EP4615973A1 - Staufen-1 modulating agents, compositions, and methods - Google Patents

Staufen-1 modulating agents, compositions, and methods

Info

Publication number
EP4615973A1
EP4615973A1 EP23822178.2A EP23822178A EP4615973A1 EP 4615973 A1 EP4615973 A1 EP 4615973A1 EP 23822178 A EP23822178 A EP 23822178A EP 4615973 A1 EP4615973 A1 EP 4615973A1
Authority
EP
European Patent Office
Prior art keywords
seq
nucleotide sequence
therapeutic agent
aso
examples
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23822178.2A
Other languages
German (de)
French (fr)
Inventor
Daniel R. Scoles
Stefan M. Pulst
Sharan PAUL
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Utah Research Foundation Inc
Original Assignee
University of Utah Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Utah Research Foundation Inc filed Critical University of Utah Research Foundation Inc
Publication of EP4615973A1 publication Critical patent/EP4615973A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense

Definitions

  • the present disclosure relates to agents, compositions, and methods for modulating Staufen-1. Accordingly, this disclosure involves the fields of chemistry and biology.
  • Neurodegenerative diseases occur when nerve cells in the brain or peripheral nervous system lose function over time and ultimately die. Further, nerve cells generally don’t reproduce or replace themselves. The risk of being affected by a neurodegenerative disease increases with age. Although treatments may help relieve some of the physical or mental symptoms associated with neurodegenerative diseases, there is currently no cure.
  • Non-limiting examples of neurodegenerative diseases include peripheral neuropathy, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease (HD), spinocerebellar ataxia (SCA), prion disease, motor neuron disease (MND), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), and spinal muscular atrophy (SMA) among others.
  • STAU1 ASOs from the insilico design step were screened in HEK-293 cells in duplicate transfections at 50 nM.
  • the STAU1/ACTB values shown are relative to mock transfected HEK-293 set to 100%, and are mean ⁇ SD for duplicate wells.
  • FIGs. 2A-B shows effects of ASOs for lowering pathologically elevated STAU1 abundance and on normalizing autophagy-related proteins as follows:
  • HEK-293 ATXN2-Q58 KI cells that have elevated STAU1 abundance relative to non-mutant HEK-293 ATXN2-Q22 cells were transfected in duplicate cultures with 100 nM of each of 10 lead ASOs. Following 48 hrs, STAU1 levels was determined in cell lysates by western blotting.
  • FIGs. 3A-E show graphical representations of the generation and characterization of a BAC-STAU1 transgenic mouse model as follows: A) Schematic of the BAC construct showing the relative position of the STAU1 gene and flanking sequences. B-E) Western blotting showing autophagy and other abnormal molecular phenotypes in the cerebellum of the BAC-STAU1 mouse model.
  • BAC-STAU1 mice had decreased levels of CALB1, RGS8, PCP2, PCP4 and FAM 107b, and increased cleaved caspase 3 in cerebellar extracts.
  • FIGs. 4A-F show a graphical representation of in vivo testing of the top 10 lead ASOs in BAC-SCA2 mice.
  • BAC-STAU1 mice were injected ICV at 8 weeks of age with 300 ug ASO and evaluated by western blotting and qPCR following 2 weeks treatment time.
  • A-D Western blotting. Shown are quantified western blot data for STAU1 and other proteins that were previously shown modified with STAU1 expression (CALB1, GFAP, mTOR, p62, LC3-TI) that are improved or restored following treatment with the ASOs.
  • ICV injection set 1 including ASOs 045, 276, 249, 307, 322, and 310.
  • ICV injection set 2 including ASOs 256, 270, 319, and 288.
  • E-F E-F qPCR: Shown are the mean + SD STAU1, Aifl, and Gfap expression values relative to Actin for the indicated ASOs in cerebellum (E) and spinal cord (F). Values are mean ⁇ SD.
  • TDP-43 staining increased in motor neurons of TDP-43TG/+ mice vs WT mice, and was reduced in TDP-43TG/+ mice treated with ASO-45.
  • FIGs. 9A-D show results of on target open field behavior testing for lowering Staul in adult mice.
  • N 21 WT (10 males 11 females), 20 Staul +/- (10 males 10 females), 15 Staul-/- (8 males 7 females).
  • B-D WT mice age 3 months treated ICV with 300 Dg ASO-45 for 3 wks.
  • N 14 mice (7 males 7 females) per group.
  • FIG. 10 shows dose response for lowering STAU1 expression for 22 ASOs in SCA2 (Q22/Q45) patient derived fibroblast line 500-1.
  • Cells were plated in 384 well plates and triplicate wells were included for each ASO dose.
  • STAU1 abundance relative to ACTB was determined by qPCR following 48 hours transfection time. Experiments were done in batches with ASO-045 retested on each plate as a comparative control.
  • IC50s were determined using the Hill equation. The value shown for the 0 nM dose is the mean across the five batches. The IC50 mean and SD for ASO- 045 is 54.09 + 2.2 nM.
  • subject refers to a mammal that can benefit from treatment with a Staufenl -modulating agent.
  • a benefit can be obtained if the subject has a disease or condition, or is at risk of developing a disease or condition for which a Staufenl - modulating agent is a therapeutically effective treatment or preventative measure.
  • such subject may be a human.
  • the terms “treat,” “treatment,” or “treating” when used in conjunction with the administration of a Staufenl -modulating agent, such as an siRNA or anti-sense oligonucleotide (ASO) that targets the STAU1 gene, including compositions and dosage forms thereof, refers to administration to subjects who are either asymptomatic or symptomatic.
  • a Staufenl -modulating agent such as an siRNA or anti-sense oligonucleotide (ASO) that targets the STAU1 gene, including compositions and dosage forms thereof
  • a Staufenl -modulating agent such as an siRNA or anti-sense oligonucleotide (ASO) that targets the STAU1 gene, including compositions and dosage forms thereof.
  • a Staufenl -modulating agent such as an siRNA or anti-sense oligonucleotide (ASO) that targets the STAU1 gene, including compositions and dosage forms thereof
  • ASO anti-sense oligonucle
  • a treatment outcome can be a delay in occurrence or onset of a disease or conditions or the signs or symptoms thereof.
  • a treatment can be reducing, ameliorating, eliminating, or otherwise providing a subject with relief from (i.e. relieving) the condition with which they are afflicted, or providing relief from signs or symptoms of the condition.
  • a “therapeutic agent” refers to an agent that can have a beneficial or positive effect on a subject when administered to the subject in an appropriate or effective amount.
  • inhibitor or “inhibiting” can refer to preventing or reducing translation of a genetic sequence to a protein, inducing an altered translation of a genetic sequence to an altered protein (e.g. as misfolded protein, etc.), and/or reducing a rate of translation of a genetic sequence to a protein, whether permanent, semi -permanent, or transient.
  • “inhibit” or “inhibiting” can refer to pre- transcriptional inhibition.
  • inhibitor or “inhibiting” can refer to post-transcriptional inhibition.
  • the type of inhibition can depend on the specific type(s) of inhibitor(s) or therapeutic agent(s) employed.
  • “inhibit” or “inhibiting” can include any decrease in expression of a gene as compared to native expression, whether pre- or post- transcriptional, partial or complete.
  • the term “middle” when used in connection with a string of alphanumeric characters refers to a portion thereof extending between the two end points, but not including the endpoints (e.g. characters on each end).
  • the “midpoint” when used in connection with a string of alphanumeric characters refers to the very center of such string, such that there are an equal number of characters on either side of the “midpoint”. For example, a string of 20 alphanumeric characters would have a midpoint between the 10 th and 11 th characters in the string (e.g.
  • the term “central” when used in connection with a string of alphanumeric characters refers to a number of characters extending equidistant from the midpoint. For example, in a string of numbers 1-20, the “central” 8 numbers would include 7, 8, 9, 10, 11, 12, 13, 14 with the midpoint being between numbers 10 and 11. Additionally, in the string of letters abcdefghijk, the “central 5 letters would be defgh with f being the midpoint. It is to be understood that when used in this written description, the term “middle” provides express support for the term “central” as if the term “central” were also recited.
  • formulation and “composition” are used interchangeably and refer to a mixture of two or more compounds, elements, or molecules.
  • the terms “formulation” and “composition” may be used to refer to a mixture of one or more active agents with a carrier or other excipients.
  • Compositions can take nearly any physical state, including solid, liquid (i.e. solution), or gas.
  • drug form can include one or more formulation(s) or composition(s) provided in a format for administration to a subject.
  • an “effective amount,” “therapeutically effective amount,” or “therapeutically effective rate(s)” of an active ingredient refers to a non-toxic, but sufficient amount or delivery rates of the active ingredient or therapeutic agent, to achieve therapeutic results in treating a disease or condition for which the drug is being delivered. It is understood that various biological factors may affect the ability of a substance to perform its intended task. Therefore, an “effective amount,” “therapeutically effective amount,” or “therapeutically effective rate(s)” may be dependent in some instances on such biological factors. Further, while the achievement of therapeutic effects may be measured by a physician or other qualified medical personnel, using evaluations known in the art, it is recognized that individual variation and response to treatments may make the achievement of therapeutic effects a subjective decision.
  • a “dosing regimen” or “regimen” such as “treatment dosing regimen,” or a “prophylactic dosing regimen,” refers to how, when, how much, and for how long a dose of a composition can or should be administered to a subject in order to achieve an intended treatment or effect.
  • carrier and “pharmaceutically acceptable carrier” may be used interchangeably, and refer to any liquid, gel, salve, solvent, liquid, diluent, fluid ointment base, liposome, micelle, giant micelle, or the like, or any other suitable carrier that is suitable for delivery of a therapeutic agent to and/or into a target cell (e.g. a nerve cell) and for use in contact with a subject or the subject’s tissue without causing adverse physiological responses, and which does not interact with the other components of the composition in a deleterious manner.
  • a target cell e.g. a nerve cell
  • a string of alphanumeric characters in this written description such as a nucleotide sequence
  • the string of alphanumeric characters provides express support for no only the entire recited sequence, but also for sub-sets or portions of the sequence as if expressly recited.
  • a sequence of: acgtctaaaccgtcacctta provides support for not only the entire sequence, but for subsets or portions thereof such as the 10 central characters ctaaaccgtc, the first 4 characters, such as acgt, etc.
  • the method can include administering a therapeutically effective amount of a Staufenl-modulating agent to a target cell of a subject.
  • Staufenl -modulating agents can be employed in the methods recited herein. It is noted that when discussing Staufenl -modulating agents per se, it is to be understood that a Staufenl -modulating agent can act or function to modulate Staufenl without directly interacting with Staufenl.
  • a Staufenl-modulating agent can be an agent that acts upstream from Staufenl to regulate Staufenl.
  • a Staufenl -modulating agent can be a therapeutic agent that inhibits expression of mutant ATXN2.
  • an effective Staufenl -modulating agent can also include a gene therapy agent, such as for modifying a mutant allele to a wild-type allele to facilitate modulation of Staufenl.
  • the Staufenl -modulating agent can be an antisense oligonucleotide (ASO).
  • ASO can include one or more suitable modifications, such as sulfur for oxygen substitutions (e.g. introduction of phosphorothioate linkages), 2’-OH modifications, 2’-0-methyl modifications, 2’-fluoro modifications, 2’-O-methoxyethyl modifications, locked nucleic acid (LNA) modifications, bridged nucleic acid (BNA) modifications, peptide nucleic acid (PNA) modifications, morpholino modifications, hexitol nucleic acid (HNAs) modifications, introduction of central phosphodiester or phosphorothioate residues (e.g. to form a “gapmer”), the like, or combinations thereof.
  • suitable modifications such as sulfur for oxygen substitutions (e.g. introduction of phosphorothioate linkages), 2’-OH modifications, 2’-0-methyl modifications, 2’-fluoro modifications, 2’-O-meth
  • the ASO can be a gapmer, such as an Ax-Gn-Ax gapmer, where A represents an artificial nucleotide monomer and x is an integer from 2 to 7, and where G represents the gap or block of natural antisense nucleotide monomers and n is an integer from 8 to 12.
  • ASO is a gapmer
  • a variety of artificial nucleotide monomers can be used in the 5’ and 3’ wings, such as those mentioned above.
  • non-limiting examples can include 2’-O-methoxyethyl (MOE), 2’, 4’ -bridged nucleic acid (BNA), locked nucleic acid (LNA), N-Me-aminooxy BNA, 2’-N-(methyl)-4’-C- aminooxymethylene 2’,4’-bridged nucleic acid, N-Me-aminooxy 2’,4’-bridged nucleic acid, 2’-N-(methyl)-4’-C-aminooxymethylene 2’, 4’ -bridged nucleic acid, 2’,4’-BNANC [NMe], 2’-O,4’-C-(N-methyl) aminomethylene, 2’, 4’ -bridged nucleic acid, 2’,4’-BNANC, 2’-O,4’-C-aminomethylene 2’,4’-bridged nucleic acid, phosphorothioate S-constrained ethyl (cEt), the like, or
  • the ASO can be or include a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20,
  • SEQ ID NO: 26 SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30,
  • SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, the 8 consecutive nucleotides can be the 8 middle (e.g. central) nucleotides of the listed nucleotide sequences.
  • the ASO can be or include one or more nucleotide sequences having at least 10 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17,
  • SEQ ID NO: 18 SEQ ID NO: 19 SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22,
  • SEQ ID NO: 23 SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27,
  • SEQ ID NO: 28 SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32,
  • the 10 consecutive nucleotides can be the 10 middle (e.g. central) nucleotides of the listed nucleotide sequences.
  • the ASO can be or include one or more nucleotide sequences having at least 12 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16,
  • SEQ ID NO: 22 SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26,
  • SEQ ID NO: 32 SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36,
  • the 12 consecutive nucleotides can be the 12 middle (e.g. central) nucleotides of the listed nucleotide sequences.
  • the ASO can be or include one or more nucleotide sequences having at least 14 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 1, SEQ ID NO: 2, SEQ
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 23.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 20.
  • the consecutive nucleotides of SEQ ID NO: 23 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 23.
  • the consecutive nucleotides of SEQ ID NO: 23 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 23.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 28.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 28.
  • the consecutive nucleotides of SEQ ID NO: 28 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 28.
  • the consecutive nucleotides of SEQ ID NO: 28 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 28.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 29.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 29.
  • the consecutive nucleotides of SEQ ID NO: 29 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 29.
  • the consecutive nucleotides of SEQ ID NO: 29 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 29.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 30.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 30.
  • the consecutive nucleotides of SEQ ID NO: 30 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 30.
  • the consecutive nucleotides of SEQ ID NO: 30 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 30.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 31.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 31.
  • the consecutive nucleotides of SEQ ID NO: 31 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 31.
  • the consecutive nucleotides of SEQ ID NO: 31 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 31.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 32.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 32.
  • the consecutive nucleotides of SEQ ID NO: 32 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 32.
  • the consecutive nucleotides of SEQ ID NO: 32 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 32.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 33.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 33.
  • the consecutive nucleotides of SEQ ID NO: 33 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 33.
  • the consecutive nucleotides of SEQ ID NO: 33 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 33.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 34.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 34.
  • the consecutive nucleotides of SEQ ID NO: 34 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 34.
  • the consecutive nucleotides of SEQ ID NO: 34 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 34. In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 35. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 35. In some examples, the consecutive nucleotides of SEQ ID NO: 35 can include the middle (e.g.
  • the consecutive nucleotides of SEQ ID NO: 35 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 35.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 36.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 36.
  • the consecutive nucleotides of SEQ ID NO: 36 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 36.
  • the consecutive nucleotides of SEQ ID NO: 36 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 36.
  • the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 37.
  • the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 37.
  • the consecutive nucleotides of SEQ ID NO: 37 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 37.
  • the consecutive nucleotides of SEQ ID NO: 37 can include the middle (e.g. central) 10 nucleotides.
  • the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 37.
  • the method of controlling, modulating, or normalizing Staufenl activity in a target cell can include introducing an amount of a Staufenl -modulating agent to a target cell sufficient to reduce Staufenl activity as compared to Staufenl activity prior to or without introducing the Staufenl -modulating agent. It is noted that, in this particular method, it is not necessary to reduce the amount of Staufenl present in the target cell to control, normalize, or minimize Staufenl activity in the target cell. However, this is also one mechanism of accomplishing reduced Staufenl activity in the target cell. In other examples, (e.g.
  • Staufenl activity can be reduced by reducing the mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein as described above) present in the target cell.
  • the activity of Staufenl can be reduced by introducing a Staufenl- modulating agent that can bind to, degrade, etc. Staufenl to inactivate or otherwise interfere with the metabolic function of Staufenl in the target cell.
  • the Staufenl -modulating agent can bind to, degrade, etc. mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) to minimize aggregation of Staufenl thereto, stabilization of Staufenl, the like, or a combination thereof.
  • the Staufenl-modulating agent can reduce or block Staufenl interaction with mRNAs, which can result in altered mRNA expression or abundance.
  • the therapeutically effective amount of the Staufenl-modulating agent can depend on the mode of administration, the subject being treated, the type and severity of the condition, the particular Staufenl-modulating agent(s) being employed, etc.
  • the therapeutically effective amount of Staufenl-modulating agent can be an amount sufficient to increase PCP2 mRNA levels in the target cell, CALB1 mRNA levels in the target cell, other mRNAs in the target cell that are metabolized via Staufenl- associated metabolism, or a combination thereof when administered in an effective dosing regimen as compared to the levels of these mRNAs prior to or without administration of the Staufenl -modulating agent.
  • the therapeutically effective amount can be an amount sufficient to increase one or more of these mRNAs by at least 10%, 20%, 30%, 40%, or more when administered in an effective dosing regimen as compared to the level prior to or without administration of the Staufenl -modulating agent.
  • the therapeutically effective amount of the Staufenl -modulating agent can be an amount sufficient to reduce the amount of Staufenl present in the target cell when administered in an effective dosing regimen as compared to the amount of Staufenl present in the target cell prior to or without administration of the Staufenl-modulating agent.
  • the therapeutically effective amount can be an amount sufficient to reduce Staufenl in the target cell by at least 30%, 40%, 50%, 60%, or 70% when administered in an effective dosing regimen as compared to Staufenl levels prior to or without administration of the Staufenl-modulating agent.
  • the therapeutically effective amount of the Staufenl- modulating agent can be an amount sufficient to reduce a mutant ATXN2 level (or a level of another protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) in the target cell when administered in an effective dosing regimen as compared to the mutant ATXN2 level (or mutant c9orf72 level, or mutant TDP-43 level, or mutant Tau level, or mutant APP level, for example) prior to or without administration of the Staufenl-modulating agent.
  • the therapeutically effective amount can be an amount sufficient to reduce ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) in the target cell by at least 30%, 40%, 50%, 60%, or 70% when administered in an effective dosing regimen as compared to ATXN2 levels (or mutant c9orf72 levels, or mutant TDP-43 levels, or mutant Tau levels, or mutant APP levels, for example) prior to or without administration of the Staufenl-modulating agent.
  • the therapeutically effective amount can be an amount from about 1 picomolar (pM) to about 100 millimolar (mM). In some other examples, the therapeutically effective amount can be an amount from about 1 pM to about 100 pM. In still other examples, the therapeutically effective amount can be an amount from about 50 pM to about 500 pM. In yet other examples, the therapeutically effective amount can be an amount from about 300 pM to about 1000 pM. In additional examples, the therapeutically effective amount can be an amount from about 1 nanomolar (nM) to about 50 nM. In still additional examples, the therapeutically effective amount can be from about 10 nM to about 500 nM. In further examples, the therapeutically effective amount can be an amount from about 400 nM to about ImM. In still further examples, the therapeutically effective amount can be an amount from about 700 nM to about 10 mM.
  • the therapeutically effective amount can be from about 0.001 pg of Staufenl -modulating agent per gram (g) of therapeutic composition (pg/g) to about 200 mg of Staufenl -modulating agent per gram of therapeutic composition (mg/g). In other examples, the therapeutically effective amount can be from about 0.01 pg/g to about 1 pg/g Staufenl -modulating agent in the therapeutic composition. In some other examples, the therapeutically effective amount can be from about 0. 1 pg/g to about 10 pg/g Staufenl -modulating agent in the therapeutic composition.
  • the therapeutically effective amount can be from about 1 pg/g to about 100 pg/g Staufenl - modulating agent in the therapeutic composition. In still other examples, the therapeutically effective amount can be from about 10 pg/g to about 1 mg/g Staufenl - modulating agent in the therapeutic composition. In some additional examples, the therapeutically effective amount can be from about 100 pg/g to about 10 mg/g Staufenl- modulating agent in the therapeutic composition. In some further examples, the therapeutically effective amount can be from about 1 mg/g to about 100 mg/g Staufenl- modulating agent in the therapeutic composition. It is again noted that the therapeutically effective amounts disclosed herein are generally based on the amount of Staufenl- modulating agent itself without any associated ligands, delivery vehicles, etc., unless otherwise specified.
  • an injectable therapeutic composition can include a solubilizing or dispersing agent.
  • solubilizing or dispersing agents can include polyoxyethylene sorbitan monooleates, lecithin, polyoxyethylene polyoxypropylene co-polymers, propylene glycol, glycerin, ethanol, polyethylene glycols, sorbitol, dimethylacetamide, polyethoxylated castor oils, n-lactamide, cyclodextrins, caboxymethyl cellulose, acacia, gelatin, methyl cellulose, polyvinyl pyrrolidone, the like, or combinations thereof.
  • an injectable therapeutic composition can include a pH adjuster or buffering agent.
  • pH adjusters or buffering agents can include a number of acids, bases, and combinations thereof, such as hydrochloric acid, phosphoric acid, citric acid, sodium hydroxide, potassium hydroxide, calcium hydroxide, acetate buffers, citrate buffers, tartrate buffers, phosphate buffers, triethanolamine (TRIS) buffers, the like, or combinations thereof.
  • the pH of the therapeutic composition can be from about 5 to about 9, or from about 6 to about 8. However, other suitable pHs can also be desirable.
  • an injectable therapeutic composition can include a preservative.
  • preservatives can include ascorbic acid, acetylcysteine, bisulfite, metabisulfite, monothioglycerol, phenol, meta-cresol, benzyl alcohol, methyl paraben, propyl paraben, butyl paraben, benzalkonium chloride, benzethonium chloride, butylated hydroxyl toluene, myristyl gamma-picolimium chloride, 2 -phenoxyethanol, phenyl mercuric nitrate, chlorobutanol, thimerosal, tocopherols, the like, or combinations thereof.
  • an injectable therapeutic composition can include a bulking agent.
  • bulking agents can include sucrose, lactose, trehalose, mannitol, sorbitol, glucose, rafinose, glycine, histidine, polyvinyl pyrrolidone, the like, or combinations thereof.
  • ASQs Antisense oligonucleotides
  • ASOs used in this example were 20mer 5-10-5 2’-O-methoxyethyl (MOE) gapmers, phosphorothioated at all positions. All cytosine positions were methylated. ASOs were produced and purified by Integrated DNA Technologies (IDT).
  • IDT Integrated DNA Technologies
  • Preparations included desalting for in vitro work or HPLC purification and dialysis to remove chromatography solvent for in vivo work.
  • HEK-293 or SCA2 patient-derived skin fibroblasts (SCA2-500-1), expressing ATXN2 q22/q45, were cultured and maintained in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, ThermoFisher #11965118) supplemented with 10% fetal bovine serum, and lx penicillin and streptomycin.
  • DMEM Dulbecco’s modified Eagle’s medium
  • the SCA2-500-1 patient fibroblasts were previously collected by us, with written consent, and the studies were approved by the Institutional Review Board at the University of Utah.
  • HEK-293 cells were transfected with ASOs using Lipof ectamine, while SCA2-500-1 cells were transfected with Lipofectamine 3000, according to manufacturer’s protocol (ThermoFisher). The cells were harvested at 48 or 72 hrs post-transfection for analyses.
  • both the HEK-293 and SCA2-500-1 cell lines were authenticated by STR analysis on 24 loci, including amelogenin for sex identification.
  • the kit used for this was the GenePrint 24 system (Promega).
  • BAC-STAU1 mouse model was developed by the University of Utah Transgenic Mouse Core by pronuclear microinjection of a non- linearized human Staufenl bacterial artificial chromosome (BAC) construct (BAC-STAU1 clone RP11- 120111, BACPAC Resources) into fertilized oocytes sourced from mice with a B6/D2 mixed hybrid background (B6D2F1J, The Jackson Laboratory stock #100006). Prior to injection, the BAC construct was separated from other nucleotide fragments by pulsed field gel electrophoresis, and gel purified, by the University of Michigan Transgenic Mouse Core.
  • BAC non- linearized human Staufenl bacterial artificial chromosome
  • Genotyping of mouse tail DNA was initially done with multiplex PCRs encompassing 17 PCR primer pairs covering all coding exons, 5’ and 3’ UTR and the 5’ upstream promoter region.
  • Transgenic mouse bone marrow samples were sequenced and analyzed by Cergentis to determine integration sites and vector- vector breakpoints that represent concatemerization.
  • BAC-STAU1 mice were maintained in a B6D2 mixed background by backcrossing to B6D2F1J no less than every 4 generations.
  • the Staul t " llApa( ' / ' ⁇ (StauT 7 ) mouse was a generous gift from Prof. Michael A. Kiebler, Ludwig Maximilian University of Kunststoff, Germany, and maintained in a C57BL/6J background.
  • mice were maintained in a temperature and humidity-controlled environment on a 12h light/dark cycle with light onset at 6:00 AM. All studies and procedures were approved by an Institutional Animal Care and Use Committee (IACUC) at the University of Utah, SLC, UT.
  • IACUC Institutional Animal Care and Use Committee
  • ASOs were delivered to mice by intracerebroventricular (ICV) injection using a Hamilton 26s gauge needle. Injections volumes were 10 pl of ASO diluted in phosphate buffered saline (PBS). Control mice received the same volume of normal saline. Injections were made under anesthesia with a mixture of oxygen and isoflurane, using a Stoelting stereotaxic frame. Anesthesia was initiated using 3% isoflurane for 5 min and the isoflurane mixture was lowered to 2% during injections. Stereotaxic bregma coordinates were -0.46 mm anteroposterior, -1.0 mm lateral (right side); -2.5 mm dorsoventral. Needles were removed 4 min after ASO delivery. Mice were maintained on a 39°C isothermal pad while anesthetized and during recovery.
  • RNAse I treated RNAs were used to synthesize cDNAs using the ProtoScript cDNA First Strand cDNA Synthesis Kit (New England Biolabs Inc., USA). Primers for RT-PCR were designed to prevent amplification from genomic DNA (annealing sites in different exons or across intron-exon boundaries). Quantitative RT- PCR was performed in Bio-Rad CFX96 (Bio-Rad Inc., USA) with the Power SYBR Green PCRMasterMix (Applied Biosystems Inc, USA).
  • PCR reaction mixtures contained SYBR Green PCRMasterMix and 0.5 pmol primers and PCR amplification was carried out for 45 cycles: denaturation at 95 °C for 10 sec, annealing at 60 °C for 10 sec and extension at 72 °C for 40 sec.
  • the threshold cycle for each sample was chosen from the linear range and converted to a starting quantity by interpolation from a standard curve run on the same plate for each set of primers. Gene expression levels were normalized to the Actin mRNA levels.
  • mice were tested on the accelerating rotarod. Open field behavior was tested using a force plate actometer. Actometer hardware with center of mass tracked at 1000 Hz and saved using Lab VIEW (National Instruments) was used. Custom code was written in MATLAB (MathWorks) to filter center of mass with a running average of 1 second, and then calculated the total distance traveled throughout the duration of the recording. The recordings were made in a small behavioral recording room, with animals placed in the room to habituate at least 30 minutes prior to recording. This room was well isolated from external noise, with dim, but equal lighting throughout the room as measured using a standard luxometer.
  • Open field recordings were made over intervals of either 10 min, 20 s or 30 min, 20 s, allowing 20 s for the experimenter to leave the room and close the door after placing the animal in the chamber, and the total distance traveled was calculated for the specified duration beginning after 20 s.
  • Borosilicate glass pipettes with resistances between with 1 to 3 M were filled with extracellular solution and used for recording action potential-associated capacitive current transients.
  • the pipette potential was held at 0 mV and placed close to the Purkinje neuron axon hillock (soma/axon).
  • Each Purkinje neuron recording spanned a duration of 2 minutes and an average of 43 cells were measured from each mouse.
  • Each treatment group contained approximately 5 mice that were injected at 8 weeks of age with ASO or PBS. Data were analyzed with custom MATLAB scripts (MathWorks) and Prism (GraphPad).
  • the ASO screen began with an in silica design stage where all possible 20 base pair “k-mers” from the start of the 5’-UTR through the end of the 3’-UTR, for a total of 3664 ASO sequences were determined. ASOs with sequences predicted to reduce efficacy were eliminated. ASOs with CpGs were eliminated to reduce immunoreactivity. Any remaining cytosines were 5 ’ -methylated. ASOs with 3 or more consecutive Gs were excluded to avoid G quadraduplexing. Only sequences with 1’Gs > -10 for hairpinning were allowed. The %GC content was limited to 40-60% for optimal annealing. ASOs not aligning with cynomolgus sequences for later NHP work were eliminated.
  • ASO-45 was included in the screen despite its sequence did not strictly conform to the established conservative criterion in that it has a tract of 3 consecutive Gs and a CpG dinucleotide. Of all the ASOs in the screen, only one other also had sequence identity to mouse Staul, ASO-308.
  • the 118 ASOs were then screened in HEK-293 cells transfected at a single 50 nM dose in duplicate, and performed qPCR to determine STAU1 mRNA abundance following 48 hours transfection time.
  • ASO-249 was the most efficacious ASO, with 38% STAU1 mRNA abundance remaining, and ASO-045 was the third-most efficacious ASO (Fig. 1A).
  • ASO-308 and ASO-287 have one and two mismatches to SORL1, respectively, that has loss of function mutations in Alzheimer’s disease.
  • ASO-294 has 1 mismatch to FUT8 and PARD3B that are both expressed in astrocytes by querying Brain RNA-seq.
  • ASO-278 that has one mismatch to POLG2 that is mutated in epilepsy.
  • ASOs in vivo was made possible by the production of a BAC mouse harboring the human STAU1 gene.
  • a 133.8 kDa BAC construct (Fig. 3A) was used and produced transgenic mice by pronuclear injection. Sequencing of BAC-SCA2 mouse bone marrow specimens determined the integration sites of 8 potential founder lines. Of these, only one founder, BAC-STAU1.6, had a single genomic integration of the transgene, on chromosome 17 (chrl7:9, 394, 829—9, 610, 924). The integration occurred simultaneously to a 210 kb genomic deletion within this region.
  • the 10 most potent ASOs in BAC-STAU1 were evaluated for efficacy. 8-week- old B AC-ST 'AU 1 mice were treated by intracerebroventricular (ICV) injection of 300 ug ASO for 2 weeks, and evaluated cerebellar and spinal cord proteins on western blots. Each of the ASOs significantly reduced STAU1 abundance both on western blots (Fig. 4A-D).
  • Fig. 4A-D the abnormally elevated levels of CALB1, GFAP, mTOR, p62, and LC3-II were markedly reduced or normalized in cerebellum.
  • STAU1, Aifl, and Gfap in cerebellum and spinal cord by qPCR were also evaluated (Fig. 4E, F).
  • some ASOs did not significantly reduce STAU1 mRNA levels in cerebellum despite the fact that they lowered STAU1 protein on western blots suggesting STAU1 ASOs may be effective for inhibiting translation.
  • Notable ASOs include ASO- 256 and ASO-319 that were consistently potent against both STAU1 protein and STAU1 mRNA and did not significantly elevate Aifl or Gfap abundance.
  • a comparison of the efficacious ASOs in doses in BAC-STAU1 mice was made.
  • ASO-256 and ASO-319 were selected as they were the two most efficacious ASOs for lowering Staufenl protein and mRNA in vivo (Fig. 4A), and ASO-249 and ASO-270 as the next two most efficacious ASOs were included based on the fact that the in vivo data, also supported by efficacy in ATXN2-Q58 KI cells (Figs. 2 and 4). These four ASOs are among the top 8 ranked by IC50 (Fig. 1C).
  • ASO-45 was further included since it also targets mouse Staul.
  • Aifl and Gfap were also assessed for microgliosis and astrogliosis, respectively, and observed no significant increases except for ASO-256 that elevated the expression of both genes at higher doses (Fig. 4B, C). ASO-256 was eliminated form further consideration.
  • the screen produced two ASOs that target human STAU1 that also have sequence identity to mouse Staul, ASO-45 and ASO-308.
  • 11 wk old wildtype mice were treated with 500 ug ASO by ICV injection with 2 wk treatment time.
  • cerebellar proteins were evaluated on western blots demonstrating -70% reduction of Staul protein levels compared to PBS treated control mice (Fig. 5A, B).
  • cerebellar Purkinje cells were showed in ATXN2-Q127 transgenic mice have reduced firing frequency that could be improved by lowering the expression of ATXN2 with an ASO.
  • a similar experiment by treating 8 wk old BAC- STAU1 mice or wildtype littermate control mice with 500 ug ASO-45 or PBS vehicle by ICV injection was performed. After two weeks treatment time extracellular recordings from PCs in acute cerebellar slices were made. As expected, it was observed significantly reduced PC firing frequency in ATXN2-Q127 mice compared to the WT littermates and the PC firing frequency in ATXN2-Q127 mice was significantly improved following treatment with ASO-45 (Fig. 7A). The PC firing frequency in wildtype littermates was unaffected by the ASO treatment (Fig. 7A). Evaluation of target engagement showed that Staul mRNA was significantly reduced in cerebellum of ATXN2-Q127 mice at the endpoint (Fig. 7B).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Agents, compositions, and methods of minimizing dysregulation of Staufen1-associated RNA metabolism are disclosed and described.

Description

STAUFEN-1 MODULATING AGENTS, COMPOSITIONS, AND METHODS
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of United States Provisional Patent Application Serial No. 63/423,787 filed on November 8, 2022, which is incorporated herein by reference in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
This invention was made with government support under grants R61 NS 124965, NS097903, NS033123, NS081182, NS 103883 and NS 127253 awarded by the National Institutes of Health. The government has certain rights in this invention.
NAMES OF THE PARTIES TO A JOINT RESEARCH AGREEMENT
Not applicable.
INCORPORATION BY REFERENCE STATEMENT
United States Provisional Patent Application Serial No. 63/423,787 filed on November 8, 2022, which is incorporated herein by reference in its entirety.
TECHNOLOGY FIELD
The present disclosure relates to agents, compositions, and methods for modulating Staufen-1. Accordingly, this disclosure involves the fields of chemistry and biology.
BACKGROUND OF THE DISCLOSURE
Neurodegenerative diseases occur when nerve cells in the brain or peripheral nervous system lose function over time and ultimately die. Further, nerve cells generally don’t reproduce or replace themselves. The risk of being affected by a neurodegenerative disease increases with age. Although treatments may help relieve some of the physical or mental symptoms associated with neurodegenerative diseases, there is currently no cure. Non-limiting examples of neurodegenerative diseases include peripheral neuropathy, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease (HD), spinocerebellar ataxia (SCA), prion disease, motor neuron disease (MND), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), and spinal muscular atrophy (SMA) among others.
BRIEF DESCRIPTION OF THE DRAWINGS
Features and advantages of the disclosure will be apparent from the detailed description which follows, taken in conjunction with the accompanying drawings, which together illustrate, by way of example, features of the disclosure; and, wherein:
FIGs. 1A-C shows an ASO screen as follows:
A) 118 STAU1 ASOs from the insilico design step were screened in HEK-293 cells in duplicate transfections at 50 nM. The STAU1/ACTB values shown are relative to mock transfected HEK-293 set to 100%, and are mean ± SD for duplicate wells.
B) A selection of efficacious STAU1 ASOs from the primary screen were rescreened in SCA2 (Q22/Q45) patient fibroblasts in triplicate at 100 nM. The least effective ASO in (A), ASO-239, was included as a negative control, and did not lower STAU1 expression in SCA2 FB cells. Values are mean ± SD. All pairwise comparisons to the mock transfected control are significantly different (****, pcO.0001), determined by one-way ANOVA with the Tukey correction for multiple comparisons.
C) IC50s from 6- point concentration curves compared for the 22 ASOs. Charts from which IC50s were derived are shown in Supplemental Data Fig. 1. In all cases, cellular STAU1 mRNA levels were determined by qPCR after 48 hours transfection time.
FIGs. 2A-B shows effects of ASOs for lowering pathologically elevated STAU1 abundance and on normalizing autophagy-related proteins as follows:
A) HEK-293 ATXN2-Q58 KI cells that have elevated STAU1 abundance relative to non-mutant HEK-293 ATXN2-Q22 cells were transfected in duplicate cultures with 100 nM of each of 10 lead ASOs. Following 48 hrs, STAU1 levels was determined in cell lysates by western blotting.
B) Quantifications of the blots shown in (A). Values are means ± SD relative to Actin. Blots were performed in duplicate or triplicate.
FIGs. 3A-E show graphical representations of the generation and characterization of a BAC-STAU1 transgenic mouse model as follows: A) Schematic of the BAC construct showing the relative position of the STAU1 gene and flanking sequences. B-E) Western blotting showing autophagy and other abnormal molecular phenotypes in the cerebellum of the BAC-STAU1 mouse model.
B) BAC- STAU1 mouse cerebellar extracts (14 weeks of age; 3-4 animals per group) showing expression of STAU1 (3 isoforms), abundance of mTOR, phospho- mTOR, phospho- S6K, p62 and LC3-II.
C) Quantification of B.
D) BAC-STAU1 mice had decreased levels of CALB1, RGS8, PCP2, PCP4 and FAM 107b, and increased cleaved caspase 3 in cerebellar extracts.
E) Quantification of D). Each lane represents an individual mouse.
0-Actin was used as a loading control.
FIGs. 4A-F show a graphical representation of in vivo testing of the top 10 lead ASOs in BAC-SCA2 mice. BAC-STAU1 mice were injected ICV at 8 weeks of age with 300 ug ASO and evaluated by western blotting and qPCR following 2 weeks treatment time. A-D) Western blotting. Shown are quantified western blot data for STAU1 and other proteins that were previously shown modified with STAU1 expression (CALB1, GFAP, mTOR, p62, LC3-TI) that are improved or restored following treatment with the ASOs.
A) ICV injection set 1 including ASOs 045, 276, 249, 307, 322, and 310. B) ICV injection set 2 including ASOs 256, 270, 319, and 288. C) Quantification of the 63 kDa and 55 kDa forms of STAU1 on blots shown in A & B. D) Quantification of CALB1, GFAP, mTOR, p62, LC3-II on blots shown in A & B. Values are means ± SD relative to Actin (for STAU1, CALB1, p62, LC3) or GAPDH (GFAP, mTOR). Blots were performed in duplicate or triplicate. E-F) qPCR: Shown are the mean + SD STAU1, Aifl, and Gfap expression values relative to Actin for the indicated ASOs in cerebellum (E) and spinal cord (F). Values are mean ± SD. One-way ANOVA with Bonferroni corrected probabilities: *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001; ns, not significant.
FIG. 5 shows a graphical representation of dose testing for lead ASOs in BAC- STAU1 mice. BAC-STAU1 mice aged 8 weeks were treated with the indicated ASOs and doses. Following 2 weeks treatment cerebellar STAU1, Aifl and Gfap were determined by quantitative PCR. N=3 mice per dose. Points represent mean ± SD for the qPCR values per mouse. One-way ANOVA with Bonferroni corrected probabilities: *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001; ns, not significant. FIGs. 6A-E show a graphical representation of ASO-45 and ASO-308 target Staul in wildtype mice. Wildtype mice were treated at 11 wks of age with 500 ug ASO, and were evaluated for molecular changes at 13 wks of age. N=2 WT injected with PBS and 4 WT mice injected with either ASO-045 or ASO-308. A&B) Western blotting of cerebellar protein extracts. C-E) Determination of Staul mRNA levels in cerebellar extracts by qPCR.
(A) and quantification
(B) Each lane represents a different mouse, and the blot was replicated once
(C) with evaluation of Gfap
(D) and Aifl
(E), markers of cytotoxicity
One-way ANOVA with Bonferroni corrected probabilities: **, p<0.01 ; ***, pcO.OO 1 ; ****, p<0.0001; ns, not significant.
FIGs. 7A-B show graphical representation demonstrating that Staul ASO-45 modifies Purkinje cell (PC) firing frequency in SCA2 ATXN2[Q127] mice. ATXN2[Q127] mice aged 8 weeks were treated with 500 ug of ASO-45 that targets mouse Staul or PBS vehicle.
A) Following 2 weeks treatment extracellular recordings were made from PCs in acute cerebellar slices. N=4-5 mice, 30- 50 neurons recorded per mouse. Values are means ± SEM.
B) Target engagement determined by qPCR. Statistical tests were performed by ANOVA using the mixed- effects model. *, p<0.05; **, p<0.01; ns, not significant.
FIGs. 8A-D show STAU1 ASO-45 normalized neuronal health markers in spinal cord of Thyl-TDP- 43TG/+ transgenic mice. Mice 24 wks of age were treated with ASO-45 or PBS for 2 wks and proteins from total spinal cord extracts were evaluated by western blotting. Proteins determined were human TDP-43 (hTDP-43), ChAT, NeuN and GFAP relative to GAPDH (A). Quantification of two blots (B). C & D) Immunohistochemical staining for TDP-43 in spinal cord. C) TDP-43 staining increased in motor neurons of TDP-43TG/+ mice vs WT mice, and was reduced in TDP-43TG/+ mice treated with ASO-45. D) Quantification of TDP-43TG/+ staining intensity in MNs from sections across the spinal cord including cervical, thoracic and lumbar regions. Probabilities were determined by one-way ANOVA and were adjusted using the Bonferroni correction: *, p<0.05; ***, p<0.001; ****, p<0.0001.
FIGs. 9A-D show results of on target open field behavior testing for lowering Staul in adult mice.
A) Distance travelled for center of mass for Staul heterozygous knockout (Staul+/-), Staul homozygous knockout (Staul-/-) and wildtype littermate mice 6 months of age, recorded over 30 min. No significant difference was observed between groups for genotype or sex (ANOVA, p>0.05). N= 21 WT (10 males 11 females), 20 Staul +/- (10 males 10 females), 15 Staul-/- (8 males 7 females).
B-D) WT mice age 3 months treated ICV with 300 Dg ASO-45 for 3 wks. B) Distance travelled for center of mass recorded over 10 min (Student’s t-test, p=0.098). No significant difference was observed between sexes (p>0.05). N=14 mice (7 males 7 females) per group.
C) Target engagement in brain by qPCR (Student’s t-test p<0.0001). D) Plot of Staul mRNA abundance vs distance revealing no correlation. Pearson’s correlation test p=0.73, r=0.078, r2=-0.006. Values are means and SEM (A-B) or SD (C). Experiments in A & B showed no significant difference in percentage of time in chamber center 50%.
FIG. 10 shows dose response for lowering STAU1 expression for 22 ASOs in SCA2 (Q22/Q45) patient derived fibroblast line 500-1. Cells were plated in 384 well plates and triplicate wells were included for each ASO dose. STAU1 abundance relative to ACTB was determined by qPCR following 48 hours transfection time. Experiments were done in batches with ASO-045 retested on each plate as a comparative control. IC50s were determined using the Hill equation. The value shown for the 0 nM dose is the mean across the five batches. The IC50 mean and SD for ASO- 045 is 54.09 + 2.2 nM.
DETAILED DESCRIPTION
Although the following detailed description contains many specifics for the purpose of illustration, a person of ordinary skill in the art will appreciate that many variations and alterations to the following details can be made and are considered to be included herein. Accordingly, the following embodiments are set forth without any loss of generality to, and without imposing limitations upon, any claims set forth. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
As used in this written description, the singular forms “a,” “an” and “the” include express support for plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a polymer” can include a plurality of such polymers.
As used herein, “subject” refers to a mammal that can benefit from treatment with a Staufenl -modulating agent. A benefit can be obtained if the subject has a disease or condition, or is at risk of developing a disease or condition for which a Staufenl - modulating agent is a therapeutically effective treatment or preventative measure. In some aspects, such subject may be a human.
As used herein, the terms “treat,” “treatment,” or “treating” when used in conjunction with the administration of a Staufenl -modulating agent, such as an siRNA or anti-sense oligonucleotide (ASO) that targets the STAU1 gene, including compositions and dosage forms thereof, refers to administration to subjects who are either asymptomatic or symptomatic. In other words, “treat,” “treatment,” or “treating” can be to reduce, ameliorate or eliminate symptoms associated with a condition present in a subject, or can be prophylactic, (i.e. to prevent or reduce the occurrence of the symptoms in a subject). Such prophylactic treatment can also be referred to as prevention of the condition. Treatment outcomes can be expected or unexpected. In one specific aspect, a treatment outcome can be a delay in occurrence or onset of a disease or conditions or the signs or symptoms thereof. In another aspect, a treatment can be reducing, ameliorating, eliminating, or otherwise providing a subject with relief from (i.e. relieving) the condition with which they are afflicted, or providing relief from signs or symptoms of the condition.
As used herein a “therapeutic agent” refers to an agent that can have a beneficial or positive effect on a subject when administered to the subject in an appropriate or effective amount.
As used herein, the terms “inhibit” or “inhibiting” are used to refer to a variety of inhibition techniques. For example, the terms “inhibit” or “inhibiting” can refer to pre- and/or post- transcriptional inhibition. With respect to pre-transcription inhibition, “inhibit” or “inhibiting” can refer to preventing or reducing transcription of a gene, inducing altered transcription of a gene, and/or reducing a rate of transcription of a gene, whether permanent, semi-permanent, or transient. Thus, in some examples, “inhibit” or “inhibiting” can refer to permanent changes to the DNA, whereas in other examples no permanent change to the DNA is made. With respect to post-transcriptional inhibition, “inhibit” or “inhibiting” can refer to preventing or reducing translation of a genetic sequence to a protein, inducing an altered translation of a genetic sequence to an altered protein (e.g. as misfolded protein, etc.), and/or reducing a rate of translation of a genetic sequence to a protein, whether permanent, semi -permanent, or transient. In some specific examples, “inhibit” or “inhibiting” can refer to pre- transcriptional inhibition. In other specific examples, “inhibit” or “inhibiting” can refer to post-transcriptional inhibition. Of course, the type of inhibition can depend on the specific type(s) of inhibitor(s) or therapeutic agent(s) employed. Thus, “inhibit” or “inhibiting” can include any decrease in expression of a gene as compared to native expression, whether pre- or post- transcriptional, partial or complete.
The term “middle” when used in connection with a string of alphanumeric characters refers to a portion thereof extending between the two end points, but not including the endpoints (e.g. characters on each end). As used herein, the “midpoint” when used in connection with a string of alphanumeric characters refers to the very center of such string, such that there are an equal number of characters on either side of the “midpoint”. For example, a string of 20 alphanumeric characters would have a midpoint between the 10th and 11th characters in the string (e.g. aaaaaaaaaalbbbbbbbbbb or 12345678910111121314151617181920, where the midpoint of the first string is between the letters a and b and of the second string between the number 10 and 11). Additionally, as used herein, the term “central” when used in connection with a string of alphanumeric characters refers to a number of characters extending equidistant from the midpoint. For example, in a string of numbers 1-20, the “central” 8 numbers would include 7, 8, 9, 10, 11, 12, 13, 14 with the midpoint being between numbers 10 and 11. Additionally, in the string of letters abcdefghijk, the “central 5 letters would be defgh with f being the midpoint. It is to be understood that when used in this written description, the term “middle” provides express support for the term “central” as if the term “central” were also recited.
As used herein, the terms “formulation” and “composition” are used interchangeably and refer to a mixture of two or more compounds, elements, or molecules. In some aspects the terms “formulation” and “composition” may be used to refer to a mixture of one or more active agents with a carrier or other excipients. Compositions can take nearly any physical state, including solid, liquid (i.e. solution), or gas. Furthermore, the term “dosage form” can include one or more formulation(s) or composition(s) provided in a format for administration to a subject.
The phrase “effective amount,” “therapeutically effective amount,” or “therapeutically effective rate(s)” of an active ingredient refers to a non-toxic, but sufficient amount or delivery rates of the active ingredient or therapeutic agent, to achieve therapeutic results in treating a disease or condition for which the drug is being delivered. It is understood that various biological factors may affect the ability of a substance to perform its intended task. Therefore, an “effective amount,” “therapeutically effective amount,” or “therapeutically effective rate(s)” may be dependent in some instances on such biological factors. Further, while the achievement of therapeutic effects may be measured by a physician or other qualified medical personnel, using evaluations known in the art, it is recognized that individual variation and response to treatments may make the achievement of therapeutic effects a subjective decision. The determination of a therapeutically effective amount or delivery rate is well within the ordinary skill in the art of pharmaceutical sciences and medicine. See, for example, Meiner and Tonascia, “Clinical Trials: Design, Conduct, and Analysis,” Monographs in Epidemiology and Biostatistics, Vol. 8 (1986).
As used herein, a “dosing regimen” or “regimen” such as “treatment dosing regimen,” or a “prophylactic dosing regimen,” refers to how, when, how much, and for how long a dose of a composition can or should be administered to a subject in order to achieve an intended treatment or effect.
As used herein, “carrier,” and “pharmaceutically acceptable carrier” may be used interchangeably, and refer to any liquid, gel, salve, solvent, liquid, diluent, fluid ointment base, liposome, micelle, giant micelle, or the like, or any other suitable carrier that is suitable for delivery of a therapeutic agent to and/or into a target cell (e.g. a nerve cell) and for use in contact with a subject or the subject’s tissue without causing adverse physiological responses, and which does not interact with the other components of the composition in a deleterious manner.
In this application, “comprises,” “comprising,” “containing” and “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “includes,” “including,” and the like, and are generally interpreted to be open ended terms. The terms “consisting oT’ or “consists of” are closed terms, and include only the components, structures, steps, or the like specifically listed in conjunction with such terms, as well as that which is in accordance with U.S. Patent law. “Consisting essentially of’ or “consists essentially of’ have the meaning generally ascribed to them by U.S. Patent law. In particular, such terms are generally closed terms, with the exception of allowing inclusion of additional items, materials, components, steps, or elements, that do not materially affect the basic and novel characteristics or function of the item(s) used in connection therewith. For example, trace elements present in a composition, but not affecting the compositions nature or characteristics would be permissible if present under the “consisting essentially of” language, even though not expressly recited in a list of items following such terminology. When using an open-ended term, like “comprising” or “including,” in this written description it is understood that direct support should be afforded also to “consisting essentially of’ language as well as “consisting of’ language as if stated explicitly and vice versa.
When reciting a string of alphanumeric characters in this written description, such as a nucleotide sequence, it is to be understood that the string of alphanumeric characters provides express support for no only the entire recited sequence, but also for sub-sets or portions of the sequence as if expressly recited. For example, a sequence of: acgtctaaaccgtcacctta provides support for not only the entire sequence, but for subsets or portions thereof such as the 10 central characters ctaaaccgtc, the first 4 characters, such as acgt, etc.
The terms “first,” “second,” “third,” “fourth,” and the like in the description and in the claims, if any, are used for distinguishing between similar elements and not necessarily for describing a particular sequential or chronological order. It is to be understood that any terms so used are interchangeable under appropriate circumstances such that the embodiments described herein are, for example, capable of operation in sequences other than those illustrated or otherwise described herein. Similarly, if a method is described herein as comprising a series of steps, the order of such steps as presented herein is not necessarily the only order in which such steps may be performed, and certain of the stated steps may possibly be omitted and/or certain other steps not described herein may possibly be added to the method.
As used herein, the term “substantially” refers to the complete or nearly complete extent or degree of an action, characteristic, property, state, structure, item, or result. For example, an object that is “substantially” enclosed would mean that the object is either completely enclosed or nearly completely enclosed. The exact allowable degree of deviation from absolute completeness may in some cases depend on the specific context. However, generally speaking the nearness of completion will be so as to have the same overall result as if absolute and total completion were obtained. The use of “substantially” is equally applicable when used in a negative connotation to refer to the complete or near complete lack of an action, characteristic, property, state, structure, item, or result. For example, a composition that is “substantially free of’ particles would either completely lack particles, or so nearly completely lack particles that the effect would be the same as if it completely lacked particles. In other words, a composition that is “substantially free of’ an ingredient or element may still actually contain such item as long as there is no measurable effect thereof.
As used herein, the term “about” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “a little above” or “a little below” the endpoint. Unless otherwise stated, use of the term “about” in accordance with a specific number or numerical range should also be understood to provide support for such numerical terms or range without the term “about”. For example, for the sake of convenience and brevity, a numerical range of “about 50 milligrams to about 80 milligrams” should also be understood to provide support for the range of “50 milligrams to 80 milligrams.” Furthermore, it is to be understood that in this written description support for actual numerical values is provided even when the term “about” is used therewith. For example, the recitation of “about” 30 should be construed as not only providing support for values a little above and a little below 30, but also for the actual numerical value of 30 as well.
As used herein, a plurality of items, structural elements, compositional elements, and/or materials may be presented in a common list for convenience. However, these lists should be construed as though each member of the list is individually identified as a separate and unique member. Thus, no individual member of such list should be construed as a de facto equivalent of any other member of the same list solely based on their presentation in a common group without indications to the contrary.
Concentrations, amounts, and other numerical data may be expressed or presented herein in a range format. It is to be understood that such a range format is used merely for convenience and brevity and thus should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. As an illustration, a numerical range of “about 1 to about 5” should be interpreted to include not only the explicitly recited values of about 1 to about 5, but also include individual values and sub-ranges within the indicated range. Thus, included in this numerical range are individual values such as 2, 3, and 4 and sub-ranges such as from 1-3, from 2-4, and from 3-5, etc., as well as 1, 2, 3, 4, and 5, individually.
This same principle applies to ranges reciting only one numerical value as a minimum or a maximum. Furthermore, such an interpretation should apply regardless of the breadth of the range or the characteristics being described.
Reference in this application may be made to compositions, systems, or methods that provide “improved” or “enhanced” performance. It is to be understood that unless otherwise stated, such “improvement” or “enhancement” is a measure of a benefit obtained based on a comparison to compositions, systems or methods in the prior art. Furthermore, it is to be understood that the degree of improved or enhanced performance may vary between disclosed embodiments and that no equality or consistency in the amount, degree, or realization of improvement or enhancement is to be assumed as universally applicable.
Reference throughout this specification to “an example” means that a particular feature, structure, or characteristic described in connection with the example is included in at least one embodiment. Thus, appearances of the phrases “in an example” in various places throughout this specification are not necessarily all referring to the same embodiment.
Example Embodiments
An initial overview of invention embodiments is provided below and specific embodiments are then described in further detail. This initial summary is intended to aid readers in understanding the technological concepts more quickly, but is not intended to identify key or essential features thereof, nor is it intended to limit the scope of the claimed subject matter.
STAU1 is an RNA binding protein that functions in RNA degradation and mRNA trafficking in neurons as well as nuclear exit of mRNA. STAU1 has been identified as an interacting protein to ATXN2, a protein that is polyglutamine expanded in spinocerebellar ataxia type 2 (SCA2). In view of this, the present inventors investigated STAU1 in both SCA2 and ALS - relevant cells and mouse models and found that STAU 1 is overabundant in SCA2 and other neurodegenerative diseases, including in the relevant cellular and transgenic mouse models and human patient tissues and cultured fibroblast cells. In addition to SCA2 these include Huntington’s disease (HD), C9orf72 ALS, and TDP-43 ALS. STAU1 overabundance is associated with abnormal autophagy in multiple human tissues and mouse models of neurodegenerative disease. Mechanistically, this occurs by STAU1 direct interaction with the MTOR mRNA 5’-UTR resulting in its increased translation. Reducing STAU1 abundance normalized autophagy marker proteins in various systems including HEK-293 cells edited to express polyglutamine expanded ATXN2-Q58, and cultured patient fibroblasts from SCA2, TDP-43 and C9orf72 ALS patients, and transgenic mouse models with TDP-43 or C9orf72 mutations. Additionally, lowering Staufen abundance improves SCA2 mouse motor phenotypes and protein aggregations and mTOR-related autophagy phenotypes.
In some aspects of the present disclosure, antisense oligonucleotides (ASO) have been developed for therapeutic targeting STAU1. Lowering STAU 1 modifies the mTOR- related autophagy phenotype in cultured cells and in a BAC-STAU1 transgenic mouse model that the present inventors developed. ASOs targeting mouse Staul useful for proof- of-concept studies in mice have also been identified and developed. Improvement of neuronal phenotypes in SCA2 and TDP-43 transgenic mice treated with the Stau 1 ASO has been demonstrated.
STAU1 is elevated and aggregated in cells from SCA2 patients, cells from amyotrophic lateral sclerosis (ALS) patients, and in SCA2 and ALS mouse models. Reduction of STAU 1 abundance in vivo by genetic interaction improved motor behavior in an SCA2 mouse model, normalized the levels of several SCA2-related proteins, and reduced aggregation of polyglutamine-expanded ATXN2. In this disclosure, antisense oligonucleotides (ASOs) that lower STAU1 expression were developed and identified as part of efforts to develop a therapeutic that may be effective for treating SCA2 and ALS. A screen of 118 20mer phosphorothioate 2’-O-methoxyethyl (MOE) ASO gapmers targeting across the STAU1 mRNA coding region for lowering STAU1 expression in HEK-293 cells was performed. ASO lowering STAU1 by >45% were rescreened in SCA2 patient fibroblasts, and 10 of these were tested for lowering STAU1 abundance in vivo in a new BAC-STAU1 mouse model. This identified efficacious ASOs targeting human STAU1 in vivo that normalized autophagy marker proteins. ASO-45 that targets human and mouse Staul was chosen for further in vivo testing. When delivered by intracerebroventricular (ICV) injection, ASO-45 normalized autophagy markers and abnormal mRNA abundances in cerebella of ATXN2-Q127 SCA2 mice. In Thyl-TDP-43 transgenic mice, a model for ALS, ASO-45 also reduced STAU1, increased ChAT and, NeuN abundance, and reduced cleaved caspase-3 levels in spinal cord extracts. Targeting STAU1 can be used for treating ALS and SCA2 as well as other disorders characterized by STAU1 overabundance or impairment of autophagic flux. Such movement or motor disorders include without limitation spinal muscular atrophy (SMA) (nusinersen, onasemnogene abeparvovec and risdiplam) and Duchenne’s muscular dystrophy (DMD) (eteplirsen, golodirsen and viltolarsen) or other conditions incident to non-mutant ATXN2.
Abnormalities in the autophagy pathway that can be improved by lowering STAU1 expression. Patient fibroblasts characterized by overabundant STAU1 have hyperactivated mTOR and overabundance of autophagy marker proteins p62 and LC3-II. The same is true in the cerebella and spinal cords of ATXN2-Q127 mice and 77zy7-TDP-43 mice. The present inventors have pinpointed the reason for these abnormalities, by demonstrating a direct interaction between STAU1 and the 5’- UTR of the MTOR mRNA transcript resulting in its increased translation. Likewise, reduced expression of the cerebellar gene PCP2 in SCA2 patient skin cell fibroblasts, previously confirmed in cerebella of ATXN2-Q127 mice has been observed, that was accounted for by STAU1 direct binding of the 3 ’-UTR of the PCP2 mRNA transcript entering it into the Staufenl mediated mRNA decay (SMD) pathway. These abnormal pathways of autophagy and PCP2 protein expression could be normalized by lowering STAU1 expression by RNAi. STAU1 also bidirectionally modulates activation of the unfolded protein response (UPR). Overexpression of STAU1 caused pro-apoptotic activation of the UPR, evidenced as an increase in PERK, p-eIF2a and CHOP proteins. Conversely, in TDP-43 and C9ORF72 mutant patient-derived skin cell fibroblasts, which have basally increased levels of STAU1, CHOP and p-eIF2a, knockdown of STAU1 by RNAi normalized the levels of UPR mediators. We also performed a number of genetic interaction studies in which we crossed SCA2 or TDP-43 transgenic mice with Staul+'~ mice. ATXN2-Q127 mice haploinsufficient for Staul had improved rotarod performance, improved expression of several cerebellar health-indicator genes including Pcp2, and no evidence of Staul/ATXN2-positive inclusion bodies in Purkinje cells that were observed in ATXN2- Q127 mice. ATXN2-Q127 mice either haploinsufficient or null for Staul also had improved or normalized protein abundances for each of mTOR, p- mTOR, p-S6k, p62, LC3 and cleaved CASP3, as did Thy 1 -TDP-43 transgenic mice haploinsufficient for Staul. These genetic interaction studies demonstrate that autophagy and neuronal death phenotypes in multiple mouse models can be improved by lowering STAU1 abundance by only 50%. As a first step in identifying potentially therapeutic ASPs, the present inventors determined all possible ASOs to the STAU1 cDNA then applied criteria for eliminating ASOs with features indicative of an ineffective therapeutic, and of these selected 118 nearly uniformly distributed ASOs for screening. The objective was to identify regions in STAU1 vulnerable to MOE gapmer ASOs supporting RNase Hl activity, revealing lead ASOs that could be optimized by ASO medchem in future research toward developing a STAU1 ASO for use in patients. Upon performing the primary screen in HEK-293 cells, then retesting efficacious ASOs in SCA2 patient fibroblasts, the most efficacious 10 ASOs in BAC-STAU1 mice for lowering STAU1 abundance and restoring the expression of autophagy marker proteins were identified and selected. The production of a new B AC-STAU 1 mouse model, allowed for identification of abnormal abundance of autophagy proteins (mTOR, p-mTOR, p-S6K, p62, LC3-II) and gene expression Calhl, Rgs8, Pcp2, Pcp4, Fam 107b) in cerebellum, further supporting STAU1 role in pathogenesis. Four ASOs (ASOs 249, 256, 270, 319) were selected in view of superior efficacy and that also had few or no off targets in CNS tissues determined by aligning ASO sequences to the human genome. Vulnerable regions in STAU1 to MOE gapmer ASOs when STAU1 levels are less than 50% were defined. The longest of these is 39 bp in length, defined by ASOs 246-249, including the lead ASO- 249. Two ASOs (ASO-045 and ASO-308) were also identified that target mouse Staul as well as human STAU1, useful for in vivo proof of concept studies. Among the top 10 leads ASO-308 had the lowest IC50, however it also had only one mismatch to SORL1 which has LOF mutations in Alzheimer’ s disease.
On- and off-target methodologies have limitations. Ultimately, it is typical that the only solution to minimizing off-target RNA-dependent activity is confirmation by empirical preclinical safety testing. In cytotoxicity analyses, the present inventors observed no increases of Aifl or Gfap in BAC-STAU1 mice treated with any of the top 10 lead ASOs (Fig. 4), except for ASO-256 in a secondary study (Fig. 5) and ASO-308 significantly elevated Gfap in wildtype mice in a separate experiment, albeit very slightly in magnitude (Fig. 6), resulting in the elimination of these two ASOs from further consideration.
Off-targets: To reduce the potential for RNA-dependent off-targets, the most efficacious ASOs from our screen for tracts of sequence identity to genes expressed in the CNS were evaluated. ASOs were aligned to the hg38 human genome. In addition, the STAU1 ASOs will not target the STAU2 gene because verified lack of sequence identity in the targeted regions was verified. Another form of target specificity is when an ASO targets the incorrect splice variant. It was confirmed that all of the 10 most efficacious ASOs (those used in Figs. 3 and 4) would target all STAU1 isoforms annotated in Ensembl.
On -tar gets: Staul'1' mice are viable and have no overt neurological phenotype. Staul'" mice have been demonstrated to have no Morris water maze phenotype and mildly reduced open field locomotor activity. Also, mice null for Staul showed reduced numbers of functional synapses in hippocampal neurons. It is unclear if this is also observed in Stau l+l' mice and if this is due to developmental or later functional defects. However, the testing activities of the present inventors did not show reduced locomotion in either Staul 1 or Staul 7 mice, and confirmed the observed normal center crossing phenotype (Fig. 9). To evaluate the effect of lowering Staul expression with an ASO therapeutic open field testing was performed on wildtype mice treated with ASO-45, showing no significant changes in locomotion (Fig. 9).
To support targeting Staufenl for treating neurodegenerative diseases ASO-45 was utilized in in vivo proof of concept studies. As stated above, it was demonstrated that ASO-308 also targeted mouse Staul but ASO-308 also slightly elevated Gfap in wildtype mice, but not ASO-45 (Fig. 6). While ASO-308 was highly potent compared to other leads by IC50, in wildtype mice it was equally effective to ASO-45 for lowering mouse Staul.
A previous experiment demonstrating that ATXN2-Q127 mice had reduced intrinsic Purkinje cell firing frequency that was restored by ICV treatment with an ASO targeting ATXN2 was repeated in ATXN2-Q127 mice, but using ASO-45. The reduced firing frequency in ATXN2-Q127 mouse PCs in extracellular recordings was shown, and the firing frequency was significantly increased in ATXN2-Q127 mice treated ICV with ASO-45 (Fig. 7). The firing frequency in this experiment was not fully restored which may be due to ASO-45 not being the most optimized for lowering mouse Staul. In a second in vivo proof of concept study, Thyl -TD P-43 mice were utilized, in which were previously showed have overabundant Staul abundance. Such mice were with ASO-45 and demonstrated that the normalized STAU1 abundance, comparable to that found in wildtype mice, resulted in completely normalized ChAT and NeuN abundance in 77n7-TDP-43 mouse spinal cord. The present disclosure confirms ASO therapeutics as viable treatment for SMA and DMD and various neurodegenerative diseases. Where STAU1 is overabundant in cells and animal models relevant to multiple neurodegenerative diseases, including SCA2, ALS, AD, and HD, and the methods of the present disclosure demonstrate that lowering Staul in mouse models relevant to SCA2 and ALS by merely 50% improves disease phenotypes.
Accordingly, the present disclosure describes compositions and methods for normalizing or controlling or otherwise modulating Staufenl levels or activity in a target cell (e.g. a nerve cell). As one non-limiting example, a method of minimizing dysregulation of Staufenl -associated RNA metabolism is described. The method can include introducing an amount of a Staufenl -modulating agent to a target cell sufficient to minimize the dysregulation.
A method of modulating Staufenl activity is also described. The method can include introducing an amount of a Staufenl -modulating agent to a target cell sufficient to reduce Staufenl activity as compared to Staufenl activity prior to or without introducing the Staufenl -modulating agent.
Further, a method of controlling Staufenl accumulation in a target cell is described. The method can include introducing an amount of a Staufenl modulating agent to a target cell sufficient to reduce a concentration of Staufenl in the target cell as compared to the concentration in the target cell prior to or without introducing the Staufenl -modulating agent.
Further still, a method of treating a neurodegenerative condition associated with Staufenl -induced dysregulation of RNA metabolism is described. The method can include administering a therapeutically effective amount of a Staufenl-modulating agent to a target cell of a subject.
A therapeutic agent or composition for treating a neurodegenerative condition associated with Staufenl -induced dysregulation of RNA metabolism is also described. The therapeutic agent can be a Staufenl-modulating agent. The therapeutic composition can include a therapeutically effective amount of a Staufenl-modulating agent and a pharmaceutically acceptable carrier.
In the present disclosure, it is noted that when discussing the various methods, the therapeutic agent, and the therapeutic composition, each of these discussions can be considered applicable to each of these examples, whether or not they are explicitly discussed in the context of that example. Thus, for example, in discussing details about a method per se, such discussion also refers to the other methods described herein, the therapeutic agent, the therapeutic composition, therapeutic dosage amounts and forms, and vice versa.
In further detail, the present disclosure describes methods of minimizing dysregulation of Staufenl -associated RNA metabolism. As described above, Staufenl can perform a number of RNA-related functions, such as mRNA transport and degradation, for example. Thus, in some cases, having elevated Staufenl levels in a target cell can lead to dysregulation of Staufenl -associated RNA metabolism. Further, in some examples, elevated levels of Staufenl in a target cell can lead to undesired and accelerated degradation of various cellular components. Accordingly, the methods can include introducing a sufficient amount of a Staufenl -modulating agent to a target cell to minimize Staufenl -associated dysregulation of RNA metabolism.
A variety of Staufenl -modulating agents can be employed in the methods recited herein. It is noted that when discussing Staufenl -modulating agents per se, it is to be understood that a Staufenl -modulating agent can act or function to modulate Staufenl without directly interacting with Staufenl. For example, in some cases a Staufenl- modulating agent can be an agent that acts upstream from Staufenl to regulate Staufenl. As one non-limiting example, in some cases, a Staufenl -modulating agent can be a therapeutic agent that inhibits expression of mutant ATXN2. In this way, the staufenl- modulating agent can facilitate modulating of Staufenl without directly interacting with Staufenl protein or STAU1 gene, but rather with cellular components or genes which have a direct or indirect impact on Staufenl protein, including its properties, or behavior, such as lifespan, residence time, binding availability, stability, cellular accumulation, etc. Thus, in some examples, an effective Staufenl -modulating agent can also include a gene therapy agent, such as for modifying a mutant allele to a wild-type allele to facilitate modulation of Staufenl.
In some specific examples, the Staufenl -modulating agent can be an antisense oligonucleotide (ASO). In some aspects, the ASO can include one or more suitable modifications, such as sulfur for oxygen substitutions (e.g. introduction of phosphorothioate linkages), 2’-OH modifications, 2’-0-methyl modifications, 2’-fluoro modifications, 2’-O-methoxyethyl modifications, locked nucleic acid (LNA) modifications, bridged nucleic acid (BNA) modifications, peptide nucleic acid (PNA) modifications, morpholino modifications, hexitol nucleic acid (HNAs) modifications, introduction of central phosphodiester or phosphorothioate residues (e.g. to form a “gapmer”), the like, or combinations thereof.
In some examples, the ASO can be a gapmer, such as an Ax-Gn-Ax gapmer, where A represents an artificial nucleotide monomer and x is an integer from 2 to 7, and where G represents the gap or block of natural antisense nucleotide monomers and n is an integer from 8 to 12. Where the ASO is a gapmer, a variety of artificial nucleotide monomers can be used in the 5’ and 3’ wings, such as those mentioned above. For example, non- limiting examples can include 2’-O-methoxyethyl (MOE), 2’, 4’ -bridged nucleic acid (BNA), locked nucleic acid (LNA), N-Me-aminooxy BNA, 2’-N-(methyl)-4’-C- aminooxymethylene 2’,4’-bridged nucleic acid, N-Me-aminooxy 2’,4’-bridged nucleic acid, 2’-N-(methyl)-4’-C-aminooxymethylene 2’, 4’ -bridged nucleic acid, 2’,4’-BNANC [NMe], 2’-O,4’-C-(N-methyl) aminomethylene, 2’, 4’ -bridged nucleic acid, 2’,4’-BNANC, 2’-O,4’-C-aminomethylene 2’,4’-bridged nucleic acid, phosphorothioate S-constrained ethyl (cEt), the like, or a combination thereof. In some specific examples, the gapmer can UU00288 SEQ ID NO: 9 TGCTGATGACTTAGATAAGG
UU00294 SEQ ID NO: 10GCCTGAAGAGATGTTATTCT
UUOO3O8 SEQ ID NO: 11 GGCCAGAAAAGGTTCAGCAC
UU00310 SEQ ID NO: 12 GGCCCACTGGAGGTATCAGA UU00359 SEQ ID NO: 37 TCTTTAAAATGGTCTCGGCT
In some non-limiting examples, the ASO can be or include a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20,
SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25,
SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30,
SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, the 8 consecutive nucleotides can be the 8 middle (e.g. central) nucleotides of the listed nucleotide sequences. In some additional examples, the ASO can be or include one or more nucleotide sequences having at least 10 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17,
SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22,
SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27,
SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32,
SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37. In some examples, the 10 consecutive nucleotides can be the 10 middle (e.g. central) nucleotides of the listed nucleotide sequences. In some additional examples, the ASO can be or include one or more nucleotide sequences having at least 12 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16,
SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21,
SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26,
SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31,
SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36,
SEQ ID NO: 37. In some examples, the 12 consecutive nucleotides can be the 12 middle (e.g. central) nucleotides of the listed nucleotide sequences. In some additional examples, the ASO can be or include one or more nucleotide sequences having at least 14 consecutive nucleotides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37. In some examples, the 14 consecutive nucleotides can be the 14 middle (e.g. central) nucleotides of the listed nucleotide sequences.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 1. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 1. In some examples, the consecutive nucleotides of SEQ ID NO: 1 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 1. In some specific examples, the consecutive nucleotides of SEQ ID NO: 1 can include the middle (e.g. central) 10 nucleotides (i.e., GGCTTATACA). In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 1.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 2. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 2. In some examples, the consecutive nucleotides of SEQ ID NO: 2 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 2. In some specific examples, the consecutive nucleotides of SEQ ID NO: 2 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 2.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 3. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 3. In some examples, the consecutive nucleotides of SEQ ID NO: 3 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 3. In some specific examples, the consecutive nucleotides of SEQ ID NO: 3 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 3.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 4. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 4. In some examples, the consecutive nucleotides of SEQ ID NO: 4 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 4. In some specific examples, the consecutive nucleotides of SEQ ID NO: 4 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 4. In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 5. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 5. In some examples, the consecutive nucleotides of SEQ ID NO: 5 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 5. In some specific examples, the consecutive nucleotides of SEQ ID NO: 5 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 5.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 6. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 6. In some examples, the consecutive nucleotides of SEQ ID NO: 6 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 6. In some specific examples, the consecutive nucleotides of SEQ ID NO: 6 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 6.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 7. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 7. In some examples, the consecutive nucleotides of SEQ ID NO: 7 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 7. In some specific examples, the consecutive nucleotides of SEQ ID NO: 7 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 7.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 8. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 8. In some examples, the consecutive nucleotides of SEQ ID NO: 8 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 8. In some specific examples, the consecutive nucleotides of SEQ ID NO: 8 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 8.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 9. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 9. In some examples, the consecutive nucleotides of SEQ ID NO: 9 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 9. In some specific examples, the consecutive nucleotides of SEQ ID NO: 9 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 9.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 10. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 10. In some examples, the consecutive nucleotides of SEQ ID NO: 10 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 10. In some specific examples, the consecutive nucleotides of SEQ ID NO: 10 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 10.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 11. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 11. In some examples, the consecutive nucleotides of SEQ ID NO: 11 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 11. In some specific examples, the consecutive nucleotides of SEQ ID NO: 11 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 11.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 12. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 12. In some examples, the consecutive nucleotides of SEQ ID NO: 12 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 12. In some specific examples, the consecutive nucleotides of SEQ ID NO: 12 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 12.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 13. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 13. In some examples, the consecutive nucleotides of SEQ ID NO: 13 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 13. In some specific examples, the consecutive nucleotides of SEQ ID NO: 13 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 13.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 14. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 14. In some examples, the consecutive nucleotides of SEQ ID NO: 14 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 14. In some specific examples, the consecutive nucleotides of SEQ ID NO: 14 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 14.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 15. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 15. In some examples, the consecutive nucleotides of SEQ ID NO: 15 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 15. In some specific examples, the consecutive nucleotides of SEQ ID NO: 15 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 15.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 16. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 16. In some examples, the consecutive nucleotides of SEQ ID NO: 16 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 16. In some specific examples, the consecutive nucleotides of SEQ ID NO: 16 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 16.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 17. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 17. In some examples, the consecutive nucleotides of SEQ ID NO: 17 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 17. In some specific examples, the consecutive nucleotides of SEQ ID NO: 17 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 17.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 18. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 18. In some examples, the consecutive nucleotides of SEQ ID NO: 18 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 18. In some specific examples, the consecutive nucleotides of SEQ ID NO: 18 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 18.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 19. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 19. In some examples, the consecutive nucleotides of SEQ ID NO: 19 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 19. In some specific examples, the consecutive nucleotides of SEQ ID NO: 19 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 19. In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 20. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 20. In some examples, the consecutive nucleotides of SEQ ID NO: 20 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 20. In some specific examples, the consecutive nucleotides of SEQ ID NO: 20 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 20.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 21. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 21. In some examples, the consecutive nucleotides of SEQ ID NO: 21 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 21. In some specific examples, the consecutive nucleotides of SEQ ID NO: 21 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 21.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 22. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 22. In some examples, the consecutive nucleotides of SEQ ID NO: 22 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 22. In some specific examples, the consecutive nucleotides of SEQ ID NO: 22 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 22.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 23. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 20. In some examples, the consecutive nucleotides of SEQ ID NO: 23 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 23. In some specific examples, the consecutive nucleotides of SEQ ID NO: 23 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 23.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 24. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 24. In some examples, the consecutive nucleotides of SEQ ID NO: 24 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 24. In some specific examples, the consecutive nucleotides of SEQ ID NO: 24 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 24.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 25. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 25. In some examples, the consecutive nucleotides of SEQ ID NO: 25 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 25. In some specific examples, the consecutive nucleotides of SEQ ID NO: 25 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 25.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 26. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 26. In some examples, the consecutive nucleotides of SEQ ID NO: 26 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 26. In some specific examples, the consecutive nucleotides of SEQ ID NO: 26 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 26.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 27. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 27. In some examples, the consecutive nucleotides of SEQ ID NO: 27 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 27. In some specific examples, the consecutive nucleotides of SEQ ID NO: 27 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 27.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 28. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 28. In some examples, the consecutive nucleotides of SEQ ID NO: 28 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 28. In some specific examples, the consecutive nucleotides of SEQ ID NO: 28 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 28.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 29. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 29. In some examples, the consecutive nucleotides of SEQ ID NO: 29 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 29. In some specific examples, the consecutive nucleotides of SEQ ID NO: 29 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 29.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 30. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 30. In some examples, the consecutive nucleotides of SEQ ID NO: 30 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 30. In some specific examples, the consecutive nucleotides of SEQ ID NO: 30 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 30.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 31. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 31. In some examples, the consecutive nucleotides of SEQ ID NO: 31 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 31. In some specific examples, the consecutive nucleotides of SEQ ID NO: 31 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 31.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 32. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 32. In some examples, the consecutive nucleotides of SEQ ID NO: 32 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 32. In some specific examples, the consecutive nucleotides of SEQ ID NO: 32 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 32.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 33. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 33. In some examples, the consecutive nucleotides of SEQ ID NO: 33 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 33. In some specific examples, the consecutive nucleotides of SEQ ID NO: 33 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 33.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 34. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 34. In some examples, the consecutive nucleotides of SEQ ID NO: 34 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 34. In some specific examples, the consecutive nucleotides of SEQ ID NO: 34 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 34. In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 35. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 35. In some examples, the consecutive nucleotides of SEQ ID NO: 35 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 35. In some specific examples, the consecutive nucleotides of SEQ ID NO: 35 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 35.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 36. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 36. In some examples, the consecutive nucleotides of SEQ ID NO: 36 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 36. In some specific examples, the consecutive nucleotides of SEQ ID NO: 36 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 36.
In some examples, the ASO can be or include a nucleotide sequence that is at least 95%, 90%, 85%, or 80% homologous to SEQ ID NO: 37. In some additional examples, the ASO can be or include a nucleotide sequence having at least 6, 8, 10, 12, or 14 consecutive nucleotides of SEQ ID NO: 37. In some examples, the consecutive nucleotides of SEQ ID NO: 37 can include the middle (e.g. central) 6, 8, 10, 12, or 14 nucleotides of SEQ ID NO: 37. In some specific examples, the consecutive nucleotides of SEQ ID NO: 37 can include the middle (e.g. central) 10 nucleotides. In some examples, the ASO can be or include a nucleotide sequence that is at least 90%, 80%, or 70% homologous to the middle (e.g. central) 10 nucleotides of SEQ ID NO: 37.
The method of controlling, modulating, or normalizing Staufenl activity in a target cell can include introducing an amount of a Staufenl -modulating agent to a target cell sufficient to reduce Staufenl activity as compared to Staufenl activity prior to or without introducing the Staufenl -modulating agent. It is noted that, in this particular method, it is not necessary to reduce the amount of Staufenl present in the target cell to control, normalize, or minimize Staufenl activity in the target cell. However, this is also one mechanism of accomplishing reduced Staufenl activity in the target cell. In other examples, (e.g. via a mutant ATXN2-inactivating agent or mutant ATXN2-inhibiting agent, or other upstream inactivating agent or inhibiting agent, such as those described above, for example) Staufenl activity can be reduced by reducing the mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein as described above) present in the target cell. This can be accomplished by a number of methods, such as inhibiting expression of the mutant ATXN2 gene (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant gene associated with neurological disorders), editing the mutant ATXN2 gene (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant gene associated with neurological disorders, such as those described above) to a wild-type sequence, the like, or a combination thereof. In still other examples, the activity of Staufenl can be reduced by introducing a Staufenl- modulating agent that can bind to, degrade, etc. Staufenl to inactivate or otherwise interfere with the metabolic function of Staufenl in the target cell. In still other examples, the Staufenl -modulating agent can bind to, degrade, etc. mutant ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) to minimize aggregation of Staufenl thereto, stabilization of Staufenl, the like, or a combination thereof. In some additional examples, the Staufenl-modulating agent can reduce or block Staufenl interaction with mRNAs, which can result in altered mRNA expression or abundance.
A therapeutic agent, such as a Staufenl-modulating agent for treating a neurodegenerative condition associated with Staufenl -induced dysregulation of RNA metabolism can include those described elsewhere herein. A therapeutic composition for treating a neurodegenerative condition associated with Staufenl -induced dysregulation of RNA metabolism can include a therapeutically effective amount of Staufenl-modulating agent and a pharmaceutically acceptable carrier. Again, the Staufenl-modulating agent in the therapeutic composition can include those described elsewhere herein.
The therapeutically effective amount of the Staufenl-modulating agent can depend on the mode of administration, the subject being treated, the type and severity of the condition, the particular Staufenl-modulating agent(s) being employed, etc. In some examples, the therapeutically effective amount of Staufenl-modulating agent can be an amount sufficient to increase PCP2 mRNA levels in the target cell, CALB1 mRNA levels in the target cell, other mRNAs in the target cell that are metabolized via Staufenl- associated metabolism, or a combination thereof when administered in an effective dosing regimen as compared to the levels of these mRNAs prior to or without administration of the Staufenl -modulating agent. In some examples, the therapeutically effective amount can be an amount sufficient to increase one or more of these mRNAs by at least 10%, 20%, 30%, 40%, or more when administered in an effective dosing regimen as compared to the level prior to or without administration of the Staufenl -modulating agent. In some examples, the therapeutically effective amount of the Staufenl -modulating agent can be an amount sufficient to reduce the amount of Staufenl present in the target cell when administered in an effective dosing regimen as compared to the amount of Staufenl present in the target cell prior to or without administration of the Staufenl-modulating agent. In some specific examples, the therapeutically effective amount can be an amount sufficient to reduce Staufenl in the target cell by at least 30%, 40%, 50%, 60%, or 70% when administered in an effective dosing regimen as compared to Staufenl levels prior to or without administration of the Staufenl-modulating agent.
In still other examples, the therapeutically effective amount of the Staufenl- modulating agent can be an amount sufficient to reduce a mutant ATXN2 level (or a level of another protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) in the target cell when administered in an effective dosing regimen as compared to the mutant ATXN2 level (or mutant c9orf72 level, or mutant TDP-43 level, or mutant Tau level, or mutant APP level, for example) prior to or without administration of the Staufenl-modulating agent. In some specific examples, the therapeutically effective amount can be an amount sufficient to reduce ATXN2 (or other protein including an elongated polyglutamine tract or similar expansion tract, or other mutant protein associated with neurological disorders, such as those described above) in the target cell by at least 30%, 40%, 50%, 60%, or 70% when administered in an effective dosing regimen as compared to ATXN2 levels (or mutant c9orf72 levels, or mutant TDP-43 levels, or mutant Tau levels, or mutant APP levels, for example) prior to or without administration of the Staufenl-modulating agent.
In some specific examples, the therapeutically effective amount can be an amount from about 1 picomolar (pM) to about 100 millimolar (mM). In some other examples, the therapeutically effective amount can be an amount from about 1 pM to about 100 pM. In still other examples, the therapeutically effective amount can be an amount from about 50 pM to about 500 pM. In yet other examples, the therapeutically effective amount can be an amount from about 300 pM to about 1000 pM. In additional examples, the therapeutically effective amount can be an amount from about 1 nanomolar (nM) to about 50 nM. In still additional examples, the therapeutically effective amount can be from about 10 nM to about 500 nM. In further examples, the therapeutically effective amount can be an amount from about 400 nM to about ImM. In still further examples, the therapeutically effective amount can be an amount from about 700 nM to about 10 mM.
In some other specific examples, the therapeutically effective amount can be from about 0.001 pg of Staufenl -modulating agent per gram (g) of therapeutic composition (pg/g) to about 200 mg of Staufenl -modulating agent per gram of therapeutic composition (mg/g). In other examples, the therapeutically effective amount can be from about 0.01 pg/g to about 1 pg/g Staufenl -modulating agent in the therapeutic composition. In some other examples, the therapeutically effective amount can be from about 0. 1 pg/g to about 10 pg/g Staufenl -modulating agent in the therapeutic composition. In yet other examples, the therapeutically effective amount can be from about 1 pg/g to about 100 pg/g Staufenl - modulating agent in the therapeutic composition. In still other examples, the therapeutically effective amount can be from about 10 pg/g to about 1 mg/g Staufenl - modulating agent in the therapeutic composition. In some additional examples, the therapeutically effective amount can be from about 100 pg/g to about 10 mg/g Staufenl- modulating agent in the therapeutic composition. In some further examples, the therapeutically effective amount can be from about 1 mg/g to about 100 mg/g Staufenl- modulating agent in the therapeutic composition. It is again noted that the therapeutically effective amounts disclosed herein are generally based on the amount of Staufenl- modulating agent itself without any associated ligands, delivery vehicles, etc., unless otherwise specified.
In some additional specific examples, where the Staufenl -modulating agent is carried by a viral vector, the therapeutically effective amount can include from about 1x105 to about 1x1015 viral particles per gram of therapeutic composition. In some examples, the therapeutically effective amount can include from about 1x105 to about 1x107 viral particles per gram of therapeutic composition. In some additional examples, the therapeutically effective amount can include from about 1x107 to about 1x109 viral particles per gram of therapeutic composition. In some other examples, the therapeutically effective amount can include from about 1x109 to about 1x1011 viral particles per gram of therapeutic composition. In yet other examples, the therapeutically effective amount can include from about 1x1011 to about 1x1013 viral particles per gram of therapeutic composition. In still other examples, the therapeutically effective amount can include from about 1x1013 to about 1x1015 viral particles per gram of therapeutic composition.
The pharmaceutically acceptable carrier can be formulated for a variety of modes of administration. For example, the pharmaceutically acceptable carrier can be formulated to administer the Staufenl -modulating agent via injection (e.g. intravenous, intrathecal, etc.), oral/enteral administration, transdermal administration, transmucosal administration, inhalation, implantation, or the like.
In some examples, the pharmaceutically acceptable carrier can be formulated to provide a therapeutic composition for administration via injection, such as intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intrathecal injection, or the like. In such examples, the pharmaceutically acceptable carrier can include a variety of components, such as water, a solubilizing agent, a dispersing agent, a tonicity agent, a pH adjuster, a buffering agent, a preservative, a chelating agent, a bulking agent, the like, or a combination thereof.
In some examples, an injectable therapeutic composition can include a solubilizing or dispersing agent. Non-limiting examples of solubilizing or dispersing agents can include polyoxyethylene sorbitan monooleates, lecithin, polyoxyethylene polyoxypropylene co-polymers, propylene glycol, glycerin, ethanol, polyethylene glycols, sorbitol, dimethylacetamide, polyethoxylated castor oils, n-lactamide, cyclodextrins, caboxymethyl cellulose, acacia, gelatin, methyl cellulose, polyvinyl pyrrolidone, the like, or combinations thereof.
In some examples, an injectable therapeutic composition can include a tonicity agent. Non-limiting examples of tonicity agents can include sodium chloride, potassium chloride, calcium chloride, magnesium chloride, mannitol, sorbitol, dextrose, glycerin, propylene glycol, ethanol, trehalose, phosphate-buffered saline (PBS), Dulbecco’s PBS, Alsever’s solution, Tris-buffered saline (TBS), water, balanced salt solutions (BSS), such as Hank’s BSS, Earle’s BSS, Grey’s BSS, Puck’s BSS, Simm’s BSS, Tyrode’s BSS, and BSS Plus, the like, or combinations thereof. The tonicity agent can be used to provide an appropriate tonicity of the therapeutic composition. In one aspect, the tonicity of the therapeutic composition can be from about 250 to about 350 milliosmoles/liter (mOsm/L). In another aspect, the tonicity of the therapeutic composition can be from about 277 to about 310 mOsm/L.
In some examples, an injectable therapeutic composition can include a pH adjuster or buffering agent. Non-limiting examples of pH adjusters or buffering agents can include a number of acids, bases, and combinations thereof, such as hydrochloric acid, phosphoric acid, citric acid, sodium hydroxide, potassium hydroxide, calcium hydroxide, acetate buffers, citrate buffers, tartrate buffers, phosphate buffers, triethanolamine (TRIS) buffers, the like, or combinations thereof. Typically, the pH of the therapeutic composition can be from about 5 to about 9, or from about 6 to about 8. However, other suitable pHs can also be desirable.
In some examples, an injectable therapeutic composition can include a preservative. Non-limiting examples of preservatives can include ascorbic acid, acetylcysteine, bisulfite, metabisulfite, monothioglycerol, phenol, meta-cresol, benzyl alcohol, methyl paraben, propyl paraben, butyl paraben, benzalkonium chloride, benzethonium chloride, butylated hydroxyl toluene, myristyl gamma-picolimium chloride, 2 -phenoxyethanol, phenyl mercuric nitrate, chlorobutanol, thimerosal, tocopherols, the like, or combinations thereof.
In some examples, an injectable therapeutic composition can include a chelating agent. Non-limiting examples of chelating agents can include ethylenediaminetetra acetic acid, calcium, calcium disodium, versetamide, calteridol, diethylenetriaminepenta acetic acid, the like, or combinations thereof.
In some examples, an injectable therapeutic composition can include a bulking agent. Non-limiting examples of bulking agents can include sucrose, lactose, trehalose, mannitol, sorbitol, glucose, rafinose, glycine, histidine, polyvinyl pyrrolidone, the like, or combinations thereof.
EXAMPLE
Antisense oligonucleotides (ASQs)
ASOs used in this example were 20mer 5-10-5 2’-O-methoxyethyl (MOE) gapmers, phosphorothioated at all positions. All cytosine positions were methylated. ASOs were produced and purified by Integrated DNA Technologies (IDT).
Preparations included desalting for in vitro work or HPLC purification and dialysis to remove chromatography solvent for in vivo work.
Cell culture
HEK-293 or SCA2 patient-derived skin fibroblasts (SCA2-500-1), expressing ATXN2 q22/q45, were cultured and maintained in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, ThermoFisher #11965118) supplemented with 10% fetal bovine serum, and lx penicillin and streptomycin. The SCA2-500-1 patient fibroblasts were previously collected by us, with written consent, and the studies were approved by the Institutional Review Board at the University of Utah. HEK-293 cells were transfected with ASOs using Lipof ectamine, while SCA2-500-1 cells were transfected with Lipofectamine 3000, according to manufacturer’s protocol (ThermoFisher). The cells were harvested at 48 or 72 hrs post-transfection for analyses.
Cell Line Authentication
In order to adhere with the National Institutes of Health (NIH) guideline on scientific rigor in conducting biomedical research (NOT-OD-15-103) on the use of biological and/or chemical resources, both the HEK-293 and SCA2-500-1 cell lines were authenticated by STR analysis on 24 loci, including amelogenin for sex identification. The kit used for this was the GenePrint 24 system (Promega).
Mice (Thyl-
(Jackson Laboratories; Stock 012836) (6) mouse lines were maintained. The BAC- STAU1 mouse model was developed by the University of Utah Transgenic Mouse Core by pronuclear microinjection of a non- linearized human Staufenl bacterial artificial chromosome (BAC) construct (BAC-STAU1 clone RP11- 120111, BACPAC Resources) into fertilized oocytes sourced from mice with a B6/D2 mixed hybrid background (B6D2F1J, The Jackson Laboratory stock #100006). Prior to injection, the BAC construct was separated from other nucleotide fragments by pulsed field gel electrophoresis, and gel purified, by the University of Michigan Transgenic Mouse Core. Genotyping of mouse tail DNA was initially done with multiplex PCRs encompassing 17 PCR primer pairs covering all coding exons, 5’ and 3’ UTR and the 5’ upstream promoter region. Transgenic mouse bone marrow samples were sequenced and analyzed by Cergentis to determine integration sites and vector- vector breakpoints that represent concatemerization. BAC-STAU1 mice were maintained in a B6D2 mixed background by backcrossing to B6D2F1J no less than every 4 generations. The Stault"llApa('/'} (StauT 7 ) mouse was a generous gift from Prof. Michael A. Kiebler, Ludwig Maximilian University of Munich, Germany, and maintained in a C57BL/6J background. Mice were maintained in a temperature and humidity-controlled environment on a 12h light/dark cycle with light onset at 6:00 AM. All studies and procedures were approved by an Institutional Animal Care and Use Committee (IACUC) at the University of Utah, SLC, UT.
ICV ASO Injections
ASOs were delivered to mice by intracerebroventricular (ICV) injection using a Hamilton 26s gauge needle. Injections volumes were 10 pl of ASO diluted in phosphate buffered saline (PBS). Control mice received the same volume of normal saline. Injections were made under anesthesia with a mixture of oxygen and isoflurane, using a Stoelting stereotaxic frame. Anesthesia was initiated using 3% isoflurane for 5 min and the isoflurane mixture was lowered to 2% during injections. Stereotaxic bregma coordinates were -0.46 mm anteroposterior, -1.0 mm lateral (right side); -2.5 mm dorsoventral. Needles were removed 4 min after ASO delivery. Mice were maintained on a 39°C isothermal pad while anesthetized and during recovery.
Quantitative PCR (qPCR)
For medium throughput assays performed in ASO screens and IC50 studies we used the Cells-to-Ct assays (ThermoFisher). These assays were combined with Taqman qPCR kits for human STAU1 (ThermoFisher Hs00244999_ml) and human ACTB (Thermofisher Hs01060665_gl). For other qPCRs, standard SYBR Green assays were performed as follows: Total RNA was extracted from cultured cells, cerebellar tissues or spinal cord tissues using the RNeasyMini Kit (Qiagen Inc., USA) according to the manufacturer’s protocol. DNAse I treated RNAs were used to synthesize cDNAs using the ProtoScript cDNA First Strand cDNA Synthesis Kit (New England Biolabs Inc., USA). Primers for RT-PCR were designed to prevent amplification from genomic DNA (annealing sites in different exons or across intron-exon boundaries). Quantitative RT- PCR was performed in Bio-Rad CFX96 (Bio-Rad Inc., USA) with the Power SYBR Green PCRMasterMix (Applied Biosystems Inc, USA). PCR reaction mixtures contained SYBR Green PCRMasterMix and 0.5 pmol primers and PCR amplification was carried out for 45 cycles: denaturation at 95 °C for 10 sec, annealing at 60 °C for 10 sec and extension at 72 °C for 40 sec. The threshold cycle for each sample was chosen from the linear range and converted to a starting quantity by interpolation from a standard curve run on the same plate for each set of primers. Gene expression levels were normalized to the Actin mRNA levels.
For human transcripts, primers included: STAU1-F 5’- TCCTTGGTTTCAAAGTCCCG-3' (SEQ ID NO: 38) STAU1-R 5 -ATTTTCATCCCCAGAGCCAG-3' (SEQ ID NO: 39) ACTB-F: 5’-GAAAATCTGGCACCACACCT-3’ (SEQ ID NO: 40) ACTB-R: 5’- TAGCACAGCCTGGATAGCAA-3’ (SEQ ID NO: 41) For mouse transcripts, primers included:
Staul-F: 5’- AGTACATGCTCCTTACAGAACG-3’ (SEQ ID NO: 42)
Staul-R: 5’-TGATGCCCAACCTTTACCTG-3’ (SEQ ID NO: 43)
Aifl-Al: 5’-CTGGAGGGGATCAACAAGCAATTC-3’ (SEQ ID NO: 44) Aif-B2: 5’- CCAGCATTCGCTTCAAGGACATAA-3’ (SEQ ID NO: 45) Gfap-for: 5’-CGGAGACGCATCACCTGTG-3’ (SEQ ID NO: 46) Gfap-rev: 5’-AGGGAGTGGAGGAGTCATTCG-3’ (SEQ ID NO: 47) Actb-F: 5’- CGTCGACAACGGCTCCGGCATG-3’ (SEQ ID NO: 48) Actb-R: 5’- GGGCCTCGTCACCCACATAGGAG-3’ (SEQ ID NO: 49) Mouse Actb-F: 5’- CGTCGACAACGGCTCCGGCATG-3’ (SEQ ID NO: 50) Mouse Actb-R: 5’- GGGCCTCGTCACCCACATAGGAG-3’ (SEQ ID NO: 51)
Western blot analyses
Protein extracts were prepared by homogenization of mouse cerebella in extraction buffer (25 mM Tris-HCl pH 7.6, 300 rnM NaCl, 0.5% Nonidet P-40, 2 mM EDTA, 2 mM MgC12, 0.5 M urea and protease inhibitors; Sigma; cat# P-8340) followed by centrifugation at 4°C for 20 min at 16,100 x g. Protein extracts were resolved by SDS- PAGE and transferred to Hybond P membranes (Amersham Bioscience Inc., USA).
After blocking with 5% skim milk in 0. 1% Tween 20/PBS, the membranes were incubated with primary antibodies in 5% skim milk in 0.1% Tween 20/PBS for 2 hrs at room temperature or overnight at 4°C. After washing in 0.1% Tween 20/PBS, the membranes were incubated with the corresponding secondary antibodies conjugated with HRP in 5% skim milk in 0.1% Tween 20/PBS for 2 hrs at room temperature and washed again. Signals were detected by using the Immobilon Western Chemiluminescent HRP Substrate (Millipore Inc., USA; cat# WBKLS0100) according to the manufacturer’s protocol, and detected using a ChemiDoc System (Bio-Rad). The intensity of proteins was determined using the ChemiDoc software and proteins were quantitated as a ratio to P-Actin. Antibodies
Antibodies included the following: rabbit polyclonal anti-Staufen antibody (Novus Biologicals, NBP1-33202); rabbit polyclonal anti-mTOR antibody (Cell Signaling Technology, 2972); rabbit polyclonal anti-Phospho-mTOR (Ser2448) [(1:3000), Cell Signaling Technology, 2971]; rabbitpoly clonal anti-SQSTMl/p62 antibody (Cell Signaling Technology, 5114); rabbit polyclonal anti-LC3B antibody (Novus Biologicals, NB 100- 2220); mouse monoclonal anti-TDP-43 (human specific) antibody (Proteintech 60019-2- Ig); rabbit polyclonal human/mouse anti-TDP-43 antibody (Proteintech 10782-2-AP); mouse monoclonal anti-Calbindin-D-28K antibody [(1:5000), Sigma-Aldrich, C9848); rabbit polyclonal anti-RGS8 antibody [(1:5000), Novus Biologicals, NBP2-20153]; mouse monoclonal anti-PCP2 antibody (F-3) [(1 :3000), Santa Cruz, sc-137064] ; rabbit polyclonal anti-PCP4 antibody [(1:5000), Abeam, abl97377]; Phospho-p70 S6 Kinase (Thr389) antibody [(1:3000), Cell Signaling, Cat# 9205]; GFAP (GA5) mouse mAb [(1:7000), Cell signaling, Cat #3670]; ChAT (E4F9G) Rabbit mAb [(1:5000), Cell Signaling, Cat# 27269]; NeuN (D4G4O) XP® Rabbit mAb [(1:5000), Cell Signaling, Cat# 24307]; GAPDH (14C10) rabbit mAb [(1 :7,000), Cell Signaling, Cat# 2118]; Cleaved Caspase-3 (Aspl75) (5A1E) rabbit mAb [(1:3000), Cell Signaling, Cat #9664]; Anti-FAM107B antibody [(1:5,000) Abeam, abl75148); and mouse monoclonal anti- -Actin-peroxidase antibody (clone AC- 15) (Sigma- Aldrich, A3854). Secondary antibodies included peroxidase- conjugated horse anti-mouse IgG (Vector Laboratories, PI-2000) and peroxidase AffiniPure goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, 111-035-144).
Immunohistochemical Staining
Spinal cords were removed, and fixed in 4% paraformaldehyde/PBS and cryoprotected stepwise in 10, 20, then 30% sucrose/PBS. Tissues were embedded in OCT and sectioned (20 um). Sections were labeled with human- specific anti-TDP-43 antibody or pan-TDP-43 antibody (see above) as previously described (1), and brightfield images were produced using an Olympus BX53 inverted microscope with a 40x objective. Regions of interest (ROIs) were selected manually around ventral hom MNs with clear evidence of a nucleolus. Staining intensity in ROIs was determined using NIH Elements software Behavioral Phenotype Testing
Mice were tested on the accelerating rotarod. Open field behavior was tested using a force plate actometer. Actometer hardware with center of mass tracked at 1000 Hz and saved using Lab VIEW (National Instruments) was used. Custom code was written in MATLAB (MathWorks) to filter center of mass with a running average of 1 second, and then calculated the total distance traveled throughout the duration of the recording. The recordings were made in a small behavioral recording room, with animals placed in the room to habituate at least 30 minutes prior to recording. This room was well isolated from external noise, with dim, but equal lighting throughout the room as measured using a standard luxometer. Open field recordings were made over intervals of either 10 min, 20 s or 30 min, 20 s, allowing 20 s for the experimenter to leave the room and close the door after placing the animal in the chamber, and the total distance traveled was calculated for the specified duration beginning after 20 s.
Electrophysiolo gy
The preparation of parasagittal cerebellar slices closely followed known processes. Cerebella from 10-week-old ATXN2-Q127 and WT littermates were removed and quickly immersed in 4 °C sucrose solution bubbled with 95% 02 and 5% CO2 (225 mM sucrose, 25 mM NaHCO3, 20 mM D-glucose, 3.0 mM MgC12, 2.5 mM KC1, 1.25 mM NaH2PO4 and 0.5 mM CaC12). Parasagittal cerebellar slices (400 pm) were sectioned using a vibratome (Vibratome 1000). Extracellular recordings were acquired in voltage-clamp mode at physiological temperature (34 ± 1°C) using a dual channel heater controller (Model TC-344B, Warner Instruments) and constantly perfused with carbogen-bubbled extracellular solution (119 mM NaCl, 26 mM NaHCO3, 11 mM D- glucose, 2.5 mM KC1, 2.0 mM CaC12, 1-5 mM MgC12 and 1.0 mM NaH2PO4) at a rate of 3 mL per minute. Cells were visualized on an upright microscope (Zeiss Axioskop 2) with a 40x water-immersion lens. Borosilicate glass pipettes with resistances between with 1 to 3 M were filled with extracellular solution and used for recording action potential-associated capacitive current transients. The pipette potential was held at 0 mV and placed close to the Purkinje neuron axon hillock (soma/axon).
Data were acquired at 20 kHz using a Multiclamp 700B amplifier, Digidata 1440 with pClamplO (Molecular Devices) and bandpass filtered between 0.1 to 5 kHz. Each Purkinje neuron recording spanned a duration of 2 minutes and an average of 43 cells were measured from each mouse. Each treatment group contained approximately 5 mice that were injected at 8 weeks of age with ASO or PBS. Data were analyzed with custom MATLAB scripts (MathWorks) and Prism (GraphPad).
Statistical Analysis
Statistical differences between selected groups evaluated by qPCR, western blotting, and the electrophysiological data were also evaluated using analysis of variance (ANOVA) tests followed by post-hoc tests of significance (Tukey’s or Bonferroni’s tests for multiple comparison, as indicated). Grip strength data were tested using repeated measures ANOVA. Student’s /-tests were unpaired and two-tailed. All tests were performed using the GraphPad Prism software package except for tests of open field behavior data that were performed in MATLAB.
Results
Identification of lead STAU1 ASOs
The ASO screen began with an in silica design stage where all possible 20 base pair “k-mers” from the start of the 5’-UTR through the end of the 3’-UTR, for a total of 3664 ASO sequences were determined. ASOs with sequences predicted to reduce efficacy were eliminated. ASOs with CpGs were eliminated to reduce immunoreactivity. Any remaining cytosines were 5 ’ -methylated. ASOs with 3 or more consecutive Gs were excluded to avoid G quadraduplexing. Only sequences with 1’Gs > -10 for hairpinning were allowed. The %GC content was limited to 40-60% for optimal annealing. ASOs not aligning with cynomolgus sequences for later NHP work were eliminated. Of all ASOs meeting these criteria, 118 ASOs spaced - 10 bp apart were selected, and synthesized as fully phosphorothioated (PS) 5-10-5 2’-O-methoxyethyl (MOE) gapmers. To determine the efficacy for an ASO with sequence identity to mouse and human Staufen that may be useful for in vivo work, ASO-45 was included in the screen despite its sequence did not strictly conform to the established conservative criterion in that it has a tract of 3 consecutive Gs and a CpG dinucleotide. Of all the ASOs in the screen, only one other also had sequence identity to mouse Staul, ASO-308. The 118 ASOs were then screened in HEK-293 cells transfected at a single 50 nM dose in duplicate, and performed qPCR to determine STAU1 mRNA abundance following 48 hours transfection time. ASO-249 was the most efficacious ASO, with 38% STAU1 mRNA abundance remaining, and ASO-045 was the third-most efficacious ASO (Fig. 1A).
Next a selection of the most efficacious ASOs from the HEK-293 screen in SCA2 (Q22/Q45) patient fibroblasts were screened. The most efficacious 37 ASOs were screened in the SCA2 patient fibroblasts, along with ASO-239 that was least effective in HEK-293 cells as a negative control. Cells were transfected at 100 nM in triplicate for 48 hours. The maximum STAU1 reduction was 98.6% for ASO-276 and ASO-045 ranked 8th (Fig. IB).
Dose response curves were determined for the most efficacious 22 ASOs for lowering STAU1 mRNA expression in SCA2 patient fibroblasts. Assays were performed in batches of ASOs, including ASO-045 in each batch as a comparative control to assess reproducibility. Six ASO doses were included with each dose triplicated. Remarkable reproducibility among five batch sets was observed, with the IC50 standard deviation for ASO-045 varying by only ± 2.2 nM (Fig. 10). Comparison of the IC50 values among the 22 most efficacious ASOs revealed ASO-308 as the most potent of all the ASOs (Fig. 1C).
Each of the most efficacious ASOs were aligned with the human GRCh38/hg38 genome identifying potential off targets for some ASOs. ASO-308 and ASO-287 have one and two mismatches to SORL1, respectively, that has loss of function mutations in Alzheimer’s disease. ASO-294 has 1 mismatch to FUT8 and PARD3B that are both expressed in astrocytes by querying Brain RNA-seq. ASO-278 that has one mismatch to POLG2 that is mutated in epilepsy. These ASOs were not considered further with the exception of ASO-308 use in wildtype mice, below. ASO-45 was aligned to the mouse MM10 genome revealing no potential off targets in the mouse.
To begin to characterize efficacy for the 10 most potent ASOs for normalization of pathologically elevated STAU1 CRISPR-Cas9 edited HEK-293 cells expressing polyglutamine expanded ATXN2 (ATXN2-Q58 KI cells), previously demonstrated to have elevated STAU1 abundance were utilized. Significantly elevated STAU1 in ATXN2-Q58 KI cells compared to HEK-293 cells with unmodified ATXN2 were confirmed and transfection of each of these 10 ASOs significantly lowered STAU1 levels to quantities equal to that in unmodified HEK-293 cells (Fig. 2).
Generation of BAC-STAU1 mice and in vivo ASO screening
Evaluation of ASOs in vivo was made possible by the production of a BAC mouse harboring the human STAU1 gene. A 133.8 kDa BAC construct (Fig. 3A) was used and produced transgenic mice by pronuclear injection. Sequencing of BAC-SCA2 mouse bone marrow specimens determined the integration sites of 8 potential founder lines. Of these, only one founder, BAC-STAU1.6, had a single genomic integration of the transgene, on chromosome 17 (chrl7:9, 394, 829—9, 610, 924). The integration occurred simultaneously to a 210 kb genomic deletion within this region. By querying the NCBI Reference Sequence Database (RefSeq), there are no annotated genes in this region of the mouse genome and therefore no gene disruption is predicted. No structural variants were identified within the integrated construct. Due to the nature of the sequence at the integration site, the copy number via this method could not be estimated.
BAC-STAU1 mice express an increased abundance of STAU1 protein in cerebellum that is associated with elevated and hyperphosphorylated mTOR as well as increased levels of other proteins in the autophagy signaling pathway including phospho- S6K, p62 and LC3-II (Fig. 3B, C). BAC-STAU1 mice also displayed reduced levels of Calbl, Rgs8, Pcp2, Pcp4 and Faml07b in cerebellum (Fig. 3D, E).
The 10 most potent ASOs in BAC-STAU1 were evaluated for efficacy. 8-week- old B AC-ST 'AU 1 mice were treated by intracerebroventricular (ICV) injection of 300 ug ASO for 2 weeks, and evaluated cerebellar and spinal cord proteins on western blots. Each of the ASOs significantly reduced STAU1 abundance both on western blots (Fig. 4A-D).
Additionally, for all ASOs the abnormally elevated levels of CALB1, GFAP, mTOR, p62, and LC3-II were markedly reduced or normalized in cerebellum (Fig. 4A-D). STAU1, Aifl, and Gfap in cerebellum and spinal cord by qPCR were also evaluated (Fig. 4E, F). Interestingly, some ASOs did not significantly reduce STAU1 mRNA levels in cerebellum despite the fact that they lowered STAU1 protein on western blots suggesting STAU1 ASOs may be effective for inhibiting translation. Notable ASOs include ASO- 256 and ASO-319 that were consistently potent against both STAU1 protein and STAU1 mRNA and did not significantly elevate Aifl or Gfap abundance.
A comparison of the efficacious ASOs in doses in BAC-STAU1 mice was made. ASO-256 and ASO-319 were selected as they were the two most efficacious ASOs for lowering Staufenl protein and mRNA in vivo (Fig. 4A), and ASO-249 and ASO-270 as the next two most efficacious ASOs were included based on the fact that the in vivo data, also supported by efficacy in ATXN2-Q58 KI cells (Figs. 2 and 4). These four ASOs are among the top 8 ranked by IC50 (Fig. 1C). ASO-45 was further included since it also targets mouse Staul. 8 wk old BAC-STAU1 mice were treated with 300, 600 and 900 ug ASO ICV for 2 weeks. Acute toxicity was evident as the number of surviving animals was reduced with dose, with all animals lost that were injected with 900 ug ASO-249 or ASO-319.
Aifl and Gfap were also assessed for microgliosis and astrogliosis, respectively, and observed no significant increases except for ASO-256 that elevated the expression of both genes at higher doses (Fig. 4B, C). ASO-256 was eliminated form further consideration.
ASOs targeting mouse Staul
The screen produced two ASOs that target human STAU1 that also have sequence identity to mouse Staul, ASO-45 and ASO-308. To compare their efficacy, 11 wk old wildtype mice were treated with 500 ug ASO by ICV injection with 2 wk treatment time. At the endpoint, cerebellar proteins were evaluated on western blots demonstrating -70% reduction of Staul protein levels compared to PBS treated control mice (Fig. 5A, B). Staul , Aifl and Gfap mRNA levels in cerebellum by qPCR were also evaluated. Staul mRNA levels were -40% reduced and no activation of Aifl was observed for either ASO. However, a significant 15% increase of Gfap was observed for ASO-308 (p=0.005). Based on this in vivo proof-of-concept studies using ASO-45 were performed.
Modification of SCA2 cerebellar Purkinje cell firing by ASO-45
Previously, cerebellar Purkinje cells were showed in ATXN2-Q127 transgenic mice have reduced firing frequency that could be improved by lowering the expression of ATXN2 with an ASO. A similar experiment by treating 8 wk old BAC- STAU1 mice or wildtype littermate control mice with 500 ug ASO-45 or PBS vehicle by ICV injection was performed. After two weeks treatment time extracellular recordings from PCs in acute cerebellar slices were made. As expected, it was observed significantly reduced PC firing frequency in ATXN2-Q127 mice compared to the WT littermates and the PC firing frequency in ATXN2-Q127 mice was significantly improved following treatment with ASO-45 (Fig. 7A). The PC firing frequency in wildtype littermates was unaffected by the ASO treatment (Fig. 7A). Evaluation of target engagement showed that Staul mRNA was significantly reduced in cerebellum of ATXN2-Q127 mice at the endpoint (Fig. 7B).
Normalization of spinal cord proteins in TDP-43 mice treated with ASO-45
We sought to determine abnormally abundant ChAT, NeuN and Gfap in older Thyl- TDP-43Tg/+ mice could be modified by treatment with ASO-45. We treated 24 wk old 77jy7-TDP-43Tg/+ mice with ASO-43 by ICV injection for a duration of 2 weeks. At the endpoint we evaluated Staul, human TDP-43, ChAT, NeuN and GFAP on western blots. We observed significant reductions of ChAT and NeuN that were each fully normalized in ASO-45 treated 77zy7-TDP-43Tg/+ mice, associated with significant reduction of TDP-43 protein abundance (Fig. 8A, B). GFAP was also highly elevated in 77; 7-TDP-43Tg/+ mice and was significantly reduced by ASO-45 treatment but the level of GFAP in treated mice did not return fully to normal (Fig. 8A, B). We also observed reduction of TDP-43 and ChAT in spinal cord motor neurons by quantitative immunohistochemical staining, that were improved after the ASO-45 treatment (Fig. 8B, C).
Investigating the on-target effects of lowering STAU 1
Alterations of motor phenotypes have not previously observed in mice null of Staul, except for mildly reduced open field locomotor activity. To confirm the observation, open field behavioral testing using 6-month-old Staul+'~, Staul 1', and wildtype littermate mice in a force plate chamber was performed. No significant reductions on open field behavior determined as distance travelled was observed (Fig. 9 A). There was also no significant difference in percentage of time in chamber center 50%. no sex differences were observed. Recordings of Staul knockout mice were made over 30 min. Analysis of the data indicated that sufficient power of the test would be obtained in 10 min recordings, that was employed for the study of ASO-45 on open field behavior. To determine how ASO-45 modified open field behavior, WT mice that were 3 months of age were treated with 300 ug ASO-45 for a duration of 3 wks. Again, no significant reduction in open field behavior was observed, including distance travelled or time in chamber center 50%, and no sex differences were observed. At the endpoint, Staul mRNA levels in cerebellum were evaluated by qPCR demonstrating significant Staul reduction in ASO-45 treated mice (Fig. 9C) to levels that were similar to reductions seen in Figs. 6 and 7 for ASO-45. A Pearson’s correlation analysis of distance traveled to Staul mRNA abundance was also made, demonstrating no significant correlation (Fig. 9D).
It is understood that the above-described various types of compositions, dosage forms and/or modes of applications are only illustrative of preferred embodiments of the present disclosure. Numerous modifications and alternative arrangements may be devised by those skilled in the art without departing from the spirit and scope of the present disclosure and the appended claims are intended to cover such modifications and arrangements. Thus, while the present disclosure has been described above with particularity and detail in connection with what is presently deemed to be the most practical and preferred embodiments of the disclosure, it will be apparent to those of ordinary skill in the art that variations including, but not limited to, variations in size, materials, shape, form, function and manner of operation, assembly and use may be made without departing from the principles and concepts set forth herein.

Claims

CLAIMS What is claimed is:
1. A therapeutic agent for treating a neurodegenerative condition associated with Staufenl- induced dysregulation of RNA metabolism, comprising: an antisense oligonucleotide (ASO) having a nucleotide sequence that is at least 80%, 85%, 90%, 95%, or 100% homologous to the 6, 8, 10, or 12 middle nucleotides, or to an entire sequence of one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20. SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, and SEQ ID NO: 37.
2. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 1.
3. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 2.
4. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 3.
5. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 4.
6. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 5.
7. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 6.
8. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 7.
9. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 8.
10. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 9.
11. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 10.
12. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 11.
13. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 12.
14. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 13.
15. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 14.
16. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 15.
17. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 16.
18. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 17.
19. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 18.
20. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 19.
21. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 20.
22. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 21.
23. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 22.
24. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 23.
25. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 24.
26. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 25.
27. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 26.
28. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 27.
29. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 28.
30. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 29.
31. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 30.
32. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 31.
33. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 32.
34. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 33.
35. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 34.
36. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 35.
37. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 36.
38. The therapeutic agent of claim 1, wherein the nucleotide sequence is SEQ ID NO: 37.
39. The therapeutic agent of any of claims 1-38, wherein the nucleotide sequence is at least 80% homologous.
40. The therapeutic agent of any of claims 1-38, wherein the nucleotide sequence is at least 85% homologous.
41. The therapeutic agent of any of claims 1-38, wherein the nucleotide sequence is at least
90% homologous.
42. The therapeutic agent of any of claims 1-38, wherein the nucleotide sequence is at least 95% homologous.
43. The therapeutic agent of any of claims 1-38, wherein the nucleotide sequence is at least 100% homologous.
44. The therapeutic agent of any preceding claim, wherein the nucleotide sequence includes the 6 middle nucleotides of the sequence.
45. The therapeutic agent of any preceding claim, wherein the nucleotide sequence includes the 8 middle nucleotides of the sequence.
46. The therapeutic agent of any preceding claim, wherein the nucleotide sequence includes the 10 middle nucleotides of the sequence.
47. The therapeutic agent of any preceding claim, wherein the nucleotide sequence includes the 12 middle nucleotides of the sequence.
48. The therapeutic agent of any preceding claim, wherein the nucleotide sequence includes the entire sequence.
49. The therapeutic agent of any preceding claim, wherein the middle nucleotides are central nucleotides.
50. A composition comprising a therapeutically effective amount of a therapeutic agent as recited in any preceding claim and a pharmaceutically acceptable carrier.
51. A method of modulating Staufenl levels or activity in a target cell comprising administering a therapeutically effective amount of a therapeutic agent as recited in any of claims 1-49 or a composition as recited in claim 50 to the target cell.
52. The method of claim 51, wherein modulating includes minimizing dysregulation of Staufenl -associated RNA metabolism.
53. The method of claim 51, wherein the therapeutically effective amount is an amount sufficient to minimize the dysregulation.
54. A method of controlling Staufenl accumulation in a target cell comprising administering a therapeutically effective amount of a therapeutic agent as recited in any of claims 1-49 or a composition as recited in claim 50 to the target cell.
55. A method of treating a neurodegenerative condition associated with Staufenl -induced dysregulation of RNA metabolism in a subject, comprising administering a therapeutically effective amount of a therapeutic agent as recited in any of claims 1-49 or a composition as recited in claim 50 to a target cell of a subject.
56. The method of any of claims 51-55, wherein the target cell is a nerve cell.
57. A therapeutic agent for use in treatment of a neurogenerative condition associated with Staufenl -induced dysregulation of RNA metabolism in a subject, comprising administering a therapeutically effective amount of the therapeutic agent as recited in any of claims 1-49 to a target cell of a subject.
58. A composition for use in treatment of a neurogenerative condition associated with Staufenl -induced dysregulation of RNA metabolism in a subject, comprising administering a therapeutically effective amount of the composition as recited in claim 50 to a target cell of a subject.
59. Use of a therapeutic agent as recited in any of claims 1-49 in the manufacture of a medicament for treatment of Staufenl -induced dysregulation of RNA metabolism in a cell of a subject.
60. Use of a composition as recited in claim 50 in the manufacture of a medicament for treatment of Staufenl -induced dysregulation of RNA metabolism in a cell of a subject.
EP23822178.2A 2022-11-08 2023-11-08 Staufen-1 modulating agents, compositions, and methods Pending EP4615973A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263423787P 2022-11-08 2022-11-08
PCT/US2023/079164 WO2024102867A1 (en) 2022-11-08 2023-11-08 Staufen-1 modulating agents, compositions, and methods

Publications (1)

Publication Number Publication Date
EP4615973A1 true EP4615973A1 (en) 2025-09-17

Family

ID=89190500

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23822178.2A Pending EP4615973A1 (en) 2022-11-08 2023-11-08 Staufen-1 modulating agents, compositions, and methods

Country Status (2)

Country Link
EP (1) EP4615973A1 (en)
WO (1) WO2024102867A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11723912B2 (en) * 2016-12-08 2023-08-15 University Of Utah Research Foundation Staufen1 agents and associated methods
EP3807291A4 (en) * 2018-06-14 2022-02-23 University of Utah Research Foundation STAUFEN1 REGULATING AGENTS AND RELATED METHODS

Also Published As

Publication number Publication date
WO2024102867A1 (en) 2024-05-16

Similar Documents

Publication Publication Date Title
JP6395058B2 (en) Composition and use thereof for huntingtin
JP2022070913A (en) Use of single-stranded antisense oligonucleotides in prevention or treatment of genetic diseases involving trinucleotide repeat expansion
JP2022103192A (en) Composition for regulating tau expression
US20250186508A1 (en) Par2 modulation to alter myelination
US12409189B2 (en) STAUFEN1 agents and associated methods
WO2026026776A1 (en) Sirna for inhibiting app gene expression and conjugate thereof, and use
CA2824843A1 (en) Dosing regimens for treating and preventing ocular disorders using c-raf antisense
US12565650B2 (en) STAUFEN1 regulating agents and associated methods
WO2024102867A1 (en) Staufen-1 modulating agents, compositions, and methods
US20220098592A1 (en) Double stranded rna and uses thereof
Scoles et al. Targeting Staufen 1 with antisense oligonucleotides for treating ALS and SCA2
KR20260030856A (en) Composition and method for inhibiting complement factor B (CFB) expression
CN107709560A (en) Treatment method
JP2025531512A (en) siRNA compositions and methods for targeting alpha synuclein nucleic acids
US20220135975A1 (en) Inhibition of let7i as a means to enhance the protective effect of progesterone against stroke
JP2022523320A (en) Oligonucleotides and methods for the treatment of age-related macular degeneration
TW202532088A (en) Compositions and methods for inhibiting expression of huntingtin (htt)
JP2026508023A (en) Compositions and methods for modulating SPTLC1
WO2023225495A2 (en) Compositions and methods for treatment of microsatellite dna expansion disorders
JP2025531484A (en) Compositions and methods for treating neuroinflammatory diseases

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250603

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)