EP4615416A1 - Self-assembling lipid nanoparticles for targeted delivery of therapeutic agents - Google Patents

Self-assembling lipid nanoparticles for targeted delivery of therapeutic agents

Info

Publication number
EP4615416A1
EP4615416A1 EP23888243.5A EP23888243A EP4615416A1 EP 4615416 A1 EP4615416 A1 EP 4615416A1 EP 23888243 A EP23888243 A EP 23888243A EP 4615416 A1 EP4615416 A1 EP 4615416A1
Authority
EP
European Patent Office
Prior art keywords
composition
delivery system
antibody
land
lipid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23888243.5A
Other languages
German (de)
French (fr)
Inventor
Dan Peer
Itai Benhar
Yael DIESENDRUCK
Limor Nahary
Niels DAMMES
Yehudit GRINBERG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ramot at Tel Aviv University Ltd
Original Assignee
Ramot at Tel Aviv University Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ramot at Tel Aviv University Ltd filed Critical Ramot at Tel Aviv University Ltd
Publication of EP4615416A1 publication Critical patent/EP4615416A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • A61K9/1272Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers comprising non-phosphatidyl surfactants as bilayer-forming substances, e.g. cationic lipids or non-phosphatidyl liposomes coated or grafted with polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • A61K9/5107Excipients; Inactive ingredients
    • A61K9/5123Organic compounds, e.g. fats, sugars
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • C12N9/222Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11021Polo kinase (2.7.11.21)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55555Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to self-assembling lipid nanoparticles for targeted delivery of nucleic acids, proteins and drugs.
  • the present invention further relates to methods of use of the self-assembling lipid nanoparticles, in particular in RNA therapeutics.
  • lipid nanoparticles are becoming more prevalent as means for delivering various active agents, including nucleic acids such as siRNA and mRNA.
  • nucleic acids such as siRNA and mRNA.
  • Targeted drug carriers such as immuno-liposomes or immuno-lipid-based nanoparticles (targeted LNPs, tLNPs) are typically constructed by chemical conjugation of the targeting moiety to the drug (or nucleic acid)-carrying delivery system. This process requires large amounts of antibodies for each conjugation and requires adjustments when using different antibodies, typically due to the deleterious effects of the conjugation on the functionality of the antibody. In addition, chemical conjugation results in the insertion of the targeting antibodies in random orientation. Thus, a portion of the antibodies are typically conjugated such that they expose their Fc part to the surrounding environment, risking immunogenicity and engulfment by phagocytic cells.
  • the strategy termed ASSET (anchored secondary scFv enabling targeting) is a self-assembled modular platform that enables the construction of targeted nanocarriers with no conjugation chemistry involved.
  • the self- assembly of the platform is based on a membrane-anchored, lipidated single-chain antibody fragment (scFv) derived from a secondary antibody, that is incorporated into therapeutic agent-loaded lipid nanoparticles.
  • scFv membrane-anchored, lipidated single-chain antibody fragment
  • the present invention provides a delivery system composition termed Lipidated Antibody Nanoparticle Delivery, i.e., LAND and use thereof for delivering therapeutic agents such as nucleic acids to target cells.
  • the delivery system utilizes an antibody which serves as a cell-targeting moiety.
  • the antibody is anchored to a lipid-based nanoparticle via a lipidated peptide portion and a peptide linker containing at least 40 amino acids which confer unexpected advantages of effective binding to a target cell.
  • the linker is a combination of functional protein, linker and spacer sequences.
  • the present invention is based, in part, on the unexpected finding that extension of the distance between the lipid nanoparticle and the antibody by using a linker (e.g. one containing at least 40 amino acids), provides superior efficacy in transducing target cells.
  • a linker e.g. one containing at least 40 amino acids
  • the LAND platform according to the principles of the present invention was shown to transduce target cells to a greater extent as compared with ASSET. It is generally appreciated that scFv antibodies which have a single antigen binding site have lower binding efficiencies compared to complete IgG antibodies which have two antigen binding sites.
  • LAND constructs incorporating primary scFv antibody targeting with a single antigen binding site demonstrated significantly enhanced efficacy compared to primary IgG antibody targeting via ASSET which contains two antigen binding sites.
  • the self-assembled modular platform of the present invention enables the construction of a wide repertoire of targeted nanocarriers, particularly suitable for RNA therapeutics.
  • a delivery system composition for delivering a therapeutic agent to a target cell, wherein the delivery system comprises a lipid nanoparticle, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker and a lipidated antibody or a fragment thereof, wherein the linker is fused to the lipidated antibody or a fragment thereof and a fusion protein is non-covalently attached to the lipid nanoparticle through the anchoring lipid so that the lipidated antibody or a fragment thereof is at the distal end from the nanoparticle.
  • the linker comprises a peptide or protein having at least 40 amino acids residues.
  • composition for delivering a therapeutic or diagnostic agent to a target cell comprising: a lipid nanoparticle encapsulating a therapeutic or diagnostic agent, a primary antibody non-covalently attached to the lipid nanoparticle via a lipidated peptide portion, and a peptide linker attached directly to the primary antibody at one terminus of a linker and the lipidated peptide portion attached to another terminus of the linker, wherein the antibody or antibody fragment is at the distal end from the nanoparticle and binds a target antigen on a target cell.
  • delivery system composition for delivering a therapeutic or diagnostic agent to a target cell
  • the delivery system comprises: a lipidated antibody which comprises an antibody attached, via a peptide linker, to a lipidated peptide portion, wherein the peptide linker comprises at least 40 amino acid residues; and a lipid nanoparticle which comprises the therapeutic or diagnostic agent, wherein the lipidated antibody is non-covalently attached to the lipid nanoparticle via the lipidated peptide portion.
  • a method of delivering a therapeutic or diagnostic agent to a subject in need thereof comprising administering to the subject the composition or delivery system described herein, thereby delivering the therapeutic or diagnostic agent to the subject.
  • a method for treating a medical condition in a subject in need thereof comprising the step of administering to the subject a therapeutically effective amount of the composition or delivery system described herein, wherein the agent is a therapeutic agent, thereby treating the medical condition.
  • a method of diagnosing a medical condition in a subject comprising administering to the subject an effective amount of the composition or delivery system described herein, wherein the agent is a diagnostic agent, thereby diagnosing the medical condition.
  • composition or delivery system described herein for diagnosing or treating a medical condition.
  • the lipidated peptide portion comprises an inner membrane lipidation signal.
  • the lipidated peptide portion of said antibody comprises the first two amino acids encoded by the E. coli NlpA gene or the first six amino acids encoded by the E. coli NlpA gene.
  • the lipidated peptide portion of said antibody is comprised in an inner membrane lipoprotein or fragment thereof selected from the group consisting of: AraH, MglC, MalF, MalG, Mai C, MalD, RbsC, RbsC, ArtM, ArtQ, GliP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E,Dpp B, DppC, OppB,AmiC, AmiD, BtuC, FhuB, FecC, FecD,FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC,PotH, Poti, ModB, NosY, PhnM, LacY, SecY, TolC, Dsb,B, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB
  • the peptide linker comprises between 40-400 amino acid residues.
  • the peptide linker comprises between 40-300 amino acid residues.
  • At least 30 % of the amino acid residues of the peptide linker are glycines or serines.
  • the linker comprises a peptide or protein having 40-400 amino acids residues, including each integer within the specified range. In another embodiment, the linker comprises a peptide or protein having 40-300 amino acids residues, including each integer within the specified range. In yet another embodiment, the linker comprises a peptide or protein having 40- 200 amino acids residues, including each integer within the specified range. In further embodiments, the linker comprises a peptide or protein having 40-100 amino acids residues, including each integer within the specified range. In particular embodiments, the linker comprises a peptide having a sequence as set forth in SEQ ID No. 11. In another particular embodiment, the linker comprises a peptide having a sequence as set forth in SEQ ID No. 12.
  • the antibody or a fragment thereof is a primary antibody or a primary antibody fragment comprising an antigen recognition domain capable of binding an antigen expressed by a target cell.
  • the antibody or a fragment thereof is humanized or human primary antibody or an antibody fragment or a chimeric antibody or a nanobody, collectively termed primary antibody or antibody fragment.
  • the primary antibody or primary antibody fragment is selected from the group consisting of anti- CD44, anti-CD34, anti-CD38, anti-Ly6C, anti-CD3, anti-CD4, anti-CD8, anti-CD25, anti- CD47, anti-CD117, anti-CD147, anti-EGFR and anti-integrin P? antibodies. Each possibility represents a separate embodiment.
  • the primary antibody or primary antibody fragment is capable of binding an antigen listed in Table 1.
  • the antibody is a secondary antibody comprising an antigen recognition domain capable of specifically binding a primary antibody.
  • the antibody is a secondary antibody comprising an antigen recognition domain capable of specifically binding a humanized or human primary antibody.
  • the antibody is a monoclonal antibody.
  • the antibody is lipidated at its N-terminus.
  • the antibody fragment is selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, dsFv, and a nanobody. Each possibility represents a separate embodiment.
  • the antibody fragment is scFv.
  • the antibody is selected from the group consisting of IgGl, IgG2, IgG3, and IgG4. Each possibility represents a separate embodiment.
  • the antibody comprises a nanobody that is monovalent or multivalent.
  • the lipid nanoparticle comprises at least one of an ionizable lipid, a stabilizing lipid, a helper lipid, and a PEG-lipid.
  • an ionizable lipid e.g., a stabilizing lipid
  • a helper lipid e.g., a PEG-lipid
  • PEG-lipid e.g., a PEG-lipid
  • the lipid nanoparticles comprises an ionizable lipid selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, N,N-dimethyl- N',N'- di[(9Z, 12Z)-octadeca-9,12-dien-l-yl] ethane- 1,2-diamine, 2-(di((9Z,12Z)-octadeca- 9,12-dien-l- yl)amino)ethyl 4-(4-methylpiperazin-l-yl)propanoate (EA-PIP), Di-oleyl- succinyl-serinyl- tobramycin, Di-oleyl-adipyl-tobramycin, Di-oleyl- suberyl-tobramycin, Di-oleyl- sebacyl- tobramycin, Di-oleyl-dithioglycolyl-tobramycin,
  • the ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, 2-(di((9Z,12Z)-octadeca-9,12-dien-l- yl)amino)ethyl 4-(4-methylpiperazin-l-yl)propanoate (EA-PIP), Di-oleyl-succinyl-serinyl- tobramycin, Di-oleyl-adipyl-tobramycin, Di-oleyl- suberyl-tobramycin, Di-oleyl- sebacyl- tobramycin, N,N-dimethyl-N',N'-di[(9Z, 12Z)-octadeca-9,12-dien-l-yl] ethane- 1,2-diamine and Di-oleyl-dithioglycolyl-tobramycin, or any combination thereof.
  • the stabilizing lipid is selected from the group consisting of cholesterol, phospholipids (such as, phosphatidylcholine (PC)), cephalins, sphingolipids and glycoglycerolipids, or combinations thereof.
  • phospholipids such as, phosphatidylcholine (PC)
  • PC phosphatidylcholine
  • cephalins cephalins
  • sphingolipids glycoglycerolipids
  • the helper lipid is selected from the group consisting of 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), 1 ,2-dilauroyl-L-phosphatidyl-ethanolamine (DLPE), l,2-Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) 1,2-Diphytanoyl-sn- glycero- 3 -phosphoethanolamine (DPhPE) l,3-Dipalmitoyl-sn-glycero-2-phosphoethanolamine (1,3-DPPE) l-Palmitoyl-3-oleoyl-sn-glycero-2-phosphoethanolamine (1,3-POPE), Biotin-
  • DSPC 1,2- distearoyl-sn-glycero-3-phosphocholine
  • DLPE 1 ,2-dilauroyl-L-phosphatidyl-ethanolamine
  • DOPE 1,2-Diphytano
  • DMPE Phosphatidylethanolamine,l,2-Dimyristoyl-sn-glycero-3- phosphoethanolamine
  • DSPE 1,2- Distearoyl-sn-glycero-3-phosphoethanolamine
  • DPPE Dipalmitoylphosphatidylethanolamine
  • the PEG-lipid is selected from the group consisting of DMG- PEG, PEG-cDMA, PEG-cDSA, DLPE-PEG, DSPE-PEG, 3-A-(-methoxy polyethylene glycol)2000)carbamoyl- 1 ,2-dimyristyloxy-propylamine; 3-A-(-methoxy poly(ethylene glycol)2000)carbamoyl-l,2-distearyloxy-propylamine, or combinations thereof.
  • DMG- PEG DMG- PEG, PEG-cDMA, PEG-cDSA, DLPE-PEG, DSPE-PEG, 3-A-(-methoxy polyethylene glycol)2000)carbamoyl- 1 ,2-dimyristyloxy-propylamine; 3-A-(-methoxy poly(ethylene glycol)2000)carbamoyl-l,2-distearyloxy-propylamine, or combinations thereof.
  • the lipid nanoparticle comprises an ionizable lipid (such as, for example, DLinDMA, DLinMC3-DMA or DlinKC2-DMA), a stabilizing lipid (such as, for example, cholesterol), a helper lipid (such as, for example DSPC or DOPE), and a PEG-lipid (such as, for example DMG-PEG).
  • an ionizable lipid such as, for example, DLinDMA, DLinMC3-DMA or DlinKC2-DMA
  • a stabilizing lipid such as, for example, cholesterol
  • a helper lipid such as, for example DSPC or DOPE
  • PEG-lipid such as, for example DMG-PEG
  • the lipid nanoparticle comprises about 30-70% (mol%) of an ionizable lipid, including each value within the specified range. In other embodiments, the lipid nanoparticle comprises about 30-50% (mol%) of a stabilizing lipid, including each value within the specified range. In further embodiments, the lipid nanoparticle comprises about 5-20% (mol%) of a helper lipid, including each value within the specified range. In additional embodiments, the lipid nanoparticle comprises about 0.5-5% (mol%) of a PEG-lipid, including each value within the specified range.
  • the lipid nanoparticles have a particle size (diameter) in the range of about 1 to about 500 nm, including each value within the specified range. In other embodiments, the lipid nanoparticles have a particle size in the range of about 1 to about 300 nm, including each value within the specified range. In yet other embodiments, the lipid nanoparticles have a particle size in the range of about 1 to about 200 nm, including each value within the specified range. In particular embodiments, the lipid nanoparticles have a particle size in the range of about 1 to about 100 nm, including each value within the specified range.
  • the anchoring lipid comprises a glycerolipid.
  • the anchoring lipid comprises a di-substituted glycerolipid.
  • the anchoring lipid is attached to the fusion protein via a cysteine residue.
  • the delivery system composition further comprises a detectable moiety.
  • the delivery system composition further comprises an affinity tag.
  • the therapeutic agent is encapsulated within the lipid nanoparticle.
  • a method of delivering a therapeutic agent to a subject in need thereof comprising administering to the subject a delivery system composition comprising a lipid nanoparticle encapsulating a therapeutic agent, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker and a lipidated antibody or a fragment thereof, wherein the linker is fused to the lipidated antibody or a fragment thereof and the fusion protein is non-covalently attached to the lipid nanoparticle through the anchoring lipid so that the lipidated antibody or a fragment thereof is at the distal end from the nanoparticle, and wherein the linker comprises a peptide or protein having at least 40 amino acids residues.
  • the weight ratio between the therapeutic agent and the lipid nanoparticle is in the range of about 1:50 to 50:1, including all iterations of ratios within the specified range. In another embodiment, the weight ratio between the therapeutic agent and the lipid nanoparticle is in the range of about 1:1 to 1:25, including all iterations of ratios within the specified range. In yet another embodiment, the weight ratio between the therapeutic agent and the lipid nanoparticle is in the range of about 45:1 to 1:1, including all iterations of ratios within the specified range.
  • administering is performed via a locoregional route/inj ection (for example, intramuscular (IM), intraperitoneal (IP), intra-tumoral, intradermal, intravesicular, intratracheal, intrathecal, intradermal or subcutaneous (SC) administrations).
  • IM intramuscular
  • IP intraperitoneal
  • SC subcutaneous
  • the administration is systemic (for example intravenously or intraarterially).
  • the delivery system is administered as a pharmaceutical composition further comprising a pharmaceutically acceptable excipient comprising at least one of a surfactant, a suspending agent, and an emulsifying agent.
  • a pharmaceutically acceptable excipient comprising at least one of a surfactant, a suspending agent, and an emulsifying agent.
  • the therapeutic agent is a nucleic acid or a polynucleotide.
  • the therapeutic agent is an exome encoded DNA or an mRNA.
  • the therapeutic agent is a non-exome encoded RNA.
  • the non-exome encoded RNA is a microRNA, a long non-coding RNA (IncRNA), a long non-coding intergenic RNA (lincRNA), a pseudogene, a circular RNA (circRNA), a transfer RNA (tRNA) or an interfering RNA (siRNA and shRNA).
  • IncRNA long non-coding RNA
  • lincRNA long non-coding intergenic RNA
  • pseudogene a circular RNA
  • circRNA circular RNA
  • tRNA transfer RNA
  • shRNA and shRNA interfering RNA
  • the therapeutic agent is a catalytically active or deactivated gene editing nuclease.
  • the catalytically active or deactivated gene editing nuclease is selected from a meganuclease, zinc finger nuclease (ZFN), transcription activator- like effectorbased nuclease (TALEN), transposase, integrase, mobile genetic element (MGE)-encoded recombinase, clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) nuclease and their related guide nucleic acids and targeting moieties.
  • ZFN zinc finger nuclease
  • TALEN transcription activator- like effectorbased nuclease
  • MGE mobile genetic element
  • CRISPR clustered regularly interspaced short palindromic repeats
  • Cas clustered regularly interspaced short palindromic repeats
  • the CRISPR associated (Cas) nuclease is Cas9, Cas 12a, Casl2b, Casl2e, Casl3, Casl3a, Casl3b, Casl4, Cas-theta, CasX, CasY or those listed in Table
  • the therapeutic agent is a gene editing agent including a base editor, prime editor, mobile genetic element gene writer.
  • the base editor is a cytosine base editor (CBE) or an adenine base editor (ABE) comprising but not limited to a catalytically inactive (dCas) or partially inactive (Cas nickase or nCas) Cas nuclease, cytidine deaminase, or adenosine deaminase and guide RNA that confers target sequence specificity.
  • CBE cytosine base editor
  • ABE adenine base editor
  • base editor or gene editing agents are selected from but not limited to those listed in Tables 2 and 3.
  • the therapeutic agent is a prime editor comprised of a prime editing guide RNA (pegRNA) targeting sequence and RNA template, and a fusion protein consisting of Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme where the pegRNA guide template and Cas9 nickase directs the reverse transcriptase to the target site where a new DNA strand from the RNA template is inserted at the target site.
  • pegRNA prime editing guide RNA
  • RT reverse transcriptase
  • the therapeutic agent is a gene writer incorporating a mobile genetic element for sequence targeting combined with an engineered integrase or transposase to integrate nucleic acid sequences at the target sequence.
  • the therapeutic agent is a mobile genetic element gene writer incorporating CRISPR-Cas9 targeting elements combined with an engineered piggyBac transposase to integrate nucleic acid sequences at the target sequence.
  • a donor DNA sequence is concurrently provided to either repair or insert a therapeutic DNA sequence.
  • the delivered gene editing moieties knock out, repair or repress expression of deleterious or abnormal nucleic acid sequences.
  • the delivered gene editing moieties knock in, provide or increase expression of therapeutically beneficial nucleic acid sequences.
  • the therapeutic agent is a catalytically deactivated CRISPR associated (Cas) protein or an mRNA fused to a transcriptional modifier.
  • Cas CRISPR associated
  • the mRNA fused to a transcriptional modifier is a transcriptional repressor.
  • the transcriptional repressor is a methyltransferase or histone deacetylase.
  • the transcriptional repressor is DNA methyltransferase 3A (DNMT3A), methyl-CpG-binding protein 2 (MeCP2), Kruppel-associated box (KRAB), MeCP2- KRAB, histone deacetylase 3 (HDAC3), Ezh2, SALL1 and/or SDS3.
  • DNMT3A DNA methyltransferase 3A
  • MeCP2 methyl-CpG-binding protein 2
  • KRAB Kruppel-associated box
  • MeCP2- KRAB histone deacetylase 3
  • Ezh2 histone deacetylase 3
  • the mRNA fused to a transcriptional modifier is a transcriptional activator.
  • the transcriptional activator is VP64, p65, Rta separately or combined (VPR), the synergistic activation mediator (SAM) activation system MS2-p65-HSFl, DNA demethylation moiety, or an acetyltransferase.
  • VPR the transcriptional activator
  • SAM synergistic activation mediator
  • the delivery system composition of the present invention is useful for knocking out, repairing or repressing expression of deleterious or abnormal nucleic acid sequences.
  • the nucleic acid sequences that are knocked out, repaired or repressed include, but are not limited to, an essential gene, a growth promoting gene, an oncogene, an angiogenic gene, an immune suppressive gene, an anti- apopto tic gene, a therapy resistance gene, a dominant negative mutated gene, a mutated gene, a viral gene, a disease promoting miRNA, IncRNA, lincRNA, pseudogene, tRNA or circRNA targets including but not limited to those listed in Table 4 where each possibility represents a separate embodiment.
  • the delivery system composition of the present invention is useful for knocking in, providing or increasing expression of therapeutically beneficial nucleic acid sequences.
  • the beneficial nucleic acid sequences that are knocked in, provided or increased in expression include, but are not limited to, a tumor suppressor nucleic acid sequence, a pro-apoptotic nucleic acid sequence, an immune stimulatory nucleic acid sequence, an anti-angiogenic nucleic acid sequence, an anti-cancer nucleic acid sequence, a beneficial nucleic acid sequence silenced by hypermethylation or other epigenetic mechanisms, or a therapy sensitizing nucleic acid sequence including but not limited to those listed in Table 5.
  • a tumor suppressor nucleic acid sequence a pro-apoptotic nucleic acid sequence
  • an immune stimulatory nucleic acid sequence an anti-angiogenic nucleic acid sequence
  • an anti-cancer nucleic acid sequence an anti-cancer nucleic acid sequence
  • a beneficial nucleic acid sequence silenced by hypermethylation or other epigenetic mechanisms or
  • the therapeutic agent is a protein, a ribonucleoprotein or a drug.
  • the therapeutic agent is delivered to a cell.
  • the therapeutic agent is delivered to a pre-malignant or malignant cell.
  • the therapeutic agent is delivered to a leukocyte cell.
  • the leukocyte cell is a primary lymphocyte.
  • the lymphocyte is selected from a B-cell and a T-cell. Each possibility represents a separate embodiment.
  • a method for treating a medical condition in a subject in need thereof comprising the step of administering to the subject a delivery system comprising a lipid nanoparticle encapsulating a therapeutic agent, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker and a lipidated antibody or a fragment thereof, wherein the linker is fused to the lipidated antibody or a fragment thereof and the fusion protein is non-covalently attached to the lipid nanoparticle through the anchoring lipid so that the lipidated antibody or a fragment thereof is at the distal end from the nanoparticle, and wherein the linker comprises a peptide or protein having at least 40 amino acids residues.
  • the medical condition is cancer or a pre- malignant disorder predisposing to cancer.
  • the cancer is a solid tumor or a hematopoietic cancer.
  • the medical condition is an autoimmune or inflammatory disease, such as inflammatory bowel disease.
  • the medical condition is a monogeneic or polygenic genetic disease.
  • the medical condition is a cardiovascular, respiratory, urogenital, neurological, endocrinological, gastrointestinal, immunological or musculoskeletal disorder. Each possibility represents a separate embodiment.
  • the medical condition is a disorder caused by an infectious agent.
  • the delivery system composition of the present invention is employed for inhibition of the target nucleic acids or genes listed in Table 4. Each possibility represents a separate embodiment.
  • the delivery system composition of the present invention is employed for the therapeutic expression of the target nucleic acids or genes listed in Table 5. Each possibility represents a separate embodiment.
  • the delivery system composition of the present invention is employed for the correction or repair of the target nucleic acids or genes listed in Table 4, Table 5 or Table 7. Each possibility represents a separate embodiment.
  • the LAND therapeutic construct is comprised of the amino acid sequence SEQ ID No. 13 MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGR followed by a functional protein followed by amino acid SEQ ID No. 1 ASGGSGGGKASGG followed by a “secondary” scFv sequence with specificity for the Fc fragment of the “primary” antibody with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • the amino acids linker AAAGSHHHHHH SEQ ID NO: 19 is added at the end of the composition.
  • the LAND therapeutic construct is comprised of the amino acid sequence (SEQ ID No. 13 MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGR followed by a functional protein followed by SEQ ID No. 6 ASGGSGGGKASGGGGGGSGGGGSGGGGS followed by a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • the amino acids linker AAAGSHHHHHH SEQ ID NO: 19 is added at the end of the composition.
  • the LAND therapeutic construct is comprised of the amino acid sequence SEQ ID No. 14
  • the amino acid linker AAAGSHHHHHH (SEQ ID NO: 19) is added at the end of the composition.
  • the EAND therapeutic construct is comprised of the amino acid sequence SEQ ID No. 14 followed by a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • the amino acid linker AAAGSHHHHHH SEQ ID NO: 19 is added at the end of the composition.
  • the antibody comprises an amino acid sequence as set forth in SEQ ID NO: 5, 8, 24, 27, 28 or 30.
  • FIGs 1A-G Schematic illustration in Figure 1A-F of delivery systems according to embodiments of the invention and of prior art (ASSET) (G)
  • FIG. 1A is a general scheme of a delivery system whereby the lipidated peptide (LP) portion is separated from the antibody with a linker (for example of more than 40 amino acids)
  • B primary IgG LAND
  • C primary scFv LAND
  • D long linker LAND
  • E long linker LAND
  • F primary Fab LAND.
  • “1” denotes primary IgG antibody targeting
  • 2 denotes primary scFv antibody targeting
  • “3” denotes primary Fab antibody targeting.
  • FIG. IB illustrates a representative example of a primary IgG LAND construct.
  • This example is comprised of the lipidated peptide portion (amino acid sequence SEQ ID NO: 17 (CDQSSS), followed by linker 1 (SEQ ID NO: 18; GGGGSGGLSGR followed by a functional protein followed by linker 3 (SEQ ID No. 1; ASGGSGGGKASGG) followed by a “secondary” scFv sequence with specificity for the Fc fragment of the “primary” antibody with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • the amino acids of linker 1, functional protein and linker 3 make up the amino acids of the total linker.
  • the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C terminus.
  • FIG. 1C illustrates an exemplary construct which is comprised of the lipidated peptide portion (amino acid sequence SEQ ID NO: 17 (CDQSSS), followed by linker 1 (SEQ ID NO: 18 GGGGSGGLSGR) followed by a functional protein followed by linker 4 (amino acid SEQ ID No. 6 ASGGSGGGKASGGGGGGSGGGGSGGGGS) followed by a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • the amino acids of linker 1, functional protein and linker 4 make up the amino acids of the total linker.
  • the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C- terminus.
  • FIG. ID illustrates an exemplary construct which is comprised of the lipidated peptide portion (amino acid sequence SEQ ID No. 17) followed by linker 5 GGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASASGG SGGGKASGG (SEQ ID NO: 12) followed by a “secondary” scFv sequence with specificity for the Fc fragment of the “primary” antibody with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.
  • FIG. IE illustrates an exemplary construct which is comprised of the lipidated peptide portion (amino acid sequence SEQ ID No. 17) followed by linker 5 GGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASASGG SGGGKASGG (SEQ ID NO: 12) followed by a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.
  • FIG. IF illustrates an exemplary construct for the expression of a LAND in Fab antibody format. It is comprised of the lipidated peptide portion (amino acid sequence SEQ ID NO: 17), followed by an 11 amino acids long linker 1 (SEQ ID NO: 18), followed by a functional protein, followed by an additional linker, 20 amino acids long (linker 4; SEQ ID NO: 6) followed by a primary Fd heavy.
  • the light chain part of the Fab is encoded by a sequence located on a separate DNA cassette and upon export to the E. coli periplasm associates with the Fd part to form the Fab which is covalently stabilized by an interchain disulfide bond.
  • the Fab acts as the primary antibody, with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • FIG. 1G illustrates a prior art ASSET construct which is comprised of the lipidated peptide portion (amino acid sequence SEQ ID NO: 17), followed by linker 1 (SEQ ID NO: 18), followed by a secondary antibody which is capable of binding to a primary antibody which has specificity for an antigen expressed on the cell type to be targeted, followed by an additional linker (linker 2; SEQ ID NO: 21) followed by functional protein.
  • FIG. 2 Analysis of fractions from purification of RG7 LAND protein.
  • Aliquot from the Triton fraction (TF, 20 pg protein loaded), unbound fraction of the His-Trap column (Ni- FT, 20 pg protein loaded) and purified lipidated RG7 scFv (pure, 5 pg protein loaded) were separated on a 12% SDS/polyacrylamide gel.
  • the arrow marks the position of the LAND protein. Representative gel out of 24 productions.
  • FIGs. 3A-B Comparison between rat IgG2a binding by RG7-LAND and RG7-ASSET by ELISA and FACS.
  • A an ELISA plate was coated overnight (ON) at 4°C, half with Fib504 (rat IgG2a) and half with BSA. The plate was blocked with 300 pl/well of 3% MPBS 37°C, Ih. The plate was washed 3 times with PBST and the purified LAND or ASSET proteins were applied in triplicates, starting at 300 nM in PBST with serial 3 fold dilutions for Ih at RT. The plate was washed again and HRP-anti HIS/5000 in PBST was applied for Ih at RT.
  • FIGs 4A-B Comparison between rat IgG2a anti-EGFR binding by RG7-LAND and RG7- ASSET by ELISA and FACS.
  • A an ELISA plate was coated ON at 4°C, half with anti-hEGFR (rat IgG2a clone 30-F11, BioRad) and half with BSA (as a negative specificity control), both at 2 pg/ml in PBS, 50 pl/well. The plate was blocked with 300 pl/well of 3% MPBS 37°C, Ih.
  • the plate was washed 3 times with PBS containing 0.05% Tween-20 (PBST) and the purified LAND or ASSET proteins were applied in triplicates, starting at 300 nM in PBST with serial 3 fold dilutions for Ih at RT.
  • the plate was washed 3 times with PBST and HRP-anti HIS diluted x5000 in PBST was applied for Ih at RT.
  • the plate was washed 3 times with PBST and 50 pl/well of TMB (Dako) were added.
  • the color reaction was stopped after 8 min with 50 pl/well of IM H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). Error bars represent the SD of the data.
  • FIG. 5 In vitro binding of purified D1D2-Fc protein to TK-1 cells mediated by RG7- LAND compared to RG7-ASSET, measured by flow cytometry. LNPs associated with D1D2- Fc bind to TK- 1 cells only when they are associated with RG7 LAND but not with the RG7 ASSET. US- unstained cells; Cy5 is the fluorescence of the encapsulated siRNA. Representative histogram out of live independent preparations.
  • FIGs. 6A-C In vitro binding of Erbitux LAND “LAND with Primary scFv Targeting” to 0VCAR8 (EGFR + ) cells measured by flow cytometry.
  • A binding of purified Erbitux-LAND protein in OG micelles.
  • B binding of EA-PIP LNPs into which purified Erbitux-LAND protein was integrated.
  • C binding of MC3 LNPs into which purified Erbitux-LAND protein was integrated.
  • mCherry in A is the fluorescence of the mCherry component of LAND.
  • Cys5 in B and C is the fluorescence of the encapsulated siRNA. Representative histogram out of four independent preparations. Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P ⁇ 0.0001.
  • FIG. 7 Competitive binding: In vitro binding of Erbitux-LAND to 0VCAR8 (EGFR + ) cells measured by flow cytometry in the presence of Erbitux mAb as a competitor or in the presence of Avastin as an isotype control. US - unstained cells; EA-PIP LNPs - empty LNPs (into which no scFv was integrated); Avastin + Erb-LNPs - LNPs into which Erbitux-LAND was integrated incubated in the presence of the isotype control mAb Avastin; Erbitux + Erb-LNPs - LNPs into which Erbitux-LAND was integrated incubated in the presence of the mAb Erbitux. Cys5 is the fluorescence of the encapsulated siRNA. Representative histogram out of four independent preparations. Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P ⁇ 0.0001.
  • FIGs. 8A-B The efficacy of LAND was compared to ASSET under conditions that minimized non-specific LNP internalization (4°C) and under standard conditions (37°C).
  • Cell viability assay 0VCAR8 cells were treated with EA-PIP LNPs in vitro for (A) Ih at 4°C with 2 pg/ml LNPs (where non-specific LNP internalization is minimized) or (B) under standard conditions at 37°C for 15 min with 0.2 pg/ml LNPs (where non-specific LNP internalization is not minimized). The cells were washed to remove LNPs that did not internalize, replenished with fresh medium and cultured for 72h, when cell viability was evaluated using an XTT assay.
  • NC5 - negative control siRNA PLK1- siPLKl
  • ASSET-EGFR - LNPs targeted by RG7-LAND protein with a rat IgG2a anti-hEGFR ASSET-Iso - LNPs targeted by RG7-LAND protein with an isotype control rat IgG2a
  • Nip A- Erb - LNPs targeted by Erbitux-LAND NlpA-RG7 - LNPs targeted by RG7-LAND protein without an added primary antibody.
  • Error bars represent the SD of triplicates.
  • FIGs. 9A-B Tumor cell uptake in vivo'.
  • OVCAR8 tumor-bearing athymic nude mice were injected intraperitonially with EA-PIP LNPs encapsulating siRNA labeled with Cy5 at 0.75 mg/kg. Tumors were harvested for analysis 4h post injection.
  • A gating strategy: single cells suspensions processed from tumors were stained with mCD45-FITC to determine the ratio of mCherry + cells positive for Cy5 (tumor cells that had LNP uptake) and the ratio of CD45 + cells positive for Cy5 (mouse leukocytes that had LNP uptake) by flow cytometry.
  • B ratio of Cys5 positive cells in tumor cells or mouse leukocytes.
  • ASSET-EGFR - LNPs targeted by RG7 LAND protein with a rat IgG2a anti-hEGFR ASSET-Iso - LNPs targeted by RG7 LAND protein with an isotype control rat IgG2a
  • NlpA-Erb - LNPs targeted by Erbitux LAND protein NlpA-RG7 - LNPs targeted by RG7 LAND protein without an added primary antibody.
  • FIG. 10 PLK1 silencing by siRNA in tumors: OVCAR8 tumor-bearing athymic nude mice were injected intraperitoneally with EA-PIP LNPs encapsulating siRNA for PLK1 or negative control siRNA at 0.75 mg/kg. Tumors were harvested for analysis by 48h post injection. RNA was extracted from tumors and PLK1 mRNA levels were evaluated by RT- PCR, compared to human 3C gene as endogenous control. All samples were normalized to mock.
  • FIGs. 11A-D In vitro binding of THB-7 LAND to Z138 (CD38 + ) and CAG (MM) cells measured by flow cytometry.
  • A THB-7-LAND micelles, binding of purified THB-7-LAND protein in OG micelles to CAG cells.
  • B NlpA-LNPs (EA-PIP), binding of EA-PIP LNPs integrated with purified THB-7-LAND protein to CAG cells.
  • C THB-7-LAND micelles, binding of purified THB-7-LAND protein in OG micelles to Z138 cells.
  • D NlpA-LNPs (EA- PIP), binding of EA-PIP LNPs integrated with purified THB-7-LAND to Z138 cells.
  • FIGs. 12A-B Analysis of rat IgG2a and BSA binding by RG7-LAND compared to RG7- LAND “long linker” by ELISA.
  • A an ELISA plate was coated ON at 4°C, half with Fib504 and half with BSA. The plate was blocked with 300 pl/well of 3% MPBS, 37°C, Ih. The plate was washed 3 times with PBST and the purified LAND proteins were applied in triplicates, starting at 300 nM in PBST with serial 3 fold dilutions for Ih at RT. The plate was washed again and HRP- anti HIS/5000 in PBST was applied for Ih at RT.
  • FIG. 13 Analysis of binding of MC3 LNP targeted by RG7-LAND compared toRG7- LAND “long linker”. Binding of LNPs to TK-1 cells (that express a4p7-integrin on their surface) mediated by Fib504 rat IgG2a (an antibody that binds a4p7-integrin) or a rat IgG2a isotype control was measured by flow cytometry, reading Cys5 fluorescence of the labeled encapsulated siRNA.
  • FIG. 14 Tumor cell viability experiments demonstrate the potential of LAND Primary scFv Targeting for gene editing applications.
  • the ability of THB-7 (anti-CD38 scFv) LAND LNPs to treat CD38 + hematopoietic cancers is shown in a representative CD38 expressing mantle cell lymphoma MCL Z138 tumor model.
  • a MCL Z138 tumor cell viability assay was carried out with anti-CD38 scFv LAND LNPs carrying a mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a single guide RNA for SOX11 which is cancer promoting gene in MCL.
  • Control groups consisted of untreated MCL Z138 cells and treatment with identically prepared anti-CD38 scFv LAND LNPs but with single guide RNAs to irrelevant target genes (GFP and HPRT). There is a statistically significant decrease in viability for the MCL tumor cells treated with CD38-LNP(sgSOXl l) compared to all of the control treatments demonstrated by ANOVA (p ⁇ 0.0001).
  • FIG. 15 To further demonstrate the potential of LAND Primary scFv Targeting for gene editing applications, in vivo experiments are conducted comparing tumor-targeted and isotypecontrol LNPs delivering an mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a guide RNA to suppress the function of a gene that promotes tumor growth.
  • Cas CRISPR associated
  • Cas9 CRISPR associated nuclease
  • IV treatment is initiated after tumor establishment 10 and 15 days after tumor inoculation with LAND LNPs at a dose of 0.5 mg/kg containing a Cas9 mRNA and single guide RNA for SOX11— CD38-LNP(sgSOXl l).
  • Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs.
  • control LNP vectors are CD38-targeted LNPs containing a Cas9 mRNA and single guide RNA for green fluorescent protein (GFP)— CD38-LNP(sgGFP); Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for SOX11— Iso-LNP(sgSOXl l) and Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for GFP— Iso-LNP (sgGFP).
  • GFP green fluorescent protein
  • FIGs. 16A-C To further demonstrate the potential of LAND Primary scFv Targeting for both safe and effective gene editing, the percentage of gene editing was evaluated in sorted tumor cells extracted from tumors and normal hepatocytes following in vivo therapy in the same representative hematopoietic tumor model used in Figure 15 and described in Example 3.
  • IV treatment is initiated after tumor establishment with LAND LNPs at a dose of 2.0 mg/kg containing a Cas9 mRNA and single guide RNA for SOX11— CD38-LNP(sgSOXl l).
  • Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs as described for Figure 15.
  • DOX doxorubicin
  • genomic DNA was extracted from MCL tumor cells and normal liver cells and analyzed for INDELs by next generation sequencing (NGS).
  • NGS next generation sequencing
  • the results shown in Figure 16A reveal that 95% of the tumor cells are edited by the treatment with single guide RNA for SOX11— CD38-LNP(sgSOXl l) compared to 0 to 4 percent of tumor cells in the control groups which include either untreated animals or treatment with similarly prepared LNP vectors with irrelevant sgRNAs as described for Figure 15. These differences are statistically significant by analysis of variance (ANOVA) with Tukey multiple comparison test. **P ⁇ 0.001.
  • FIG. 17 To further demonstrate the safety of LAND Primary scFv treatment, liver toxicity and the percentage of gene editing was evaluated in normal hepatocytes following in vivo administration in normal mice.
  • anti-EGFR LAND LNPs at a dose of 2.0 mg/kg containing a Cas9 mRNA and single guide RNA for PLK1— EGFR-LNP(sgPLKl) was administered IV.
  • Control groups include untreated animals and LNP vectors with irrelevant GFP sgRNAs as described for Figure 15.
  • Serum liver enzyme levels and the percentage of gene edited hepatocytes are determined as described in Figure 16.
  • the percentage of liver edited cells was low and there was no significant difference between the anti- EGFR LAND LNPs with single guide RNA for PLK1— EGFR-LNP(sgPLKl) and control groups treated with anti-EGFR LAND LNPs with single guide RNA for an irrelevant sgRNA to GFP as described for Figure 16. There was no negative effect on serum liver enzymes which are similar in all treatment groups to untreated animals.
  • FIG. 18 In vitro binding of Erbitux LAND “LAND with Primary scFv Targeting” and “LAND with Primary Fab Targeting” to OVCAR8 (EGFR + ) cells measured by flow cytometry. Binding of purified Erbitux-LAND proteins in OG micelles. UT- unstained cells; RG7 micelle: RG7 detergent micelles as negative control; Erb micelle: Primary Erbitux scFv LAND detergent micelles; Fab micelle: Primary Erbitux Fab LAND detergent micelles: APC-anti His: detection fluorescent antibody only without micelles.
  • FIG. 19 In vitro binding of THB-7 LAND “LAND with Primary scFv Targeting” and “LAND with Primary Fab Targeting” to Z138 (CD38 + ) cells measured by flow cytometry. Binding of purified THB-7-LAND proteins in pure OG micelles. UT- unstained cells; RG7 micelle: RG7 OG micelles; scFv: Primary THB-7 scFv LAND OG micelles; Fab: Primary THB-7 Fab LAND OG micelles: aHis: detection anti His-Tag fluorescent antibody only without micelles.
  • the present invention provides a novel platform for effective delivery of therapeutic agents to target cells.
  • the platform termed “LAND” affords uniform applicability and superior antigen binding efficacy and specificity.
  • the LAND platform includes a primary antibody which is associated via a lipidated peptide and a peptide linker (e.g. from 10-200 amino acids in length, from 20-200 amino acids in length, from 30-300 amino acids in length or from 40-400 amino acids in length) to a lipid particle.
  • the platform includes unique linker/spacers of at least 40 amino acids in length (which may or may not encode afunctional protein) that were incorporated between the lipidated peptide portion of the antibody and the antibody itself (see Figure 1A).
  • the platform showed high efficacy in transducing cells with LNPs encapsulating an active agent, for example RNA.
  • Figures 1B-F are schematic illustration of certain configurations of the delivery system according to the principles of the present invention vs. the previous configuration (referred to herein as ASSET; Figure 1G).
  • ASSET the previous configuration
  • the ASSET configuration only utilized a short linker (Linker #1) of 11 amino acids prior to the lipidated antibody (secondary scFv) and followed by an additional linker (Linker #2) and a functional protein
  • the configurations according to the principles of the present invention utilize a longer linker (Linker #5 in D and E) or those that include a functional protein (in B and C) prior to the lipidated antibody.
  • the antibody is encoded at the 5’ end of the construct.
  • the delivery system of the present invention is useful for targeting various antigens and treating the listed corresponding diseases including but not limited to those shown in Table 1.
  • the therapeutic agent is a base editor, prime editor or mobile genetic element gene writer.
  • the gene editing nuclease is a cytosine base editor (CBE) which is basically composed of three fused elements: a cytidine deaminase, a uracil DNA glycosylase inhibitor (UGI), and a Cas nuclease that is either catalytically inactive (dCas) or partially inactive (Cas nickase or nCas).
  • CBE cytosine base editor
  • UMI uracil DNA glycosylase inhibitor
  • Cas nuclease that is either catalytically inactive (dCas) or partially inactive (Cas nickase or nCas).
  • Cas9 variants contain mutations that prevent the generation of double strand breaks (DSBs).
  • An associated single-guide RNA (sgRNA) confers target sequence specificity.
  • the CBE complex is recruited to the target DNA by the Cas protein and sgRNA, the cytidine deaminase recognizes the singlestranded DNA (ssDNA) in the R-loop structure formed by the pairing between the sgRNA and the non-edited DNA strand and converts a cytosine into a uracil, generating a U/G pair.
  • the mismatched U/G pair is then sequentially converted into a U/A pair and a T/A pair by the mismatch repair (MMR) pathway.
  • the gene editing nuclease is an adenine base editor (ABE).
  • ABEs resemble CBEs in both structure and base editing mechanisms, except that an adenosine deaminase replaces the cytidine deaminase.
  • the ABE complex is recruited to the target DNA in a process similar to that used by CBEs, after which the adenosine deaminase converts an adenosine into an inosine, generating an I/T pair. MMR then sequentially converts the mismatched I/T pair into an EC pair and a G/C pair. Numerous variants of CBEs and ABE have been generated to improve their efficiency, specificity, and to reduce off target effects.
  • the CBEs and ABEs and other gene editing agents include but are not limited to those listed respectively in Tables 2 and 3.
  • CBEs and ABEs and other gene editing agents are used for introducing a premature termination codon (PTC) in a target gene to disrupt its expression.
  • PTC premature termination codon
  • base editors including but not limited to BE3 create in-frame stop codons by converting CAA, CAG, CGA, and/or TGG codons into TAA, TAG, and TGA stop codons in the genome.
  • Another approach for gene expression inhibition is to use an ABE to mutate the start codon (ATG), thereby abolishing gene expression.
  • i-Silence an adenine base editor is employed for conversion of an ATG to GTG or ACG using for example, ABEmax, resulting in silencing of a gene of interest.
  • ABEmax abnormal pre-existing disease related PTCs can be bypassed by BEs to avoid disease causing truncated protein generation.
  • CRISPR-pass successfully changes PTCs to glutamine (CAA or CAG) or arginine (CGA) codons through A-to-G or T-to-C conversion to avert truncated protein generation by allowing transcription to proceed.
  • isoformspecific gene expression can also be controlled by DNA base editors.
  • Most proteins have multiple isoforms, and the alternative splicing of the pre-mRNA is a key step to determine the isoform type by which some exons are excluded from the mature transcripts.
  • CBEs are employed in an approach termed CRISPR-SKIP that convert Gs within splice acceptor sites into As by editing Cs in the complementary strand of the target site. In consequence, the corresponding exons fail to be incorporated into the mature transcripts while the other exons are expressed normally.
  • sgRNA design programs such as CRISPOR, CHOPCHOP, and Cas-Designer can be used for sgRNAs of DNA base editors.
  • DNA base editor dedicated tools such as BE-Designer, sgSTOPs, beditor, SNP- CRISPR, BE-FF, and Benchling are available to design sgRNAs for use in BE.
  • BE-Hive a machine learning-based sgRNA design tool, termed BE-Hive, is available which provides predicted editing efficacy, as well as genotype outcomes for each target according to different CBEs and ABEs and different cell lines.
  • base editing systems that recruit a DNA base-modifying enzyme through an RNA aptamer within the gRNA molecule is utilized.
  • the gRNA guide RNA
  • the gRNA is engineered to include an RNA aptamer, which interacts with its cognate ligand fused to an effector protein.
  • the separation of the DNA recognition element from the effector element and the use of RNA aptamers for effector recruitment allows convenient reconfiguration of the system by the mix and match of individual components and simultaneous recruitment of different effectors to different target sites.
  • heterologous BE at separate loci is conveniently achieved.
  • the RNA aptamer-mediated BE system named Pin-Point is employed.
  • Cytosine Base Editors, Adenine Base Editors and other Gene Editing Agents that are suitable for particular embodiments include but are not limited to those in Tables 2 and 3 below which are incorporated by reference and characterize their nuclease origin, mutations if present, editing windows, and PAM sequences.
  • CBE Cytosine Base Editors
  • ABE Adenine Base Editors
  • Pin-Point RNA aptamer-mediated CBE and ABE systems that may be used in particular embodiments.
  • CBE, ABE and other gene editing components in Table 3 are utilized including but not limited to Glycosylase Base Editors (GBE) and C-to-G Base Editors (CGBE), Adenine Transversion Editors (AYBE and AXBE), Prime Editors (PE) S CRISPR- Associated Transposon (CAST), CRIS PR- Associated Serine Recombinases (twinPE and PASTE), Retrons and SeLection by Essential-Gene Exon Knock-in (SLEEK) doi: 10.3390/biomedicinesl 1082168 which are incorporated by reference.
  • GEB Glycosylase Base Editors
  • CGBE C-to-G Base Editors
  • AYBE and AXBE Adenine Transversion Editors
  • PE Prime Editors
  • CRIS PR- Associated Serine Recombinases twinPE and PASTE
  • Retrons and SeLection by Essential-Gene Exon Knock-in doi: 10.3390/biomedicine
  • Prime editing a guide RNA template and Cas9 nickase is employed to direct a reverse transcriptase enzyme to a target site to generate a new DNA strand from the RNA template for insertion at the target sequence.
  • Prime editors enable generating small insertions and deletions in addition to substitution of several nucleotides at target sites.
  • Prime editors can change any DNA base into any other mediating all possible base-to-base conversions and generate insertions and deletions (indels) and their combinations without the need for doublestrand breaks (DSBs) or donor DNA (dDNA) templates.
  • Prime editing employs a longer than usual single guide RNA (sgRNA), known as a prime editing guide RNA (pegRNA), and a fusion protein consisting of a Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme. Described as “search-and-replace” base-editing technology, prime editing supplies the desired genetic construct in an extension to the guide RNA, which is then converted to DNA using the RT enzyme.
  • sgRNA single guide RNA
  • pegRNA prime editing guide RNA
  • RT reverse transcriptase
  • the gene editing enzymes incorporate mobile genetic elements for targeted integration of large DNA fragments in mammalian genomes.
  • Mobile genetic elements include but are not limited to transposons, retrotransposons, short interspersed nuclear elements (SINEs) and long interspersed nuclear elements (LINEs).
  • SINEs short interspersed nuclear elements
  • LINEs long interspersed nuclear elements
  • FiCAT find, cut and transfer
  • CRISPR-Cas9 targeting elements find, cut
  • PiggyBac functional domains are engineered to provide increased on-target integration while reducing off-target events.
  • Cas9 finds and cuts the genomic insertion point and the transposase with potentiated donor excision and reduced promiscuous DNA binding contributes to the genetic insertion.
  • the system acts irreversibly by destroying the preferred transposase recognition site during insertion.
  • efficient targeted insertion of multi kilobase DNA fragments in mammalian genomes is achieved.
  • a list of endogenous pathogenic cancer promoting genes and sequences for down modulation by LAND therapy include, but are not limited to, those listed in Table 4 along with representative, non-limiting, designed guide RNAs for use with Cas9 and Cas9 repressor fusion proteins.
  • examples of the one or more up modulated anticancer genes and endogenous genomic sequences for transcriptional activation by LAND for cancer treatment have tumor suppressor, pro-apoptotic, immune stimulatory, therapy sensitizing, suicide, anti-cancer gene silenced by hypermethylation or other epigenetic mechanisms, or secreted decoy receptor gene activities including, but not limited to, those listed in Table 5.
  • Cas and dCas nucleases may be provided as either an mRNA encoding the Cas/dCas nuclease (e.g., a CleanCap Cas9 or dCas9 mRNA (modified) custom manufactured by TriLink BioTechnologies Inc) or complexed with a guideRNA as a ribonucloprotein (RNP) (e.g., custom manufactured by Aldevron Inc).
  • RNP ribonucloprotein
  • representative Cas and dCas with their protospacer adjacent motifs (PAM) suitable for LAND therapy in activated or deactivated forms include but are not limited to those listed in Table 6 below.
  • LAND may also be applied for the treatment of the genetic diseases including but not limited to those listed in Table 7 below by gene editing knockout, silencing or correction applications using the LAND platform.
  • These additional diseases, related genes, tissue/cell and antibody targets for LAND platform applications include but are not limited to those described in Table 7 below:
  • antibody as used in this invention includes intact molecules as well as functional fragments thereof.
  • the antibody is a primary antibody.
  • primary antibody refers to an antibody (or antibody fragment as defined herein) which specifically recognizes an antigenic target of interest (e.g., a protein, peptide, carbohydrate, or other small molecule) and is typically unconjugated (unlabelled).
  • an antigenic target of interest e.g., a protein, peptide, carbohydrate, or other small molecule
  • Primary antibodies that recognize and bind with high affinity and specificity to unique epitopes across a broad spectrum of biomolecules are available as high specificity (e.g., 1 pM to 0.5 nM) monoclonal antibodies and/or as polyclonal antibodies.
  • the primary antibody comprises an antigen recognition domain which binds a tissue or tumor specific antigen.
  • tissue specific antigen refers to a heterogenetic antigen with organ or tissue specificity.
  • a tumor (or cancer) specific antigen refers to an antigenic substance produced in tumor cells, i.e., it triggers an immune response in the host. Tumor antigens are useful in identifying tumor cells and are potential candidates for use in cancer therapy. The term also encompasses tumor associated antigens.
  • the antigen recognized by the primary antibody is a cell-surface antigen.
  • the antigen recognized by the primary antibodies is CD44, CD34, Ly6C, CD3, CD4, CD25, CD29 and/or Itgb7.
  • the primary antibody refers to a plurality of primary antibodies that bind different targets e.g., 2, 3 or 4 distinct targets.
  • one target may be a tissue specific antigen while the other(s) can be a tumor specific antigen or vise a versa.
  • all the primary antibodies bind tissue (cell) specific antigens.
  • all the primary antibodies bind tumor specific antigens.
  • the primary antibody is a monoclonal antibody.
  • the primary antibody is a bispecific antibody.
  • the primary antibody is conjugated to a pharmaceutical agent.
  • the primary antibody is conjugated to a diagnostic agent.
  • the antibody is a secondary antibody.
  • secondary antibody refers to an antibody which binds to conserved regions of a primary antibody.
  • the secondary antibody may have a specificity for the antibody species and optionally isotype of the primary antibody.
  • Secondary antibodies are available for particular antibody classes and fragment types. Secondary antibodies can bind parts of whole IgG (heavy and light chains, H+L), or only the Fab or Fc region, or only the gamma chain. In one embodiment, the secondary antibodies described herein bind to the Fc region only of antibodies and not to the light chain of an antibody (i.e. with at least 10, 100 fold or 1000 fold higher affinity). Secondary antibodies also exist that are specific for IgM heavy chains ( or Fc5p), or the or K light chains common to all immunoglobulins (IgG, IgA, IgD, IgE and IgM).
  • IgM heavy chains or Fc5p
  • K light chains common to all immunoglobulins
  • the secondary antibody may be an antibody fragment that binds to the Fc constant region of Rat IgG2a antibodies. In another embodiment, the secondary antibody may be an antibody fragment that binds to the Fc constant region of human antibodies (for example human IgG antibodies).
  • the secondary antibody (or fragment thereof, such as the scFv) should have sufficient affinity to avoid exchange with serum IgG e.g. having a Kd betweenlO' lo M to 10’ 8 M.
  • the secondary antibody may be a monoclonal antibody or a polyclonal antibody.
  • the antibody (primary or secondary) is a monoclonal antibody (as further described herein below), for example a humanized monoclonal antibody.
  • the antibody can belong to any antibody class (e.g., IgG, IgA, IgD, IgE and IgM) or isotype. According to a specific embodiment, the antibody is selected from the group consisting of IgGl, IgG2, IgG3 and IgG4.
  • the antibodies may be provided as intact antibodies (e.g., whole IgG) or as divalent F(ab')2 fragments and monovalent Fab fragments, though other forms of antibody fragments, as described herein below can be used.
  • antibody fragment refers to a functional fragment of an antibody (such as Fab, F(ab')2, Fv, scFv, dsFv, or single domain molecules such as VH and VE) that is capable of binding to an epitope of an antigen.
  • the antibody or antibody fragment comprises a constant region.
  • Suitable antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as a Fv, a single chain Fv (scFv), a disulfide- stabilized Fv (dsFv), an Fab, an Fab’, and an F(ab’)2.
  • CDR complementarity-determining region
  • light chain referred to herein as “light chain”
  • heavy chain a complementarity-determining region of an immunoglobulin heavy chain
  • variable region of a light chain a variable region of a heavy chain
  • a light chain a variable region of a
  • Fv defined as a genetically engineered fragment consisting of the variable region of the light chain (VL) and the variable region of the heavy chain (VH) expressed as two chains;
  • scFv single chain Fv
  • scFv a genetically engineered single chain molecule including the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
  • dsFv disulfide- stabilized Fv
  • Fab a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme papain to yield the intact light chain and the Fd fragment of the heavy chain which consists of the variable and CHI domains thereof;
  • Fab a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin, followed by reduction (two Fab’ fragments are obtained per antibody molecule);
  • F(ab’)2 a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin (i.e., a dimer of Fab’ fragments held together by two disulfide bonds); and
  • Single domain antibodies are composed of a single VH or VL domains which exhibit sufficient affinity to the antigen.
  • the fragment is a scFv.
  • the polypeptide sequence of the primary or secondary antibody contains an N-terminal sequence which is derived from a leader peptide recognized by a bacterial lipidation system. After removal of the leader peptide during export through the inner membrane, the mature polypeptide contains the N-terminal sequence of the leader peptide (e.g. CDQSSS - SEQ ID NO: 17) which is targeted by the lipidation system, resulting in lipid-acylation of the cysteine).
  • the signal sequence is part of an inner membrane bacterial (e.g. E.coli) lipoprotein.
  • NlpA new lipoprotein A
  • the first six amino acid of NlpA can be used as an N terminal anchor (CDQSSS: SEQ ID NO: 17).
  • Other examples of anchors that may find use with the invention include lipoproteins, Pullulanase of K. pneumoniae, which has the CDNSSS (SEQ ID NO: 13) mature lipoprotein anchor, phage encoded celB, and E. coli acrE (envC).
  • the N-terminal end of the antibody is attached to a lipidated peptide portion via a linker peptide.
  • the linker peptide is a sequence of amino acids which serves to link the antibody with the lipidated peptide portion.
  • the linker peptide may include amino acids which encode a functional protein (e.g. a detectable protein, such as a fluorescent protein) or may serve no other function other to link the antibody with the lipidated peptide portion (i.e. a spacer).
  • the linker is preferably of a flexibility and a length which allows the lipidated peptide portion of the antibody to penetrate and associate (non-covalently) with the lipids of the particle and the antigen binding fragment of the antibody to bind its target with a high degree of affinity (as further detailed herein).
  • the linker peptide is at least 40, 50, 60, 70, 80, 90, 100 amino acids in length. In one embodiment, the linker peptide is between 40-400, 40-300, 50-400, 50-300, 60-400, 60-300 amino acids in length.
  • At least 20 %, at least 30 %, at least 40 %, at least 50 %, at least 60 %, at least 70 %, at least 80 %, at least 90 % of the amino acids of the linker are glycines and/or serines.
  • the linker is a combination of functional protein, linker and spacer sequences.
  • a polynucleotide sequence encoding the elements described above is preferably ligated into a nucleic acid construct suitable for host cell expression.
  • a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
  • FIG. 1A-F Exemplary constructs contemplated by the present inventors are shown in Figures 1A-F, whereby the 3’ end of the DNA encoding the antibody encodes a lipidated peptide portion, a linker peptide of more than 40 amino acids and towards the 5’ end, the antibody itself. According to a particular embodiment, the antibody is encoded at the terminal 5’ end.
  • the nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors).
  • a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal.
  • such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
  • the nucleic acid construct of some embodiments of the invention typically includes a signal sequence for secretion of the fusion protein from a host cell in which it is placed.
  • Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements.
  • the TATA box located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis.
  • the other upstream promoter elements determine the rate at which transcription is initiated.
  • promoters contemplated by the present invention include, but are not limited to polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and cytomegalovirus promoters.
  • the promoter is a bacterial promoter.
  • the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed.
  • cell type-specific and/or tissue-specific promoters include promoters such as albumin that is liver specific [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulins; [Banerji et al.
  • neuron-specific promoters such as the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreas-specific promoters [Edlunch et al. (1985) Science 230:912-916] or mammary gland- specific promoters such as the milk whey promoter (U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).
  • Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation.
  • Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream.
  • Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.
  • mammalian expression vectors include, but are not limited to, pcDNA3, pcDN A3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RS V and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
  • Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
  • SV40 vectors include pSVT7 and pMT2.
  • Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5.
  • exemplary vectors include pMSG, pAV009/A + , pMTO10/A + , pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
  • bacterial constructs include the pET series of E. coli expression vectors [Studier et al. (1990) Methods in Enzymol. 185:60-89).
  • Additional bacterial systems contemplated by the present invention include but are not limited to Lactoccocus lactis, Pseudomonas, Streptomyces, coryneform bacteria, and halophilic bacteria.
  • yeast a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Pat. Application No: 5,932,447.
  • vectors can be used which promote integration of foreign DNA sequences into the yeast chromosome.
  • the expression of the coding sequence can be driven by a number of promoters.
  • viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al. (1984) Nature 310:511-514], or the coat protein promoter to TMV [Takamatsu et al. (1987) EMBO J. 3:17-311] can be used.
  • plant promoters such as the small subunit of RUBISCO [Coruzzi et al. (1984) EMBO J.
  • the antibody Since the antibody is lipidated, it is inserted into the membranes of the expressing cells.
  • the membrane fraction may be isolated (e.g. by centrifugation) and the lipidated antibody may be extracted from the membranes using detergent before optionally being further purified (e.g. using Nickel affinity chromatography).
  • the lipidated antibody described herein may be contacted with a particle to generate an immunoparticle.
  • the contacting is effected for a length of time (e.g. 6-72 hours) and under conditions (e.g. temperature) that allow the lipidated portion of the protein (e.g. secondary antibody) to insert into the immunoparticle.
  • a length of time e.g. 6-72 hours
  • conditions e.g. temperature
  • the lipidated portion of the protein e.g. secondary antibody
  • the lipidated antibody is thus non-covalently attached to the particle via its lipidated portion.
  • the lipidated antibody of the invention couples to the outer surface of the particle. Measures are taken to couple the antibody without significantly affecting its functionality in binding its target (i.e., more than 80 %, 90 % or 95% of the antibodies on the particle are available for binding their target and the particle's loadability or loading with the pharmaceutical agent.
  • immunoparticle refers to a particle which typically serves as a drug or diagnostic carrier to which an antibody has been coupled on a surface thereof.
  • particles refers to nano to micro structures which are not biological cells.
  • the particle may be a synthetic carrier, gel or other object or material having an external surface which is capable of being loadable with (e.g., encapsulating) a pharmaceutical agent.
  • the particle may be either polymeric or non-polymeric preparations.
  • Exemplary particles that may be used according to this aspect of the present invention include, but are not limited to polymeric particles, microcapsules, liposomes, microspheres, microemulsions, nanoparticles, nanocapsules, nano-spheres, nano-liposomes, nano-emulsions and nanotubes.
  • the particle is a biological particle - e.g. an erythrocyte or a cell ghost.
  • the particle is a non-biological particle - i.e. not a cell.
  • the particles are nanoparticles.
  • nanoparticle refers to a particle or particles having an intermediate size between individual atoms and macroscopic bulk solids.
  • nanoparticle has a characteristic size (e.g., diameter for generally spherical nanoparticles, or length for generally elongated nanoparticles) in the sub-micrometer range, e.g., from about 1 nm to about 500 nm, or from about 1 nm to about 200 nm, or of the order of 10 nm, e.g., from about 1 nm to about 100 nm.
  • the nanoparticles may be of any shape, including, without limitation, elongated particle shapes, such as nanowires, or irregular shapes, in addition to more regular shapes, such as generally spherical, hexagonal and cubic nanoparticles. According to one embodiment, the nanoparticles are generally spherical.
  • the particles of this aspect of the present invention may have a charged surface (i.e., positively charged or negatively charged) or a neutral surface.
  • Agents which are used to fabricate the particles may be selected according to the desired charge required on the outer surface of the particles.
  • the particles may be fabricated from negatively charged lipids (i.e. anionic phospholipids) such as described herein below.
  • the particles may be fabricated from positively charged lipids (i.e. cationic phospholipids), such as described herein below.
  • positively charged lipids i.e. cationic phospholipids
  • non-charged particles are also contemplated by the present invention.
  • Such particles may be fabricated from neutral lipids such as phosphatidylethanolamine or dioleilphosphatidylethanolamine (DOPE) .
  • DOPE dioleilphosphatidylethanolamine
  • lipids may be used to fabricate the particles of the present invention, including a mixture of more than one cationic lipid, a mixture of more than one anionic lipid, a mixture of more than one neutral lipid, a mixture of at least one cationic lipid and at least one anionic lipid, a mixture of at least one cationic lipid and at least one neutral lipid, a mixture of at least one anionic lipid and at least one neutral lipid and additional combinations of the above.
  • polymer-lipid based formulations may be used.
  • Polymers typically used as lipid modifiers include, without being limited thereto: polyethylene glycol (PEG), polysialic acid, polylactic (also termed polylactide), polyglycolic acid (also termed polyglycolide), apolylactie- polyglycolic acid' polyvinyl alcohol, polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyllydroxyetlyloxazolille, solyhydroxypryloxazoline, polyaspartarllide, polyhydroxypropyl methacrylamide, polymethacrylamide, polydimethylacrylamide, polyvinylmethylether, polyhydroxyethyl acrylate, derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.
  • PEG polyethylene glycol
  • polysialic acid polylactic
  • polyglycolic acid also termed polyglycolide
  • the polymers may be employed as homopolymers or as block or random copolymers.
  • the particles may also include other components. Examples of such other components includes, without being limited thereto, fatty alcohols, fatty acids, and/or cholesterol esters or any other pharmaceutically acceptable excipients which may affect the surface charge, the membrane fluidity and assist in the incorporation of the biologically active lipid into the lipid assembly. Examples of sterols include cholesterol, cholesterol hemisuccinate, cholesterol sulfate, or any other derivatives of cholesterol.
  • Preferred lipid assemblies according the invention include either those which form a micelle (typically when the assembly is absent from a lipid matrix) or those which form a liposome (typically, when a lipid matrix is present).
  • the particle is a lipid-based nanoparticle.
  • the core of the particle may be hydrophilic or hydrophobic.
  • the core of the lipid-based nanoparticle may comprise some lipids, such that it is not fully hydrophilic.
  • the particle is a liposome.
  • liposomes include any synthetic (i.e., not naturally occurring) structure composed of lipid bilayers, which enclose a volume. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. The liposomes may be prepared by any of the known methods in the art [Monkkonen, J. et al., 1994, J. Drug Target, 2:299-308; Monkkonen, J. et al., 1993, Calcif.
  • the liposomes may be unilamellar or may be multilamellar. Unilamellar liposomes may be preferred in some instances as they represent a larger surface area per lipid mass. Suitable liposomes in accordance with the invention are preferably non-toxic.
  • the liposomes may be fabricated from a single phospholipid or mixtures of phospholipids.
  • the liposomes may also comprise other lipid materials such as cholesterol.
  • acidic phospho- or sphingo- or other synthetic-lipids may be used.
  • the lipids have a high partition coefficient into lipid bilayers and a low desorption rate from the lipid assembly.
  • Exemplary phospholipids that may be used for fabricating liposomes with a negative electrical surface potential include, but are not limited to phosphatidylserine, phosphatidic acid, phosphatidylcholine and phosphatidyl glycerol.
  • sphingolipids such as cerebroside sulfate, and various gangliosides.
  • lipids derivatized into lipopolymers are those based on phosphatidyl ethanolamine (PE), usually distearylphosphatidylethanolamine (DSPE).
  • PE phosphatidyl ethanolamine
  • DSPE distearylphosphatidylethanolamine
  • the lipid phase of the liposome may comprise a physiologically acceptable liposome forming lipid or a combination of physiologically acceptable liposome forming lipids for medical or veterinarian applications.
  • Liposome-forming lipids are typically those having a glycerol backbone wherein at least one of the hydrofoil groups is substituted with an acyl chain, a phosphate group, a combination or derivatives of same and may contain a chemically reactive group (such as an as amine imine, acids ester, aldelhyde or alcohol) at the headgroup.
  • the acyl chain is between 12 to about 24 carbon atoms in length, and has varying degrees of saturation being fully, partially or non-hydrogenated lipids.
  • the lipid matrix may be of natural source, semisynthetic or fully synthetic lipid, and neutral, negatively or positively charged.
  • the lipid phase comprises phospholipids.
  • the phospholipids may be a glycerophospholipid.
  • glycerophospholipid include, without being limited thereto, phosphatidylglycerol (PG) including dimyristoyl phosphatidylglycerol (DMPG); phosphatidylcholine (PC), including egg yolk phosphatidylcholine and dimyristoyl phosphatidylcholine (DMPC), phosphatidic acid (PA), phosphatidylinositol (PI), phosphatidylserine (PS) and sphingomyelin (SM) and derivatives of the same.
  • PG phosphatidylglycerol
  • DMPG dimyristoyl phosphatidylglycerol
  • PC phosphatidylcholine
  • PA phosphatidic acid
  • PI phosphatidylinositol
  • PS phosphatidylserine
  • SM sphingomyelin
  • lipid matrix employed according to the invention includes cationic lipids (monocationic or polycationic lipids).
  • Cationic lipids typically consist of a lipophilic moiety, such as a sterol or the same glycerol backbone to which two acyl or two alkyl, or one acyl and one alkyl chain contribute the hydrophobic region of the amphipathic molecule, to form a lipid having an overall net positive charge.
  • Monocationic lipids may include, for example, l,2-dimyristoyl-3- trimethylammonium propane (DMTAP) l,2-dioleyloxy-3-(trimethylanino) propane (DOTAP), N-[-l-(2,3,- ditetradecyloxy)propyl]-N,N- dimethyl-N- hydroxyethylammonium bromide (DMRIE), N-[l- (2,3,- dioleyloxy)propyl]-N,N- dimethyl-N-hydroxy ethyl- ammonium bromide (DORIE), N-[l- (2,3-dioleyloxy) propyl] ;-N,N,N- trimethylammonium chloride (DOTMA); 3;N-(N',N'- dimethylaminoethane) carbamoly]; cholesterol (DC-Chol), and I dimethyl- dioctadecyl, DOTAP,3- dimethylaminoethan
  • polycationic lipids include a similar lipoplilic moiety as with the mono cationic lipids, to which spermine or spermidine is attached. These include' without being limited thereto, N-[2-[[2,5-bis[3 - aminoprop yl)amino]-l- oxopentyl] amino ]ethyl]N,N dimethul-2,3 bis (1-oXo- 9-octadecenyl) oXy];-l propanaminium (DOSPA), and ceramide carbamoyl spermine (CCS).
  • DOSPA 1-oXo- 9-octadecenyl
  • CCS ceramide carbamoyl spermine
  • the cationic lipids may be used alone, in combination with cholesterol, with neutral phospholipids or other known lipid assembly components.
  • the cationic lipids may form part of a derivatized phospholipids such as the neutral lipid dioleoylphosphatidyl ethanolamine (DOPE) derivatized with polylysine to form a cationic lipopolymer.
  • DOPE neutral lipid dioleoylphosphatidyl ethanolamine
  • the diameter of the liposomes used preferably ranges from 50-200 nM and more preferably from 20-100 nM.
  • Homogenizers which may be conveniently used include microfluidizers (produced by Microfluidics of Boston, MA, USA) or microfluidic micro mixer (Precision NanoSystems, Vancouver, BC, Canada).
  • microfluidizers produced by Microfluidics of Boston, MA, USA
  • microfluidic micro mixer Precision NanoSystems, Vancouver, BC, Canada.
  • liposomes are recirculated through a standard emulsion homogenizer until selected liposomes sizes are observed.
  • the particle size distribution can be monitored by conventional laser beam particle size discrimination.
  • Extrusion of liposomes through a small-pore polycarbonate membrane or an asymmetric ceramic membrane is an effective method for reducing liposome sizes to a relatively well defined size distribution.
  • the suspension is cycled through the membrane one or more times until the desired liposome size distribution is achieved.
  • the liposomes may be extruded through successively smaller pore membranes to achieve a gradual reduction in liposome size.
  • the particle is a nanoparticle.
  • nanoparticles are less than 100 nm in diameter and can be spherical, non- spherical, or polymeric particles.
  • the polymer used for fabricating nanoparticles is biocompatible and biodegradable, such as poly(DL-lactide-co-glycolide) polymer (PLGA).
  • additional polymers which may be used for fabricating the nanoparticles include, but are not limited to, PLA (polylactic acid), and their copolymers, polyanhydrides, polyalkyl-cyanoacrylates (such as polyisobutylcyanoacrylate), polyethyleneglycols, polyethyleneoxides and their derivatives, chitosan, albumin, gelatin and the like.
  • PLA polylactic acid
  • polyanhydrides polyanhydrides
  • polyalkyl-cyanoacrylates such as polyisobutylcyanoacrylate
  • polyethyleneglycols polyethyleneoxides and their derivatives
  • chitosan albumin, gelatin and the like.
  • the particles of the present invention may be modified. According modified to enhance their circulatory half-life (e.g. by PEGylation) to reduce their clearance, to prolong their scavenging time-frame and to allow antibody binding.
  • the PEG which is incorporated into the particles may be characterized by of any of various combinations of chemical composition and/or molecular weight, depending on the application and purpose.
  • the antibody may be packed in a container and identified as a universal kit for in-vivo delivery of a pharmaceutical agent.
  • Drugs or therapeutic agents that may be loaded into the particles include but are not limited to anticancer agent (e.g., chemotherapy, radioisotopes, immunotherapy), antibiotic, enzyme, antioxidant, lipid intake inhibitor, hormone, anti-inflammatory, steroid, vasodilator, angiotensin converting enzyme inhibitor, angiotensin receptor antagonist, inhibitor for smooth muscle cell growth and migration, platelet aggregation inhibitor, anticoagulant, inhibitor for release of chemical mediator, promoter or inhibitor for endothelial cell growth, aldose reductase inhibitor, inhibitor for mesangium cell growth, lipoxygenase inhibitor, immunosuppressive, immunostimulant, antiviral agent, Maillard reaction suppressor, amyloidosis inhibitor, nitric oxide synthetic inhibitor, AGEs (Advanced glycation endproducts) inhibitor, radical scavenger, protein, peptide; glycosaminoglycan and derivatives thereof; and oligosaccharide, polysaccharide, and derivatives thereof.
  • the particles are loaded with a diagnostic agent.
  • Exemplary diagnostic drugs include in vivo diagnostics such as an X ray contrast medium, a diagnostic agent for ultrasound, an isotope-labeled agent for diagnosis by nuclear medicine, and an agent for diagnosis by nuclear magnetic resonance.
  • Loading of the particle with the pharmaceutical agent can be effected concomitant with, or following particle assembly.
  • the nucleic acid agent of interest when the pharmaceutical agent is a nucleic acid, e.g., DNA, RNA, siRNA, plasmid DNA, short-hairpin RNA, small temporal RNA (stRNA), microRNA (miRNA), RNA mimetics, or heterochromatic siRNA, the nucleic acid agent of interest has a charged backbone that prevents efficient encapsulation in the lipid particle.
  • the nucleic acid agent of interest may be condensed with a cationic polymer, e.g., PEI, polyamine spermidine, and spermine, or cationic peptide, e.g., protamine and polylysine, prior to encapsulation in the lipid particle.
  • the agent is not condensed with a cationic polymer.
  • the agent of interest is encapsulated in the lipid particle in the following manner.
  • the immunoparticle is provided lyophilized.
  • the agent of interest is in an aqueous solution.
  • the agent of interest in aqueous solution is utilized to rehydrate the lyophilized lipid particle.
  • the agent of interest is encapsulated in the rehydrated lipid particle.
  • more than one agent of interest may be delivered by the immunoparticles (e.g., lipid-based particle) of this aspect of the present invention.
  • two or more agents may be delivered, where both (or all) the agents are hydrophilic.
  • two or more agents may be delivered, where both (or all) the agents are hydrophobic.
  • two cargo agents of interest may be delivered by the immunoparticles (e.g., lipid-based particle).
  • One cargo agent may be hydrophobic and the other hydrophilic.
  • the hydrophobic agent may be added to the lipid particle during formation of the lipid particle.
  • the hydrophobic agent associates with the lipid portion of the lipid particle.
  • the hydrophilic agent is added in the aqueous solution rehydrating the lyophilized lipid particle.
  • a condensed siRNA is encapsulated in a liposome and a drug that is poorly soluble in aqueous solution is associated with the lipid portion of the lipid particle.
  • “poorly soluble in aqueous solution” refers to a composition that is less that 10 % soluble in water.
  • lipid: pharmaceutical agent ratio that is efficacious is contemplated by this invention.
  • Preferred lipid: pharmaceutical agent molar ratios include about 2: 1 to about 30: 1 , about 5:1 to about 100:1, about 10:1 to about 40:1, about 15:1 to about 25:1.
  • the fusion protein: siRNA weight ratio is about 1:20, 1:30, 1:36 or even 1:50.
  • the preferred loading efficiency of pharmaceutical agent is a percent encapsulated pharmaceutical agent of about 50%, about 60%, about 70% or greater. In one embodiment, the loading efficiency for a hydrophilic agent is a range from 50-100%.
  • the preferred loading efficiency of pharmaceutical agent associated with the lipid portion of the lipid particle e.g., a pharmaceutical agent poorly soluble in aqueous solution, is a percent loaded pharmaceutical agent of about 50%, about 60%, about 70%, about 80%, about 90%, about 100%. In one embodiment, the loading efficiency for a hydrophobic agent in the lipid layer is a range from 80-100%.
  • loading refers to encapsulating or absorbing.
  • encapsulated refers to the pharmaceutical agent being distributed in the interior portion of the particles.
  • the pharmaceutical agents are homogenously distributed. Homogeneous distribution of a pharmaceutical agent in polymer particles is known as a matrix encapsulation. However, due to the manufacturing process it is foreseen that minor amounts of the pharmaceutical agent may also be present on the outside of the particle and/or mixed with the polymer making up the shell of the particle.
  • absorbed refers to binding of the pharmaceutical agent to the outer surface of the particle.
  • the desired amount of the drug loaded in the particle varies depending on the type of the drug. However, it is preferable that the drug can be loaded in the particle at a high loading efficiency.
  • lipidated secondary antibody is conjugated to the particle via the lipidated peptide portion
  • the present invention further contemplates contacting the immunoparticle with a primary antibody.
  • immunocomplexation of the primary antibody with the secondary antibody refers to antibody (i.e., secondary antibody) -antigen (i.e., primary antibody)-based interaction.
  • Antibody- antigen binding is a non-covalent, reversible interaction (specific binding is typically in the 1 pM- 0.1 nM range), which fully maintains the functionality of the primary antibody in binding its epitope.
  • the immunocomplexation reaction is effected ex- vivo.
  • the weight ratio of secondary antibody: primary antibody is typically 1:1, although other ratios such as 1:2, 2:1, 1:3, 3:1 are also contemplated.
  • Conditions for performing immunocomplexation are well known in the art and require physiological conditions and avoid high salt concentrations and extremes of pH which disrupt antigen- antibody binding by weakening electrostatic interactions and/or hydrogen bonds.
  • Antibody fragments according to some embodiments of the invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment.
  • Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods.
  • antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab')2.
  • This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5S Fab' monovalent fragments.
  • a thiol reducing agent optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages
  • an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly.
  • cleaving antibodies such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.
  • Fv fragments comprise an association of VH and VL chains. This association may be noncovalent, as described in Inbar et al. [Proc. Nafl Acad. Sci. USA 69:2659-62 (19720]. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragments comprise VH and VL chains connected by a peptide linker.
  • sFv single-chain antigen binding proteins
  • the structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli.
  • the recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains.
  • Methods for producing sFvs are described, for example, by [Whitlow and Filpula, Methods 2: 97-105 (1991); Bird et al., Science 242:423-426 (1988); Pack et al., Bio/Technology 11:1271-77 (1993); and U.S. Pat. No. 4,946,778, which is hereby incorporated by reference in its entirety.
  • CDR peptides (“minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry [Methods, 2: 106-10 (1991)].
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323- 329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
  • Fc immunoglobulin constant region
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
  • humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)].
  • the techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(l):86-95 (1991)].
  • human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos.
  • immunoparticles of the present invention are typically used in pharmaceutical applications, they are typically non-immunogenic to the treated subject.
  • the particles of the present invention may be administered to the subject per se or as part of a pharmaceutical composition in order to treat a disease.
  • a pharmaceutical composition refers to a preparation of the particles encapsulating the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
  • the pharmaceutical agent is a therapeutic agent, as further described herein above.
  • the purpose of the pharmaceutical composition is to facilitate administration of the active ingredients to the subject.
  • active ingredient refers to the pharmaceutical agents.
  • physiologically acceptable carrier and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to the subject and does not abrogate the biological activity and properties of the administered active ingredients.
  • An adjuvant is included under these phrases.
  • excipient refers to an inert substance added to the pharmaceutical composition to further facilitate administration of an active ingredient of the present invention.
  • excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
  • the pharmaceutical composition may advantageously take the form of a foam or a gel.
  • Suitable routes of administration may, for example, include the inhalation, oral, buccal, rectal, transmucosal, topical, transdermal, intradermal, transnasal, intestinal and/or parenteral routes; the intramuscular, subcutaneous and/or intramedullary injection routes; the intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, and/or intraocular injection routes.
  • the pharmaceutical composition may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art.
  • the pharmaceutical composition can be formulated readily by combining the active ingredients with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
  • Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
  • disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active ingredient doses.
  • compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
  • compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the active ingredients for use according to the present invention can be delivered in the form of an aerosol/spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., a fluorochlorohydrocarbon such as dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane; carbon dioxide; or a volatile hydrocarbon such as butane, propane, isobutane, or mixtures thereof.
  • a suitable propellant e.g., a fluorochlorohydrocarbon such as dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane
  • carbon dioxide or a volatile hydrocarbon such as butane, propane, isobutane, or mixtures thereof.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • the pharmaceutical composition may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
  • the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • a pharmaceutical composition for parenteral administration may include an aqueous solution of the active ingredients in water-soluble form.
  • suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes.
  • Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
  • the active ingredients may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
  • a suitable vehicle e.g., sterile, pyrogen-free water based solution
  • the pharmaceutical composition may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
  • the pharmaceutical composition should contain the active ingredients in an amount effective to achieve disease treatment.
  • the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays - e.g. lysosomal enzyme comprising particles may be tested for in-vitro activity in plasma or in other plasma mimicking environments.
  • a dose can be formulated in animal models to achieve a desired tissue concentration or titer. Such information can be used to more accurately determine useful doses in humans.
  • Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
  • the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage may vary depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-l).
  • Dosage amount and interval may be adjusted individually to provide plasma or tissue levels of the active ingredients which are sufficient to achieve the desired therapeutic effect (minimal effective concentration, MEC).
  • MEC minimum effective concentration
  • the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
  • dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
  • the amount of the composition to be administered will be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
  • compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredients.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration.
  • Such notice for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
  • the immunoparticles of the present invention may be used to deliver a pharmaceutical agent to a subject in need thereof. Both therapeutic and diagnostic applications are contemplated herein.
  • Subjects who may be treated according to the methods described herein are typically mammalian subjects, e.g. human.
  • compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
  • a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
  • range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
  • a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range.
  • the phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
  • IBD Inflammatory bowel disease
  • GI gastrointestinal
  • ADA antibody drug antibody
  • Integrin functionality depends on the conformational state (Yu et al., J. Cell Bio. 196(1): 131-146, 2012). Integrins change conformation when stimulated to result in a dramatic increase in the affinity for their ligands. Integrin a4p7 can bind both Vascular Cell Adhesion Molecule 1 (VCAM-1) for homing to peripheral tissues, and Mucosal Vascular Address in Cell Adhesion Molecule 1 (MAdCAM-1) for homing to intestinal tissues, but not simultaneously. Whether integrin a4p7 has affinity for VCAM-1 or MAdCAM-1 depends on the specific stimulus, subsequent signaling and type of conformational change.
  • VCAM-1 Vascular Cell Adhesion Molecule 1
  • MAdCAM-1 Mucosal Vascular Address in Cell Adhesion Molecule 1
  • integrin a4p7-expressing cells in a conformation-dependent manner is desirable as opposed to commercially available monoclonal antibodies such as natalizumab and vedolizumab (anti a4p7-integrin) that are conformation-insensitive.
  • a recombinant fusion protein that contains two domains of the intestinal endothelium ligand MAdCAM-1 were generated.
  • MAdCAM-1 has an increased affinity to integrin ⁇ 4 ⁇ 7 in its HA conformation and is therefore used in the design of the LNP targeting moiety.
  • MAdC AM- l is a multi-domain protein that is naturally involved in both initial tethering and in firm adhesion of leukocytes to the intestinal endothelium.
  • DI and D2 were used.
  • RG7 a monoclonal secondary antibody against rat IgG2a, herein referred to as RG7, which serves as a linker between the LNPs and the MAdCAM-DlD2 protein was used.
  • the RG7 linker was chemically conjugated to the LNPs using maleimide/thiol chemistry and the MAdCAM-DlD2 protein was recombinantly fused to the Fc region of rat IgG2a.
  • the RG7 antibody binds the MAdC AM- 1 protein by affinity to the rat IgG2a domain thus leaving the domains DI and D2 free for binding the a4p7 integrin.
  • This conjugation strategy was compared with two other conjugations, namely direct conjugation of the D1D2 recombinant protein to the DSPE-PEG-maleimide lipid using reduced cysteine residues in the D1D2 protein or by using ASSET.
  • the scFv was placed immediately following the NlpA lipidation sequence (lipidated peptide portion - SEQ ID NO: 17) and a first 11 amino acids linker (Linker #1; SEQ ID NO: 18) and preceding a second 11 amino acids linker (Linker #2; SEQ ID NO: 21) followed by the functional protein (mCherry - SEQ ID NO: 22), while in LAND, the order of the scFv and mCherry were switched and a novel linker containing 13 amino acids (Linker 3: ASGGSGGGKASGG, SEQ ID No: 1) was generated.
  • the coding sequences of all the components were cloned into a pET30a plasmid backbone, carrying Kanamycin resistance. Expression was performed in the E. coli strain Lemo21(DE3) from New England Biolabs. Lemo21(DE3), is an E. coli strain suitable for tunable T7 promoter- controlled expression of challenging recombinant proteins.
  • the sequence of the RG7-LAND open reading frame is set forth in SEQ ID No. 2 (DNA sequence) and SEQ ID No. 3 (amino acid sequence).
  • Buffer Al (40 ml for every 500 ml culture): 20 mM Tris pH 8.0 (Dilution x50 from the IM stock solution), 10 mM EDTA (Dilution x50 from the 0.5M stock solution), 4 mg lysozyme (100 pg/ml), protease inhibitor cocktail (cOmplete, Roche).
  • Buffer A2 (20 ml for every insoluble pellet from 500 ml volume of culture): 20 mM Tris PH
  • Buffer A3 150 mM NaCl, 20 mM Tris pH 8.0, 1.4% octyl glucoside detergent (OG, Sigma (now Roche), Israel).
  • IPTG isopropyl P- d-1 -thiogalactopyranoside
  • Day 2 The induced cells were collected by centrifugation at 4,000 RPM, 20 min, 4°C SLC3000 Sorvall rotor. The pellet was frozen and kept at -80°C. After 2 h or longer at -80°C, the cell pellet was thawed on ice and suspended in 40 ml of Buffer Al using a cell spreader. After 30 min at RT with intermittent shaking, the cells were broken by homogenization with the large probe of a Tissuemizer (stainless steel blade motorized tissue homogenizer) for 20 sec. Next, the cells were sonicated on ice-water using a large sonicator probe, 3 cycles of 30 sec each, followed by at least 1 min between cycles.
  • Tissuemizer stainless steel blade motorized tissue homogenizer
  • the lysate was spun using Sorvall SS34 tubes in SS34 rotor, 16,000 RPM, 30 min, 4°C.
  • the pellet (which contained the membrane fraction of the lysed E. coli cells as well as other insoluble proteins) was homogenized with the small probe of the Tissuemizer in 20 ml of Buffer A2, 1 min grinding in top speed.
  • the extract was sonicated on ice water with the small probe of the sonicator at 50% power (about 5 on the power scale) for 1 min.
  • the extract was further incubated at room temperature (RT), rotated for 30 min followed by centrifugation using Sorvall SS34 tubes 16,000 RPM, 30 min, 4°C.
  • the supernatant was referred to as the Triton fraction (TF).
  • the pellet which contained other insoluble proteins (such as inclusion bodies) was discarded.
  • the Triton fraction was adjusted to 5 mM imidazole (ID).
  • ID 5 mM imidazole
  • a 1 ml His-Trap column (GE healthcare, life sciences) was equilibrated with ten column volumes (CV) of buffer Al adjusted to 5 mM ID (column loading buffer) loaded with the TF at 0.5 ml/min. The column was washed and eluted at 1 ml/min.
  • the unbound fraction (Ni-FT, shown at the bottom of Figure 2) contained almost the same amount of total protein but no LAND protein.
  • the column was washed with 10 CV of Buffer A2 with 5 mM ID.
  • the column was washed with 10 CV of Buffer A3 with 5 mM ID.
  • the latter wash was performed to replace the Triton X- 100 detergent with the OG detergent.
  • the column was washed with 10 CV of Buffer A3 with 20 mM ID.
  • the column was eluted with 2x5 ml of Buffer A3 with 250 mM ID.
  • the 10 ml combined eluates were concentrated using Centricon 10000 (Centrifugal Filter Unit, Merck, Israel) spinning at 3,000 RPM in a swing out rotor at 18°C, down to about 2.5 ml.
  • a 10 ml Zeba desalting column (Thermo Fisher Scientific, USA) was equilibrated with Buffer A3 (x3).
  • the concentrated LAND protein was loaded and recovered by centrifugation. All centrifugations were performed for 2 min at lOOOxg, 4°C. Protein concentration was determined using a protein assay kit (such as Bradford). Measuring by Nanodrop at 280 nm was found to be less reliable at this step. The protein concentration was adjusted to 0.5 mg/ml with Buffer A3.
  • LNPs LNPs The preparation of LNPs was carried out essentially as described in Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018). Two types of ionizable lipids were used: Dlin-MC3-DMA (MC3) was synthesized according to Cohen et al. (ACS Nano 9(2): 1581- 1591 , 2015), and EA- PIP (lipid 10) was synthesized according to Ramishetti et al. (Adv Mater 32(12): el906128, 2020). All other lipids were acquired from Av anti Polar lipids.
  • MC3-DMA MC3
  • EA- PIP lipid 10
  • lipid mixture ionizable lipid, DSPC, Cholesterol, DMG-PEG at 50:10.5:38.5:1.4 mole ratio
  • siRNA 1:16 w/w siRNA to lipid
  • the resultant mixture was dialyzed against phosphate buffered saline (PBS) (pH 7.4) for 16 h to remove ethanol and residual un-incorporated lipids.
  • Cy5-labelled particles were prepared with scrambled control siRNA (siNC) and Cy5- labelled siNC in a 1:1 ratio.
  • ASSET technology was utilized for the preparation of targeted LNPs or isotype control LNPs. Briefly, ASSET or LAND OG micelles were incubated with the LNPs for 48 h at 4°C to allow its incorporation into LNPs (1:36, ASSET or LAND protein: siRNA weight ratio). Typically, 40 ng of purified lipidated scFv in OG micelles were mixed for every 1 pl of LNPs. Lipidated scFv incorporation into LNPs was measured by mCherry fluorescence and by ELISA.
  • the cell line TK-1 (or other cells as described in the Examples).
  • the targeting moiety D1D2-Fc (MAdCAM fused to rat IgG2a Fc as described in Dammes et al. (Nature Nanotech. 16:1030-1038, 2021)).
  • Isotype control Rat IgG2a that does not bind the TK1 cells.
  • LNPs MC3 lipid (+Cy5 fluorescently-labeled siRNA).
  • the tubes were vortexed briefly and incubated for 48 h at 4°C.
  • TK-1 cells were activated according to Yang et al. (Scand J Immunol 42(2): 235- 247, 1995). Briefly, the activation involved exposing the cells to Mn 2+ ions, that cause the conversion of the a4p7 integrin to the HA configuration (compatible with MAdCAM-1 binding). Flow cytometry experiments were performed on a CytoFLEX (Beckman Coulter, USA).
  • HBSS HBSS (w/o) with 10 mM HEPES buffer, 2 mM CaC12, and 2 mM MgC12.
  • HBSS pre-incubation buffer
  • Cells were incubated for 30 min at RT with gentle rotation (100 pl/sample).
  • ASSET-LNPs or LAND-LNPs were incubated with D1D2-Fc or isotype control at 1 g/sample for 30 min at RT. Cells were washed with PBS to remove the EDTA. Cells were incubated in activation buffer 100 l/sample (full medium with 2 mM CaC12, and 2 mM MnC12) in order to invoke switching 06407 integrin on the surface of the cells to the active conformation to which MAdCAM binds. ASSET-LNPs or LAND-LNPs were immediately added to the cells and left for 20 min on ice. Cells were washed with PBS and analyzed by flow cytometry (Cy5 channel) on a CytoFLEX (Beckman Coulter, USA).
  • MC3 nanoparticles into which RG7-LAND or RG7-ASSET lipidated scFvs were incorporated were prepared and their performance in directing the Fib504 rat IgG2a-mediated binding to cells was compared.
  • the flow cytometry experiment was carried out as described hereinabove. The results of the flow cytometry are shown in Figure 3B. As shown, the RG7- LAND configuration provided improved binding to the TK-1 cells in the presence of the Fib504 targeting primary antibody as compared to the RG7-ASSET configuration.
  • Lipidated scFvs derived from cell-binding antibodies as shown in Figure 1C were made.
  • Erbitux (Cetuximab) which is based on a therapeutic chimeric monoclonal antibody that binds the human epidermal growth receptor (EGFR) was used.
  • the expression vector was constructed by replacing the RG7 scFv sequence of the LAND Figure IB plasmid with the coding sequence of the scFv of Erbitux.
  • the sequence of the Erbitux-LAND open reading frame is set forth in SEQ ID No. 4 (DNA sequence) and SEQ ID No. 5 (amino acids sequence).
  • Linker #3 (depicted in Figure IB) was extended from 13 amino acid residues to 28 amino acid residues (Linker 4: ASGGSGGGKASGGGGGGSGGGGSGGGGS, SEQ ID No. 6).
  • Example 2 is representative of Figure 1C.
  • the Erbitux-LAND protein was produced and purified as described in the general protocol above and tested for functionality by flow cytometry.
  • SEQ ID No. 4 Erbitux-LAND (anti-human EGFR) (LAND with Primary scFv Targeting) coding DNA sequence:
  • EA-PIP and MC3 lipidated Erbitux scFv was functional and effective in cell targeting.
  • specificity of binding of the Erbitux-targeted LNPs was further validated by competition, where the Erbitux mAb was used as a competitor in a flow cytometry experiment. Competition for the binding of Erbitux-LAND-targeted LNPs to the OVCAR8 cells was substantiated.
  • the binding signal of the Erbitux-LAND targeted LNPs to the OVCAR8 cells was inhibited (shifted to the left) in the presence of the Erbitux mAb compared to the signal obtained in the presence of the anti-VEGF mAb, Avastin, which does not bind these cells, serving as an isotype control.
  • LNPs contained either siRNA PLK1 (PLK1 is a kinase required for mitosis or negative control siRNA.
  • PLK1 is a kinase required for mitosis
  • siRNA PLK1 is a kinase required for mitosis
  • G2-M phase cell cycle arrest and cell death in dividing cells occurs (Rosenblum et al., Sci. Adv. 6: eabc9450, 2020).
  • OVCAR8 cells were treated with EA-PIP LNPs in vitro for 1 h at 4 °C with 2 pg/ml LNPs (where non-specific LNP internalization is minimized), washed to remove LNPs that were not internalized, replenished with fresh medium and cultured for 72 h, when cell viability was evaluated using a XTT assay.
  • OVCAR8 xenograft model in nude mice was used. Xenografts were induced by injecting 3xl0 6 OVCAR8 cells expressing mCherry suspended in 200 pl PBS intraperitoneally into 8-10-weeks old female athymic nude mice on day 0.
  • mice were imaged by In Vivo Imaging System IVIS-Lumina III (Perkin Elmer, USA) and divided into groups so that the tumor burden, based on the mCherry signal, was homogeneously distributed between the groups.
  • EA-PIP LNPs encapsulating siNC (negative control, siRNA that does not silence any gene in these cells) labeled with Cy5 were injected intraperitoneally at 0.75 mg/kg, in a total volume of 200 pl/mouse. Mice were given a single dose on day 18, and tumors were recovered 4 h after injection and analyzed for LNPs uptake by flow cytometry. The gating strategy and cell uptake ratios are shown in Figure 9.
  • LNPs encapsulating siPLKl or control siRNA were injected intraperitoneally at 0.75 mg/kg, in a total volume of 200 pl/mouse. The mice were given a single dose on day 16. The extent of PLK1 silencing in tumor was determined by RT-PCR. Tumors were recovered at day 18 for RNA extraction.
  • the “Original ASSET” approach showed improved selectivity in tumor uptake compared to isotype control in this model.
  • Tumors from mice treated with siPLKl LNPs targeted by Erbitux-LAND (marked as NlpA-Erb in Figure 10) had less PLK1 mRNA levels compared to control NlpA-RG7.
  • Such selectivity was not seen in mice treated with LNPs targeted by RG7 ASSET protein combined with a rat IgG2a anti human EGFR or isotype control.
  • the in vivo data in Figure 10 was also surprising as complete IgG molecules are known to have higher avidity than the monovalent scFv fragments. Only the Erbitux-LAND construct but not the ASSET-EGFR construct demonstrated statistically significant efficacy compared to their controls.
  • composition type “C” shown in Figure 1C that contains a functional protein and a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy.
  • CD38 is expressed on the surface of immature hematopoietic cells, including immature B cells. Its expression is tightly regulated during B-cell ontogeny. It is expressed on bone marrow precursors, but not on mature B cells.
  • CD38 is overexpressed in many B cell malignancies, including mantle-cell lymphoma (MCL) and multiple myeloma (MM) cells.
  • CD38 has been shown to be a suitable target for antibody-mediated delivery of therapeutic siRNAs to MCL.
  • siRNA-LNPs coated with an anti-CD38 monoclonal antibody showed specific MCL binding in vitro (in MCL cell lines and MCL primary lymphomas) and in vivo (in mice xenografted with a human MCL cell line) (Weinstein et al., PNAS 113(1): E16-22, 2016), where THB-7 mAb was chemically conjugated to the MC3 LNPs.
  • THB-7 based lipidated scFv THB-7 based lipidated scFv (THB-7-LAND) was prepared similarly to Erbitux-LAND “LAND with Primary scFv Targeting” based on Figure 1C.
  • the sequence of the THB-7 LAND open reading frame is set forth in SEQ ID No. 7 (DNA sequence) and SEQ ID No. 8 (amino acid sequence).
  • the lipidated THB-7 scFv were incorporated into EA- PIP LNPs and evaluated for their binding to CD38 + Z138 (MCL) and CAG (MM) cells by flow cytometry.
  • SEQ ID No. 7 THB-7-LAND (anti-CD38) (LAND with Primary scFv Targeting) coding DNA sequence:
  • SEQ ID No. 8 THB-7-LAND (anti-CD38) (LAND with Primary scFv Targeting) Amino acids sequence:
  • the cell lines CAG and Z138
  • the targeting moiety THB-7 LAND Isotype control: RG7 LAND LNPs: EA-PIP lipid (+Cy5 fluorescently-labeled siRNA)
  • RG7-LAND and THB-7-LAND proteins were added at 40 ng/ml (for Z138 cells) and at 60 ng/ml (for CAG cells) to EA-PIP/Cy5 LNPs. The tubes were vortexed briefly and incubated for 48 h at 4°C.
  • Cells were washed with PBS (0.5-1 million cells/sample) and spun at 300xg for 5 min. Cells were then incubated with full medium, containing one of the following: RG7-LAND -LNPs, THB-7-LAND-LNPs, or LAND micelles for 20 min on ice. Cells were washed with PBS. 1 pg of anti His-PE antibody diluted in FACS buffer (1% BSA + PBS) was added to the cells incubated with LAND micelles and incubated for 30 min on ice. Cells were washed with PBS and flow cytometry was carried out (Cy5 channel was read).
  • Example 4 evaluates additional LAND constructs, (in which the linkers do not encode a separate functional protein (e.g. detectable protein)) and their potential for therapeutic applications.
  • Example 4 is representative of Figure “ID” and “IE”.
  • LAND expression vectors are constructed by replacing the mCherry coding sequence pET30a RG7 expression plasmid with the coding sequence of a 45 amino acids long linker, as shown schematically in Figure ID and I E.
  • the sequence of the RG7-LAND “long linker” of 69 amino acids spans between the lipidation peptide to the scFv (Linker #5 in Figures ID and IE); (SEQ ID No. 10 protein sequence, SEQ ID NO: 9 DNA sequence).
  • SEQ ID No. 15 is an exemplary Erbitux-LAND “long linker” (anti-human EGFR) coding DNA sequence.
  • SEQ ID No. 16 is an exemplary Erbitux- LAND “long linker” (anti-human EGFR) Amino acid sequence.
  • the RG7-LAND “long linker” protein was expressed in E. coli and purified by His- Trap Ni-NTA chromatography as described above for the other LAND proteins.
  • the purified RG7-LAND and RG7-LAND “long linker” in OG micelles were evaluated for binding Fib504 (a rat IgG2a anti human P7 integrin, to which the RG7 scFv binds) by ELISA.
  • the ELISA was carried out as follows: 96-well ELISA plates (Nunc, Sweden) were coated with 5 pg/ml of antigen (Fib504 rat IgG2a, to which RG7 binds) diluted in PBS for ON at 4°C.
  • the ELISA was developed with TMB peroxidase-substrate solution until color developed. Color development was terminated with the addition of 1 M H2SO4 and the absorbance was measured at 450 nm by EMax® Plus microplate reader (Molecular Devices, USA).
  • EA-PIP LNPs were prepared with RG7-LAND or with RG7-LAND “long linker”. Their binding to TK-1 cells (expressing P7 integrin) in the presence of the Fib504 (anti- P7 integrin) rat IgG2 or in the presence of an isotype control was evaluated by flow cytometry. The flow cytometry was carried out as described above in Example 1 with the following differences: Cells were not activated by Mn 2+ but instead were incubated with LNPs or OG micelles in full medium (containing 10% FBS). The results are shown in Figure 13.
  • RG7-LAND “long linker” (marked in Figure 13 as “LL FIB) bound better compared to RG7-LAND (marked in Figure 13 as “WT FIB), further suggesting successful design of the long linker in terms of functionality of the LAND with a “long linker” protein in antigen binding.
  • Tumor cells expressing one of the Primary scFV listed in Table 1 were used for targeting but instead of carrying PLK1 siRNA and controls, they delivered an mRNA encoding the CRISPR base editor BE3 with guide RNAs for PLK1 regions to convert CAA, CAG, CGA, and TGG codons into STOP codons when the targeted bases are at the correct distance (13-17 bps) from a protospacer adjacent motif (PAM).
  • the following guide RNAs, genomic coordinates, and target codons for PLK1 were utilized — the lower case base in the PAM:NGG column denotes the targeted base for editing:
  • Control groups include LNPs omitting or with irrelevant guide RNAs or with uncoated LNPs or LNPs with lipidated isotype control scFV.
  • the methods for preparing the anti-tumor scFV LAND LNPs are described in Examples 1-4 while the methods for performing the cell viability assays are described in Example 2. Consistent with experiments in Example 2, LAND with Primary scFv Targeting shows statistically significant increased efficacy compared to controls demonstrating the utility of LAND for gene editing applications incorporating deactivated CRISPR/Cas systems such as base editors.
  • a MCL Z138 tumor cell viability assay was carried out with anti-CD38 scFV LAND LNPs carrying a mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a single guide RNA for SOX11 which is cancer promoting gene in MCL.
  • Control groups consisted of untreated MCL Z138 cells and treatment with identically prepared anti-CD38 scFV LAND LNPs but with single guide RNAs to irrelevant target genes (GFP and HPRT). The following single guide RNAs were utilized: i.SOXl l - SEQ ID No. 38 GGCGGTGCCAAGACCTCCAA ii.PLKl - SEQ ID No.
  • Example 3 The methods for preparing the anti-CD38 scFv LAND LNPs are described in Example 3 while the methods for performing the cell viability assays are described in Example 2.
  • Figure 14 there is a statistically significant decrease in viability for the MCL tumor cells treated with CD38-LNP(sgSOX11) compared to all of the control treatments demonstrated by ANOVA (p ⁇ 0.05).
  • cell viability was less than 10% compared to greater than 90% in the control CD38-LNP(sgGFP), CD38-LNP(sgHPRT) and untreated groups.
  • LAND Primary scFv Targeted LNPs can deliver CRISPR/Cas gene editing components to suppress the function of a gene that promotes tumor growth for efficacious tumor therapy.
  • CD33 positive disorders including but not limited to acute myelogenous leukemia (AML) and myelodysplastic syndromes (MDS)
  • AML acute myelogenous leukemia
  • MDS myelodysplastic syndromes
  • HL60 or MV4-11 tumor cell viability assays are carried out with anti-CD33 scFv LAND LNPs carrying a mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a single guide RNA for PLK1 which is an essential gene in AML and MDS.
  • Control groups consisted of untreated HL60 and MV4-l lcells and treatment with identically prepared anti-CD33 scFv LAND LNPs but with single guide RNAs to irrelevant target genes (GFP and HPRT).
  • the methods for preparing the anti-CD33 scFv LAND LNPs are described in Example 3 while the methods for performing the cell viability assays are described in Example 2.
  • IV treatment is initiated after tumor establishment 10 and 15 days after tumor inoculation with LAND LNPs prepared as described in Example 3 at a dose of 0.5 mg/kg containing a Cas9 mRNA and single guide RNA for SOX11— CD38- LNP(sgSOXl l).
  • Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs.
  • control LNP vectors are CD38-targeted LNPs containing a Cas9 mRNA and single guide RNA for green fluorescent protein (GFP)— CD38- LNP(sgGFP); Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for SOX11— Iso-LNP(sgSOXl 1) and Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for GFP— Iso-LNP (sgGFP).
  • GFP green fluorescent protein
  • CD33 positive disorders including but not limited to acute myelogenous leukemia (AML) and myelodysplastic syndromes (MDS)
  • AML acute myelogenous leukemia
  • MDS myelodysplastic syndromes
  • IV treatment is initiated after tumor establishment 10 and 15 days after tumor inoculation with LAND LNPs prepared as described in Example 3 at a dose of 0.5 mg/kg containing a Cas9 mRNA and single guide RNA for PLK1 — CD33-LNP(sgPLKl).
  • Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs.
  • control LNP vectors are CD33- targeted LNPs containing a Cas9 mRNA and single guide RNA for green fluorescent protein (GFP)— CD33-LNP(sgGFP); Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for PLK1— Iso-LNP(sgPLKl) and Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for GFP— Iso-LNP (sgGFP).
  • GFP green fluorescent protein
  • DOX doxorubicin
  • genomic DNA was extracted from MCL tumor cells and normal liver cells and analyzed for INDELs by next generation sequencing (NGS).
  • Genomic DNA from single-cell suspension sections of MCL (GFP + 005) cells was extracted with QuickExtract DNA Extraction Solution (Lucigen Inc.) using the manufacturer’s protocol, and amplification was performed using locus -specific primers containing universal tails to add sample-unique P5 and P7 indexes for Illumina sequencing in two rounds of polymerase chain reaction (PCR). Following PCR, a lx SPRI (Solid Phase Reversible Immobilization) bead cleanup and library quantification by quantitative PCR (IDT) were performed before sequencing. PCR amplicons were sequenced on an Illumina MiSeq instrument [v2 chemistry; 150-base pair (bp) paired-end reads; Illumina, San Diego, CA, USA].
  • IDT quantitative PCR
  • Data were analyzed using a custom-built pipeline. Data were demultiplexed (Picard tools v2.9; githubdotcom/broadinstitute/picard); forward and reverse reads were merged into extended amplicons (flash v 1.2.11); reads were aligned against the GRCh38 genomic reference (bwa mem vO.7.15), assigned to targets (bedtools tags v2.25). Reads, with more than 30% of bases with quality target, custom python identified INDELs based on gapped alignments between reads and targets, and editing was calculated as the percentage of total reads containing an INDEL within an 8-bp window of the cut site.
  • the superiority of LAND compared to standard chemical conjugation antibody LNP targeting methods was also demonstrated for gene editing treatment in vivo.
  • an additional treatment group was tested utilizing anti-CD38 targeted LNPs prepared using chemical conjugation methods.
  • the chemically conjugated CD38 targeted LNPs (chemical CD38- LNPs-sgSOXl l) utilized the identical lipids, Cas9 mRNA and SOX11 sgRNA as described in Figure 16 A. Chemical conjugation of the anti-CD38 to the LNPs was performed as previously described in Tarab-Ravski et al 2023.
  • anti-human CD38 IgG antibody (clone THB-7, BioXCell) was reduced with 1 x 10 3 m dithiothreitol (Sigma-Aldrich) and 5 x 10 3 m EDTA (Sigma- Aldrich) for 1 h at room temperature.
  • Dithiothreitol was later removed by using 7K Zeba spin desalting column (ThermoFischer Scientific) according to manufacturer protocol and the reduced antibody was immediately added to the LNPs at a ratio of 1:40.7 antibody to LNPs (mg/mg) and incubated for 2 h at room temperature with gentle shaking and overnight at 4 °C.
  • LNPs were loaded on CL4B Sepharose beads (Sigma- Aldrich) and purified by gravity fed gel filtration chromatography column (BioRad Laboratories) using PBS as a mobile phase. The fractions were collected with a FC-203B fraction collector (Gilson) and the anti-CD38 LNP fractions were collected and concentrated with 100K Amicon tubes (Millipore) to original volume. IV treatment with chemical CD38-LNPs-sgSOXl l was similarly initiated after tumor establishment at a dose of 2.0 mg/kg and the results compared to those obtained with the same treatment groups described in Figure 16A.
  • liver toxicity and the percentage of gene editing was evaluated in normal hepatocytes following in vivo administration in normal mice.
  • anti-EGFR LAND LNPs at a dose of 2.0 mg/kg containing a Cas9 mRNA and single guide RNA for PLK1— EGFR-LNP(sgPLKl) was administered IV.
  • Control groups include untreated animals and LNP vectors with irrelevant GFP sgRNAs as described for Figure 15.
  • Serum liver enzyme levels and the percentage of gene edited liver hepatocytes and macrophages are determined as described in Figure 16.
  • Example 17 the percentage of liver edited cells was low and there was no significant difference between the anti-EGFR LAND LNPs with single guide RNA for PLK1— EGFR-LNP(sgPLKl) and control groups treated with anti-EGFR LAND LNPs with single guide RNA for an irrelevant sgRNA to GFP as described for Figure 16. There was no negative effect on serum liver enzymes which are similar in all treatment groups to untreated animals.
  • the results in Example 7 ( Figure 16) and Example 8 ( Figure 17) utilizing LAND constructs to very different antibody targets revealed very high levels of specific gene editing with minimal effects in normal tissues supporting the general applicability of the technology.
  • the cellular and disease models are representative of clinical tissue and cellular targets that are suitable for LAND treatments.
  • the in vivo disease models are highly aggressive and known to be generally resistant to conventional therapies.
  • the statistically superior efficacy of LAND antibody targeted LNP compositions and methods (which have one antigen binding site per targeting molecule) are unexpected compared to ASSET and chemically conjugated antibody targeted LNPs which have two antigen binding sites per targeting molecule.
  • the statistically superior efficacy of LAND is demonstrated for a broad range of RNA therapeutics including but not limited to siRNA, mRNA, and gene editing treatments for a wide variety of antigen targets and diseases.
  • Figure IF illustrates the system used in Examples 8 and 9.
  • the vector in this system comprised two expression cassettes, each controlled separately at the transcriptional level by a T7 promoter, a configuration known by the name “pET-Duet” (biocomparedotcom/Product- Reviews/40993-Co-expression-with-pETDuet-l -Duet-Expression-System- From-Novagen/).
  • pET-Duet biocomparedotcom/Product- Reviews/40993-Co-expression-with-pETDuet-l -Duet-Expression-System- From-Novagen/.
  • the light chain that contains the C-terminal HIS-tag is exported to the periplasmatic space as a soluble protein and assembles with the heavy chain part to form a Fab. Only a complete Fab that contains both the lipidated heavy chain (Fd) part assembled with the light chain can be extracted from the membrane fraction using detergent and purified by Ni-NTA affinity chromatography. Free light chain protein is removed as part of the soluble fraction before detergent extraction, while free Fd does not contain a HIS-tag, so does not bind to the Ni-NTA column.
  • Fd lipidated heavy chain
  • the first expression cassette for preparing a Fab contains the protein-coding part the NlpA leader sequence (SEQ ID NO: 20), the lipidation sequence (SEQ ID NO: 17), l laa linker 1 (SEQ ID NO: 18), mCherry as the “functional protein (SEQ ID NO: 22), 28aa linker #4 (SEQ ID NO: 6), the VH of Erbitux and a CHI domain of human IgGl constant domain.
  • the sequence of the Erbitux-Fab-LAND open reading frame of the heavy chain part is set forth in SEQ ID No. 23 (DNA sequence) and SEQ ID No. 24 (amino acid sequence).
  • the second expression cassette for preparing a Fab contains in the protein-coding part of a pelB leader sequence followed by the open reading frame of Erbitux kappa light chain, ending with a hexa-histidine tag (to allow purification by Ni-NTA affinity chromatography.
  • the sequence of the Erbitux-Fab-LAND open reading frame of the light chain part is set forth in SEQ ID No. 26 (DNA sequence) and SEQ ID No. 27 (amino acid sequence).
  • the Erbitux- Fab-LAND protein was produced and purified as described in the general protocol above and tested for functionality by flow cytometry.
  • the first expression cassette for preparing a Fab contains the protein-coding part the NlpA leader sequence (SEQ ID NO: 20), the lipidation sequence (SEQ ID NO: 17), l laa linker 1 (SEQ ID NO: 18), mCherry as the “functional protein (SEQ ID NO: 22), 28aa linker #4 (SEQ ID NO: 6), the VH of THB-7 and a CHI domain of human IgGl constant domain.
  • THB-7-Fab-LAND open reading frame of the heavy chain part is set forth in SEQ ID No. 27 (DNA sequence) and SEQ ID No. 28 (amino acid sequence).
  • the sequence of the Erbitux-Fab-LAND open reading frame of the light chain part is set forth in SEQ ID No. 29 (DNA sequence) and SEQ ID No. 30 (amino acid sequence).
  • the THB-7- Fab-LAND protein was produced and purified as described in the general protocol above and tested for functionality by flow cytometry.
  • the second expression cassette for preparing a Fab contains in the protein-coding part of a pelB leader sequence followed by the open reading frame of Erbitux kappa light chain, ending with a hexa-histidine tag (to allow purification by Ni-NTA affinity chromatography.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dispersion Chemistry (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention provides delivery system compositions comprising self- assembling lipid nanoparticles for targeted delivery of therapeutic or diagnostic agents to target cells. The particles are non-covalently attached to a lipidated antibody or antibody fragment which comprises an antibody or antibody fragment attached, via a peptide linker, to a lipidated peptide portion, wherein the antibody or antibody fragment is at the distal end from the nanoparticle.

Description

SELF-ASSEMBLING LIPID NANOPARTICLES FOR TARGETED DELIVERY OF THERAPEUTIC AGENTS
RELATED APPLICATION/S
This application claims the benefit of priority of U.S. Provisional Patent Application No. 63/423,069 filed on November 7, 2022, the contents of which are incorporated herein by reference in their entirety.
SEQUENCE LISTING STATEMENT
The XML file, entitled 97717 Sequence Listing.xml, created on November 7, 2023, comprising 377,564 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates to self-assembling lipid nanoparticles for targeted delivery of nucleic acids, proteins and drugs. The present invention further relates to methods of use of the self-assembling lipid nanoparticles, in particular in RNA therapeutics.
BACKGROUND OF THE INVENTION
In the field of nanomedicine, lipid nanoparticles (LNPs) are becoming more prevalent as means for delivering various active agents, including nucleic acids such as siRNA and mRNA. The recent approval of the first RNAi-based drug, Onpattro™ (Patisiran) by the FDA, and the RNA vaccines recently deployed during the COVID- 19 pandemic are present manifestations of the use of LNPs in RNA therapeutics.
Targeted drug carriers such as immuno-liposomes or immuno-lipid-based nanoparticles (targeted LNPs, tLNPs) are typically constructed by chemical conjugation of the targeting moiety to the drug (or nucleic acid)-carrying delivery system. This process requires large amounts of antibodies for each conjugation and requires adjustments when using different antibodies, typically due to the deleterious effects of the conjugation on the functionality of the antibody. In addition, chemical conjugation results in the insertion of the targeting antibodies in random orientation. Thus, a portion of the antibodies are typically conjugated such that they expose their Fc part to the surrounding environment, risking immunogenicity and engulfment by phagocytic cells.
To overcome such limitations, a novel strategy for preparing antibody-targeted LNPs in an oriented fashion was previously presented. The strategy, termed ASSET (anchored secondary scFv enabling targeting), is a self-assembled modular platform that enables the construction of targeted nanocarriers with no conjugation chemistry involved. The self- assembly of the platform is based on a membrane-anchored, lipidated single-chain antibody fragment (scFv) derived from a secondary antibody, that is incorporated into therapeutic agent-loaded lipid nanoparticles. These particles then interact with the crystallizable fragment (Fc) domain of a primary antibody, forming a stable complex that binds specifically via the primary antibody to target cells that express the target of the primary antibody on their surface (Kedmi et al., Nat. Nanotechnol. 13(3): 214-219, 2018; WO 2018/015881). The therapeutic potential of the ASSET platform was successfully demonstrated for the delivery of siRNA, mRNA and gRNA to target cells, affecting phenotypic changes of the cells (Veiga et al., Nature Comm. 9: 4493, 2018;Veiga et al., JCR 313: 33-41, 2019, Rosenblum et al., Sci. Adv. 6: eabc9450, 2020).
There is an unmet need for an additional delivery platform for targeted delivery of therapeutic agents to target cells.
SUMMARY OF THE INVENTION
The present invention provides a delivery system composition termed Lipidated Antibody Nanoparticle Delivery, i.e., LAND and use thereof for delivering therapeutic agents such as nucleic acids to target cells. The delivery system utilizes an antibody which serves as a cell-targeting moiety. The antibody is anchored to a lipid-based nanoparticle via a lipidated peptide portion and a peptide linker containing at least 40 amino acids which confer unexpected advantages of effective binding to a target cell. In some embodiments, the linker is a combination of functional protein, linker and spacer sequences. The system of the present invention overcomes the limitations of previous compositions and methods and represents a significant development of precision medicine.
The present invention is based, in part, on the unexpected finding that extension of the distance between the lipid nanoparticle and the antibody by using a linker (e.g. one containing at least 40 amino acids), provides superior efficacy in transducing target cells. In particular, the LAND platform according to the principles of the present invention was shown to transduce target cells to a greater extent as compared with ASSET. It is generally appreciated that scFv antibodies which have a single antigen binding site have lower binding efficiencies compared to complete IgG antibodies which have two antigen binding sites. Surprisingly, LAND constructs incorporating primary scFv antibody targeting with a single antigen binding site demonstrated significantly enhanced efficacy compared to primary IgG antibody targeting via ASSET which contains two antigen binding sites. Thus, the self-assembled modular platform of the present invention enables the construction of a wide repertoire of targeted nanocarriers, particularly suitable for RNA therapeutics.
According to one aspect, there is provided a delivery system composition for delivering a therapeutic agent to a target cell, wherein the delivery system comprises a lipid nanoparticle, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker and a lipidated antibody or a fragment thereof, wherein the linker is fused to the lipidated antibody or a fragment thereof and a fusion protein is non-covalently attached to the lipid nanoparticle through the anchoring lipid so that the lipidated antibody or a fragment thereof is at the distal end from the nanoparticle. In one embodiment the linker comprises a peptide or protein having at least 40 amino acids residues.
According to another aspect, there is provided a composition for delivering a therapeutic or diagnostic agent to a target cell comprising: a lipid nanoparticle encapsulating a therapeutic or diagnostic agent, a primary antibody non-covalently attached to the lipid nanoparticle via a lipidated peptide portion, and a peptide linker attached directly to the primary antibody at one terminus of a linker and the lipidated peptide portion attached to another terminus of the linker, wherein the antibody or antibody fragment is at the distal end from the nanoparticle and binds a target antigen on a target cell.
According to another aspect, there is delivery system composition for delivering a therapeutic or diagnostic agent to a target cell, wherein the delivery system comprises: a lipidated antibody which comprises an antibody attached, via a peptide linker, to a lipidated peptide portion, wherein the peptide linker comprises at least 40 amino acid residues; and a lipid nanoparticle which comprises the therapeutic or diagnostic agent, wherein the lipidated antibody is non-covalently attached to the lipid nanoparticle via the lipidated peptide portion.
According to still another aspect, there is provided a method of delivering a therapeutic or diagnostic agent to a subject in need thereof, the method comprising administering to the subject the composition or delivery system described herein, thereby delivering the therapeutic or diagnostic agent to the subject.
According to still another aspect, there is provided a method for treating a medical condition in a subject in need thereof, the method comprising the step of administering to the subject a therapeutically effective amount of the composition or delivery system described herein, wherein the agent is a therapeutic agent, thereby treating the medical condition. According to still another aspect, there is provided a method of diagnosing a medical condition in a subject comprising administering to the subject an effective amount of the composition or delivery system described herein, wherein the agent is a diagnostic agent, thereby diagnosing the medical condition.
According to still another aspect, there is provided a use of the composition or delivery system described herein, for diagnosing or treating a medical condition.
According to embodiments of the invention, the lipidated peptide portion comprises an inner membrane lipidation signal.
According to embodiments of the invention, the lipidated peptide portion of said antibody comprises the first two amino acids encoded by the E. coli NlpA gene or the first six amino acids encoded by the E. coli NlpA gene.
According to embodiments of the invention, the lipidated peptide portion of said antibody is comprised in an inner membrane lipoprotein or fragment thereof selected from the group consisting of: AraH, MglC, MalF, MalG, Mai C, MalD, RbsC, RbsC, ArtM, ArtQ, GliP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E,Dpp B, DppC, OppB,AmiC, AmiD, BtuC, FhuB, FecC, FecD,FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC,PotH, Poti, ModB, NosY, PhnM, LacY, SecY, TolC, Dsb,B, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB and Aas.
According to embodiments of the invention, the peptide linker comprises between 40-400 amino acid residues.
According to embodiments of the invention, the peptide linker comprises between 40-300 amino acid residues.
According to embodiments of the invention, at least 30 % of the amino acid residues of the peptide linker are glycines or serines.
In one embodiment, the linker comprises a peptide or protein having 40-400 amino acids residues, including each integer within the specified range. In another embodiment, the linker comprises a peptide or protein having 40-300 amino acids residues, including each integer within the specified range. In yet another embodiment, the linker comprises a peptide or protein having 40- 200 amino acids residues, including each integer within the specified range. In further embodiments, the linker comprises a peptide or protein having 40-100 amino acids residues, including each integer within the specified range. In particular embodiments, the linker comprises a peptide having a sequence as set forth in SEQ ID No. 11. In another particular embodiment, the linker comprises a peptide having a sequence as set forth in SEQ ID No. 12.
In some embodiments, the antibody or a fragment thereof is a primary antibody or a primary antibody fragment comprising an antigen recognition domain capable of binding an antigen expressed by a target cell. In other embodiments, the antibody or a fragment thereof is humanized or human primary antibody or an antibody fragment or a chimeric antibody or a nanobody, collectively termed primary antibody or antibody fragment. In particular embodiments, the primary antibody or primary antibody fragment is selected from the group consisting of anti- CD44, anti-CD34, anti-CD38, anti-Ly6C, anti-CD3, anti-CD4, anti-CD8, anti-CD25, anti- CD47, anti-CD117, anti-CD147, anti-EGFR and anti-integrin P? antibodies. Each possibility represents a separate embodiment. In other embodiments, the primary antibody or primary antibody fragment is capable of binding an antigen listed in Table 1. In alternative embodiments, the antibody is a secondary antibody comprising an antigen recognition domain capable of specifically binding a primary antibody. In other embodiments, the antibody is a secondary antibody comprising an antigen recognition domain capable of specifically binding a humanized or human primary antibody. In further embodiments, the antibody is a monoclonal antibody. In additional embodiments, the antibody is lipidated at its N-terminus.
In other embodiments, the antibody fragment is selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, dsFv, and a nanobody. Each possibility represents a separate embodiment. In one embodiment, the antibody fragment is scFv. In yet other embodiments, the antibody is selected from the group consisting of IgGl, IgG2, IgG3, and IgG4. Each possibility represents a separate embodiment. In certain embodiments, the antibody comprises a nanobody that is monovalent or multivalent.
In various embodiments, the lipid nanoparticle comprises at least one of an ionizable lipid, a stabilizing lipid, a helper lipid, and a PEG-lipid. Each possibility represents a separate embodiment.
In certain embodiments, the lipid nanoparticles comprises an ionizable lipid selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, N,N-dimethyl- N',N'- di[(9Z, 12Z)-octadeca-9,12-dien-l-yl] ethane- 1,2-diamine, 2-(di((9Z,12Z)-octadeca- 9,12-dien-l- yl)amino)ethyl 4-(4-methylpiperazin-l-yl)propanoate (EA-PIP), Di-oleyl- succinyl-serinyl- tobramycin, Di-oleyl-adipyl-tobramycin, Di-oleyl- suberyl-tobramycin, Di-oleyl- sebacyl- tobramycin, Di-oleyl-dithioglycolyl-tobramycin, monocationic lipid N-[l-(2,3- Dioleoyloxy)] - N,N,N-trimethylammonium propane (DOTAP), BCAT O-(2R-l,2-di-O-(l'Z, 9'Z- octadecadienyl)-glycerol)-3-N-(bis-2-aminoethyl)-carbamate, BGSC (Bis-guanidinium- spermidine-cholesterol), BGTC (Bis-guanidinium-tren-cholesterol), CDAN (N1 -cholesteryl oxycarbony l-3,7-diazanonane-l,9-diamine), CHDTAEA (Cholesteryl hemidithiodiglycolyl tris(amino(ethyl)amine), DCAT (O-(l ,2-di-O-(9'Z-octadecanyl)-glycerol)-3-N-(bis-2- aminoethyl )-carbamate), DC-Chol (3p [N-(N', N'-dimethylaminoethane)-carbamoyl] cholesterol), DLKD (O,O'-Dilauryl N-lysylaspartate), DMKD (O,O'-Dimyristyl N- lysylaspartate), DOG (Diolcylglycerol, DOGS (Dioctadecylamidoglycylspermine), DOGSDSO (l,2-Dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl disulfide ornithine), DOPC (1,2-Dioleoyl- sn-glycero-3-phosphocholine), DOPE (l,2-Dioleoyl-sn-glycerol-3- phosphoethanolamine, DOSN (Dioleyl succinyl ethylthioneomycin), DOSP (Dioleyl succinyl paromomycin), DOST (Dioleyl succinyl tobramycin), 1,2- Uiolcoyl-3-trimethyl ammoniopropane, DOTMA (N'[l-(2,3- Dioleyloxy)propyl]-N,N,N-trimethvlammonium chloride), DPPES (Di-palmitoyl phosphatidyl ethanolamidosperminc), DDAB and DODAP, or any combination thereof. Each possibility represents a separate embodiment.
In other embodiments, the ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, 2-(di((9Z,12Z)-octadeca-9,12-dien-l- yl)amino)ethyl 4-(4-methylpiperazin-l-yl)propanoate (EA-PIP), Di-oleyl-succinyl-serinyl- tobramycin, Di-oleyl-adipyl-tobramycin, Di-oleyl- suberyl-tobramycin, Di-oleyl- sebacyl- tobramycin, N,N-dimethyl-N',N'-di[(9Z, 12Z)-octadeca-9,12-dien-l-yl] ethane- 1,2-diamine and Di-oleyl-dithioglycolyl-tobramycin, or any combination thereof. Each possibility represents a separate embodiment. Additional ionizable lipids are disclosed in WO 2018/087753 and WO 2022/168085, the contents of which are disclosed herein in their entirety.
In some embodiments, the stabilizing lipid is selected from the group consisting of cholesterol, phospholipids (such as, phosphatidylcholine (PC)), cephalins, sphingolipids and glycoglycerolipids, or combinations thereof. Each possibility represents a separate embodiment.
In further embodiments, the helper lipid is selected from the group consisting of 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), 1 ,2-dilauroyl-L-phosphatidyl-ethanolamine (DLPE), l,2-Dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) 1,2-Diphytanoyl-sn- glycero- 3 -phosphoethanolamine (DPhPE) l,3-Dipalmitoyl-sn-glycero-2-phosphoethanolamine (1,3-DPPE) l-Palmitoyl-3-oleoyl-sn-glycero-2-phosphoethanolamine (1,3-POPE), Biotin-
Phosphatidylethanolamine,l,2-Dimyristoyl-sn-glycero-3- phosphoethanolamine (DMPE), 1,2- Distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), and
Dipalmitoylphosphatidylethanolamine (DPPE), or combinations thereof. Each possibility represents a separate embodiment.
In additional embodiments, the PEG-lipid is selected from the group consisting of DMG- PEG, PEG-cDMA, PEG-cDSA, DLPE-PEG, DSPE-PEG, 3-A-(-methoxy polyethylene glycol)2000)carbamoyl- 1 ,2-dimyristyloxy-propylamine; 3-A-(-methoxy poly(ethylene glycol)2000)carbamoyl-l,2-distearyloxy-propylamine, or combinations thereof. Each possibility represents a separate embodiment.
In particular embodiments, the lipid nanoparticle comprises an ionizable lipid (such as, for example, DLinDMA, DLinMC3-DMA or DlinKC2-DMA), a stabilizing lipid (such as, for example, cholesterol), a helper lipid (such as, for example DSPC or DOPE), and a PEG-lipid (such as, for example DMG-PEG).
In some embodiments, the lipid nanoparticle comprises about 30-70% (mol%) of an ionizable lipid, including each value within the specified range. In other embodiments, the lipid nanoparticle comprises about 30-50% (mol%) of a stabilizing lipid, including each value within the specified range. In further embodiments, the lipid nanoparticle comprises about 5-20% (mol%) of a helper lipid, including each value within the specified range. In additional embodiments, the lipid nanoparticle comprises about 0.5-5% (mol%) of a PEG-lipid, including each value within the specified range.
In various embodiments, the lipid nanoparticles have a particle size (diameter) in the range of about 1 to about 500 nm, including each value within the specified range. In other embodiments, the lipid nanoparticles have a particle size in the range of about 1 to about 300 nm, including each value within the specified range. In yet other embodiments, the lipid nanoparticles have a particle size in the range of about 1 to about 200 nm, including each value within the specified range. In particular embodiments, the lipid nanoparticles have a particle size in the range of about 1 to about 100 nm, including each value within the specified range.
In certain embodiments, the anchoring lipid comprises a glycerolipid. In particular embodiments, the anchoring lipid comprises a di-substituted glycerolipid. In other particular embodiments, the anchoring lipid is attached to the fusion protein via a cysteine residue.
In various embodiments, the delivery system composition further comprises a detectable moiety.
In other embodiments, the delivery system composition further comprises an affinity tag.
In some embodiments, the therapeutic agent is encapsulated within the lipid nanoparticle.
According to another aspect, there is provided a method of delivering a therapeutic agent to a subject in need thereof, the method comprising administering to the subject a delivery system composition comprising a lipid nanoparticle encapsulating a therapeutic agent, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker and a lipidated antibody or a fragment thereof, wherein the linker is fused to the lipidated antibody or a fragment thereof and the fusion protein is non-covalently attached to the lipid nanoparticle through the anchoring lipid so that the lipidated antibody or a fragment thereof is at the distal end from the nanoparticle, and wherein the linker comprises a peptide or protein having at least 40 amino acids residues.
In one embodiment, the weight ratio between the therapeutic agent and the lipid nanoparticle is in the range of about 1:50 to 50:1, including all iterations of ratios within the specified range. In another embodiment, the weight ratio between the therapeutic agent and the lipid nanoparticle is in the range of about 1:1 to 1:25, including all iterations of ratios within the specified range. In yet another embodiment, the weight ratio between the therapeutic agent and the lipid nanoparticle is in the range of about 45:1 to 1:1, including all iterations of ratios within the specified range.
In some embodiments, administering is performed via a locoregional route/inj ection (for example, intramuscular (IM), intraperitoneal (IP), intra-tumoral, intradermal, intravesicular, intratracheal, intrathecal, intradermal or subcutaneous (SC) administrations). In various embodiments, the administration is systemic (for example intravenously or intraarterially). In several embodiments, the delivery system is administered as a pharmaceutical composition further comprising a pharmaceutically acceptable excipient comprising at least one of a surfactant, a suspending agent, and an emulsifying agent. Each possibility represents a separate embodiment.
In certain embodiments, the therapeutic agent is a nucleic acid or a polynucleotide.
In other embodiments, the therapeutic agent is an exome encoded DNA or an mRNA.
In yet other embodiments, the therapeutic agent is a non-exome encoded RNA. In particular embodiments, the non-exome encoded RNA is a microRNA, a long non-coding RNA (IncRNA), a long non- coding intergenic RNA (lincRNA), a pseudogene, a circular RNA (circRNA), a transfer RNA (tRNA) or an interfering RNA (siRNA and shRNA). Each possibility represents a separate embodiment.
In further embodiments, the therapeutic agent is a catalytically active or deactivated gene editing nuclease.
In specific embodiments, the catalytically active or deactivated gene editing nuclease is selected from a meganuclease, zinc finger nuclease (ZFN), transcription activator- like effectorbased nuclease (TALEN), transposase, integrase, mobile genetic element (MGE)-encoded recombinase, clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) nuclease and their related guide nucleic acids and targeting moieties. Each possibility represents a separate embodiment.
In other specific embodiments, the CRISPR associated (Cas) nuclease is Cas9, Cas 12a, Casl2b, Casl2e, Casl3, Casl3a, Casl3b, Casl4, Cas-theta, CasX, CasY or those listed in Table
6. Each possibility represents a separate embodiment.
In certain embodiments, the therapeutic agent is a gene editing agent including a base editor, prime editor, mobile genetic element gene writer.
In certain embodiments, the base editor is a cytosine base editor (CBE) or an adenine base editor (ABE) comprising but not limited to a catalytically inactive (dCas) or partially inactive (Cas nickase or nCas) Cas nuclease, cytidine deaminase, or adenosine deaminase and guide RNA that confers target sequence specificity.
In particular embodiments the base editor or gene editing agents are selected from but not limited to those listed in Tables 2 and 3.
In other embodiments the therapeutic agent is a prime editor comprised of a prime editing guide RNA (pegRNA) targeting sequence and RNA template, and a fusion protein consisting of Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme where the pegRNA guide template and Cas9 nickase directs the reverse transcriptase to the target site where a new DNA strand from the RNA template is inserted at the target site.
In certain embodiments, the therapeutic agent is a gene writer incorporating a mobile genetic element for sequence targeting combined with an engineered integrase or transposase to integrate nucleic acid sequences at the target sequence.
In particular embodiments, the therapeutic agent is a mobile genetic element gene writer incorporating CRISPR-Cas9 targeting elements combined with an engineered piggyBac transposase to integrate nucleic acid sequences at the target sequence.
In other embodiments, a donor DNA sequence is concurrently provided to either repair or insert a therapeutic DNA sequence. In particular embodiments, the delivered gene editing moieties knock out, repair or repress expression of deleterious or abnormal nucleic acid sequences. In other particular embodiments, the delivered gene editing moieties knock in, provide or increase expression of therapeutically beneficial nucleic acid sequences.
In various embodiments, the therapeutic agent is a catalytically deactivated CRISPR associated (Cas) protein or an mRNA fused to a transcriptional modifier.
In some embodiments, the mRNA fused to a transcriptional modifier is a transcriptional repressor. In other embodiments, the transcriptional repressor is a methyltransferase or histone deacetylase. In yet other embodiments, the transcriptional repressor is DNA methyltransferase 3A (DNMT3A), methyl-CpG-binding protein 2 (MeCP2), Kruppel-associated box (KRAB), MeCP2- KRAB, histone deacetylase 3 (HDAC3), Ezh2, SALL1 and/or SDS3. Each possibility represents a separate embodiment.
In certain embodiments, the mRNA fused to a transcriptional modifier is a transcriptional activator. In specific embodiments, the transcriptional activator is VP64, p65, Rta separately or combined (VPR), the synergistic activation mediator (SAM) activation system MS2-p65-HSFl, DNA demethylation moiety, or an acetyltransferase. Each possibility represents a separate embodiment.
In certain embodiments, the delivery system composition of the present invention is useful for knocking out, repairing or repressing expression of deleterious or abnormal nucleic acid sequences. In particular embodiments, the nucleic acid sequences that are knocked out, repaired or repressed include, but are not limited to, an essential gene, a growth promoting gene, an oncogene, an angiogenic gene, an immune suppressive gene, an anti- apopto tic gene, a therapy resistance gene, a dominant negative mutated gene, a mutated gene, a viral gene, a disease promoting miRNA, IncRNA, lincRNA, pseudogene, tRNA or circRNA targets including but not limited to those listed in Table 4 where each possibility represents a separate embodiment.
In other embodiments, the delivery system composition of the present invention is useful for knocking in, providing or increasing expression of therapeutically beneficial nucleic acid sequences. In particular embodiments, the beneficial nucleic acid sequences that are knocked in, provided or increased in expression include, but are not limited to, a tumor suppressor nucleic acid sequence, a pro-apoptotic nucleic acid sequence, an immune stimulatory nucleic acid sequence, an anti-angiogenic nucleic acid sequence, an anti-cancer nucleic acid sequence, a beneficial nucleic acid sequence silenced by hypermethylation or other epigenetic mechanisms, or a therapy sensitizing nucleic acid sequence including but not limited to those listed in Table 5. Each possibility represents a separate embodiment.
In yet other embodiments, the therapeutic agent is a protein, a ribonucleoprotein or a drug.
In further embodiments, the therapeutic agent is delivered to a cell. In particular embodiments, the therapeutic agent is delivered to a pre-malignant or malignant cell. In other embodiments, the therapeutic agent is delivered to a leukocyte cell. In yet other embodiments, the leukocyte cell is a primary lymphocyte. In some embodiments, the lymphocyte is selected from a B-cell and a T-cell. Each possibility represents a separate embodiment.
According to yet another aspect, there is provided a method for treating a medical condition in a subject in need thereof, the method comprising the step of administering to the subject a delivery system comprising a lipid nanoparticle encapsulating a therapeutic agent, an anchoring lipid embedded in the outer surface of the lipid nanoparticle, a linker and a lipidated antibody or a fragment thereof, wherein the linker is fused to the lipidated antibody or a fragment thereof and the fusion protein is non-covalently attached to the lipid nanoparticle through the anchoring lipid so that the lipidated antibody or a fragment thereof is at the distal end from the nanoparticle, and wherein the linker comprises a peptide or protein having at least 40 amino acids residues. In some embodiments, the medical condition is cancer or a pre- malignant disorder predisposing to cancer. In particular embodiments, the cancer is a solid tumor or a hematopoietic cancer. In other embodiments, the medical condition is an autoimmune or inflammatory disease, such as inflammatory bowel disease. In other embodiments, the medical condition is a monogeneic or polygenic genetic disease. In certain embodiments, the medical condition is a cardiovascular, respiratory, urogenital, neurological, endocrinological, gastrointestinal, immunological or musculoskeletal disorder. Each possibility represents a separate embodiment. In other embodiments, the medical condition is a disorder caused by an infectious agent.
In other embodiments, the delivery system composition of the present invention is employed for inhibition of the target nucleic acids or genes listed in Table 4. Each possibility represents a separate embodiment.
In other embodiments, the delivery system composition of the present invention is employed for the therapeutic expression of the target nucleic acids or genes listed in Table 5. Each possibility represents a separate embodiment.
In other embodiments, the delivery system composition of the present invention is employed for the correction or repair of the target nucleic acids or genes listed in Table 4, Table 5 or Table 7. Each possibility represents a separate embodiment.
In further embodiments, the LAND therapeutic construct is comprised of the amino acid sequence SEQ ID No. 13 MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGR followed by a functional protein followed by amino acid SEQ ID No. 1 ASGGSGGGKASGG followed by a “secondary” scFv sequence with specificity for the Fc fragment of the “primary” antibody with specificity for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acids linker AAAGSHHHHHH (SEQ ID NO: 19) is added at the end of the composition.
In further embodiments, the LAND therapeutic construct is comprised of the amino acid sequence (SEQ ID No. 13 MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGR followed by a functional protein followed by SEQ ID No. 6 ASGGSGGGKASGGGGGGSGGGGSGGGGS followed by a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acids linker AAAGSHHHHHH (SEQ ID NO: 19) is added at the end of the composition.
In further embodiments, the LAND therapeutic construct is comprised of the amino acid sequence SEQ ID No. 14
MKLTTHHLRTGAALLLAGILLAGCDQSSSGGGGSGGLSGRSAGKAEGSEGKSSGSGSES KSTVGSAGSAAGSGESGGSAGSAAASASGGSGGGKASGG followed by a “secondary” scFv sequence with specificity for the Fc fragment of the “primary” antibody with specificity for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid linker AAAGSHHHHHH (SEQ ID NO: 19) is added at the end of the composition.
In further embodiments, the EAND therapeutic construct is comprised of the amino acid sequence SEQ ID No. 14 followed by a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid linker AAAGSHHHHHH (SEQ ID NO: 19) is added at the end of the composition.
In further embodiments, the antibody comprises an amino acid sequence as set forth in SEQ ID NO: 5, 8, 24, 27, 28 or 30.
In addition to the exemplary aspects and embodiments described above, further aspects and embodiments will become apparent by reference to the figures and by study of the following detailed description.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
FIGs 1A-G Schematic illustration in Figure 1A-F of delivery systems according to embodiments of the invention and of prior art (ASSET) (G)
FIG. 1A is a general scheme of a delivery system whereby the lipidated peptide (LP) portion is separated from the antibody with a linker (for example of more than 40 amino acids) (B) primary IgG LAND; (C) primary scFv LAND; (D) long linker LAND (primary IgG targeting); (E) long linker LAND (primary scFv targeting) and (F) primary Fab LAND. “1” denotes primary IgG antibody targeting, “2” denotes primary scFv antibody targeting and “3” denotes primary Fab antibody targeting.
Without the intention of any limitation, representative descriptions of each of these delivery systems are provided below.
FIG. IB illustrates a representative example of a primary IgG LAND construct. This example is comprised of the lipidated peptide portion (amino acid sequence SEQ ID NO: 17 (CDQSSS), followed by linker 1 (SEQ ID NO: 18; GGGGSGGLSGR followed by a functional protein followed by linker 3 (SEQ ID No. 1; ASGGSGGGKASGG) followed by a “secondary” scFv sequence with specificity for the Fc fragment of the “primary” antibody with specificity for an antigen expressed on the cell type to be targeted for therapy. The amino acids of linker 1, functional protein and linker 3 make up the amino acids of the total linker. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19), is present at the C terminus.
FIG. 1C illustrates an exemplary construct which is comprised of the lipidated peptide portion (amino acid sequence SEQ ID NO: 17 (CDQSSS), followed by linker 1 (SEQ ID NO: 18 GGGGSGGLSGR) followed by a functional protein followed by linker 4 (amino acid SEQ ID No. 6 ASGGSGGGKASGGGGGGSGGGGSGGGGS) followed by a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy. The amino acids of linker 1, functional protein and linker 4 make up the amino acids of the total linker. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C- terminus.
FIG. ID illustrates an exemplary construct which is comprised of the lipidated peptide portion (amino acid sequence SEQ ID No. 17) followed by linker 5 GGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASASGG SGGGKASGG (SEQ ID NO: 12) followed by a “secondary” scFv sequence with specificity for the Fc fragment of the “primary” antibody with specificity for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.
FIG. IE illustrates an exemplary construct which is comprised of the lipidated peptide portion (amino acid sequence SEQ ID No. 17) followed by linker 5 GGGGSGGLSGRSAGKAEGSEGKSSGSGSESKSTVGSAGSAAGSGESGGSAGSAAASASGG SGGGKASGG (SEQ ID NO: 12) followed by a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy. In some embodiments, the amino acid sequence AAAGSHHHHHH (SEQ ID NO: 19) is present at the C-terminus.
FIG. IF illustrates an exemplary construct for the expression of a LAND in Fab antibody format. It is comprised of the lipidated peptide portion (amino acid sequence SEQ ID NO: 17), followed by an 11 amino acids long linker 1 (SEQ ID NO: 18), followed by a functional protein, followed by an additional linker, 20 amino acids long (linker 4; SEQ ID NO: 6) followed by a primary Fd heavy. The light chain part of the Fab is encoded by a sequence located on a separate DNA cassette and upon export to the E. coli periplasm associates with the Fd part to form the Fab which is covalently stabilized by an interchain disulfide bond. The Fab acts as the primary antibody, with specificity for an antigen expressed on the cell type to be targeted for therapy.
FIG. 1G illustrates a prior art ASSET construct which is comprised of the lipidated peptide portion (amino acid sequence SEQ ID NO: 17), followed by linker 1 (SEQ ID NO: 18), followed by a secondary antibody which is capable of binding to a primary antibody which has specificity for an antigen expressed on the cell type to be targeted, followed by an additional linker (linker 2; SEQ ID NO: 21) followed by functional protein.
FIG. 2 Analysis of fractions from purification of RG7 LAND protein. Aliquot from the Triton fraction (TF, 20 pg protein loaded), unbound fraction of the His-Trap column (Ni- FT, 20 pg protein loaded) and purified lipidated RG7 scFv (pure, 5 pg protein loaded) were separated on a 12% SDS/polyacrylamide gel. The arrow marks the position of the LAND protein. Representative gel out of 24 productions.
FIGs. 3A-B Comparison between rat IgG2a binding by RG7-LAND and RG7-ASSET by ELISA and FACS. (A) an ELISA plate was coated overnight (ON) at 4°C, half with Fib504 (rat IgG2a) and half with BSA. The plate was blocked with 300 pl/well of 3% MPBS 37°C, Ih. The plate was washed 3 times with PBST and the purified LAND or ASSET proteins were applied in triplicates, starting at 300 nM in PBST with serial 3 fold dilutions for Ih at RT. The plate was washed again and HRP-anti HIS/5000 in PBST was applied for Ih at RT. The plate was washed and 50 pl/well of TMB (Dako) were added. The color reaction was stopped after 5 min with 50 pl/well of IM H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). (B) binding of RG7- LAND and RG7-ASSET to TK-1 cells measured by flow cytometry on a CytoFLEX (Beckman Coulter, USA) in the presence of Fib504 mAb. US- unstained cells; Cy5 is the fluorescence of the encapsulated siRNA. Data are means of +SD of five independent experiments. Applied proteins: ASSET on rat IgG2a - marked by circles. ASSET on BSA - marked by diamonds. LAND on rat IgG2a - marked by triangles. LAND on BSA - marked by squares.
FIGs 4A-B Comparison between rat IgG2a anti-EGFR binding by RG7-LAND and RG7- ASSET by ELISA and FACS. (A) an ELISA plate was coated ON at 4°C, half with anti-hEGFR (rat IgG2a clone 30-F11, BioRad) and half with BSA (as a negative specificity control), both at 2 pg/ml in PBS, 50 pl/well. The plate was blocked with 300 pl/well of 3% MPBS 37°C, Ih. The plate was washed 3 times with PBS containing 0.05% Tween-20 (PBST) and the purified LAND or ASSET proteins were applied in triplicates, starting at 300 nM in PBST with serial 3 fold dilutions for Ih at RT. The plate was washed 3 times with PBST and HRP-anti HIS diluted x5000 in PBST was applied for Ih at RT. The plate was washed 3 times with PBST and 50 pl/well of TMB (Dako) were added. The color reaction was stopped after 8 min with 50 pl/well of IM H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). Error bars represent the SD of the data. Applied proteins: ASSET on EGFR - marked by circles. ASSET on BSA - marked by diamonds. LAND on EGFR - marked by triangles. LAND on BSA - marked by squares. (B) binding of RG7-LAND and RG7-ASSET incorporated to LNPs to OVCAR8 cells measured by flow cytometry (on a CytoFLEX (Beckman Coulter, USA) in the presence of an anti-hEGFR mAb. US- unstained cells; Cy5 is the fluorescence of the encapsulated siRNA. Representative histogram out of five independent preparations.
FIG. 5 In vitro binding of purified D1D2-Fc protein to TK-1 cells mediated by RG7- LAND compared to RG7-ASSET, measured by flow cytometry. LNPs associated with D1D2- Fc bind to TK- 1 cells only when they are associated with RG7 LAND but not with the RG7 ASSET. US- unstained cells; Cy5 is the fluorescence of the encapsulated siRNA. Representative histogram out of live independent preparations.
FIGs. 6A-C In vitro binding of Erbitux LAND “LAND with Primary scFv Targeting” to 0VCAR8 (EGFR+) cells measured by flow cytometry. (A) binding of purified Erbitux-LAND protein in OG micelles. (B) binding of EA-PIP LNPs into which purified Erbitux-LAND protein was integrated. (C) binding of MC3 LNPs into which purified Erbitux-LAND protein was integrated. US - unstained cells; ASSET-RG7 - RG7 LAND protein serving as negative control; ASSET-Erb - Erbitux LAND; mCherry in A is the fluorescence of the mCherry component of LAND. Cys5 in B and C is the fluorescence of the encapsulated siRNA. Representative histogram out of four independent preparations. Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P<0.0001.
FIG. 7 Competitive binding: In vitro binding of Erbitux-LAND to 0VCAR8 (EGFR+) cells measured by flow cytometry in the presence of Erbitux mAb as a competitor or in the presence of Avastin as an isotype control. US - unstained cells; EA-PIP LNPs - empty LNPs (into which no scFv was integrated); Avastin + Erb-LNPs - LNPs into which Erbitux-LAND was integrated incubated in the presence of the isotype control mAb Avastin; Erbitux + Erb-LNPs - LNPs into which Erbitux-LAND was integrated incubated in the presence of the mAb Erbitux. Cys5 is the fluorescence of the encapsulated siRNA. Representative histogram out of four independent preparations. Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P<0.0001.
FIGs. 8A-B The efficacy of LAND was compared to ASSET under conditions that minimized non-specific LNP internalization (4°C) and under standard conditions (37°C). Cell viability assay: 0VCAR8 cells were treated with EA-PIP LNPs in vitro for (A) Ih at 4°C with 2 pg/ml LNPs (where non-specific LNP internalization is minimized) or (B) under standard conditions at 37°C for 15 min with 0.2 pg/ml LNPs (where non-specific LNP internalization is not minimized). The cells were washed to remove LNPs that did not internalize, replenished with fresh medium and cultured for 72h, when cell viability was evaluated using an XTT assay. NC5 - negative control siRNA; PLK1- siPLKl; ASSET-EGFR - LNPs targeted by RG7-LAND protein with a rat IgG2a anti-hEGFR; ASSET-Iso - LNPs targeted by RG7-LAND protein with an isotype control rat IgG2a; Nip A- Erb - LNPs targeted by Erbitux-LAND; NlpA-RG7 - LNPs targeted by RG7-LAND protein without an added primary antibody. Error bars represent the SD of triplicates. Unexpectedly, as shown in Figure 8, under both conditions that minimized non-specific LNP internalization (4°C Figure 8A) and under standard conditions (37°C Figure 8B), LAND targeted LNPs (NlpA-Erb) demonstrated statistically significant increased efficacy compared to ASSET targeted LNPs (ASSET-EGFR) Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance (* p <0.05; ** p <0.01; ***p <0.005; ****p <0.001).
FIGs. 9A-B Tumor cell uptake in vivo'. OVCAR8 tumor-bearing athymic nude mice were injected intraperitonially with EA-PIP LNPs encapsulating siRNA labeled with Cy5 at 0.75 mg/kg. Tumors were harvested for analysis 4h post injection. (A) gating strategy: single cells suspensions processed from tumors were stained with mCD45-FITC to determine the ratio of mCherry+ cells positive for Cy5 (tumor cells that had LNP uptake) and the ratio of CD45+ cells positive for Cy5 (mouse leukocytes that had LNP uptake) by flow cytometry. (B) ratio of Cys5 positive cells in tumor cells or mouse leukocytes. ASSET-EGFR - LNPs targeted by RG7 LAND protein with a rat IgG2a anti-hEGFR; ASSET-Iso - LNPs targeted by RG7 LAND protein with an isotype control rat IgG2a; NlpA-Erb - LNPs targeted by Erbitux LAND protein; NlpA-RG7 - LNPs targeted by RG7 LAND protein without an added primary antibody. Error bars represent the SEM, N=4.
FIG. 10 PLK1 silencing by siRNA in tumors: OVCAR8 tumor-bearing athymic nude mice were injected intraperitoneally with EA-PIP LNPs encapsulating siRNA for PLK1 or negative control siRNA at 0.75 mg/kg. Tumors were harvested for analysis by 48h post injection. RNA was extracted from tumors and PLK1 mRNA levels were evaluated by RT- PCR, compared to human 3C gene as endogenous control. All samples were normalized to mock. NC5- negative control siRNA; PLK1- siPLKl ; ASSET-EGFR - LNPs targeted by RG7 LAND protein with a rat IgG2a anti-hEGFR; ASSET-Iso - LNPs targeted by RG7 LAND protein with an isotype control rat IgG2a; NlpA-Erb - LNPs targeted by Erbitux LAND protein; NlpA-RG7 - LNPs targeted by RG7 LAND protein without an added primary antibody. Error bars represent the SD, N=4.
FIGs. 11A-D In vitro binding of THB-7 LAND to Z138 (CD38+) and CAG (MM) cells measured by flow cytometry. (A) THB-7-LAND micelles, binding of purified THB-7-LAND protein in OG micelles to CAG cells. (B) NlpA-LNPs (EA-PIP), binding of EA-PIP LNPs integrated with purified THB-7-LAND protein to CAG cells. (C) THB-7-LAND micelles, binding of purified THB-7-LAND protein in OG micelles to Z138 cells. (D) NlpA-LNPs (EA- PIP), binding of EA-PIP LNPs integrated with purified THB-7-LAND to Z138 cells. US- unstained cells; ASSET-RG7 - RG7 LAND protein serving as negative control; ASSET-THB7 - THB-7- LAND. Anti-His PE in A and C is the fluorescence labeling of the His component of LAND. Cys5 in B and D is the fluorescence of the encapsulated siRNA. Representative histogram out of four independent preparations. Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P<0.0001.
FIGs. 12A-B Analysis of rat IgG2a and BSA binding by RG7-LAND compared to RG7- LAND “long linker” by ELISA. (A) an ELISA plate was coated ON at 4°C, half with Fib504 and half with BSA. The plate was blocked with 300 pl/well of 3% MPBS, 37°C, Ih. The plate was washed 3 times with PBST and the purified LAND proteins were applied in triplicates, starting at 300 nM in PBST with serial 3 fold dilutions for Ih at RT. The plate was washed again and HRP- anti HIS/5000 in PBST was applied for Ih at RT. The plate was washed and 50pl/well of TMB (Dako) was added. The color reaction was stopped after 3min with 50pl/well of IM H2SO4 and read at 450 nm using an Emax Plus microplate reader (Molecular Devices, USA). (B) the data of Fib504 binding from (A) plotted as the fraction of maximal binding signal. Representative histogram out of four independent preparations. Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P<0.0001.
FIG. 13 Analysis of binding of MC3 LNP targeted by RG7-LAND compared toRG7- LAND “long linker”. Binding of LNPs to TK-1 cells (that express a4p7-integrin on their surface) mediated by Fib504 rat IgG2a (an antibody that binds a4p7-integrin) or a rat IgG2a isotype control was measured by flow cytometry, reading Cys5 fluorescence of the labeled encapsulated siRNA. US- unstained cells, LNPs+WT iso- RG7 LNPs prepared with RG7- LAND in the presence of an isotype control rat IgG2a; LNPs+WT Fib - RG7 LNPs prepared with RG7-LAND in the presence of a Fib504 IgG; LNPs+LL iso -RG7-LAND “long linker” (45aa) LNPs prepared with RG7-LAND in the presence of isotype control rat IgG2a; LNPs+LL Fib - RG7-LAND “long linker” (45aa) LNPs prepared with RG7-LAND in the presence of Fib504 IgG. Representative histogram out of four independent preparations. Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****P<0.0001
FIG. 14 Tumor cell viability experiments demonstrate the potential of LAND Primary scFv Targeting for gene editing applications. Tumor- targeted Primary scFv LAND LNPs delivering a mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a guide RNA suppress the function of a gene that promotes tumor growth. The ability of THB-7 (anti-CD38 scFv) LAND LNPs to treat CD38+ hematopoietic cancers is shown in a representative CD38 expressing mantle cell lymphoma MCL Z138 tumor model. In these studies, a MCL Z138 tumor cell viability assay was carried out with anti-CD38 scFv LAND LNPs carrying a mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a single guide RNA for SOX11 which is cancer promoting gene in MCL. Control groups consisted of untreated MCL Z138 cells and treatment with identically prepared anti-CD38 scFv LAND LNPs but with single guide RNAs to irrelevant target genes (GFP and HPRT). There is a statistically significant decrease in viability for the MCL tumor cells treated with CD38-LNP(sgSOXl l) compared to all of the control treatments demonstrated by ANOVA (p<0.0001). In the CD38-LNP(sgSOXl l) treatment group, cell viability was less than 10% compared to greater than 90% in the control CD38-LNP(sgGFP), CD38-LNP(sgHPRT) and untreated groups. These results indicate that LAND Primary scFv Targeted LNPs can deliver CRISPR/Cas gene editing components to suppress the function of a gene that promotes tumor growth for efficacious tumor therapy. Representative histogram out of four independent preparations. Analysis of variance (ANOVA) with Tukey multiple comparison test was used to assess the significance. ****p<0.0001.
FIG. 15 To further demonstrate the potential of LAND Primary scFv Targeting for gene editing applications, in vivo experiments are conducted comparing tumor-targeted and isotypecontrol LNPs delivering an mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a guide RNA to suppress the function of a gene that promotes tumor growth. To show the ability of anti-CD38 THB-7 LAND to treat CD38+ hematopoietic cancers in vivo, we employed representative CD38 expressing mantle cell lymphoma animal models MCL Z138. Z138 tumor cells (approximately 1 x 106 cells) are injected intravenously into SCID mice (n=8 to 10 animals/group). In these studies, IV treatment is initiated after tumor establishment 10 and 15 days after tumor inoculation with LAND LNPs at a dose of 0.5 mg/kg containing a Cas9 mRNA and single guide RNA for SOX11— CD38-LNP(sgSOXl l). Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs. Specifically, the control LNP vectors are CD38-targeted LNPs containing a Cas9 mRNA and single guide RNA for green fluorescent protein (GFP)— CD38-LNP(sgGFP); Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for SOX11— Iso-LNP(sgSOXl l) and Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for GFP— Iso-LNP (sgGFP). There is a statistically significant difference between the treatment groups with increased survival for the group treated with CD38-LNP(sgSOXl l) compared to all of the control treatments demonstrated by Kaplan-Meier curves and log rank test (p < 0.001). In the CD38-LNP(sgSOXl l) group, 90% of the animals were alive at day 50 while all animals the control groups had died before day 40. These in vivo results are consistent with the in vitro data shown in Figure 14 and further indicate that LAND Primary scFv Targeted LNPs can deliver CRISPR/Cas gene editing components to suppress the function of a gene that promotes tumor growth for efficacious tumor therapy.
FIGs. 16A-C To further demonstrate the potential of LAND Primary scFv Targeting for both safe and effective gene editing, the percentage of gene editing was evaluated in sorted tumor cells extracted from tumors and normal hepatocytes following in vivo therapy in the same representative hematopoietic tumor model used in Figure 15 and described in Example 3. In these studies, IV treatment is initiated after tumor establishment with LAND LNPs at a dose of 2.0 mg/kg containing a Cas9 mRNA and single guide RNA for SOX11— CD38-LNP(sgSOXl l). Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs as described for Figure 15. As additional controls, mice (N = 5 / group) were treated with a single intravenous administration of doxorubicin (DOX) at 1 mg/Kg or 2.5 mg/Kg doses. Following treatment, genomic DNA was extracted from MCL tumor cells and normal liver cells and analyzed for INDELs by next generation sequencing (NGS). The results shown in Figure 16A reveal that 95% of the tumor cells are edited by the treatment with single guide RNA for SOX11— CD38-LNP(sgSOXl l) compared to 0 to 4 percent of tumor cells in the control groups which include either untreated animals or treatment with similarly prepared LNP vectors with irrelevant sgRNAs as described for Figure 15. These differences are statistically significant by analysis of variance (ANOVA) with Tukey multiple comparison test. **P<0.001.
As shown in Figure 16B, the superiority of LAND compared to standard chemical conjugation antibody LNP targeting is demonstrated for therapeutic applications. In these evaluations an additional treatment group was tested utilizing anti-CD38 LNPs prepared using chemical conjugation methods. The chemically conjugated CD38 targeted LNPs (chemical CD38- LNPs-sgSOXl l) utilized the identical lipids, Cas9 mRNA and SOX11 sgRNA as described in Figure 16 A. Chemical conjugation of the anti-CD38 to the LNPs was performed as previously described Tarab-Ravski et al 2023. IV treatment with chemical CD38-LNPs-sgSOXl 1 is similarly initiated 10 days after tumor establishment at a dose of 2.0 mg/kg and the results compared to those obtained with the same treatment groups described in Figure 16A.
As shown in Figure 16B, there is a statistically significant increase in tumor gene editing for LAND CD38-LNPs-sgSOXl lvs. chemical CD38-LNPs-sgSOXl l (>95% vs. <40%). In addition, there is significantly less “off tumor” gene editing in normal liver cells (hepatocytes and macrophages) for the LAND vs. chemical conjugation LNP treatments (<4% vs. >40%). Both of these differences are statistically significant by analysis of variance (ANOVA) with Tukey multiple comparison test (p<0.0005). The substantially superior results for LAND vs. chemical conjugation antibody targeted LNPs are unexpected as the lipidated scFv antibody utilized in LAND has only one binding site compared to two binding sites for antibodies used for the chemically conjugated LNPs.
As shown in Figure 16C, the superior safety of LAND compared to standard chemotherapy is demonstrated. In these evaluations, additional control groups (N = 5 / group) were treated with a single intravenous administration of doxorubicin (DOX) at 1 mg/Kg or 2.5 mg/Kg doses. These doses are generally in the range used clinically. Following treatment, genomic DNA was extracted from normal liver cells and analyzed for INDELs by next generation sequencing (NGS). Surprisingly, there is an order of magnitude less “off tumor” gene editing in normal liver cells for LAND (<4% Figure 16B) compared to standard chemotherapy that resulted in >50%) INDELs
(Figure 16C doxorubicin 2.5 mg/Kg).
FIG. 17 To further demonstrate the safety of LAND Primary scFv treatment, liver toxicity and the percentage of gene editing was evaluated in normal hepatocytes following in vivo administration in normal mice. In these studies, anti-EGFR LAND LNPs at a dose of 2.0 mg/kg containing a Cas9 mRNA and single guide RNA for PLK1— EGFR-LNP(sgPLKl) was administered IV. Control groups include untreated animals and LNP vectors with irrelevant GFP sgRNAs as described for Figure 15. Serum liver enzyme levels and the percentage of gene edited hepatocytes are determined as described in Figure 16. Consistent with the results in Figure 16, the percentage of liver edited cells was low and there was no significant difference between the anti- EGFR LAND LNPs with single guide RNA for PLK1— EGFR-LNP(sgPLKl) and control groups treated with anti-EGFR LAND LNPs with single guide RNA for an irrelevant sgRNA to GFP as described for Figure 16. There was no negative effect on serum liver enzymes which are similar in all treatment groups to untreated animals.
FIG. 18. In vitro binding of Erbitux LAND “LAND with Primary scFv Targeting” and “LAND with Primary Fab Targeting” to OVCAR8 (EGFR+) cells measured by flow cytometry. Binding of purified Erbitux-LAND proteins in OG micelles. UT- unstained cells; RG7 micelle: RG7 detergent micelles as negative control; Erb micelle: Primary Erbitux scFv LAND detergent micelles; Fab micelle: Primary Erbitux Fab LAND detergent micelles: APC-anti His: detection fluorescent antibody only without micelles.
FIG. 19. In vitro binding of THB-7 LAND “LAND with Primary scFv Targeting” and “LAND with Primary Fab Targeting” to Z138 (CD38+) cells measured by flow cytometry. Binding of purified THB-7-LAND proteins in pure OG micelles. UT- unstained cells; RG7 micelle: RG7 OG micelles; scFv: Primary THB-7 scFv LAND OG micelles; Fab: Primary THB-7 Fab LAND OG micelles: aHis: detection anti His-Tag fluorescent antibody only without micelles.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides a novel platform for effective delivery of therapeutic agents to target cells. The platform termed “LAND” affords uniform applicability and superior antigen binding efficacy and specificity. In one embodiment, the LAND platform includes a primary antibody which is associated via a lipidated peptide and a peptide linker (e.g. from 10-200 amino acids in length, from 20-200 amino acids in length, from 30-300 amino acids in length or from 40-400 amino acids in length) to a lipid particle. In other embodiments, the platform includes unique linker/spacers of at least 40 amino acids in length (which may or may not encode afunctional protein) that were incorporated between the lipidated peptide portion of the antibody and the antibody itself (see Figure 1A). Unexpectedly, the platform showed high efficacy in transducing cells with LNPs encapsulating an active agent, for example RNA.
Reference is now made to Figures 1B-F which are schematic illustration of certain configurations of the delivery system according to the principles of the present invention vs. the previous configuration (referred to herein as ASSET; Figure 1G). Whereas the ASSET configuration only utilized a short linker (Linker #1) of 11 amino acids prior to the lipidated antibody (secondary scFv) and followed by an additional linker (Linker #2) and a functional protein, the configurations according to the principles of the present invention utilize a longer linker (Linker #5 in D and E) or those that include a functional protein (in B and C) prior to the lipidated antibody. In a particular embodiment the antibody is encoded at the 5’ end of the construct. Surprisingly, the novel configurations incorporating LAND primary scFv antibody targeting (Figure 1 (C) and (E)) which have a single antigen binding site demonstrated significantly increased efficacy compared to ASSET primary IgG antibody targeting which has two antigen binding sites that are generally considered to have superior affinities compared to their corresponding scFv fragments.
The delivery system of the present invention is useful for targeting various antigens and treating the listed corresponding diseases including but not limited to those shown in Table 1.
Table 1-Target Antigens and Corresponding Therapeutic Indications for Treatment by The Compositions and Methods of The Present Invention
In certain embodiments, the therapeutic agent is a base editor, prime editor or mobile genetic element gene writer. In particular embodiments, the gene editing nuclease is a cytosine base editor (CBE) which is basically composed of three fused elements: a cytidine deaminase, a uracil DNA glycosylase inhibitor (UGI), and a Cas nuclease that is either catalytically inactive (dCas) or partially inactive (Cas nickase or nCas). Such Cas9 variants contain mutations that prevent the generation of double strand breaks (DSBs). An associated single-guide RNA (sgRNA) confers target sequence specificity. In particular embodiments, the CBE complex is recruited to the target DNA by the Cas protein and sgRNA, the cytidine deaminase recognizes the singlestranded DNA (ssDNA) in the R-loop structure formed by the pairing between the sgRNA and the non-edited DNA strand and converts a cytosine into a uracil, generating a U/G pair. The mismatched U/G pair is then sequentially converted into a U/A pair and a T/A pair by the mismatch repair (MMR) pathway. In other embodiments the gene editing nuclease is an adenine base editor (ABE). ABEs resemble CBEs in both structure and base editing mechanisms, except that an adenosine deaminase replaces the cytidine deaminase. In certain embodiments, the ABE complex is recruited to the target DNA in a process similar to that used by CBEs, after which the adenosine deaminase converts an adenosine into an inosine, generating an I/T pair. MMR then sequentially converts the mismatched I/T pair into an EC pair and a G/C pair. Numerous variants of CBEs and ABE have been generated to improve their efficiency, specificity, and to reduce off target effects. In specific embodiments, the CBEs and ABEs and other gene editing agents include but are not limited to those listed respectively in Tables 2 and 3. In particular embodiments to silence gene expression, CBEs and ABEs and other gene editing agents are used for introducing a premature termination codon (PTC) in a target gene to disrupt its expression. In particular embodiments, named CRISPR-STOP and iSTOP, base editors including but not limited to BE3 create in-frame stop codons by converting CAA, CAG, CGA, and/or TGG codons into TAA, TAG, and TGA stop codons in the genome. Another approach for gene expression inhibition is to use an ABE to mutate the start codon (ATG), thereby abolishing gene expression. In an embodiment, named i-Silence, an adenine base editor is employed for conversion of an ATG to GTG or ACG using for example, ABEmax, resulting in silencing of a gene of interest. Conversely, abnormal pre-existing disease related PTCs can be bypassed by BEs to avoid disease causing truncated protein generation. This approach is termed CRISPR-pass successfully changes PTCs to glutamine (CAA or CAG) or arginine (CGA) codons through A-to-G or T-to-C conversion to avert truncated protein generation by allowing transcription to proceed.
In addition to restoring normal gene expression and inhibiting gene function, isoformspecific gene expression can also be controlled by DNA base editors. Most proteins have multiple isoforms, and the alternative splicing of the pre-mRNA is a key step to determine the isoform type by which some exons are excluded from the mature transcripts. As most introns end with a G, CBEs are employed in an approach termed CRISPR-SKIP that convert Gs within splice acceptor sites into As by editing Cs in the complementary strand of the target site. In consequence, the corresponding exons fail to be incorporated into the mature transcripts while the other exons are expressed normally.
Designing proper sgRNAs is important for DNA base editor applications because the design and optimization of sgRNA for DNA base editors is more complicated compared to those for CRIS PR-based methods. Currently, typical CRISPR sgRNA design programs such as CRISPOR, CHOPCHOP, and Cas-Designer can be used for sgRNAs of DNA base editors. In particular, DNA base editor dedicated tools such as BE-Designer, sgSTOPs, beditor, SNP- CRISPR, BE-FF, and Benchling are available to design sgRNAs for use in BE. Recently, a machine learning-based sgRNA design tool, termed BE-Hive, is available which provides predicted editing efficacy, as well as genotype outcomes for each target according to different CBEs and ABEs and different cell lines.
In another embodiment, base editing systems that recruit a DNA base-modifying enzyme through an RNA aptamer within the gRNA molecule is utilized. In this approach, as an alternative to fusing an effector deaminase to Cas9 is to engineer the guide RNA (gRNA) component of the CRISPR-Cas9 complex as an anchor for recruitment. In this approach, the gRNA is engineered to include an RNA aptamer, which interacts with its cognate ligand fused to an effector protein. The separation of the DNA recognition element from the effector element and the use of RNA aptamers for effector recruitment allows convenient reconfiguration of the system by the mix and match of individual components and simultaneous recruitment of different effectors to different target sites. By harnessing orthologous RNA aptamer-RNA binding protein pairings to recruit different DNA deaminases, heterologous BE at separate loci is conveniently achieved. In particular embodiments, the RNA aptamer-mediated BE system named Pin-Point is employed.
Cytosine Base Editors, Adenine Base Editors and other Gene Editing Agents that are suitable for particular embodiments include but are not limited to those in Tables 2 and 3 below which are incorporated by reference and characterize their nuclease origin, mutations if present, editing windows, and PAM sequences.
Table 2 Cytosine Base Editors (CBE) and Adenine Base Editors (ABE)
As listed in Table 2, Jeong et al., and Collantes et al., (both incorporated by reference) describe examples of Cytosine Base Editors (CBE), Adenine Base Editors (ABE), Pin-Point RNA aptamer-mediated CBE and ABE systems that may be used in particular embodiments.
In certain embodiments, CBE, ABE and other gene editing components in Table 3 are utilized including but not limited to Glycosylase Base Editors (GBE) and C-to-G Base Editors (CGBE), Adenine Transversion Editors (AYBE and AXBE), Prime Editors (PE)S CRISPR- Associated Transposon (CAST), CRIS PR- Associated Serine Recombinases (twinPE and PASTE), Retrons and SeLection by Essential-Gene Exon Knock-in (SLEEK) doi: 10.3390/biomedicinesl 1082168 which are incorporated by reference.
Table 3 Cytosine Base Editors (CBE) and Adenine Base Editors (ABE)
In another embodiment, termed prime editing, a guide RNA template and Cas9 nickase is employed to direct a reverse transcriptase enzyme to a target site to generate a new DNA strand from the RNA template for insertion at the target sequence. Prime editors enable generating small insertions and deletions in addition to substitution of several nucleotides at target sites. Prime editors can change any DNA base into any other mediating all possible base-to-base conversions and generate insertions and deletions (indels) and their combinations without the need for doublestrand breaks (DSBs) or donor DNA (dDNA) templates. Prime editing employs a longer than usual single guide RNA (sgRNA), known as a prime editing guide RNA (pegRNA), and a fusion protein consisting of a Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme. Described as “search-and-replace” base-editing technology, prime editing supplies the desired genetic construct in an extension to the guide RNA, which is then converted to DNA using the RT enzyme.
In another embodiment, termed gene writing, the gene editing enzymes incorporate mobile genetic elements for targeted integration of large DNA fragments in mammalian genomes. Mobile genetic elements include but are not limited to transposons, retrotransposons, short interspersed nuclear elements (SINEs) and long interspersed nuclear elements (LINEs). In a particular gene writing embodiment, termed “find, cut and transfer” (FiCAT) CRISPR-Cas9 targeting elements (find, cut) are combined with the payload transfer efficiency of an engineered piggyBac transposase (transfer). PiggyBac functional domains are engineered to provide increased on-target integration while reducing off-target events. In a particular embodiment, Cas9 finds and cuts the genomic insertion point and the transposase with potentiated donor excision and reduced promiscuous DNA binding contributes to the genetic insertion. The system acts irreversibly by destroying the preferred transposase recognition site during insertion. In gene writing, efficient targeted insertion of multi kilobase DNA fragments in mammalian genomes is achieved.
A list of endogenous pathogenic cancer promoting genes and sequences for down modulation by LAND therapy include, but are not limited to, those listed in Table 4 along with representative, non-limiting, designed guide RNAs for use with Cas9 and Cas9 repressor fusion proteins.
Table 4 - Representative Endogenous Human Cancer Sequences for Down Modulation and Non-Limiting Examples of gRNA Sequences for use with Cas9 and dCas9 Fusion Repressors (SEQ ID 55 to 198)
Without the intention of any limitation, examples of the one or more up modulated anticancer genes and endogenous genomic sequences for transcriptional activation by LAND for cancer treatment have tumor suppressor, pro-apoptotic, immune stimulatory, therapy sensitizing, suicide, anti-cancer gene silenced by hypermethylation or other epigenetic mechanisms, or secreted decoy receptor gene activities including, but not limited to, those listed in Table 5.
Table 5 - Representative Target Endogenous Human Cancer Genomic Sequences for Transcription Up Modulation and Non-Limiting Examples of gRNA Sequences for use with dCas9 Fusion Activators (SEQ ID NO: 199 to 418)
For EAND therapy, Cas and dCas nucleases may be provided as either an mRNA encoding the Cas/dCas nuclease (e.g., a CleanCap Cas9 or dCas9 mRNA (modified) custom manufactured by TriLink BioTechnologies Inc) or complexed with a guideRNA as a ribonucloprotein (RNP) (e.g., custom manufactured by Aldevron Inc). Without the intention of any limitation, representative Cas and dCas with their protospacer adjacent motifs (PAM) suitable for LAND therapy in activated or deactivated forms include but are not limited to those listed in Table 6 below.
Table 6. Representative Cas and dCas with their protospacer adjacent motifs (PAM) Suitable for LAND Therapy in Activated or Deactivated Forms
Without the intention of any limitation, in addition to the antibody targets and disorders listed in Table 1 that are largely related to cancer and other hyperproliferative diseases, LAND may also be applied for the treatment of the genetic diseases including but not limited to those listed in Table 7 below by gene editing knockout, silencing or correction applications using the LAND platform. These additional diseases, related genes, tissue/cell and antibody targets for LAND platform applications include but are not limited to those described in Table 7 below:
The term "antibody" as used in this invention includes intact molecules as well as functional fragments thereof.
In one embodiment, the antibody is a primary antibody.
As used herein the term "primary antibody" refers to an antibody (or antibody fragment as defined herein) which specifically recognizes an antigenic target of interest (e.g., a protein, peptide, carbohydrate, or other small molecule) and is typically unconjugated (unlabelled). Primary antibodies that recognize and bind with high affinity and specificity to unique epitopes across a broad spectrum of biomolecules are available as high specificity (e.g., 1 pM to 0.5 nM) monoclonal antibodies and/or as polyclonal antibodies.
According to a specific embodiment, the primary antibody comprises an antigen recognition domain which binds a tissue or tumor specific antigen.
As used herein "a tissue specific antigen" refers to a heterogenetic antigen with organ or tissue specificity.
As used herein "a tumor (or cancer) specific antigen" refers to an antigenic substance produced in tumor cells, i.e., it triggers an immune response in the host. Tumor antigens are useful in identifying tumor cells and are potential candidates for use in cancer therapy. The term also encompasses tumor associated antigens.
According to a specific embodiment, the antigen recognized by the primary antibody is a cell-surface antigen.
In particular, the antigen recognized by the primary antibodies is CD44, CD34, Ly6C, CD3, CD4, CD25, CD29 and/or Itgb7.
It will be appreciated that to improve specificity, the primary antibody refers to a plurality of primary antibodies that bind different targets e.g., 2, 3 or 4 distinct targets. Thus, one target may be a tissue specific antigen while the other(s) can be a tumor specific antigen or vise a versa. Alternatively, all the primary antibodies bind tissue (cell) specific antigens. Yet alternatively all the primary antibodies bind tumor specific antigens.
According to a specific embodiment, the primary antibody is a monoclonal antibody.
According to a specific embodiment, the primary antibody is a bispecific antibody.
According to a specific embodiment, the primary antibody is conjugated to a pharmaceutical agent.
According to another embodiment, the primary antibody is conjugated to a diagnostic agent.
In another embodiment, the antibody is a secondary antibody.
As used herein the phrase "secondary antibody" refers to an antibody which binds to conserved regions of a primary antibody. Thus, the secondary antibody may have a specificity for the antibody species and optionally isotype of the primary antibody.
Varieties of secondary antibodies are available for particular antibody classes and fragment types. Secondary antibodies can bind parts of whole IgG (heavy and light chains, H+L), or only the Fab or Fc region, or only the gamma chain. In one embodiment, the secondary antibodies described herein bind to the Fc region only of antibodies and not to the light chain of an antibody (i.e. with at least 10, 100 fold or 1000 fold higher affinity). Secondary antibodies also exist that are specific for IgM heavy chains ( or Fc5p), or the or K light chains common to all immunoglobulins (IgG, IgA, IgD, IgE and IgM).
In one embodiment, the secondary antibody may be an antibody fragment that binds to the Fc constant region of Rat IgG2a antibodies. In another embodiment, the secondary antibody may be an antibody fragment that binds to the Fc constant region of human antibodies (for example human IgG antibodies). The secondary antibody (or fragment thereof, such as the scFv) should have sufficient affinity to avoid exchange with serum IgG e.g. having a Kd betweenlO'loM to 10’ 8M.
The secondary antibody may be a monoclonal antibody or a polyclonal antibody.
According to a particular embodiment, the antibody (primary or secondary) is a monoclonal antibody (as further described herein below), for example a humanized monoclonal antibody.
The antibody can belong to any antibody class (e.g., IgG, IgA, IgD, IgE and IgM) or isotype. According to a specific embodiment, the antibody is selected from the group consisting of IgGl, IgG2, IgG3 and IgG4.
The antibodies may be provided as intact antibodies (e.g., whole IgG) or as divalent F(ab')2 fragments and monovalent Fab fragments, though other forms of antibody fragments, as described herein below can be used.
As used herein, the phrase “antibody fragment” refers to a functional fragment of an antibody (such as Fab, F(ab')2, Fv, scFv, dsFv, or single domain molecules such as VH and VE) that is capable of binding to an epitope of an antigen.
According to a particular the antibody or antibody fragment comprises a constant region.
Suitable antibody fragments for practicing some embodiments of the invention include a complementarity-determining region (CDR) of an immunoglobulin light chain (referred to herein as “light chain”), a complementarity-determining region of an immunoglobulin heavy chain (referred to herein as “heavy chain”), a variable region of a light chain, a variable region of a heavy chain, a light chain, a heavy chain, an Fd fragment, and antibody fragments comprising essentially whole variable regions of both light and heavy chains such as a Fv, a single chain Fv (scFv), a disulfide- stabilized Fv (dsFv), an Fab, an Fab’, and an F(ab’)2.
Functional antibody fragments comprising whole or essentially whole variable regions of both light and heavy chains are defined as follows:
(i) Fv, defined as a genetically engineered fragment consisting of the variable region of the light chain (VL) and the variable region of the heavy chain (VH) expressed as two chains; (ii) single chain Fv (“scFv”), a genetically engineered single chain molecule including the variable region of the light chain and the variable region of the heavy chain, linked by a suitable polypeptide linker as a genetically fused single chain molecule.
(iii) disulfide- stabilized Fv (“dsFv”), a genetically engineered antibody including the variable region of the light chain and the variable region of the heavy chain, linked by a genetically engineered disulfide bond.
(iv) Fab, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme papain to yield the intact light chain and the Fd fragment of the heavy chain which consists of the variable and CHI domains thereof;
(v) Fab’, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin, followed by reduction (two Fab’ fragments are obtained per antibody molecule);
(vi) F(ab’)2, a fragment of an antibody molecule containing a monovalent antigen-binding portion of an antibody molecule which can be obtained by treating whole antibody with the enzyme pepsin (i.e., a dimer of Fab’ fragments held together by two disulfide bonds); and
(vii) Single domain antibodies are composed of a single VH or VL domains which exhibit sufficient affinity to the antigen.
In one embodiment, the fragment is a scFv.
According to a particular embodiment, the polypeptide sequence of the primary or secondary antibody contains an N-terminal sequence which is derived from a leader peptide recognized by a bacterial lipidation system. After removal of the leader peptide during export through the inner membrane, the mature polypeptide contains the N-terminal sequence of the leader peptide (e.g. CDQSSS - SEQ ID NO: 17) which is targeted by the lipidation system, resulting in lipid-acylation of the cysteine). . In one embodiment, the signal sequence is part of an inner membrane bacterial (e.g. E.coli) lipoprotein.
One example of an inner membrane lipoprotein is NlpA (new lipoprotein A). The first six amino acid of NlpA can be used as an N terminal anchor (CDQSSS: SEQ ID NO: 17). Other examples of anchors that may find use with the invention include lipoproteins, Pullulanase of K. pneumoniae, which has the CDNSSS (SEQ ID NO: 13) mature lipoprotein anchor, phage encoded celB, and E. coli acrE (envC).
Examples of inner membrane proteins which can be used as protein anchors include: AraH, MglC, MalF, MalG, Mai C, MalD, RbsC, RbsC, ArtM, ArtQ, GlnP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E,Dpp B, DppC, OppB,AmiC, AmiD, BtuC, FhuB, FecC, FecD,FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC,PotH, Poti, ModB, NosY, PhnM, LacY, SecY, ToIC, Dsb,B, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB and Aas. Further, a single transmembrane loop of any cytoplasmic protein can be used as a membrane anchor.
As mentioned, the N-terminal end of the antibody is attached to a lipidated peptide portion via a linker peptide.
The linker peptide is a sequence of amino acids which serves to link the antibody with the lipidated peptide portion. The linker peptide may include amino acids which encode a functional protein (e.g. a detectable protein, such as a fluorescent protein) or may serve no other function other to link the antibody with the lipidated peptide portion (i.e. a spacer).
The linker is preferably of a flexibility and a length which allows the lipidated peptide portion of the antibody to penetrate and associate (non-covalently) with the lipids of the particle and the antigen binding fragment of the antibody to bind its target with a high degree of affinity (as further detailed herein).
The linker peptide is at least 40, 50, 60, 70, 80, 90, 100 amino acids in length. In one embodiment, the linker peptide is between 40-400, 40-300, 50-400, 50-300, 60-400, 60-300 amino acids in length.
In another embodiment, at least 20 %, at least 30 %, at least 40 %, at least 50 %, at least 60 %, at least 70 %, at least 80 %, at least 90 % of the amino acids of the linker are glycines and/or serines.
In some embodiments, the linker is a combination of functional protein, linker and spacer sequences.
In order to express the antibody of this aspect of the present invention, a polynucleotide sequence encoding the elements described above is preferably ligated into a nucleic acid construct suitable for host cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
Exemplary constructs contemplated by the present inventors are shown in Figures 1A-F, whereby the 3’ end of the DNA encoding the antibody encodes a lipidated peptide portion, a linker peptide of more than 40 amino acids and towards the 5’ end, the antibody itself. According to a particular embodiment, the antibody is encoded at the terminal 5’ end.
The nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.
The nucleic acid construct of some embodiments of the invention typically includes a signal sequence for secretion of the fusion protein from a host cell in which it is placed.
Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.
Exemplary promoters contemplated by the present invention include, but are not limited to polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and cytomegalovirus promoters. According to a particular embodiment, the promoter is a bacterial promoter.
Preferably, the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed. Examples of cell type-specific and/or tissue-specific promoters include promoters such as albumin that is liver specific [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulins; [Banerji et al. (1983) Cell 33729-740], neuron- specific promoters such as the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreas-specific promoters [Edlunch et al. (1985) Science 230:912-916] or mammary gland- specific promoters such as the milk whey promoter (U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).
Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.
Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDN A3.1 (+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RS V and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives. Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
Various methods can be used to introduce the expression vector of some embodiments of the invention into stem cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
Examples of bacterial constructs include the pET series of E. coli expression vectors [Studier et al. (1990) Methods in Enzymol. 185:60-89).
Additional bacterial systems contemplated by the present invention include but are not limited to Lactoccocus lactis, Pseudomonas, Streptomyces, coryneform bacteria, and halophilic bacteria.
In yeast, a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Pat. Application No: 5,932,447. Alternatively, vectors can be used which promote integration of foreign DNA sequences into the yeast chromosome.
In cases where plant expression vectors are used, the expression of the coding sequence can be driven by a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al. (1984) Nature 310:511-514], or the coat protein promoter to TMV [Takamatsu et al. (1987) EMBO J. 6:307-311] can be used. Alternatively, plant promoters such as the small subunit of RUBISCO [Coruzzi et al. (1984) EMBO J. 3:1671-1680 and Brogli et al., (1984) Science 224:838-843] or heat shock promoters, e.g., soybean hspl7.5-E or hspl7.3-B [Gurley et al. (1986) Mol. Cell. Biol. 6:559-565] can be used. These constructs can be introduced into plant cells using Ti plasmid, Ri plasmid, plant viral vectors, direct DNA transformation, microinjection, electroporation and other techniques well known to the skilled artisan. See, for example, Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463.
Other expression systems such as insects and mammalian host cell systems which are well known in the art and are further described hereinbelow can also be used by some embodiments of the invention.
Since the antibody is lipidated, it is inserted into the membranes of the expressing cells. The membrane fraction may be isolated (e.g. by centrifugation) and the lipidated antibody may be extracted from the membranes using detergent before optionally being further purified (e.g. using Nickel affinity chromatography).
Following isolation, the lipidated antibody described herein may be contacted with a particle to generate an immunoparticle.
The contacting is effected for a length of time (e.g. 6-72 hours) and under conditions (e.g. temperature) that allow the lipidated portion of the protein (e.g. secondary antibody) to insert into the immunoparticle. It will be appreciate that the lipidated antibody is thus non-covalently attached to the particle via its lipidated portion.
The lipidated antibody of the invention couples to the outer surface of the particle. Measures are taken to couple the antibody without significantly affecting its functionality in binding its target (i.e., more than 80 %, 90 % or 95% of the antibodies on the particle are available for binding their target and the particle's loadability or loading with the pharmaceutical agent.
As used herein the term "immunoparticle" refers to a particle which typically serves as a drug or diagnostic carrier to which an antibody has been coupled on a surface thereof.
As used herein, "particles" refers to nano to micro structures which are not biological cells.
The particle may be a synthetic carrier, gel or other object or material having an external surface which is capable of being loadable with (e.g., encapsulating) a pharmaceutical agent. The particle may be either polymeric or non-polymeric preparations.
Exemplary particles that may be used according to this aspect of the present invention include, but are not limited to polymeric particles, microcapsules, liposomes, microspheres, microemulsions, nanoparticles, nanocapsules, nano-spheres, nano-liposomes, nano-emulsions and nanotubes.
In one embodiment, the particle is a biological particle - e.g. an erythrocyte or a cell ghost.
In another embodiment, the particle is a non-biological particle - i.e. not a cell.
According to a particular embodiment, the particles are nanoparticles.
As used herein, the term "nanoparticle" refers to a particle or particles having an intermediate size between individual atoms and macroscopic bulk solids. Generally, nanoparticle has a characteristic size (e.g., diameter for generally spherical nanoparticles, or length for generally elongated nanoparticles) in the sub-micrometer range, e.g., from about 1 nm to about 500 nm, or from about 1 nm to about 200 nm, or of the order of 10 nm, e.g., from about 1 nm to about 100 nm. The nanoparticles may be of any shape, including, without limitation, elongated particle shapes, such as nanowires, or irregular shapes, in addition to more regular shapes, such as generally spherical, hexagonal and cubic nanoparticles. According to one embodiment, the nanoparticles are generally spherical.
The particles of this aspect of the present invention may have a charged surface (i.e., positively charged or negatively charged) or a neutral surface.
Agents which are used to fabricate the particles may be selected according to the desired charge required on the outer surface of the particles.
Thus, for example if a negatively charged surface is desired, the particles may be fabricated from negatively charged lipids (i.e. anionic phospholipids) such as described herein below.
When a positively charged surface is desired, the particles may be fabricated from positively charged lipids (i.e. cationic phospholipids), such as described herein below.
As mentioned, non-charged particles are also contemplated by the present invention. Such particles may be fabricated from neutral lipids such as phosphatidylethanolamine or dioleilphosphatidylethanolamine (DOPE) .
It will be appreciated that combinations of different lipids may be used to fabricate the particles of the present invention, including a mixture of more than one cationic lipid, a mixture of more than one anionic lipid, a mixture of more than one neutral lipid, a mixture of at least one cationic lipid and at least one anionic lipid, a mixture of at least one cationic lipid and at least one neutral lipid, a mixture of at least one anionic lipid and at least one neutral lipid and additional combinations of the above. In addition, polymer-lipid based formulations may be used.
There are numerous polymers which may be attached to lipids. Polymers typically used as lipid modifiers include, without being limited thereto: polyethylene glycol (PEG), polysialic acid, polylactic (also termed polylactide), polyglycolic acid (also termed polyglycolide), apolylactie- polyglycolic acid' polyvinyl alcohol, polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyllydroxyetlyloxazolille, solyhydroxypryloxazoline, polyaspartarllide, polyhydroxypropyl methacrylamide, polymethacrylamide, polydimethylacrylamide, polyvinylmethylether, polyhydroxyethyl acrylate, derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.
The polymers may be employed as homopolymers or as block or random copolymers. The particles may also include other components. Examples of such other components includes, without being limited thereto, fatty alcohols, fatty acids, and/or cholesterol esters or any other pharmaceutically acceptable excipients which may affect the surface charge, the membrane fluidity and assist in the incorporation of the biologically active lipid into the lipid assembly. Examples of sterols include cholesterol, cholesterol hemisuccinate, cholesterol sulfate, or any other derivatives of cholesterol. Preferred lipid assemblies according the invention include either those which form a micelle (typically when the assembly is absent from a lipid matrix) or those which form a liposome (typically, when a lipid matrix is present).
In one embodiment, the particle is a lipid-based nanoparticle. The core of the particle may be hydrophilic or hydrophobic. The core of the lipid-based nanoparticle may comprise some lipids, such that it is not fully hydrophilic.
In a specific embodiment, the particle is a liposome. As used herein and as recognized in the art, liposomes include any synthetic (i.e., not naturally occurring) structure composed of lipid bilayers, which enclose a volume. Liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. The liposomes may be prepared by any of the known methods in the art [Monkkonen, J. et al., 1994, J. Drug Target, 2:299-308; Monkkonen, J. et al., 1993, Calcif. Tissue Int., 53:139-145; Lasic D D., Liposomes Technology Inc., Elsevier, 1993, 63-105. (chapter 3); Winterhalter M, Lasic D D, Chem Phys Lipids, 1993 September;64(l-3):35-43].
The liposomes may be unilamellar or may be multilamellar. Unilamellar liposomes may be preferred in some instances as they represent a larger surface area per lipid mass. Suitable liposomes in accordance with the invention are preferably non-toxic. The liposomes may be fabricated from a single phospholipid or mixtures of phospholipids. The liposomes may also comprise other lipid materials such as cholesterol. For fabricating liposomes with a negative electrical surface potential, acidic phospho- or sphingo- or other synthetic-lipids may be used. Preferably, the lipids have a high partition coefficient into lipid bilayers and a low desorption rate from the lipid assembly. Exemplary phospholipids that may be used for fabricating liposomes with a negative electrical surface potential include, but are not limited to phosphatidylserine, phosphatidic acid, phosphatidylcholine and phosphatidyl glycerol.
Other negatively charged lipids which are not liposome forming lipids that may be used are sphingolipids such as cerebroside sulfate, and various gangliosides.
The most commonly used and commercially available lipids derivatized into lipopolymers are those based on phosphatidyl ethanolamine (PE), usually distearylphosphatidylethanolamine (DSPE). The lipid phase of the liposome may comprise a physiologically acceptable liposome forming lipid or a combination of physiologically acceptable liposome forming lipids for medical or veterinarian applications. Liposome-forming lipids are typically those having a glycerol backbone wherein at least one of the hydrofoil groups is substituted with an acyl chain, a phosphate group, a combination or derivatives of same and may contain a chemically reactive group (such as an as amine imine, acids ester, aldelhyde or alcohol) at the headgroup. Typically, the acyl chain is between 12 to about 24 carbon atoms in length, and has varying degrees of saturation being fully, partially or non-hydrogenated lipids. Further, the lipid matrix may be of natural source, semisynthetic or fully synthetic lipid, and neutral, negatively or positively charged.
According to one embodiment, the lipid phase comprises phospholipids.
The phospholipids may be a glycerophospholipid. Examples of glycerophospholipid include, without being limited thereto, phosphatidylglycerol (PG) including dimyristoyl phosphatidylglycerol (DMPG); phosphatidylcholine (PC), including egg yolk phosphatidylcholine and dimyristoyl phosphatidylcholine (DMPC), phosphatidic acid (PA), phosphatidylinositol (PI), phosphatidylserine (PS) and sphingomyelin (SM) and derivatives of the same.
Another group of lipid matrix employed according to the invention includes cationic lipids (monocationic or polycationic lipids). Cationic lipids typically consist of a lipophilic moiety, such as a sterol or the same glycerol backbone to which two acyl or two alkyl, or one acyl and one alkyl chain contribute the hydrophobic region of the amphipathic molecule, to form a lipid having an overall net positive charge.
Preferably, the head groups of the lipid carry the positive charge. Monocationic lipids may include, for example, l,2-dimyristoyl-3- trimethylammonium propane (DMTAP) l,2-dioleyloxy-3-(trimethylanino) propane (DOTAP), N-[-l-(2,3,- ditetradecyloxy)propyl]-N,N- dimethyl-N- hydroxyethylammonium bromide (DMRIE), N-[l- (2,3,- dioleyloxy)propyl]-N,N- dimethyl-N-hydroxy ethyl- ammonium bromide (DORIE), N-[l- (2,3-dioleyloxy) propyl] ;-N,N,N- trimethylammonium chloride (DOTMA); 3;N-(N',N'- dimethylaminoethane) carbamoly]; cholesterol (DC-Chol), and I dimethyl- dioctadecylammonium (DDAB).
Examples of polycationic lipids include a similar lipoplilic moiety as with the mono cationic lipids, to which spermine or spermidine is attached. These include' without being limited thereto, N-[2-[[2,5-bis[3 - aminoprop yl)amino]-l- oxopentyl] amino ]ethyl]N,N dimethul-2,3 bis (1-oXo- 9-octadecenyl) oXy];-l propanaminium (DOSPA), and ceramide carbamoyl spermine (CCS).
The cationic lipids may be used alone, in combination with cholesterol, with neutral phospholipids or other known lipid assembly components. In addition, the cationic lipids may form part of a derivatized phospholipids such as the neutral lipid dioleoylphosphatidyl ethanolamine (DOPE) derivatized with polylysine to form a cationic lipopolymer.
The diameter of the liposomes used preferably ranges from 50-200 nM and more preferably from 20-100 nM. For sizing liposomes, extrusion, homogenization or exposure to ultrasound irradiation may be used, Homogenizers which may be conveniently used include microfluidizers (produced by Microfluidics of Boston, MA, USA) or microfluidic micro mixer (Precision NanoSystems, Vancouver, BC, Canada). In a typical homogenization procedure, liposomes are recirculated through a standard emulsion homogenizer until selected liposomes sizes are observed. The particle size distribution can be monitored by conventional laser beam particle size discrimination. Extrusion of liposomes through a small-pore polycarbonate membrane or an asymmetric ceramic membrane is an effective method for reducing liposome sizes to a relatively well defined size distribution. Typically, the suspension is cycled through the membrane one or more times until the desired liposome size distribution is achieved. The liposomes may be extruded through successively smaller pore membranes to achieve a gradual reduction in liposome size.
According to another embodiment, the particle is a nanoparticle. Preferably, nanoparticles are less than 100 nm in diameter and can be spherical, non- spherical, or polymeric particles. In a preferred embodiment, the polymer used for fabricating nanoparticles is biocompatible and biodegradable, such as poly(DL-lactide-co-glycolide) polymer (PLGA). However, additional polymers which may be used for fabricating the nanoparticles include, but are not limited to, PLA (polylactic acid), and their copolymers, polyanhydrides, polyalkyl-cyanoacrylates (such as polyisobutylcyanoacrylate), polyethyleneglycols, polyethyleneoxides and their derivatives, chitosan, albumin, gelatin and the like.
The particles of the present invention may be modified. According modified to enhance their circulatory half-life (e.g. by PEGylation) to reduce their clearance, to prolong their scavenging time-frame and to allow antibody binding. The PEG which is incorporated into the particles may be characterized by of any of various combinations of chemical composition and/or molecular weight, depending on the application and purpose.
It will be appreciated that once the antibody is attached to the particle (and loaded with its cargo), it may be packed in a container and identified as a universal kit for in-vivo delivery of a pharmaceutical agent.
Drugs or therapeutic agents that may be loaded into the particles include but are not limited to anticancer agent (e.g., chemotherapy, radioisotopes, immunotherapy), antibiotic, enzyme, antioxidant, lipid intake inhibitor, hormone, anti-inflammatory, steroid, vasodilator, angiotensin converting enzyme inhibitor, angiotensin receptor antagonist, inhibitor for smooth muscle cell growth and migration, platelet aggregation inhibitor, anticoagulant, inhibitor for release of chemical mediator, promoter or inhibitor for endothelial cell growth, aldose reductase inhibitor, inhibitor for mesangium cell growth, lipoxygenase inhibitor, immunosuppressive, immunostimulant, antiviral agent, Maillard reaction suppressor, amyloidosis inhibitor, nitric oxide synthetic inhibitor, AGEs (Advanced glycation endproducts) inhibitor, radical scavenger, protein, peptide; glycosaminoglycan and derivatives thereof; and oligosaccharide, polysaccharide, and derivatives thereof.
In another embodiment, the particles are loaded with a diagnostic agent.
Exemplary diagnostic drugs include in vivo diagnostics such as an X ray contrast medium, a diagnostic agent for ultrasound, an isotope-labeled agent for diagnosis by nuclear medicine, and an agent for diagnosis by nuclear magnetic resonance.
Loading of the particle with the pharmaceutical agent can be effected concomitant with, or following particle assembly.
Thus, in one preferred embodiment, for example, when the pharmaceutical agent is a nucleic acid, e.g., DNA, RNA, siRNA, plasmid DNA, short-hairpin RNA, small temporal RNA (stRNA), microRNA (miRNA), RNA mimetics, or heterochromatic siRNA, the nucleic acid agent of interest has a charged backbone that prevents efficient encapsulation in the lipid particle. Accordingly, the nucleic acid agent of interest may be condensed with a cationic polymer, e.g., PEI, polyamine spermidine, and spermine, or cationic peptide, e.g., protamine and polylysine, prior to encapsulation in the lipid particle. In one embodiment, the agent is not condensed with a cationic polymer.
In another embodiment, the agent of interest is encapsulated in the lipid particle in the following manner. The immunoparticle is provided lyophilized. The agent of interest is in an aqueous solution. The agent of interest in aqueous solution is utilized to rehydrate the lyophilized lipid particle. Thus, the agent of interest is encapsulated in the rehydrated lipid particle.
In one embodiment, more than one agent of interest may be delivered by the immunoparticles (e.g., lipid-based particle) of this aspect of the present invention. For example, two or more agents may be delivered, where both (or all) the agents are hydrophilic. In another example, two or more agents may be delivered, where both (or all) the agents are hydrophobic.
In one embodiment, two cargo agents of interest may be delivered by the immunoparticles (e.g., lipid-based particle). One cargo agent may be hydrophobic and the other hydrophilic. The hydrophobic agent may be added to the lipid particle during formation of the lipid particle. The hydrophobic agent associates with the lipid portion of the lipid particle. The hydrophilic agent is added in the aqueous solution rehydrating the lyophilized lipid particle. In an exemplary embodiment of two agent delivery, a condensed siRNA is encapsulated in a liposome and a drug that is poorly soluble in aqueous solution is associated with the lipid portion of the lipid particle. As used herein, "poorly soluble in aqueous solution" refers to a composition that is less that 10 % soluble in water.
Any suitable lipid: pharmaceutical agent ratio that is efficacious is contemplated by this invention. Preferred lipid: pharmaceutical agent molar ratios include about 2: 1 to about 30: 1 , about 5:1 to about 100:1, about 10:1 to about 40:1, about 15:1 to about 25:1.
According to a specific embodiment, the fusion protein: siRNA weight ratio is about 1:20, 1:30, 1:36 or even 1:50.
The preferred loading efficiency of pharmaceutical agent is a percent encapsulated pharmaceutical agent of about 50%, about 60%, about 70% or greater. In one embodiment, the loading efficiency for a hydrophilic agent is a range from 50-100%. The preferred loading efficiency of pharmaceutical agent associated with the lipid portion of the lipid particle, e.g., a pharmaceutical agent poorly soluble in aqueous solution, is a percent loaded pharmaceutical agent of about 50%, about 60%, about 70%, about 80%, about 90%, about 100%. In one embodiment, the loading efficiency for a hydrophobic agent in the lipid layer is a range from 80-100%.
As used herein "loading" refers to encapsulating or absorbing.
The term "encapsulated" as used herein refers to the pharmaceutical agent being distributed in the interior portion of the particles. Preferably, the pharmaceutical agents are homogenously distributed. Homogeneous distribution of a pharmaceutical agent in polymer particles is known as a matrix encapsulation. However, due to the manufacturing process it is foreseen that minor amounts of the pharmaceutical agent may also be present on the outside of the particle and/or mixed with the polymer making up the shell of the particle.
As used herein "absorbed" refers to binding of the pharmaceutical agent to the outer surface of the particle.
The desired amount of the drug loaded in the particle varies depending on the type of the drug. However, it is preferable that the drug can be loaded in the particle at a high loading efficiency.
If a lipidated secondary antibody is conjugated to the particle via the lipidated peptide portion, the present invention further contemplates contacting the immunoparticle with a primary antibody.
According to a specific embodiment, immunocomplexation of the primary antibody with the secondary antibody, refers to antibody (i.e., secondary antibody) -antigen (i.e., primary antibody)-based interaction. Antibody- antigen binding is a non-covalent, reversible interaction (specific binding is typically in the 1 pM- 0.1 nM range), which fully maintains the functionality of the primary antibody in binding its epitope. According to a specific embodiment, the immunocomplexation reaction is effected ex- vivo.
The weight ratio of secondary antibody: primary antibody is typically 1:1, although other ratios such as 1:2, 2:1, 1:3, 3:1 are also contemplated.
Conditions for performing immunocomplexation are well known in the art and require physiological conditions and avoid high salt concentrations and extremes of pH which disrupt antigen- antibody binding by weakening electrostatic interactions and/or hydrogen bonds.
Methods of producing polyclonal and monoclonal antibodies (either the primary or the secondary antibodies described herein) as well as fragments thereof are well known in the art (See for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, incorporated herein by reference).
Antibody fragments according to some embodiments of the invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment. Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods. For example, antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab')2. This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5S Fab' monovalent fragments. Alternatively, an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly. These methods are described, for example, by Goldenberg, U.S. Pat. Nos. 4,036,945 and 4,331,647, and references contained therein, which patents are hereby incorporated by reference in their entirety. See also Porter, R. R. [Biochem. J. 73: 119-126 (1959)]. Other methods of cleaving antibodies, such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.
Fv fragments comprise an association of VH and VL chains. This association may be noncovalent, as described in Inbar et al. [Proc. Nafl Acad. Sci. USA 69:2659-62 (19720]. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragments comprise VH and VL chains connected by a peptide linker. These single-chain antigen binding proteins (sFv) are prepared by constructing a structural gene comprising DNA sequences encoding the VH and VL domains connected by an oligonucleotide. The structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli. The recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains. Methods for producing sFvs are described, for example, by [Whitlow and Filpula, Methods 2: 97-105 (1991); Bird et al., Science 242:423-426 (1988); Pack et al., Bio/Technology 11:1271-77 (1993); and U.S. Pat. No. 4,946,778, which is hereby incorporated by reference in its entirety.
Another form of an antibody fragment is a peptide coding for a single complementaritydetermining region (CDR). CDR peptides ("minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry [Methods, 2: 106-10 (1991)].
Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323- 329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(l):86-95 (1991)]. Similarly, human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al., Bio/Technology 10,: 779-783 (1992); Lonberg et al., Nature 368: 856- 859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845- 51 (1996); Neuberger, Nature Biotechnology 14: 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13, 65-93 (1995).
Since the immunoparticles of the present invention are typically used in pharmaceutical applications, they are typically non-immunogenic to the treated subject.
The particles of the present invention may be administered to the subject per se or as part of a pharmaceutical composition in order to treat a disease. As used herein a "pharmaceutical composition" refers to a preparation of the particles encapsulating the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
According to a specific embodiment, the pharmaceutical agent is a therapeutic agent, as further described herein above.
The purpose of the pharmaceutical composition is to facilitate administration of the active ingredients to the subject.
Herein the term "active ingredient" refers to the pharmaceutical agents.
Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to the subject and does not abrogate the biological activity and properties of the administered active ingredients. An adjuvant is included under these phrases.
Herein, the term "excipient" refers to an inert substance added to the pharmaceutical composition to further facilitate administration of an active ingredient of the present invention. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. The pharmaceutical composition may advantageously take the form of a foam or a gel.
Suitable routes of administration may, for example, include the inhalation, oral, buccal, rectal, transmucosal, topical, transdermal, intradermal, transnasal, intestinal and/or parenteral routes; the intramuscular, subcutaneous and/or intramedullary injection routes; the intrathecal, direct intraventricular, intravenous, intraperitoneal, intranasal, and/or intraocular injection routes.
The pharmaceutical composition may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer.
For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
For oral administration, the pharmaceutical composition can be formulated readily by combining the active ingredients with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active ingredient doses.
Pharmaceutical compositions, which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration via the inhalation route, the active ingredients for use according to the present invention can be delivered in the form of an aerosol/spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., a fluorochlorohydrocarbon such as dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane; carbon dioxide; or a volatile hydrocarbon such as butane, propane, isobutane, or mixtures thereof. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the active ingredients and a suitable powder base such as lactose or starch.
The pharmaceutical composition may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
A pharmaceutical composition for parenteral administration may include an aqueous solution of the active ingredients in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
Alternatively, the active ingredients may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
The pharmaceutical composition may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
The pharmaceutical composition should contain the active ingredients in an amount effective to achieve disease treatment.
Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays - e.g. lysosomal enzyme comprising particles may be tested for in-vitro activity in plasma or in other plasma mimicking environments. For example, a dose can be formulated in animal models to achieve a desired tissue concentration or titer. Such information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-l).
Dosage amount and interval may be adjusted individually to provide plasma or tissue levels of the active ingredients which are sufficient to achieve the desired therapeutic effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
The amount of the composition to be administered will be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredients. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
The immunoparticles of the present invention may be used to deliver a pharmaceutical agent to a subject in need thereof. Both therapeutic and diagnostic applications are contemplated herein.
Subjects who may be treated according to the methods described herein are typically mammalian subjects, e.g. human.
The present teachings can be used in a variety of clinical applications which will benefit from the implementation of such a simple and cost-effective platform.
It is expected that during the life of a patent maturing from this application many relevant particles will be developed and the scope of the term immunoparticle is intended to include all such new technologies a priori.
As used herein the term “about” refers to ± 10 %
The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".
The term “consisting of’ means “including and limited to”.
The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.
Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
As used herein, the term “treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
EXAMPLES
EXAMPLE 1
Inflammatory bowel disease (IBD) is a generic classification which includes several forms of inflammatory diseases and conditions affecting various parts of the gastrointestinal (GI) tract. Despite several decades of research in both animals and humans, current treatments remain disappointing and do not provide a cure. Although novel therapies such as antibodies against TNF- a, revolutionized IBD treatment, not all patients respond to the treatment and initial responders may become unresponsive to treatment over time due to the development of antibody drug antibody (ADA) responses (Dammes et al. Nature Nanotech. 16:1030-1038, 2021).
To establish a curative solution to IBD, blocking cytokines or receptors with antibodies is frequently insufficient and provides only temporary relief of the symptoms. Altering the expression of specific genes in inflammatory leukocytes and thereby changing their behavior may restore the balance in the intestinal immune response for a longer term. The delivery of siRNAs specifically to activation-sensitive receptors expressed on gut-homing leukocytes in a mouse model of colitis was recently demonstrated. This was afforded by using a targeting moiety that only recognizes a specific protein conformation, namely the high-affinity (HA) conformation of integrin a4p7. Gut-homing leukocytes utilize this pivotal intestinal homing receptor to adhere to the intestinal endothelium.
Integrin functionality depends on the conformational state (Yu et al., J. Cell Bio. 196(1): 131-146, 2012). Integrins change conformation when stimulated to result in a dramatic increase in the affinity for their ligands. Integrin a4p7 can bind both Vascular Cell Adhesion Molecule 1 (VCAM-1) for homing to peripheral tissues, and Mucosal Vascular Address in Cell Adhesion Molecule 1 (MAdCAM-1) for homing to intestinal tissues, but not simultaneously. Whether integrin a4p7 has affinity for VCAM-1 or MAdCAM-1 depends on the specific stimulus, subsequent signaling and type of conformational change. As only leukocytes that actively home to the intestinal tissues possess a4p7-integrin in the HA confirmation, targeting the integrin a4p7- expressing cells in a conformation-dependent manner is desirable as opposed to commercially available monoclonal antibodies such as natalizumab and vedolizumab (anti a4p7-integrin) that are conformation-insensitive. To that end, a recombinant fusion protein that contains two domains of the intestinal endothelium ligand MAdCAM-1 were generated. MAdCAM-1 has an increased affinity to integrin α4β7 in its HA conformation and is therefore used in the design of the LNP targeting moiety. MAdC AM- l is a multi-domain protein that is naturally involved in both initial tethering and in firm adhesion of leukocytes to the intestinal endothelium. To maximize specificity, only the integrin binding domains, DI and D2 were used. To protect the integrin binding domains while tethering the protein to the LNPs, a monoclonal secondary antibody against rat IgG2a, herein referred to as RG7, which serves as a linker between the LNPs and the MAdCAM-DlD2 protein was used. The RG7 linker was chemically conjugated to the LNPs using maleimide/thiol chemistry and the MAdCAM-DlD2 protein was recombinantly fused to the Fc region of rat IgG2a. In this manner, the RG7 antibody binds the MAdC AM- 1 protein by affinity to the rat IgG2a domain thus leaving the domains DI and D2 free for binding the a4p7 integrin. This conjugation strategy was compared with two other conjugations, namely direct conjugation of the D1D2 recombinant protein to the DSPE-PEG-maleimide lipid using reduced cysteine residues in the D1D2 protein or by using ASSET.
While chemical conjugation of RG7 IgG to the LNPs was effective in delivering siRNA to leukocytes, the RG7-ASSET-mediated delivery was less effective. To overcome the challenge of successfully delivering siRNA to leukocytes using LNPs into which a lipidated RG7 scFv was incorporated and that bound D1D2-Fc, a LAND based on the construct shown in Figure IB Primary IgG LAND (Primary IgG Targeting with Secondary scFv LAND) where the MAdCAM- D1D2 protein recombinantly fused to the Fc region of rat IgG2a replaced the primary IgG targeting moiety was generated. In the original ASSET design, the scFv was placed immediately following the NlpA lipidation sequence (lipidated peptide portion - SEQ ID NO: 17) and a first 11 amino acids linker (Linker #1; SEQ ID NO: 18) and preceding a second 11 amino acids linker (Linker #2; SEQ ID NO: 21) followed by the functional protein (mCherry - SEQ ID NO: 22), while in LAND, the order of the scFv and mCherry were switched and a novel linker containing 13 amino acids (Linker 3: ASGGSGGGKASGG, SEQ ID No: 1) was generated.
Molecular cloning: the original plasmids for expression of the original ASSET-RG7 protein in E. coli was constructed as described in Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018). All the other plasmids described herein were constructed in a similar manner, using PCR amplification and Gibson assembly (Gibson et al., Nat Methods 6(5): 343-345 2009). For verification, the nucleotide sequences of all the plasmids (before being used for protein production) were determined using the ABI 3500x1 Genetic analyzer (Applied Biosystems, USA) according to the supplier’s recommendations. The coding sequences of all the components were cloned into a pET30a plasmid backbone, carrying Kanamycin resistance. Expression was performed in the E. coli strain Lemo21(DE3) from New England Biolabs. Lemo21(DE3), is an E. coli strain suitable for tunable T7 promoter- controlled expression of challenging recombinant proteins. The sequence of the RG7-LAND open reading frame is set forth in SEQ ID No. 2 (DNA sequence) and SEQ ID No. 3 (amino acid sequence).
The expression and purification of the lipidated RG7-LAND protein was performed as described in Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018) and is detailed herein below.
Materials for production of lipidated scFv micelles
Buffer Al (40 ml for every 500 ml culture): 20 mM Tris pH 8.0 (Dilution x50 from the IM stock solution), 10 mM EDTA (Dilution x50 from the 0.5M stock solution), 4 mg lysozyme (100 pg/ml), protease inhibitor cocktail (cOmplete, Roche).
Buffer A2 (20 ml for every insoluble pellet from 500 ml volume of culture): 20 mM Tris PH
8.0 (Dilution x50 from the IM stock solution), 1% Triton X-100 detergent (25% stock) and
25 150 mM NaCl (5M stock).
Buffer A3 150 mM NaCl, 20 mM Tris pH 8.0, 1.4% octyl glucoside detergent (OG, Sigma (now Roche), Israel).
Production of lipidated scFvs:
Day 1: Lemo21 / pET30a-RA-RG7 cells were grown in 500 ml of LB + 50 qg/ml Kanamycin in a 2L shake flask at 37°C shaking at 240 RPM. When the cells reached an OD600 =0.9, they were induced with 0.5 mM isopropyl P- d-1 -thiogalactopyranoside (IPTG) overnight (ON) at 18°C.
Day 2: The induced cells were collected by centrifugation at 4,000 RPM, 20 min, 4°C SLC3000 Sorvall rotor. The pellet was frozen and kept at -80°C. After 2 h or longer at -80°C, the cell pellet was thawed on ice and suspended in 40 ml of Buffer Al using a cell spreader. After 30 min at RT with intermittent shaking, the cells were broken by homogenization with the large probe of a Tissuemizer (stainless steel blade motorized tissue homogenizer) for 20 sec. Next, the cells were sonicated on ice-water using a large sonicator probe, 3 cycles of 30 sec each, followed by at least 1 min between cycles. To remove the soluble proteins in the lysate, the lysate was spun using Sorvall SS34 tubes in SS34 rotor, 16,000 RPM, 30 min, 4°C. The pellet (which contained the membrane fraction of the lysed E. coli cells as well as other insoluble proteins) was homogenized with the small probe of the Tissuemizer in 20 ml of Buffer A2, 1 min grinding in top speed. Next, to provide complete extraction of the lipidated scFvs from the cell membranes, the extract was sonicated on ice water with the small probe of the sonicator at 50% power (about 5 on the power scale) for 1 min. The extract was further incubated at room temperature (RT), rotated for 30 min followed by centrifugation using Sorvall SS34 tubes 16,000 RPM, 30 min, 4°C. The supernatant was referred to as the Triton fraction (TF). The pellet which contained other insoluble proteins (such as inclusion bodies) was discarded. The Triton fraction was adjusted to 5 mM imidazole (ID). A 1 ml His-Trap column (GE healthcare, life sciences) was equilibrated with ten column volumes (CV) of buffer Al adjusted to 5 mM ID (column loading buffer) loaded with the TF at 0.5 ml/min. The column was washed and eluted at 1 ml/min. The unbound fraction (Ni-FT, shown at the bottom of Figure 2) contained almost the same amount of total protein but no LAND protein. The column was washed with 10 CV of Buffer A2 with 5 mM ID. The column was washed with 10 CV of Buffer A3 with 5 mM ID. The latter wash was performed to replace the Triton X- 100 detergent with the OG detergent. The column was washed with 10 CV of Buffer A3 with 20 mM ID. The column was eluted with 2x5 ml of Buffer A3 with 250 mM ID.
The 10 ml combined eluates were concentrated using Centricon 10000 (Centrifugal Filter Unit, Merck, Israel) spinning at 3,000 RPM in a swing out rotor at 18°C, down to about 2.5 ml. In order to desalt (buffer exchange to Buffer A3 without ID), a 10 ml Zeba desalting column (Thermo Fisher Scientific, USA) was equilibrated with Buffer A3 (x3). Next, the concentrated LAND protein was loaded and recovered by centrifugation. All centrifugations were performed for 2 min at lOOOxg, 4°C. Protein concentration was determined using a protein assay kit (such as Bradford). Measuring by Nanodrop at 280 nm was found to be less reliable at this step. The protein concentration was adjusted to 0.5 mg/ml with Buffer A3.
Cholesterol (Avanti Polar lipids, USA) was added to 250 mM (from a 38.7 mM stock solution in EtOH) and the OG micelles were further rotated at RT for 30 min at 100 RPM. 100 pl aliquots were made and stored at -80°C. The final product obtained was a lipoprotein associated with OG detergent micelles that were stabilized by cholesterol. When these micelles were mixed with LNPs, they become integrated into the LNPs thereby being a permanent component of the LNPs. Aliquots from a typical purification that were analyzed by SDS/PAGE are shown in Figure 2.
Preparation of LNPs
The preparation of LNPs was carried out essentially as described in Kedmi et al. (Nat. Nanotechnol. 13(3): 214-219, 2018). Two types of ionizable lipids were used: Dlin-MC3-DMA (MC3) was synthesized according to Cohen et al. (ACS Nano 9(2): 1581- 1591 , 2015), and EA- PIP (lipid 10) was synthesized according to Ramishetti et al. (Adv Mater 32(12): el906128, 2020). All other lipids were acquired from Av anti Polar lipids. Briefly, one volume of lipid mixture (ionizable lipid, DSPC, Cholesterol, DMG-PEG at 50:10.5:38.5:1.4 mole ratio) in ethanol and three volumes of siRNA (1:16 w/w siRNA to lipid) in an acetate buffer were injected into a microfluidic mixing device Nanoassemblr (Precision Nanosystems, Vancouver, BC) at a combined flow rate of 12 ml/min.
The resultant mixture was dialyzed against phosphate buffered saline (PBS) (pH 7.4) for 16 h to remove ethanol and residual un-incorporated lipids. Cy5-labelled particles were prepared with scrambled control siRNA (siNC) and Cy5- labelled siNC in a 1:1 ratio. ASSET technology was utilized for the preparation of targeted LNPs or isotype control LNPs. Briefly, ASSET or LAND OG micelles were incubated with the LNPs for 48 h at 4°C to allow its incorporation into LNPs (1:36, ASSET or LAND protein: siRNA weight ratio). Typically, 40 ng of purified lipidated scFv in OG micelles were mixed for every 1 pl of LNPs. Lipidated scFv incorporation into LNPs was measured by mCherry fluorescence and by ELISA.
To evaluate cell targeting with original ASSET compared to LAND, a set of experiments was performed. First, comparisons between antigen binding of RG7-ASSET and RG7-LAND to rat IgG2a by ELISA and FACS were made. Next, comparisons between the targeting abilities of the RG7-ASSET and RG7-LAND by D1D2-Fc to TK-1 cells (which express a4p7-integrin on their surface) were made.
Materials for flow cytometry experiments
The cell line: TK-1 (or other cells as described in the Examples). The targeting moiety: D1D2-Fc (MAdCAM fused to rat IgG2a Fc as described in Dammes et al. (Nature Nanotech. 16:1030-1038, 2021)). Isotype control: Rat IgG2a that does not bind the TK1 cells. LNPs: MC3 lipid (+Cy5 fluorescently-labeled siRNA).
FACS samples:
1. Unstained cells (US in all flow cytometry plots)
2. [TK-1 + isotype control] + LNPs-RG7 ASSET
3. [TK-1 + D1D2-Fc] + LNPs-RG7 ASSET
4. [TK-1 + isotype control] + LNPs-RG7 LAND
5. [TK-1 + D1D2-Fc] + LNPs-RG7 LAND
Flow cytometry protocol:
Day 0: ASSET and LAND proteins were added at 40 ng/ml to MC3/Cy5 LNPs. The proteins that were tested:
A. RG7 ASSET
B. RG7 LAND (or other lipidated scFvs as described in the Examples)
The tubes were vortexed briefly and incubated for 48 h at 4°C.
Day 2: TK-1 cells were activated according to Yang et al. (Scand J Immunol 42(2): 235- 247, 1995). Briefly, the activation involved exposing the cells to Mn2+ ions, that cause the conversion of the a4p7 integrin to the HA configuration (compatible with MAdCAM-1 binding). Flow cytometry experiments were performed on a CytoFLEX (Beckman Coulter, USA).
Flow cytometry cell preparation and analysis protocol:
Cells were washed with PBS (0.5-1 Million cells/sample) and collected by spinning at 300xg for 5 min. Cells were then washed in resuspension buffer, 100 l/sample (HBSS (w/o) with 10 mM HEPES buffer, 2 mM CaC12, and 2 mM MgC12). Cells were incubated in pre-incubation buffer (HBSS (w/o) with 10 mM HEPES buffer, and 2 mM EDTA). Cells were incubated for 30 min at RT with gentle rotation (100 pl/sample). ASSET-LNPs or LAND-LNPs were incubated with D1D2-Fc or isotype control at 1 g/sample for 30 min at RT. Cells were washed with PBS to remove the EDTA. Cells were incubated in activation buffer 100 l/sample (full medium with 2 mM CaC12, and 2 mM MnC12) in order to invoke switching 06407 integrin on the surface of the cells to the active conformation to which MAdCAM binds. ASSET-LNPs or LAND-LNPs were immediately added to the cells and left for 20 min on ice. Cells were washed with PBS and analyzed by flow cytometry (Cy5 channel) on a CytoFLEX (Beckman Coulter, USA).
Methods with an anti-EGFR antibody
These experiments were carried out in an almost identical manner, except that the targeted cells were OVCAR8 (EGFR+ human ovarian cancer cell line). The primary antibody was a commercial rat IgG2a anti-human EGFR (anti-hEGFR, clone 30-F11, Bio-Rad).
Results:
A direct comparison between purified OG micelles of RG7-ASSET and RG7-LAND in binding to Fib504 rat IgG2a was first made. As shown in Figure 3 A, RG7-LAND and RG7- ASSET bound with similar (but not identical) affinities, with RG7-LAND having a higher apparent affinity (IC50) of 18 nM while RG7-ASSET had an IC50 of 36 nM. Similar results were obtained when a direct comparison between purified OG micelles of RG7-ASSET and RG7- LAND in binding to anti human EGFR rat IgG2a was made (Figure 4A). The binding of RG7 LAND to anti human EGFR rat IgG2a showed a higher apparent affinity (IC50) of about 80 nM compared to RG7-ASSET binding, showing an IC50 of about 100 nM.
Next, MC3 nanoparticles into which RG7-LAND or RG7-ASSET lipidated scFvs were incorporated were prepared and their performance in directing the Fib504 rat IgG2a-mediated binding to cells was compared. The flow cytometry experiment was carried out as described hereinabove. The results of the flow cytometry are shown in Figure 3B. As shown, the RG7- LAND configuration provided improved binding to the TK-1 cells in the presence of the Fib504 targeting primary antibody as compared to the RG7-ASSET configuration.
A similar experiment, where the primary antibody was the anti-human EGFR rat IgG2a was then performed. The target cells were EGFR+ OVCAR8. MC3 nanoparticles incorporating RG7- LAND or RG7-ASSET proteins were prepared and their performance in directing rat IgG2a- madiated binding to OVCAR8 cells was assessed. The results of the flow cytometry are shown in Figure 4B. As shown, the RG7-LAND configuration provided improved binding to the cells in the presence of the anti-human EGFR targeting primary antibody as compared to the RG7-ASSET configuration.
A further comparison of the performance in directing MAdCAM-1 Dl-D2-Fc-mediated binding to cells was made by flow cytometry. As shown in Figure 5, the D1D2-Fc that was incorporated to LNPs via RG7-LAND enabled binding to activated TK- 1 cells, while incorporation via RG7- ASSET did not.
EXAMPLE 2
“LAND with Primary scFv Targeting” based on the anti-EGFR antibody Erbitux
Lipidated scFvs derived from cell-binding antibodies as shown in Figure 1C (LAND with Primary scFv Targeting) were made. First, Erbitux (Cetuximab) which is based on a therapeutic chimeric monoclonal antibody that binds the human epidermal growth receptor (EGFR) was used. The expression vector was constructed by replacing the RG7 scFv sequence of the LAND Figure IB plasmid with the coding sequence of the scFv of Erbitux. The sequence of the Erbitux-LAND open reading frame is set forth in SEQ ID No. 4 (DNA sequence) and SEQ ID No. 5 (amino acids sequence). Of note, in the “LAND with Primary scFv Targeting” configuration “Linker #3” (depicted in Figure IB) was extended from 13 amino acid residues to 28 amino acid residues (Linker 4: ASGGSGGGKASGGGGGGSGGGGSGGGGS, SEQ ID No. 6). Example 2 is representative of Figure 1C.
The Erbitux-LAND protein was produced and purified as described in the general protocol above and tested for functionality by flow cytometry.
SEQ ID No. 4: Erbitux-LAND (anti-human EGFR) (LAND with Primary scFv Targeting) coding DNA sequence:
SEQ ID No. 5: Erbitux-LAND (anti-human EGFR) (LAND with Primary scFv Targeting) Amino acid sequence:
Method: The flow cytometry experiments were carried out essentially as described in Example 1, except for the use of 0VCAR8 cells (ovarian cancer cell line which is EGFR positive). Cells were not activated by Mn2+. Instead, cells were incubated with LNPs or OG micelles in full medium (containing 10% FBS). Binding of Erbitux-LAND OG micelles to the cells was monitored by measuring mCherry fluorescence. Binding of LAND-integrated LNPs was monitored by measuring the Cy5 fluorescence of the labelled siRNA that was encapsulated in the LNPs.
Results:
As shown in Figure 6, LAND (“LAND with Primary scFv Targeting”) protein micelles and LNPs prepared from two different lipids (EA-PIP and MC3) bound the OVCAR8 cells. These results suggest that the lipidated Erbitux scFv was functional and effective in cell targeting. Furthermore, the specificity of binding of the Erbitux-targeted LNPs was further validated by competition, where the Erbitux mAb was used as a competitor in a flow cytometry experiment. Competition for the binding of Erbitux-LAND-targeted LNPs to the OVCAR8 cells was substantiated. As shown in Figure 7, the binding signal of the Erbitux-LAND targeted LNPs to the OVCAR8 cells was inhibited (shifted to the left) in the presence of the Erbitux mAb compared to the signal obtained in the presence of the anti-VEGF mAb, Avastin, which does not bind these cells, serving as an isotype control.
To further evaluate the potential efficacy of treatments to kill tumor cells with Erbitux-LAND (NlpA-Erb = Erbitux “LAND with Primary scFv Targeting”) compared to Erbitux-ASSET (Erbitux ASSET with Primary IgG targeting), cell viability assays were carried out comparing different EGFR-targeted and isotype-control LNPs . The LNPs contained either siRNA PLK1 (PLK1 is a kinase required for mitosis or negative control siRNA. When PLK1 function is inhibited, G2-M phase cell cycle arrest and cell death in dividing cells occurs (Rosenblum et al., Sci. Adv. 6: eabc9450, 2020). The efficacy of LAND was compared to ASSET under conditions that minimized non-specific internalization of LNPs (4 °C) and under standard conditions (37 °C). OVCAR8 cells were treated with EA-PIP LNPs in vitro for 1 h at 4 °C with 2 pg/ml LNPs (where non-specific LNP internalization is minimized), washed to remove LNPs that were not internalized, replenished with fresh medium and cultured for 72 h, when cell viability was evaluated using a XTT assay.
The results are shown in Figure 8. In Figure 8 A, treating 0VCAR8 cells with LNPs for 1 hr at 4°C reduces non-specific uptake of LNPs, mostly reflecting antibody-mediated internalization of said LNPs. Under these conditions, LNPs targeted by Erbitux-LAND and encapsulating siPLKl were more potent than LNPs targeted by RG7-LAND, serving as a negative control. More importantly, LNPs targeted by Erbitux-LAND were statistically more potent than LNPs targeted by RG7-LAND combined with an anti-EGFR primary antibody (ASSET Primary IgG Targeting). This demonstrates that using the “LAND with Primary scFv Targeting” approach of Erbitux-LAND facilitates a more efficient antibody mediated LNP internalization than the original ASSET with Primary IgG targeting mAb. This result is most unexpected as complete IgG molecules are known to have higher avidity than their corresponding scFv fragments (or scFvs derived from an IgG with similar affinity and specificity, as in the present case). The statistically superior efficacy of Erbitux-LAND (NlpA-Erb) compared to Erbitux- ASSET was also demonstrated under standard conditions (37°C) as shown in Figure 8B. Unexpectedly, under both conditions that minimized non-specific LNP internalization (4°C Figure 8A) and under standard conditions (37°C Figure 8B), LAND targeted LNPs (NlpA-Erb) demonstrated statistically significant increased efficacy compared to ASSET targeted LNPs (ASSET-EGFR) (* p <0.05; ** p <0.01; ***p <0.005; ****p <0.001).
The statistically superior efficacy of Primary scFv LAND with primary scFv targeting compared the previous ASSET compositions (see Figure 1G) is surprising as complete IgG molecules with two antigen binding sites used in ASSET are known to have higher avidity than scFv fragments used in LAND with primary scFv targeting.
To study the potential of Erbitux-LAND to treat a cancer model in vivo, an OVCAR8 xenograft model in nude mice was used. Xenografts were induced by injecting 3xl06 OVCAR8 cells expressing mCherry suspended in 200 pl PBS intraperitoneally into 8-10-weeks old female athymic nude mice on day 0.
On day 14, mice were imaged by In Vivo Imaging System IVIS-Lumina III (Perkin Elmer, USA) and divided into groups so that the tumor burden, based on the mCherry signal, was homogeneously distributed between the groups.
For the cell uptake study, EA-PIP LNPs encapsulating siNC (negative control, siRNA that does not silence any gene in these cells) labeled with Cy5 were injected intraperitoneally at 0.75 mg/kg, in a total volume of 200 pl/mouse. Mice were given a single dose on day 18, and tumors were recovered 4 h after injection and analyzed for LNPs uptake by flow cytometry. The gating strategy and cell uptake ratios are shown in Figure 9.
Flow cytometry data was analyzed to determine the ratio of mCherry+ cells positive for Cy5 (tumor cells that had LNP uptake) and the ratio of CD45+ cells positive for Cy5 (mouse leukocytes that had LNP uptake). As shown in Figure 9, no statistical significance was observed between any of the groups. However, a trend of preferential uptake by tumor cells was observed in the Erbitux-LAND (marked as NlpA-Erb in Figure 9) group, compared to its control (NlpA- RG7) and compared to ASSET-EGFR.
The ability of different EGFR targeted LNPs to cause gene silencing in tumors in vivo was evaluated. LNPs encapsulating siPLKl or control siRNA were injected intraperitoneally at 0.75 mg/kg, in a total volume of 200 pl/mouse. The mice were given a single dose on day 16. The extent of PLK1 silencing in tumor was determined by RT-PCR. Tumors were recovered at day 18 for RNA extraction.
As shown in Figure 10, the “Original ASSET” approach showed improved selectivity in tumor uptake compared to isotype control in this model. Tumors from mice treated with siPLKl LNPs targeted by Erbitux-LAND (marked as NlpA-Erb in Figure 10) had less PLK1 mRNA levels compared to control NlpA-RG7. Such selectivity was not seen in mice treated with LNPs targeted by RG7 ASSET protein combined with a rat IgG2a anti human EGFR or isotype control. Consistent with the in vitro results shown in Figure 8, the in vivo data in Figure 10 was also surprising as complete IgG molecules are known to have higher avidity than the monovalent scFv fragments. Only the Erbitux-LAND construct but not the ASSET-EGFR construct demonstrated statistically significant efficacy compared to their controls.
Taken together, the experiments demonstrate that LAND with Primary scFv Antigen Targeting has statistically superior efficacy, when compared to the original ASSET LNPs which utilize a lipidated secondary scFv and Primary IgG Antigen Targeting. In addition to its superior efficacy, to the fact the LAND is simpler in configuration, renders it an attractive approach for LNP targeting with a lipidated primary scFv compared to ASSET which requires both a lipidated scFv (secondary) combined with a primary IgG. Importantly, the superior efficacy results of LAND with Primary scFv Targeting are surprising as complete IgG molecules are known to have higher avidities than the monovalent scFv fragments used in LAND with primary scFv targeting (or scFvs derived from an IgG with similar affinity and specificity, as in the present case). The ability to obtain superior or equivalent efficacy with primary scFv targeting (LAND) compared to secondary scFv targeting (ASSET) is important because secondary scFv targeting requires the production and binding of an additional targeting IgG antibody substantially adding to the complexity and cost of manufacturing the final product. EXAMPLE 3
“LAND with Primary scFv Targeting” based on the anti-CD38 antibody THB-7”
To further evaluate the general applicability of LAND with Primary scFv Targeting, LAND scFv primary targeting constructs based on the anti-CD38 antibody THB-7 were tested. This is a further example corresponding to composition type “C” shown in Figure 1C that contains a functional protein and a “primary” scFv sequence with specificity for an antigen expressed on the cell type to be targeted for therapy. CD38 is expressed on the surface of immature hematopoietic cells, including immature B cells. Its expression is tightly regulated during B-cell ontogeny. It is expressed on bone marrow precursors, but not on mature B cells. Also, CD38 is overexpressed in many B cell malignancies, including mantle-cell lymphoma (MCL) and multiple myeloma (MM) cells. CD38 has been shown to be a suitable target for antibody-mediated delivery of therapeutic siRNAs to MCL. siRNA-LNPs coated with an anti-CD38 monoclonal antibody (the anti CD38 mAb THB-7) showed specific MCL binding in vitro (in MCL cell lines and MCL primary lymphomas) and in vivo (in mice xenografted with a human MCL cell line) (Weinstein et al., PNAS 113(1): E16-22, 2016), where THB-7 mAb was chemically conjugated to the MC3 LNPs.
“LAND with Primary scFv Targeting” THB-7 based lipidated scFv (THB-7-LAND) was prepared similarly to Erbitux-LAND “LAND with Primary scFv Targeting” based on Figure 1C. The sequence of the THB-7 LAND open reading frame is set forth in SEQ ID No. 7 (DNA sequence) and SEQ ID No. 8 (amino acid sequence). The lipidated THB-7 scFv were incorporated into EA- PIP LNPs and evaluated for their binding to CD38+ Z138 (MCL) and CAG (MM) cells by flow cytometry.
SEQ ID No. 7: THB-7-LAND (anti-CD38) (LAND with Primary scFv Targeting) coding DNA sequence:
SEQ ID No. 8: THB-7-LAND (anti-CD38) (LAND with Primary scFv Targeting) Amino acids sequence:
Method: The Flow cytometry experiment was carried out as follows:
Materials for the flow cytometry experiments:
The cell lines: CAG and Z138
The targeting moiety: THB-7 LAND Isotype control: RG7 LAND LNPs: EA-PIP lipid (+Cy5 fluorescently-labeled siRNA)
FACS samples:
1. Unstained (US);
2. CAG/Z138 + LNPs with RG7-LAND;
3. CAG/Z138 + LNPs- with THB-7-LAND;
4. CAG/Z138 + RG7-LAND OG micelles (+ Anti His-PE antibody for detection of the LAND protein contained in the OG micelles);
5. CAG/Z138 + THB-7-LAND OG micelles (+ Anti His-PE antibody).
Day 0: RG7-LAND and THB-7-LAND proteins were added at 40 ng/ml (for Z138 cells) and at 60 ng/ml (for CAG cells) to EA-PIP/Cy5 LNPs. The tubes were vortexed briefly and incubated for 48 h at 4°C.
Day 2: Flow cytometry experiments were carried out on a CytoFLEX (Beckman Coulter, USA).
FACS protocol:
Cells were washed with PBS (0.5-1 million cells/sample) and spun at 300xg for 5 min. Cells were then incubated with full medium, containing one of the following: RG7-LAND -LNPs, THB-7-LAND-LNPs, or LAND micelles for 20 min on ice. Cells were washed with PBS. 1 pg of anti His-PE antibody diluted in FACS buffer (1% BSA + PBS) was added to the cells incubated with LAND micelles and incubated for 30 min on ice. Cells were washed with PBS and flow cytometry was carried out (Cy5 channel was read).
Results: As shown in Figure 11, similarly to the Erbitux-LAND, protein micelles and EA- PIP LNPs incorporated with the THB-7-LAND (labeled in as ASSET-THB7 in Figure 11A and 11C) bound the Z138 (MCL) and CAG (MM) cells while control RG7 OG micelles or LNPs (labeled in as ASSET-RG7 in Figure 11A and 11C) did not. These results demonstrate the functionality and effectiveness of the lipidated THB-7 scFv in targeting subtypes of hematopoietic cells and specifically malignant B cells.
EXAMPLE 4
Example 4 evaluates additional LAND constructs, (in which the linkers do not encode a separate functional protein (e.g. detectable protein)) and their potential for therapeutic applications. Example 4 is representative of Figure “ID” and “IE”.
These LAND expression vectors are constructed by replacing the mCherry coding sequence pET30a RG7 expression plasmid with the coding sequence of a 45 amino acids long linker, as shown schematically in Figure ID and I E. The sequence of the RG7-LAND “long linker” of 69 amino acids spans between the lipidation peptide to the scFv (Linker #5 in Figures ID and IE); (SEQ ID No. 10 protein sequence, SEQ ID NO: 9 DNA sequence).
An example of a construct shown in Figure IE involving long linkers with scFv specificity for the EGFR antigen recognized by Erbitux is:
SEQ ID No. 15 is an exemplary Erbitux-LAND “long linker” (anti-human EGFR) coding DNA sequence.
SEQ ID No. 16 is an exemplary Erbitux- LAND “long linker” (anti-human EGFR) Amino acid sequence.
Another example of a construct shown in Figure IE involving long linkers with scFv specificity is provided below with specificity for the CD38 antigen recognized by THB-7 is:
SEQ ID No 17. THB-7-LAND “long linker” (anti-CD38) coding DNA sequence.
SEQ ID No 18. THB-7-LAND “long linker” (anti-CD38) Amino acid sequence.
In a representative experiment, the RG7-LAND “long linker” protein was expressed in E. coli and purified by His- Trap Ni-NTA chromatography as described above for the other LAND proteins. The purified RG7-LAND and RG7-LAND “long linker” in OG micelles were evaluated for binding Fib504 (a rat IgG2a anti human P7 integrin, to which the RG7 scFv binds) by ELISA. The ELISA was carried out as follows: 96-well ELISA plates (Nunc, Sweden) were coated with 5 pg/ml of antigen (Fib504 rat IgG2a, to which RG7 binds) diluted in PBS for ON at 4°C. After one wash with PBS containing 0.05% Tween 20 (PBST), the plates were blocked with 3% skim milk in PBS for 1 hr at 37°C. After another wash with PBST, an initial concentration of the high concentration (50 nM) of purified LAND protein in OG micelles were applied onto the plates with 3-fold serial dilution. The plates were incubated 1 hr at RT. Next, the plates were washed 3 times with PBST and the appropriate HRP-conjugated secondary Ab was added (HRP-conjugated anti His tag antibody) diluted x5000 in PBST and incubated for 1 hr at RT. Following 3 additional washes with PBST, the ELISA was developed with TMB peroxidase-substrate solution until color developed. Color development was terminated with the addition of 1 M H2SO4 and the absorbance was measured at 450 nm by EMax® Plus microplate reader (Molecular Devices, USA).
The results are shown in Figure 12. As shown, RG7-LAND “long linker” (IC50 of 4 nM) showed better binding to rat IgG2a as compared to RG7-LAND (IC50 of 8 nM), suggesting successful design of the long linker in terms of functionality of the LAND protein in antigen binding.
Next, EA-PIP LNPs were prepared with RG7-LAND or with RG7-LAND “long linker”. Their binding to TK-1 cells (expressing P7 integrin) in the presence of the Fib504 (anti- P7 integrin) rat IgG2 or in the presence of an isotype control was evaluated by flow cytometry. The flow cytometry was carried out as described above in Example 1 with the following differences: Cells were not activated by Mn2+ but instead were incubated with LNPs or OG micelles in full medium (containing 10% FBS). The results are shown in Figure 13. As shown, RG7-LAND “long linker” (marked in Figure 13 as “LL FIB) bound better compared to RG7-LAND (marked in Figure 13 as “WT FIB), further suggesting successful design of the long linker in terms of functionality of the LAND with a “long linker” protein in antigen binding.
Taken together, the results show that LNPs that were prepared with RG7-LAND “long linker” bind the cells better than LNPs that were prepared with the original (mCherry containing) RG7-LAND. Thus, the design of the long linker was successful in terms of functionality of the LAND protein in antigen binding.
EXAMPLE 5
To demonstrate the potential of LAND Primary scFv Targeting for gene editing applications, cell viability experiments similar to those described in Example 2 were conducted comparing tumor-targeted Primary scFv and isotype-control LNPs. Tumor cells expressing one of the Primary scFV listed in Table 1 were used for targeting but instead of carrying PLK1 siRNA and controls, they delivered an mRNA encoding the CRISPR base editor BE3 with guide RNAs for PLK1 regions to convert CAA, CAG, CGA, and TGG codons into STOP codons when the targeted bases are at the correct distance (13-17 bps) from a protospacer adjacent motif (PAM). The following guide RNAs, genomic coordinates, and target codons for PLK1 were utilized — the lower case base in the PAM:NGG column denotes the targeted base for editing:
Table 8
Control groups include LNPs omitting or with irrelevant guide RNAs or with uncoated LNPs or LNPs with lipidated isotype control scFV. The methods for preparing the anti-tumor scFV LAND LNPs are described in Examples 1-4 while the methods for performing the cell viability assays are described in Example 2. Consistent with experiments in Example 2, LAND with Primary scFv Targeting shows statistically significant increased efficacy compared to controls demonstrating the utility of LAND for gene editing applications incorporating deactivated CRISPR/Cas systems such as base editors.
To further demonstrate the potential of LAND Primary scFv Targeting for gene editing applications, cell viability experiments similar to those described in Example 2 and Example 5 were conducted evaluating tumor-targeted Primary scFv LAND LNPs delivering a mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a guide RNA to suppress the function of a gene that promotes tumor growth. To show the ability of THB-7 (anti-CD38 scFV) LAND LNPs to treat CD38+ hematopoietic cancers, we employed a representative CD38 expressing mantle cell lymphoma MCL Z138 tumor model. In these studies, a MCL Z138 tumor cell viability assay was carried out with anti-CD38 scFV LAND LNPs carrying a mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a single guide RNA for SOX11 which is cancer promoting gene in MCL. Control groups consisted of untreated MCL Z138 cells and treatment with identically prepared anti-CD38 scFV LAND LNPs but with single guide RNAs to irrelevant target genes (GFP and HPRT). The following single guide RNAs were utilized: i.SOXl l - SEQ ID No. 38 GGCGGTGCCAAGACCTCCAA ii.PLKl - SEQ ID No. 39 ACCTCGGGAGCTATGTAATT iii.EGFP - SEQ ID No. 40 GACCAGGAUGGGCACCACCC and SEQ ID No. 41 CCGGCAAGCTGCCCGTGCCC iv.HPRT - SEQ ID No. 42 AATTATGGGGATTACTAGGA
The methods for preparing the anti-CD38 scFv LAND LNPs are described in Example 3 while the methods for performing the cell viability assays are described in Example 2. As shown in Figure 14, there is a statistically significant decrease in viability for the MCL tumor cells treated with CD38-LNP(sgSOX11) compared to all of the control treatments demonstrated by ANOVA (p < 0.05). In the CD38-LNP(sgSOX11) treatment group, cell viability was less than 10% compared to greater than 90% in the control CD38-LNP(sgGFP), CD38-LNP(sgHPRT) and untreated groups. These results indicate that LAND Primary scFv Targeted LNPs can deliver CRISPR/Cas gene editing components to suppress the function of a gene that promotes tumor growth for efficacious tumor therapy. To demonstrate efficacy of LAND for CD33 positive disorders including but not limited to acute myelogenous leukemia (AML) and myelodysplastic syndromes (MDS), similar experiments are performed in representative CD33 expressing hematopoietic cells such as HL60 and MV4-11. In these studies, HL60 or MV4-11 tumor cell viability assays are carried out with anti-CD33 scFv LAND LNPs carrying a mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a single guide RNA for PLK1 which is an essential gene in AML and MDS. Control groups consisted of untreated HL60 and MV4-l lcells and treatment with identically prepared anti-CD33 scFv LAND LNPs but with single guide RNAs to irrelevant target genes (GFP and HPRT). The methods for preparing the anti-CD33 scFv LAND LNPs are described in Example 3 while the methods for performing the cell viability assays are described in Example 2. There is a statistically significant decrease in viability for CD33 expressing tumor cells treated with CD33-LNP(sgPLKl) compared to all of the control treatments demonstrated by ANOVA.
EXAMPLE 6
To further demonstrate the potential of LAND Primary scFv Targeting for gene editing applications, in vivo experiments were conducted comparing tumor-targeted and isotype-control LNPs delivering an mRNA encoding a CRISPR associated (Cas) nuclease (Cas9) with a guide RNA to suppress the function of a gene that promotes tumor growth. The same single guide RNA sequences described in Example 6 were also utilized for the in vivo experiments described in Example 7. To show the ability of anti-CD38 THB-7 LAND to treat CD38+ hematopoietic cancers in vivo, we employed representative CD38 expressing mantle cell lymphoma animal models MCL Z138. Z138 tumor cells (approximately 1 x 106 cells) are injected intravenously into SCID mice (n=8 to 10 animals/group). In these studies, IV treatment is initiated after tumor establishment 10 and 15 days after tumor inoculation with LAND LNPs prepared as described in Example 3 at a dose of 0.5 mg/kg containing a Cas9 mRNA and single guide RNA for SOX11— CD38- LNP(sgSOXl l). Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs. Specifically, the control LNP vectors are CD38-targeted LNPs containing a Cas9 mRNA and single guide RNA for green fluorescent protein (GFP)— CD38- LNP(sgGFP); Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for SOX11— Iso-LNP(sgSOXl 1) and Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for GFP— Iso-LNP (sgGFP). To demonstrate the efficacy of LAND for CD33 positive disorders including but not limited to acute myelogenous leukemia (AML) and myelodysplastic syndromes (MDS), similar experiments are performed with representative CD33 expressing hematopoietic animal tumor models such as HL60 and MV4-11. HL60 and MV4-11 tumor cells (approximately 1 to 5 x 106 cells) are injected intravenously or subcutaneously into immune deficient mice (n=8 to 10 animals/group). In these studies, IV treatment is initiated after tumor establishment 10 and 15 days after tumor inoculation with LAND LNPs prepared as described in Example 3 at a dose of 0.5 mg/kg containing a Cas9 mRNA and single guide RNA for PLK1 — CD33-LNP(sgPLKl). Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs. Specifically, the control LNP vectors are CD33- targeted LNPs containing a Cas9 mRNA and single guide RNA for green fluorescent protein (GFP)— CD33-LNP(sgGFP); Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for PLK1— Iso-LNP(sgPLKl) and Isotype control scFv LNPs containing a Cas9 mRNA and single guide RNA for GFP— Iso-LNP (sgGFP).
There is a statistically significant increased survival for the group treated with the LAND tumor targeted LNP (sgSOXl 1) compared to all of the control treatments demonstrated by Kaplan- Meier curves and log rank test. As shown in Figure 15, there is a statistically significant increased survival for the group treated with CD38-LNP(sgSOXl 1) compared to all of the control treatments demonstrated by Kaplan-Meier curves and log rank test (p < 0.0001). In the CD38- LNP(sgSOXl l) group, 90% of the animals were alive at day 50 while all animals the control groups had died before day 40. These in vivo results are consistent with the in vitro data shown in Example 6 and further indicate that LAND Primary scFv Targeted LNPs can deliver CRISPR/Cas gene editing components to suppress the function of a gene that promotes tumor growth for efficacious tumor therapy.
To further demonstrate the potential of LAND Primary scFv Targeting for both safe and effective gene editing, the percentage of gene editing was evaluated in sorted tumor cells extracted from tumors and normal liver (hepatocytes and macrophages) following in vivo therapy in the same representative hematopoietic tumor model used in Example 3. In these studies, IV treatment is initiated after tumor establishment with LAND LNPs at a dose of 2.0 mg/kg containing a Cas9 mRNA and single guide RNA for SOX11— CD38-LNP(sgSOXl l) prepared as described in Example 3. Control groups include mock treatment and LNP vectors with either irrelevant scFv specificity or irrelevant sgRNAs as described in Figure 15. As additional controls, mice (N = 5 / group) were treated with a single intravenous administration of doxorubicin (DOX) at 1 mg/Kg or 2.5 mg/Kg doses. Following treatment, genomic DNA was extracted from MCL tumor cells and normal liver cells and analyzed for INDELs by next generation sequencing (NGS).
Genomic DNA from single-cell suspension sections of MCL (GFP+ 005) cells was extracted with QuickExtract DNA Extraction Solution (Lucigen Inc.) using the manufacturer’s protocol, and amplification was performed using locus -specific primers containing universal tails to add sample-unique P5 and P7 indexes for Illumina sequencing in two rounds of polymerase chain reaction (PCR). Following PCR, a lx SPRI (Solid Phase Reversible Immobilization) bead cleanup and library quantification by quantitative PCR (IDT) were performed before sequencing. PCR amplicons were sequenced on an Illumina MiSeq instrument [v2 chemistry; 150-base pair (bp) paired-end reads; Illumina, San Diego, CA, USA]. Data were analyzed using a custom-built pipeline. Data were demultiplexed (Picard tools v2.9; githubdotcom/broadinstitute/picard); forward and reverse reads were merged into extended amplicons (flash v 1.2.11); reads were aligned against the GRCh38 genomic reference (bwa mem vO.7.15), assigned to targets (bedtools tags v2.25). Reads, with more than 30% of bases with quality target, custom python identified INDELs based on gapped alignments between reads and targets, and editing was calculated as the percentage of total reads containing an INDEL within an 8-bp window of the cut site. The results are shown in Figure 16A and reveal that 95% of the tumor cells are edited by the treatment with single guide RNA for SOX11— CD38-LNP(sgSOXl l) compared to 0 to 4 percent of tumor cells in the control groups which include either untreated animals or treatment with similarly prepared LNP vectors with irrelevant sgRNAs as described in Figure 15. These differences are statistically significant by One-way analysis of variance (ANOVA) with Tukey multiple comparison test. **P<0.001.
The superiority of LAND compared to standard chemical conjugation antibody LNP targeting methods was also demonstrated for gene editing treatment in vivo. In these evaluations an additional treatment group was tested utilizing anti-CD38 targeted LNPs prepared using chemical conjugation methods. The chemically conjugated CD38 targeted LNPs (chemical CD38- LNPs-sgSOXl l) utilized the identical lipids, Cas9 mRNA and SOX11 sgRNA as described in Figure 16 A. Chemical conjugation of the anti-CD38 to the LNPs was performed as previously described in Tarab-Ravski et al 2023. Briefly, anti-human CD38 IgG antibody (clone THB-7, BioXCell) was reduced with 1 x 103 m dithiothreitol (Sigma-Aldrich) and 5 x 103 m EDTA (Sigma- Aldrich) for 1 h at room temperature. Dithiothreitol was later removed by using 7K Zeba spin desalting column (ThermoFischer Scientific) according to manufacturer protocol and the reduced antibody was immediately added to the LNPs at a ratio of 1:40.7 antibody to LNPs (mg/mg) and incubated for 2 h at room temperature with gentle shaking and overnight at 4 °C. To remove free un- conjugated mAbs, LNPs were loaded on CL4B Sepharose beads (Sigma- Aldrich) and purified by gravity fed gel filtration chromatography column (BioRad Laboratories) using PBS as a mobile phase. The fractions were collected with a FC-203B fraction collector (Gilson) and the anti-CD38 LNP fractions were collected and concentrated with 100K Amicon tubes (Millipore) to original volume. IV treatment with chemical CD38-LNPs-sgSOXl l was similarly initiated after tumor establishment at a dose of 2.0 mg/kg and the results compared to those obtained with the same treatment groups described in Figure 16A. As shown in Figure 16B, there was a statistically significant increase in tumor gene editing for LAND CD38-LNPs-sgSOXl lvs. chemical CD38- LNPs-sgSOXl l (>95% vs. <40%). In addition, there was significantly less “off tumor” gene editing in normal liver cells (hepatocytes and macrophages) for the LAND vs. chemical conjugation LNP treatments (<4% vs. >40%). Both of these differences were statistically significant by analysis of variance (ANOVA) with Tukey multiple comparison test (p<0.0005). The substantially superior results for LAND vs. chemical conjugation antibody targeted LNPs are unexpected as the lipidated scFv antibody utilized in LAND has only one binding site compared to two binding sites for antibodies used for the chemically conjugated LNPs.
As shown in Figure 16B, the superiority of LAND compared to standard chemical conjugation antibody LNP targeting is demonstrated for therapeutic applications. In these evaluations an additional treatment group was tested utilizing anti-CD38 LNPs prepared using chemical conjugation methods. The chemically conjugated CD38 targeted LNPs (chemical CD38- LNPs-sgSOXl l) utilized the identical lipids, Cas9 mRNA and SOX11 sgRNA as described in Figure 16 A. Chemical conjugation of the anti-CD38 to the LNPs was performed as previously described Tarab-Ravski et al 2023. IV treatment with chemical CD38-LNPs-sgSOXl 1 is similarly initiated 10 days after tumor establishment at a dose of 2.0 mg/kg and the results compared to those obtained with the same treatment groups described in Figure 16A. As shown in Figure 16B, there is a statistically significant increase in tumor gene editing for LAND CD38-LNPs- sgSOXl Ivs. chemical CD38-LNPs-sgSOXl 1 (>95% vs. <40%). In addition, there is significantly less “off tumor” gene editing in normal liver cells (hepatocytes and macrophages) for the LAND vs. chemical conjugation LNP treatments (<4% vs. >40%). Both of these differences are statistically significant by analysis of variance (ANOVA) with Tukey multiple comparison test (p<0.0005). The substantially superior results for LAND vs. chemical conjugation antibody targeted LNPs are unexpected as the lipidated scFv antibody utilized in LAND has only one binding site compared to two binding sites for antibodies used for the chemically conjugated LNPs.
As shown in Figure 16C, the superior safety of LAND compared to standard chemotherapy is demonstrated. In these evaluations, additional control groups (N = 5 / group) were treated with a single intravenous administration of doxorubicin (DOX) at 1 mg/Kg or 2.5 mg/Kg doses. These doses are generally in the range used clinically. Following treatment, genomic DNA was extracted from normal liver cells and analyzed for INDELs by next generation sequencing (NGS). Surprisingly, there is an order of magnitude less “off tumor” gene editing in normal liver cells for LAND (<4% Figure 16B) compared to standard chemotherapy that resulted in >50%) INDELs (Figure 16C doxorubicin 2.5 mg/Kg).
EXAMPLE 7
To further demonstrate the safety of LAND Primary scFv treatment, liver toxicity and the percentage of gene editing was evaluated in normal hepatocytes following in vivo administration in normal mice. In these studies, anti-EGFR LAND LNPs at a dose of 2.0 mg/kg containing a Cas9 mRNA and single guide RNA for PLK1— EGFR-LNP(sgPLKl) was administered IV. Control groups include untreated animals and LNP vectors with irrelevant GFP sgRNAs as described for Figure 15. Serum liver enzyme levels and the percentage of gene edited liver hepatocytes and macrophages are determined as described in Figure 16. As shown in Figure 17, the percentage of liver edited cells was low and there was no significant difference between the anti-EGFR LAND LNPs with single guide RNA for PLK1— EGFR-LNP(sgPLKl) and control groups treated with anti-EGFR LAND LNPs with single guide RNA for an irrelevant sgRNA to GFP as described for Figure 16. There was no negative effect on serum liver enzymes which are similar in all treatment groups to untreated animals. The results in Example 7 (Figure 16) and Example 8 (Figure 17) utilizing LAND constructs to very different antibody targets revealed very high levels of specific gene editing with minimal effects in normal tissues supporting the general applicability of the technology.
Summary: The cellular and disease models are representative of clinical tissue and cellular targets that are suitable for LAND treatments. In particular, the in vivo disease models are highly aggressive and known to be generally resistant to conventional therapies. The statistically superior efficacy of LAND antibody targeted LNP compositions and methods (which have one antigen binding site per targeting molecule) are unexpected compared to ASSET and chemically conjugated antibody targeted LNPs which have two antigen binding sites per targeting molecule. The statistically superior efficacy of LAND is demonstrated for a broad range of RNA therapeutics including but not limited to siRNA, mRNA, and gene editing treatments for a wide variety of antigen targets and diseases.
EXAMPLE 8
Primary Fab LAND (LAND with Primary Fab Targeting-Erbitux-Fab-LAND)
The ASSET and LAND proteins shown thus far all contained a secondary or a primary scFv. To further demonstrate the robustness and flexibility of LAND, we prepared and evaluated LAND proteins where a Fab’ was used for cell targeting. These are referred to as “Primary Fab LAND (LAND with primary Fab targeting)”.
Figure IF illustrates the system used in Examples 8 and 9. The vector in this system comprised two expression cassettes, each controlled separately at the transcriptional level by a T7 promoter, a configuration known by the name “pET-Duet” (biocomparedotcom/Product- Reviews/40993-Co-expression-with-pETDuet-l -Duet-Expression-System- From-Novagen/). When protein expression is induced (with IPTG), the two proteins are exported separately across the inner membrane. The heavy chain part that contains the CDQSSS (SEQ ID NO: 17) lipidated peptide portion is inserted into the periplasmatic side of the inner membrane. The light chain that contains the C-terminal HIS-tag is exported to the periplasmatic space as a soluble protein and assembles with the heavy chain part to form a Fab. Only a complete Fab that contains both the lipidated heavy chain (Fd) part assembled with the light chain can be extracted from the membrane fraction using detergent and purified by Ni-NTA affinity chromatography. Free light chain protein is removed as part of the soluble fraction before detergent extraction, while free Fd does not contain a HIS-tag, so does not bind to the Ni-NTA column.
The first expression cassette for preparing a Fab contains the protein-coding part the NlpA leader sequence (SEQ ID NO: 20), the lipidation sequence (SEQ ID NO: 17), l laa linker 1 (SEQ ID NO: 18), mCherry as the “functional protein (SEQ ID NO: 22), 28aa linker #4 (SEQ ID NO: 6), the VH of Erbitux and a CHI domain of human IgGl constant domain.
The sequence of the Erbitux-Fab-LAND open reading frame of the heavy chain part is set forth in SEQ ID No. 23 (DNA sequence) and SEQ ID No. 24 (amino acid sequence).
The second expression cassette for preparing a Fab contains in the protein-coding part of a pelB leader sequence followed by the open reading frame of Erbitux kappa light chain, ending with a hexa-histidine tag (to allow purification by Ni-NTA affinity chromatography.
The sequence of the Erbitux-Fab-LAND open reading frame of the light chain part is set forth in SEQ ID No. 26 (DNA sequence) and SEQ ID No. 27 (amino acid sequence). The Erbitux- Fab-LAND protein was produced and purified as described in the general protocol above and tested for functionality by flow cytometry.
Method: The flow cytometry experiments were carried out essentially as described in Example 2 (where “primary Erbitux scFv LAND was tested), with 0VCAR8 cells. Cells were incubated with OG (Octyl glucoside) micelles in full medium (containing 10% FBS). Binding of Erbitux-LAND OG micelles to the cells was monitored, instead of following the mCherry fluorescent signal (as was done in EXAMPLE 2), by adding APC anti His-tag secondary antibody to the cells and left for 30 minutes on ice. Cells were washed with PBS. Finally, the cells were analyzed by flow cytometry (APC channel) on a CytoFLEX (Beckman Coulter, USA).
Results:
As shown in Figure 18, both Erbitux-based purified LAND preparations (“LAND with Primary scFv Targeting” and (“LAND with Primary Fab Targeting”) protein micelles bound the OVCAR8 cells. In this analysis, the Fab constructs were superior to the scFv constructs.
These results suggest that the lipidated Erbitux Fab was functional and effective in targeting and was not inferior to the lipidated Erbitux scFv.
EXAMPLE 9
Primary Fab LAND (LAND with Primary Fab Targeting — THB-7 -Fab-LAND)
The first expression cassette for preparing a Fab contains the protein-coding part the NlpA leader sequence (SEQ ID NO: 20), the lipidation sequence (SEQ ID NO: 17), l laa linker 1 (SEQ ID NO: 18), mCherry as the “functional protein (SEQ ID NO: 22), 28aa linker #4 (SEQ ID NO: 6), the VH of THB-7 and a CHI domain of human IgGl constant domain.
The sequence of the THB-7-Fab-LAND open reading frame of the heavy chain part is set forth in SEQ ID No. 27 (DNA sequence) and SEQ ID No. 28 (amino acid sequence).
The sequence of the Erbitux-Fab-LAND open reading frame of the light chain part is set forth in SEQ ID No. 29 (DNA sequence) and SEQ ID No. 30 (amino acid sequence). The THB-7- Fab-LAND protein was produced and purified as described in the general protocol above and tested for functionality by flow cytometry.
The second expression cassette for preparing a Fab contains in the protein-coding part of a pelB leader sequence followed by the open reading frame of Erbitux kappa light chain, ending with a hexa-histidine tag (to allow purification by Ni-NTA affinity chromatography.
Method: The flow cytometry experiments were carried out essentially as described in Example 3 (where “primary THB-7 scFv LAND was tested), with Z138 cells. Cells were incubated with OG (Octyl glucoside) micelles in full medium (containing 10% FBS). Binding of THB-7-LAND OG micelles to the cells was monitored, instead of following the mCherry fluorescent signal (as was done in EXAMPLE 3), by adding APC anti His secondary antibody was added to the cells and left for 30 minutes on ice. Cells were washed with PBS. Finally, the cells were analyzed by flow cytometry (APC channel) on a CytoFLEX (Beckman Coulter, USA).
Results:
As shown in Figure 19, both THB-7-based purified LAND preparations (“LAND with Primary scFv Targeting” and (“LAND with Primary Fab Targeting”) protein micelles bound the Z138 cells.
The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the spirit and scope of the present invention as described by the claims, which follow.
It is the intent of the applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.

Claims

WHAT IS CLAIMED IS:
1. A composition for delivering a therapeutic or diagnostic agent to a target cell comprising: a lipid nanoparticle encapsulating a therapeutic or diagnostic agent, a primary antibody non-covalently attached to the lipid nanoparticle via a lipidated peptide portion, and a peptide linker attached directly to the primary antibody at one terminus of a linker and the lipidated peptide portion attached to another terminus of the linker, wherein the antibody or antibody fragment is at the distal end from the nanoparticle and binds a target antigen on a target cell.
2. A delivery system composition for delivering a therapeutic or diagnostic agent to a target cell, wherein the delivery system comprises: a lipidated antibody which comprises an antibody attached, via a peptide linker, to a lipidated peptide portion, wherein the peptide linker comprises at least 40 amino acid residues; and a lipid nanoparticle which comprises the therapeutic or diagnostic agent, wherein the lipidated antibody is non-covalently attached to the lipid nanoparticle via the lipidated peptide portion.
3. The composition of claim 1 or delivery system of claim 2, wherein the lipidated peptide portion comprises an inner membrane lipidation signal.
4. The composition or delivery system of any one of claims 1-3, wherein the lipidated peptide portion of said antibody comprises the first two amino acids encoded by the E. coli NlpA gene or the first six amino acids encoded by the E. coli NlpA gene.
5. The composition or delivery system of any one of claims 1-3, wherein the lipidated peptide portion of said antibody is comprised in an inner membrane lipoprotein or fragment thereof selected from the group consisting of: AraH, MglC, MalF, MalG, Mai C, MalD, RbsC, RbsC, ArtM, ArtQ, GliP, ProW, HisM, HisQ, LivH, LivM, LivA, Liv E,Dpp B, DppC, OppB,AmiC, AmiD, BtuC, FhuB, FecC, FecD,FecR, FepD, NikB, NikC, CysT, CysW, UgpA, UgpE, PstA, PstC, PotB, PotC,PotH, Poti, ModB, NosY, PhnM, LacY, SecY, TolC, Dsb,B, DsbD, TonB, TatC, CheY, TraB, Exb D, ExbB and Aas.
6. The composition or delivery system composition of claims 1 or 2, wherein the peptide linker comprises between 40-400 amino acid residues.
7. The composition or delivery system composition of claim 6, wherein the peptide linker comprises between 40-300 amino acid residues.
8. The composition or delivery system composition of any one of claims 1-7, wherein at least 30 % of the amino acid residues of the peptide linker are glycines or serines.
9. The composition or delivery system composition of claim 7, wherein the peptide linker comprises an amino acid sequence as set forth in SEQ ID No. 11.
10. The c omp o s itio n or delivery system composition of claim 9, wherein the linker comprises an amino acid sequence as set forth in SEQ ID No. 12.
11. The delivery system composition of any one of claims 2 to 10, wherein the antibody is a primary antibody comprising an antigen recognition domain capable of binding an antigen expressed by a target cell.
12. The composition or claim 1 or delivery system composition of claim 11, wherein the primary antibody is humanized or human primary antibody.
13. The compo sition of claim 1 or delivery system composition of claim 11 or 12, wherein the primary antibody is selected from the group consisting of anti-CD44, anti- CD34, anti-CD38, anti-Ly6C, anti-CD3, anti-CD4, anti-CD8, anti-CD25, anti-CD47, antiCD 117, anti-CD147, anti-EGFR and anti-integrin 07 antibodies.
14. The compo sition or claim 1 or delivery system composition of claim 11 or 12, wherein the primary antibody is capable of binding an antigen listed in Table 1 and Table 7.
15. The delivery system composition of any one of claims 2 to 10, wherein the antibody is a secondary antibody comprising an antigen recognition domain capable of specifically binding an Fc domain of a primary antibody.
16. The delivery system composition of any one of claims 2 to 10, wherein the antibody is an antibody fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, dsFv and nanobody.
17. The delivery system composition of claim 16, wherein the nanobody is a monovalent or a multivalent nanobody.
18. The delivery system composition of any one of claims 1 to 10, wherein the antibody is a monoclonal antibody.
19. The composition or delivery system composition of any one of claims 1 to 18, wherein the lipidated peptide portion is attached to an N-terminus of the antibody.
20. The composition or delivery system composition of any one of claims 1 to 19, wherein the lipid nanoparticle comprises at least one of an ionizable lipid, a stabilizing lipid, a helper lipid and a PEG-lipid.
21. The composition or delivery system composition of claim 20, wherein the ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, N,N-dimethyl- N',N'-di[(9Z, 12Z)-octadeca-9,12-dien-l-yl] ethane- 1,2-diamine, 2-(di((9Z,12Z)- octadeca-9,12-dien-l-yl)amino)ethyl 4-(4-methylpiperazin-l-yl)propanoate (EA-PIP), Di-oleyl- succinyl-serinyl-tobramycin, Di-oleyl-adipyl-tobramycin, Di-oleyl-suberyl- tobramycin, Di-oleyl- sebacyl-tobramycin, Di-oleyl-dithioglycolyl-tobramycin, monocationic lipid N-[l-(2,3- Dioleoyloxy)]-N,N,N-trimethylammonium propane (DOTAP), BCAT O-(2R-l,2-di-O-(l'Z, 9'Z- octadecadienyl)-glycerol)-3-N-(bis-2- aminoethyl)-carbamate, BGSC (Bis-guanidinium- spermidine-cholesterol), BGTC (Bis-guanidinium-tren-cholesterol), CDAN (N1 -cholesteryl oxycarbony 1-3,7-diazanonane- 1,9-diamine), CHDTAEA (Cholesteryl hemidithiodiglycolyl tris(amino(ethyl)amine), DCAT (O-(l,2-di-O-(9'Z-octadecanyl)-glycerol)-3-N-(bis-2-aminoethyl )-carbamate), DC-Chol (3β [N-(N', N'-dimethylaminoethane)-carbamoyl] cholesterol), DLKD (0,0'- Dilauryl N-lysylaspartate), DMKD (O,O'-Dimyristyl N-lysylaspartate), DOG (Diolcylglycerol, DOGS (Dioctadecylamidoglycylspermine), DOGSDSO (1,2-Dioleoyl- sn- glycero-3-succinyl-2-hydroxyethyl disulfide ornithine), DOPC (l,2-Dioleoyl-sn-glycero-3- phosphocholine), DOPE (l,2-Dioleoyl-sn-glycerol-3-phosphoethanolamine, DOSN (Dioleyl succinyl ethylthioneomycin), DOSP (Dioleyl succinyl paromomycin), DOST (Dioleyl succinyl tobramycin), 1,2- Uiolcoyl-3 -trimethyl ammoniopropane, DOTMA (N'[l-(2,3-
Dioleyloxy)propyl]-N,N,N-trimethvlammonium chloride), DPPES (Di-palmitoyl phosphatidyl ethanolamidosperminc), DDAB and DODAP, or any combination thereof.
22. The composition or delivery system composition of claim 21 , wherein the ionizable lipid is selected from the group consisting of DLinDMA, DLin-MC3-DMA, DLin-KC2-DMA, 2- (di((9Z,12Z)- octadeca-9,12-dien-l-yl)amino)ethyl 4-(4-methylpiperazin-l-yl)propanoate (EA- PIP), Di-oleyl-succinyl-serinyl-tobramycin, Di-oleyl-adipyl-tobramycin, Di-oleyl-suberyl- tobramycin, Di-oleyl-sebacyl-tobramycin, N,N-dimethyl-N',N'-di[(9Z, 12Z) -octadeca- 9,12-dien-l-yl] ethane-1,2- diamine and Di-oleyl -dithioglycolyl-tobramycin, or any combination thereof.
23. The composition or delivery system composition of claim 20, wherein the stabilizing lipid is selected from the group consisting of cholesterol, phospholipids (such as, phosphatidylcholine (PC)), cephalins, sphingolipids and glycoglycerolipids, or combinations thereof.
24. The composition or delivery system composition of claim 20, wherein the helper lipid is selected from the group consisting of l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC),
1.2- dilauroyl-L-phosphatidyl-ethanolamine (DLPE), l,2-Dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE) l,2-Diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhPE)
1.3-Dipalmitoyl-sn-glycero-2-phosphoethanolamine (1,3-DPPE) 1-Palmitoyl- 3-oleoyl-sn- glycero-2-phosphoethanolamine (1,3-POPE), Biotin- Phosphatidylethanolamine, 1,2- Dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE), 1 ,2-Distearoyl-sn-glycero-3- phosphoethanolamine (DSPE), and Dipalmitoylphosphatidylethanolamine (DPPE), or combinations thereof.
25. The composition or delivery system composition of claim 20, wherein the PEG- lipid is selected from the group consisting of DMG-PEG, PEG-cDMA, PEG-cDSA, DLPE-PEG, DSPE-PEG, 3- A-(-methoxy poly(ethylene glycol)2000)carbamoyl-l,2-dimyristyloxy- propylamine; 3- A-(-methoxy poly(ethylene glycol)2000)carbamoyl-l,2-distearyloxy- propylamine, or combinations thereof.
26. The composition or delivery system composition of any one of claims 1 to 25, wherein the lipidated peptide portion comprises a glycerolipid.
27. The composition or delivery system composition of any one of claims 1 to 26, wherein the therapeutic agent is encapsulated within the lipid nanoparticle.
28. The composition or delivery system composition of claim 27, wherein therapeutic agent is a nucleic acid or a polynucleotide.
29. The composition or delivery system composition of claim 27, wherein the therapeutic agent is an exome encoded DNA or an mRNA.
30. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a non-exome encoded RNA.
31. The composition or delivery system composition of claim 30, wherein the non- exome encoded RNA is a microRNA, a long non-coding RNA (IncRNA), a long non-coding intergenic RNA (lincRNA), a pseudogene, a circular RNA (circRNA), a transfer RNA (tRNA) or an interfering RNA (siRNA and shRNA).
32. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a catalytically active or deactivated gene editing nuclease.
33. The composition or delivery system composition of claim 32, wherein the catalytically active or deactivated gene editing nuclease is selected from a meganuclease, zinc finger nuclease (ZFN), transcription activator-like effector-based nuclease (TALEN), transposase, integrase, mobile genetic element (MGE)-encoded recombinase, clustered regularly interspaced short palindromic repeats (CRISPR) associated (Cas) nuclease and their related guide nucleic acids and targeting moieties.
34. The composition or delivery system composition of claim 33, wherein the CRISPR associated (Cas) nuclease is Cas9, Casl2a, Casl2b, Casl2e, Casl3, Casl3a, Casl3b, Casl4, Cas- theta, CasX, CasY or listed in Table 6.
35. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a catalytically deactivated CRISPR associated (Cas) protein or an mRNA fused to a transcriptional modifier.
36. The composition or delivery system composition of claim 35, wherein the mRNA fused to a transcriptional modifier is a transcriptional repressor.
37. The composition or delivery system composition of claim 36, wherein the transcriptional repressor is a methyltransferase or histone deacetylase.
38. The composition or delivery system composition of claim 36, wherein the transcriptional repressor is DNA methyltransferase 3A (DNMT3A), methyl-CpG-binding protein 2 (MeCP2), Kruppel-associated box (KRAB), MeCP2-KRAB, histone deacetylase 3 (HDAC3), Ezh2, SALL1 and/or SDS3.
39. The composition or delivery system composition of claim 35, wherein the mRNA fused to a transcriptional modifier is a transcriptional activator.
40. The composition or delivery system composition of claim 39, wherein the transcriptional activator is VP64, p65, Rta separately or combined (VPR), the synergistic activation mediator (SAM) activation system MS2-p65-HSFl, DNA demethylation moiety, or an acetyltransferase.
41. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a base editor, prime editor or mobile genetic element gene writer.
42. The composition or delivery system composition of claim 41, wherein the base editor is a cytosine base editor (CBE) or an adenine base editor (ABE) comprising a catalytically inactive (dCas) or partially inactive (Cas nickase or nCas) Cas nuclease, cytidine deaminase, or adenosine deaminase and guide RNA that confers target sequence specificity.
43. The composition or delivery system composition of claim 42, wherein the base editor or gene editing agent is selected from those listed in Tables 2 and 3.
44. The composition or delivery system composition of claim 41, wherein the prime editor is comprised of a prime editing guide RNA (pegRNA) targeting sequence and RNA template, and a fusion protein consisting of Cas9 nickase fused to an engineered reverse transcriptase (RT) enzyme where the pegRNA guide template and Cas9 nickase directs the reverse transcriptase to the target site where a new DNA strand from the RNA template is inserted at the target site.
45. The composition or delivery system composition of claim 41, wherein the mobile genetic element gene writer incorporates mobile genetic elements for sequence targeting combined with an engineered integrase or transposase to integrate nucleic acid sequences at the target sequence.
46. The composition or delivery system composition of claim 45, wherein the mobile genetic element gene writer incorporates CRISPR-Cas9 targeting elements combined with an engineered piggyBac transposase to integrate nucleic acid sequences at the target sequence.
47. The composition or delivery system composition of claim 27, wherein the therapeutic agent is a protein, a ribonucleoprotein or drug.
48. The composition or delivery system compositions of claims 1-48, wherein the target nucleic acid or gene for inhibition is listed in Table 4.
49. The composition or delivery system compositions of any one of claims 1-48, wherein the target nucleic acid or gene for therapeutic expression is listed in Table 5.
50. The composition or delivery system compositions of any one of claims 1-48, wherein the target nucleic acid or gene for correction or repair is listed in Table 4, Table 5 or Table 7.
51. The composition or delivery system compositions of any one of claims 1-48, wherein the antibody comprises an amino acid sequence as set forth in SEQ ID NO: 5, 8, 24, 27, 28 or 30.
52. A method of delivering a therapeutic or diagnostic agent to a subject in need thereof, the method comprising administering to the subject the composition or delivery system of any one of claims 1-51, thereby delivering the therapeutic or diagnostic agent to the subject.
53. A method for treating a medical condition in a subject in need thereof, the method comprising the step of administering to the subject a therapeutically effective amount of the composition or delivery system of any one of claims 1-51, wherein the agent is a therapeutic agent, thereby treating the medical condition.
54. A method of diagnosing a medical condition in a subject comprising administering to the subject an effective amount of the composition or delivery system of any one of claims 1- 51, wherein the agent is a diagnostic agent, thereby diagnosing the medical condition.
55. Use of the composition or delivery system of any one of claims 1-51, for diagnosing or treating a medical condition.
EP23888243.5A 2022-11-07 2023-11-07 Self-assembling lipid nanoparticles for targeted delivery of therapeutic agents Pending EP4615416A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263423069P 2022-11-07 2022-11-07
PCT/IL2023/051145 WO2024100656A1 (en) 2022-11-07 2023-11-07 Self-assembling lipid nanoparticles for targeted delivery of therapeutic agents

Publications (1)

Publication Number Publication Date
EP4615416A1 true EP4615416A1 (en) 2025-09-17

Family

ID=91032208

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23888243.5A Pending EP4615416A1 (en) 2022-11-07 2023-11-07 Self-assembling lipid nanoparticles for targeted delivery of therapeutic agents

Country Status (8)

Country Link
EP (1) EP4615416A1 (en)
JP (1) JP2025541601A (en)
KR (1) KR20250089566A (en)
CN (1) CN120500329A (en)
AU (1) AU2023378958A1 (en)
IL (1) IL320704A (en)
MX (1) MX2025005244A (en)
WO (1) WO2024100656A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2024279278A1 (en) 2023-05-31 2025-12-18 Capstan Therapeutics, Inc. Lipid nanoparticle formulations and compositions
CN121449524A (en) * 2026-01-05 2026-02-03 国家纳米科学中心 Ionizable lipid compound, and preparation method and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2716420C2 (en) * 2013-06-17 2020-03-11 Те Брод Инститьют Инк. Delivery and use of systems of crispr-cas, vectors and compositions for targeted action and therapy in liver
LT3436077T (en) * 2016-03-30 2025-06-25 Intellia Therapeutics, Inc. Lipid nanoparticle formulations for crispr/cas components
US11708421B2 (en) * 2016-07-18 2023-07-25 Ramot At Tel-Aviv University Ltd. Modular platform for targeted therapeutics

Also Published As

Publication number Publication date
JP2025541601A (en) 2025-12-22
MX2025005244A (en) 2025-07-01
WO2024100656A1 (en) 2024-05-16
AU2023378958A1 (en) 2025-06-05
CN120500329A (en) 2025-08-15
KR20250089566A (en) 2025-06-18
IL320704A (en) 2025-07-01

Similar Documents

Publication Publication Date Title
US20250188191A1 (en) Compositions and methods to modify cells for therapeutic objectives
Cheng et al. The use of single chain Fv as targeting agents for immunoliposomes: an update on immunoliposomal drugs for cancer treatment
US20200360388A1 (en) Alpha polyglutamated pemetrexed and uses thereof
US20230312745A1 (en) Modular platform for targeted therapeutics
US20210113466A1 (en) Non-viral, non-cationic nanoparticles and uses thereof
JPWO2009020094A1 (en) Antibodies modified with hydrophobic molecules
JP2017119701A (en) Exosome for delivery of biotherapeutics
US20230233706A1 (en) In vivo targeting of CD4+-T cells for mRNA therapeutics
EP4615416A1 (en) Self-assembling lipid nanoparticles for targeted delivery of therapeutic agents
JP2024522607A (en) Compositions and methods for targeted delivery of therapeutic agents
WO2021234699A1 (en) MAdCAM-1 POLYPEPTIDES AND USES THEREOF
WO2025232812A1 (en) Biomolecule conjugated lipid nanoparticles
WO2026040957A1 (en) Cd117 antibody and use thereof
HK40117558A (en) Modular platform for targeted therapeutics
WO2026040956A1 (en) Lipid nanoparticles and use thereof
WO2025072623A1 (en) Compositions and methods for targeting immune cells
JP2025534663A (en) Compositions and methods for targeted delivery of therapeutic agents
WO2006030602A1 (en) Diagnostic and/or remedy for ovary cancer

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250529

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40131620

Country of ref document: HK