EP4618967A1 - Combination of polyamine pathway inhibitor drug and proline/arginine diet restriction - Google Patents

Combination of polyamine pathway inhibitor drug and proline/arginine diet restriction

Info

Publication number
EP4618967A1
EP4618967A1 EP23808830.6A EP23808830A EP4618967A1 EP 4618967 A1 EP4618967 A1 EP 4618967A1 EP 23808830 A EP23808830 A EP 23808830A EP 4618967 A1 EP4618967 A1 EP 4618967A1
Authority
EP
European Patent Office
Prior art keywords
proline
dfmo
arginine
cancer
less
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23808830.6A
Other languages
German (de)
French (fr)
Inventor
Raphael MORSCHER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zurich Universitaet Institut fuer Medizinische Virologie
Original Assignee
Zurich Universitaet Institut fuer Medizinische Virologie
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zurich Universitaet Institut fuer Medizinische Virologie filed Critical Zurich Universitaet Institut fuer Medizinische Virologie
Publication of EP4618967A1 publication Critical patent/EP4618967A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/197Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
    • A61K31/198Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia

Definitions

  • the present invention relates to methods for treatment, pharmaceutical compositions and applications that combine the pharmaceutical administration of polyamine pathway inhibitor drugs, particularly of alpha-difluoromethylornithine (DFMO), in combination with interventions that restrict the intake, or lead to a lowered plasma level, of arginine and/or proline, in cancer treatment.
  • polyamine pathway inhibitor drugs particularly of alpha-difluoromethylornithine (DFMO)
  • DFMO alpha-difluoromethylornithine
  • Amino acid side chain characteristics affect the kinetics of protein biosynthesis. Translation of proline imposes particular structural challenges due to its imide ring moiety. To resolve ribosome stalling and allow processive translation of polyproline tracts nature has evolved the translation elongation factor eif5a. Across all domains of life eif5a is the only protein being post translationally hypusinated, a polyamine derived modification critical for its function.
  • Eflornithin (DMFO, alpha-difluoromethylornithine), commercially available as Vaniqa, Ornidyl and other brands, is a drug used to treat African trypanosomiasis, and hirsutism. Several clinical trials have explored its use in treatment of cancer.
  • DMFO is dosed i.v. at 200 mg/kg every 12 hours for 7 days in treatment of trypanosomiasis (MSF eflornithine information) in combination, and in monotherapy 150 mg/kg every 6 hours for 14 days (children ⁇ 12Y) or 100 mg/kg every 6 hours for 14 days (children >12Y and adults).
  • MSF eflornithine information trypanosomiasis
  • monotherapy 150 mg/kg every 6 hours for 14 days (children ⁇ 12Y) or 100 mg/kg every 6 hours for 14 days (children >12Y and adults).
  • Bassiri et al. Transl Pediatr. 2015 Jul; 4(3): 226-238
  • LoGiudice et al. (Med Sci (Basel). 2018 Mar; 6(1 ): 12) report DFMO dosing in colon cancer prevention trials as typically around 500 mg/m 2 /day DFMO daily in tablet form over several years, and that higher oral doses were tested clinically for neuroblastoma treatment in children; 2000 mg/m 2 /day DMFO alone or up to 9000 mg/m 2 /day in combination therapies.
  • WO2021143579 relates adenoma risk reduction in patients receiving DFMO and sulindac to polyamine and arginine intake.
  • W02016130918 reports that DFMO may prevent relapse and increases overall survival in neuroblastoma patients.
  • the objective of the present invention is to provide means and methods to treat cancer. This objective is attained by the subject-matter of the independent claims of the present specification, with further advantageous embodiments described in the dependent claims, items, embodiments, examples, figures and general description of this specification.
  • the invention relates to the use of a polyamine pathway inhibitor drug, particularly of DFMO, in treatment of cancer, wherein the polyamine pathway inhibitor drug is administered to a patient undergoing a dietary regimen and/or drug treatment that is designed to reduce a plasma level of proline, arginine, or both.
  • a method of treating a condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a polyamine pathway inhibitor, wherein the subject is undergoing a dietary regimen that is designed to reduce a plasma level of proline, arginine, or both in the subject.
  • the polyamine pathway inhibitor drug is difluoromethylornithine (DFMO).
  • compositions comprising in a unit dosage form that comprises or consists of a) a dietary product comprising a plurality of amino acids, wherein the dietary product is designed to reduce a plasma level of proline, arginine, or both in the subject; b) a polyamine pathway inhibitor, particularly DFMO; and c) a pharmaceutically acceptable excipient.
  • provided herein is a method of treating a condition in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a dietary product designed to reduce a plasma level of proline and/or arginine in the subject.
  • Non-limiting examples of conditions include a cancer, a pediatric cancer, a cancer characterized by overexpression of a MYC-family oncogene (e.g., MYC, MYC-L, or MYC-N), a MYC-amplified cancer, a MYC-N-amplified cancer, a solid tumour, a non-solid tumour, a liquid tumour, lymphoma, leukemia, a brain cancer, neuroblastoma, medulloblastoma, prostate cancer, colorectal cancer, cervical cancer, skin cancer (e.g., melanoma), bladder cancer, or gastric cancer.
  • a MYC-family oncogene e.g., MYC, MYC-L, or MYC-N
  • MYC-amplified cancer e.g., MYC, MYC-L, or MYC-N
  • a MYC-amplified cancer e.g., MYC, MY
  • methods provided herein further comprise administering one or more chemotherapeutic agents.
  • chemotherapeutic agents include: sulindac, temozolomide, irinotecan, dinutuximab, triamcinolone, bicalutamide, celecoxib, cyclophosphamide, topotecan, AMXT 1501 , etoposide, ceritinib, dasatinib, sorafenib, vorinostat, and bortezomib.
  • references to “about” a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”
  • cancer immunotherapy biological or immunomodulatory therapy is meant to encompass types of cancer treatment that help the immune system to fight cancer.
  • Non-limiting examples of cancer immunotherapy include immune checkpoint inhibitors and agonists, T cell transfer therapy, cytokines and their recombinant derivatives, adjuvants, and vaccination with small molecules or cells.
  • checkpoint inhibitory agent or checkpoint inhibitor antibody is meant to encompass a cancer immunotherapy agent, particularly an antibody (or antibody-like molecule) capable of disrupting an inhibitory signalling cascade that limits immune cell activation, known in the art as an immune checkpoint mechanism.
  • the checkpoint inhibitory agent or checkpoint inhibitor antibody is an antibody to CTLA-4 (Uniprot P16410), PD-1 (Uniprot Q15116), PD-L1 (Uniprot Q9NZQ7), B7H3 (CD276; Uniprot Q5ZPR3), VISTA (Uniprot Q9H7M9), TIGIT (UniprotQ495A1 ), TIM-3 (HAVCR2, Uniprot Q8TDQ0), CD158 (killer cell immunoglobulin-like receptor family), TGF-beta (P01137).
  • CTLA-4 Uniprot P16410
  • PD-1 Uniprot Q15116
  • PD-L1 Uniprot Q9NZQ7
  • B7H3 CD276; Uniprot Q5ZPR3
  • VISTA Uniprot Q9H7M9
  • TIGIT UniprotQ495A1
  • TIM-3 HVCR2, Uniprot Q8TDQ0
  • the cancer immunotherapy agent is selected from the clinically available antibody drugs ipilimumab (Bristol-Myers Squibb; CAS No. 477202-00-9), nivolumab (Bristol-Myers Squibb; CAS No 946414-94-4), pembrolizumab (Merck Inc.; CAS No. 1374853-91-4), pidilizumab (CAS No. 1036730-42-3), atezolizumab (Roche AG; CAS No. 1380723-44-3), Avelumab (Merck KGaA; CAS No. 1537032-82-8), Durvalumab (Astra Zenaca, CAS No. 1428935-60-7), and Cemiplimab (Sanofi Aventis; CAS No.
  • checkpoint agonist agent or checkpoint agonist antibody is meant to encompass a cancer immunotherapy agent, particularly but not limited to an antibody (or antibody-like molecule) capable of enhancing an immune cell activation signalling cascade.
  • the term checkpoint agonist agent further encompasses cytokines, recombinant immune stimulatory proteins, vaccines, adjuvants and agonist antibodies that promote immune activation.
  • cytokines known to stimulate immune cell activation include, IL-12, IL-2, IL-15, IL-21 and interferon-alpha.
  • the checkpoint agonist agent or checkpoint agonist antibody is an antibody to CD122 (Uniprot P14784) and CD137 (4-1 BB; Uniprot Q07011 ), ICOS (Uniprot Q9Y6W8), 0X40 (GP34, Uniprot P43489), or CD40 (Uniprot P25942) .
  • the cancer immunotherapy is meant to encompass immune cell transfer cancer treatments wherein a patient’s immune cells are activated or expanded in vitro, and/or genetically modified, for example with the addition of a chimeric antigen receptor, before being infused back into the patient to inhibit neoplastic disease.
  • immune cell transfer therapy include chimeric antigen receptor T lymphocytes, and autologous activated T cells or dendritic cells.
  • checkpoint inhibitory agent or checkpoint inhibitory antibody is meant to encompass an agent, particularly an antibody (or antibody-like molecule) capable of disrupting the signal cascade leading to T cell inhibition after T cell activation as part of what is known in the art the immune checkpoint mechanism.
  • a checkpoint inhibitory agent or checkpoint inhibitory antibody include antibodies to CTLA-4 (Uniprot P16410) such as exemplified by ipilimumab (Yervoy; CAS No.
  • PD- 1 Uniprot Q15116
  • PD-L1 Uniprot Q9NZQ7
  • B7H3 CD276; Uniprot Q5ZPR3
  • nivolumab Bristol-Myers Squibb; CAS No 946414-94-4
  • pembrolizumab Merck Inc.; CAS No. 1374853-91-4
  • pidilizumab CAS No. 1036730-42-3
  • atezolizumab (Roche AG; CAS No. 1380723-44-3)
  • Avelumab Merck KGaA; CAS No. 1537032-82-8).
  • the term pharmaceutical composition refers to a compound of the invention, or a pharmaceutically acceptable salt thereof, together with at least one pharmaceutically acceptable carrier.
  • the pharmaceutical composition according to the invention is provided in a form suitable for topical, parenteral or injectable administration.
  • the term pharmaceutically acceptable carrier includes any solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (for example, antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington: the Science and Practice of Pharmacy, ISBN 0857110624).
  • cancer as used in the context of the present specification relates to malignant neoplastic disease; the terms “cancer” and “malignant neoplastic disease” are used synonymously herein. They specifically include carcinoma (epithelial derived cancer), sarcoma (connective tissue derived cancer), lymphoma and leukemia, germ-cell derived tumours and blastomas. Particular alternatives of any of the aspects and embodiments disclosed herein are directed at the use of the compounds and compositions of the invention in treatment of solid tumours.
  • treating or treatment of any disease or disorder refers in one embodiment, to ameliorating the disease or disorder (e.g. slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof).
  • treating or treatment refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient.
  • treating or treatment refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both.
  • difluoromethylornithine refers to a- difluoromethylornithine, or a pharmaceutically acceptable salt thereof.
  • the drug is known as Eflornithin; CAS No 70052-12-9 or 96020-91-6 and commonly used as the hydrochloride, but use as disclosed herein of any other pharmaceutically acceptable salt form is to be deemed encompassed by the invention.
  • 2,5-Diamino-2-(difluoromethyl)-pentanoic acid is commercialized as a racemate of the R and S form. The invention is not limited to the racemate but encompasses the pure enantiomers for use as indicated further herein.
  • the invention provides the use of a polyamine pathway inhibitor in in treatment or prevention of recurrence of cancer.
  • the polyamine pathway inhibitor is difluormethylornithine, or a pharmaceutically acceptable salt thereof, (DFMO).
  • DFMO is administered to a patient characterized by a significantly reduced blood plasma level of proline and/or arginine, in comparison to a physiological level of proline and/or arginine.
  • the physiological level of proline and/or arginine depends on the age of the patient.
  • the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
  • the arithmetic middle is used between the upper and lower value of the respective range:
  • the term “significantly reduced” with regard to the blood plasma level of an amino acid refers to the reduction of the blood plasma level of the amino acid below that of physiological level of the amino acid, wherein the physiological level of the amino acid varies with patient age.
  • the terms “significantly reduced blood plasma level of proline” or “significantly reduced proline blood plasma level” refer to a proline blood plasma level in a patient that is at least 10% lower than a physiological proline level that depends on the age of the patient as shown in the following table:
  • the blood plasma level of proline is less than 67% of said physiological level of proline (i.e. , the proline blood plasma level is at least 33% lower than the physiological proline level). In some embodiments, the blood plasma level of proline is less than 33% of said physiological level of proline (i.e., the proline blood plasma level is at least 67% lower than the physiological proline level).
  • the proline blood plasma level is at least 10%, at least 15%, at least 20%, at least 30%, 33%, at least 40%, at least 50%, at least 60%, at least 67%, at least 70%, or at least 80% lower than the physiological proline level.
  • the patient is characterized by a significantly reduced proline blood plasma level that is at least 20% lower than the physiological proline level.
  • the patient is characterized by a significantly reduced proline blood plasma level that is at least 33% lower than the physiological proline level.
  • the patient is characterized by a significantly reduced proline blood plasma level that is at least 67% lower than the physiological proline level.
  • the terms “significantly reduced blood plasma level of arginine” or “significantly reduced arginine blood plasma level” refer to an arginine blood plasma level in a patient that is at least 10% lower than a physiological arginine level that depends on the age of the patient as shown in the following table:
  • the blood plasma level of arginine is less than 67% of said physiological level of arginine (i.e. , the arginine blood plasma level is at least 33% lower than the physiological arginine level). In some embodiments, the blood plasma level of arginine is less than 33% of said physiological level of arginine (i.e., the proline arginine plasma level is at least 67% lower than the physiological arginine level).
  • the arginine blood plasma level is at least 10%, at least 15%, at least 20%, at least 30%, 33%, at least 40%, at least 50%, at least 60%, at least 67%, at least 70%, or at least 80% lower than the physiological arginine level.
  • the patient is characterized by a significantly reduced arginine blood plasma level that is at least 20% lower than the physiological arginine level. In some embodiments, the patient is characterized by a significantly reduced arginine blood plasma level that is at least 33% lower than the physiological arginine level. In some embodiments, the patient is characterized by a significantly reduced arginine blood plasma level that is at least 67% lower than the physiological arginine level.
  • the plasma level of arginine is less than 80% of said physiological level of arginine (i.e., the arginine blood plasma level is at least 20% lower than the physiological arginine level) and the blood plasma level of proline is less than 50% of said physiological level of proline (i.e., the proline blood plasma level is at least 50% lower than the physiological proline level).
  • the plasma level of arginine is less than 67% of said physiological level of arginine (i.e., the arginine blood plasma level is at least 33% lower than the physiological arginine level) and the blood plasma level of proline is less than 33% of said physiological level of proline (i.e., the proline blood plasma level is at least 67% lower than the physiological proline level).
  • said blood plasma level of proline and/or arginine is less than 90% of said physiological plasma level of proline and/or arginine.
  • a patient in the 10-year to 18- year age group would need to be below 172 pmol/L proline and below 97 pmol/L arginine to qualify for that below-90% plasma level group.
  • said blood plasma level of proline and/or arginine is less than 67% of said physiological plasma level of proline and/or arginine.
  • a patient in the above 18- year age group would need to be below 127 pmol/L proline and below 74 pmol/L arginine to qualify for that below-67% plasma level group.
  • said blood plasma level of proline and/or arginine is less than 33% of said physiological level of proline and/or arginine.
  • said blood plasma levels of proline and of arginine of the patient are less than the 10 th percentile of plasma levels of proline and of arginine, respectively, of a control population of healthy patients.
  • the patient has a plasma level of proline in an amount that is below a physiological plasma level of proline in a control group of healthy subjects of the same age group as the patient.
  • the patient has a plasma level at least 25% lower compared to the average plasma level of proline of a control of healthy subjects of the same age group as the patient.
  • the patient is in the lower 25%ile of his or her age group in relation to the proline plasma level.
  • the patient is in the lower 10%ile of his or her age group in relation to the proline plasma level.
  • the subject has a plasma level of arginine in an amount that is below a physiological plasma level of arginine in a control or healthy subject of the same age group as the subject.
  • the patient has a plasma level at least 25% lower compared to the average plasma level of arginine of a control of healthy subjects of the same age group as the patient.
  • the patient is in the lower 25%ile of his or her age group in relation to the arginine plasma level.
  • the patient is in the lower 10 % ile of his or her age group in relation to the arginine plasma level.
  • the patient is in the lower 25%ile of his or her age group in relation to both the proline and arginine plasma levels. In certain other embodiments, the patient is in the lower 10%ile of his or her age group in relation to both the proline and arginine plasma levels.
  • the physiological plasma level of proline, arginine, or both depends on the age of the human subject, and are used as defined above:
  • the invention provides a method of treating a condition in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a polyamine pathway inhibitor, wherein the subject is undergoing a dietary regimen that is designed to reduce a plasma level of proline, arginine, or both in the subject.
  • DFMO or its pharmaceutically acceptable salt can be administered at an effective dose or amount effective for treatment of a condition (e.g., a cancer), inhibiting a cell proliferative disorder, or increasing survival time.
  • a condition e.g., a cancer
  • the polyamine pathway inhibitor is an arginase inhibitor.
  • the polyamine pathway inhibitor is an ornithine decarboxylase inhibitor.
  • the ornithine decarboxylase inhibitor is selected from the group consisting of: caffeic acid phenethyl ester, caffeic acid methyl ester, phenethyl dimethyl caffeate, (2S)-(+)-amino-6-iodoacetamidohexanoic acid, phenylethyl 3-methylcaffeate, caffeic acid, N-(4'- pyridoxyl)-ornithine(BOC)-ome (POB), alicin, ODC-MPI-2, alpha-ethynyl ornithine, 6-heptyne-2,5- diamine, 2-methyl-6-heptyne diamine, ornithine decarboxylase antizyme (AZ), eflornithine hydrochloride; 1 ,4-diamino-2-butanone (DAB); chlorogenic acid; ferulic acid; DL-alpha- monofluor
  • the ornithine decarboxylase inhibitor is difluoromethylornithine (DFMO) or a pharmaceutically acceptable salt thereof (eflornithine; D,L-a-difluoromethylornithine).
  • DFMO difluoromethylornithine
  • eflornithine D,L-a-difluoromethylornithine
  • the DFMO is administered by oral administration.
  • DFMO is known to be safely administered orally in treatment of trypanosomiasis, at doses indicated above.
  • DFMO is administered by intravenous administration.
  • DFMO is known to be safely administered by i.v. infusion at the beginning of treatment in treatment of trypanosomiasis, as well as in treatment of oncological conditions.
  • the DFMO is administered by topical administration.
  • DMFO is safely administered in topical form for treatment of hirsutism.
  • the DFMO is administered at a dose of at least about 250 mg/m 2 , at least about 500 mg/m 2 , at least about 1000 mg/m 2 , or at least about 2000 mg/m 2 .
  • DFMO or a pharmaceutically acceptable salt thereof can be administered at a dose of at least about 250 mg/m 2 , at least about 500 mg/m 2 , at least about 1000 mg/m 2 , or at least about 2000 mg/m 2 .
  • DFMO is administered at a dose of from about 200 mg/m 2 to about 3000 mg/m 2 , from about 500 mg/m 2 to about 2500 mg/m 2 , from about 500 mg/m 2 to about 1000 mg/m 2 , from about 1000 mg/m 2 to about 2000 mg/m 2 , from about 1000 mg/m 2 to about 3000 mg/m 2 , or from about 2000 mg/m 2 to about 3000 mg/m 2 .
  • DFMO is administered at a dose of about 250 mg/m 2 , about 500 mg/m 2 , about 750 mg/m 2 , about 1000 mg/m 2 , about 1500 mg/m 2 , about 2000 mg/m 2 , about 2250 mg/m 2 , about 2500 mg/m 2 , about 2750 mg/m 2 , or about 3000 mg/m 2 .
  • the DFMO is administered at a dose of from about 200 mg/m 2 to about 3000 mg/m 2 , from about 500 mg/m 2 to about 2500 mg/m 2 , from about 500 mg/m 2 to about 1000 mg/m 2 , from about 1000 mg/m 2 to about 2000 mg/m 2 , from about 1000 mg/m 2 to about 3000 mg/m 2 , or from about 2000 mg/m 2 to about 3000 mg/m 2 .
  • DFMO or a pharmaceutically acceptable salt thereof can be administered at a dose of from about 200 mg/kg/day to about 1000 mg/kg/day.
  • the DFMO is administered at a dose of about 250 mg/m 2 , about 500 mg/m 2 , about 750 mg/m 2 , about 1000 mg/m 2 , about 1500 mg/m 2 , about 2000 mg/m 2 , about 2250 mg/m 2 , about 2500 mg/m 2 , about 2750 mg/m 2 , or about 3000 mg/m 2 .
  • the DFMO is administered at a dose from about 200 mg/kg/day to about 1000 mg/kg/day.
  • the DFMO is administered at a dose from 1 ,000 mg/m 2 /day to 9,000 mg/m 2 /day.
  • the DFMO is administered at a dose from 1 ,500 mg/m 2 /day to 6,000 mg/m 2 /day.
  • DFMO or a pharmaceutically acceptable salt thereof can be administered at suitable frequency effective for treatment of cancer), inhibiting a cell proliferative disorder, or increasing survival time. In some embodiments, DFMO or a pharmaceutically acceptable salt thereof can be administered daily. In some embodiments, DFMO or a pharmaceutically acceptable salt thereof can be administered once daily. In some embodiments, DFMO or a pharmaceutically acceptable salt thereof can be administered twice daily.
  • the DFMO is administered over a period of at least 100 days. In certain embodiments, the DFMO is administered over a period of at least 200 days. In certain embodiments, the DFMO is administered over a period of at least 300 days. In certain embodiments, the DFMO is administered over a period of at least 365 days. In certain embodiments, the DFMO is administered over a period of 100 days to 200 days. In certain embodiments, the DFMO is administered over a period of 100 days to 300 days.
  • the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of proline for the subject’s age group.
  • the “low physical activity” amount shall apply.
  • the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of arginine for the subject’s age group as specified above.
  • the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of each, proline and arginine, for the subject’s age group as specified above.
  • the dietary regimen provides an amount of proline, of arginine, or of proline and arginine leading to a plasma level of less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, less than 50%, less than 40%, or even less than 30% of a physiological plasma level of proline, arginine, or both, respectively.
  • physiological levels of proline and arginine depend on the age of the human subject.
  • physiological level of proline (Pro) and/or arginine (Arg), respectively, is defined as being within the following ranges (all values in pmol/L):
  • the arithmetic middle is used between the upper and lower value of the respective range.
  • the dietary regimen administered in combination with the polyamine pathway inhibitor does not comprise proline. In some embodiments, the dietary regimen administered in combination with the polyamine pathway inhibitor does not comprise arginine. In some embodiments, the dietary regimen administered in combination with the polyamine pathway inhibitor does not comprise proline nor arginine.
  • the dietary regimen administered in combination with DMFO does not comprise proline. In some embodiments, the dietary regimen administered in combination with DMFO does not comprise arginine. In some embodiments, the dietary regimen administered in combination with DMFO does not comprise proline nor arginine.
  • the dietary regimen is further restricted in one or more additional amino acids selected from the group consisting of: serine, glycine, cystine, cysteine, tyrosine, glutamine, glutamate, ornithine, and citrulline.
  • DMFO is administered together with a dietary product having an amino acid composition designed to lead to a reduction of a plasma level of proline, arginine, or both in the patient.
  • the method further comprises administering to the subject a therapeutically effective amount of a dietary product designed to reduce a plasma level of proline, arginine, or both in the subject.
  • the dietary product is designed to lead to a reduction of the plasma level of proline, arginine, or both in the subject to less than 90%, less than 67%, or even less than 33% of a physiological plasma level of proline, arginine, or both.
  • the dietary product is designed to lead to a reduction of the plasma level of proline, arginine, or both in the subject to less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, less than 50%, less than 40%, or even less than 30% of a physiological plasma level of proline, arginine, or both.
  • proline and arginine depend on the age of the human subject and are used as tabularized above.
  • the dietary product comprises a restricted amount of proline, arginine, or both.
  • the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of recommended average dietary intake of proline, arginine, or both in a control or healthy subject of the same age group as the subject.
  • the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of an average recommended dietary intake of proline, arginine, or both for the subject’s age group.
  • the dietary product does not comprise proline.
  • the dietary product does not comprise arginine.
  • the dietary product does not comprise proline and arginine.
  • the condition is a cancer.
  • the cancer is a MYC-amplified cancer.
  • the cancer is a MYC-L-amplified cancer.
  • the cancer is a MYC-N-amplified cancer.
  • the cancer is characterized by overexpression of a MYC-family oncogene.
  • the MYC-family oncogene is MYC, MYC-L, or MYC-N.
  • the cancer is a pediatric cancer, i.e. a cancer in a human patient younger than 18 years, particularly younger than 15 years, more particularly younger than 14 years.
  • the cancer is a solid tumour.
  • the cancer is a non-solid tumour or liquid tumour.
  • the cancer is a brain cancer.
  • the cancer is a neuroblastoma.
  • the cancer is a medulloblastoma.
  • the cancer is a leukemia.
  • the cancer is a lymphoma.
  • the cancer is a prostate cancer.
  • the cancer is a colorectal cancer.
  • the cancer is a cervical cancer.
  • the cancer is a skin cancer. In some embodiments, the cancer is a melanoma.
  • the cancer is a bladder cancer.
  • the cancer is a gastric cancer.
  • the method further comprises administering to the subject a therapeutically effective amount of an agent that reduces a plasma level of proline and/or arginine in the subject.
  • the agent is a proline biosynthetic pathway inhibitor.
  • the agent is an arginine biosynthetic pathway inhibitor.
  • the agent is a proline degrading enzyme.
  • the agent is an arginine degrading enzyme.
  • the agent is a proline uptake inhibitor.
  • the agent is an arginine uptake inhibitor.
  • the subject has a plasma level of proline in an amount that is below a physiological plasma level of proline in a control or healthy subject of the same age group as the subject.
  • DFMO is provided for use according to any one of the preceding items, administered in combination with a pharmaceutical drug capable of lowering plasma levels of arginine.
  • the pharmaceutical drug capable of lowering plasma levels of arginine is a recombinant arginase.
  • the recombinant arginase is pegylated recombinant human arginase.
  • BT-100 or BT-200 are used (see US2014363417A1 , US2015315561A1 ).
  • physiological plasma level of proline, arginine, or both depends on the age of the human subject, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
  • the method according to the invention further comprises administering to the subject a therapeutically effective amount of a chemotherapeutic agent.
  • the method according to the invention further comprises administering to the subject a therapeutically effective amount of a radiotherapy.
  • the method according to the invention further comprises administering to the subject a therapeutically effective amount of an immunotherapy.
  • the method results in a synergistic survival effect in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
  • the method results in at least a 2-fold in survival probability in the subject compared with a control subject administered either the polyamine pathway inhibitor alone or the dietary regimen alone.
  • the method results in a synergistic reduction in tumour growth in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
  • the method results in at least a 2-fold reduction in tumour growth in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
  • a pharmaceutical composition comprising in a unit dosage form: a dietary product comprising a plurality of amino acids, wherein the dietary product is designed to reduce a plasma level of proline, arginine, or both in the subject; a polyamine pathway inhibitor; and a pharmaceutically acceptable excipient.
  • the dietary product is designed to reduce the plasma level of proline, arginine, or both in the patient to less than 90%, less than 67%, or even less than 33% of a physiological plasma level of proline, arginine, or both.
  • physiological levels of proline and arginine depend on the age of the human subject.
  • physiological level of proline (Pro) and/or arginine (Arg), respectively, is defined as being within the following ranges (all values in pmol/L):
  • the dietary product comprises essential amino acids phenylalanine, lysine, leucine, isoleucine, threonine, valine, tryptophan, methionine, and histidine.
  • the dietary product comprises a restricted amount of proline, arginine, or both.
  • the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a normal average dietary intake of proline, arginine, or both in a control or healthy subject of the same age group as the subject.
  • the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of an average recommended dietary intake of proline, arginine, or both for the subject’s age group.
  • the dietary product does not comprise proline.
  • the dietary product does not comprise arginine.
  • the dietary product does not comprise proline and arginine.
  • the polyamine pathway inhibitor is an ornithine decarboxylase inhibitor.
  • the ornithine decarboxylase inhibitor is difluoromethylornithine (DFMO; D,L-a-difluoromethylornithine, eflornith ine)) or a pharmaceutically acceptable salt thereof.
  • DFMO difluoromethylornithine
  • the DFMO is D,L-a-difluoromethylornithine.
  • the DFMO is eflornithine.
  • the DFMO is administered by oral administration.
  • the DFMO is administered by intravenous administration.
  • the DFMO is administered by topical administration.
  • the DFMO is administered at a dose of at least about 250 mg/m 2 , at least about 500 mg/m 2 , at least about 1000 mg/m 2 , or at least about 2000 mg/m 2 .
  • the DFMO is administered at a dose of from about 200 mg/m 2 to about 3000 mg/m 2 , from about 500 mg/m 2 to about 2500 mg/m 2 , from about 500 mg/m 2 to about 1000 mg/m 2 , from about 1000 mg/m 2 to about 2000 mg/m 2 , from about 1000 mg/m 2 to about 3000 mg/m 2 , or from about 2000 mg/m 2 to about 3000 mg/m 2 .
  • the DFMO is administered at a dose of about 250 mg/m 2 , about 500 mg/m 2 , about 750 mg/m 2 , about 1000 mg/m 2 , about 1500 mg/m 2 , about 2000 mg/m 2 , about 2250 mg/m 2 , about 2500 mg/m 2 , about 2750 mg/m 2 , or about 3000 mg/m 2 .
  • the DFMO is administered at a dose of from about 200 mg/kg/day to about 1000 mg/kg/day.
  • the DFMO is administered daily. In some embodiments, the DFMO is administered once daily.
  • the DFMO is administered twice daily.
  • the ornithine decarboxylase inhibitor is selected from the group consisting of: caffeic acid phenethyl ester, caffeic acid methyl ester, phenethyl dimethyl caffeate, (2S)-(+)- amino-6-iodoacetamidohexanoic acid, phenylethyl 3-methylcaffeate, caffeic acid, N-(4'-pyridoxyl)- ornithine(BOC)-ome (POB), allicin, ODC-MPI-2, alpha-ethynyl ornithine, 6-heptyne-2,5-diamine, 2-methyl-6-heptyne diamine, ornithine decarboxylase antizyme (AZ), eflornithine hydrochloride;
  • DAB 1 ,4-diamino-2-butanone
  • chlorogenic acid ferulic acid
  • ferulic acid DL-alpha- monofluoromethyldehydroornithine methyl ester
  • 3-amino-oxy-l-propanamine 3-amino-oxy-l-propanamine
  • a-methyl ornithine 1 ,4-diamino-2-butanone (DAB); chlorogenic acid; ferulic acid; DL-alpha- monofluoromethyldehydroornithine methyl ester; 3-amino-oxy-l-propanamine; and a-methyl ornithine.
  • the polyamine pathway inhibitor is an arginase inhibitor.
  • the invention further encompasses the following items of the invention:
  • DFMO Difluormethylornithin, or a pharmaceutically acceptable salt thereof, for use in treatment or prevention of recurrence of cancer, wherein the DFMO is administered to a patient characterized by a significantly reduced blood plasma level of proline and/or arginine, in comparison to a physiological level of proline and/or arginine, wherein the physiological level of proline and/or arginine depends on the age of the patient, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
  • DFMO Difluormethylornithin
  • the DFMO is administered to a patient characterized by a significantly reduced proline blood plasma level and a significantly reduced arginine blood plasma level
  • the significantly reduced proline blood plasma level is less than 67% of a physiological proline level (/.e., the proline blood plasma level is reduced by 33% or more)
  • the significantly reduced arginine blood plasma level is less than 80% of a physiological arginine level (/.e., the arginine blood plasma level is reduced by 20% or more)
  • the physiological proline level and the physiological arginine level depend on the age of the patient and are defined as being (all values in pmol/L):
  • DMFO for use according to item 1 , wherein said blood plasma level of proline and/or arginine is less than 67% of said physiological level of proline and/or arginine.
  • DMFO for use according to item 1 , wherein said blood plasma level of proline and/or arginine is less than 33% of said physiological level of proline and/or arginine.
  • DFMO for use according to any one of items 1 to 3, wherein the patient is characterized by a significantly reduced blood plasma level of proline, particularly wherein the reduced blood plasma level of proline is less than 67% of the physiological proline level.
  • DFMO for use according to any one of items 1 to 4, wherein the patient is characterized by a significantly reduced blood plasma level of arginine, particularly wherein the reduced blood plasma level of arginine is less than 80% of the physiological proline level.
  • DFMO Difluormethyl ornithin
  • a pharmaceutically acceptable salt thereof for use in treatment or prevention of recurrence of cancer, wherein the DFMO is administered to a patient undergoing or scheduled to undergo a treatment aimed at lowering the plasma level of proline and/or arginine.
  • DMFO for use according to item 6, wherein the treatment is aimed at lowering the plasma levels of proline and of arginine.
  • DFMO for use according to any one of the preceding items, wherein DFMO is administered at a daily dose ranging from 500 mg/m 2 to 9000 mg/m 2 , particularly from 1000 mg/m 2 to 5000 mg/m 2 , more particularly from 2000 mg/m 2 to 4000 mg/m 2 .
  • DFMO for use according to any one of the preceding items, wherein DFMO is administered in combination with a pharmaceutical drug capable of lowering plasma levels of proline.
  • DFMO for use according to any one of the preceding items, wherein said cancer is characterized by overexpression of a MYC-family oncogene.
  • DMFO for use according to item 10, wherein the cancer is characterized by overexpression of c-myc.
  • DMFO for use according to item 10, wherein the cancer is characterized by overexpression of l-myc.
  • DMFO for use according to item 10, wherein the cancer is characterized by overexpression of n-myc.
  • DFMO for use according to any one of the preceding items, wherein said cancer is a solid tumour.
  • DMFO for use according to item 14, wherein said solid tumour is a tumour of the brain or a cancer of the peripheral nervous system, more particularly wherein said tumour of the brain is selected from the group of neuroblastoma, glioblastoma or medulloblastoma.
  • DFMO for use according to item 14, wherein said cancer is breast cancer.
  • DFMO for use according to item 14, wherein said cancer is ovarian cancer.
  • DFMO for use according to item 14, wherein said cancer is esophageal cancer.
  • DFMO for use according to item 14, wherein said cancer is lung cancer.
  • DFMO for use according to any one of items 1 to 14, wherein said cancer is leukemia.
  • DFMO for use according to any one of items 1 to 14, wherein said cancer is lymphoma.
  • DFMO for use according to any one of items 1 to 14, wherein said cancer is MYC-rearranged or MYC amplified cancer.
  • DFMO for use according to item 22, wherein said cancer is selected from the group consisting of MYC-rearranged lymphoma; MYC amplified breast cancer; MYC amplified ovarian cancer; MYC amplified esophageal cancer; MYC amplified lung cancer, MYC- rearranged or hyperactivated leukaemia.
  • DFMO for use according to any one of the preceding items, wherein the DFMO is administered over a period of 100 days or more, particularly wherein the DFMO is administered over a period of 200 days or more.
  • DFMO for use according to any one of the preceding items, wherein the DFMO is administered without administration of a second agent selected from the group consisting of a chemotherapeutic agent and a non-steroidal anti-inflammatory agent immediately prior to, concomitant with or immediately subsequent to administration of DFMO.
  • a second agent selected from the group consisting of a chemotherapeutic agent and a non-steroidal anti-inflammatory agent immediately prior to, concomitant with or immediately subsequent to administration of DFMO.
  • a pharmaceutical composition in unit dosage form comprising, particularly consisting of:
  • DFMO a mixture of amino acids comprising eighteen amino acids selected from the proteinogenic amino acids, except proline and arginine; and optionally, a pharmaceutically acceptable excipient.
  • a method of treating a condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a polyamine pathway inhibitor, wherein the subject is undergoing a dietary regimen that is designed to reduce a plasma level of proline, arginine, or both in the subject.
  • polyamine pathway inhibitor is an ornithine decarboxylase inhibitor.
  • DFMO is administered at a dose of from about 200 mg/m 2 to about 3000 mg/m 2 , from about 500 mg/m 2 to about 2500 mg/m2, from about 500 mg/m 2 to about 1000 mg/m 2 , from about 1000 mg/m 2 to about 2000 mg/m 2 , from about 1000 mg/m 2 to about 3000 mg/m 2 , or from about 2000 mg/m 2 to about 3000 mg/m 2 .
  • the ornithine decarboxylase inhibitor is selected from the group consisting of: caffeic acid phenethyl ester, caffeic acid methyl ester, phenethyl dimethyl caffeate, (2S)-(+)-amino-6-iodoacetamidohexanoic acid, phenylethyl 3- methylcaffeate, caffeic acid, N-(4'-pyridoxyl)-ornithine(BOC)-ome (POB), alicin, ODC-MPI-2, alpha-ethynyl ornithine, 6-heptyne-2,5-diamine, 2-methyl-6-heptyne diamine, ornithine decarboxylase antizyme (AZ), eflornithine hydrochloride; 1 ,4-diamino-2-butanone (DAB); chlorogenic acid; ferulic acid; DL-alpha
  • the dietary product reduces the plasma level of proline, arginine, or both in the subject to less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, less than 50%, less than 40%, or even less than 30% of a physiological plasma level of proline, arginine, or both, wherein the physiological level of proline and/or arginine depends on the age of the subject, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
  • the dietary product comprises one or more essential amino acids selected from the group consisting of: phenylalanine, lysine, leucine, isoleucine, threonine, valine, tryptophan, methionine, and histidine.
  • the dietary product comprises a restricted amount of proline, arginine, or both.
  • the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a normal average dietary intake of proline, arginine, or both in a control or healthy subject of the same age group as the subject.
  • the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of an average recommended dietary requirement of proline, arginine, or both for the subject’s age group.
  • the method of embodiment 31 wherein the average recommended dietary requirement is given in the following table: 33.
  • a pharmaceutical composition comprising in a unit dosage form: a) a dietary product comprising a plurality of amino acids, wherein the dietary product is designed to reduce a plasma level of proline, arginine, or both in the subject; b) a polyamine pathway inhibitor; and c) a pharmaceutically acceptable excipient.
  • composition of embodiment 74 or 75, wherein the dietary product comprises essential amino acids phenylalanine, lysine, leucine, isoleucine, threonine, valine, tryptophan, methionine, and histidine.
  • the pharmaceutical composition of embodiment 77, wherein the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of an average recommended dietary intake of proline, arginine, or both for the subject’s age group.
  • the pharmaceutical composition of embodiment 77, wherein the average recommended dietary requirement is given in the following table:
  • ornithine decarboxylase inhibitor is selected from the group consisting of: caffeic acid phenethyl ester, caffeic acid methyl ester, phenethyl dimethyl caffeate, (2S)-(+)-amino-6-iodoacetamidohexanoic acid, phenylethyl 3-methylcaffeate, caffeic acid, N-(4'-pyridoxyl)-ornithine(BOC)-ome (POB), allicin, ODC-MPI-2, alpha-ethynyl ornithine, 6-heptyne-2,5-diamine, 2-methyl-6-heptyne diamine, ornithine decarboxylase antizyme (AZ), eflornithine hydrochloride; 1 ,4-diamino-2- butanone (DAB); chlorogenic acid; ferulic acid; DL
  • the compound according to the invention is provided as a pharmaceutical composition, pharmaceutical administration form, or pharmaceutical dosage form, said pharmaceutical composition, pharmaceutical administration form, or pharmaceutical dosage form comprising at least one of the compounds of the present invention or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier, diluent or excipient.
  • any specifically mentioned drug compound mentioned herein, particularly DFMO may be present as a pharmaceutically acceptable salt of said drug.
  • pharmaceutically acceptable anionic salt forms include acetate, benzoate, besylate, bitatrate, bromide, carbonate, chloride, citrate, edetate, edisylate, embonate, estolate, fumarate, gluceptate, gluconate, hydrobromide, hydrochloride, iodide, lactate, lactobionate, malate, maleate, mandelate, mesylate, methyl bromide, methyl sulfate, mucate, napsylate, nitrate, pamoate, phosphate, diphosphate, salicylate, disalicylate, stearate, succinate, sulfate, tartrate, tosylate, triethiodide and valerate.
  • the compound of the present invention is typically formulated into pharmaceutical dosage forms to provide an easily controllable dosage of the drug and to give the patient an elegant and easily handleable product.
  • compositions of the present invention relate to a dosage form for enteral administration, such as nasal, buccal, rectal, transdermal or oral administration, or as an inhalation form or suppository.
  • pharmaceutical compositions of the present invention can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions).
  • Certain embodiments of the invention relate to a dosage form for parenteral administration, such as subcutaneous, intravenous, intrahepatic or intramuscular injection forms.
  • a pharmaceutically acceptable carrier and/or excipient may be present.
  • Certain embodiments of the invention relate to a dosage form for topical administration.
  • the skilled artisan is aware of a broad range of possible recipes for providing topical formulations, as exemplified by the content of Benson and Watkinson (Eds.), Topical and Transdermal Drug Delivery: Principles and Practice (1st Edition, Wiley 2011 , ISBN-13: 978-0470450291 ); and Guy and Handcraft: Transdermal Drug Delivery Systems: Revised and Expanded (2 nd Ed., CRC Press 2002, ISBN-13: 978-0824708610); Osborne and Amann (Eds.): Topical Drug Delivery Formulations (1 st Ed. CRC Press 1989; ISBN-13: 978-0824781835).
  • the pharmaceutical composition is formulated in a way that is suitable for topical administration such as aqueous solutions, suspensions, ointments, creams, gels or sprayable formulations, e.g., for delivery by aerosol or the like, comprising the active ingredient together with one or more of solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives that are known to those skilled in the art.
  • the invention further encompasses, as an additional aspect, the use of a polyamine pathway inhibitor, particularly DMFO, or its pharmaceutically acceptable salt, as specified in detail above, for use in a method of manufacture of a medicament for the treatment or prevention of cancer, wherein the medicament is to be administered to a patient undergoing a dietary regimen and/or drug treatment that is designed to reduce a plasma level of proline, arginine, or both.
  • a polyamine pathway inhibitor particularly DMFO, or its pharmaceutically acceptable salt
  • Figure 1 High proline, not glutamine or arginine, characterizes the arqinine-proline-qlutamine axis in MYCN-dmen neuroblastoma tumors.
  • Proline is the most significantly increased metabolite in MYCN amplified primary human neuroblastoma, relative to non-amplified tumors. Dotted line marks significance threshold, with p-values corrected for false discovery rate of 5%, *q ⁇ 0.05. n - 10 tumors in each group.
  • F Schematic of gene expression levels of enzymes across the arginine-proline-glutamine axis, with the color of each gene label indicating relative expression (MYCN amplified/non-amplified) based on patient data from (Kocak H et al., Cell Death Dis. 2013 Apr 11 ;4(4):e586.
  • MYCN amplified n 93, MYCN nonamplified n - 551 .
  • FIG. 2 Tumor proline in MYCN amplified neuroblastoma is predominantly derived from circulation.
  • Figure 3 Combination of dietary proline and arginine depletion with DFMQ treatment abrogates tumor growth in MYCN amplified neuroblastoma.
  • B Kaplan-Meier plot of overall survival, with censored mice at time of stopping treatment.
  • the intervention arms are control diet (CD), treatment with DFMO (CD DFMO), proline and arginine dropout diet (ProArg), and combination of proline and arginine dropout diet and treatment with DFMO (ProArg DFMO) in TH-MYCN GEMM.
  • Hash-marks identify mice censored at the end of therapy (with outcomes described in the text).
  • C) Tumor growth defined as tumor weight at death normalized by day of life (weight in milligrams divided by days). Two-tailed t-test compared to CD: *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 , ****P ⁇ 0.0001. Mean ⁇ s.e.m., n 13-14 per group. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
  • Figure 4 Dietary intervention alters circulating and intratumoral arginine-proline-glutamine axis metabolites to enhance DFMO treatment effect.
  • A-C Differential serum metabolite levels comparing the respective treatment groups (DFMO, ProArg and ProArg DFMO) to control diet (CD). Blue highlights metabolites that are significantly (FDR ⁇ 0.05) down and shades of red up regulated in the treatment group.
  • D Schematic of arginine-proline-glutamine axis connection to polyamine metabolism.
  • E-F *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 , ****P ⁇ 0.0001 , two-tailed t-test.
  • CD control diet
  • ProArg proline arginine deficient diet
  • DFMO difluoromethylornithine.
  • FIG. 5 Ribo-Seg reveals defective decoding of adenosine-ending codons upon polyamine depletion.
  • NC negative control
  • PC positive control
  • D) Polyproline tract decoding is particularly affected by combining DFMO with proline and arginine dropout diet. Normalized ribosome depth encoding for positions with >- 3 prolines in a row. Mean, n - 5 mice.
  • data in B-F are from TH-MYCN GEMM mouse model.
  • In vivo treatment with DFMO is 1 % in the drinking water.
  • C-F shows mean, n - 4-5 mice.
  • FIG. 6 Targeting metabolic dependencies of translation preferentially impairs cell cycle proteins.
  • Four top- down regulated proteins have been identified in both comparisons and the distribution of fold change on the right side of the two plots.
  • Relative ribosome pausing sum across Cenpr reveals a dysfunction in decoding adenosine ending codons.
  • the relative ribosome occupancy ratios between ProArg DFMO and CD are summed according to nucleotide identity at the codon ending position.
  • CD control diet
  • ProArg proline arginine deficient diet
  • DFMO difluoromethylornithine.
  • Figure 7 Targeting translation disrupts core oncogenic programs and induces neuroblast differentiation.
  • A) Hallmark gene set enrichment across omics layers identifies biological processes predominantly affected on the ribosome and protein level. Only in the combined ProArg DFMO intervention this significant effect is evident, as compared to the DFMO monotherapy or ProArg depletion only. Displayed are the five top enriched hallmarks with the extended list in Figure 16G. Size of the dot denotes significance of enrichment and color gives the normalized enrichment score. Red enriched in the respective intervention group and, and blue higher in the CD arm.
  • CD and ProArg tumors show undifferentiated primitive neuroblasts with nested architecture, absent neuropil, and prominent mitotic and karyorrhectic figures.
  • CD DFMO-treated tumors show poorly differentiated primitive neuroblasts with scant neuropil (arrowhead) and foci of cytodifferentiation (arrow) ( ⁇ 5% of overall cellularity).
  • E2F is downregulated in combination with G2M checkpoint, overall downregulation of cell cycle genes due to translation of inhibition of specific genes, leading to overall cellular division arrest, and enabling immature cancer cells to differentiate into neurons.
  • CD control diet
  • ProArg proline arginine deficient diet
  • DFMO difluoromethylornithine
  • SE super-enhancer.
  • Figure 8 Metabolomic profiling of MYCN amplified primary patient tumors and xenografts reveals reprogramming of the arginine-proline-glutamine axis.
  • Figure 9 Metabolomic profiling of the TH-MYCN genetically engineered neuroblastoma model by liquid chromatography-mass spectrometry and neuroblastoma patient tumor gene expression.
  • Arginine-proline-glutamine axis gene expression displayed from non-amplified to MYCN amplified tumors (left to right).
  • G Differential gene expression between MYCN amplified I nonamplified primary human neuroblastoma tumor, with arginine-proline-glutamine axis metabolism related genes denoted in red, MYCN in black and all other genes in grey. All gene expression graphs (D-G) are generated using data from neuroblastoma tumors taken from (Kocak et al., 2019 ibid).
  • Figure 10 Direct contribution of related metabolites and turnover flux in the TH-MYCN neuroblastoma model.
  • A) Direct circulating nutrient contributions to metabolites of the arginine- proline-glutamine axis in the respective tissue. Contributions derived from [U- 13 C]-labelled tracer infusions as given in the legend, complementing Figure 2C. Mean ⁇ s.e.m., tumor, pancreas, brain, serum n - 4-9; liver, muscle, kidney n - 3-7; small int. , spleen n - 1-3.
  • Figure 11 Proline and arginine nutrient depletion combined with DFMQ treatment abrogates tumor growth in MYCN amplified neuroblastoma.
  • Figure 12 Metabolite profiles of serum and tumor under dietary proline and arginine nutrient depletion and/or difluoromethylornithine (DFMO) treatment, with focus on urea cycle, nucleotides and arginine/proline related metabolites.
  • C Tumor levels of arginine, proline, glutamine and ornithine, compared to CD.
  • A-E metabolomics was performed on advanced stage tumors (> 7 weeks for DFMO and/or ProArg DFMO).
  • B-E: *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 , ****p ⁇ 0.0001 , two-tailed t-test. Mean ⁇ s.e.m., n 5-6 mice. Technical replicates are averaged for each mouse.
  • Figure 13 Ribo-Seg Quality control.
  • Figure 14 Polyamine depletion causes codon specific translation defects.
  • First letter of name denotes amino acid followed by codon encoding.
  • D) Combined treatment specific effect induced pausing for codon with adenine at 3 rd position at all site. The three tRNA-binding sites on the ribosome are the denoted as follow: aminoacyl (A) site, the peptidyl (P) site, and the exit (E) site.
  • E) Diet effect (ProArg vs. CD) does not induce ribosome pausing at arginine and proline amino acid codons.
  • CD in the ribosome P site is characterized by only a discrete ribosome pausing at arginine and proline amino acid codons but rather depends on nucleotide identity at the codon ending position.
  • G) DFMO treatment effect (CD DFMO vs. CD) is characterized by ribosome pausing depending nucleotide at ending position in ribosome P site.
  • Figure 15 Proteomics quality control with evaluation of protein levels relation to proline content.
  • E Correlation between relative protein levels in combined treatment effect (ProArg DFMO vs. CD) to percentage of proline from all amino acids of each protein.
  • Poly-proline tract are defined by having at least 3 prolines in a row.
  • G Comparison of relative protein levels in combined treatment effect to length of poly-proline tract in protein.
  • H Comparison of relative protein levels in combined treatment effect to number of polyproline tracts in protein.
  • Figure 16 Targeting translation causes reprogramming of arqinine-proline-qlutamine axis and polyamine metabolism.
  • n 5-6.
  • Figure 17 Adenosine ending codon frequency correlates with translation defects.
  • Figure 18 Targeting metabolic dependencies of translation affects hallmarks of cellular regulation.
  • P-value (p-adj) displayed comparing ProArg DFMO to CD and corrected for multiple hypothesis testing using permutation across all measured proteins.
  • results contained in the present specification show that simultaneous induction of translation stress by defined amino acid depletion combined with inhibition of eif5a hypusination by the clinically approved drug difluromethyl-ornithine inhibits tumour growth.
  • expression of the transcription factor MYCN correlates to high proline levels.
  • In vivo stable isotope tracing identifies diet derived uptake of proline from the serum as the primary tumour source. Dietary depletion of the two non-essential amino acids proline and arginine, a polyamine biosynthesis precursor, impairs tumour growth.
  • Example 1 Primary tumors and models of MYCN-driven neuroblastoma show reprogrammed arqinine-proline-qlutamine axis.
  • TH-MYCN genetically engineered mouse model that enforces Mycn expression in peripheral sympathoadrenal cells under the tyrosine hydroxylase promoter.
  • Mice homozygous for the transgene develop tumors with 100% penetrance and early lethality.
  • Quantitatively comparing tumors to normal organs showed that glutamine, arginine and glutamate (Figure 8A) were present within the physiological range.
  • Proline in contrast, was strikingly elevated to more than eight-fold higher in tumors than the average of any organ surveyed and 30-fold above brain as a reference neural tissue ( Figure 1 E, Figure 9A).
  • Proline was also markedly higher in late tumors (> 50 mm 3 ) compared with early tumors ( Figure 9B).
  • Arginine and glutamine utilization were also upregulated, and ornithine amino transferase (OAT), the enzyme linking this metabolic axis, showed lower expression ( Figure 9E and Figure 9F).
  • OAT ornithine amino transferase
  • MYCN-d riven neuroblastomas increase tumor proline levels by substantial upregulation of biosynthetic flux into this non-essential amino acid.
  • Example 2 In vivo stable isotope tracing identifies external nutrient dependency in MYCN amplified neuroblastoma
  • intratumoral ornithine the direct polyamine precursor
  • Glutamine or proline through OAT did not contribute significantly ( ⁇ 5 %). This indicates that OAT, a core linker enzyme in the arginine-proline-glutamine axis, is not active in neuroblastoma under the given metabolic state.
  • Example 4 Depletion of dietary arginine and proline reduces circulatory tumor nutrient supply
  • Depletion of proline and arginine from the diet therefore targets the arginine-proline-glutamine axis by reducing intratumoral amino acid availability.
  • the dual amino acid depletion additionally decreases ornithine availability to potentiate the effect of DFMO leading to enhanced tumoral polyamine depletion and anti-tumor activity.
  • Example 5 Dietary amino acid depletion enhances the translation defects induced by DFMO
  • Eif5a has been canonically implicated in facilitating peptide bond formation involving repetitive instances of the amino acid proline, termed poly-proline tracts. Due to its reactive amine localized within a ring structure, proline is a poor peptidyl acceptor. We thus investigated by evaluating relative ribosome occupancy, whether the translation speed of poly-proline tracts was changed. In this context, high occupancy indicates slow decoding by ribosomes. Consistent with functional deficiency of Eif5a, increased occupancy was observed at poly-proline tracts within ProArg DFMO treated tumors ( Figure 5D, Figure 15A). Thus, further supporting lower spermidine levels under combined treatment impeding Eif5a function.
  • proline codons both within and independent of poly-proline tracts, showed occupancy changes that depended even more prominently on codon identity rather than the amino acid.
  • CCA showed the most notable pausing phenotype, with less pausing for CCC and no pausing for CCG or CCT ( Figure 4E). This indicated an additional unanticipated level of regulation at the individual codon, rather than the amino acid level.
  • Example 7 Combined targeting of translation affects cellular programs on the ribosome and protein level
  • Cenpr contains a remarkably shifted distribution in codon composition with 38.6 % of codons ending with adenosine, as opposed to 18.8% across all protein coding transcripts ( Figure 6G, Figure 17G and Figure 17J).
  • Figure 6G, Figure 17G and Figure 17J When evaluating relative ribosome distribution along the Cenpr coding sequence, more frequent ribosome pausing was highlighted at adenosine ending codons as compared to codons with non-adenosine nucleotides at the ending positions in ProArg DFMO compared to CD ( Figure 6H).
  • Example 8 Disruption of core oncogenic programs is accompanied by neuronal differentiation
  • a special feature of pediatric cancers is their arrest in an undifferentiated state. Inducing differentiation with drugs, such as retinoic acid in neuroblastoma, is a central treatment element. Given our finding of increased neuronal signatures, changes in cell cycle, and adrenergic core regulatory circuitry disruption, we hypothesized that the combined treatment induces neuronal differentiation. We therefore evaluated the tumor differentiation status on histology by H&E staining, according to clinical pathological criteria. This revealed a strong differentiation phenotype in ProArg DFMO treated tumors, as all CD and ProArg tumors had absent neuropil, a feature of neuronal differentiation, and were undifferentiated ( ⁇ 5% differentiated).
  • Such application identifies real-life tumor biosynthetic activity and nutrient uptake dependencies directly in the context of patient specific metabolism. It harbors the potential to guide therapy approaches involving nutrient depletion by means of dietary interventions or pharmacologic modalities to optimize combination therapies.
  • polyamines form specific and non-specific interactions to facilitate translation.
  • codon resolution translation profiles of polyamine depletion have not been reported earlier.
  • polyamines ionically associate to a variety of negatively charged macromolecules including mRNA, rRNA and tRNAs.
  • polyamines associate with the ribosomes in the several hundreds with their importance being mechanistically highlighted in in vitro translation systems, where they are an essential ingredient to allow translation independent of elF5A hypusination.
  • polyamines ensure ribosome function in this setting.
  • Table 1 Key resource table
  • Flash-frozen primary neuroblastoma tumor samples were provided by the Children’s Oncology Group (COG) under study number ANBL16B2-Q.
  • International Neuroblastoma Pathology Classification (INPC) histologic parameters Histology of poorly differentiated neuroblastoma, MYCN amplification status, age, and stage and pathologic classification for every patient was obtained centrally via COG testing and review. Tumor cell content of analyzed samples was confirmed as > 80% percent. Patient and tumor characteristics are given in Table 2. Water soluble metabolites were extracted and analyzed as described below.
  • xenografts cancer cell lines were grown in RPMI supplemented with 10% FBS and 0.01 % insulin/transferrin solution. Cell lines were provided by the Children’s Oncology Group Cell Culture Repository: LA-N-5, SMS-SAN, CHLA-90 and SK-N-SH. All cell lines repeatedly tested negative for Mycoplasma. Subcutaneous xenografts were established on 6-week old female CD1-nu mice by injection of 10Oul 50/50 RPMI/Matrigel solution containing 10 A 6 cells of the respective cell line.
  • the TH-MYCN mouse model was used as a primary model to investigate the functional changes of metabolism driven by MYCN.
  • 129x1/SvJ mice transgenic for the TH-MYCN construct were originally obtained from Bill Weiss (University of California, San Francisco).
  • TH-MYCN hemizygous mice were bred and litters randomized to assigned therapy. Mice were genotyped from tail-snip-isolated DNA using qPCR and only transgene homozygous mice (TH-MYCN+/+) were included in these studies.
  • MYCN expression is targeted to the murine neural crest under the tyrosine hydroxylase promoter recapitulating the lethal hallmark features of human neuroblastoma.
  • mice TH-MYCN mice were housed in groups and food was supplied without restriction to guarantee sufficient supply. Mice weights were recorded every day. During experiments mice were freely moving and tissues and serum was analysed following the above mentioned method. Tumor and inter organ cooperativity in proline biosynthesis as well as energy production was analysed on whole body level. The mice were on normal light cycle (7 AM - 7 PM). In vivo infusion was performed on 6-7-week old normal TH-MYCN mice pre-catheterized on the right jugular vein and 13 C metabolite tracers were infused for 2.5-5 h to achieve isotopic pseudo-steady state. The mouse infusion setup included a tether and swivel system, connecting to the button pre-implanted under the back skin of mice.
  • mice were fasted from 9:00 am to 2 pm and infused from 2pm till 4:30 pm. Tracers were dissolved in saline and infused via the catheter at a constant rate (0.1 pl/min/g mouse weight) using a Just infusion Syringe Pump. 100mM [U- 13 C]glutamine was dissolved and infused for 2.5 hours, 40mM [U- 13 C] arginine for 5 hours, 200mM [U- 13 C]glucose for 5 hours, 10mM [U- 13 C]proline for 5 hours and 5mM [U- 13 C]ornithine for 5 hours. At the end of infusion, mice were dissected and tissues were clamped in aluminum foil and stored in liquid nitrogen.
  • Arginine and Proline drop-out diet was purchased from TestDiet® Baker under the catalog number 1812426 (5CC7) for control diet and 1816284-203 (5WYF) for arginine I proline deficient diet.
  • the ODC-inhibitor, DFMO was obtained from Pat Woster (Medical University of South Carolina). DFMO was dissolved in drinking water and supplied to mice ad libitum at a dose of 1 % in the drinking water. Survival end-point. TH-MYCN+/+ mice were randomized to DFMO or no DFMO at birth, and diets changed to amino acid-based control diet or arginine I proline deficient diet at day 21 , per treatment assignment.
  • mice were weighed and assessed for tumor growth and symptoms, at least thrice weekly. Mice were euthanized for pre-defined humane endpoints related to overal health or tumor burden: hunching, immobility, gait disturbance, poor weight maintenance, discoloration or distress.
  • Tissues and tumors were collected from mice in fed state and immediately clamped into liquid nitrogen using Wollenberger clamp. All tissues were stored in -80°C. Frozen tissues were transferred into 2 ml Eppendorf tubes, which were precooled on dry ice, and pulverized by using Cyromill. The resulting tissue powder was weighed (around 10mg) and mixed well by vortexing in extraction buffer (40 pL extraction buffer per mg tissue). The extraction solution was neutralized with NH4HCO3 as above and centrifuged in a microfuge at maximum speed for 30 min at 4°C. Supernatant was transferred to LC-MS vials for analysis. Blood samples were drawn from mouse tail veins using a microvette and kept on ice.
  • Metabolomics was performed on the following systems.
  • a quadrupole-orbitrap mass spectrometer (Q Exactive, Thermo Fisher Scientific), operating in positive or negative mode was coupled to hydrophilic interaction chromatography (HILIC) via electrospray ionization. Scans were performed from m/z 70 to 1000 at 1 Hz and 140 000 resolution.
  • LC separation was on a XBridge BEH Amide column using a gradient of solvent A (20 mM ammonium acetate, 20 mM ammounium hydroxide in 95:5 wateracetonitrile, pH 9.45) and solvent B (acetonitrile). Flow rate was 150 mL/min.
  • the LC gradient was: 0 min, 85% B; 2 min, 85% B; 3 min, 80% B; 5 min, 80% B; 6 min, 75% B; 7 min, 75% B; 8 min, 70% B; 9 min, 70% B; 10 min, 50% B; 12 min, 50% B; 13 min, 25% B; 16 min, 25% B; 18 min, 0% B; 23 min, 0% B; 24 min, 85% B.
  • Autosampler temperature was 5°C, and injection volume was 5-10 uL.
  • the gradient is 0 min, 0% B; 2.5 min, 0% B; 5 min, 20% B; 7.5 min, 20% B; 13 min, 55% B; 15.5 min, 95% B; 18.5 min, 95% B; 19 min, 0% B; 25 min, 0% B.
  • Gene expression profiles of 649 neuroblastoma tumours were obtained from R2 (R2: Genomics Analysis and Visualization Platform (http://r2.amc.nl)).
  • Gene set enrichment analysis was performed using the implementation in R (https://github.com/GSEA- MSigDB/GSEA_R) and by comparing tumours MYCN amplification status (amplified/non-amplified) provided in the study.
  • GSEA was run on KEGG 64 metabolic pathway gene sets, which were downloaded from MSigDB (Liberzon, A. et al., Bioinformatics (Oxford, England) 27, 1739-1740 (2011 ).
  • RNA Total RNA were isolated from the same extracts, that were used to obtain RPF (bellow, RiboSeq). 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 pl of cell extracts, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit. RNA were sent to Genomic Platform (UNIGE) for stranded mRNA libraries preparation. Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 10 libraries in 1 pool.
  • Mouse tumors were mechanically disrupted in liquid nitrogen and homogenized in a lysis buffer (LB, 50 mM Tris, pH 7.4, 100 mM KCI, 1.5 mM MgCI2, 1.0% Triton X-100, 0.5% Na-Deoxycholate, 25 U/ml Turbo DNase I, 1 mM DTT, 100 pg/ml cycloheximide, and Protease inhibitors) 3 ml of LB per 1 g of tissue.
  • a lysis buffer LB, 50 mM Tris, pH 7.4, 100 mM KCI, 1.5 mM MgCI2, 1.0% Triton X-100, 0.5% Na-Deoxycholate, 25 U/ml Turbo DNase I, 1 mM DTT, 100 pg/ml cycloheximide, and Protease inhibitors
  • RPFs 25-34 nt were size-selected by electrophoresis using a 15% TBE-Urea polyacrylamide gel electrophoresis (PAGE) and two RNA markers, 25-mer (5’ AUGUACACGGAGUCGAGCACCCGCA 3’; SEQ ID NO: 2) and 34-mer (5’AUGUACACGGAGUCGAGCACCCGCAACGCGAAUG 3’; SEQ ID NO: 3).
  • the adapter Linker-1 (5' rAppCTGTAGGCACCATCAAT/3ddC/ 3'; SEQ ID NO: 4) was ligated to the 3' end of the RPF using T4 RNA Ligase 2. Ligated products were purified using 10% TBE-Urea PAGE. Ribosomal RNA was subtracted using RiboCop rRNA Depletion Kit V2 H/M/R.
  • the adapter Linker-1 was used for priming reverse transcription (RT) with the RT primer Ni-Ni-9 (5’AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC 5 CACTCA 5 TTC AGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG 3’; SEQ ID NO: 5) using ProtoScript® II Reverse Transcriptase. RT products were purified using 10% TBE-Urea PAGE. The cDNA was circularized with CircLigaseTM II ssDNA Ligase.
  • the final libraries were generated by PCR using forward index primer NI-N-2 (5’ AATGATACGGCGACCACCGAGATCTACAC 3’; SEQ ID NO: 6) and one of the reverse index primers. Amplified libraries were purified using 8% TBE-PAGE and analyzed by Qubit and TapeStation. Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 4 libraries in 1 pool.
  • the P-site position of each read was predicted by riboWaltz (Lauria F et al., PLoS Comput Biol. 2018 Aug 13;14(8):e1006169. doi: 10.1371/journal.pcbi.1006169) and confirmed by inspection. Counts were made by aggregating P-sites overlapping with the CDS and P-sites Per Kilobase Million (PPKMs) were then generated through normalizing by CDS length and total counts for the sample. Differential expression and translational efficiency analysis was performed using DESeq2 (Love Ml et al., Genome Biol. 2014;15(12):550. doi: 10.1186/s 13059-014-0550-8).
  • Crude protein extraction obtained as described above was electrophoresed through a slab isoelectric focusing gel (pH 3-7, Invitrogen Novex EC66452) employing freshly made cathode and anode buffers (Novex).
  • the gel was transferred to a PVDF membrane and transferred using the iBIot transfer unit prior to blocking in buffer according to manufacturer’s recommendations for iBind.
  • the iBind was then assembled with a probe against elF5a (BD Laboratories, 1 :3000) and incubated for at least 2.5 hours prior to development.
  • mice The number of mice in every experiment is recorded in each figure legend. Unless specified, P- values were computed using an unpaired two-sided Welch’s t-test using the Welch-Satterthwaite equation (not assuming equal variances).

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

In one aspect, the invention relates to the use of difluoromethylornithine (DFMO) in treatment of cancer. The drug is administered to a patient undergoing a dietary regimen and/or drug treatment that is designed to reduce a plasma level of proline, arginine, or both.

Description

Combination of Polyamine Pathway Inhibitor Drug and Proline/Arginine Diet Restriction
This application claims the right of priority of European patent applications EP22208452.7 filed 20. November 2022, EP22208608.4 filed 21.11.22, EP22208623.3 filed 21. November 2022, EP22208681.1 filed 21. November 2022, and EP23166882.3 filed 5 April 2023, all of which are incorporated herein by reference in their entirety.
Field
The present invention relates to methods for treatment, pharmaceutical compositions and applications that combine the pharmaceutical administration of polyamine pathway inhibitor drugs, particularly of alpha-difluoromethylornithine (DFMO), in combination with interventions that restrict the intake, or lead to a lowered plasma level, of arginine and/or proline, in cancer treatment.
Background
Genetic and epigenetic programs driving cancer growth by rewiring metabolism have been studied intensively. Despite deepened molecular understanding, clinical approaches targeting cancer metabolism have primarily focused on nucleotide biosynthesis. Integrating in vivo cancer metabolism phenotypes with untargeted analytical methods has recently allowed to enlarge the therapeutic space. This shift from in vitro to living models shifted the understanding from a cancer cell centric view to capturing the real-live complexity of metabolic environments in tumours. Ground breaking work at that intersection has revealed a dynamic metabolic crosstalk on the whole-body level in disease models and in humans. Likewise, the transcription factor MYC, a master regulator of metabolism and translation, has been studied in detail on the cellular level. The full in vivo functional metabolic phenotypes of MYC driven cancers implications for therapeutic vulnerabilities targeting cancer metabolism, however, have yet to be determined.
Amino acid side chain characteristics affect the kinetics of protein biosynthesis. Translation of proline imposes particular structural challenges due to its imide ring moiety. To resolve ribosome stalling and allow processive translation of polyproline tracts nature has evolved the translation elongation factor eif5a. Across all domains of life eif5a is the only protein being post translationally hypusinated, a polyamine derived modification critical for its function.
Eflornithin (DMFO, alpha-difluoromethylornithine), commercially available as Vaniqa, Ornidyl and other brands, is a drug used to treat African trypanosomiasis, and hirsutism. Several clinical trials have explored its use in treatment of cancer.
DMFO is dosed i.v. at 200 mg/kg every 12 hours for 7 days in treatment of trypanosomiasis (MSF eflornithine information) in combination, and in monotherapy 150 mg/kg every 6 hours for 14 days (children <12Y) or 100 mg/kg every 6 hours for 14 days (children >12Y and adults). Bassiri et al. (Transl Pediatr. 2015 Jul; 4(3): 226-238) report on the translational development of DFMO for the treatment of neuroblastoma; according to their publication, a lower dose of DFMO alone (2,000 mg/m2/day) can be used at the completion of standard therapy, or higher doses combined with chemotherapy (up to 9,000 mg/m2/day). LoGiudice et al. (Med Sci (Basel). 2018 Mar; 6(1 ): 12) report DFMO dosing in colon cancer prevention trials as typically around 500 mg/m2/day DFMO daily in tablet form over several years, and that higher oral doses were tested clinically for neuroblastoma treatment in children; 2000 mg/m2/day DMFO alone or up to 9000 mg/m2/day in combination therapies.
WO2021143579 relates adenoma risk reduction in patients receiving DFMO and sulindac to polyamine and arginine intake.
W02016130918 reports that DFMO may prevent relapse and increases overall survival in neuroblastoma patients.
Based on the above-mentioned state of the art, the objective of the present invention is to provide means and methods to treat cancer. This objective is attained by the subject-matter of the independent claims of the present specification, with further advantageous embodiments described in the dependent claims, items, embodiments, examples, figures and general description of this specification.
Summary of the Invention
In one aspect, the invention relates to the use of a polyamine pathway inhibitor drug, particularly of DFMO, in treatment of cancer, wherein the polyamine pathway inhibitor drug is administered to a patient undergoing a dietary regimen and/or drug treatment that is designed to reduce a plasma level of proline, arginine, or both. In an alternative of this aspect of the invention, a method of treating a condition in a subject in need thereof is provided, the method comprising administering to the subject a therapeutically effective amount of a polyamine pathway inhibitor, wherein the subject is undergoing a dietary regimen that is designed to reduce a plasma level of proline, arginine, or both in the subject.
In certain embodiments, the polyamine pathway inhibitor drug is difluoromethylornithine (DFMO).
Anotheraspect of the invention relates to a pharmaceutical composition comprising in a unit dosage form that comprises or consists of a) a dietary product comprising a plurality of amino acids, wherein the dietary product is designed to reduce a plasma level of proline, arginine, or both in the subject; b) a polyamine pathway inhibitor, particularly DFMO; and c) a pharmaceutically acceptable excipient.
In some aspects, provided herein is a method of treating a condition in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a dietary product designed to reduce a plasma level of proline and/or arginine in the subject. Non-limiting examples of conditions include a cancer, a pediatric cancer, a cancer characterized by overexpression of a MYC-family oncogene (e.g., MYC, MYC-L, or MYC-N), a MYC-amplified cancer, a MYC-N-amplified cancer, a solid tumour, a non-solid tumour, a liquid tumour, lymphoma, leukemia, a brain cancer, neuroblastoma, medulloblastoma, prostate cancer, colorectal cancer, cervical cancer, skin cancer (e.g., melanoma), bladder cancer, or gastric cancer.
In some aspects, methods provided herein further comprise administering one or more chemotherapeutic agents. Non-limiting examples of chemotherapeutic agents include: sulindac, temozolomide, irinotecan, dinutuximab, triamcinolone, bicalutamide, celecoxib, cyclophosphamide, topotecan, AMXT 1501 , etoposide, ceritinib, dasatinib, sorafenib, vorinostat, and bortezomib.
Terms and definitions
For purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with any document incorporated herein by reference, the definition set forth shall control.
The terms “comprising”, “having”, “containing”, and “including”, and other similar forms, and grammatical equivalents thereof, as used herein, are intended to be equivalent in meaning and to be open-ended in that an item or items following any one of these words is not meant to be an exhaustive listing of such item or items, or meant to be limited to only the listed item or items. For example, an article “comprising” components A, B, and C can consist of (i.e., contain only) components A, B, and C, or can contain not only components A, B, and C but also one or more other components. As such, it is intended and understood that “comprises” and similar forms thereof, and grammatical equivalents thereof, include disclosure of embodiments of “consisting essentially of or “consisting of.”
Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
Reference to “about” a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”
As used herein, including in the appended claims, the singular forms “a”, “or” and “the” include plural referents unless the context clearly dictates otherwise.
"And/or" where used herein is to be taken as specific recitation of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a phrase such as "A and/or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques and biochemistry, organic synthesis). Standard techniques are used for molecular, genetic, and biochemical methods (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed. (2012) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel et al., Short Protocols in Molecular Biology (2002) 5th Ed, John Wiley & Sons, Inc.) and chemical methods.
Any patent document cited herein shall be deemed incorporated by reference herein in its entirety.
Cancer Immunotherapy
In the context of the present specification, the term cancer immunotherapy, biological or immunomodulatory therapy is meant to encompass types of cancer treatment that help the immune system to fight cancer. Non-limiting examples of cancer immunotherapy include immune checkpoint inhibitors and agonists, T cell transfer therapy, cytokines and their recombinant derivatives, adjuvants, and vaccination with small molecules or cells.
In the context of the present specification, the term checkpoint inhibitory agent or checkpoint inhibitor antibody is meant to encompass a cancer immunotherapy agent, particularly an antibody (or antibody-like molecule) capable of disrupting an inhibitory signalling cascade that limits immune cell activation, known in the art as an immune checkpoint mechanism. In certain embodiments, the checkpoint inhibitory agent or checkpoint inhibitor antibody is an antibody to CTLA-4 (Uniprot P16410), PD-1 (Uniprot Q15116), PD-L1 (Uniprot Q9NZQ7), B7H3 (CD276; Uniprot Q5ZPR3), VISTA (Uniprot Q9H7M9), TIGIT (UniprotQ495A1 ), TIM-3 (HAVCR2, Uniprot Q8TDQ0), CD158 (killer cell immunoglobulin-like receptor family), TGF-beta (P01137).
In certain embodiments, the cancer immunotherapy agent is selected from the clinically available antibody drugs ipilimumab (Bristol-Myers Squibb; CAS No. 477202-00-9), nivolumab (Bristol-Myers Squibb; CAS No 946414-94-4), pembrolizumab (Merck Inc.; CAS No. 1374853-91-4), pidilizumab (CAS No. 1036730-42-3), atezolizumab (Roche AG; CAS No. 1380723-44-3), Avelumab (Merck KGaA; CAS No. 1537032-82-8), Durvalumab (Astra Zenaca, CAS No. 1428935-60-7), and Cemiplimab (Sanofi Aventis; CAS No.
1801342-60-8).
In the context of the present specification, the term checkpoint agonist agent or checkpoint agonist antibody is meant to encompass a cancer immunotherapy agent, particularly but not limited to an antibody (or antibody-like molecule) capable of enhancing an immune cell activation signalling cascade. The term checkpoint agonist agent further encompasses cytokines, recombinant immune stimulatory proteins, vaccines, adjuvants and agonist antibodies that promote immune activation. Non-limiting examples of cytokines known to stimulate immune cell activation include, IL-12, IL-2, IL-15, IL-21 and interferon-alpha. In certain embodiments, the checkpoint agonist agent or checkpoint agonist antibody is an antibody to CD122 (Uniprot P14784) and CD137 (4-1 BB; Uniprot Q07011 ), ICOS (Uniprot Q9Y6W8), 0X40 (GP34, Uniprot P43489), or CD40 (Uniprot P25942) .
In certain embodiments, the cancer immunotherapy is meant to encompass immune cell transfer cancer treatments wherein a patient’s immune cells are activated or expanded in vitro, and/or genetically modified, for example with the addition of a chimeric antigen receptor, before being infused back into the patient to inhibit neoplastic disease. Non-limiting examples of immune cell transfer therapy include chimeric antigen receptor T lymphocytes, and autologous activated T cells or dendritic cells.
In the context of the present specification, the term checkpoint inhibitory agent or checkpoint inhibitory antibody is meant to encompass an agent, particularly an antibody (or antibody-like molecule) capable of disrupting the signal cascade leading to T cell inhibition after T cell activation as part of what is known in the art the immune checkpoint mechanism. Non-limiting examples of a checkpoint inhibitory agent or checkpoint inhibitory antibody include antibodies to CTLA-4 (Uniprot P16410) such as exemplified by ipilimumab (Yervoy; CAS No. 477202-00-9), or antibodies to PD- 1 (Uniprot Q15116) or to PD-L1 (Uniprot Q9NZQ7), B7H3 (CD276; Uniprot Q5ZPR3), such as exemplified by the clinically available antibody drugs nivolumab (Bristol-Myers Squibb; CAS No 946414-94-4), pembrolizumab (Merck Inc.; CAS No. 1374853-91-4), pidilizumab (CAS No. 1036730-42-3), atezolizumab (Roche AG; CAS No. 1380723-44-3), and Avelumab (Merck KGaA; CAS No. 1537032-82-8).
As used herein, the term pharmaceutical composition refers to a compound of the invention, or a pharmaceutically acceptable salt thereof, together with at least one pharmaceutically acceptable carrier. In certain embodiments, the pharmaceutical composition according to the invention is provided in a form suitable for topical, parenteral or injectable administration.
As used herein, the term pharmaceutically acceptable carrier includes any solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (for example, antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington: the Science and Practice of Pharmacy, ISBN 0857110624).
The term cancer as used in the context of the present specification relates to malignant neoplastic disease; the terms “cancer” and “malignant neoplastic disease” are used synonymously herein. They specifically include carcinoma (epithelial derived cancer), sarcoma (connective tissue derived cancer), lymphoma and leukemia, germ-cell derived tumours and blastomas. Particular alternatives of any of the aspects and embodiments disclosed herein are directed at the use of the compounds and compositions of the invention in treatment of solid tumours. Other alternatives of any of the aspects and embodiments disclosed herein are directed at the use of the combinations of the invention in treatment of liquid cancers such as myelogenous or granulocytic leukemia, particularly AML, lymphatic, lymphocytic, or lymphoblastic leukemia and lymphoma, polycythemia vera or erythremia.
As used herein, the term treating or treatment of any disease or disorder (e.g. cancer) refers in one embodiment, to ameliorating the disease or disorder (e.g. slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In another embodiment "treating" or "treatment" refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient. In yet another embodiment, "treating" or "treatment" refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both. Methods for assessing treatment and/or prevention of disease are generally known in the art, unless specifically described hereinbelow.
The terms “difluoromethylornithine”, or ”DFMO”, where used herein, refer to a- difluoromethylornithine, or a pharmaceutically acceptable salt thereof. The drug is known as Eflornithin; CAS No 70052-12-9 or 96020-91-6 and commonly used as the hydrochloride, but use as disclosed herein of any other pharmaceutically acceptable salt form is to be deemed encompassed by the invention. 2,5-Diamino-2-(difluoromethyl)-pentanoic acid is commercialized as a racemate of the R and S form. The invention is not limited to the racemate but encompasses the pure enantiomers for use as indicated further herein.
Detailed Description of the Invention
Dietary supply and plasma target levels of proline and arginine
In a first aspect, the invention provides the use of a polyamine pathway inhibitor in in treatment or prevention of recurrence of cancer. In particular embodiments, the polyamine pathway inhibitor is difluormethylornithine, or a pharmaceutically acceptable salt thereof, (DFMO).
DFMO is administered to a patient characterized by a significantly reduced blood plasma level of proline and/or arginine, in comparison to a physiological level of proline and/or arginine. The physiological level of proline and/or arginine depends on the age of the patient. For the purpose of defining the invention, the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
W: week; M: month; Y: year. These reference values are adapted from: Blau, Duran, Gibson 2008. Laboratory Guide to the Methods in Biochemical Genetics. 2. Ed. Springer, Berlin, 74. Soldin et al., Pediatric Reference Ranges. 3. Edition. AACC Press, Washington DC, 11-20.
For calculation purposes, the arithmetic middle is used between the upper and lower value of the respective range:
(all values in pmol/L)
As used herein, the term “significantly reduced” with regard to the blood plasma level of an amino acid refers to the reduction of the blood plasma level of the amino acid below that of physiological level of the amino acid, wherein the physiological level of the amino acid varies with patient age.
As used herein, the terms “significantly reduced blood plasma level of proline” or "significantly reduced proline blood plasma level” refer to a proline blood plasma level in a patient that is at least 10% lower than a physiological proline level that depends on the age of the patient as shown in the following table:
(all values in pmol/L)
In some embodiments, the blood plasma level of proline is less than 67% of said physiological level of proline (i.e. , the proline blood plasma level is at least 33% lower than the physiological proline level). In some embodiments, the blood plasma level of proline is less than 33% of said physiological level of proline (i.e., the proline blood plasma level is at least 67% lower than the physiological proline level).
In some embodiment, the proline blood plasma level is at least 10%, at least 15%, at least 20%, at least 30%, 33%, at least 40%, at least 50%, at least 60%, at least 67%, at least 70%, or at least 80% lower than the physiological proline level.
For example, in some embodiments, the patient is characterized by a significantly reduced proline blood plasma level that is at least 20% lower than the physiological proline level. In some embodiments, the patient is characterized by a significantly reduced proline blood plasma level that is at least 33% lower than the physiological proline level. In some embodiments, the patient is characterized by a significantly reduced proline blood plasma level that is at least 67% lower than the physiological proline level. As used herein, the terms “significantly reduced blood plasma level of arginine” or "significantly reduced arginine blood plasma level” refer to an arginine blood plasma level in a patient that is at least 10% lower than a physiological arginine level that depends on the age of the patient as shown in the following table:
(all values in pmol/L)
In some embodiments, the blood plasma level of arginine is less than 67% of said physiological level of arginine (i.e. , the arginine blood plasma level is at least 33% lower than the physiological arginine level). In some embodiments, the blood plasma level of arginine is less than 33% of said physiological level of arginine (i.e., the proline arginine plasma level is at least 67% lower than the physiological arginine level).
In some embodiment, the arginine blood plasma level is at least 10%, at least 15%, at least 20%, at least 30%, 33%, at least 40%, at least 50%, at least 60%, at least 67%, at least 70%, or at least 80% lower than the physiological arginine level.
For example, in some embodiments, the patient is characterized by a significantly reduced arginine blood plasma level that is at least 20% lower than the physiological arginine level. In some embodiments, the patient is characterized by a significantly reduced arginine blood plasma level that is at least 33% lower than the physiological arginine level. In some embodiments, the patient is characterized by a significantly reduced arginine blood plasma level that is at least 67% lower than the physiological arginine level.
In some embodiments, the plasma level of arginine is less than 80% of said physiological level of arginine (i.e., the arginine blood plasma level is at least 20% lower than the physiological arginine level) and the blood plasma level of proline is less than 50% of said physiological level of proline (i.e., the proline blood plasma level is at least 50% lower than the physiological proline level).
In some embodiments, the plasma level of arginine is less than 67% of said physiological level of arginine (i.e., the arginine blood plasma level is at least 33% lower than the physiological arginine level) and the blood plasma level of proline is less than 33% of said physiological level of proline (i.e., the proline blood plasma level is at least 67% lower than the physiological proline level). In particular embodiments, said blood plasma level of proline and/or arginine is less than 90% of said physiological plasma level of proline and/or arginine. In other words, a patient in the 10-year to 18- year age group would need to be below 172 pmol/L proline and below 97 pmol/L arginine to qualify for that below-90% plasma level group.
In particular embodiments, said blood plasma level of proline and/or arginine is less than 67% of said physiological plasma level of proline and/or arginine. In other words, a patient in the above 18- year age group would need to be below 127 pmol/L proline and below 74 pmol/L arginine to qualify for that below-67% plasma level group.
In particular embodiments, said blood plasma level of proline and/or arginine is less than 33% of said physiological level of proline and/or arginine.
In particular embodiments, said blood plasma levels of proline and of arginine of the patient are less than the 25th percentile of plasma levels of proline and of arginine, respectively, of a control population of healthy patients.
In more particular embodiments, said blood plasma levels of proline and of arginine of the patient are less than the 10th percentile of plasma levels of proline and of arginine, respectively, of a control population of healthy patients.
In some embodiments, the patient has a plasma level of proline in an amount that is below a physiological plasma level of proline in a control group of healthy subjects of the same age group as the patient. In particular embodiments, the patient has a plasma level at least 25% lower compared to the average plasma level of proline of a control of healthy subjects of the same age group as the patient. In certain other embodiments, the patient is in the lower 25%ile of his or her age group in relation to the proline plasma level. In certain other embodiments, the patient is in the lower 10%ile of his or her age group in relation to the proline plasma level.
In some embodiments, the subject has a plasma level of arginine in an amount that is below a physiological plasma level of arginine in a control or healthy subject of the same age group as the subject. In particular embodiments, the patient has a plasma level at least 25% lower compared to the average plasma level of arginine of a control of healthy subjects of the same age group as the patient. In certain other embodiments, the patient is in the lower 25%ile of his or her age group in relation to the arginine plasma level. In certain other embodiments, the patient is in the lower 10 % ile of his or her age group in relation to the arginine plasma level.
In certain other embodiments, the patient is in the lower 25%ile of his or her age group in relation to both the proline and arginine plasma levels. In certain other embodiments, the patient is in the lower 10%ile of his or her age group in relation to both the proline and arginine plasma levels.
The physiological plasma level of proline, arginine, or both depends on the age of the human subject, and are used as defined above:
Reference values adapted from: Blau et al., 2008, ibid..
Alternatively, the invention provides a method of treating a condition in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a polyamine pathway inhibitor, wherein the subject is undergoing a dietary regimen that is designed to reduce a plasma level of proline, arginine, or both in the subject.
DFMO or its pharmaceutically acceptable salt can be administered at an effective dose or amount effective for treatment of a condition (e.g., a cancer), inhibiting a cell proliferative disorder, or increasing survival time.
In certain embodiments of the first aspect of the invention, the polyamine pathway inhibitor is an arginase inhibitor.
In certain embodiments, the polyamine pathway inhibitor is an ornithine decarboxylase inhibitor.
In certain embodiments, the ornithine decarboxylase inhibitor is selected from the group consisting of: caffeic acid phenethyl ester, caffeic acid methyl ester, phenethyl dimethyl caffeate, (2S)-(+)-amino-6-iodoacetamidohexanoic acid, phenylethyl 3-methylcaffeate, caffeic acid, N-(4'- pyridoxyl)-ornithine(BOC)-ome (POB), alicin, ODC-MPI-2, alpha-ethynyl ornithine, 6-heptyne-2,5- diamine, 2-methyl-6-heptyne diamine, ornithine decarboxylase antizyme (AZ), eflornithine hydrochloride; 1 ,4-diamino-2-butanone (DAB); chlorogenic acid; ferulic acid; DL-alpha- monofluoromethyldehydroornithine methyl ester; 3-amino-oxy-l-propanamine; and a-methyl ornithine.
In certain particular embodiments, the ornithine decarboxylase inhibitor is difluoromethylornithine (DFMO) or a pharmaceutically acceptable salt thereof (eflornithine; D,L-a-difluoromethylornithine).
Administration and dosing of DMFO
In certain embodiments, the DFMO is administered by oral administration. DFMO is known to be safely administered orally in treatment of trypanosomiasis, at doses indicated above.
In certain embodiments, wherein the DFMO is administered by intravenous administration. DFMO is known to be safely administered by i.v. infusion at the beginning of treatment in treatment of trypanosomiasis, as well as in treatment of oncological conditions.
In certain embodiments, the DFMO is administered by topical administration. DMFO is safely administered in topical form for treatment of hirsutism.
In certain embodiments, the DFMO is administered at a dose of at least about 250 mg/m2, at least about 500 mg/m2, at least about 1000 mg/m2, or at least about 2000 mg/m2.
For example, DFMO or a pharmaceutically acceptable salt thereof can be administered at a dose of at least about 250 mg/m2, at least about 500 mg/m2, at least about 1000 mg/m2, or at least about 2000 mg/m2. In some embodiments, DFMO is administered at a dose of from about 200 mg/m2 to about 3000 mg/m2, from about 500 mg/m2 to about 2500 mg/m2, from about 500 mg/m2 to about 1000 mg/m2, from about 1000 mg/m2 to about 2000 mg/m2, from about 1000 mg/m2 to about 3000 mg/m2, or from about 2000 mg/m2 to about 3000 mg/m2. In some embodiments, DFMO is administered at a dose of about 250 mg/m2, about 500 mg/m2, about 750 mg/m2, about 1000 mg/m2, about 1500 mg/m2, about 2000 mg/m2, about 2250 mg/m2, about 2500 mg/m2, about 2750 mg/m2, or about 3000 mg/m2.
In certain embodiments, the DFMO is administered at a dose of from about 200 mg/m2 to about 3000 mg/m2, from about 500 mg/m2 to about 2500 mg/m2, from about 500 mg/m2 to about 1000 mg/m2, from about 1000 mg/m2 to about 2000 mg/m2, from about 1000 mg/m2 to about 3000 mg/m2, or from about 2000 mg/m2 to about 3000 mg/m2.
In some embodiments, DFMO or a pharmaceutically acceptable salt thereof can be administered at a dose of from about 200 mg/kg/day to about 1000 mg/kg/day.
In certain embodiments, the DFMO is administered at a dose of about 250 mg/m2, about 500 mg/m2, about 750 mg/m2, about 1000 mg/m2, about 1500 mg/m2, about 2000 mg/m2, about 2250 mg/m2, about 2500 mg/m2, about 2750 mg/m2, or about 3000 mg/m2.
In certain embodiments, the DFMO is administered at a dose from about 200 mg/kg/day to about 1000 mg/kg/day.
In certain embodiments, the DFMO is administered at a dose from 1 ,000 mg/m2/day to 9,000 mg/m2/day.
In certain embodiments, the DFMO is administered at a dose from 1 ,500 mg/m2/day to 6,000 mg/m2/day.
DFMO or a pharmaceutically acceptable salt thereof can be administered at suitable frequency effective for treatment of cancer), inhibiting a cell proliferative disorder, or increasing survival time. In some embodiments, DFMO or a pharmaceutically acceptable salt thereof can be administered daily. In some embodiments, DFMO or a pharmaceutically acceptable salt thereof can be administered once daily. In some embodiments, DFMO or a pharmaceutically acceptable salt thereof can be administered twice daily.
In certain embodiments, the DFMO is administered over a period of at least 100 days. In certain embodiments, the DFMO is administered over a period of at least 200 days. In certain embodiments, the DFMO is administered over a period of at least 300 days. In certain embodiments, the DFMO is administered over a period of at least 365 days. In certain embodiments, the DFMO is administered over a period of 100 days to 200 days. In certain embodiments, the DFMO is administered over a period of 100 days to 300 days.
In certain embodiments, the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of proline for the subject’s age group.
The following dietary requirements apply to the recommended daily intake of Arg and Pro, respectively:
These reference values are adapted from: Wu G. Dietary protein intake and human health. Food & Function. 2016;7(3):1251-1265. doi:10.1039/c5fo01530h.
For determination of proline and arginine dietary requirements for adults undergoing treatment as disclosed herein, the “low physical activity” amount shall apply. In certain embodiments, the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of arginine for the subject’s age group as specified above.
In certain embodiments, wherein the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of each, proline and arginine, for the subject’s age group as specified above.
In certain embodiments, the dietary regimen provides an amount of proline, of arginine, or of proline and arginine leading to a plasma level of less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, less than 50%, less than 40%, or even less than 30% of a physiological plasma level of proline, arginine, or both, respectively.
W: week; M: month; Y: year.
The physiological levels of proline and arginine depend on the age of the human subject. For the purpose of the present specification, the physiological level of proline (Pro) and/or arginine (Arg), respectively, is defined as being within the following ranges (all values in pmol/L):
W: week; M: month; Y: year.
As before, for calculation purposes defining the scope of protection conferred by the invention, the arithmetic middle is used between the upper and lower value of the respective range.
In some embodiments, the dietary regimen administered in combination with the polyamine pathway inhibitor does not comprise proline. In some embodiments, the dietary regimen administered in combination with the polyamine pathway inhibitor does not comprise arginine. In some embodiments, the dietary regimen administered in combination with the polyamine pathway inhibitor does not comprise proline nor arginine.
In some embodiments, the dietary regimen administered in combination with DMFO does not comprise proline. In some embodiments, the dietary regimen administered in combination with DMFO does not comprise arginine. In some embodiments, the dietary regimen administered in combination with DMFO does not comprise proline nor arginine.
In particular embodiments, the dietary regimen is further restricted in one or more additional amino acids selected from the group consisting of: serine, glycine, cystine, cysteine, tyrosine, glutamine, glutamate, ornithine, and citrulline.
In some embodiments, DMFO is administered together with a dietary product having an amino acid composition designed to lead to a reduction of a plasma level of proline, arginine, or both in the patient.
Alternatively, the method further comprises administering to the subject a therapeutically effective amount of a dietary product designed to reduce a plasma level of proline, arginine, or both in the subject.
In some embodiments, the dietary product is designed to lead to a reduction of the plasma level of proline, arginine, or both in the subject to less than 90%, less than 67%, or even less than 33% of a physiological plasma level of proline, arginine, or both.
In some embodiments, the dietary product is designed to lead to a reduction of the plasma level of proline, arginine, or both in the subject to less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, less than 50%, less than 40%, or even less than 30% of a physiological plasma level of proline, arginine, or both.
The physiological levels of proline and arginine depend on the age of the human subject and are used as tabularized above.
In some embodiments, the dietary product comprises a restricted amount of proline, arginine, or both.
In some embodiments, the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of recommended average dietary intake of proline, arginine, or both in a control or healthy subject of the same age group as the subject.
In some embodiments, the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of an average recommended dietary intake of proline, arginine, or both for the subject’s age group.
In some embodiments, the dietary product does not comprise proline.
In some embodiments, the dietary product does not comprise arginine.
In some embodiments, the dietary product does not comprise proline and arginine.
Cancer targets
In some embodiments, the condition is a cancer.
In some embodiments, the cancer is a MYC-amplified cancer.
In some embodiments, the cancer is a MYC-L-amplified cancer.
In some embodiments, the cancer is a MYC-N-amplified cancer.
In some embodiments, the cancer is characterized by overexpression of a MYC-family oncogene.
In some embodiments, the MYC-family oncogene is MYC, MYC-L, or MYC-N.
In some embodiments, the cancer is a pediatric cancer, i.e. a cancer in a human patient younger than 18 years, particularly younger than 15 years, more particularly younger than 14 years.
In some embodiments, the cancer is a solid tumour.
In some embodiments, the cancer is a non-solid tumour or liquid tumour.
In some embodiments, the cancer is a brain cancer.
In some embodiments, the cancer is a neuroblastoma.
In some embodiments, the cancer is a medulloblastoma.
In some embodiments, the cancer is a leukemia.
In some embodiments, the cancer is a lymphoma.
In some embodiments, the cancer is a prostate cancer.
In some embodiments, the cancer is a colorectal cancer.
In some embodiments, the cancer is a cervical cancer.
In some embodiments, the cancer is a skin cancer. In some embodiments, the cancer is a melanoma.
In some embodiments, the cancer is a bladder cancer.
In some embodiments, the cancer is a gastric cancer.
Combinations
In some embodiments, the method further comprises administering to the subject a therapeutically effective amount of an agent that reduces a plasma level of proline and/or arginine in the subject.
In some embodiments, the agent is a proline biosynthetic pathway inhibitor.
In some embodiments, the agent is an arginine biosynthetic pathway inhibitor.
In some embodiments, the agent is a proline degrading enzyme.
In some embodiments, the agent is an arginine degrading enzyme.
In some embodiments, the agent is a proline uptake inhibitor.
In some embodiments, the agent is an arginine uptake inhibitor.
In some embodiments, the subject has a plasma level of proline in an amount that is below a physiological plasma level of proline in a control or healthy subject of the same age group as the subject.
In certain embodiments, DFMO is provided for use according to any one of the preceding items, administered in combination with a pharmaceutical drug capable of lowering plasma levels of arginine. In particular embodiments thereof, the pharmaceutical drug capable of lowering plasma levels of arginine is a recombinant arginase. In more particular embodiments, the recombinant arginase is pegylated recombinant human arginase. In most particular embodiments, BT-100 or BT-200 are used (see US2014363417A1 , US2015315561A1 ).
The physiological plasma level of proline, arginine, or both depends on the age of the human subject, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
In some embodiments, the method according to the invention further comprises administering to the subject a therapeutically effective amount of a chemotherapeutic agent.
In some embodiments, the method according to the invention further comprises administering to the subject a therapeutically effective amount of a radiotherapy.
In some embodiments, the method according to the invention further comprises administering to the subject a therapeutically effective amount of an immunotherapy.
Endpoints
In some embodiments, the method results in a synergistic survival effect in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
In some embodiments, the method results in at least a 2-fold in survival probability in the subject compared with a control subject administered either the polyamine pathway inhibitor alone or the dietary regimen alone.
In some embodiments, the method results in a synergistic reduction in tumour growth in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
In some embodiments, the method results in at least a 2-fold reduction in tumour growth in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
Dosage forms
A pharmaceutical composition comprising in a unit dosage form: a dietary product comprising a plurality of amino acids, wherein the dietary product is designed to reduce a plasma level of proline, arginine, or both in the subject; a polyamine pathway inhibitor; and a pharmaceutically acceptable excipient.
In some embodiments, the dietary product is designed to reduce the plasma level of proline, arginine, or both in the patient to less than 90%, less than 67%, or even less than 33% of a physiological plasma level of proline, arginine, or both.
The physiological levels of proline and arginine depend on the age of the human subject. For the purpose of the present specification, the physiological level of proline (Pro) and/or arginine (Arg), respectively, is defined as being within the following ranges (all values in pmol/L):
W: week; M: month; Y: year.
Reference values adapted from: Blau et al., 2008, ibid.
In some embodiments, the dietary product comprises essential amino acids phenylalanine, lysine, leucine, isoleucine, threonine, valine, tryptophan, methionine, and histidine.
In some embodiments, the dietary product comprises a restricted amount of proline, arginine, or both.
In some embodiments, the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a normal average dietary intake of proline, arginine, or both in a control or healthy subject of the same age group as the subject.
In some embodiments, the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of an average recommended dietary intake of proline, arginine, or both for the subject’s age group.
In some embodiments, the dietary product does not comprise proline.
In some embodiments, the dietary product does not comprise arginine.
In some embodiments, the dietary product does not comprise proline and arginine.
In some embodiments, the polyamine pathway inhibitor is an ornithine decarboxylase inhibitor.
In some embodiments, the ornithine decarboxylase inhibitor is difluoromethylornithine (DFMO; D,L-a-difluoromethylornithine, eflornith ine)) or a pharmaceutically acceptable salt thereof.
In some embodiments, the DFMO is D,L-a-difluoromethylornithine.
In some embodiments, the DFMO is eflornithine.
In some embodiments, the DFMO is administered by oral administration.
In some embodiments, the DFMO is administered by intravenous administration.
In some embodiments, the DFMO is administered by topical administration.
In some embodiments, the DFMO is administered at a dose of at least about 250 mg/m2, at least about 500 mg/m2, at least about 1000 mg/m2, or at least about 2000 mg/m2.
In some embodiments, the DFMO is administered at a dose of from about 200 mg/m2 to about 3000 mg/m2, from about 500 mg/m2 to about 2500 mg/m2, from about 500 mg/m2 to about 1000 mg/m2, from about 1000 mg/m2 to about 2000 mg/m2, from about 1000 mg/m2 to about 3000 mg/m2, or from about 2000 mg/m2 to about 3000 mg/m2.
In some embodiments, the DFMO is administered at a dose of about 250 mg/m2, about 500 mg/m2, about 750 mg/m2, about 1000 mg/m2, about 1500 mg/m2, about 2000 mg/m2, about 2250 mg/m2, about 2500 mg/m2, about 2750 mg/m2, or about 3000 mg/m2.
In some embodiments, the DFMO is administered at a dose of from about 200 mg/kg/day to about 1000 mg/kg/day.
In some embodiments, the DFMO is administered daily. In some embodiments, the DFMO is administered once daily.
In some embodiments, the DFMO is administered twice daily.
In some embodiments, the ornithine decarboxylase inhibitor is selected from the group consisting of: caffeic acid phenethyl ester, caffeic acid methyl ester, phenethyl dimethyl caffeate, (2S)-(+)- amino-6-iodoacetamidohexanoic acid, phenylethyl 3-methylcaffeate, caffeic acid, N-(4'-pyridoxyl)- ornithine(BOC)-ome (POB), allicin, ODC-MPI-2, alpha-ethynyl ornithine, 6-heptyne-2,5-diamine, 2-methyl-6-heptyne diamine, ornithine decarboxylase antizyme (AZ), eflornithine hydrochloride;
1 ,4-diamino-2-butanone (DAB); chlorogenic acid; ferulic acid; DL-alpha- monofluoromethyldehydroornithine methyl ester; 3-amino-oxy-l-propanamine; and a-methyl ornithine.
In some embodiments, the polyamine pathway inhibitor is an arginase inhibitor.
The invention further encompasses the following items of the invention:
Items
1. Difluormethylornithin, or a pharmaceutically acceptable salt thereof, (DFMO), for use in treatment or prevention of recurrence of cancer, wherein the DFMO is administered to a patient characterized by a significantly reduced blood plasma level of proline and/or arginine, in comparison to a physiological level of proline and/or arginine, wherein the physiological level of proline and/or arginine depends on the age of the patient, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
W: week; M: month; Y: year, particularly wherein the physiological level of proline and/or arginine is defined as:
W: week; M: month; Y: year
1 .A Difluormethylornithin (DFMO), or a pharmaceutically acceptable salt thereof, for use in treatment or prevention of recurrence of cancer, wherein: the DFMO is administered to a patient characterized by a significantly reduced proline blood plasma level and a significantly reduced arginine blood plasma level; the significantly reduced proline blood plasma level is less than 67% of a physiological proline level (/.e., the proline blood plasma level is reduced by 33% or more); the significantly reduced arginine blood plasma level is less than 80% of a physiological arginine level (/.e., the arginine blood plasma level is reduced by 20% or more); and the physiological proline level and the physiological arginine level depend on the age of the patient and are defined as being (all values in pmol/L):
W: week; M: month; Y: year.
2. DMFO for use according to item 1 , wherein said blood plasma level of proline and/or arginine is less than 67% of said physiological level of proline and/or arginine.
3. DMFO for use according to item 1 , wherein said blood plasma level of proline and/or arginine is less than 33% of said physiological level of proline and/or arginine.
4. DFMO for use according to any one of items 1 to 3, wherein the patient is characterized by a significantly reduced blood plasma level of proline, particularly wherein the reduced blood plasma level of proline is less than 67% of the physiological proline level.
5. DFMO for use according to any one of items 1 to 4, wherein the patient is characterized by a significantly reduced blood plasma level of arginine, particularly wherein the reduced blood plasma level of arginine is less than 80% of the physiological proline level.
6. Difluormethyl ornithin (DFMO), or a pharmaceutically acceptable salt thereof, for use in treatment or prevention of recurrence of cancer, wherein the DFMO is administered to a patient undergoing or scheduled to undergo a treatment aimed at lowering the plasma level of proline and/or arginine.
7. DMFO for use according to item 6, wherein the treatment is aimed at lowering the plasma levels of proline and of arginine.
8. DFMO for use according to any one of the preceding items, wherein DFMO is administered at a daily dose ranging from 500 mg/m2 to 9000 mg/m2, particularly from 1000 mg/m2 to 5000 mg/m2, more particularly from 2000 mg/m2 to 4000 mg/m2. 9. DFMO for use according to any one of the preceding items, wherein DFMO is administered in combination with a pharmaceutical drug capable of lowering plasma levels of proline.
10. DFMO for use according to any one of the preceding items, wherein said cancer is characterized by overexpression of a MYC-family oncogene.
11 . DMFO for use according to item 10, wherein the cancer is characterized by overexpression of c-myc.
12. DMFO for use according to item 10, wherein the cancer is characterized by overexpression of l-myc.
13. DMFO for use according to item 10, wherein the cancer is characterized by overexpression of n-myc.
14. DFMO for use according to any one of the preceding items, wherein said cancer is a solid tumour.
15. DMFO for use according to item 14, wherein said solid tumour is a tumour of the brain or a cancer of the peripheral nervous system, more particularly wherein said tumour of the brain is selected from the group of neuroblastoma, glioblastoma or medulloblastoma.
16. DFMO for use according to item 14, wherein said cancer is breast cancer.
17. DFMO for use according to item 14, wherein said cancer is ovarian cancer.
18. DFMO for use according to item 14, wherein said cancer is esophageal cancer.
19. DFMO for use according to item 14, wherein said cancer is lung cancer.
20. DFMO for use according to any one of items 1 to 14, wherein said cancer is leukemia..
21 . DFMO for use according to any one of items 1 to 14, wherein said cancer is lymphoma.
22. DFMO for use according to any one of items 1 to 14, wherein said cancer is MYC-rearranged or MYC amplified cancer.
23. DFMO for use according to item 22, wherein said cancer is selected from the group consisting of MYC-rearranged lymphoma; MYC amplified breast cancer; MYC amplified ovarian cancer; MYC amplified esophageal cancer; MYC amplified lung cancer, MYC- rearranged or hyperactivated leukaemia.
24. DFMO for use according to any one of the preceding items, wherein the DFMO is administered over a period of 100 days or more, particularly wherein the DFMO is administered over a period of 200 days or more.
25. DFMO for use according to any one of the preceding items, wherein the DFMO is administered without administration of a second agent selected from the group consisting of a chemotherapeutic agent and a non-steroidal anti-inflammatory agent immediately prior to, concomitant with or immediately subsequent to administration of DFMO. 26. DFMO for use according to any one of the preceding items, wherein the subject is 0 to 18 years old.
27. DFMO for use according to any one of the preceding items, wherein the subject is 0 to 10 years old.
28. A pharmaceutical composition in unit dosage form comprising, particularly consisting of:
DFMO and a mixture of amino acids comprising eighteen amino acids selected from the proteinogenic amino acids, except proline and arginine; and optionally, a pharmaceutically acceptable excipient.
The invention further encompasses the following enumerated embodiments:
1 . A method of treating a condition in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a polyamine pathway inhibitor, wherein the subject is undergoing a dietary regimen that is designed to reduce a plasma level of proline, arginine, or both in the subject.
2. The method of embodiment 1 , wherein the polyamine pathway inhibitor is an ornithine decarboxylase inhibitor.
3. The method of embodiment 2, wherein the ornithine decarboxylase inhibitor is difluoromethylornithine (DFMO) or a pharmaceutically acceptable salt thereof.
4. The method of embodiment 3, wherein the DFMO is D,L-a-difluoromethylornithine.
5. The method of embodiment 3, wherein the DFMO is eflornithine.
6. The method of embodiment 3, wherein the DFMO is administered by oral administration.
7. The method of embodiment 3, wherein the DFMO is administered by intravenous administration.
8. The method of embodiment 3, wherein the DFMO is administered by topical administration.
9. The method of any one of embodiments 3-8, wherein the DFMO is administered at a dose of at least about 250 mg/m2, at least about 500 mg/m2, at least about 1000 mg/m2, or at least about 2000 mg/m2.
10. The method of any one of embodiments 3-8, wherein the DFMO is administered at a dose of from about 200 mg/m2 to about 3000 mg/m2, from about 500 mg/m2 to about 2500 mg/m2, from about 500 mg/m2 to about 1000 mg/m2, from about 1000 mg/m2 to about 2000 mg/m2, from about 1000 mg/m2 to about 3000 mg/m2, or from about 2000 mg/m2 to about 3000 mg/m2.
11 . The method of any one of embodiments 3-8, wherein the DFMO is administered at a dose of about 250 mg/m2, about 500 mg/m2, about 750 mg/m2, about 1000 mg/m2, about 1500 mg/m2, about 2000 mg/m2, about 2250 mg/m2, about 2500 mg/m2, about 2750 mg/m2, or about 3000 mg/m2.
12. The method of any one of embodiments 3-8, wherein the DFMO is administered at a dose of from about 200 mg/kg/day to about 1000 mg/kg/day.
13. The method of any one of embodiments 3-12, wherein the DFMO is administered daily.
14. The method of any one of embodiments 3-13, wherein the DFMO is administered once daily.
15. The method of any one of embodiments 3-13, wherein the DFMO is administered twice daily.
16. The method of embodiment 2, wherein the ornithine decarboxylase inhibitor is selected from the group consisting of: caffeic acid phenethyl ester, caffeic acid methyl ester, phenethyl dimethyl caffeate, (2S)-(+)-amino-6-iodoacetamidohexanoic acid, phenylethyl 3- methylcaffeate, caffeic acid, N-(4'-pyridoxyl)-ornithine(BOC)-ome (POB), alicin, ODC-MPI-2, alpha-ethynyl ornithine, 6-heptyne-2,5-diamine, 2-methyl-6-heptyne diamine, ornithine decarboxylase antizyme (AZ), eflornithine hydrochloride; 1 ,4-diamino-2-butanone (DAB); chlorogenic acid; ferulic acid; DL-alpha-monofluoromethyldehydroornithine methyl ester; 3- amino-oxy-l-propanamine; and a-methyl ornithine.
17. The method of embodiment 1 , wherein the polyamine pathway inhibitor is an arginase inhibitor.
18. The method of any one of embodiments 1 -17, wherein the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of proline for the subject’s age group as specified in the following table:
19. The method of any one of embodiments 1 -17, wherein the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of arginine for the subject’s age group as specified in the following table: The method of any one of embodiments 1 -17, wherein the dietary regimen provides less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a recommended dietary requirement of proline for the subject’s age group as specified in the following table: The method of any one of embodiments 1 -17, wherein the dietary regimen provides an amount of proline, of arginine, or of proline and arginine leading to a plasma level of less than 290%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, less than 50%, less than 40%, or even less than 30% of a physiological plasma level of proline, arginine, or both, respectively, wherein the physiological level of proline and/or arginine depends on the age of the subject, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L): The method of any one of embodiments 1-21 , wherein the dietary regimen does not comprise proline. The method of any one of embodiments 1-21 , wherein the dietary regimen does not comprise arginine. The method of any one of embodiments 1-21 , wherein the dietary regimen does not comprise proline and arginine. The method of any one of embodiments 1-24, wherein the dietary regimen is further restricted in one or more additional amino acids selected from the group consisting of: serine, glycine, cystine, cysteine, tyrosine, glutamine, glutamate, ornithine, and citrulline. . The method of any one of embodiments 1 -25, further comprising administering to the subject a therapeutically effective amount of a dietary product designed to reduce a plasma level of proline, arginine, or both in the subject. . The method of embodiment 26, wherein the dietary product reduces the plasma level of proline, arginine, or both in the subject to less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 60%, less than 50%, less than 40%, or even less than 30% of a physiological plasma level of proline, arginine, or both, wherein the physiological level of proline and/or arginine depends on the age of the subject, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L): The method of embodiment 26 or 27, wherein the dietary product comprises one or more essential amino acids selected from the group consisting of: phenylalanine, lysine, leucine, isoleucine, threonine, valine, tryptophan, methionine, and histidine. The method of any one of embodiments 26-28, wherein the dietary product comprises a restricted amount of proline, arginine, or both. The method of embodiment 29, wherein the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a normal average dietary intake of proline, arginine, or both in a control or healthy subject of the same age group as the subject. The method of embodiment 29, wherein the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of an average recommended dietary requirement of proline, arginine, or both for the subject’s age group. The method of embodiment 31 , wherein the average recommended dietary requirement is given in the following table: 33. The method of any one of embodiments 26-32, wherein the dietary product does not comprise proline.
34. The method of any one of embodiments 26-32, wherein the dietary product does not comprise arginine.
35. The method of any one of embodiments 26-32, wherein the dietary product does not comprise proline and arginine.
36. The method of any one of embodiments 1-35, wherein the condition is a cancer.
37. The method of embodiment 36, wherein the cancer is a MYC-amplified cancer.
38. The method of embodiment 36 or 37, wherein the cancer is a MYC-L-amplified cancer.
39. The method of embodiment 36 or 37, wherein the cancer is a MYC-N-amplified cancer.
40. The method of any one of embodiments 36-39, wherein the cancer is characterized by overexpression of a MYC-family oncogene.
41 . The method of embodiment 40, wherein the MYC-family oncogene is MYC, MYC-L, or MYOIM.
42. The method of any one of embodiments 36-41 , wherein the cancer is a pediatric cancer.
43. The method of any one of embodiments 36-42, wherein the cancer is a solid tumour.
44. The method of any one of embodiments 36-43, wherein the cancer is a non-solid tumour or liquid tumour.
45. The method of any one of embodiments 36-44, wherein the cancer is a brain cancer.
46. The method of any one of embodiments 36-45, wherein the cancer is a neuroblastoma.
47. The method of any one of embodiments 36-45, wherein the cancer is a medulloblastoma.
48. The method of any one of embodiments 36-42 and 44, wherein the cancer is a leukemia.
49. The method of any one of embodiments 36-42 and 44, wherein the cancer is a lymphoma.
50. The method of any one of embodiments 36-43, wherein the cancer is a prostate cancer.
51 . The method of any one of embodiments 36-43, wherein the cancer is a colorectal cancer.
52. The method of any one of embodiments 36-43, wherein the cancer is a cervical cancer.
53. The method of any one of embodiments 36-43, wherein the cancer is a skin cancer.
54. The method of any one of embodiments 36-43 and 53, wherein the cancer is a melanoma.
55. The method of any one of embodiments 36-43, wherein the cancer is a bladder cancer.
56. The method of any one of embodiments 36-43, wherein the cancer is a gastric cancer.
57. The method of any one of embodiments 1-56, further comprising administering to the subject a therapeutically effective amount of an agent that reduces a plasma level of proline and/or arginine in the subject.
58. The method of embodiment 57, wherein the agent is a proline biosynthetic pathway inhibitor.
59. The method of embodiment 57, wherein the agent is an arginine biosynthetic pathway inhibitor.
60. The method of embodiment 57, wherein the agent is a proline degrading enzyme.
61. The method of embodiment 57, wherein the agent is an arginine degrading enzyme.
62. The method of embodiment 57, wherein the agent is a proline uptake inhibitor.
63. The method of embodiment 57, wherein the agent is an arginine uptake inhibitor.
64. The method of any one of embodiments 1-63, wherein the subject has a plasma level of proline in an amount that is below a physiological plasma level of proline in a control or healthy subject of the same age group as the subject.
65. The method of any one of embodiments 1-63, wherein the subject has a plasma level of arginine in an amount that is below a physiological plasma level of arginine in a control or healthy subject of the same age group as the subject.
66. The method of embodiment 64 or 65, wherein the physiological plasma level of proline, arginine, or both depends on the age of the subject, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
67. The method of any one of embodiments 1-66, further comprising administering to the subject a therapeutically effective amount of a chemotherapeutic agent.
68. The method of any one of embodiments 1-67, further comprising administering to the subject a therapeutically effective amount of a radiotherapy.
69. The method of any one of embodiments 1-68, further comprising administering to the subject a therapeutically effective amount of an immunotherapy.
70. The method of any one of embodiments 1-69, wherein the method results in a synergistic survival effect in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
71 . The method of any one of embodiments 1-70, wherein the method results in at least a 2-fold in survival probability in the subject compared with a control subject administered either the polyamine pathway inhibitor alone or the dietary regimen alone.
72. The method of any one of embodiments 1-71 , wherein the method results in a synergistic reduction in tumour growth in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
73. The method of any one of embodiments 1-72, wherein the method results in at least a 2-fold reduction in tumour growth in the subject compared with a control subject administered with either the polyamine pathway inhibitor alone or the dietary regimen alone.
74. A pharmaceutical composition comprising in a unit dosage form: a) a dietary product comprising a plurality of amino acids, wherein the dietary product is designed to reduce a plasma level of proline, arginine, or both in the subject; b) a polyamine pathway inhibitor; and c) a pharmaceutically acceptable excipient.
75. The pharmaceutical composition of embodiment 74, wherein the dietary product reduces the plasma level of proline, arginine, or both in the subject to less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a physiological plasma level of proline, arginine, or both, wherein the physiological level of proline and/or arginine depends on the age of the subject, and wherein the physiological level of proline and/or arginine is defined as being within the following ranges (all values in pmol/L):
76. The pharmaceutical composition of embodiment 74 or 75, wherein the dietary product comprises essential amino acids phenylalanine, lysine, leucine, isoleucine, threonine, valine, tryptophan, methionine, and histidine.
77. The pharmaceutical composition of any one of embodiments 74-76, wherein the dietary product comprises a restricted amount of proline, arginine, or both.
78. The pharmaceutical composition of embodiment 77, wherein the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of a normal average dietary requirement of proline, arginine, or both in a control or healthy subject of the same age group as the subject.
79. The pharmaceutical composition of embodiment 77, wherein the restricted amount comprises less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 1 %, less than 0.5%, or less than 0.1 % of an average recommended dietary intake of proline, arginine, or both for the subject’s age group. . The pharmaceutical composition of embodiment 77, wherein the average recommended dietary requirement is given in the following table:
81 . The pharmaceutical composition of any one of embodiments 74-80, wherein the dietary product does not comprise proline.
82. The pharmaceutical composition of any one of embodiments 74-80, wherein the dietary product does not comprise arginine.
83. The pharmaceutical composition of any one of embodiments 74-80, wherein the dietary product does not comprise proline and arginine.
84. The pharmaceutical composition of any one of embodiments 74-83, wherein the polyamine pathway inhibitor is an ornithine decarboxylase inhibitor.
85. The pharmaceutical composition of embodiment 84, wherein the ornithine decarboxylase inhibitor is difluoromethylornithine (DFMO) or a pharmaceutically acceptable salt thereof.
86. The pharmaceutical composition of embodiment 85, wherein the DFMO is D,L-a- difluoromethylornithine.
87. The pharmaceutical composition of embodiment 85, wherein the DFMO is eflornithine.
88. The pharmaceutical composition of embodiment 85, wherein the DFMO is administered by oral administration.
89. The pharmaceutical composition of embodiment 85, wherein the DFMO is administered by intravenous administration.
90. The pharmaceutical composition of embodiment 85, wherein the DFMO is administered by topical administration.
91 . The pharmaceutical composition of any one of embodiments 85-90, wherein the DFMO is administered at a dose of at least about 250 mg/m2, at least about 500 mg/m2, at least about 1000 mg/m2, or at least about 2000 mg/m2.
92. The pharmaceutical composition of any one of embodiments 85-90, wherein the DFMO is administered at a dose of from about 200 mg/m2 to about 3000 mg/m2, from about 500 mg/m2 to about 2500 mg/m2, from about 500 mg/m2 to about 1000 mg/m2, from about 1000 mg/m2 to about 2000 mg/m2, from about 1000 mg/m2 to about 3000 mg/m2, or from about 2000 mg/m2 to about 3000 mg/m2.
93. The pharmaceutical composition of any one of embodiments 85-90, wherein the DFMO is administered at a dose of about 250 mg/m2, about 500 mg/m2, about 750 mg/m2, about 1000 mg/m2, about 1500 mg/m2, about 2000 mg/m2, about 2250 mg/m2, about 2500 mg/m2, about 2750 mg/m2, or about 3000 mg/m2.
94. The pharmaceutical composition of any one of embodiments 85-90, wherein the DFMO is administered at a dose of from about 200 mg/kg/day to about 1000 mg/kg/day.
95. The pharmaceutical composition of any one of embodiments 85-94, wherein the DFMO is administered daily.
96. The pharmaceutical composition of any one of embodiments 85-95, wherein the DFMO is administered once daily.
97. The pharmaceutical composition of any one of embodiments 85-95, wherein the DFMO is administered twice daily.
98. The pharmaceutical composition of embodiment 84, wherein the ornithine decarboxylase inhibitor is selected from the group consisting of: caffeic acid phenethyl ester, caffeic acid methyl ester, phenethyl dimethyl caffeate, (2S)-(+)-amino-6-iodoacetamidohexanoic acid, phenylethyl 3-methylcaffeate, caffeic acid, N-(4'-pyridoxyl)-ornithine(BOC)-ome (POB), allicin, ODC-MPI-2, alpha-ethynyl ornithine, 6-heptyne-2,5-diamine, 2-methyl-6-heptyne diamine, ornithine decarboxylase antizyme (AZ), eflornithine hydrochloride; 1 ,4-diamino-2- butanone (DAB); chlorogenic acid; ferulic acid; DL-alpha-monofluoromethyldehydroornithine methyl ester; 3-amino-oxy-l-propanamine; and a-methyl ornithine.
99. The pharmaceutical composition of any one of embodiments 74-83, wherein the polyamine pathway inhibitor is an arginase inhibitor.
100. The method or the pharmaceutical composition for use of any one of the preceding embodiments, wherein the subject is 0 to 18 years old.
101. The method or the pharmaceutical composition for use of any one of the preceding embodiments, wherein the subject is 0 to 10 years old.
Pharmaceutical Compositions, Administration/Dosaqe Forms and Salts
According to one aspect of the compound according to the invention, the compound according to the invention is provided as a pharmaceutical composition, pharmaceutical administration form, or pharmaceutical dosage form, said pharmaceutical composition, pharmaceutical administration form, or pharmaceutical dosage form comprising at least one of the compounds of the present invention or a pharmaceutically acceptable salt thereof and at least one pharmaceutically acceptable carrier, diluent or excipient.
The skilled person is aware that any specifically mentioned drug compound mentioned herein, particularly DFMO, may be present as a pharmaceutically acceptable salt of said drug. Non-limiting examples of pharmaceutically acceptable anionic salt forms include acetate, benzoate, besylate, bitatrate, bromide, carbonate, chloride, citrate, edetate, edisylate, embonate, estolate, fumarate, gluceptate, gluconate, hydrobromide, hydrochloride, iodide, lactate, lactobionate, malate, maleate, mandelate, mesylate, methyl bromide, methyl sulfate, mucate, napsylate, nitrate, pamoate, phosphate, diphosphate, salicylate, disalicylate, stearate, succinate, sulfate, tartrate, tosylate, triethiodide and valerate.
In certain embodiments of the invention, the compound of the present invention is typically formulated into pharmaceutical dosage forms to provide an easily controllable dosage of the drug and to give the patient an elegant and easily handleable product.
Certain embodiments of the invention relate to a dosage form for enteral administration, such as nasal, buccal, rectal, transdermal or oral administration, or as an inhalation form or suppository. In addition, the pharmaceutical compositions of the present invention can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions).
Certain embodiments of the invention relate to a dosage form for parenteral administration, such as subcutaneous, intravenous, intrahepatic or intramuscular injection forms. Optionally, a pharmaceutically acceptable carrier and/or excipient may be present.
Certain embodiments of the invention relate to a dosage form for topical administration. The skilled artisan is aware of a broad range of possible recipes for providing topical formulations, as exemplified by the content of Benson and Watkinson (Eds.), Topical and Transdermal Drug Delivery: Principles and Practice (1st Edition, Wiley 2011 , ISBN-13: 978-0470450291 ); and Guy and Handcraft: Transdermal Drug Delivery Systems: Revised and Expanded (2nd Ed., CRC Press 2002, ISBN-13: 978-0824708610); Osborne and Amann (Eds.): Topical Drug Delivery Formulations (1st Ed. CRC Press 1989; ISBN-13: 978-0824781835). In embodiments of the invention relating to topical uses of the compounds of the invention, the pharmaceutical composition is formulated in a way that is suitable for topical administration such as aqueous solutions, suspensions, ointments, creams, gels or sprayable formulations, e.g., for delivery by aerosol or the like, comprising the active ingredient together with one or more of solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives that are known to those skilled in the art. Method of Manufacture and Method of Treatment according to the invention
The invention further encompasses, as an additional aspect, the use of a polyamine pathway inhibitor, particularly DMFO, or its pharmaceutically acceptable salt, as specified in detail above, for use in a method of manufacture of a medicament for the treatment or prevention of cancer, wherein the medicament is to be administered to a patient undergoing a dietary regimen and/or drug treatment that is designed to reduce a plasma level of proline, arginine, or both.
Wherever alternatives for single separable features are laid out herein as “embodiments”, it is to be understood that such alternatives may be combined freely to form discrete embodiments of the invention disclosed herein.
The invention is further illustrated by the following examples and figures, from which further embodiments and advantages can be drawn. These examples are meant to illustrate the invention but not to limit its scope.
Description of the Figures
Figure 1 : High proline, not glutamine or arginine, characterizes the arqinine-proline-qlutamine axis in MYCN-dmen neuroblastoma tumors. A) Schematic outline of the analysis workflow for primary neuroblastoma tumor tissue and mouse models undergoing liquid chromatography-mass spectrometry-based metabolomics followed by differential analysis. B) Differential abundance of 303 metabolites. Proline is the most significantly increased metabolite in MYCN amplified primary human neuroblastoma, relative to non-amplified tumors. Dotted line marks significance threshold, with p-values corrected for false discovery rate of 5%, *q < 0.05. n - 10 tumors in each group. C) Proline, glutamine and arginine levels in primary neuroblastoma tumor tissue. Displayed are corrected p-values, same as in B. *q < 0.05. Mean ± s.e.m., n - 10 each group. D) Relative levels of proline, glutamine and arginine in bilateral xenografts from MYCN amplified and non-amplified neuroblastoma cell lines. *P < 0.05, **P < 0.01 , two-tailed paired t-test. Mean t s.e.m., n - 4 each cell line. E) Proline concentration in MYCN driven neuroblastoma tumors is significantly increased in the H-MYCN genetically modified mouse model, whereas glutamine and arginine levels across organs are within physiological range. Mean ± s.e.m., tumor proline n - 31 , tumor glutamine n - 29, tumor arginine n= 27, other organs n - 8-31 . F) Schematic of gene expression levels of enzymes across the arginine-proline-glutamine axis, with the color of each gene label indicating relative expression (MYCN amplified/non-amplified) based on patient data from (Kocak H et al., Cell Death Dis. 2013 Apr 11 ;4(4):e586. doi: 10.1038/cddis.2013.84). MYCN amplified n = 93, MYCN nonamplified n - 551 . Abbreviations: arginine, Arg; glutamate, Glu; glutamine Gin; alpha-ketoglutarate, oKG ; tricarboxylic acid cycle, TCA.
Figure 2: Tumor proline in MYCN amplified neuroblastoma is predominantly derived from circulation. A) Schematic of in vivo stable isotope tracing setup to unravel the primary source of tumor metabolite precursors. B) Normalized labelling of serum proline, glutamine, arginine and ornithine and of tumor proline, arginine and ornithine as determined by [U-13C]proline, [U- 13C]glutamine, [U-13C]arginine and [U-13C]ornithine infusion in neuroblastoma bearing TH-MYCN mice in fasted state. Mean ± s.e.m., tumor and serum, n - 4-9. C) Direct circulating nutrient contributions to tumor tissue proline, arginine and ornithine in freely moving mice. Mean ± s.e.m.. D) Steady- state whole-body flux model of interconversion between all sources of circulating proline, ornithine and arginine and exchange with glutamine in nmol C/min/g. E) Schematic showing tumor proline and arginine are primarily taken up from circulation. The direct polyamine precursor ornithine is derived from circulating arginine and not by biosynthesis in the tumor.
Figure 3: Combination of dietary proline and arginine depletion with DFMQ treatment abrogates tumor growth in MYCN amplified neuroblastoma. A) Schematic of 2 factor intervention including amino acid depletion diet (day 21 ) and DFMO drug treatment via the drinking water (1 %, day 0) in the TH-MYCN mouse model (Weiss, W. A., et al., Embo j 16, 2985-2995 (1997). https://doi.org: 10.1093/emboj/16.11.2985). B) Kaplan-Meier plot of overall survival, with censored mice at time of stopping treatment. The intervention arms are control diet (CD), treatment with DFMO (CD DFMO), proline and arginine dropout diet (ProArg), and combination of proline and arginine dropout diet and treatment with DFMO (ProArg DFMO) in TH-MYCN GEMM. Log-rank test p-value compared to CD: *P < 0.05, **P < 0.01 , ***P < 0.001 , ****P < 0.0001 . CD n = 13, CD DFMO n = 14, ProArg n = 13, ProArg DFMO n = 14. Hash-marks identify mice censored at the end of therapy (with outcomes described in the text). C) Tumor growth defined as tumor weight at death normalized by day of life (weight in milligrams divided by days). Two-tailed t-test compared to CD: *P < 0.05, **P < 0.01 , ***P < 0.001 , ****P < 0.0001. Mean ± s.e.m., n = 13-14 per group. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Figure 4: Dietary intervention alters circulating and intratumoral arginine-proline-glutamine axis metabolites to enhance DFMO treatment effect. A-C) Differential serum metabolite levels comparing the respective treatment groups (DFMO, ProArg and ProArg DFMO) to control diet (CD). Blue highlights metabolites that are significantly (FDR < 0.05) down and shades of red up regulated in the treatment group. D) Schematic of arginine-proline-glutamine axis connection to polyamine metabolism. E) Absolute levels of arginine, proline, glutamate and glutamine and relative levels of ornithine, all under acute dietary and drug treatment, reveals depletion of arginine-proline- glutamine axis in the combined treatment. Comparison to CD. Mean t s.e.m., n - 4-8 mice. F) Proline/arginine depleted diet augments DFMO treatment induced polyamine depletion in tumor tissue, comparison treatment to CD. Zoom to show difference in polyamine levels between CD DFMO and ProArg DFMO. Mean ± s.e.m., n - 5-6 mice. For E-F: *P < 0.05, **P < 0.01 , ***P < 0.001 , ****P < 0.0001 , two-tailed t-test. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Figure 5: Ribo-Seg reveals defective decoding of adenosine-ending codons upon polyamine depletion. A) Schematic of evaluation of tumor translation from intervention arms. Tumors were lysed under the presence of the translation inhibitor cycloheximide. Lysates were used for preparation either RNA- or Ribo-Seq libraries. RNA ribosome protected fragments were isolated and sequenced for translation evaluation. B) Normalized ribosome density across transcripts. Combined treatment of DFMO with proline and arginine dropout diet affects global ribosome distribution at initiation/early elongation (left) and causes a termination defect (right). Mean, n - 5 mice. C) elF5A hypusination defects detected upon isoelectric focusing followed by immunoblotting. Control cell line IMR5 under increasing DFMO concentrations for 5 days, with the concentration for negative control (NC) and positive control (PC) identified below. Tumors of CD and ProArg DFMO arms, showing defective hypusination in a subset of tumors in the double treatment. The two last lanes are the NC and PC cell line treated for 7 days. D) Polyproline tract decoding is particularly affected by combining DFMO with proline and arginine dropout diet. Normalized ribosome depth encoding for positions with >- 3 prolines in a row. Mean, n - 5 mice. E) Proline translation defects are codon specific. Relative ribosome density on proline codons across treatment groups compared to control diet CD. Upper panel denotes proline codons not in poly-proline tracks whereas lower panels denote codons in poly-proline tracks where the increase occupancy in CCA and CCC occurs. Mean, n - 5 mice. F) A-ending codon specific translation defects induced by combined DFMO treatment compared to CD with proline/arginine depletion revealed by relative ribosome occupancy at the P site. G) Schematic showing two mechanisms revealed by combined DFMO and proline/arginine depletion therapy. Only combined treatment induces hallmarks of elF5A hypusination deficiency and boosts previously unknown codon specific translation defects induced by polyamine depletion. As described in figure 3, data in B-F are from TH-MYCN GEMM mouse model. In vivo treatment with DFMO is 1 % in the drinking water. C-F shows mean, n - 4-5 mice. Abbreviations: CD, control diet; ProArg, proline and arginine depleted diet; DFMO difluoromethylornithine.
Figure 6: Targeting metabolic dependencies of translation preferentially impairs cell cycle proteins. A) Venn diagram displaying treatment group-specific significant changes across the different layers of protein biosynthesis. mRNA transcripts, ribosome footprints per transcript and proteins. Tumors from all treatment arms were compared to control by differential analysis after RNA-Seq, Ribo-Seq and proteomics. Ribo-Seq and Proteomics: CD DFMO, ProArg and ProArg DFMO n=6; CD n=5, RNA-Seq: CD DFMO, ProArg and ProArg DFMO n-5 CD n-4. B) Gene set enrichment analysis across omics layers using the Reactome database shows cell cycle being regulated on the translation level. Data displayed comparing combined ProArg DFMO treatment to CD. Enriched pathways are ranked by significance and signed with positive enrichment indicating upregulation in ProArg DFMO. Top differentially regulated pathways on proteomics are highlighted across the omics layers by the same color. C) Percentage of adenosine ending codons in a pathway correlates with protein levels, with enrichment in A ending and protein levels performed across all Reactome pathways. Pathways with increasing fraction of adenosine ending codons are more downregulated on the protein level. In red highlighting upregulated neuronal system and blue downregulated cell cycle. D) Individual levels log2(LFQ) of cell cycle proteins, the most downregulated pathway, where the difference between ProArg DFMO and CD (combined treatment effect) is evaluated by subtraction on the y axis and the difference between E) ProArg DFMO and CD DFMO (diet additive effect) similarly, highlighting the additive diet effect on downregulating cell cycle proteins. Four top- down regulated proteins have been identified in both comparisons and the distribution of fold change on the right side of the two plots. F) Fold change across omics layers of top downregulated cell cycle proteins indicates predominant change on the protein level. G) Percentage of codons with the respective nucleotide at the ending position in Itgb3pg gene which encodes for the Cenpr protein as compared to the transcriptome background. H) Relative ribosome pausing sum across Cenpr reveals a dysfunction in decoding adenosine ending codons. The relative ribosome occupancy ratios between ProArg DFMO and CD are summed according to nucleotide identity at the codon ending position. I) Position specific relative ribosome pausing across the transcript, where the relative ribosome occupancy ratio between ProArg DFMO and CD are displayed for each position of Cenpr according to nucleotide identity at the ending position. J) Immunohistochemistry showing Ki67 (proliferation marker) in TH-MYCN tumors treated as indicated. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Figure 7: Targeting translation disrupts core oncogenic programs and induces neuroblast differentiation. A) Hallmark gene set enrichment across omics layers identifies biological processes predominantly affected on the ribosome and protein level. Only in the combined ProArg DFMO intervention this significant effect is evident, as compared to the DFMO monotherapy or ProArg depletion only. Displayed are the five top enriched hallmarks with the extended list in Figure 16G. Size of the dot denotes significance of enrichment and color gives the normalized enrichment score. Red enriched in the respective intervention group and, and blue higher in the CD arm. B) Differential protein levels across the hallmark gene set oxidative phosphorylation in the combined treatment compared to CD. The upregulated gene set is highlighted in shades of red. C) Differential protein levels across the hallmark gene set MYC targets V2 in the combined treatment compared to CD. The downregulated gene set is highlighted in shades of blue. D) Christina blots. E) Mycn levels across omics, compared to CD. F) MYCN transcript and Mycn protein levels across comparisons to CD. G) Combined treatment disrupts the MYCN driven core regulatory super enhancer circuitry on the protein level. Whereas M YCN transcript expression is upregulated (square), the protein level is reduced (ellipsoid). Similarly, other elements of the MYCN core circuitry, as described in (Durbin AD et al., Nat Genet. 2018 Sep;50(9):1240-1246. doi: 10.1038/s41588-018-0191 -z) and a latest addition from Decaesteker et al. (Decaesteker B et al., Nat Commun. 2023 Mar 7; 14(1 ): 1267. doi: 10.1038/s41467-023-36735-2) adrenergic circuit are affected. Coloring according to relative transcript expression or protein levels compared to control. H) Blinded histological assessment by pathologist of differentiation status and abundance of neuropil status in tumor sections (linked to Figure 7J). I) Representative H&E-stained tumor sections from the four treatment groups. CD and ProArg tumors show undifferentiated primitive neuroblasts with nested architecture, absent neuropil, and prominent mitotic and karyorrhectic figures. CD DFMO-treated tumors show poorly differentiated primitive neuroblasts with scant neuropil (arrowhead) and foci of cytodifferentiation (arrow) (<5% of overall cellularity). ProArg DFMO-treated tumors show high fractions of differentiating neuroblasts (>5% of tumor cellularity) with increased cytoplasmic to nuclear ratio (arrow) and abundant neuropil (arrowhead). Scale bar= 50/zm. J) Summary of treatment effects. E2F is downregulated in combination with G2M checkpoint, overall downregulation of cell cycle genes due to translation of inhibition of specific genes, leading to overall cellular division arrest, and enabling immature cancer cells to differentiate into neurons. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine; SE, super-enhancer.
Figure 8: Metabolomic profiling of MYCN amplified primary patient tumors and xenografts reveals reprogramming of the arginine-proline-glutamine axis. A) Global metabolomic signatures of primary human neuroblastoma tumors analyzed by principal component analysis, with MYCN amplified (red) and non-amplified (blue). B) Unsupervised clustering of primary neuroblastoma tumor samples by significantly changed metabolites (q < 0.05), comparing MYCN amplified to non-amplified tumors. C) Levels of all proteinogenic amino acids in primary neuroblastoma tumor tissue, with M YCN amplified (red) and non-amplified (blue). Displayed are corrected p-values, same as in Figure 1 B, *q < 0.05. Mean ± s.e.m.. D) MYCN expression across neuroblastoma cell lines, colored by MYCN amplification status. Based on data from (Harenza, J. L. et al., Sci Data 4, 170033, 2017, https://doi.org: 10.1038/sdata.2017.33). Cell lines selected for xenografts are depicted by their name. CHLA90, not in this dataset, is a MYCN non-amplified line. E) Glutamate levels in bilateral xenografts derived from neuroblastoma cell lines displayed by MYCN amplification status. **P < 0.01 , two-tailed paired t-test. Mean ± s.e.m., n - 4 each cell line. Data in A-C as in Figi B. n - 10 each group.
Figure 9: Metabolomic profiling of the TH-MYCN genetically engineered neuroblastoma model by liquid chromatography-mass spectrometry and neuroblastoma patient tumor gene expression. A) Glutamate levels across organs in TH-/WYC/VGEMM. Mean ± s.e.m., tumor glutamate n - 29, other organs n - 8-29. B) Relative metabolite levels across tumors harvested at early ( <50 mm3) compared to late timepoint in the TH-MYCN GEMM **P < 0.01 , ***P < 0.001 , Two-tailed t-test. Mean t s.e.m., early n - 10, late n - 14. D) Purine and pyrimidine metabolism gene expression displayed from MYCN non-amplified to amplified tumors (left to right). E) Differential gene expression between MYCN amplified I non-amplified primary human neuroblastoma tumors, with purine and pyrimidine metabolism denoted in red and dark red and all other genes in grey.
F) Arginine-proline-glutamine axis gene expression displayed from non-amplified to MYCN amplified tumors (left to right). G) Differential gene expression between MYCN amplified I nonamplified primary human neuroblastoma tumor, with arginine-proline-glutamine axis metabolism related genes denoted in red, MYCN in black and all other genes in grey. All gene expression graphs (D-G) are generated using data from neuroblastoma tumors taken from (Kocak et al., 2019 ibid). MYCN amplified n - 93, MYCN non-amplified n - 551. Abbreviation: GEMM, genetically- engineered mouse model.
Figure 10: Direct contribution of related metabolites and turnover flux in the TH-MYCN neuroblastoma model. A) Direct circulating nutrient contributions to metabolites of the arginine- proline-glutamine axis in the respective tissue. Contributions derived from [U-13C]-labelled tracer infusions as given in the legend, complementing Figure 2C. Mean ± s.e.m., tumor, pancreas, brain, serum n - 4-9; liver, muscle, kidney n - 3-7; small int. , spleen n - 1-3. B) Circulatory serum turnover flux, Fcirc of proline, arginine, ornithine, glutamine and glucose turnover fluxes. Mean ± s.e.m., proline n - 4, arginine n - 8, ornithine n - 6, glutamine n - 9, glucose n - 4. C) Steady -state wholebody flux model of interconversion between sources of circulating proline, ornithine, arginine, glutamine and glucose in nmol C/min/g. Fluxes above 1 nmol C/min/g are displayed. Abbreviation: Small int., small intestine.
Figure 11 : Proline and arginine nutrient depletion combined with DFMQ treatment abrogates tumor growth in MYCN amplified neuroblastoma. A) Kaplan-Meier plot of tumor-related death, uncensored, from control diet arm (CD), treatment with DFMO (CD DFMO) and proline and arginine dropout diet (ProArg) in the TH-MYCN mouse model. Log-rank test p-value compared to CD, *P < 0.05, **P < 0.01 , ***P < 0.001 , ****P < 0.0001 . B) Mouse day of life from CD, CD DFMO, ProArg and ProArg DFMO treatment arms. C) Tumor weight at death in grams from CD, CD DFMO, ProArg and ProArg DFMO treatment arms. D) Delayed tumor growth as shown by time to palpable tumor onset across CD, CD DFMO, ProArg and ProArg DFMO treatment arms. E) Mouse weight at death minus tumor weight in grams from CD, CD DFMO, ProArg and ProArg DFMO treatment arms. For B, C and E: two-tailed t-test compared to CD, *P < 0.05, **P < 0.01 , ***P < 0.001 , ****P < 0.0001 . All panels: CD n - 13, CD DFMO n - 14, ProArg n - 13, ProArg DFMO, n - 14. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Figure 12: Metabolite profiles of serum and tumor under dietary proline and arginine nutrient depletion and/or difluoromethylornithine (DFMO) treatment, with focus on urea cycle, nucleotides and arginine/proline related metabolites. A) Tumor intracellular metabolite levels normalized to control diet (CD). For each intervention, 6 mice are displayed, relative to the average level in 5 mice on CD. B) Serum levels of arginine, proline, glutamine and ornithine, compared to CD. C) Tumor levels of arginine, proline, glutamine and ornithine, compared to CD. D) Tumor levels of proline related metabolite, dipeptide glycol-l-proline and l-hydroxyproline, compared to CD. E) Tumor levels of acetylated polyamines, compared to CD. For A-E metabolomics was performed on advanced stage tumors (> 7 weeks for DFMO and/or ProArg DFMO). B-E: *P < 0.05, **P < 0.01 , ***P < 0.001 , ****p < 0.0001 , two-tailed t-test. Mean ± s.e.m., n = 5-6 mice. Technical replicates are averaged for each mouse. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Figure 13: Ribo-Seg Quality control. A) Read length frequency distribution of ribosome footprints of each measured sample showing no group specific differences. B) Periodicity by frame for each measured sample showing high frame 0 concordance across the cohort. Mean, n - 5 mice. C) Pairwise ribosome profile correlation between samples, n - 19. D) Nucleotide resolution indicating high periodicity of translation at the transcript 5’ comparing CD and ProArg DFMO samples. Mean, n - 5 mice. E) Nucleotide resolution indicating high periodicity of translation at the transcript 3’ and a termination defect of CD compared to ProArg DFMO. Mean, n - 4-5 mice. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Figure 14: Polyamine depletion causes codon specific translation defects. A) elF5A hypusination defects detected upon isoelectric focusing followed by immunoblotting. Tumors of ProArg and CD DFMO arms, showing defective hypusination in only one tumors from DFMO. Control cell line IMR5 as negative control (NC) and positive control (PC) treated with 7 days with 500 pM of DFMO. B) Count of tumors from all treatment arms with elF5A hypusination defects (in red) and no defect (in blue), evaluated by isoelectric focusing followed by immunoblotting. C) Translation defects are codon specific. Relative ribosome density on all amino acid codons in combined treatment (ProArg DFMO compared to CD). First letter of name denotes amino acid followed by codon encoding. D) Combined treatment specific effect induced pausing for codon with adenine at 3rd position at all site. The three tRNA-binding sites on the ribosome are the denoted as follow: aminoacyl (A) site, the peptidyl (P) site, and the exit (E) site. E) Diet effect (ProArg vs. CD) does not induce ribosome pausing at arginine and proline amino acid codons. F) Diet effect (ProArg vs. CD) in the ribosome P site is characterized by only a discrete ribosome pausing at arginine and proline amino acid codons but rather depends on nucleotide identity at the codon ending position. G) DFMO treatment effect (CD DFMO vs. CD) is characterized by ribosome pausing depending nucleotide at ending position in ribosome P site. C-G shows mean of n = 4-5 mice. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Figure 15: Proteomics quality control with evaluation of protein levels relation to proline content. A) Global proteomic signatures all treatment arms analyzed by principal component analysis. B) Number of proteins measured per treatment group. Mean ± s.e.m.. CD DFMO, ProArg and ProArg DFMO n=6; CD n=5. C) Data completeness of each proteomics analytical measurements, with percentage of protein captured by each sample. D) Distribution per sample of protein levels. LFQ: label-free quantification. E) Correlation between relative protein levels in combined treatment effect (ProArg DFMO vs. CD) to percentage of proline from all amino acids of each protein. F) Comparison of relative protein levels in combined treatment effect to the presence or absence of at least one poly-proline tract. Poly-proline tract are defined by having at least 3 prolines in a row. G) Comparison of relative protein levels in combined treatment effect to length of poly-proline tract in protein. H) Comparison of relative protein levels in combined treatment effect to number of polyproline tracts in protein. For A-H: CD DFMO, ProArg and ProArg DFMO n=6; CD n=5. Abbreviations: CD control diet; ProArg proline arginine deficient diet; DFMO difluoromethylornithine.
Figure 16: Targeting translation causes reprogramming of arqinine-proline-qlutamine axis and polyamine metabolism. A) Schematic of arginine-proline-glutamine axis, with the color of each protein indicating relative level ProArg DFMO vs. CD. B) Significantly changed proteins (p-adj < 0.05) from arginine-proline-glutamine axis in the comparison ProArg DFMO to CD. C) Polyamine biosynthesis protein levels across treatment groups, compared to CD. Tumors upregulate polyamine biosynthesis (Odd , Amd1 ). P-value comparing ProArg DFMO to CD and corrected for multiple hypothesis testing using a permutation-based FDR across all measured proteins and conditions. n= 5-6. D) Polyamine catabolism protein levels across treatment groups, compared to CD. E) Polyamine transport protein levels across treatment groups, compared to CD. C-F P-values (p-adj) displayed comparing ProArg DFMO to CD and corrected for multiple hypothesis testing using permutation across all measured proteins. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Figure 17: Adenosine ending codon frequency correlates with translation defects. A) Top downregulated and top upregulated Reactome pathways in the GSEA analysis on the protein level in double treatment comparison (ProArg DFMO vs. CD). B) Average percentage of adenine (A), thymidine (T), guanine (G) or cytosine (C) ending codons in Reactome pathways. Highlighted enriched pathways that are linked to ‘cell cycle’ and ‘neuronal system’ pathways are denoted using shades of red and blue. In grey are all the other pathways found in Reactome. C) Gene set enrichment analysis based on ranking genes by fraction (percentage) of A, T, G or C ending codons in each genes. Pathways with containing genes with a higher percentage of adenine-ending codons will be significantly enriched and will have a positive value, as seen with the ‘cell cycle’ pathway. D) Percentage of adenosine ending codons in a pathway correlates with protein levels, with mean percentage and levels across Reactome pathways. Pathways with increasing fraction of adenosine ending codons are more downregulated on the protein level. Red highlights the upregulated neuronal system and blue highlights the downregulated cell cycle. E) Average percentage of adenosine-ending codons in “neuronal system”, “cell cycle” and all Reactome pathways. F) Relative amino acid codon preference comparing cell cycle to whole transcriptome, where percentage highlights the utilization preference of the cell cycle genes to encode the same amino acid with A ending. G) Relative amino acid codon preference comparing selected cell cycle genes to whole transcriptome, where percentage highlights the utilization preference of the selected genes to encode the same amino acid with A ending. H) Relative amino acid codon preference comparing Cenpr to whole transcriptome, where percentage highlights the utilization preference of the Cenpr to encode the same amino acid with A ending. I) Percentage of codons with respective nucleotide at the ending position in Cep57, Hus1 and Kif2c. J) Percentage of codons with respective nucleotide at the ending position in transcriptome. K) Relative pausing sum of Cep57 and Kif2c, where the relative ribosome occupancy ratio between ProArg DFMO and CD are summed according to codon ending. Hus1 did not show sufficient coverage.
Figure 18: Targeting metabolic dependencies of translation affects hallmarks of cellular regulation. A) Hallmark gene set enrichment across omics layers. Displayed are all hallmarks in the ProArg DFMO vs. CD, CD DFMO vs. CD and ProArg vs. CD comparisons. Point size denotes the significance level and the color scale the normalized enrichment score (NES), with red representing higher and blue representing lower in the ProArg DFMO treatment arm. B) Mycn protein levels across treatment arms. P-value (p-adj) displayed comparing ProArg DFMO to CD and corrected for multiple hypothesis testing using permutation across all measured proteins. Abbreviations: CD, control diet; ProArg, proline arginine deficient diet; DFMO, difluoromethylornithine.
Examples
The results contained in the present specification show that simultaneous induction of translation stress by defined amino acid depletion combined with inhibition of eif5a hypusination by the clinically approved drug difluromethyl-ornithine inhibits tumour growth. In human primary neuroblastoma tumours and across mouse models, expression of the transcription factor MYCN correlates to high proline levels. In vivo stable isotope tracing identifies diet derived uptake of proline from the serum as the primary tumour source. Dietary depletion of the two non-essential amino acids proline and arginine, a polyamine biosynthesis precursor, impairs tumour growth. Cotreatment with difluromethyl-ornithine potentiates this effect by inducing deficient protein production through codon-specific ribosome stalling, affecting the MYC regulatory circuit in combination with global reprogramming of translation. The results contained herein therefore provide proof of concept for rational designed targeting of metabolic dependencies of translation to inhibit tumour growth in cancers dependent on external nutrient uptake.
Example 1: Primary tumors and models of MYCN-driven neuroblastoma show reprogrammed arqinine-proline-qlutamine axis.
In neuroblastoma, genomic amplification of MYCN, a member of the /WYC-family, serves worldwide as a biomarker of aggressive disease. Whereas the hallmarks of metabolic reprogramming in adult /WYC-driven cancers are well described to include increased glutamine catabolism and proline biosynthesis, the in vivo metabolic phenotype of MYCN-d riven neuroblastoma is less well understood. To address this, we performed an unbiased metabolomics screen for the metabolic fingerprint of primary human MYCN amplified neuroblastomas (Figure 1A). Compared with nonamplified tumors, proline was the single most differentially expressed metabolite (Figure 1 B). Along with high nucleotides and reduced alcohol sugars, this formed the characteristic metabolic signature of MYCN amplification (Figure 8A and Figure 8B). Neither glutamine nor arginine or other amino acids were similarly altered (Figure 1 C and 8C). Patient characteristics are given in Table 2. Bearing in mind the therapeutic relevance of the arginine-proline-glutamine axis for targeting polyamine metabolism, we next compared amino acid pool sizes in contralaterally implanted xenografts from high and low /WYC/V-expressing cell lines (Figure 8D). High MYCN xenografts also had significantly higher proline, and in addition higher glutamine levels, but no consistent changes in arginine or glutamate (Figure 1 D, Figure 8E). To circumvent cell lines’ potential in vitro selective pressures, we next evaluated the TH-MYCN genetically engineered mouse model (GEMM) that enforces Mycn expression in peripheral sympathoadrenal cells under the tyrosine hydroxylase promoter. Mice homozygous for the transgene (TH-/WYC/V+/+) develop tumors with 100% penetrance and early lethality. Quantitatively comparing tumors to normal organs showed that glutamine, arginine and glutamate (Figure 8A) were present within the physiological range. Proline, in contrast, was strikingly elevated to more than eight-fold higher in tumors than the average of any organ surveyed and 30-fold above brain as a reference neural tissue (Figure 1 E, Figure 9A). Proline was also markedly higher in late tumors (> 50 mm3) compared with early tumors (Figure 9B).
We next leveraged publicly available RNA-expression profiles of primary neuroblastomas, aiming to understand the reprogrammed metabolic networks that might drive these differences (Bermuda. J Nutr. 2004 Oct;134(10 Suppl):2741S-2897S; Kocak 2019, ibid). Consistent with the untargeted metabolomics, gene expression evidenced increased nucleotide biosynthesis of both purines and pyrimidines (Figure 9C and Figure 9D). Regarding the arginine-proline-glutamine axis, overexpression of proline biosynthetic genes was observed by differential expression analysis. Arginine and glutamine utilization were also upregulated, and ornithine amino transferase (OAT), the enzyme linking this metabolic axis, showed lower expression (Figure 9E and Figure 9F). We therefore hypothesized that MYCN-d riven neuroblastomas increase tumor proline levels by substantial upregulation of biosynthetic flux into this non-essential amino acid. To reveal potential therapeutic targets by identifying the interconversions along the arginine-proline-glutamine axis and the proline source, we aimed to functionally evaluate the whole-body metabolic network’s contributions to the tumor.
Example 2 In vivo stable isotope tracing identifies external nutrient dependency in MYCN amplified neuroblastoma
Having characterized metabolite pool size across the arginine-proline-glutamine axis, we set out to elucidate the quantitative nutrient sources by in vivo stable isotope tracing (Figure 2A). Using the TH-MYCN GEMM, we investigated the systemic contributions to intratumoral arginine, proline and glutamine. Both tumoral arginine (Figure 2B and Figure 2C) and glutamine (Figure 10A) were predominantly derived from uptake from the bloodstream. As glutamine has been shown to be a major precursor for proline in vitro, we hypothesized that M YCN drives proline accumulation by de novo biosynthesis via glutamine utilization. In contrast to gene expression data and prior reports, however, we likewise identified uptake from the serum, and therefore dietary intake, as the dominant proline source of tumors. Only glutamine contributed a relevant fraction (~ 20 %) to intratumoral proline. Other precursors, including ornithine through OAT, provided minor contributions (< 4 %; Figure 2C, Figure 10A). Other organs, including pancreas, the organ with the highest protein synthesis, showed comparable relative sources of proline, whereas neuronal tissue of the brain derived proline mainly from glucose (Figure 10A). Of note, intratumoral ornithine, the direct polyamine precursor, was derived from circulating ornithine, with no detectable direct intratumoral contribution from arginine, and minor contributions from other circulating nutrients (Figure 2B and Figure 2C). When calculating the total contribution, including its indirect contribution through serum ornithine, 75 % of intratumoral ornithine were derived from circulating arginine. Glutamine or proline through OAT did not contribute significantly (< 5 %). This indicates that OAT, a core linker enzyme in the arginine-proline-glutamine axis, is not active in neuroblastoma under the given metabolic state. The disconnect in the axis and creates a dependency on circulating nutrient supply on both sides of OAT (Figure 1 F). Modelling of metabolite turnover and interconversion fluxes related to the arginine-proline-glutamine axis quantitatively confirmed dietary uptake or body protein stores as the primary source of the non-essential amino acids, proline and arginine (Figure 2D, Figure 10B and Figure 10C). Ornithine itself did not contribute relevantly to proline, arginine or glutamine pools, so we hypothesized ornithine is used for polyamine biosynthesis via Ode.
Example 3: Targeting metabolic dependencies in neuroblastoma
Hypothesizing that this uptake dependency indicates an exploitable metabolic vulnerability, we next harnessed it for targeting the arginine-proline-glutamine axis in MYCN- riven neuroblastoma. As circulating arginine and proline were identified to be the primary sources of tumor arginine, ornithine and proline, we sought to reduce their availability in the serum by removal from the diet. Ornithine is the direct precursor for intratumoral polyamine biosynthesis via Ode, a key contributor to Myc oncogenicity. The ultrashort half-life of Ode makes its complete pharmacologic inhibition challenging, but simultaneously reducing ornithine substrate availability may augment polyamine depletion and enhance anti-tumor activity. We therefore combined dietary amino acid depletion with the Ode inhibitor DFMO in a 2 x 2 factorial design (Figure 3A). As for the single interventions, mice fed the proline and arginine depleted diet alone (ProArg) showed reduced neuroblastoma growth compared to control diet (CD), but without an effect on overall survival (Figure 3B-C). Inhibition of polyamine biosynthesis by DFMO extended survival (Figure 3B and Figure 11 A). For the two mice with prolonged survival, tumor progression was observed after treatment cessation. Most importantly, adding the ProArg diet to DFMO significantly enhanced its effect, inducing a marked survival benefit (Figure 3B and Figure 11 B), reduced tumor growth (Figure 3C and Figure 11 C), and increased time to palpable tumor (Figure 11 D). Four mice in the ProArg DFMO regimen had extended survival, with three of them remaining tumor-free as confirmed via necropsy. While the ProArg depletion caused a reduction in mouse weight, this did not affect survival (Figure 11 E). In summary, DFMO, a clinically-approved Ode inhibitor being investigated for cancer indications, combined with dietary depletion of the two non-essential amino acids arginine and proline significantly augments anti-tumor activity with ~ 20 % of treated mice remaining tumor free 100 days beyond the end of therapy.
Example 4: Depletion of dietary arginine and proline reduces circulatory tumor nutrient supply
To understand the mechanisms underlying this anti-tumor activity, we evaluated the metabolic reprogramming induced by dietary ProArg depletion and/or DFMO treatment by an unbiased metabolomics screen of mouse serum. DFMO alone did not alter circulating metabolite profiles, except for reduced citrulline (Figure 4A). In contrast, dietary depletion of ProArg alone or when combined with DFMO achieved significant circulatory depletion of both proline and arginine to less than half of the CD concentration. In further support of a whole-body metabolic effect, circulating ornithine, citrulline and hydroxyproline were also reduced (Figure 4B-C), while serum glutamine was increased. As many ProArg DFMO treated mice had very small or absent tumors at end-point (Figure 11C) we delayed the treatment to day 28 and harvested tumors at the onset of palpable tumor. Compared to serum, tumors partially compensated for circulatory nutrient depletion, indicated by the reduced fold-change in metabolite depletion. Still, both arginine and proline were significantly reduced, and the reduced substrate availability indirectly depleted tumor ornithine, supporting a dietary effect on the intratumoral axis (Figure 4D and Figure 4E). This reprogramming occurred despite increased intratumoral precursor levels in the form of glutamine upon ProArg depletion, supporting subtotal equilibration along the arginine-proline-glutamine axis (Figure 4E). As indicated by in vivo stable isotope tracing, this further highlights a nutrient uptake dependency of proline, arginine and ornithine in neuroblastoma. Assessing metabolite levels in tumors, which arose much later due to early therapy start as in the survival trial, showed normalized proline levels, whereas arginine and ornithine remained reduced (Figure 12A-C). Concomitantly the proline dipeptide glycyl-proline accumulated, and the mature collagen breakdown product hydroxyproline showed decreased levels (Figure 12D). This combination hints towards defective collagen biosynthesis with an accumulation of precursors and reduced mature collagen breakdown products.
To isolate the effect of the ProArg diet on tumoral polyamine depletion by DFMO, we next performed targeted measurements across groups (Figure 4F). This revealed a significant reduction of putrescine, the direct product from ornithine decarboxylation by Ode, and its derivatives such as spermidine in tumors of both DFMO treatment (Figure 4F). More importantly, adding the ProArg intervention potentiated the DFMO effect to further decrease polyamine levels, including a >2-fold reduction in spermidine (Figure 4F). N1-acetyl-spermidine and N1 ,N8-diacetyl-spermidine were unchanged (Figure 12D). Depletion of proline and arginine from the diet therefore targets the arginine-proline-glutamine axis by reducing intratumoral amino acid availability. The dual amino acid depletion additionally decreases ornithine availability to potentiate the effect of DFMO leading to enhanced tumoral polyamine depletion and anti-tumor activity.
Example 5: Dietary amino acid depletion enhances the translation defects induced by DFMO
Polyamines stimulate translation and cell growth. Their role in protein synthesis at transcript and codon resolution, however, remains unknown. We therefore used Ribo-seq to assess the impact of ProArg dietary depletion and DFMO on translation. This tool allows to probe transcriptome-wide protein synthesis by mapping ribosome footprints at high resolution (Figure 5A). Disrupted translation dynamics are detected as ribosome occupancy changes. Uniform coverage and optimal read phasing were technically achieved (Figures 13A-E). On the global level, therapeutic interventions caused distinct translation defects as indicated by a change in average ribosome occupancy distribution across protein coding transcripts (Figure 5B). Whereas increased ribosome occupancy was observed at the start codon, ribosome density at post-initiation and early elongation showed graded reductions from CD, ProArg, CD DFMO to ProArg DFMO-treated tumors. In contrast, exclusively observed in the ProArg DFMO treatment group ribosomes accumulated at the stop codons, indicating defective ribosome release (Figure 5B). As elongation and termination defects have been reported in cell models lacking Eif5a or with reduced Eif5a hypusination, this suggested a preferential in vivo functional Eif5a defect in the combined ProArg DFMO treatment arm. To assess whether intratumoral polyamine depletion might lead to substrate deprivation (spermidine) for Eif5a hypusination, we assessed its modification status across treatments (Figure 5C and Figure 14A-B). All tumors from the CD and ProArg groups demonstrated complete Eif5a hypusination, reflecting spermidine sufficiency. Only 1 of 7 DFMO treated tumors had incompletely hypusinated Eif5a detected, whereas more than half (5 of 9) in the ProArg DFMO group showed incomplete hypusination, likely reflecting the more profound spermidine depletion (Figure 4G).
Eif5a has been canonically implicated in facilitating peptide bond formation involving repetitive instances of the amino acid proline, termed poly-proline tracts. Due to its reactive amine localized within a ring structure, proline is a poor peptidyl acceptor. We thus investigated by evaluating relative ribosome occupancy, whether the translation speed of poly-proline tracts was changed. In this context, high occupancy indicates slow decoding by ribosomes. Consistent with functional deficiency of Eif5a, increased occupancy was observed at poly-proline tracts within ProArg DFMO treated tumors (Figure 5D, Figure 15A). Thus, further supporting lower spermidine levels under combined treatment impeding Eif5a function.
More intriguingly, proline codons, both within and independent of poly-proline tracts, showed occupancy changes that depended even more prominently on codon identity rather than the amino acid. Of the four proline codons, CCA showed the most notable pausing phenotype, with less pausing for CCC and no pausing for CCG or CCT (Figure 4E). This indicated an additional unanticipated level of regulation at the individual codon, rather than the amino acid level. To exclude a diet effect, we isolated the consequences of dietary proline and arginine depletion on ribosome pausing. Whereas a tendency to increased occupancy at proline and arginine codons were observed, likely induced by the reduced amino acid availability, this intervention did not cause preferential ribosome pausing at adenosine-ending codons (Figure 15E-F).
Example 6: Polyamine depletion causes defective decoding of adenosine ending codons
We next assessed the combined treatment effect globally across all codons at high resolution. Strikingly, codon specific occupancy showed a major ribosome pausing effect driven by the codon type rather than amino acid identity. When sorting individual codons by relative occupancy, the primary factor determining translation speed was the nucleotide at the third position. Whereas adenine-ending (A-ending) codons showed increased occupancy in ProArg DFMO tumors, occupancy at guanine-ending (G-ending) codons was markedly decreased (Fig 5F and Figure 14C). The same phenotype, with a reduced effect size, was shown for the DFMO monotherapy group, suggesting a previously unknown role of polyamines in the decoding of codons with adenosine at the ending position, also called the wobble position (Figure 5G and Figure 14D-G). This difficulty in translating A-ending codons was observed at all three ribosome sites (A, P and E) supporting globally disturbed kinetics (Figure 14D). Together, reducing dietary arginine and proline availability enhanced polyamine depletion to alter Eif5a hypusination and function. This leads to canonical translation phenotypes of Eif5a deficiency including elongation and termination defects, as well as reduced decoding speed of poly-proline tracts. Whereas isolating the diet effect at the codon level indicated a mild pausing at arginine and proline codons, the dominant effect was a defective decoding of A-ending codons that correlated with the degree of polyamine depletion. While interactions of polyamines with ribosomes and tRNAs have been previously described and well documented to stimulate translation in vitro (Dever TE et al., J Biol Chem. 2018 Nov 30;293(48):18719-18729. doi: 10.1074/jbc.TM118.003338. Epub 2018 Oct 15), the codon resolution phenotype and in vivo mechanism have not previously been described.
Example 7 Combined targeting of translation affects cellular programs on the ribosome and protein level
To better understand the phenotypic consequences induced by this specific translation defect, we integrated unbiased protein quantification (LC-MS based proteomics; QC data in Figure 15) to complement gene expression (RNA-seq) and ribosome profiling (Ribo-Seq). We then performed differential analysis for each treatment group to reveal global reprogramming across the omics, as derived from the number of significantly changing transcripts, ribosome footprint densities and proteins (Figure 6A). The observed gene expression changes were largely overlapping between the ProArg DFMO and the CD DFMO tumors when compared with CD treatment, reflecting the ProArg diet inducing only minor DFMO independent changes. In stark contrast, both Ribo-Seq and proteomics revealed predominant reprogramming unique to the ProArg DFMO intervention group, as evident from the large fraction of significant changes exclusive to tumors treated with the combination. The effect was independent from proline or poly-proline abundance in the proteins (Figure 15E-H), suggesting an independent mechanism driving this phenotype This further supported the observation of combined ProArg DFMO treatment affecting protein biosynthesis in neuroblastomas, as suggested by the high-resolution phenotypes identified by Ribo-Seq.
Therapeutic interventions targeting metabolism often induce adaptive responses in related pathway. We therefore leveraged the proteomics to investigate reprogramming of the arginine- proline-glutamine axis under combined treatment (Figure 16A). Significant upregulation of proline transport (Slc6a17), arginine biosynthesis (Als1 ), and glutaminolysis (GIs) was observed, in addition to downregulation of arginine catabolism (Arg1 ) (Figure 16B). Polyamine metabolism itself is tightly controlled by translational regulation. Investigating the tumor response to reduced polyamine levels revealed a significant increase in key pathway elements for biosynthesis, without changes in transport or catabolism (Figure 16B-F). To further dissect the cellular reprograming we performed enrichment analysis based on the Reactome database gene sets. This revealed “cell cycle” on the protein level to be the most downregulated program despite having unchanged RNA expression. This protein-RNA discordance further evidences predominant regulation at the translation level (Figure 6B and Figure 17A). Other processes, such as ‘rRNA processing’ were consistently suppressed, indicating an active regulation of the translation machinery across levels. The most upregulated gene sets ‘neuronal system’ and 'neurotransmitter receptors and postsynaptic signal transmission’ both link combined ProArg DFMO treatment to neural differentiation and neuronal cell identity.
We then assessed whether the observed regulation within specific gene sets correlates to its translation defects. Based on the impaired decoding of adenine-ending codons (Figure 5F), we hypothesized that pathways containing genes with a higher frequency of adenine-ending codons would show slower translation due to ribosome pausing. Indeed, a significant inverse correlation was identified between the enrichment (Figure 6C and 17A-B) or frequency (Figure 17C-E) of adenine ending codons in Reactome pathway gene sets and their average enrichment (Figure 6C) or fold change (Figure 17D) on the protein level, respectively. More precisely, across all gene sets, ‘cell cycle’ was the most significantly enriched in adenosine ending codons (Figure 17A) with on average 21 .0% of codons. This contrasted to ‘neuronal system’ (15.9%) at the opposite end of the spectrum (Figure 17A-E). Congruently, cell cycle proteins were largely reduced in the combined ProArg DFMO treatment. Four proteins related to mitosis showed globally the strongest effect size, namely centromere protein R (Cenpr), clamp component (Hus1 ), centrosomal protein 57 (Cep57), and kinesin family member 2C (Kif2C) (Figure 6D). As compared to DFMO monotherapy, the combined treatment enhanced the reduction and confirmed at least additive effect of the diet in impairing the cell cycle, particularly for a subset of proteins (Figure 6E). Evaluating these across the omics layers revealed the major effect is at the protein level, without changes in gene expression (Figure 6F).
Next, we focused on the most affected cell cycle protein, Cenpr, to assess its translation phenotype at high resolution. Cenpr contains a remarkably shifted distribution in codon composition with 38.6 % of codons ending with adenosine, as opposed to 18.8% across all protein coding transcripts (Figure 6G, Figure 17G and Figure 17J). When evaluating relative ribosome distribution along the Cenpr coding sequence, more frequent ribosome pausing was highlighted at adenosine ending codons as compared to codons with non-adenosine nucleotides at the ending positions in ProArg DFMO compared to CD (Figure 6H).
Upon quantification the intervention resulted in a significantly increased relative ribosomal pausing sum at adenine-ending codons and reduced pausing at guanosine-ending codons, indicating a codon specific translation defect (Figure 6H-I). Similar results were observed for Cep57 and Kif2c, with high adenine relative pausing, whereas Hus1 did not reach sufficient coverage (Figure 17H - K). To assess the impact of diet and/or DFMO on cell cycle progression we used Ki67, a clinical marker of cell proliferation, on TH-MYCN tumors and confirmed a significant decrease in actively cycling cells in the combined treatment group. Thus, in summary, ribosome pausing caused by impaired decoding of adenosine ending codons likely contributes to a translation defect impairing cell cycle.
Example 8: Disruption of core oncogenic programs is accompanied by neuronal differentiation
Focusing more on overarching cellular programs affected by treatment, we next performed enrichment analysis for the Hallmarks gene-set across conditions and omics layers. This again highlighted a predominant effect at the translation and proteome level, as indicated by significant reprogramming specifically on those levels (Figure 7A and Figure 18A). Combining DFMO with ProArg depletion induced gene sets indirectly associated with neuronal differentiation (Figure 7A- B). Cell growth and MYC target activation signatures were impaired (Figure 7A and Figure 7C). Neither of the two single treatment arms displayed this response pattern (Figure 7A and Figure 18A). Thus, addition of a defined amino acid diet to DFMO treatment boosts disruption of protein homeostasis to inhibit cancer cell proliferation and the /WYC/V-related oncogene program.
Given the essential role of MYCN in the development and maintenance of neuroblastoma, we asked whether the loss of “MYC targets” under combined treatment indicates a disruption of the neuroblastoma adrenergic core regulatory circuit. Unexpectedly, a significant upregulation of MYCN mRNA expression was detected in tumors upon treatment (Figure 7E). Aligned with the enrichment analysis, however, Mycn protein showed an opposite trend to downregulation in the combined ProArg DFMO treatment group on proteomics (Figure 7E-F and Figure 16H). Immunoblot and Immunohistochemistry analysis confirmed this downregulation of Mycn, the principal core regulatory circuit driver, on the protein level in the combined treatment. Expanding the analysis to additional core transcription factors supported a broad disruption of the adrenergic regulatory circuit (Figure 7G), including the recently nominated adrenergic Sox11 protein. In line with Mycn, this was partially driven by asymmetric RNA-protein relations with predominant effects at the protein level, suggesting regulation on the translation or proteome level (Isl1 , Phox2b and Gata3). As changes in any member of this feed-forward autoregulation circuitry can alter its stability, these results indicate a potential novel approach of targeting this essential element in neuroblastoma (Figure 6G).
A special feature of pediatric cancers is their arrest in an undifferentiated state. Inducing differentiation with drugs, such as retinoic acid in neuroblastoma, is a central treatment element. Given our finding of increased neuronal signatures, changes in cell cycle, and adrenergic core regulatory circuitry disruption, we hypothesized that the combined treatment induces neuronal differentiation. We therefore evaluated the tumor differentiation status on histology by H&E staining, according to clinical pathological criteria. This revealed a strong differentiation phenotype in ProArg DFMO treated tumors, as all CD and ProArg tumors had absent neuropil, a feature of neuronal differentiation, and were undifferentiated (<5% differentiated). In contrast, one third of CD DFMO treated tumors were differentiating (>5%) with abundant neuropil, and two thirds of ProArg DFMO treated tumors were differentiating or partially differentiated with abundant neuropil (Figure 7I). Together, the treatment combination of DFMO and a ProArg depleted diet led to marked reductions in polyamines, inducing selective translation defects. This results in a reduced translation of cell cycle genes and induction of neuronal programs, inducing tumor differentiation and extending survival. Example 9: Discussion
Cancer cell metabolism, and therefore tumor growth, depends on nutrients supplied by the host. Systematic approaches to identify such interventions are crucial. Our screen for metabolic changes associated with activated MYCN in neuroblastoma highlighted the arginine-proline-glutamine axis across patient samples and tumor models. Importantly, using stable isotope tracing, we found that uptake from the bloodstream is the primary source of all three amino acids. This finding complements evidence that MYC(N) boosts glutamine metabolism and proline de novo biosynthesis in vitro, as well as the accumulation of proline derived from de novo biosynthesis in anchorage independent growth. Upon dietary depletion of proline and arginine, we found that neuroblastomas fail to sufficiently compensate these deficiencies despite increased intratumoral glutamine levels and gene expression supporting biosynthesis. This failure of metabolic equilibration along the arginine-proline-glutamine axis further highlights a dependency on uptake from circulation. De novo biosynthesis from glutamine is therefore not a universally sufficient source of proline across /WYC-driven cancers likely reflects the physiological contributions in the in vivo setting, where proline can be limiting. Our work thereby provides a first quantitative map of metabolic exchange across the arginine-proline-glutamine axis and the host-tumor network of neuroblastoma.
Dissecting this axis in pancreatic cancer has recently highlighted glutamine as the primary source of ornithine, via intratumoral ornithine aminotransferase activity (Oat) and supported Oat inhibition as a therapeutic strategy. In contrast, in vivo tracing in neuroblastomas identified direct ornithine uptake from circulation rather than intratumoral conversion from precursors of the arginine-proline- glutamine axis. Systemically, ornithine was primarily derived from arginine to feed polyamine synthesis via Ode activity and support tumor progression . The irreversible Ode inhibitor DFMO is under clinical evaluation for neuroblastoma, as high dose DFMO extends survival in preclinical models. To leverage the newly discovered metabolic dependency, we depleted arginine and proline in combination with pharmacological targeting of Ode by DFMO, which led to significantly enhanced polyamine depletion and anti-tumor activity. In this setting, dietary nutrient depletion is an attractive option over enzymatic depletion as it simultaneously deprives related metabolites including ornithine from circulation. Importantly, the combined removal of both non-essential amino acids minimizes interconversions. In contrast, enzymatic conversions by means such as arginase would increase ornithine in circulation and therefore substrate provision for polyamine production. We envision an increasing role for the diagnostic use of stable isotope tracing to characterize cancers. Such application identifies real-life tumor biosynthetic activity and nutrient uptake dependencies directly in the context of patient specific metabolism. It harbors the potential to guide therapy approaches involving nutrient depletion by means of dietary interventions or pharmacologic modalities to optimize combination therapies.
In this work we take a mechanistically independent approach by combining dietary intervention with DFMO to target protein biosynthesis, rather than nucleotide metabolism. DFMO monotherapy has mainly failed to deliver relevant clinical impact due to unfavorable pharmacokinetics for this covalent inhibitor of Ode, which has one of the shortest half-lives in the human proteome. To enhance DFMO efficacy, we systematically introduced a new line of combined treatment to deprive Ode substrate availability by depletion of intratumoral and whole-body ornithine. Our data indicate a potent reduction in tumor polyamines compared exceeding other combined methods (DFMO plus AMXT or SAM486). Thus, the decreased nutrient availability shifted the metabolic state of the host to be exploited by combination therapy with a metabolism targeted drug. Although diet alone caused systemic metabolic reprogramming of the arginine-proline-glutamine axis, it failed to prolong survival as the tumors sufficiently replenish nutrient pools. This exemplifies the abilities to overcome targeted dietary interventions by rewiring nutrient resources through interconnections of the organismal and cancer metabolic networks. It also contrasts studies showing reduced growth in defined cancers upon single amino acid depletion of arginine.
Across all levels of the central dogma, reprogramming of the proteome was the primary effect of amino acid depletion, when introduced on top of DFMO. Dietary depletion of proline and arginine alone had minimal impact on the tumors, indicating that the systemic activity might be dependent on ornithine depletion, rather than a direct amino acid effect. Whereas monotherapy of DFMO similarly altered mRNA expression, we found enhanced proteome disruption specifically under combined treatment. Surprisingly, the underlying translation defect is dominated by a reduced decoding speed of adenosine-ending codons with the ribosome pausing being largely independent of the type of amino acid encoded. The same applied to features of classic eif5A deficiency. Whereas it is expected that a hypusination defect of eif5a would similarly affect all four proline codons, a strong preference for CCA pausing was observed, the only adenosine-ending codon encoding for proline. This applies to proline codons both, within and outside of poly proline tracts, suggesting an eif5a independent polyamine depletion effect. The link to polyamines, is additionally highlighted by pausing at adenosine ending codons without evidence for elF5A deficiency in DFMO monotherapy. We therefore identify a novel in vivo translation defect beyond classic elF5A deficiency. This suggests a first functional readout of polyamine depletion and therefore the clinically used drug DFMO on translation.
Reaching up to millimolar intracellular concentrations, polyamines form specific and non-specific interactions to facilitate translation. Despite the wealth of information on functional consequences of eif5a deficiency, codon resolution translation profiles of polyamine depletion have not been reported earlier. Besides binding covalently to eif5a, polyamines ionically associate to a variety of negatively charged macromolecules including mRNA, rRNA and tRNAs. In this role polyamines associate with the ribosomes in the several hundreds with their importance being mechanistically highlighted in in vitro translation systems, where they are an essential ingredient to allow translation independent of elF5A hypusination. However, it is not conclusively clear how polyamines ensure ribosome function in this setting. They have also been described in facilitating decoding of noncognate codons in bacteria in vivo by different mechanisms involving tRNA-mRNA interactions. The observation of ribosomal decoding being predominantly dysfunctional at adenosine-ending codons strongly indicates a role of polyamines excreted in a codon specific manner. It thereby seems to facilitate decoding of adenosine ending codons by acting directly on the ribosome-tRNA- mRNa complex or the modification of tRNAs at the U34 position. We thereby provide a first hint how polyamines functionally ensure ribosome processivity. Going forward, it will be important to further delineate the molecular basis of polyamine depletion and reduced processivity decoding of adenosine ending codons.
The reprogramming of biological processes included a downregulation of cell cycle proteins and Myc regulated targets, opposed to increased neuronal differentiation. These processes were primarily affected on the proteome level, as opposed to being driven by gene expression regulation. Mechanistically, this regulation correlated to the content of adenosine-ending codons directly linking it to the translation defects introduced by ribosome pausing under combined treatment. Phenotypically, effects on cycle have been described upon polyamine depletion and similarly genomic deletion of elF5A in a MYC-driven lymphoma model. Both observations reflect polyamine related phenotypes, with the ribosome profiling mechanistically revealing dysfunctional decoding of adenosine-ending codons driven by polyamine depletion. Interestingly, both in vivo assessments were based on independent MYC-driven models. Across cancer types MYC overactivation is related to poor outcome making such therapeutic vulnerability highly relevant. In Neuroblastoma MYCN expression maintains a transcription factor circuit arresting cancer cells in an undifferentiated state. MYC(N) is traditionally regarded as a difficult to target protein with several attempts to directly target Mycn or other elements of this circuitry having failed. We provide evidence for targeting the expression circuit on the translation level, likely contributing to the differentiation phenotype. Combined treatments can therefore be envisioned to enhance differentiation to leverage this validated mechanism.
In summary, we identified metabolic dependencies of /WYC/V-amplified neuroblastoma, where dietary depletion of non-essential amino acids potentiated the efficacy of the polyamine biosynthesis inhibitor DFMO. We thereby designed a new diet-drug combination therapy for defined metabolite depletion, reducing substrate availability for polyamine biosynthesis. Complementary to other dietary approaches we thereby achieved targeting of protein biosynthesis, rather than nucleotide biosynthetic processes opening potential new therapeutic avenues for neuroblastoma and beyond.
Example 10: Material and Methods
Resources
Table 1 : Key resource table
Primary neuroblastoma tumour samples
Flash-frozen primary neuroblastoma tumor samples were provided by the Children’s Oncology Group (COG) under study number ANBL16B2-Q. International Neuroblastoma Pathology Classification (INPC) histologic parameters. Histology of poorly differentiated neuroblastoma, MYCN amplification status, age, and stage and pathologic classification for every patient was obtained centrally via COG testing and review. Tumor cell content of analyzed samples was confirmed as > 80% percent. Patient and tumor characteristics are given in Table 2. Water soluble metabolites were extracted and analyzed as described below.
Mouse models
Animal studies followed protocols approved by the Princeton University and Children’s Hospital of Philadelphia Institutional Animal Care and Use Committees. For xenografts, cancer cell lines were grown in RPMI supplemented with 10% FBS and 0.01 % insulin/transferrin solution. Cell lines were provided by the Children’s Oncology Group Cell Culture Repository: LA-N-5, SMS-SAN, CHLA-90 and SK-N-SH. All cell lines repeatedly tested negative for Mycoplasma. Subcutaneous xenografts were established on 6-week old female CD1-nu mice by injection of 10Oul 50/50 RPMI/Matrigel solution containing 10A6 cells of the respective cell line. The TH-MYCN mouse model was used as a primary model to investigate the functional changes of metabolism driven by MYCN. 129x1/SvJ mice transgenic for the TH-MYCN construct were originally obtained from Bill Weiss (University of California, San Francisco). TH-MYCN hemizygous mice were bred and litters randomized to assigned therapy. Mice were genotyped from tail-snip-isolated DNA using qPCR and only transgene homozygous mice (TH-MYCN+/+) were included in these studies. In this model, MYCN expression is targeted to the murine neural crest under the tyrosine hydroxylase promoter recapitulating the lethal hallmark features of human neuroblastoma.
Infusion studies in TH-MYCN
TH-MYCN mice were housed in groups and food was supplied without restriction to guarantee sufficient supply. Mice weights were recorded every day. During experiments mice were freely moving and tissues and serum was analysed following the above mentioned method. Tumor and inter organ cooperativity in proline biosynthesis as well as energy production was analysed on whole body level. The mice were on normal light cycle (7 AM - 7 PM). In vivo infusion was performed on 6-7-week old normal TH-MYCN mice pre-catheterized on the right jugular vein and 13C metabolite tracers were infused for 2.5-5 h to achieve isotopic pseudo-steady state. The mouse infusion setup included a tether and swivel system, connecting to the button pre-implanted under the back skin of mice. Mice were fasted from 9:00 am to 2 pm and infused from 2pm till 4:30 pm. Tracers were dissolved in saline and infused via the catheter at a constant rate (0.1 pl/min/g mouse weight) using a Just infusion Syringe Pump. 100mM [U-13C]glutamine was dissolved and infused for 2.5 hours, 40mM [U-13C] arginine for 5 hours, 200mM [U-13C]glucose for 5 hours, 10mM [U- 13C]proline for 5 hours and 5mM [U-13C]ornithine for 5 hours. At the end of infusion, mice were dissected and tissues were clamped in aluminum foil and stored in liquid nitrogen.
Intervention study in TH-MYCN
Arginine and Proline drop-out diet was purchased from TestDiet® Baker under the catalog number 1812426 (5CC7) for control diet and 1816284-203 (5WYF) for arginine I proline deficient diet. The ODC-inhibitor, DFMO, was obtained from Pat Woster (Medical University of South Carolina). DFMO was dissolved in drinking water and supplied to mice ad libitum at a dose of 1 % in the drinking water. Survival end-point. TH-MYCN+/+ mice were randomized to DFMO or no DFMO at birth, and diets changed to amino acid-based control diet or arginine I proline deficient diet at day 21 , per treatment assignment. Mice were weighed and assessed for tumor growth and symptoms, at least thrice weekly. Mice were euthanized for pre-defined humane endpoints related to overal health or tumor burden: hunching, immobility, gait disturbance, poor weight maintenance, discoloration or distress. Early take-down: TH-MYCN+/+ mice were treated as above, serum was obtained at day 43 (+/- 2 days) and tumors and organs harvested at that time if tumor present, or delayed to the earliest time a tumor became palpable. Time to tumor harvest varied based on the treatment group. Late intervention, early take-dow Additional TH-MYCN+/+ mice were assigned to delayed DFMO and diet change to day 28 to enable assessment of metabolomic changes in tumors at earlier time-points prior to metabolic adaptation.
Polyamine quantification
Polyamine concentrations were quantified using the AccQ-Tag fluorescence dye (Waters) as described by Yang et al. (Yang Y et al., Mol Microbiol. 2015 Jun;96(6):1272-82. doi: 10.1111/mmi.13006). Derivatives were separated on an Acquity BEH C18 column (150 mm x 2.1 mm, 1.7 pm, Waters) by reverse phase UPLC (Acquity H-class UPLC system, Acquity FLR detector, Waters). The column was equilibrated with buffer A (140 mM sodium acetate pH 6.3, 7 mM triethanolamine) at a flow rate of 0.45 ml min-1 and heated at 42°C. Pure acetonitrile served as buffer B. The gradient was produced by the following concentration changes: 1 min 8% B, 7 min 9% B, 7.3 min 15% B, 12.2 min 18% B, 13.1 min 41 % B, 15.1 min 80% B, hold for 2.2 min, and return to 8% B in 1.7 min. Chromatograms were recorded and processed with the Empowers software (Waters). For acetylated polyamines a MS/MS method was used. In brief, a Waters Acquity l-class Plus UPLC system (Binary Solvent Manager, thermostatic Column Manager and FTN Sample Manager) (Waters, USA) coupled to an QTRAP 6500+ (Sciex, USA) mass spectrometer with electrospray ionization (ESI) source was used. Data acquisition was performed with Analyst (Sciex, USA) while data quantification were performed with the SciexOS software suite (Sciex, USA). Chromatography was made on an Acquity HSS T3 column (150 mm x 2.1 mm, 1.7 pm, Waters) kept at 20 °C and a flow rate of 0.3 ml/min. Eluent A consisted of water with 0,1 % formic acid and eluent B in ACN with 0,1 % formic acid. Gradient elution consisted in changing %B as follows: 0- 1 min 0% ; 5 min 20%; 5, 5-7, 5 min 100%, and 8-10 min 0%. The ion source settings were as follow: curtain gas: 30 psi; collision gas: low; ion spray: 4500 V; source temperature: 500°C; ion source gas 1 : 40 (GS1 ) and ion source gas 2: 50 (GS2). All compounds were measured in positive electrospray ion mode.
Xenograft cell lines:
Cancer cell lines were grown with RPMI + 10% FBS and 0.01 % insulin/transferrin solution. Cell lines were from the childhood cancer repository of the Children’s oncology group. Cell line characteristics are given in the following: name (MYCN amplification status: A = amplified, N = nonamplified): SK-N-BE(1 ) (A), SK-N-BE(2) (A), SK-N-BE(2)-C (A), LA-N-5 (A, p53?, 100, Dx), CHLA- 136 (A, p53F, 44, PD), COG-N-415 (A,p53N, 50, PD) .SMS-SAN (A,p53F, 71 , DX), SH-SY5Y (N, p53F, Dx), LA-N-6 (N,p53F,150, PD), COG-N-291 (N,p53N,224, PD), CHLA-90 (N,p53N,59, PD) and CHLA-15 (N,p53F,21 , Dx). SK-NS-H (N) and SHEP (N) provided by the Hogarty Lab. All cell lines were repeatedly tested negative for Mycoplasma. Subcutaneous xenografts were established on 6-week old female CD1-nu mice by injection of 10Oul 50/50 RPMI/Matrigel solution containing 10A6 cells of the respective cell line.
Metabolite extraction from tissue, tumours and serum:
Tissues and tumors were collected from mice in fed state and immediately clamped into liquid nitrogen using Wollenberger clamp. All tissues were stored in -80°C. Frozen tissues were transferred into 2 ml Eppendorf tubes, which were precooled on dry ice, and pulverized by using Cyromill. The resulting tissue powder was weighed (around 10mg) and mixed well by vortexing in extraction buffer (40 pL extraction buffer per mg tissue). The extraction solution was neutralized with NH4HCO3 as above and centrifuged in a microfuge at maximum speed for 30 min at 4°C. Supernatant was transferred to LC-MS vials for analysis. Blood samples were drawn from mouse tail veins using a microvette and kept on ice. After centrifugation (10 min, benchtop microfuge maximum speed, 4°C), serum was collected in a 1 .5ml tube and store in -80 °C for future analysis. 5 pl of serum were mixed with 200 pl of extraction buffer (40:40:20 acetonitrile: methanol: water with 0.5% formic acid) and neutralized with 15% NH4HCO3. After centrifugation (30 min, benchtop microfuge maximum speed, 4°C), supernatant was transferred into LC-MS vial for analysis.
Metabolite measurement by liquid chromatography-mass spectrometry:
Metabolomics was performed on the following systems. A quadrupole-orbitrap mass spectrometer (Q Exactive, Thermo Fisher Scientific), operating in positive or negative mode was coupled to hydrophilic interaction chromatography (HILIC) via electrospray ionization. Scans were performed from m/z 70 to 1000 at 1 Hz and 140 000 resolution. LC separation was on a XBridge BEH Amide column using a gradient of solvent A (20 mM ammonium acetate, 20 mM ammounium hydroxide in 95:5 wateracetonitrile, pH 9.45) and solvent B (acetonitrile). Flow rate was 150 mL/min. The LC gradient was: 0 min, 85% B; 2 min, 85% B; 3 min, 80% B; 5 min, 80% B; 6 min, 75% B; 7 min, 75% B; 8 min, 70% B; 9 min, 70% B; 10 min, 50% B; 12 min, 50% B; 13 min, 25% B; 16 min, 25% B; 18 min, 0% B; 23 min, 0% B; 24 min, 85% B. Autosampler temperature was 5°C, and injection volume was 5-10 uL. Complementary, primary samples analyzed on an Exactive (Thermo Fisher Scientifc) operating in negative ion mode. Liquid chromatography separation was achieved on a Synergy Hydro-RP column (100 mm x 2 mm, 2.5 pm particle size, Phenomenex, Torrance, CA), using reversed-phase chromatography with the ion pairing agent tributylamine in the aqueous mobile phase to enhance retention and separation. An adaptive scan range was used with an m/Z from 85-1000. Resolution was 100 000 at 1 Hz. The total run time is 25 min with a flow rate at 200 pL/min. Solvent A is 97:3 water/methanol with 10 mM tributylamine and 15 mM acetic acid; solvent B is methanol. The gradient is 0 min, 0% B; 2.5 min, 0% B; 5 min, 20% B; 7.5 min, 20% B; 13 min, 55% B; 15.5 min, 95% B; 18.5 min, 95% B; 19 min, 0% B; 25 min, 0% B.
Mass spectrometry analysis:
Metabolomics data analysis was performed using EIMaven software (https://github.com/Elucidatalnc/EIMaven). For labelling experiments, correction for natural abundance of 13C was performed using Accucor (https://github.com/XiaoyangSu/AccuCor).
Gene expression analysis in neuroblastoma tumours
Gene expression profiles of 649 neuroblastoma tumours (Kocak 2019, ibid.) were obtained from R2 (R2: Genomics Analysis and Visualization Platform (http://r2.amc.nl)). Gene set enrichment analysis (GSEA) was performed using the implementation in R (https://github.com/GSEA- MSigDB/GSEA_R) and by comparing tumours MYCN amplification status (amplified/non-amplified) provided in the study. GSEA was run on KEGG 64 metabolic pathway gene sets, which were downloaded from MSigDB (Liberzon, A. et al., Bioinformatics (Oxford, England) 27, 1739-1740 (2011 ). https://doi.org: 10.1093/bioinformatics/btr260). Metabolic pathways were considered significantly enriched at a false discovery rate (FDR) under 5%. Differential expression analysis between MYCN amplification status was performed using the Bioconductor package ‘limma’ (version 3.40.6 https://doi.org/10.1093/nar/gkv007 ). P-values were corrected for multiple hypothesis testing using Benjamini-Hochberg’s FDR.
Gene expression analysis in neuroblastoma cell lines
Expression profiles of 39 neuroblastoma cell lines were obtained from Gene Expression Omnibus (Harenza 2017, ibid.). Differential analysis was performed using the Bioconductor package ‘limma’ (version 3.40.6 https://doi.org/10.1093/nar/gkv007) and by comparing MYCN amplification status provided in the study. P-values were corrected for multiple hypothesis testing using Benjamini- Hochberg’s FDR.
RNA sequencing and ribosome profiling
Isolation of total RNA, library preparation and sequencing
Total RNA were isolated from the same extracts, that were used to obtain RPF (bellow, RiboSeq). 3 volumes of QIAzol® (Qiagen, Cat. No. 79306) were added to 80 pl of cell extracts, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit. RNA were sent to Genomic Platform (UNIGE) for stranded mRNA libraries preparation. Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 10 libraries in 1 pool.
RiboSeq
Mouse tumors were mechanically disrupted in liquid nitrogen and homogenized in a lysis buffer (LB, 50 mM Tris, pH 7.4, 100 mM KCI, 1.5 mM MgCI2, 1.0% Triton X-100, 0.5% Na-Deoxycholate, 25 U/ml Turbo DNase I, 1 mM DTT, 100 pg/ml cycloheximide, and Protease inhibitors) 3 ml of LB per 1 g of tissue. To obtain ribosome footprints 0.12 ml of total extracts containing 300 pg of total RNA were treated with RNAse I (Epicentre) (25U/1 mg of total RNA), for 45 min at 20°C with slow agitation. 10 ml SUPERaseln RNase inhibitor was added to stop nuclease digestion. Monosomes were isolated using S-400 columns. For isolation of mRNA protected fragments (RPF) 3 volumes of QIAzol® were added to the S-400 eluate, mixed thoroughly and proceed to RNA purification with Direct-Zol RNA Mini Prep Plus kit.
RPF libraries were prepared as described (McGIincy NJ et al., Methods. 2017 Aug 15;126:112- 129. doi: 10.1016/j.ymeth.2017.05.028; Ingolia NT et al., Science. 2009 Apr 10;324(5924):218-23. doi: 10.1126/science.1168978). Briefly, RPFs (25-34 nt) were size-selected by electrophoresis using a 15% TBE-Urea polyacrylamide gel electrophoresis (PAGE) and two RNA markers, 25-mer (5’ AUGUACACGGAGUCGAGCACCCGCA 3’; SEQ ID NO: 2) and 34-mer (5’AUGUACACGGAGUCGAGCACCCGCAACGCGAAUG 3’; SEQ ID NO: 3). After dephosphorylation with T4 Polynucleotide Kinase (NEB, #M0201S) the adapter Linker-1 (5' rAppCTGTAGGCACCATCAAT/3ddC/ 3'; SEQ ID NO: 4) was ligated to the 3' end of the RPF using T4 RNA Ligase 2. Ligated products were purified using 10% TBE-Urea PAGE. Ribosomal RNA was subtracted using RiboCop rRNA Depletion Kit V2 H/M/R. The adapter Linker-1 was used for priming reverse transcription (RT) with the RT primer Ni-Ni-9 (5’AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC5CACTCA5TTC AGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG 3’; SEQ ID NO: 5) using ProtoScript® II Reverse Transcriptase. RT products were purified using 10% TBE-Urea PAGE. The cDNA was circularized with CircLigase™ II ssDNA Ligase. The final libraries were generated by PCR using forward index primer NI-N-2 (5’ AATGATACGGCGACCACCGAGATCTACAC 3’; SEQ ID NO: 6) and one of the reverse index primers. Amplified libraries were purified using 8% TBE-PAGE and analyzed by Qubit and TapeStation. Libraries were sequenced on an Illumina NovaSeq 6000, SR 100 bp, 4 libraries in 1 pool.
RiboSeq mapping
Fastq files were adaptor stripped using cutadapt. Only trimmed reads were retained, with a minimum length of 15 and a quality cutoff of 2 (parameters: adapter sequence - CTGTAGGCACCATCAAT (SEQ ID NO: 1 )- trimmed-only -minimum-length = 15 -quality-cutoff = 2). Histograms were produced of ribosome footprint lengths and reads were retained if the trimmed size was 28 or 29 nucleotides. Resulting reads were mapped, using default parameters, with HISAT243, using a GRCm38, release 101 genome and index and were removed if they mapped to rRNA or tRNA according to GRCm38 RepeatMasker definitions from UCSC. A full set of transcript and CDS sequences for Ensembl release 101 was then established. Only canonical transcripts [defined by knownCanonical table, downloaded from UCSC] were retained with their corresponding CDS. Reads were then mapped to the canonical transcriptome with bowtie2 using default parameters.
RNASeq mapping
Fastq files were adaptor stripped using cutadapt with a minimum length of 15 and a quality cutoff of 2 (parameters: adapter sequence - CTGTAGGCACCATCAAT (SEQ ID NO: 1 )-minimum-length = 15 -quality-cutoff = 2). Resulting reads were mapped, using default parameters, with HISAT243, using a GRCm38, release 101 genome and index. Differential expression analysis was performed using DESeq244.
RiboSeq analysis
The P-site position of each read was predicted by riboWaltz (Lauria F et al., PLoS Comput Biol. 2018 Aug 13;14(8):e1006169. doi: 10.1371/journal.pcbi.1006169) and confirmed by inspection. Counts were made by aggregating P-sites overlapping with the CDS and P-sites Per Kilobase Million (PPKMs) were then generated through normalizing by CDS length and total counts for the sample. Differential expression and translational efficiency analysis was performed using DESeq2 (Love Ml et al., Genome Biol. 2014;15(12):550. doi: 10.1186/s 13059-014-0550-8). All metagenes, stalling and Ribosome Dwelling Occupancy (RDO) analyses are carried out on a subset of expressed canonical transcripts which had PPKM values greater than 1 across all samples (10366 total). Within these, P-site depths per nucleotide were normalized to the mean value in their respective CDS. For metagenes around codon types, the mean of these normalized values is taken for each codon within 90 nucleotides of every instance of that codon. For RDO calculation for a given type of codon, the mean of these normalized values is taken over all instances of that codon, then these are compared using a log2FC-ratio between conditions. To assess relative pausing, P- site depths normalized to the CDS mean were compared at each codon position in the CDS. A value of 1 was added to these normalized depths and a log2FC ratio was taken pairwise between conditions. To compare effects of different codon ending bases, the resulting values were separated by the ending base of each codon and plotted across their respective positions in the CDS. The relative pausing sum for each ending A, C, G or T is then the sum of these values for every codon containing the respective ending codon across the CDS.
Immunoblots
Harvested TH-MYCN tumors were clamped and flash-frozen in liquid nitrogen. After this mechanical dissociation, crude protein extraction was obtained by lysis with CHAPS buffer (10mM HEPES, 150mM NaCI, 2% CHAPS) with fresh protease inhibitor and phosphatase inhibitor. This protein lysate (25 micrograms) was electrophoresed through a 5-10% Tris-Glycine gel and immunoblotted using antibodies to Mycn (1 :200, Santa Cruz) and PCNA (1 :1000, Cell Signaling Technologies).
Isoelectric Focusing Blots
Crude protein extraction obtained as described above was electrophoresed through a slab isoelectric focusing gel (pH 3-7, Invitrogen Novex EC66452) employing freshly made cathode and anode buffers (Novex). The gel was transferred to a PVDF membrane and transferred using the iBIot transfer unit prior to blocking in buffer according to manufacturer’s recommendations for iBind. The iBind was then assembled with a probe against elF5a (BD Laboratories, 1 :3000) and incubated for at least 2.5 hours prior to development.
Histology
Harvested TH-MYCN tumors were preserved in 10% formalin and embedded in paraffin blocks. Slides were cut and then stained with hematoxylin and eosin. These slides were reviewed by a pathologist blinded to the treatment groups, and tumors were scored according to 1 ) differentiation status, 2) neuropil presence or absence and relative abundance, and 3) evidence of global or localized necrosis. Slides were then scanned and re-reviewed by the same pathologist.
Immunohistochemistry
Slides of formalin fixed, paraffin embedded tumors (prepared as above) were stained with MYCN (1 :100, Abeam) and Ki67. These slides were reviewed by a pathologist blinded to the treatment groups and scored according to differential Mycn expression and Ki67 staining, respectively.
Proteomics
Total proteome sample preparation
Previously flash-frozen samples were quickly placed on ice and pellets were solubilized in 200 pL lysis buffer (6 M guanidinium Chloride, 100 mM Tris-HCI pH 8.5, 2 mM DTT) and heated for 10 min at 99°C under constant shaking at 1 ,400 rpm. Subsequently, samples were sonicated at 4°C in 30 s on/off intervals for 15 cycles using a Bioruptor ® Plus sonication instrument (Diagenode) at high-intensity settings. If the viscosity of the samples was sufficiently reduced, protein concentrations were estimated, otherwise, sonication was repeated. For concentration measurements, the Pierce™ BCA Protein Assay Kit (23225, Thermo Fisher Scientific) was employed following the manufacturer’s instructions. After at least 20 min of incubation with 40 mM chloroacetamide, 30 pg of each proteome sample was diluted in a 30 pL lysis buffer supplemented with CAA and DTT. Samples were diluted in 270 pL digestion buffer (10% acetonitrile, 25 mM Tris- HCI pH 8.5, 0.6 pg Trypsin/sample (Pierce™ Trypsin Protease, 90058, Thermo Fisher Scientific) and 0.6 pg/sample LysC (Pierce™ LysC Protease, 90051 , Thermo Fisher Scientific) and proteins digested for 16 h at 37°C with constant shaking at 1 ,100 rpm.
To stop protease activity 1 % (v/v) trifluoroacetic acid (TFA) was added the next day and samples were loaded on self-made StageTips consisting of three layers of SDB-RPS matrix (Empore)87 that were previously equilibrated by 0.1 % (v/v) TFA. After loading, two washing steps with 0.1 % (v/v) TFA were scheduled and peptides were eluted by 80% acetonitrile and 2% ammonium hydroxide. Upon evaporation of the eluates in a SpeedVac centrifuge, samples were resuspended in 20 pL 0.1 % TFA and 2% acetonitrile. After complete solubilization of peptides by constant shaking for 10 min at 2,000 rpm, peptide concentrations were estimated on a NanodropTM 2000 spectrophotometer (Thermo Fisher Scientific) at 280 nm.
Nanoflow LC-MS/MS measurements for proteomes
Peptides were separated prior to MS by liquid chromatography on an Easy-nLC 1200 (Thermo Fisher Scientific) on in-house packed 50 cm columns of ReproSilPur C18-AQ 1.9-pm resin (Dr. Maisch GmbH). By employing a binary buffer system (buffer A: 0.1 % formic acid and buffer B: 0.1 % formic acid and 80% acetonitrile) with successively increasing buffer B percentage (from 5% in the beginning to 95% at the end) peptides were eluted for 120 min under a constant flow rate of 300 nL/min. Via a nanoelectrospray source, peptides were then injected into an Orbitrap Exploris™ 480 mass spectrometer (Thermo Fisher Scientific). Samples were scheduled in triplicates and a subsequent washing step while the column temperature was constantly at 60°C. Thereby the operational parameters were monitored in real-time by SprayQc.
DIA-based runs employed an orbitrap resolution of 120,000 for full scans in a scan range of 350- 1 ,400 m/z. The maximum injection time was set to 45 ms. For MS2 acquisitions the mass range was set to 361-1 ,033 with isolation windows of 22.4 m/z. A window overlap of 1 m/z was set as default. The orbitrap resolution for MS2 scans was at 30,000, the normalized AGO target at 1 ,000%, and the maximum injection time at 54 ms. The tested DIA methods varied within the range of the isolation windows which were 37.3 m/z for in total of 18 windows and 16.8 m/z for in total of 40 windows.
MS data quantification
DIA-NN-based analysis of raw MS data acquired in DIA mode was performed by using version 1.7.17 beta 12 in “high accuracy” mode. Instead of a previously measured precursor library, spectra and RTs were predicted by a deep learning-based algorithm and spectral libraries were generated from FASTA files. Cross-run normalization was established in an RT-dependent manner. Missed cleavages were set to 1. N-terminal methionine excision was activated and cysteine carbamidomethylation was set as a fixed modification. Proteins were grouped with the additional command “-relaxed-prot-inf. Match-between runs was enabled and the precursor FDR was set to 1 %.
Proteomics analyses
Downstream analysis of raw data output was performed with Perseus (version 1 .6.0.9)91 . For the calculation of CVs, proteins or precursors with less than 2 out of 3 valid values were filtered out. For GO term counts the filtering was stricter and 3 out of 3 valid values were required. Student’s t- tests were performed after imputation of missing values. The latter was always performed based on a Gaussian distribution relative to the standard deviations of measured values (width of 0.2 and a downshift of 1 .8 standard deviations).
Statistical analyses
The number of mice in every experiment is recorded in each figure legend. Unless specified, P- values were computed using an unpaired two-sided Welch’s t-test using the Welch-Satterthwaite equation (not assuming equal variances).
For metabolomics: A two-tailed unpaired Welch’s t-test was used to calculate p-values. Metabolomics data were corrected for multiple comparisons, based on the number of measured metabolites, via the Benjamini-Hochberg method, with a false-discover rate (FDR) cut-off of 0.05 used to determine statistical significance. For proteomics: Both two-sided Student t-tests were calculated with a permutation-based FDR of 0.05 and an sO = 1 if not otherwise declared. For mouse survival analyses: Survival was assessed according to the method of Kaplan and Meier (E. L. Kaplan & Paul Meier; Journal of the American Statistical Association, 53:282, 457-481 , DOI: 10.1080/01621459.1958.10501452; 1958) with SEs according to Peto and Peto (Peto, R. and Peto, J.; Journal of the Royal Statistical Society: Series A (General), 135: 185-198. https://doi.orq/10.2307/2344317 ; 1972). Comparisons of outcome between groups were performed by a two-sided log-rank test, with mice censored at the time of treatment cessation.
Table 2: Tumour/ Patient characteristics
All scientific publications and patent documents cited in the present specification are incorporated by reference herein.

Claims

Claims
1. Difluormethylornithin (DFMO), or a pharmaceutically acceptable salt thereof, for use in treatment or prevention of recurrence of cancer, wherein the DFMO is administered to a patient characterized by a blood plasma level of proline that is less than 67% in comparison to a physiological level of proline, and a blood plasma level of arginine that is less than 80%, particularly less than 67% in comparison to a physiological level of arginine, wherein the physiological levels of proline and arginine depend on the age of the patient, and wherein the physiological level of proline and/or arginine is defined as being (all values in pmol/L):
W: week; M: month; Y: year.
2. DFMO for use according to claim 1 , wherein said blood plasma level of proline and arginine is less than 33% of said physiological level of proline and/or arginine.
3. DFMO for use according to claim 1 , wherein the patient is characterized by plasma levels of proline and of arginine of less than the 25th percentile of plasma levels of proline and of arginine, respectively, of a control population of healthy patients, particularly by plasma levels of proline and of arginine of less than the 10th percentile of plasma levels of proline and of arginine, respectively, of a control population of healthy patients.
4. Difluormethyl ornithin (DFMO), or a pharmaceutically acceptable salt thereof, for use in treatment or prevention of recurrence of cancer, wherein the DFMO is administered to a patient undergoing or scheduled to undergo a treatment aimed at lowering the plasma level of proline and arginine.
5. DFMO for use according to claim 4, wherein the treatment is aimed at lowering the plasma levels of proline and of arginine.
6. DFMO for use according to any one of the preceding claims, wherein DFMO is administered at a daily dose ranging from 500 mg/m2 to 9000 mg/m2, particularly from 1000 mg/m2 to 5000 mg/m2, more particularly from 2000 mg/m2 to 4000 mg/m2. DFMO for use according to any one of the preceding claims, administered in combination with a pharmaceutical drug capable of lowering plasma levels of proline. DFMO for use according to any one of the preceding claims, administered in combination with a pharmaceutical drug capable of lowering plasma levels of arginine, particularly wherein the pharmaceutical drug capable of lowering plasma levels of arginine is a recombinant arginase; more particularly, wherein, the recombinant arginase is pegylated recombinant human arginase; most particularly, the arginase is BT-100 or BT-200. DFMO for use according to any one of the preceding claims, wherein said cancer is characterized by overexpression of a MYC-family oncogene, particularly wherein the cancer is characterized by overexpression of c-myc, l-myc or n-myc. DFMO for use according to any one of the preceding claims, wherein said cancer is a solid tumour; particularly wherein said solid tumour is a tumour of the brain or a cancer of the peripheral nervous system, more particularly wherein said tumour of the brain is selected from the group of neuroblastoma, glioblastoma or medulloblastoma. DFMO for use according to any one of the preceding claims, wherein said cancer is a cancer selected from the group consisting of breast cancer, ovarian cancer, esophageal cancer, lung cancer, leukemia, lymphoma. DFMO for use according to claim 11 , wherein said cancer is selected from the group consisting of MYC-rearranged lymphoma; MYC amplified breast cancer; MYC amplified ovarian cancer; MYC amplified esophageal cancer; MYC amplified lung cancer, MYC- rearranged or hyperactivated leukaemia. DFMO for use according to any one of the preceding claims, wherein the DFMO is administered over a period of 100 days or more, particularly wherein the DFMO is administered over a period of 200 days or more. A pharmaceutical composition in unit dosage form comprising:
DFMO and a mixture of amino acids comprising eighteen amino acids selected from the proteinogenic amino acids, except proline and arginine; and optionally, a pharmaceutically acceptable excipient.
EP23808830.6A 2022-11-20 2023-11-20 Combination of polyamine pathway inhibitor drug and proline/arginine diet restriction Pending EP4618967A1 (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
EP22208452 2022-11-20
EP22208608 2022-11-21
EP22208681 2022-11-21
EP22208623 2022-11-21
EP23166882 2023-04-05
PCT/EP2023/082430 WO2024105276A1 (en) 2022-11-20 2023-11-20 Combination of polyamine pathway inhibitor drug and proline/arginine diet restriction

Publications (1)

Publication Number Publication Date
EP4618967A1 true EP4618967A1 (en) 2025-09-24

Family

ID=88839611

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23808830.6A Pending EP4618967A1 (en) 2022-11-20 2023-11-20 Combination of polyamine pathway inhibitor drug and proline/arginine diet restriction

Country Status (3)

Country Link
EP (1) EP4618967A1 (en)
CN (1) CN120548176A (en)
WO (1) WO2024105276A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109069462A (en) 2016-02-23 2018-12-21 癌症研究科技有限公司 Lack the dietary product of at least two nonessential amino acid

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2799431A1 (en) * 2010-05-14 2011-11-17 Cancer Prevention Pharmaceuticals, Inc. Cancer prevention and treatment methods based on dietary polyamine content
CN103184208B (en) 2011-12-27 2015-09-16 拜奥生物科技(上海)有限公司 Human arginase and site directed pegylation human arginase and application thereof
CN106456723B (en) 2014-04-29 2021-03-09 康达医药科技有限公司 Methods and compositions for modulating the immune system using arginase I
CA2976106A1 (en) 2015-02-12 2016-08-18 The Arizona Board Of Regents On Behalf Of The University Of Arizona Methods for treating neuroblastoma
CN113189696B (en) 2020-01-14 2025-12-12 华为技术有限公司 A fiber optic filter and a fiber optic amplifier

Also Published As

Publication number Publication date
CN120548176A (en) 2025-08-26
WO2024105276A1 (en) 2024-05-23

Similar Documents

Publication Publication Date Title
Lee et al. Ornithine aminotransferase supports polyamine synthesis in pancreatic cancer
US20250376733A1 (en) Methods for diagnosing and treating cancer by means of the expression status and mutational status of nrf2 and downstream target genes of said gene
Yang et al. Glutaminolysis: a hallmark of cancer metabolism
Cordova et al. GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis
Wiita et al. Global cellular response to chemotherapy-induced apoptosis
Kulka et al. Impact of HDAC inhibitors on protein quality control systems: consequences for precision medicine in malignant disease
Prelowska et al. Inhibition of the ʟ-glutamine transporter ASCT2 sensitizes plasma cell myeloma cells to proteasome inhibitors
US20230149415A1 (en) Methods and compositions for treating cancer
Hu et al. WEE1 inhibition induces glutamine addiction in T-cell acute lymphoblastic leukemia
KR20190039730A (en) Use of mitochondrial activity inhibitors for the treatment of acute myeloid leukemia with poor prognosis
Cherkaoui et al. Reprogramming neuroblastoma by diet-enhanced polyamine depletion
Wang et al. Targeting c‐Myc transactivation by LMNA inhibits tRNA processing essential for malate‐aspartate shuttle and tumour progression
EP4618967A1 (en) Combination of polyamine pathway inhibitor drug and proline/arginine diet restriction
Xiao et al. Cystine/cysteine metabolism regulates the progression and response to treatment of triple‑negative breast cancer
Luo et al. Targeted Degradation of SOS1 Exhibits Potent Anticancer Activity and Overcomes Resistance in KRAS-Mutant Tumors and BCR–ABL–Positive Leukemia
Pfänder et al. Tryptophan stress activates EGFR-RAS-signaling to MTORC1 and p38/MAPK to sustain translation and AHR-dependent autophagy
Jiang et al. Exploring the molecular therapeutic mechanisms of gemcitabine through quantitative proteomics
Lewis et al. RNA Splicing as a Therapeutic Target in Cancer
Zhang et al. Micropeptides in the oncological dark matter: decoding their roles in tumor progression and therapy resistance
Akgeyik et al. Glioblastoma multiforme: Subtypes based on IDH, ATRX, H3F3A, MGMT and p53 mutations
US10213449B2 (en) Compositions and methods for treating medulloblastoma
Han et al. Cancer IDO1‐Mediated Tryptophan–Kynurenine Metabolic Reprogramming to Drive Skeletal Muscle Atrophy and Cachexia Acceleration
US20250146080A1 (en) Methods for overcoming tazemetostat-resistance in cancer patients
Mao et al. Inhibitory effects of gabapentin on the proliferation and cell motility of hepatocellular carcinoma cells
Vella Identification of kinases implicated in temozolomide resistance in glioblastoma

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250606

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)