cultured plant cells, and production of protoplasts are described in, for example, Introduction to Plant Tissue Culture, by MK Razdan 2nd Ed. (Science Publishers, 2003), Gillard et al. (2021), Eeckhaut et al. (2013) and Davey et al. (2005).
Enzymes useful for digesting or degrading plant cell walls for release or protoplasts are known to one of skill in the art and may include cellulase (EC 3.2.1.4), pectinase (EC 3.2.1.15), xylanase (EC 3.2.1.8), chitinases (EC 3.2.1.14), hemicellulase,
or a combination thereof. Non-limiting examples of suitable enzymes includes a multicomponent enzyme mixture comprising cellulase, hemicellulase, and pectinase, for example MACEROZYME R-10™ (containing approximately: Cellulase: 0.1 U/mg, Hemicellulase: 0.25 U/mg, and Pectinase: 0.5 U/mg) (also see Introduction to Plant Tissue Culture, by MK Razdan 2nd Ed., Science Publishers, 2003).
Alternate names, and types of cellulases include endo-l,4-p-D-glucanase; p-1,4- glucanase; p-l,4-endoglucan hydrolase; cellulase A; cellulosin AP; endoglucanase D; alkali cellulase; cellulase A 3; celludextrinase; 9.5 cellulase; avicelase; pancellase SS and 1,4-(1,3;1,4)- p-D-glucan 4-glucanohydrolase. Alternate names, and types of pectinases (polygalacturonases) include pectin depolymerase; pectinase; endopolygalacturonase; pectolase; pectin hydrolase; pectin polygalacturonase; endopolygalacturonase; poly-a-l,4-galacturonide glycanohydrolase; endogalacturonase; endo-D-galacturonase and poly(l,4- a-D-galacturonide) glycanohydrolase. Alternate names, and types of xylanases include hemicellulase; endo-l,4-xylanase; xylanase; p- 1,4-xylanase; endo-l,4-xylanase; endo-P-l,4-xylanase; endo-l,4-p-D-xylanase; 1,4-p- xylan xylanohydrolase; P-xylanase; P-l,4-xylan xylanohydrolase; endo-l,4-p-xylanase; 3-D-xylanase. Alternate names, and types of chitinases include chitodextrinase; 1,4-p- poly-N-acetylglucosaminidase; poly-p-glucosaminidase; p-l,4-poly-N-acetyl glucosamidinase; poly[l,4-(N-acetyl-P-D-glucosaminide)] glycanohydrolase.
Choice of a particular enzyme or combination of enzymes, and concentration and reaction conditions may depend on the type of plant tissue used from which the protoplast is obtained. A mixture of cellulase, hemicellulase and pectinase, for example, a pectinase MACEROZYME™ or Multifect, may be used in a concentration ranging from 0.01% to 2.5% (v/v), for example 0.01, 0.02, 0.04, 0.06, 0.08, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5% (v/v), or any amount therebetween. MACEROZYME™ or Multifect may be used alone, or in combination with other enzymes, e.g cellulase, pectinase, hemicellulase, or a combination thereof. Cellulase may be used in a concentration ranging from 0.1% to 5%, for example 0.1, 0.25, 0.5, 0.75, 1.0, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75. 3.0. 3.25, 3.5, 3.75, 4.0, 4.25, 4.5, 4.75, 5.0% (w/v) or any amount therebetween.
The enzyme solution (alternately referred to as a cell wall degrading composition, digesting solution) will generally comprise a buffer or buffer system, an osmoticum, and one or more than one salts, divalent cations or other additives. The buffer or buffer system is selected to maintain a pH in the range suitable, for example, within the range of about pH 5.0 to about 8.0, or any value therebetween such as 5.0,
5.2, 5.4, 5.6, 5.8, 6.0, 6.2, 6.4, 6.6, 6.8, 7.0, 7.2, 7.4, 7.6, 7.8, 8.0. Examples of buffers or buffer systems include, but are not limited to, MES, phosphate, citrate and the like. One or more buffers or buffer systems may be combined in an enzyme solution (digesting solution); the one or more buffers may be present at a concentration from 0 mM to about 200 mM, or any amount therebetween, for example 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180 or 190 mM or any amount therebetween. Depending on the suitability, an osmoticum component can be added if desired. The osmoticum and its concentration are selected to raise the osmotic strength of the enzyme solution. Examples of osmoticum include mannitol, sorbitol or other sugar alcohols, polyethylene glycol (PEG) of varying polymer lengths, and the like. Concentration ranges of osmoticum may vary depending on the plant species, the type of osmoticum used, and the type of plant tissue selected (species or organ of origin e.g. leaf or stem) generally the range is from 0M to about 0.8 M, for example 0.05, 0.1, 0.15, 0.2, 0.25, 0.3. 0.35, 0.4, 0.5, 0.6, 0.7, or 0.75 M, or any amount therebetween, for example, 0, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600 nM mannitol, or any amount therebetween. The concentration of osmoticum may also be expressed as a percentage (w/v). For some plant or tissue types, it may be beneficial to employ a slightly hypertonic preparation, which may facilitate separation of plant cell plasma membrane from the cell wall. The osmoticum can also be omitted during digestion.
Another parameter to set for the plant digestion is the temperature. Temperature may be controlled if desired during the digestion process. Useful temperature range should be between 4°C and 40°C or any temperature therebetween, for example from about 4°C to about 15 °C, or any amount therebetween, or from about 4°C to about 22°C, or any temperature therebetween. Depending to the temperature chosen, the other digestion experimental parameters may be adjusted to maintain optimal extraction conditions.
Cations, salts or both may be added to improve plasma membrane stability, for example divalent cations, such as Ca2+, or Mg2+, at 0.5-50 mM, or any amount therebetween, salts, for example CaCh, NaCl, CuSC>4, KNOs, and the like, from about 0 to about 750 mM, or any amount therebetween, for example 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700 or 750 mM. Other additives may also be added including a chelator for example, but not limited to, EDTA, EGTA, from about 0 to about 200 mM, or any amount therebetween, for example 5, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200 mM, or any amount therebetween, a reducing agent to prevent oxidation such as, but not limited to, sodium bisulfite or ascorbic acid, at 0.005-0.4% or any amount therebetween, for example 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.15,
0.2, 0.25, 0.3, 0.35, 0.4%, or any amount therebetween, specific enzyme inhibitors (see below), and if desired, an inhibitor of foliar senescence, for example, cycloheximide, kinetin, or one or more polyamines.
The digestion solution may also comprise one or more of mannitol from about 0 to about 600 mM, NaCl from about 0 to about 500 mM, EDTA from about 0 to about 50 mM, cellulose from about 1% to about 2% v/v, pectinase from about 0 to about 1% v/v, sodium metabisulfite from about 0.03 to about 0.04%, citrate from about 0 to about 125 mM orNaPC from about 0 to 75 mM.
The plant matter may be treated to enhance access of the enzymes or enzyme composition to the plant cell wall. For example, the epidermis of the leaf may be removed or 'peeled' before treatment with an enzyme composition. The plant matter may be cut into small pieces (manually, or with a shredding or cutting device such as an Urschel slicer); the cut up plant matter may be further infiltrated with an enzyme composition under a partial vacuum (Nishimura and Beevers 1978; Newell et al., 1998). Mechanical perturbation of the plant matter may also be applied to the plant tissues before or during treatment with an enzyme composition. Furthermore, cultured plant cells, either liquid or solid cultures, may be used to prepare protoplasts.
Any suitable method of mixing or agitating the plant matter in the enzyme composition may be used. For example, the plant matter may be gently swirled or shaken in a tray or pan or via a rotary shaker, tumbled in a rotating or oscillating drum. Precaution should be taken in order to minimize the protoplast damage until they are removed form the digestion soup. The digestion vessel should be selected accordingly.
As a non-limiting example, an enzyme composition comprising 1.5% cellulase (Onozuka R-10) and 0.375% MACEROZYME™ in 500 mM mannitol, 10 m CaCh and 5 mM MES (pH 5.6) may be used for protoplast production from some Nicotiana tissues. As described herein, the concentration of mannitol may also be varied from about 0 to about 500 mM, or any amount therebetween. One of skill in the art, provided with the information disclosed herein, will be able to determine a suitable enzyme composition for the age and strain of the Nicotiana sp, or for another species.
As the skilled person would be aware, plant protoplasts can be produced from a variety of different plant cell types including, but not limited to, callus, leaf cells, stem cells, root cells, cotyledon, hypocotyls, mesophyll cells from in vitro leaves and somatic embryos.
In an embodiment, the protoplasts are not genetically modified.
In an embodiment, the protoplasts are genetically modified. In an embodiment, the protoplasts have been genome edited such as described by Yue et al. (2021).
The methods of the current invention can be practiced using protoplasts from a wide variety of plants. Non-limiting examples include, but are not limited to, monocots and dicots such as com (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago saliva), rice (Oryza saliva), rye (Secale cereale), sorghum (Sorghum hicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana), sunflower (Helianthus annum), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tahacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), Sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp ), coconut (Cocos nucifera), pineapple (Ananas comosus), Citrus trees (Citrus spp ), cocoa (Theobroma cacao), tea (Camelia sinensis), banana (Musa spp ), avocado (Pervea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Oleo europaea), papaya (Carica papaya), cashew (Anacardium occidentale), Macadamia (Macadamia integrifolia), almond (Prunus amygdalus), Sugar beets (Beta vulgaris), Sugarcane (Saccharum sppj, oats (Avena), barley (Hordeum), palm, legumes including beans and peas such as guar, locust bean, fenugreek, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, and castor, Arabidopsis, vegetables, ornamentals, grasses, conifers, crop and grain plants that provide seeds of interest, oil-seed plants, and other leguminous plants. Vegetables include tomatoes (Solanum lycopersicum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include azalea (Rhododendron spp ), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp ), tulips (Tulipa spp ), daffodils (Narcissus spp ), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pukherrima), and chrysanthemum. Conifers include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotil), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), Monterey pine (Pinus radiata), Douglas-fir (Pseudotsuga menziesii), Western hemlock (Tsuga canadensis), Sitka spruce (Picea glauca), redwood (Sequoia sempervirens), true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea), and cedars such as western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis). In an embodiment, the plant is grape (Vitis sp.). In an embodiment, the plant is a berry such as (Fragaria x ananassa),
blueberry (Cyanococcus sp.), raspberry (Rubus idaeus), blackberry (some Rubus sp.) or cranberry (Oxycoccus sp.). In an embodiment, the plant protoplast is a cereal plant protoplast such as wheat, barley, or rice. In an embodiment, the plant protoplast is an oilseed plant protoplast such as canola, cotton or soy.
In an embodiment, at least one protein being screened in the protoplast is from the same plant species as the protoplast.
The below uses the Avr-R protein-protein interaction as an example of the advantages of the invention when compared to the commonly used luciferase assay where every effector is to be tested individually. Using the prior art technique the time and costs for labour and consumables would prohibit the scale of testing undertaken using the approach described herein. By way of example, it is reasonably expected about 15 effectors per week could be tested. Moreover, you need to make a DNA preparation for every effector which is estimated to be multiple years work for screening each effector against one R gene to perform the analysis described here of about 700 effectors. To the inventor’s knowledge, the largest number of effectors anyone has screened using the individual luciferase assay is 120 (Deng et al., 2022) or 311 effectors against one R gene via N. benthamiana leaf infdtration assay (Lin et al., 2022). This would have been a lot of time and work, and probably not something that most labs would be keen to do. Using the present invention DNA for 696 effectors was prepared in a week and all of the effectors were screened as a pooled library against eight R genes in a single experiment that took about two weeks (plus an additional two weeks for individual validation to confirm the candidates from the library screen). Screening a larger library, such as 1,400 effectors, will take the same amount of time and labour, not more. Thus, using the invention am expanded library of 1373 effectors can be screened against eight R genes in about 5 weeks. By the inventor’s calculation, this would take about 15 person years of non-stop work using the common luciferase protoplast assay.
Protoplast Transformation and Screening
The methods described herein include transforming a vector(s) into a plant protoplast. As used herein, "transforming" is intended to mean presenting to the plant protoplasts the vector in such a manner that the vector gains access to the interior of the cell. The methods herein do not depend on a particular method for introducing a vector to a plant protoplast, only that the nucleic acid gains access to the interior of at least one protoplast. Methods for introducing nucleic acids into plant protoplasts are known
in the art including, but not limited to, stable transformation methods, transient transformation methods, microinjection, and virus-mediated methods.
Methodologies for constructing plant expression cassettes and introducing foreign nucleic acids into plant protoplasts are known in the art and have been previously described. Suitable methods include microinjection (Crossway et al., 1986), electroporation (Riggs et al., 1986), Agrobacterium-mediated transformation (US 5,981,840 and US 5,563,055), direct gene transfer (Paszkowski et al., 1984), and ballistic particle acceleration (Tomes et al., 1995; McCabe et al., 1988). In some embodiments, transformation is by polyethylene glycol (PEG)-mediated transformation.
The steps in the methods of the present invention may be performed manually or by automation. For high-throughput transient expression, it is preferable that the methods are automated. In a preferred embodiment, one or more steps are automated. One embodiment of the current invention provides high throughput automated handling for protoplast isolation and/or transformation. Use of robots and other automated devices in the laboratory is common in the art (see, for example, Dlugosz et al, 2016). In a high throughput automated method, a plurality of plant protoplasts are transformed with a plurality of nucleic acids to produce a plurality of transformed plant protoplasts.
In one example, the method is used to identify a protein-polynucleotide interaction. An example of how such interactions have been analysed using a different method relying on the use of protoplasts in the past is described by Wang et al. (2020).
In an embodiment, the vector is a viral vector such as a member of Geminiviridae family, particularly members of the Mastrevirus genus including Wheat dwarf virus, or Bean yellow dwarf virus. In an embodiment, the vector is a plasmid vector. Examples of such vectors for transforming protoplast are well known in the art and are described in, for instance, Amdell et al. (2019), Yoo et al. (2007), Deng et al. (2022), Saur et al. (2019), Luo et al. (2021), Xing and Wang (2015), Ehlert et al. (2006), Hsu et al. (2010), Bottner et al. (2009), Bethke et al. (2009), Long et al. (2018), Li et al. (2019b), Menzel et al. (2019), Ortiz et al. (2022) and Ye et al. (2019).
In an embodiment, the method does not rely on the presence of a detectable marker (reporter) such as luciferase or a fluorescent protein. For instance, in an embodiment, the protein-protein interaction in the plant protoplast results in programmed cell death which is used to detect the protein-protein interaction. In an embodiment, following a suitable incubation time such as 16 hours to 3 days, or 1 day or 2 days, the protoplasts comprising the molecules to be screened are centrifuged such that intact protoplasts are collected at the bottom of the centrifugation tube and dead
cells and cell debris remain in the supernatant and are discarded. The living protoplasts are then subjected to RNA-seq analysis with mRNA matching the effector (for example) to which the R protein bound (for example) (second protein) being depleted in the protoplasts representing effector protein(s) (encoded by the mRNA) which bind the R protein.
In an embodiment, the first protein is not a fusion protein. In an embodiment, the second proteinis not a fusion protein. In an embodiment, the first protein and the second protein are not fusions proteins.
In an embodiment, between them the first protein and the second protein do not have portions of the same protein.
In an embodiment, particularly if the interactions does not result in cell death, a protoplast two hybrid system is used to detected protein-protein interactions. For example, the library of first proteins can be expressed as fusion proteins with a first component, and the second protein can be expressed as fusion protein with a second component, and upon the protein-protein interaction the first component and second component are co-located to produce a detectable signal such as driving expression of a reporter gene (see, for instance, Ehlert et al., 2006). One example of such a system uses the GAL4 DNA-binding domain (BD) and activating domain (AD) as the two components. Interaction is measured using a reporter such as luciferase, GUS or a fluorescent protein. In order to enable a high-throughput screening the cells can be sorted using, for example, fluorescence-activated cell sorting.
In an embodiment, a detectable marker is used to detect the interaction. For instance, when detecting if a candidate transcription factor binds a candidate promoter polynucleotide, the promoter is operably linked to a reporter gene, such as encoding a luciferase or fluorescent protein. The protoplasts may be sorted using a FACs machine, to select and separate the positive (fluorescent) protoplasts in a single FACS run. The selected protoplasts can then be sequence analysed to identify the transcription factorpromoter interaction in the positive population.
Multiplicity of Transfection
Generally speaking, the best Multiplicity of Transfection (MOT) for library delivery is the lowest MOT that still produces a clear and detectable effect (i.e. the cell death shows up in the RNA-seq data). It is desirable because the lower the achievable MOT, the larger the library that can be used. MOT herein refers to the number of input copies of a given plasmid construct per cell in the transformation reaction and in a pooled library scenario, MOT refers to the number of input copies of each individual
unique library construct per cell in the transformation reaction or, for simplicity, the number of copies of the pooled library per cell (assuming each construct is pooled in equimolar amounts). The inventors optimised the MOT using the known AvrSr50 gene delivered at a range of MOTs in a mock library of constant total MOT. 0 and 36 million (M) are negative and positive controls, respectively. As 0.7M is probably producing too much cell death for library screening, the inventors selected 0.14M and 0.07M as working ranges for the R-Avr pair tested in the following examples. The optimal MOT is going to depend on many factors, such as transformation efficiency, and in some cases perhaps the particular interaction, e.g. the R-Avr pair or transcription factorpromoter to be examined. The 0.7M - 0.00 IM range will cover the optimal MOT for most systems in which this kind of library screening might be performed. The lower ranges are preferable and may include lower than 0.07M. The lower the better.
In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is between about 2 million and about 0.001 million. In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is between about 0.7 million and about 0.01 million. In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is between about 0.7 million and about 0.07 million. In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is between about 0.3 million and about 0.1 million. In an embodiment, the number copies of each different vector of the library per protoplast used in the transformation is about 0. 14 million.
The vector encoding the second protein can be transformed into the protoplasts at levels commonly used in the art. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 10 million and about 150 million. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 20 million and about 100 million. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 30 million and about 60 million. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 30 million and about 50 million. In an embodiment the number copies per protoplast of the vector encoding the second protein used in the transformation is between about 40 million.
Pathogens and Plant Resistance
The present invention may be used to identify a pathogen effector protein which binds a plant pathogen resistance protein of interest, or to identify a plant pathogen resistance protein which binds a pathogen effector protein of interest.
In an embodiment, the method is suitable for investigating a plant pathogen that manipulate the plants own programmed cell death (PCD) pathway or pathogens that induce a plant response that causes PCD. Examples are species from the orders eg. Uredinales (rusts), Ustilaginales (i.e. smuts such as ustilago maydis), Erysiphales (Powdery mildews), Oomycetes, Magnaporthales (e.g. Magnaporthe and Pyricularia or blasts), Dothideomycetes includes many of the other ascomycete pathogens (clado, zymo, stago, lepto). Other examples may be bacterial, Pseudomonas spp, Xanthomonas spp, Ralstonia spp (e.g. wilts). Other pathogen examples inclue Oomycetes (eg blights). Further pathogen examples include viruses, such as yellow dwarf virus, mosaic viruses of wheat, barley, oats, beans, and soybean dwarf virus (Luteoviridae family).
In an embodiment, the one or more fungal pathogen(s) is selected from, but not limited to, Puccinia sp., Blumeria sp., Fusarium sp., Magnaporthe sp., Bipolaris sp., Oidium sp., Gihherella sp., Cochlioholus sp., Exserohilum sp., Uredo sp. Microdochium sp., Helminthosporium sp., Monographella sp., Colletotrichum sp., Uromyces sp., Erysiphe sp., Ustilago sp., Zymoseptoria sp., Stagonospora sp., Septoria sp., Pyrenophora sp., Cladosporium sp., Leptospheria sp., Venturia sp. and Phakospsora sp..
In an embodiment, the one or more Oomycetes pathogen(s) is selected from, but not limited to, Phytophthora sp and Hyaloperonospora sp.
In an embodiment, the one or more bacteria pathogen(s) is selected from, but not limited to, Pseudomonas spp, Xanthomonas sp and Ralstonia sp.
Plant pathogen resistance is determined by immune receptors that recognize appropriate ligands (i.e. pathogen-associated molecular patterns (PAMPs) or effector proteins) to activate defence molecules (which may be PRR (pattern recognition receptors) or R protein). Thomma et al. (2011) conclude that plants sense the pathogen invasion by receptors that interact with the pathogen structure or by receptors that directly or indirectly detect plant-manipulating activities of microbial effectors. Generally, it is recognised that effectors do not have high sequence similarity or share sequence features (Sperschneider et al., 2015 and 2016), so structural modelling or methods without a biological functional aspect may not be ideal for rapid screening.
A resistance receptor /effector interaction usually induces PCD in a process termed the hypersensitive response (HR), thought to be a means of controlling pathogen spread. In a susceptible plant receptor-effector interaction, the pathogen may inhibit PCD and/or induce the plant cell PCD. Resistance gene of the embodiments of the method described herein includes any NLR type protein, receptor kinases are another class of R genes and includes several types, LRR receptor kinases, LRR receptor like proteins, LysM receptor kinases, wall-associated receptor kinases (WAK), lectin receptor kinases (see, for example, Saintenac et al., 2018; Zhou and Yang, 2016).
EXAMPLES
EXAMPLE 1 - Materials and Methods
Vector design and construction
All vectors were designed using Geneious Prime software. pTA22-YFP (Figure 1) (SEQ ID NO: 1) is a high-copy (pUC19 origin of replication) plasmid containing the coding sequence for Venus yellow fluorescent protein (YFP) flanked by the maize ubiquitin 1 promoter (including first intron) and a 35S:NOS double terminator. The negative control empty vector pTA22 (SEQ ID NO: 2) was created by digestion of pTA22-YFP with KpnI-SacI followed by blunting and self-ligation, to remove the YFP coding sequence. The destination vectors pTA22-GW (SEQ ID NO: 3) and pTA22- GW-PBS (SEQ ID NO: 4) were created by replacing the YFP coding sequence in pTA22-YFP with a synthesised Gateway cassette via restriction/ligation (KpnI-SacI). pTA22-GW-PBS is identical to pTA22-GW with the exception that pTA22-GW-PBS also contains a reverse primer binding site (PBS) between the Gateway cassette and the 35S:NOS double terminator.
The coding sequence of the wheat stem rust resistance gene Sr50 (SEQ ID NO: 5) and the open reading frames including introns of the wheat stem rust resistance genes Sr27 (SEQ ID NO: 6), Sr35 (SEQ ID NO: 7), Srl3c (SEQ ID NO: 8), Sr21 (SEQ ID NO: 9), Sr22 (SEQ ID NO: 10), Sr26 (SEQ ID NO: 11), Sr33 (SEQ ID NO: 12) and Sr61 (SEQ ID NO: 13) were cloned into pTA22-GW via Gateway LR reaction to create the expression vectors pTA22-Sr50, pTA22-Sr27, pTA22-Sr35, pTA22-Srl3c, pTA22- Sr21, pTA22-Sr22, pTA22-Sr26, pTA22-Sr33, and pTA22-Sr61, respectively. The open reading frames in the R gene expression vectors were sequence verified. Avr gene open reading frames (AvrSr50 (SEQ ID NO: 14), AvrSr27-2 (SEQ ID NO: 15), AvrSr35 (SEQ ID NO: 16), AvrSr22b (SEQ ID NO: 17)) were cloned into pTA22- GW-PBS via Gateway LR reaction to create the expression vectors pTA22-AvrSr50- PBS, pTA22-AvrSr27-2-PBS, pTA22-AvrSr35-PBS, and pTA22-AvrSr22b-PBS,
respectively. pTA22-AvrSrl3b-PBS was created via site directed mutagenesis (inverse PCR) of pTA22-0336-PBS to introduce the amino acid substitution R82C (primers AvrSrl3a-R102 C-F and AvrSrl3a-R102 C-R, Table 1). The Avr gene expression vectors were confirmed correct by diagnostic restriction enzyme digest.
Table 1 - Primers.
For transient expression in Nicotiana spp, the coding sequences of AvrSrl3 and AvrSr22 were cloned into the pDONR207 vector from the library constructs pTA22- 0336-PBS and pTA22-0100-PBS, respectively, via Gateway BP reaction (Invitrogen). The predicted coding sequences of Srl3c, Sr22 and AvrSr22b were synthesized and subcloned into pDONR207 similarly. R and Avr gene sequences were then transferred into the binary vectors pAM-35s-GWY-YFPv and pAM-35s-YFPv-GWY, respectively, by Gateway LR reaction as previously described by Bemoux et al. (2008).
For PCD using Sr50 with an inducible AvrSr50 activated by the transcription factor GAL4-VP16, two additional constructs were synthesised and cloned into the pDONR207 vector. UAS-AvrSr50, containing 5 copies in tandem of the GAL4 UAS (upstream activation sequence) copies and a minimal 35 S promoter upstream from the AvrSr50 CDS (SEQ ID NO: 14), and GAL4-VP16 (residues 1-147) of the yeast GAL4 protein (GenBank ADC42842) fused in frame with the herpes virus VP 16 AD (GenBank ADC42842, residues 154-231). The GAL4-VP16 was subsequently cloned into the pTA22-PBS vector via LR cloning reaction, as described above.
Effector library design and construction
Effector candidates from the wheat stem rust fungus Puccinia graminis fsp tritici (Pgt) were selected from the genome reference annotation for Pgt21-0 (NCBI
BioProject PRJNA516922, Li et al., 2019a) and a differential expression analysis of all genes encoding secreted proteins that identified eight clusters of genes with different expression profiles during the Pgt infection cycle (Upadhyaya et al., 2021). Candidates for inclusion in the Pgt effector library were selected based on the following filtering criteria: present in secreted protein gene expression clusters 2, 3 or 7 (1588 candidates), length <1000 nt after removal of the signal peptide encoding region (937 candidates), expression level in haustoria >5 transcripts per million (TPM; 760 candidates), SignalP3.0 signal peptide prediction probability >0.5 (738 candidates), unique translated protein sequence in candidate set (718 candidates). The coding sequences of the 718 putative effectors were codon-optimised for wheat using GeneOptimizer.
Additional sequences designed to facilitate synthesis and cloning were added immediately upstream (5’-AGGCTTCACC-3') (SEQ ID NO: 22) and immediately downstream (5’-
CCATACCCAGCTTTCTTGTACAAAGTGGTTTGATCGTACTGTCGAGATCTAG CAACGCGATCGGAGGCGCTCATTATACGCAGATTCTTTATCGAAGCTGAGGGTG TGCCCGCTGTAACCCGCAAAGCCGTCAATATACAATCCTGACCAAATAGGAGACT GAACCGGTTTGGTAGCAGATAAGTTGCTTGGTGCCG-3') (SEQ ID NO: 23) of the optimised coding sequences. It was a manufacturing requirement that all synthesised fragments be at least 300 bp long. Therefore, the minimum length of randomly generated filler sequence (italicised above in the downstream sequence) was used where necessary (the 94 smallest effectors) to meet this manufacturing requirement. Six hundred and ninety-six of the 718 putative effectors were successfully synthesised and cloned into pTA22-GW-PBS to create a library of expression vectors with names pTA22-0001-PBS to pTA22-0718-PBS.
Effector library pooling and propagation
The 696 effector library constructs were individually resuspended in 100 pL IDTE buffer (10 mM Tris, 0.1 mM EDTA, pH 7.5) and then pooled in equimolar amounts (150 finol per construct) using a JANUS G3 automated liquid handling workstation. The pooled library was named Pgt21 -0 EL 0001 -0718.
To propagate the pooled library, 2.5 pL of pooled library DNA (-330 ng total) was transformed into 50 pL of ElectroMAX Stbl4 competent Escherichia coli cells (Invitrogen) by electroporation, followed by addition of 2.5 mL pre-warmed SOC medium (supplied with the cells). Outgrowth without selection proceeded at 37°C for 1 hour with shaking at 220 RPM. After outgrowth, cells were spun down and resuspended in 2.5 mL of Luria-bertani (LB) medium. The culture was then diluted 1 in
200 using LB medium, and 300 pL of the diluted culture was spread on a 14.5 cm diameter LB agar plate containing 50 pg/mL carbenicillin (72 plates were spread).
To check the number of colony forming units (cfu), 20 pL of a 1 in 10,000 dilution was spread on a 9 cm plate. Plates were incubated at 37°C for 16 hours overnight. After overnight incubation, there were 60 colonies on the 9 cm plate, and therefore -45,000 cfu per 14.5 cm plate or -3.24 million cfu in total (4645x library representation). Colonies were scraped off the plates using a cell spreader and LB medium, and then transferred to Falcon tubes. Cells were spun down, supernatant was removed, and the pellets were then stored at -20°C prior to plasmid DNA isolation.
Plasmid DNA isolation pTA22-YFP was isolated using the MACHEREY NAGEL NucleoBond Xtra Maxi Plus EF kit. All other plasmids were isolated using the MACHEREY NAGEL NucleoBond Xtra Midi Plus EF kit. The pooled library was isolated using the QIAGEN EndoFree Plasmid Giga kit. Isolated plasmid DNA was resuspended at a concentration of 1 pg/uL (measured on NanoDrop).
Plant growth
Wheat (Triticum aestivum) seeds were planted in 13 cm pots (12 seeds per pot) containing Martins Seed Raising and Cutting Mix supplemented with 3 g/L osmocote. Seedlings were grown in a growth cabinet at 24°C on a cycle of 12 hours light (-100 pmol m'2 s'1) and 12 h dark, for 7-8 days. Wheat cultivar Fielder was used unless otherwise stated.
Protoplast isolation and transformation
Protoplast isolation and transformation was carried out as described previously (Amdell et al., 2019), with minor modifications. The abaxial epidermis of the primary leaf was peeled off and discarded. Peeled leaves were placed abaxial side down in a petri dish (ten leaves per dish) containing 0.6 M mannitol for 30 min. Leaves were then placed abaxial side down in a petri dish containing 10 mL of enzyme solution (20 mM MES-KOH (pH 5.7), 1.5% (wt/vol) cellulase Onozuka RS, 0.75% (wt/vol) macerozyme R10, 0.6 M mannitol, 10 mM KC1, 10 mM CaCh, 0.1% (wt/vol) BSA) and incubated at 25 °C for 3 hours in the dark with rotation at 50 RPM. After addition of one volume of W5 solution (2 mM MES-KOH (pH 5.7), 154 mM NaCl, 125 mM CaCh, 5 mM KC1), released protoplasts were filtered through a 40 pm nylon cell strainer and transferred to a 30 mL round-bottom tube. Protoplasts were centrifuged for 3 min at 80 x g,
resuspended in 20 mL of W5 solution, and incubated on ice for 30 min, after which time most of the cells had settled to the bottom of the tube by gravity. The supernatant was removed, and the protoplasts were resuspended in 6 mL MMG solution (4 mM MES-KOH (pH 5.7), 0.4 M mannitol, 15 mM MgCh).
The protoplast concentration was determined by cell counting on a hemocytometer, and subsequently adjusted to 2.5 x 105 cells/mL using MMG solution. For standard individual transformations involving single effector genes, 3 pmol of each vector was mixed with 200 pL of protoplasts (50,000 protoplasts) and 230 pL of PEG solution (40% (wt/vol) polyethylene glycol-4000, 0.2 M mannitol, 100 mM CaCh) in a 2 mL tube. The DNA/protoplast/PEG mixture was homogenised by gently flicking the tube, and then incubated for 15-30 min at room temperature. The transformation reaction was stopped by adding 940 pL of W5 solution and gently inverting the tube to mix. Transformed protoplasts were centrifuged for 2 min at 100 x g and the supernatant was removed. Protoplasts were resuspended in 650 pL W5 solution, transferred to 12- well cell culture plates and incubated at 23°C for 24 hours in the dark. For mock library screening and pooled library screening, transformation reactions were scaled up 8-1 Ox in 25 mL tubes, and transformed protoplasts were incubated in cell culture flasks. Transformations were performed in triplicate for all treatments and controls.
Flow cytometry
After the 24-hour incubation period, protoplasts were transferred to 2 mL tubes, stained with propidium iodide (10 pg/mL) and then subjected to flow cytometry using the Invitrogen Attune NxT Flow Cytometer to detect fluorescence properties of individual cells. Propidium iodide fluorescence (excitation 561 nm, emission filter 620/15 nm) was measured as an indicator for living protoplasts (no fluorescence), and YFP fluorescence (excitation 488 nm, emission filter 530/30 nm) was measured as an indicator of the reporter gene expression. The percentage of YFP -positive protoplasts in the living (propidium iodide -negative) population was used to assess the transformation efficiency and the strength of programmed cell death (PCD).
For PCD using Sr50 with an inducible AvrSr50 activated by the transcription factor GAL4-VP16, a BD Biosciences LSR II Flow cytometer was used for data collection. mRNA extraction
After the 24-hour incubation period, protoplasts were transferred to 5 mL tubes and centrifuged for 3 min at 150 x g. The supernatant was discarded, and mRNA was
extracted from the protoplast pellet, which contains the intact living cells, using the Invitrogen Dynabeads mRNA DIRECT Purification Kit, according to the manufacturer’s protocol for ‘Mini’ extractions. mRNA was eluted with 20 pL of elution buffer and the concentration determined using the Invitrogen Qubit RNA HS Assay Kit with the Invitrogen Qubit 4 Fluorometer. Concentrations ranged from -5-9 ng/pL. cDNA synthesis and amplification
Library-specific cDNA synthesis and PCR was carried out using the Invitrogen SuperScript IV One-Step RT-PCR System with ezDNase kit, following the manufacturer’s protocol with minor modifications. All PCR reactions used 30 ng of mRNA template and had a final volume of 50 pL. The forward primer ZmUbil_5UTR_F3b (5’-GCACACACACACAACCAG-3’) (SEQ ID NO: 18) was used with the reverse primer FS cDNA R (5’-TGCTAGATCTCGACAGTACG-3’) (SEQ ID NO: 19). Cycling conditions were as follows: 55°C for 10 min (inactivation of ezDNase and first strand cDNA synthesis), 98°C for 2 min (inactivation of reverse transcriptase and initial denaturation), 98°C for 10 sec (denaturation), 61°C for 10 sec (annealing), 72°C for 35 sec (extension), 72°C for 5 min (final extension). Eighteen cycles of denaturation, annealing and extension were performed. The PCR product was column purified using the QIAGEN QIAquick PCR Purification Kit, following the manufacturer’s protocol. DNA was eluted with 35 pL of elution buffer and the concentration determined using the Qubit IX dsDNA HS Assay Kit with the Invitrogen Qubit 4 Fluorometer. Concentrations ranged from -8-21 ng/pL.
Illumina library construction
Illumina libraries were constructed using the Illumina DNA Prep Kit and IDT for Illumina DNA/RNA UD Indexes, following the manufacturer’s protocol with minor modifications. Around 120-220 ng of dsDNA from the cDNA synthesis / PCR was used as input to achieve on-bead normalisation. Right side library clean up with purification beads was carried out as per the Illumina protocol, while a 1.8x bead ratio was used for the left side clean up in order to retain smaller amplicons. Illumina library concentrations were measured using the Qubit IX dsDNA HS Assay Kit with the Invitrogen Qubit 4 Fluorometer. Concentrations ranged from -22-29 ng/pL. Quality control of library size was carried out using the Agilent TapeStation 2200 with High Sensitivity DI 000 ScreenTapes and Reagents. Illumina libraries were pooled in equimolar amounts for RNA-seq.
RNA-seq
Pooled Illumina libraries were sequenced on the Illumina NextSeq 500 platform using the NextSeq 500/550 Mid Output Kit v2.5 and 74 bp paired end reads. PhiX was spiked in at 5%.
Read mapping
RNA sequencing reads were cleaned using fastp 0.22.0 (Chen et al., 2018) (— length_required 20) specifying the UTR sequences common to all library transcripts as well as the Illumina DNA Prep adapter sequence as adapters. The clean reads were aligned to the coding sequences of the 696 cloned effector candidates with HISAT2 2.2.1 (Kim et al., 2015) (-very-sensitive; — sp 1,1; — no-spliced-alignment). Mappings where the read pairs map to different transcripts were dismissed. Salmon 1.8.0 (Patro et al., 2017) was used to quantify expression from the HISAT2 alignments.
The effector candidates are, with reference to the Pgt21-0 genome, PGT21_028576, PGT21_028868, PGT21_023609, PGT21_028678, PGT21_022139, PGT21 024112, PGT21_007472, PGT21_018726, PGT21_028020, PGT21_029366, PGT21_003600, PGT21_018850, PGT21_005355, PGT21_006653, PGT21_019255, PGT21 021104, PGT21_032884, PGT21_016232, PGT21_003096, PGT21_005562, PGT21_035026, PGT21_037229, PGT21_027360, PGT21 011841, PGT21_022880, PGT21_025607, PGT21_004329, PGT21_003782, PGT21_029864, PGT21_033443, PGT21 003441, PGT21_022719, PGT21_024535, PGT21_025302, PGT21_034323, PGT21 010051, PGT21_025660, PGT21_009331, PGT21 011473, PGT21_020075, PGT21_021553, PGT21_029199, PGT21_030904, PGT21_034673, PGT21_021063, PGT21 035741, PGT21_008296, PGT21_025606, PGT21_009345, PGT21_005332, PGT21 005281, PGT21_021760, PGT21_023689, PGT21_024483, PGT21_003797, PGT21_009813, PGT21_016879, PGT21_024638, PGT21_011720, PGT21_014598, PGT21_035310, PGT21 015751, PGT21_029443, PGT21_022160, PGT21_005680, PGT21_027819, PGT21 028117, PGT21_006342, PGT21_005556, PGT21_028544, PGT21_029755, PGT21_029849, PGT21_030949, PGT21_006494, PGT21_036189, PGT21_034056, PGT21_008241, PGT21_009934, PGT21_030038, PGT21_035348, PGT21_030997, PGT21_007045, PGT21_007121, PGT21_023202, PGT21_026786, PGT21_034630, PGT21_026314, PGT21_028670, PGT21_029996, PGT21_003751, PGT21_004486, PGT21 008110, PGT21_034956, PGT21_008208, PGT21_018202, PGT21 019669, PGT21_025534, PGT21_015326, PGT21_017626 (AvrSr22), PGT21_020392, PGT21_029940, PGT21_031999, PGT21_011202, PGT21_013886,
PGT21 017702, PGT21_021563, PGT21_024730, PGT21_028497, PGT21_029876, PGT21_023185, PGT21_031433, PGT21 033611, PGT21_020897, PGT21_029954, PGT21_006351, PGT21_022422, PGT21_029625, PGT21_008346, PGT21_021857, PGT21 037119, PGT21_023046, PGT21_010438, PGT21_020642, PGT21_022678, PGT21_006573, PGT21_006559, PGT21 013166, PGT21_027392, PGT21_030859, PGT21_032718, PGT21_005382, PGT21_005394, PGT21_005435, PGT21_021020, PGT21_024754, PGT21_026130, PGT21_030651, PGT21_031342, PGT21_031454, PGT21 031495, PGT21_005947, PGT21_005962, PGT21 011827, PGT21_020544, PGT21_031356, PGT21_015362, PGT21_006477, PGT21_021934, PGT21_023845, PGT21_026588, PGT21_026605, PGT21_027137, PGT21_035444, PGT21 019422, PGT21_027162, PGT21_036086, PGT21_001290, PGT21 017654, PGT21 018619, PGT21_019337, PGT21_020199, PGT21_022245, PGT21_023315, PGT21 014158, PGT21_022705, PGT21_005749, PGT21_006784, PGT21_006835, PGT21_008366, PGT21_009523, PGT21_019350, PGT21_019360, PGT21 019682, PGT21_026836, PGT21 019690, PGT21_024477, PGT21 005189, PGT21_007578, PGT21_008314, PGT21 018271, PGT21 019354, PGT21 019560, PGT21_037270, PGT21_017925, PGT21_022470, PGT21_027003, PGT21_034250, PGT21_006893, PGT21_003813, PGT21_003890, PGT21_004033, PGT21_006263, PGT21_004278, PGT21 018618, PGT21 019497, PGT21 006581, PGT21_006982, PGT21_007185, PGT21_007255, PGT21 012816, PGT21_020423, PGT21_036748, PGT21 006631, PGT21_007150, PGT21_004028, PGT21_004257, PGT21 011450, PGT21 012298, PGT21 015271, PGT21 015797, PGT21_028696, PGT21 015416, PGT21_004224, PGT21_004644, PGT21_006572, PGT21_017304, PGT21 018408, PGT21_020919, PGT21_021251, PGT21_027809, PGT21_005898, PGT21_007370, PGT21 014928, PGT21 019618, PGT21_023623, PGT21_024182, PGT21 026686, PGT21_009090, PGT21_027224, PGT21 034181, PGT21_006289, PGT21_003943, PGT21_005869, PGT21_006427, PGT21_008521, PGT21_010438, PGT21 014381, PGT21 016741, PGT21 018712, PGT21 021969, PGT21_013313, PGT21_014300, PGT21 018401, PGT21_028864, PGT21_028873, PGT21_036064, PGT21_036608, PGT21_020236, PGT21_028229, PGT21 008181, PGT21 014270, PGT21 014847, PGT21 019671, PGT21 001944, PGT21_007548, PGT21 012363, PGT21_013230, PGT21_027013, PGT21_028173, PGT21_035088, PGT21_007707, PGT21 012565, PGT21_005327, PGT21_006067, PGT21_007745, PGT21_008344, PGT21_009152, PGT21 016627, PGT21_017337, PGT21_029708, PGT21_003838, PGT21_007032, PGT21_007109, PGT21 009169, PGT21 009491, PGT21 019088, PGT21_020131, PGT21_020399, PGT21_027343 (AvrSr271ike-l), PGT21 028479 (AvrSr271ike-2), PGT21_004122, PGT21_010425,
PGT21 010171, PGT21_012620, PGT21 013561, PGT21_013690, PGT21_023328, PGT21_024670, PGT21_026322, PGT21_028667, PGT21_034724, PGT21_034989, PGT21_020314 (AvrSr50), PGT21_004087, PGT21_004149, PGT21_004227, PGT21 025441, PGT21_035732, PGT21_008686, PGT21_020336, PGT21_024255, PGT21_025565, PGT21_030892, PGT21_002359, PGT21_005762, PGT21 011741, PGT21_016737, PGT21_035206, PGT21 001851, PGT21_004723, PGT21_004970, PGT21_005392, PGT21_006302, PGT21_012416, PGT21_025910, PGT21 011308, PGT21 012186, PGT21 012991, PGT21_013524, PGT21_013876, PGT21_021823, PGT21_027746, PGT21_028806, PGT21_033463, PGT21_005441, PGT21_002194, PGT21_012125, PGT21_016727, PGT21 018761, PGT21_021053 (AvrSrl3), PGT21_021905, PGT21_023252, PGT21_027121, PGT21_031516, PGT21_006532 (AvrSr27-l), PGT21_006593 (AvrSr27-2), PGT21_007034 (avrSr27-3),
PGT21 011601, PGT21 012597, PGT21 014566, PGT21 015983, PGT21 019638, PGT21_020855, PGT21_021920, PGT21_023973, PGT21_025941, PGT21_026016, PGT21_002477, PGT21_002632, PGT21_002222, PGT21_031625, PGT21_033068, PGT21 004546, PGT21 006843, PGT21 011814, PGT21 012915, PGT21 012945, PGT21 016889, PGT21_025120, PGT21_007816, PGT21_008625, PGT21_008893, PGT21_012242, PGT21_014316, PGT21_015803, PGT21_033326, PGT21_007839, PGT21_021315, PGT21_022022, PGT21_023269, PGT21_018297, PGT21_019575, PGT21_012670, PGT21_013487, PGT21_006776, PGT21_014337, PGT21_019259, PGT21 019619, PGT21 019657, PGT21_027462, PGT21_027550, PGT21_036207, PGT21_023646, PGT21_027860, PGT21_004227, PGT21_012746, PGT21_013555, PGT21_007867, PGT21_012273, PGT21_012862, PGT21_014199, PGT21_016337, PGT21_025195, PGT21_026282, PGT21_035227, PGT21_004630, PGT21_034147, PGT21 030281, PGT21_021626, PGT21_021655, PGT21_022991, PGT21_024981, PGT21 007571, PGT21_008773, PGT21_009785, PGT21_033213, PGT21 014371, PGT21 017687, PGT21_028247, PGT21_008660, PGT21_021792, PGT21 031471, PGT21_035274, PGT21_004605, PGT21_009410, PGT21_010702, PGT21_019368, PGT21_031340, PGT21_037451, PGT21_037677, PGT21 009141, PGT21 013631, PGT21_024919, PGT21_027571, PGT21_006912, PGT21_013590, PGT21_014856, PGT21_027669, PGT21_027923, PGT21_035762, PGT21_025354, PGT21_037308, PGT21_002758, PGT21_010744, PGT21 011552, PGT21_026376, PGT21_010332, PGT21 011715, PGT21_006950, PGT21_037257, PGT21_035120, PGT21_037238, PGT21_016370, PGT21_023745, PGT21_029967, PGT21_019340, PGT21_024741, PGT21_023968, PGT21_032018, PGT21_003712, PGT21_003967, PGT21_012586, PGT21_037366, PGT21_012341, PGT21_030464, PGT21_008944, PGT21_007890,
PGT21 036621, PGT21_003706, PGT21_014735, PGT21_015800, PGT21_036648, PGT21_013590, PGT21_013627, PGT21_019226, PGT21_025264, PGT21_030812, PGT21_030832, PGT21_026584, PGT21_018785, PGT21_030510, PGT21_003712, PGT21_029805, PGT21_036291, PGT21_036655, PGT21_024212, PGT21_025199, PGT21_026792, PGT21_027176, PGT21_036996, PGT21_003987, PGT21_015706, PGT21 018897, PGT21_014176, PGT21_030044, PGT21_036462, PGT21_012026, PGT21 014171, PGT21 013811, PGT21 015449, PGT21 010706, PGT21 028814, PGT21_025922, PGT21_008090, PGT21_008768, PGT21_024665, PGT21_036157, PGT21_005762, PGT21_009954, PGT21_034361, PGT21_003910, PGT21_003967, PGT21 010104, PGT21 014398, PGT21_015907, PGT21_007929, PGT21_031043, PGT21_006742, PGT21_021095, PGT21_012928, PGT21_013217, PGT21_024229, PGT21_037540, PGT21_027036, PGT21_003806, PGT21_004327, PGT21_027234, PGT21_026792, PGT21_033979, PGT21_007222, PGT21 018141, PGT21_026823, PGT21 011421, PGT21 011461, PGT21 013841, PGT21 018230, PGT21 024484, PGT21_024599, PGT21_024632, PGT21_026855, PGT21_026880, PGT21_022772, PGT21_023983, PGT21_030177, PGT21_030533, PGT21_031223, PGT21 031561, PGT21 003061, PGT21_013290, PGT21_013597, PGT21_031163, PGT21_032951, PGT21_010634, PGT21_013454, PGT21_028340, PGT21_029822, PGT21_030800, PGT21_023976, PGT21_026070, PGT21_009508, PGT21_029745, PGT21_030649, PGT21_000868, PGT21_024289, PGT21_026802, PGT21_035464, PGT21_036053, PGT21 018143, PGT21_018206, PGT21_002604, PGT21_007073, PGT21_017894, PGT21_020699, PGT21_028777, PGT21_004391, PGT21_015588, PGT21_021193, PGT21_035975, PGT21_003364, PGT21_003692, PGT21_003947, PGT21_008791, PGT21 028141, PGT21_003839, PGT21_013318, PGT21_013473, PGT21_026815, PGT21 012165, PGT21_028004, PGT21_013258, PGT21 021145, PGT21_027757, PGT21_031297, PGT21_003928, PGT21_013919, PGT21_016190, PGT21_029467, PGT21 031476, PGT21_032092, PGT21_008770, PGT21_013830, PGT21_025017, PGT21 035601, PGT21_013239, PGT21_028820, PGT21 026981, PGT21_028125, PGT21_032802, PGT21_027709, PGT21_029710, PGT21_027096, PGT21_035619, PGT21_028419, PGT21_031737, PGT21_028330, PGT21_034480, PGT21_020738, PGT21 014945, PGT21_015873, PGT21_026798, PGT21_015332, PGT21_029210, PGT21 031118, PGT21 002071, PGT21_010033, PGT21_023695, PGT21_019715, PGT21_021490, PGT21_031737, PGT21_005762, PGT21 005891, PGT21_023863, PGT21_027993, PGT21_027262, PGT21_033890, PGT21_026723, PGT21_030752, PGT21_006409, PGT21_027800, PGT21_015429, PGT21_005747, PGT21_031947, PGT21_026709, PGT21_030750, PGT21_032569, PGT21_031077, PGT21_031316,
PGT21_033328, PGT21_013612, PGT21_008248, PGT21 011619, PGT21_033619, PGT21 036158, PGT21_016500, PGT21_025889, PGT21_027117, PGT21_028459, PGT21 025911, PGT21_004522, PGT21_033586, PGT21_029104, PGT21_007310, PGT21_010630, PGT21 008021, PGT21_015278, PGT21_030880, PGT21_010492, PGT21_005823, PGT21_002356, PGT21_021705, PGT21_023991, PGT21_008417, PGT21_009338, PGT21_014050, PGT21_034546, PGT21_034519, PGT21 032111, PGT21_033927, PGT21_027796, PGT21_003652, PGT21_005919, PGT21_006621, PGT21_005230, PGT21_003971, PGT21_033345, PGT21_005967, PGT21_010389, PGT21 011589, PGT21 008618, PGT21_020323, PGT21_016080, PGT21_029038, PGT21_008502, PGT21_037158, PGT21_028155, PGT21_003265, PGT21_020526, PGT21 014698, PGT21_019315, PGT21_019348, PGT21_022359, PGT21_031241, PGT21_007302, PGT21_002585, PGT21_004076 and PGT21_004557.
Analysis of differential gene expression with DESeq2
Read counts were imported into DESeq2 (Love et al., 2014) with tximport (type = "salmon”). Differential expression analysis was performed with DESeq() and default parameters followed by IfcShrink (type="apeglm"). P-values of zero were converted to the machine-lowest value possible in R before plotting (function: .Machine$double.xmin). Volcano plots were produced with EnhancedVolcano (Blighe et al., 2022).
Agroinfdtration of Nicotiana tabcicum and Nicotiana benthamiana leaves
N. tabcicum and N. benthamiana plants were grown in a growth chamber at 23 °C with a 16-hour light period. Agrobacterium tumefaciens cultures containing the expression vectors of each construct were grown overnight at 28°C in LB media with appropriate antibiotic selections. The cells were pelleted and resuspended in infdtration mix (10 mM MES pH 5.6, lO mM MgCh, 1500 pM acetosyringone) to an optical density (OD600) of 0.2 or 0.5, followed by incubation at room temperature for two hours. Cultures were infiltrated into leaves of four-week-old plants with a 1 mL syringe. For documentation of cell death, leaves were photographed or scanned 2- 5 days after infiltration.
Identification of AyrSrl3b
Illumina genome sequence data derived from Pgt isolate 09ETH8-3 (race JRCQC) were obtained from NCBI BioProject PRJNA164531. Reads were cleaned with fastp 0.22.0 and default parameters and aligned to the Pgt21-0 genome reference
with bwa mem 0.7.17. The reads that aligned to the chromosome 1A region that encodes PGT21_021053 were assembled with Trinity 2.13.2 (- jaccard clip — gcnomc giiidcd bam — gcnomc guidcd max intron 3000). Proteins were predicted from the assembled transcripts with TransDecoder 5.5.0 (TransDecoder.LongOrfs and TransDecoder. Predict) (https ://github .com/TransDecoder/TransDecoder) . The predicted protein was designated AvrSrl3b.
EXAMPLE 2 - Flow cytometric assay for PCD using Sr50-AyrSr50., Sr27- AyrSr27 and Sr35-AyrSr35
In this example, a flow cytometric assay for PCD in transiently transformed protoplasts was established. Previously, the inventors and others used a luciferasebased assay for PCD in transiently transformed protoplasts (Saur et al., 2019; Luo et al., 2021; Ortiz et al., 2022). In the luciferase-based assay, protoplasts are cotransformed with an R gene, a candidate Avr gene, and a luciferase reporter. In the absence of PCD, luciferase expression is strong and therefore measured luminescence is high. However, if the R-Avr is a matching pair, transformed protoplasts undergo PCD resulting in a relative decrease in luciferase expression and therefore measured luminescence is also decreased. In the flow cytometric assay for PCD established here, a fluorescent protein reporter (in this case YFP) is used instead of luciferase, and transformed protoplasts are analysed by flow cytometry. PCD is indicated by a relative decrease in the percent YFP+ protoplasts in the living (propidium iodide-negative) population of cells. The flow cytometric assay for PCD was validated using the three known wheat stem rust R-Avr pairs: Sr50-AvrSr50, Sr27-AvrSr27, and Sr35-AvrSr35.
As shown in Figure 2, transformation with a matching R-Avr pair resulted in a significant decrease in the percent YFP+ protoplasts in the living population, compared to the controls where non-matching R-Avr pairs or R / Avr genes alone were expressed. This result demonstrated that flow cytometric analysis of transiently transformed protoplasts can be used to detect PCD.
EXAMPLE 3 - Assessment of relationship between MOT and frequency of single transformation
In this example, the relationship between multiplicity of transfection (MOT) and frequency of single gene transformation was assessed using flow cytometry. MOT refers to the number of input copies of a given plasmid construct per cell in the transformation reaction. Hereafter the MOT is expressed in units of million plasmid copies (rounded, except for MOT 0) per cell. Single transformation, where each cell
receives only one library construct, is ideal for pooled library screening because it results in differential expression of individual library genes between individual cells within the transformed population (that is, it results in a variable population). By contrast, if the entire library is transformed into each cell, then screening likely will not be possible due to the transformed cell population being uniform. For this very reason, doubts have been raised as to whether protoplasts are suitable for pooled library screening, given the large amounts of DNA (high MOT) that are typically used in protoplast transformation (Gaillochet et al., 2021). An additional concern is that even if high frequency single gene transformation could be achieved by lowering the MOT, gene expression levels may be too low to produce an effect.
In this example, it was hypothesised that the frequency of single gene transformation would increase relative to the frequency of double transformation as MOT decreased. To test this hypothesis, the YFP reporter construct pTA22-YFP was co-transformed with the RFP reporter construct pTA22-mRuby3 and the empty vector pTA22. pTA22-YFP and pTA22-mRuby3 were delivered in equimolar amounts at a range of MOT’s (36, 18, 3.6, 0.7, 0.07 or 0), while the amount of pTA22 was varied such that combined MOT for all three constructs remained constant at 72. Thus, six mock libraries were produced, where pTA22-YFP and pTA22-mRuby3 each represented a single library construct, and pTA22 represented all other library constructs with a constant total amount of plasmid.
MOT’s 0 and 36 are negative and positive controls, respectively. As shown in Figure 3, at higher MOT’s most transformed cells were double transformed, while at lower MOT’s most transformed cells were singly transformed. At lower MOT’s, expression levels were lower but still well above background levels. This result demonstrated that pooled library screening in protoplasts may be feasible, on the basis that vector delivery at the low MOT required for library screening produces predominantly singly transformed cells that express the vector gene at moderate levels.
EXAMPLE 4 - Flow cytometric assay for PCD using Sr50-AyrSr50 with AyrSr50 delivered at a range of MOT’s
In this example, the flow cytometric assay for PCD described in Example 2 was used to see if the multiplicity of transfection (MOT) could be altered to effectively produce a pooled effector library delivery to protoplasts. In a pooled library scenario, MOT refers to the number of input copies of each unique library construct per cell in the transformation reaction or, for simplicity, the number of copies of the pooled library per cell (assuming each construct is pooled in equimolar amounts).
In assays using single effector genes described above, there is 3 pmol of each unique library construct per 50,000 protoplasts which corresponds to an MOT of 36. Hereafter, the MOT is expressed in units of million plasmid copies per cell.
The MOT is a critical consideration for pooled library delivery for two main reasons: 1) There is a practical limit to the total amount of plasmid DNA that can be delivered to protoplasts and therefore it is not possible to deliver a pooled library using the same amount of each construct as used in single gene assays; and 2) delivering a pooled effector library at an MOT that is too high or too low could result in PCD that is too strong or too weak, respectively. This could potentially cause downstream processing or data analysis to fail e.g. due to low mRNA yields (too few living cells due to strong PCD) or inability to detect an effect in the RNA-seq data (no differential expression due to weak PCD). The ideal solution is to deliver the pooled library at the lowest MOT that consistently produces a detectable effect. However, it was unknown whether PCD would be detectable when the PCD-triggering Avr gene is delivered at low MOT.
To establish, if at all possible, the MOT for pooled library delivery, the R-Avr pair Sr50-AvrSr50 was used. Sr50 was delivered to protoplasts in the standard amount (MOT 36), while AvrSr50 was delivered at a range of MOT’s (36, 0.7, 0.14, 0.07 or 0). AvrSr35 was also delivered in varying amounts so that the combined MOT for AvrSr50 and AvrSr35 was 36. Thus, combining AvrSr50 and AvrSr35 in different amounts produced five mock libraries, where AvrSr50 represented a single library construct and AvrSr35 represented all other library constructs with a constant total amount of plasmid.
As shown in Figure 4, the strength of PCD (as indicated by the relative decrease in the percent YFP+ protoplasts) increased as the AvrSr50 MOT increased. Importantly, PCD was detected even at the low MOTs (0.07 and 0.14) that would be required for library screening. This result demonstrated that pooled library screening in protoplasts may be feasible, on the basis that Avr-gene expressing plasmids delivered at the low MOT required for library screening are still capable of triggering specific cell death with their corresponding R gene partner.
EXAMPLE 5 - Mock library screen using Sr50-AyrSr50 and Sr27-AyrSr27
In this example, a mock library was screened against the R genes Sr50 and Sr27 in protoplasts. The mock library consisted of AvrSr50 at MOT 0.14, AvrSr27-2 at MOT 0.14, and AvrSr35 at MOT 100 [0.14 x (718 - 2)]. Thus, the mock library imitated a pooled library comprised of 718 constructs, where AvrSr50 and AvrSr27-2
each represented a single library construct and AvrSr35 represented the other 716 library constructs. Sr50, Sr27, or an empty vector (negative control) was delivered in the standard amount (MOT 36). Following the 24-hour incubation of the transiently transformed protoplasts, mRNA was extracted and used as a mock template for libraryspecific cDNA synthesis and PCR. Illumina libraries were then constructed and sequenced. RNA-seq reads were mapped to the mock library coding sequences and and the transcripts per million (TPM) was calculated for each Avr gene. It was hypothesised that only a proportion of transformed cells would receive the PCD- triggering Avr gene (AvrSr50 when screening against Sr50; AvrSr27-2 when screening against Sr27), and that only those cells would undergo PCD, resulting in depletion of mRNA and associated RNA-seq reads for that Avr gene only and identified by a decrease in TPM.
As shown in Figure 5, AvrSr50 TPM was greatly reduced when the mock library was screened against Sr50, and AvrSr27-2 TPM was greatly reduced when the mock library was screened against Sr27. This result validated the experimental approach and further demonstrated that pooled library screening in protoplasts may be feasible on the basis that a significant change in expression can be detected for Avr- encoding gene constructs delivered in the presence of a mock library and the corresponding R gene.
EXAMPLE 6 - Pooled effector library screen and identification of candidates for AyrSrl3 and AyrSr22
In this example, a pooled stem rust effector library Pgt21-0_EL_0001-0718 consisting of 696 putative effectors from Pgt was screened against Sr50 and Sr27 (positive control R genes as AvrSr50 and AvrSr27 variants are present in the library), as well as six additional R genes of interest, whose matching Avrs are unknown: Sri 3c, Sr21, Sr22, Sr26, Sr33, and Sr61. The effector candidates in the library were selected from the Pgt21-0 reference genome annotation (Li et al., 2019a) as genes encoding secreted proteins with expression patterns similar to known Avr genes (Upadhyaya et al., 2021) as described in Example 1. The screening approach was the same as in Example 5 above, with the pooled effector library delivered at MOT 0.14 and RNA- Seq reads mapped to the effector library coding sequences. The library screen was performed a first time (screen 1) with Sr50 and the six R genes of interest. To ensure reproducibility, the library screen was then repeated from the beginning (screen 2) with Sr50, Sr27, and the six R genes of interest. Sr27 was used in screen 2 as an additional
positive control to see whether all five known variants of AvrSr27 could be correctly identified.
As shown in Figure 6, the screen correctly identified AvrSr50 and the five known variants of AvrSr27 (AvrSr27-l, AvrSr27-2, avrSr27-3, AvrSr271ike-l, and AvrSr271ike-2) as showing significantly lower expression in the Sr50 and Sr27 treatments, respectively, compared to the no R gene control. In each case the remainder of the effector genes in the library showed similar expression in the control and R gene treatments. Furthermore, and most importantly, a single effector construct (#0336) was identified from the library that showed significantly reduced expression in the presence of Srl3, and represents a candidate for AvrSrl3. Likewise, a single effector construct (#0100) showed significantly reduced expression in the presence of Sr22, and represents a candidate for AvrSr22. This result demonstrated that the experimental approach described in this example can successfully identify known and novel Avr genes by high-throughput screening of pooled effector libraries in protoplasts for recognition by specific R genes.
EXAMPLE 7 - Validation of candidates for AyrSrl3 and AyrSr22
In this example, the flow cytometric assay for PCD described in Example 2 was used to independently validate the AvrSrl3 and AvrSr22 candidates that were identified in Example 6. As shown in Figure 7, co-transformation of Srl3c and the AvrSrl3 candidate (effector 0336) resulted in a substantial decrease in the percent YFP+ protoplasts, as did co-transformation of Sr22 and the AvrSr22 candidate (effector 0100), compared to co-expression of Sri 3c or Sr22 with another effector (AvrSr50), or expression of either candidate Avr alone. This result confirmed that the candidate effectors encoded by library clones 0336 and 0100 are specifically recognised by Sr 13 and Sr22 respectively supporting that they are indeed AvrSrl3 and AvrSr22, respectively. This result also demonstrated that pooled effector library screening as described in Example 6 enables rapid identification of new pathogen Avr genes.
EXAMPLE 8 - Validation of candidate for AyrSrl3 in native and transgenic lines
In this example, the flow cytometric assay for PCD described in Example 2 was used to further validate the AvrSrl3 candidate in protoplasts derived from wheat cv. Kronos (which carries Srl3a in its native context) and a transgenic wheat line (cv. Fielder) carrying Srl3c. As shown in Figure 8, transformation of effector 0336 alone (no R gene co-transformed) into cv. Kronos and the transgenic cv. Fielder line resulted in a decrease in the percent YFP+ protoplasts compared to the negative control line
Fielder, although the decrease was moderate in both cases, possibly due to weak expression of Srl3a and Srl3c in cv. Kronos and the transgenic cv. Fielder line, respectively. This result further confirmed that effector 0336 is indeed AvrSrl3.
EXAMPLE 9 - Validation of candidate for AyrSr22 in native and transgenic lines
In this example, the flow cytometric assay for PCD described in Example 2 was used to further validate the AvrSr22 candidate in protoplasts derived from wheat cv. Schomburgk (which carries Sr22 in its native context), a transgenic wheat line (cv. Fielder) carrying Sr22, and a transgenic wheat line (cv. Robin) carrying a five gene stack (‘Big 5’) including Sr22 (Luo et al., 2021).
As shown in Figure 9, transformation of effector 0100 alone (no R gene cotransformed) into cv. Schomburgk, and the transgenic cv. Robin lines resulted in a decrease in the percent YFP+ protoplasts, compared to the negative control Robin line, although the decrease was moderate in cv. Schomburgk, possibly due to weak expression of Sr22 in this cultivar. This result further confirmed that effector 0100 is indeed AvrSr22.
EXAMPLE 10 - Validation of candidates for AyrSrl3 and AyrSr22 in N. tabacum
In this example, agroinfiltration of N. tabacum leaves was carried out to further validate the AvrSrl3 and AvrSr22 candidates. As shown in Figure 10, co-infiltration of Srl3c and effector 0336 resulted in PCD (visible as light brown necrotic tissue), as did co-infiltration of Sr22 and effector 0100. However, co-infiltration of Srl3c with a different effector (AvrSr27), co-infiltration of effector 0336 with a different R gene (Sr27), and infiltration of Srl3c or effector 0336 alone did not cause any response. Likewise, co-infiltration of Sr22 with a different effector (AvrSr27), co-infiltration of effector 0100 with a different R gene (Sr27), and infiltration of Sr22 or effector 0100 alone did not cause any response. This result further confirmed that effectors 0336 and 0100 are AvrSrl3 and AvrSr22, respectively.
EXAMPLE 11 - Validation of candidates for AyrSrl3 and AyrSr22 in N. benthamiana
In this example, agroinfiltration of N. benthamiana leaves was carried out to further validate the AvrSrl3 and AvrSr22 candidates.
As shown in Figure 11, co-infiltration of Srl3c and effector 0336 resulted in PCD (indicated by patchy discoloured necrotic tissue), as did co-infiltration of Sr22 and effector 0100. However, co-infiltration of Srl3c with a different effector (AvrSr27), co-
infiltration of effector 0336 with a different R gene (Sr27), and infiltration of Srl3c or effector 0336 alone did not cause any response. Likewise, co-infiltration of Sr22 with a different effector (AvrSr27), co-infiltration of effector 0100 with a different R gene (Sr27), and infiltration of Sr22 or effector 0100 alone did not cause any response. This result further confirmed that effectors 0336 and 0100 are AvrSrl3 and AvrSr22, respectively.
EXAMPLE 12 - Validation of Srl3 recognition specificity for AyrSrl3 alleles
In this example, the flow cytometric assay for PCD described in Example 2 was used to test the recognition specificity of Srl3c (Zhang et al., 2017; Gill et al., 2021) against two AvrSrl3 alleles: AvrSrl3 and AvrSrl3b. AvrSrl3 (library effector 0336) is encoded by PGT21_021053 on chromosome 1A in the Pgt21-0 genome reference (Li et al., 2019a). A BLAST search revealed no homologous sequence on the homologous chromosome IB of Pgt21-0, and a single identical gene copy in the Ug99 (race TTKSK) reference sequence, PGTUg99_007363 (Li et al., 2019a). Thus, both Pgt21-0 and Ug99 are heterozygous for AvrSrl3. An allelic variant of AvrSrl3, with a single amino acid substitution R82C, was identified from Illumina genome sequence data derived from Pgt isolate 09ETH8-3 (race JRCQC) obtained from NCBI BioProject PRJNA164531, and designated AvrSrl3b. Gill et al. (2021) reported that Srl3c gave resistance to Ug99 and race JRCQC.
As shown in Figure 12, Srl3c recognised both AvrSrl3 alleles based on the decrease in the percent YFP+ protoplasts, but the response was stronger with AvrSrl3 (0336). This result is consistent with the observations of Gill et al. (2021).
EXAMPLE 13 - Validation of Sr22 recognition specificity for AyrSr22 alleles
In this example, the flow cytometric assay for PCD described in Example 2 was used to test the recognition specificity of Sr22 against two AvrSr22 alleles (AvrSr22 and AvrSr22b). AvrSr22 (library effector 0100) is encoded by PGT21_017626 on chromosome 16B in the Pgt21-0 genome reference (Li et al., 2019a). A BLAST search revealed a related sequence on the homologous chromosome 16A of Pgt21-0 that was not annotated but could encode a mature protein with nine amino acid differences from AvrSr22. RNA-seq reads corresponding to the sequence were present in sequence derived from infected tissues (Li et al., 2019a) suggesting that this allele is expressed, and it was designated AvrSr22b. The Ug99 reference genome (Li et al., 2019a) contains sequences identical to both AvrSr22 (chromosome 16C, PGTUg99_032354) and AvrSr22b (chromosome 16A, not annotated).
As shown in Figure 13, Sr22 recognised both AvrSr22 alleles based on the decrease in the percent YFP+ protoplasts. This result indicated that both Pgt21-0 and Ug99 are likely homozygous for AvrSr22.
EXAMPLE 14 - Validation of AyrSr22 alleles in N. tabacum
In this example, agroinfiltration of N. tabacum leaves was carried out to provide additional confirmation of the results obtained in Examples 12 and 13. As shown in Figure 14, co-infiltration of Sri 3c with either AvrSrl3 or AvrSrl3b resulted in PCD (visible as light brown necrotic tissue), as did co-infiltration of Sr22 with either AvrSr22 or AvrSr22b, whereas co-infiltration of Sri 3c, AvrSrl3b, Sr22 or AvrSr22b with YFP did not cause any response. This result provided additional confirmation of the results obtained in Examples 12 and 13.
EXAMPLE 15 - Validation of Srl3c and Sr22 recognition specificity for AyrSrl3 and AyrSr22 alleles in N. benthamiana
In this example, agroinfiltration of N. benthamiana leaves was carried out to provide additional confirmation of the results obtained in Examples 12, 13 and 14. As shown in Figure 15, co-infiltration of Srl3c with either AvrSrl3 or AvrSrl3b resulted in PCD (visible as discoloured necrotic tissue), as did co-infiltration of Sr22 with either AvrSr22 or AvrSr22b, whereas co-infiltration of Sri 3c, AvrSrl3b, Sr22 or AvrSr22b with YFP did not cause any response (apart from low level Sr22 autoactivity). This result provided additional confirmation of the results obtained in Examples 12, 13 and 14.
EXAMPLE 16 - Flow cytometric assays for PCD using Sr50 with an inducible AyrSr50 activated by the transcription factor GAL4-VP16
In this example, a flow cytometric assay for PCD was performed as described in Example 2 to determine whether transcriptional activation of an Avr effector and subsequent interaction with an R protein could be detected and quantified.
In previous examples, the inventors assessed the capacity for recognition between a corresponding Avr and R protein via constitutive expression with both components driven by the Ubiquitin promoter (ubi). In this example, the capacity to detect transcriptional activation of an Avr protein leading to recognition by a corresponding R protein for future application for a library screening approach was tested.
For this approach, the inventors assessed the capacity of a chimeric transcription factor GAL4-VP16 protein containing the yeast GAL4 DNA-binding domain and the Herpes simplex virus VP16 transcription activation domain (Sadowski et al., 1988) (encoded by SEQ ID NO:28) to bind to activate transcription of the AvrSr50 construct containing a minimal GAL4 upstream activator sequence (UAS; Brand & Perrimon, 1993) leading to expression of the AvrSr50 protein and induction of cell death in the presence of Sr50 (schematically represented in Figure 17).
As shown in Figure 18, co-transformation of UAS-AvrSr50 (SEQ ID NO:29), GAL4-BD and Sr50 resulted in a substantial decrease in the percentage of YFP+ protoplasts, similar to the constitutively activated AvrSr50 and Sr50. No PCD was observed in the absence of the corresponding Avr or R protein, or the GAL4-BD transcriptional activator. This result confirms that this approach can be successfully applied to detect transcriptional activation of a gene, and therefore has the capacity to be successfully applied in a high-throughput library screen to identify transcription factor proteins that activate specific gene promoter sequences.
In a high throughput library approach, the pooled rust effector library described in Example 6 was supplemented with the GAL4-VP16-PBS construct at the same molar concentration. For this experiment, co-transformation of Sr50 with the library act as a positive control becasue the AvrSr50 (corresponding Avr) is present, as well as UAS-AvrSr50 with Sr50 to detect GAL4-VP16 activation of AvrSr50.
The screening approach would be the same as Example 6, with pooled library delivered at MOT 0.14 and RNA-Seq reads mapped to library coding sequences. The anticipated result would be a depletion of both AvrSr50 and GAL4-VP16 transcripts as protoplasts that have taken up Sr50, UAS-AvrSr50 and GAL4-VP16 would undergo PCD. In a more general approach, a synthesised library of candidate transcription factor genes can be screened against a specific promoter element controlling expression of an Avr gene co-expressed with a corresponding resistance gene to identify a transcription factor(s) acting on the promoter element to activate transcription.
The present application claims priority from AU 2022903442 filed 16 November 2022, the entire contents of which are incorporated herein by reference.
It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly
described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
All publications discussed and/or referenced herein are incorporated herein in their entirety. Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
REFERENCES
Amdell et al. (2019) BMC Biotechnology 19:71.
Bethke et al. (2009) Proc. Natl. Acad. Sci. USA 106:8067-8072.
Bemoux et al. (2008) Plant Cell 32:3036-3037.
Blighe et al. (2022) EnhancedVolcano: Publication-ready volcano plots with enhanced colouring and labeling. R package version 1.14.0.
Bbttner et al. (2009) Plant J. 58:914-926.
Brand and Perrimon (1993) Development 118:401-415.
Chen et al. (2018) Bioinformatics 34:i884-i890.
Crossway et al. (1986) Biotechniques 4:320-334.
Davey et al. (2005) Biotechnology Advances 23: 131-171.
Deng et al. (2022) Molecular Plant 15:P904-P912.
Dlugosz et al. (2016) J Vis Exp 115:54300.
Dodds et al. (2001) Plant Cell 13: 163-178.
Eeckhaut et al. (2013) Planta 238:991-1003.
Ehlert et al. (2006) Plant J. 46:890-900.
Evans et al. (2021) bioRxiv ://doi.org/10.1101/2021.10.04.463034.
Gaillochet et al. (2021) The Plant Cell 33:794-813.
Gill et al. (2021) The Plant Journal 106: 1674-1691.
Gillard et al. (2021) Frontiers in Plant Science 12:749581.
Hsu et al. (2010) Plant Physiol. 153:773-784.
Jumper et al. (2021) Nature 596:583-589.
Kim et al. (2015) Nature Methods 12:357-360.
Li et al. (2019a) Nature Communications 10:5068.
Li et al. (2019b) Nature Communications 10:4996.
Lin et al. (2022) Molecular Plant 15: 1457-1469.
Lolle et al. (2020) Curr Opin Immunol 62:99-105.
Long et al. (2018) Front. Plant Sci. 9:639.
Love et al. (2014) Genome Biology 15:550.
Luo et al. (2021) Nature Biotechnology 39: 561-566.
Marchal et al. (2022) Zenodo. doi.org/10.5281/zenodo.6997489.
McCabe et al. (1988) Biotechnology 6:923-926.
Menzel et al. (2019) New Phytol. 224:833-847.
Newell et al. (1998) J Exp Botany 49:817-827.
Nishimura and Beevers (1978) Plant Physiol 62:40-43.
.
Saintenac et al. (2018) Nature 50:368-374.
Saur et al. (2019) eLife 8: 1-31.
Sperschneider et al. (2015) PLOS Pathogens, doi.org/10.1371/joumal.ppat.1004806.
Sperschneider et al. (2016) New Phytologist 210:743-761.
Thomma et al. (2011) Plant Cell. 23:4-15.
Tomes et al. (1995) In Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin).
Upadhyaya et al. (2021) Nature Plants 7: 1220-1228.
Wang et al. (2007) Plant Cell. 19:2898:2912.
Wang et al. (2020) Autophagy 1: 123-139.
Xing and Wang (2015) Botany 93:325-332.
Ye et al. (2019) Plant Cell 31:2682-2696.
Yoo et al. (2007) Nat. Protoc. 2: 1565-1572.
Yue et al. (2021) Frontier in Genome Editing 3:717017.
Zhang et al. (2017) Proc. Natl. Acad. Sci. USA 114:E9483- E9492.
Zhou and Yang (2016) Science China 59:863-866.
Claims
1. A method of identifying a protein-protein interaction in a plant protoplast, the method comprising i) transforming a pool of plant protoplasts with a library of vectors encoding a first protein which is a member of a library of proteins expressed by the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector encoding a second protein, b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector encoding the second protein, or c) the protoplasts endogenously produce the second protein, and ii) screening the pool of plant protoplasts for an interaction between a first protein and the second protein.
2. The method of claim 1, wherein the number copies of each different vector of the library per protoplast used in step i) is between about 0.7 million and about 0.01 million.
3. The method of claim 1 or claim 2, wherein the number copies of each different vector of the library per protoplast used in step i) is about 0. 14 million.
4. The method according to any one of claims 1 to 3, wherein the protein-protein interaction in the plant protoplast results in programmed cell death.
5. The method according to any one of claims 1 to 4, wherein the library of vectors encode a library of candidate effector proteins or fragments thereof from a plant pathogen some of which may interact directly or indirectly with a plant protein, or a combination thereof.
6. The method of claim 5, wherein the second protein is a candidate plant protein or a fragment thereof which may interact directly or indirectly with a pathogen effector protein.
7. The method of claim 5 or claim 6, wherein the plant protein is a plant receptor protein.
8. The method according to any one of claims 5 to 7, wherein the plant protein is a candidate or known plant pathogen resistance protein.
9. The method according to any one of claims 5 to 7, wherein the pathogen is a fungus, virus or bacteria.
10. The method of claim 9, wherein the pathogen is a fungus.
11. The method of claim 10, wherein the fungus is Puccinia sp., Blumeria sp., Fusarium sp., Magnaporthe sp., Bipolaris sp., Oidium sp., Gibberella sp., Cochliobolus sp., Exserohilum sp., Uredo sp. Microdochium sp., Helminthosporium sp., Monographella sp., Colletotrichum sp., Uromyces sp., Erysiphe sp., Ustilago sp., Zymoseptoria sp., Stagonospora sp., Septaria sp., Pyrenophora sp., Cladosporium sp., Leptospheria sp., Venturia sp. or Phakospsora sp..
12. The method of claim 10 or claim 11, wherein the fungus causes rust.
13. The method according to any one of claims 1 to 12, wherein the vector encoding the second protein further encodes a detectable marker.
14. The method according to any one of claims 1 to 13, wherein step ii) comprises extracting mRNA from a pool of live protoplasts and quantifying the level of mRNA encoding the proteins expressed by the library, wherein mRNA under-represented from the extraction is mRNA encoding a protein which interacts with the second protein.
15. The method according to any one of claims 1 to 13, wherein step ii) comprises screening for expression of a detectable marker and selecting protoplasts for the presence or absence of marker expression.
16. The method of claim 15, wherein step ii) comprises screening for expression of the marker and selecting protoplasts expressing the marker.
17. The method of claim 16, wherein the marker is a fluorescent protein.
18. The method according to any one of claims 1 to 17, wherein interaction between a first protein and the second protein results in marker gene expression from a vector.
19. The method according to any one of claims 1 to 18, wherein the number copies of the vector encoding the second protein per protoplast used in part b) is between about 10 million and about 150 million.
20. The method according to any one of claims 1 to 19, wherein the vectors are plasmid vectors or viral vectors.
21. A method of identifying a protein-polynucleotide interaction in a plant protoplast, the method comprising i) transforming a pool of plant protoplasts with a library of vectors encoding a first protein which is a member of a library of proteins expressed by the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector comprising or encoding a polynucleotide of interest, b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector comprising or encoding a polynucleotide of interest, or c) the protoplasts endogenously comprise a polynucleotide of interest, and ii) screening the pool of plant protoplasts for an interaction between a first protein and the polynucleotide of interest.
22. A method of identifying a protein-polynucleotide interaction in a plant protoplast, the method comprising i) transforming a pool of plant protoplasts with a library of vectors comprising or encoding a polynucleotide which is a member of a library of polynucleotides comprised in, or expressed by, the vectors, wherein at least one of the following apply; a) plant protoplasts of the pool comprise a vector encoding a first protein, b) the method further comprises transforming the pool of plant protoplasts with the library of vectors with the vector encoding a first protein, or c) the protoplasts endogenously comprise the first protein, and ii) screening the pool of plant protoplasts for an interaction between a polynucleotide and the first protein.
23. A method of determining the phenotypic effect in a plant, or part thereof, of a protein-protein interaction or protein-polynucleotide interaction identified by a method according to any one of claims 1 to 22, the method comprising, i) modifying the expression of one of the proteins or polynucleotides in a plant or part thereof, and ii) examining the effects of the modification on the phenotype of the plant, or part thereof.
24. The method of claim 23, wherein the protein is a candidate pathogen resistance protein, and the phenotype is resistance to the pathogen.
25. The method of claim 23 or claim 24, wherein the plant part is a plant leaf.
26. The method according to any one of claims 23 to 25, wherein the plant or part thereof does not endogenously produce the protein or polynucleotide.
27. A method of producing a library of plant protoplasts, the method comprising transforming a pool of plant protoplasts with a library of vectors encoding a library of proteins, wherein the number copies of each different vector of the library per protoplast used in the transformation is between about 2 million and about 0.001 million.
28. The method of claim 27, wherein the number copies of each different vector of the library per protoplast used in the transformation is between about 0.7 million and about 0.01 million.
29. A composition comprising a library of vectors encoding at least 100 different predicted pathogen effector proteins or fragments thereof which may interact with a plant protein, or a combination thereof, and a suitable carrier.
30. A method of identifying a molecule that confers resistance to a pathogen expressing an AvrSrl3 or AvrSr22 effector protein, the method comprising a) identifying a molecule that binds the effector protein, and b) determining if the molecule confers resistance to the pathogen.
RECTIFIED SHEET (RULE 91)
im 30, wherein the pathogen is a plant pathogen, the molecule ) comprises expressing the polypeptide in a plant.
RECTIFIED SHEET (RULE 91)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2022903442A AU2022903442A0 (en) | 2022-11-16 | Protoplast screening assay | |
| PCT/AU2023/051161 WO2024103117A1 (en) | 2022-11-16 | 2023-11-15 | Protoplast screening assay |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4619519A1 true EP4619519A1 (en) | 2025-09-24 |
Family
ID=91083406
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP23889894.4A Pending EP4619519A1 (en) | 2022-11-16 | 2023-11-15 | Protoplast screening assay |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP4619519A1 (en) |
| AU (1) | AU2023382072A1 (en) |
| WO (1) | WO2024103117A1 (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001068920A1 (en) * | 2000-03-13 | 2001-09-20 | The General Hospital Corporation | Plant protoplast gene expression systems and uses thereof |
| AU2001261408A1 (en) * | 2000-05-12 | 2001-11-26 | Odyssey Pharmaceuticals, Inc. | Mapping molecular interactions in plants with protein fragments complementation assays |
| US20250313828A1 (en) * | 2022-05-05 | 2025-10-09 | University Of Washington | Synthetic genetic platform in eukaryote cells and methods of use |
-
2023
- 2023-11-15 AU AU2023382072A patent/AU2023382072A1/en active Pending
- 2023-11-15 WO PCT/AU2023/051161 patent/WO2024103117A1/en not_active Ceased
- 2023-11-15 EP EP23889894.4A patent/EP4619519A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024103117A1 (en) | 2024-05-23 |
| AU2023382072A1 (en) | 2025-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102871442B1 (en) | Modifying the specificity of plant non-coding RNA molecules for silencing gene expression | |
| Arndell et al. | Pooled effector library screening in protoplasts rapidly identifies novel Avr genes | |
| Mackey et al. | Arabidopsis RIN4 is a target of the type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance | |
| Zhou et al. | Importance of OsRac1 and RAI1 in signalling of nucleotide‐binding site leucine‐rich repeat protein‐mediated resistance to rice blast disease | |
| WO2018107103A1 (en) | Crispr-systems for modifying a trait of interest in a plant | |
| AU2010210009B2 (en) | Method for isolation of transcription termination sequences | |
| Cheong et al. | Xanthomonas oryzae pv. oryzae type III effector XopN targets OsVOZ2 and a putative thiamine synthase as a virulence factor in rice | |
| CN104136615B (en) | Development of novel plant-derived cis-regulatory elements in pathogen-responsive chimeric promoters | |
| Jin et al. | PM2b, a CC-NBS-LRR protein, interacts with TaWRKY76-D to regulate powdery mildew resistance in common wheat | |
| Li et al. | The barley powdery mildew effectors CSEP0139 and CSEP0182 suppress cell death and promote B. graminis fungal virulence in plants | |
| US20140366219A1 (en) | Increasing Soybean Defense Against Pests | |
| US7026123B1 (en) | UTR tag assay for gene function discovery | |
| RU2375453C2 (en) | Self-activated stability protein | |
| CN106414742A (en) | Zea mays regulatory elements and uses thereof | |
| WO2024103117A1 (en) | Protoplast screening assay | |
| US20140007293A1 (en) | Inducible Plant Promoters and the Use Thereof | |
| AU2015222996B2 (en) | Root specific expression conferred by chimeric gene regulatory elements | |
| KR20160099105A (en) | Novel maize ubiquitin promoters | |
| KR20160105451A (en) | Novel maize ubiquitin promoters | |
| US12319919B2 (en) | Synthetic ethylene-responsive binding element and uses thereof | |
| US9637750B2 (en) | P5SM suicide exon for regulating gene expression | |
| Wilson | Identifying and characterising effector molecules corresponding to disease outcomes in wheat stripe rust disease | |
| KR20160099104A (en) | Novel maize ubiquitin promoters | |
| Wang et al. | Xanthomonas type III effector XopN targets scaffold protein OsRACK1B to suppress rice immunity | |
| Dong et al. | A pair of NLRs coordinately modulates NRC3-mediated ETI responses to facilitate age-dependent immunity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250523 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) |