EP4612175A1 - Interrupted ran proteins in disease - Google Patents

Interrupted ran proteins in disease

Info

Publication number
EP4612175A1
EP4612175A1 EP23886931.7A EP23886931A EP4612175A1 EP 4612175 A1 EP4612175 A1 EP 4612175A1 EP 23886931 A EP23886931 A EP 23886931A EP 4612175 A1 EP4612175 A1 EP 4612175A1
Authority
EP
European Patent Office
Prior art keywords
poly
ran
interrupted
protein
antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23886931.7A
Other languages
German (de)
French (fr)
Inventor
Laura Ranum
Lien Nguyen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Florida
University of Florida Research Foundation Inc
Original Assignee
University of Florida
University of Florida Research Foundation Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Florida, University of Florida Research Foundation Inc filed Critical University of Florida
Publication of EP4612175A1 publication Critical patent/EP4612175A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • RAN translation can occur across a broad range of repeat lengths from pre-mutation lengths ( ⁇ 30 – 40 repeats) to full expansions (up to 10,000 repeats). While repetitive elements account for a Attorney Docket No. U1202.70128WO00 large portion of the human genome, the detection of repeats and repeat expansion mutations is challenging.
  • RAN protein e.g., a repeat-associated non-ATG translated protein
  • a “RAN protein” is a polypeptide translated from mRNA sequence carrying a nucleotidic expansion in the absence of an apparent AUG initiation codon.
  • RAN proteins comprise expansion repeats of a single amino acid, di-amino acid, tri-amino acid, or quad-amino acid (e.g., tetra-amino acid), termed poly-amino acid repeats.
  • poly-amino acid repeats e.g., tetra-amino acid
  • the present inventors have surprisingly discovered that a novel class of RAN proteins, which comprise discontiguous or “interrupted” poly-amino acid repeat motifs, are expressed in certain RAN protein diseases.
  • an “interrupted RAN protein” or a “discontiguous RAN protein” refers to a RAN protein translated from an RNA transcript comprising a plurality of nucleotidic expansion repeat units (e.g., a GGGGCT repeat unit, a GAAGGA repeat unit, a GGGAGA repeat unit, etc.) having one or more amino acid alterations that causes a frameshift and results in production of a polypeptide comprising a non-contiguous, repeating pattern of poly- amino acid repeat units that extends for the length of the nucleotidic expansion.
  • nucleotidic expansion repeat units e.g., a GGGGCT repeat unit, a GAAGGA repeat unit, a GGGAGA repeat unit, etc.
  • an RNA transcript encoding an interrupted RAN protein comprises one or more nucleotides inserted between one or more expansion repeat units and/or one or more nucleotide substitutions within one or more expansion repeat units.
  • interrupted RAN proteins expressed from certain RNA transcripts are associated with RAN protein diseases, for example Alzheimer’s disease and amyotrophic lateral sclerosis (ALS).
  • ALS amyotrophic lateral sclerosis
  • one or more genes that may be transcribed to produce interrupted RAN proteins are listed in Table 1 or Table 6.
  • an interrupted RAN protein may comprise between about 2 and about 10,000 discontiguous or “interrupted” amino acid repeats (in sum) (“RAN repeat units”).
  • an interrupted RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 discontiguous or “interrupted” Attorney Docket No. U1202.70128WO00 amino acid repeats, etc. (e.g., RAN repeat units).
  • an interrupted RAN protein comprises one or more poly-amino acid repeat(s) that is between 2 and 500, between 20 and 300, between 30 and 200, between 40 and 100, between 50 and 90, or between 60 and 80 amino acid residues in length.
  • an interrupted RAN protein comprises one or more poly-amino acid repeat(s) that is at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or at least 200 amino acid residues in length.
  • an interrupted RAN protein has one or more poly-amino acid repeat(s) more than 200 amino acid residues (e.g., 500, 1000, 5000, 10,000, etc.) in length.
  • the poly-amino acid repeat(s) comprised within an interrupted RAN protein are separated by one or more non-repeating amino acids (see, e.g., FIG.1B).
  • at least one of the interrupted RAN proteins comprises at least one amino acid residue between each RAN repeat unit.
  • the poly-amino acid repeat(s) comprised within an interrupted RAN protein are separated by between about 2 and about 100 non-repeating amino acids.
  • at least one of the interrupted RAN proteins comprises between 2 and 20 amino acid residues between each RAN repeat unit.
  • the poly-amino acid repeat(s) comprised within an interrupted RAN proteins are separated by between about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 non-repeating amino acids.
  • the disclosure provides a method for identifying a subject as having a RAN protein disease based upon the presence or absence of interrupted RAN proteins, as described herein.
  • said method comprises detecting one or more interrupted RAN proteins in a biological sample obtained from the subject, wherein the one or more interrupted RAN proteins each comprise multiple RAN repeat units.
  • the biological sample is tissue, blood, serum, or cerebrospinal fluid (CSF).
  • the tissue is brain tissue or spinal cord tissue.
  • the subject is identified as having a RAN protein disease according to the methods described herein for identifying a subject as having a RAN protein disease.
  • a subject is identified as having a RAN protein disease according to the methods described herein for identifying a subject as having a RAN protein disease, and a therapeutic agent (e.g., an anti-RAN protein agent) is administered to the identified subject.
  • a therapeutic agent e.g., an anti-RAN protein agent
  • the one or more anti-RAN protein agents target one or more interrupted RAN proteins.
  • the one or more anti-RAN protein agents reduce the transcription, translation, expression, aggregation or accumulation of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly-amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein transcription, translation, expression, aggregation or accumulation in the subject prior to the administration of the one or more anti-RAN protein agents.
  • the one or more anti-RAN protein agents reduce the transcription of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly-amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein transcription in the subject prior to the administration of the one or more anti- RAN protein agents.
  • the one or more anti-RAN protein agents reduce the translation of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly- amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein translation in the subject prior to the administration of the one or more anti-RAN protein agents. In some embodiments, the one or more anti-RAN protein agents reduce the expression of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly- amino acid repeat motifs (e.g., RAN repeat units), relative to the expression in the subject prior to the administration of the one or more anti-RAN protein agents.
  • interrupted e.g., discontiguous
  • interrupted poly- amino acid repeat motifs e.g., RAN repeat units
  • the one or more anti-RAN protein agents reduce the aggregation of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly-amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein aggregation in the subject prior to the administration of the one or more anti-RAN protein agents. In some embodiments, the one or more anti-RAN protein agents reduce the accumulation of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly-amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein accumulation in the subject prior to the administration of the one or more anti-RAN protein agents.
  • interrupted e.g., discontiguous
  • interrupted poly-amino acid repeat motifs e.g., RAN repeat units
  • the RAN protein is an interrupted poly-Glycine-Alanine (poly- GA) or a poly-Glycine-Arginine (poly-GR) repeat-containing RAN protein.
  • Interrupted poly- GA and poly-GR RAN protein-encoding sequences can be found in the genome (e.g., human genome) at one or multiple loci, including but not limited to the loci and sequences set forth in Table 1 or Table 6.
  • a subject is characterized as having a mutation in one or more chromosomal loci or genes set forth in Table 1 or Table 6, where the one or more mutations results in translation of one or more interrupted poly-GA and/or poly(GR) RAN proteins.
  • expansion repeats encoding interrupted RAN proteins are located in protein coding regions of a gene (e.g., exonic regions). In some embodiments, expansion repeats encoding interrupted RAN proteins are located in non-coding regions of a gene (e.g., intronic regions, untranslated regions such as 5’UTR or 3’UTR, etc.). In some embodiments, expansion repeats encoding interrupted RAN proteins are located in intergenic regions of a chromosome (e.g., nucleic acid sequences positioned between genes on a chromosome). In some embodiments, the one or more interrupted RAN proteins comprises a poly- GA interrupted RAN protein.
  • At least one of the interrupted RAN proteins is translated from a (GGGGCT) x expansion repeat, a (GGGAGA) x expansion repeat, or a (GAAGGA) x expansion repeat, where x represents the number of repeat units present.
  • the one or more interrupted RAN proteins comprises a poly-GR interrupted RAN protein.
  • at least one of the interrupted RAN proteins is translated from a (GGGAGA) x expansion repeat.
  • x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc.
  • x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117
  • a poly- GA interrupted RAN protein comprises between 10 and 50 GA repeat units over a stretch of 100 amino acids (e.g., between 10% and 50%).
  • a poly-GR interrupted RAN protein comprises between 10 and 50 GR repeat units over a stretch of 100 amino acids (e.g., between 10% and 50%).
  • at least one of the interrupted RAN proteins is transcribed from a gene or chromosomal locus as set forth in Table 1.
  • at least one of the interrupted RAN proteins is transcribed from ARMCX4, ALK, and/or CASP8.
  • a ARMCX4, ALK, and/or CASP8 gene is transcribed to produce one or more interrupted RAN proteins.
  • an ARMCX4 gene is transcribed to produce one or more interrupted poly(GA) RAN proteins.
  • an ALK gene is transcribed to produce one or more interrupted poly(GA) RAN proteins.
  • a CASP8 gene is transcribed to produce one or more interrupted poly(GR) RAN proteins.
  • an interrupted poly(GA) or interrupted poly(GR) RAN protein is translated from an mRNA transcript encoded by a ARMCX4, ALK, and/or CASP8 gene, or a genetic locus thereof.
  • an interrupted poly(GA) RAN protein is translated from an mRNA transcript encoded by ARMCX4, or a genetic locus thereof. In some embodiments, an interrupted poly(GA) RAN protein is translated from an mRNA transcript encoded by ALK, or a genetic locus thereof. In some embodiments, an interrupted poly(GR) RAN protein is translated from an mRNA transcript encoded by CASP8, or a genetic locus thereof. In some embodiments, an ARMCX4 gene comprises an(GGGGCT) x expansion repeat, a (GGGAGA)x expansion repeat, or a (GAAGGA)x expansion repeat, where x represents the number of repeat units present.
  • an ALK gene comprises an (GGGGCT) x expansion repeat, a (GGGAGA) x expansion repeat, or a (GAAGGA)x expansion repeat, where x represents the number of repeat units present.
  • a CASP8 gene comprises an (GGGGCT) x expansion repeat, a (GGGAGA) x expansion repeat, or a (GAAGGA) x expansion repeat, where x represents the number of repeat units present.
  • a subject is a mammal.
  • a subject is a human.
  • a subject is a non-human mammal, such as a mouse, rat, dog, cat, or pig. Attorney Docket No.
  • detecting one or more interrupted RAN proteins comprises performing an assay on the biological sample.
  • the assay comprises an antibody-based capture assay, binding assay, hybridization assay (e.g., Fluorescence In situ Hybridization (FISH)), immunoblot analysis, Western blot analysis, immunohistochemistry, dCas9-based enrichment, label free immunoassays, immunoquantitative PCR, mass spectrometry, bead-based immunoassays, immunoprecipitation, immunostaining, immunoelectrophoresis, and/or ELISA.
  • FISH Fluorescence In situ Hybridization
  • a sample e.g., a biological sample
  • an antibody-based capture process to isolate and/or detect one or more interrupted RAN proteins within the sample.
  • the antibody-based capture methods include contacting the sample with one or more (e.g., 2, 3, 4, 5, or more) anti-RAN protein antibodies (e.g., anti-interrupted RAN protein antibodies).
  • the one or more anti-RAN antibodies are conjugated to a solid support (e.g., a scaffold, resin beads, etc.).
  • antibody-based capture methods comprise physically separating and/or isolating RAN proteins that have been bound by the anti-RAN antibody(s), for example eluting the RAN proteins by a chromatographic method such as affinity chromatography or ion-exchange chromatography.
  • Detection of interrupted RAN proteins in a biological sample may be performed by Western blot.
  • Western blots generally employ the use of a detection agent or probe to identify the presence of a protein or peptide.
  • detection of one or more interrupted RAN proteins is performed by immunoblot (e.g., dot blot, 2-D gel electrophoresis, Western Blot, etc.), immunohistochemistry (IHC), ELISA (e.g., RCA-based ELISA or RT-PCR-based ELISA), label free immunoassays such as surface plasmon resonance bio layer interferometry, immunoquantitative PCR, mass spectrometry such as GC- MS, LC-MS, MALDI-TOF-MS, bead-based immunoassays, immunoprecipitation, immunostaining, or immunoelectrophoresis.
  • the detection agent is an antibody.
  • the antibody is an anti-RAN protein antibody (e.g., an anti- interrupted RAN protein antibody), such as an anti-poly(GA) or anti-poly(GR) antibody.
  • an anti-RAN protein antibody targets (e.g., specifically binds to) the amino acid repeat region (e.g., GAGAGAGAGAGAGAGAGA (SEQ ID NO: 1), etc.) of a RAN protein.
  • an anti-RAN protein antibody targets (e.g., specifically binds to) an epitope comprising amino acids in the characteristic reading frame-specific C- Attorney Docket No. U1202.70128WO00 terminus translated 3’ of the repeated amino acids.
  • an anti-RAN protein antibody targets (e.g., specifically binds to) an epitope comprising amino acids bridging the C-terminus of the amino acid repeat region and the N-terminus of the characteristic reading-frame specific C-terminus translated 3’ of the repeated amino acids.
  • an anti-RAN antibody targets (e.g., specifically binds to) any portion of an interrupted RAN protein that does not comprise the poly-amino acid repeat, for example the C-terminus of an interrupted RAN protein (e.g., the C-terminus of an interrupted poly(GA) or poly(GR) repeat protein). Examples of anti-RAN antibodies targeting RAN protein poly-amino acid repeats are disclosed, for example, in International Application Publication No.
  • WO 2014/159247 the entire content of which is incorporated herein by reference.
  • anti-RAN antibodies targeting the C-terminus of RAN proteins are disclosed, for example, in U.S. Publication No.2013/0115603, the entire content of which is incorporated herein by reference.
  • the RAN protein disease is amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10
  • ALS
  • the method of identifying a subject as having a RAN protein disease further comprises administering to the subject one or more anti-RAN protein agents.
  • the one or more anti-RAN protein agents comprises a protein, peptide, nucleic acid, or small molecule.
  • the protein comprises an antibody.
  • the antibody is an anti-poly-GA or anti-poly-GR antibody.
  • the anti-poly- GA antibody specifically binds to a poly-GA repeat region of the RAN protein in the subject.
  • the anti-poly-GR antibody specifically binds to a poly-GR repeat region of the RAN protein in the subject.
  • An anti-RAN antibody can be a polyclonal antibody or a monoclonal antibody.
  • the anti-poly-GA or anti-poly-GR antibody is a polyclonal antibody.
  • polyclonal antibodies are produced by inoculation of a suitable mammal, such as a mouse, rabbit or goat. Larger mammals are often preferred as the amount of serum that can be collected is greater.
  • An antigen is injected into the mammal. This induces the B- lymphocytes to produce IgG immunoglobulins specific for the antigen. This polyclonal IgG is purified from the mammal’s serum.
  • the anti-poly-GA or anti-poly- GR antibody is a monoclonal antibody.
  • Monoclonal antibodies are generally produced by a single cell line (e.g., a hybridoma cell line).
  • an anti-RAN antibody is purified (e.g., isolated from serum).
  • the antigen is 12-20 amino acids.
  • an antigen is a repeat sequence.
  • an antigen is a C-terminal-specific sequence.
  • an antigen is a portion of a C-terminal sequence, for example, a fragment of the C-terminal sequences that is 3-5 or 5-10, or more amino acids in length, for example 6, 7, 8, 9, 10, 11, 12, 13, 1415, 16, 17, 18, 19, 20, 25, 30, 35, 40, or 50 amino acids in length.
  • the disclosure provides methods of producing an antibody, the method comprising administering to the subject a peptide antigen comprising a RAN protein repeat sequence, for example a poly(GA) or poly(GR) repeat sequence.
  • the subject is a mammal, for example a non-human primate, rodent (e.g., rat, hamster, guinea pig, etc.).
  • the subject is a human (e.g., a human subject is injected with a peptide antigen for the purposes of eliciting a host antibody response against the peptide antigen, for example a RAN protein).
  • an antibody is produced by expressing in a cell (e.g., a B-cell, hybridoma cell, etc.) one or more interrupted RAN proteins or interrupted RAN protein repeat sequences. Numerous methods may be used for obtaining anti-RAN antibodies. For example, antibodies can be produced using recombinant DNA methods.
  • Monoclonal antibodies may also be produced by generation of hybridomas (see, e.g., Kohler and Milstein (1975) Nature, 256: 495-499) in accordance with known methods. Hybridomas formed in this manner are then screened using standard methods, such as enzyme-linked immunosorbent assay (ELISA; e.g., RCA-based ELISA or rtPCR-based ELISA) and surface plasmon resonance (e.g., OCTET or BIACORE) analysis, to identify one or more hybridomas that produce an antibody that specifically binds with a specified antigen. Any form of the specified antigen (e.g., an Attorney Docket No.
  • U1202.70128WO00 interrupted RAN protein may be used as the immunogen, e.g., recombinant antigen, naturally occurring forms, any variants or fragments thereof.
  • One exemplary method of making antibodies includes screening protein expression libraries that express antibodies or fragments thereof (e.g., scFv), e.g., phage or ribosome display libraries. Phage display is described, for example, in Ladner et al., U.S. Pat. No.5,223,409; Smith (1985) Science 228:1315-1317; Clackson et al. (1991) Nature, 352: 624-628; Marks et al. (1991) J. Mol.
  • the specified antigen e.g., one or more interrupted RAN proteins
  • a non-human animal e.g., a rodent, e.g., a mouse, hamster, or rat.
  • the non-human animal is a mouse.
  • a monoclonal antibody is obtained from the non-human animal, and then modified, e.g., made chimeric, using recombinant DNA techniques known in the art.
  • modified e.g., made chimeric, using recombinant DNA techniques known in the art.
  • a variety of approaches for making chimeric antibodies have been described. See, e.g., Morrison et al., Proc. Natl. Acad. Sci. U.S.A.81:6851, 1985; Takeda et al., Nature 314:452, 1985, Cabilly et al., U.S. Pat. No.4,816,567; Boss et al., U.S. Pat.
  • Antibodies can also be humanized by methods known in the art. For example, monoclonal antibodies with a desired binding specificity can be commercially humanized (Scotgene, Scotland; and Oxford Molecular, Palo Alto, Calif.). Fully humanized antibodies, such as those expressed in transgenic animals are within the scope of the invention (see, e.g., Green et al. (1994) Nature Genetics 7, 13; and U.S. Patent Nos.5,545,806 and 5,569,825). For additional antibody production techniques, see, Antibodies: A Laboratory Manual, Second Edition.
  • the one or more anti-RAN protein agents comprises a nucleic acid.
  • the nucleic acid is an inhibitory nucleic acid.
  • the inhibitory nucleic acid is an interfering RNA.
  • the nucleic acid is double-stranded RNA (dsRNA), short-interfering RNA (siRNA), short-hairpin RNA (shRNA), microRNA (miRNA), artificial microRNA (amiRNA), an aptamer, or an Attorney Docket No.
  • the inhibitory nucleic acid is a nucleic acid aptamer (e.g., an RNA aptamer or DNA aptamer).
  • an inhibitory RNA molecule can be unmodified or modified.
  • an inhibitory RNA molecule comprises one or more modified oligonucleotides, e.g., phosphorothioate-, 2'-O- methyl-, etc.-modified oligonucleotides, as such modifications have been recognized in the art as improving the stability of oligonucleotides in vivo.
  • the nucleic acid comprises a region of complementarity with a nucleic acid sequence encoding a poly-GA or poly-GR repeat expansion in the subject.
  • a region of complementarity may comprise between 2 and 50 nucleotides.
  • the region of complementarity comprises between 2 and 10, 2 and 15, 5 and 20, or 10 and 30 nucleotides in length.
  • the nucleic acid comprises a region of complementarity with a nucleic acid sequence present at a chromosomal locus or gene as set forth in Table 1 or Table 6.
  • the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by a gene, or a genetic locus thereof, selected from the group consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, A
  • the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by a chromosomal locus in chrX beginning at 100748986 and ending at 100749205. In some embodiments, the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by ARMCX4. In some embodiments, the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by ALK. In some embodiments, the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by CASP8. In some embodiments, the one or more anti-RAN protein agents comprises a small molecule.
  • the small molecule inhibits expression or activity of one or more RAN proteins.
  • a small molecule is an inhibitor of eIF3 (or an eIF3 subunit).
  • small molecule inhibitors of eIF3 include but are not limited to mTOR inhibitors (e.g., rapamycin, PP242), S6 kinase (S6K) inhibitors, etc.
  • the small molecule inhibits expression or activity of eukaryotic initiation factor 2A (eIF2A) or eIF2 ⁇ .
  • eIF2A eukaryotic initiation factor 2A
  • small molecule inhibitors of eIF2A include but are not limited to salubrinal, Sal003, ISRIB , etc.
  • the small molecule in an inhibitor of TARBP2 in an inhibitor of TARBP2.
  • TARBP2 inhibitors include anti-TARBP2 antibodies, interfering RNAs (e.g., dsRNA, siRNA, shRNA, miRNA, etc.) that target TARBP2, peptide inhibitors of TARBP2, and small molecule inhibitors of TARBP2.
  • the small molecule is metformin, also known as N,N-dimethylbiguanide (IUPAC N,N- Dimethylimidodicarbonimidic diamide and CAS 657-24-9), or an alternate bioactive biguanide including chloroguanide [1-[amino-(4-chloroanilino)methylidene]-2-propan-2-yl- Attorney Docket No.
  • FIGs.1A and 1B show a predicted ARMCX4 poly-GA repeat protein.
  • FIG.1A shows alternative splicing variants, demonstrating that an ARMCX4 repeat expansion can be in an intron (left) or an exon (right).
  • FIG.1B shows a predicted GA-rich protein produced by an ARMCX4 repeat expansion.
  • FIG.1B illustrates interrupted GA repeat motifs.
  • FIGs.2A and 2B show a predicted ALK poly-GA repeat protein.
  • FIG.2A shows the predicted coding region.
  • the expanded allele has expanded GGA repeats and contains ⁇ 143- 156 repeats.
  • FIG.2B shows a predicted GA-rich protein produced by an ALK repeat expansion.
  • the example amino acid sequence (SEQ ID NO: 7) shown in FIG.2B illustrates interrupted GA repeat motifs.
  • FIGs.3A and 3B show representative data demonstrating that anti-GA antibodies recognize GA-rich proteins expressed from ARMCX4 and ALK repeat expansions.
  • FIG.3A shows example ARMCX4-RE and ALK-RE plasmids which were designed and cloned.
  • FLAG tag expresses in frame with ARMCX4 and ALK GA-rich proteins.
  • FIG.3B shows data demonstrating that, in ARMCX4-RE and ALK-RE overexpressing HEK293T cells, anti-GA antibody staining co-localizes with FLAG tag.
  • FIGs.4A-4C show a predicted CASP8 poly-GR repeat protein.
  • FIG.4A shows the predicted coding region.
  • FIG.4B shows a predicted GR-rich protein produced by an CASP8 Attorney Docket No. U1202.70128WO00 repeat expansion.
  • FIG.4A-5I show representative data of distinct polyGR accumulation that correlates with p-Tau levels in AD and tauopathy-related autopsy brains.
  • FIG.5A shows examples of polyGR immunohistochemical (IHC) staining (red) detected by a rabbit polyclonal ⁇ -polyGR antibody in the hippocampal sections (HC) from AD and control cases.
  • IHC polyGR immunohistochemical
  • FIG.5E shows quantification polyGR levels in frontal cortex protein lysates from AD and control cases determined by dot blot analyses.
  • FIG.5G shows double IHC staining analyses showing polyGR (pink) detected in brain regions with both high and low p-tau (S202 and T205) (brown) sub- regions of the same AD brain section. Black arrows: cells with both polyGR and p-tau signal, open arrows: cells with polyGR staining.
  • FIG.5H shows a plot of polyGR and p-tau (S202 and T205) staining detected in sequential slides from 21 randomly selected AD cases. Data represent mean ⁇ SEM. Two- tailed, unpaired t-test. **** p ⁇ 0.0001.
  • case 9 with a mixed pathology of LBD, Parkinson’s disease (PD), and AD (C9-LBD/PD/AD).
  • This figure includes representative staining images from all cases that have polyGR staining and some examples that are negative for polyGR staining. The remaining cases (not shown) are all negative for Attorney Docket No. U1202.70128WO00 polyGR staining.
  • the two non-AD cases with strong polyGR staining are C14-LBD and C19-Pick’s.
  • FIGs.6A-6F show an example of a CRISPR deactivated Cas9-based repeat enrichment and detection (dCas9READ) strategy for pulling down repeat expansion mutations.
  • dCas9READ CRISPR deactivated Cas9-based repeat enrichment and detection
  • FIG.6A Schematic diagram showing how dCas9READ method works.
  • FIG.6B shows a examples of primers used in qPCR assays to measure levels of the C9orf72 flanking sequence in dCas9READ-enriched DNA samples.
  • FIG.6F show mapping of Illumina short-read sequencing reads of C9 and control samples enriched with mixtures of 8 or 24 sgRNA containing GR-encoding repeat motifs.
  • E, F Scale bar shows number of reads. Data represent mean ⁇ SEM. Unpaired two-tailed t-test. ** p ⁇ 0.01, *** p ⁇ 0.001.
  • FIGs.7A-7F show detection of GGGAGA ⁇ TCTCCC (SEQ ID NO: 10) repeat expansion mutation using dCas9READ.
  • FIG.7A shows an example approach to identify novel repeat expansions using polyGR protein signature and dCas9READ and to determine association of novel repeat expansions with AD.
  • FIG.7B shows a diagram of the genomic location of the CASP8 GGGAGA repeat expansion within an SVA-E retrotransposon element, reference repeat sequences, and repeat primed PCR (RP-PCR) primers used to characterize the repeat expansion (SEQ ID NOs: 11, 12).
  • RP-PCR repeat primed PCR
  • FIG.7C shows examples of dCas9READ fold enrichment of ten loci using genomic DNA from a polyGR(-) control (Cntl), a polyGR(-) AD (AD#1) and five polyGR(+) AD cases.
  • FIG.7D shows mapping of Illumina short-read sequencing reads at the CASP8 locus shows increased enrichment in AD#2 and AD#3 cases. The red arrow indicates location of the repeat expansion in CASP8.
  • FIG.7E shows RP-PCR data showing two positive repeat expansion patterns ( ⁇ 64-repeats (SEQ ID NO: 13) and 44-repeats (SEQ ID NO: 14)) for (GAGAGG)2GAGACG (SEQ ID Attorney Docket No.
  • FIG.7F shows percentage of long ( ⁇ 64-repeats (SEQ ID NO: 13)), intermediate ( ⁇ 44-repeats (SEQ ID NO: 14)) CASP8 GGGAGA repeats, and non-expanded CASP8 GGGAGA repeats in AD and control populations.
  • FIGs.8A-8E shows representative data for increased cleaved caspase 8 levels and accumulation of expansion proteins expressed from the CASP8 GGGAGAexp in AD autopsy brain tissue.
  • FIG.8A shows cleaved caspase-8 detected in the frontal cortex tissue from CASP8-GGGAGAexp(+) AD, CASP8-GGGAGAexp(-) AD, and non-AD control cases (free of AD pathology).
  • FIG.8B shows a quantification of cleaved caspase-8 from FIG.8A.
  • FIG. 8C shows a diagram of expansion proteins translated from sense and antisense transcripts from the CASP8 GGGAGAexp locus. Amino acid sequences highlighted in red were used to generate frame specific C-terminal (CT) antibodies. S, sense; AS, antisense; f1–3, reading frames 1–3; * stop codon.
  • CT frame specific C-terminal
  • FIG.8D shows IHC detection of CASP8 RAN Sf3 protein aggregate staining (red) in the hippocampus of CASP8-GGGAGAexp(+) AD patients detected with ⁇ -CT-f3S antibody.
  • FIG.8E shows a double IF analysis of co-localization of polyGR (red) and ⁇ -CT-f3S (green) staining in the frontal cortex from CASP8- GGGAGAexp(+) AD patients. Data represent mean ⁇ SEM. One- way ANOVA Holm- Sidak’s multiple comparisons test. ** p ⁇ 0.01.
  • FIGs.9A-9J show the effects of stress on RAN translation of CASP8 GGGAGAexp and effects of CASP8 GGGAGAexp and polyGR on cells and tau phosphorylation.
  • FIG.9A shows a representative protein blot of FLAG-tagged RAN proteins expressed from 6XStop- CASP8-RE-3T minigenes in HEK293T cells.6XStop-CASP8-RE-3T minigenes: CASP8- hi64-3T (highly interrupted with 64 GGGAGA repeats (SEQ ID NO: 13)); CASP8-i44-3T (interrupted with 44 GGGAGA repeats (SEQ ID NO: 14)); CASP8-i64-3T (interrupted with 64 GGGAGA repeats (SEQ ID NO: 13)).
  • FIG.9D show increased tau phosphorylation (S202 and T205) in polyGR overexpressing SH-SY5Y cells overexpressing FLAG-GR60 using alternative codon minigenes.
  • FIG.9F shows a diagram of RAN repeat units and corresponding flanking sequences including an insertion in the VNTR sequence identified in CASP8 that are associated with a higher risk of AD.
  • This specific repeat configuration may be used for diagnostic screening and for therapeutic targeting with ASOs, RNAi, CRISPR/Cas and other methods etc.
  • FIG.9G shows a schematic of the assay used to analyze polyGR aggregates in HEK293T cells transfected with CASP8 SVA cloned from AD or control cases.
  • FIG.9H shows representative confocal images showing polyGR staining (in red) in cells transfected with AD SVA or control SVA (Cntl SVA) plasmids.
  • FIG.9J shows schmatic representation describing the contribution of CASP8 and other repeat expansion mutations in AD and in triggering pathogenic tau phosphorylation. Data represent mean ⁇ SEM.
  • FIGs.9B-9C One-way ANOVA Holm-Sidak’s multiple comparisons test and unpaired two-tailed t-test (E).
  • FIG.9I Data represent mean ⁇ SEM. unpaired two-tailed t-test** p ⁇ 0.01.
  • FIG.10 shows repeat primer PCR analysis of Casp8 repeat gene sequences encoding interrupted dipeptides comprising poly(GR) that were performed using a primer containing (GGGAGA)3 (SEQ ID NO: 23).
  • FIGs.11A-11C show polyGR protein pathology in AD patient autopsy brain tissue.
  • FIG.11A shows examples of broader field microscopy analyses of polyGR IHC staining detected by the rabbit polyclonal ⁇ -polyGR antibody in hippocampus (HC) in AD sections but not control sections.
  • FIG.11B shows an example of a 3xFLAG-(GR)60 construct and immunofluorescence analyses wherein rabbit polyclonal ⁇ -polyGR antibody was used to stain T98 cells overexpressing 3xFLAG-(GR)60 plasmids.
  • FIG.11C show dot blot analyses of polyGR detected by rat monoclonal polyGR antibody. Total protein control detected by LICOR RevertTM 700 Total Protein Stain Kit.
  • FIGs.12A-12D show an example of a CRISPR deactivated Cas9-based repeat enrichment and detection (dCas9READ) strategy for pulling down repeat expansion mutations.
  • FIG.12C shows representative fragment analysis plots showing the Attorney Docket No. U1202.70128WO00 molecular weight range of DNA fragments enriched in a dCas9READ pulldown assay using 24 GR-encoding repeat sgRNAs. LM: lower marker.
  • FIG.12D shows a summary graph showing fractions of enriched GR repeat loci in intergenic, intronic, and exonic regions. Data represent mean ⁇ SEM. Unpaired two-tailed t-test.
  • FIGs.13A-13E show GGGAGA ⁇ TCTCCC (SEQ ID NO: 10) repeat expansions within SVA retrotransposon elements detected by dCas9READ.
  • FIG.13A shows repeat primed (RP) PCR (RP-PCR) analyses showing an example of negative repeat expansion pattern for (GAGAGG)4 (SEQ ID NO: 24) repeat primer (left) and an example of biallelic CASP8 GGGAGAexp repeat pattern for (GAGAGG)2GAGACG (SEQ ID NO: 15) repeat primer (right) from a homozygous case.
  • RP repeat primed
  • FIG.13B show genomic location and RP-PCR patterns of five repeat expansion loci of samples with (+) or without (-) repeat expansion at the specific locus.
  • FIG.13C shows RP-PCR analyses of repeat patterns for genomic DNA (gDNA) samples extracted from blood monocytes or frontal cortex tissue from the same individuals.
  • FIG.13D Diagram showing long-range PCR (LR-PCR) primers used to amplify the CASP8 GGGAGAexp.
  • FIG.13E shows an EtBR gel analysis of LR-PCR products using gDNA extracted from blood monocytes or frontal cortex tissue from three different cases. Cases A and B have ⁇ 70 CASP8-GGGAGA repeats.
  • FIGs.14A-14D show characterization of CASP8 GGGAGAexp by long-read sequencing.
  • FIG.14A shows an example of an approach for long read sequencing of dCas9 enriched DNA samples.
  • FIG.14B shows mapping of PacBio long-read sequencing reads at the CASP8 GGGAGA repeat locus of polyGR(+) AD groups 1 and 2. Purple lines or bars show insertions, orange/red/green/blue lines show single nucleotide polymorphisms (SNPs).
  • FIG.14C shows interruption percentages in the CASP8 GGGAGAexp in 18 long-read sequencing reads from two cognitively normal controls and in 31 long-read sequencing reads from seven AD cases.
  • FIG.14D shows three representative repeat expansion sequences (RE1, RE2, and RE3) of the CASP8 GGGAGAexp detected by long-read sequencing. Interruptions within the repeat region highlighted in red and bold, flanking sequences in bold.
  • FIGs.15A-15F shows analyses of CASP8 RNA transcript levels in CASP8- GGGAGAexp(+) and CASP8- GGGAGAexp(-) AD cases.
  • FIG.15A shows an example of a qRT-PCR strategy to detect CASP8 exon 7-8 and exon 9.
  • Data represent mean ⁇ SEM.
  • FIG.15D shows a western blot showing caspase-8 levels in CASP8-GGGAGAexp(+) AD, CASP8- GGGAGAexp(-) AD, and controls without AD pathologies.
  • FIG.15E is a plot showing levels of full-length caspase-8 relative to actin. Data represent mean ⁇ SEM. One-way ANOVA Holm-Sidak’s multiple comparisons test. ns p > 0.05, * p ⁇ 0.05, ** p ⁇ 0.01.
  • FIG. 15F is a plot showing levels of cleaved caspase-8 relative to actin. Data represent mean ⁇ SEM. One-way ANOVA Holm-Sidak’s multiple comparisons test.
  • FIGs.16A-16I show RAN translation from CASP8 GGGAGAexp in cultured cells and characterization of C-terminal antibodies.
  • FIG.16A shows examples of constructs containing 100-bp of upstream flanking sequence and three repeat expansions in CASP8 repeat expansion configurations, and 3 tag epitopes corresponding to three reading frames (6XStop-CASP8-RE- 3T: CASP8-hi64-3T, CASP8-i44-3T, CASP8-i64-3T).
  • the upstream flanking sequence contained ATG codons in frame with HA tags.
  • FIG.16B show protein blot analysis of mutant proteins from the CASP8 GGGAGAexp minigenes that were detected in FLAG (upper blot) and HA(AUG) (lower blot) frames in HEK293T cells transfected with 6XStop-CASP8-RE-3T plasmids.
  • FIG.16C show protein blot analysis of mutant proteins from the CASP8 GGGAGAexp minigenes that were detected as being expressed from the FLAG frame in HEK293T cells transfected with 6XStop-CASP8-RE-3T plasmids and treated with thapsigargin and/or metformin.
  • FIG.16D show quantifications from protein blot analysis of mutant proteins from the CASP8 GGGAGAexp minigenes that were detected as being expressed from the FLAG or HA frames in HEK293T cells transfected with 6XStop- CASP8-RE-3T plasmids and treated with thapsigargin and/or metformin.
  • FIG.16E shows LDH and MTT assay analysis of T98 cell viability as a result of transfection and expression of interrupted RAN proteins from 6XStop-CASP8-RE-3T plasmids.
  • FIG.16F shows immunofluorescence (IF) analysis of mutant proteins expressed in all three reading frames (FLAG, HA(AUG), and Myc) in HEK293T cells transfected with 6XStop-CASP8-RE-3T plasmids of all repeat expansion configurations.
  • FIG.16G shows IF analysis using ⁇ -CT-f1S Attorney Docket No. U1202.70128WO00 C-terminal antibody that recognizes unique C- terminal sequences in expansion proteins expressed from the CASP8 GGGAGAexp locus.
  • FIG.16H shows IF analysis using ⁇ -CT- f3S C-terminal antibody that recognizes unique C- terminal sequences in expansion proteins expressed from the CASP8 GGGAGAexp locus.
  • FIG.16I shows ⁇ -polyGR antibody recognizes CASP8 chimeric expansion proteins containing polyGR tracts.
  • the top panel is a diagram showing minigenes containing 100-bp of upstream flanking sequence and three repeat expansions in CASP8 repeat expansion configurations expressing AUG-FLAG tagged CASP8 chimeric polymeric proteins (AUG-FLAG-hi64/i44/i64).
  • the bottom panel shows representative confocal images from double IF experiments showing ⁇ -polyGR antibody signal colocalizes with FLAG tag staining in SH-SY5Y transfected with AUG-FLAG- hi64/i44/i64 plasmids.
  • FIGs.17A-17C show IHC staining analyses with ⁇ -CT-F3S and ⁇ -CT-F1S C- terminal CASP8 locus-specific antibodies in hippocampal and frontal cortex regions from AD and control cases.
  • FIG.17A shows examples of IHC images showing CASP8-RAN-Sf3 protein aggregate staining (red) detected in the hippocampal tissue from CASP8 GGGAGAexp(+) AD, but not in CASP8 GGGAGAexp(-) AD and controls (free of Alzheimer’s pathologic changes).
  • FIG.17B shows examples of IHC detection of CASP8- RAN-Sf3 protein aggregates in frontal cortex gray and white matter regions from CASP8 GGGAGAexp(+) AD cases.
  • FIG.17C shows IHC detection of CASP8-RAN-Sf1 protein aggregates in frontal cortex gray matter region from CASP8 GGGAGAexp(+) AD cases.
  • FIGs.18A-18B show IHC staining analyses with ⁇ -CT-f3S antibody in hippocampal regions (HC) from AD and control cases.
  • FIG.18A shows IHC analyses ⁇ -CT-F3S staining in CA, Sub, and DG in AD#2 in addition to staining of pre-bleed control.
  • FIG.18B shows additional ⁇ -CT-f3S IHC analyses of hippocampal sections from CASP8 GGGAGAexp(+) controls (free of Alzheimer’s pathologic changes).
  • FIG.19 shows co-localization analyses of polyGR and ⁇ -CT-f3S antibody staining detected by immunofluorescence. Broader field images indicate polyGR staining partially co- localized with ⁇ - CT-f3S antibody staining in frontal cortex of CASP8 GGGAGAexp(+) and polyGR(+) but not in CASP8 GGGAGAexp(-) AD cases.
  • FIGs.20A-20E show effects of stress on translation of CASP8 GGGAGAexp and toxicity of CASP8 GGGAGA repeat expansion in cells.
  • FIG.20A shows an example of western blot analysis results of mutant protein in HA frame expressed from 6XStop-CASP8- Attorney Docket No.
  • FIG.20B shows quantification of the data in FIG.20A.
  • FIGs.21A-21B show analyses of pTau protein in SH-SY5Y cells transfected with FLAG-GR60 or 6XStop-CASP8-RE-3T minigenes.
  • FIG.21A shows IF analyses of endogenous pTau levels at S202 and T205 in polyGR(+) SH-SY5Y cells compared to polyGR(-) SH-SY5Y in cells transfected with FLAG-GR60 minigenes containing an alternative codon DNA sequence expressing AUG-initiated 3xFLAG-GR60 proteins.
  • FIG. 21B shows examples of IF analyses of pTau levels at S202 and T205 in SH-SY5Y cells expressing FLAG/Myc CASP8 RAN polymeric proteins compared with control cells. pTau (S202 and T205) was detected using AT8 antibody.
  • FIG.22 shows IF co-localization analyses of polyGR and human tau proteins in HEK293T cells.
  • FIGs.23A-23B shows long-range PCR of CASP8 GGGAGA exp .
  • FIG.23A shows a schematic diagram showing the primers for long-range PCR (LR-PCR) experiments, the reverse primer is conjugated with FAM fluorophore, which enables down-stream fragment analysis.
  • FIG.23B shows fragment analysis of LR-PCR products of CASP8 GGGAGAexp.
  • Case AD #1 showed two expansion alleles with LR-PCR product size of 919 and 946 bp.
  • Case AD #2 showed a single expanded allele with product size of 946 bp.
  • Case AD #3 showed no expansion alleles.
  • BG background peaks.
  • RAN protein e.g., a repeat-associated non-ATG translated protein
  • a “RAN protein” refers to a polypeptide translated from mRNA sequence comprising repeat sequences in the absence of an AUG initiation codon. Repeat sequences in nucleic acids encoding RAN proteins may be referred to as “microsatellite repeats” or “expansion repeats”. Translation of expansion Attorney Docket No.
  • U1202.70128WO00 repeats may produce RAN proteins comprising single amino acid, di-amino acid, tri-amino acid, quad-amino acid, penta-amino acid, hexa-amino acid, hepta-amino acid, octa-amino acid, nona-amino acid, or deca-amino acid repeat sequences which may be referred to “poly- amino acid repeats.”
  • Non-limiting examples of expansion repeats found in a nucleic acid encoding a RAN protein include those encoding poly(GR) RAN proteins (e.g., poly(GGTCGT), poly(GGCCGT), poly(GGACGT), poly(GGGCGT), poly(GGTCGC), poly(GGCCGC), poly(GGACGC), poly(GGGCGC), poly(GGTCGA), poly(GGCCGA), poly(GGACGA), poly(GGGCGA), poly(GGTCGG), poly(GGCCGG), poly(GGACGG), poly(GGGCGG
  • RAN proteins may comprise a plurality of poly-amino acid repeats (e.g., at least 10- 10,000 repeats.
  • RAN proteins comprising poly-amino acid repats may be capable of forming insoluble aggregates inside cells and/or tissues.
  • expression of RAN proteins comprising about 10 poly-amino acid repeats may not lead to a disease in a subject.
  • expression of RAN proteins comprising more than 10 poly-amino acid repeats e.g., 40 or more
  • may result a RAN protein-associated disease for example, a neurological disease, such as a neurodegenerative disease.
  • the present disclosure relates, at least in part, to the surprising discovery of a novel class of RAN proteins which comprise discontiguous or interrupted poly-amino acid repeat motifs. Aspects of the present disclosure further relate to the surprising discovery that said interrupted poly-amino acid repeat motifs are expressed in certain RAN protein diseases.
  • the present disclosure provides for methods of identifying a subject as having a RAN protein disease and/or treating a subject having or suspected of having a RAN- protein associated disease.
  • methods described herein comprise detecting one or more interrupted RAN proteins in a subject.
  • methods described herein comprise administering to the subject one or more anti-RAN protein agents.
  • an interrupted RAN protein or a discontiguous RAN protein is a RAN protein comprising a plurality of repeat units, wherein each repeat unit of the plurality is separated by one or more amino acids.
  • repeat units, repeat motifs, or RAN repeats refers to poly-amino acid repeats (e.g., poly(GA) or poly(GR)) and/or sequences comprising amino acids which are of the same sequence as the poly-amino acid repeats but are not contiguous (e.g., (GA) or (GR), (LPAC) (SEQ ID NO: 31), etc.).
  • repeat motifs, repeat units, and RAN repeats may be referred to as nucleotidic expansions in the nucleic acids (e.g., DNA, such as genomic DNA, and RNA, such as mRNA) encoding interrupted RAN proteins.
  • nucleic acids e.g., DNA, such as genomic DNA, and RNA, such as mRNA
  • an interrupted RAN protein comprises an amino acid sequence, wherein less than 100% of the amino acid sequence comprises repeat units.
  • an interrupted RAN protein comprising GAGAGAFGAGA (SEQ ID NO: 32), GAGAGAFGADGAGA (SEQ ID NO: 33), or GRGRGRFGRVYGRRKDGRGR (SEQ ID NO: 34) would have 90.9% (10 out of 11 residues are comprised in repeat units), 85.7% (12 out of 14 residues are comprised in repeat units), or 30% (6 out of 20 residues are comprised in repeat units) of its sequence comprising repeat units, respectively.
  • an interrupted RAN protein comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, Attorney Docket No.
  • an interrupted RAN protein comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted RAN protein comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.).
  • an interrupted RAN protein comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units).
  • an interrupted RAN protein comprises at least 2 repeat units.
  • an interrupted RAN protein may comprise between about 2 and about 10,000 repeat units.
  • an interrupted RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000- 1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500- 4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, or 9000-10000 repeat units.
  • an interrupted RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 repeat units.
  • repeat units comprise one or more amino acids residues in length.
  • repeat units comprise at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or at least 200 amino acid residues in length.
  • repeat units are 2-10,000 amino acid residues in length.
  • repeat units comprise between 2 and 500, between 20 and 300, between 30 and 200, between 40 and 100, between 50 and 90, or between 60 and 80 amino acid residues in length.
  • repeat units comprise more than 200 amino acid residues (e.g., 250, 500, 1000, 5000, 10,000, etc.) in length.
  • an interrupted RAN protein comprises a Attorney Docket No. U1202.70128WO00 plurality of repeat units comprising the same length and/or a plurality of repeat units comprising different lengths.
  • repeat units comprise single amino acid, di-amino acid, tri- amino acid, or quad-amino acid (e.g., tetra-amino acid) sequences.
  • repeat units comprise (PR), (GR), (S), (CP), (GP), (G), (A), (GA), (GD), (GE), (GQ), (GT), (L), (LP), (LPAC) (SEQ ID NO: 31), (LS), (P), (PA), (QAGR) (SEQ ID NO: 35), (RE), (SP), (VP), (FP), (GK), (FTPLSLPV) (SEQ ID NO: 36), (LLPSPSRC) (SEQ ID NO: 37), (YSPLPPGV) (SEQ ID NO: 38), (HREGEGSK) (SEQ ID NO: 39), (TGRERGVN) (SEQ ID NO: 40), (PGGRGE) (SEQ ID NO: 41), (GRQRGVNT) (SEQ ID NO: 42), or (GSKHREAE) (SEQ ID NO: 43).
  • repeat units comprise at least two poly-amino acid repeats. In some embodiments, repeat units comprise between about 2-10,000 poly-amino acid repeats. In some embodiments, repeat units comprise 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200- 1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500- 5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, or 9000-10000 poly-amino acids repeats.
  • repeat units comprise between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly-amino acid repeats.
  • repeat units comprise poly(Proline-Arginine) [poly(PR)], poly(Glycine- Arginine) [poly(GR)], poly(Serine) [poly(Ser)], poly(Cysteine-Proline) [poly(CP)], poly(Glycine-Proline) [(poly(GP)], poly(Glycine) [poly(G)], poly(Ala) [polyAla], poly(Glycine-Alanine) [poly(GA)], poly(Glycine-Aspartate) [poly(GD)], poly(Glycine- Glutamate) [poly(GE)], poly(Glycine-Glutamine) [poly(GQ)], poly(Glycine-Threonine) [poly(GT)], poly(Leucine) [polyLeucine) [polyLeu
  • repeat units are separated by one or more amino acid residues (e.g., non-repeating amino acids). In some embodiments, repeat units are separated by a plurality of amino acids (e.g., non-repeating amino acids).
  • repeat units are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acids.
  • 2-100 amino acids e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
  • repeat units are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, repeat units are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.). In some embodiments, repeat units are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.). In some embodiments, repeat units comprising poly-amino acid repeats are separated by a plurality of amino acids comprising one or more repeat units.
  • the plurality of amino acids comprises 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30- 50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-1000 repeat units.
  • the one or more repeat units in the plurality of amino acids comprise amino acids that are not contiguous.
  • the plurality of amino acids comprise one or more (PR), (GR), (S), (CP), (GP), (G), (A), (GA), (GD), (GE), (GQ), (GT), (L), (LP), (LPAC) (SEQ ID NO: 31), (LS), (P), (PA), (QAGR) (SEQ ID NO: 35), (RE), (SP), (VP), (FP), (GK), (FTPLSLPV) (SEQ ID NO: 36), (LLPSPSRC) (SEQ ID NO: 37), (YSPLPPGV) (SEQ ID NO: 38), (HREGEGSK) (SEQ ID NO: 39), (TGRERGVN) (SEQ ID NO: 40), (PGGRGE) (SEQ ID NO: 41), (GRQRGVNT) (SEQ ID NO: 42), or (GSKHREAE) (SEQ ID NO: 43) repeat units that are not contiguous.
  • an interrupted RAN protein comprises one or more of the following RAN repeat units: (PR), (GR), (S), (CP), (GP), (G), (A), (GA), (GD), (GE), (GQ), (GT), (L), (LP), (LPAC) (SEQ ID NO: 31), (LS), (P), (PA), (QAGR) (SEQ ID NO: 35), (RE), (SP), (VP), (FP), (GK), (FTPLSLPV) (SEQ ID NO: 36), (LLPSPSRC) (SEQ ID NO: 37), (YSPLPPGV) (SEQ ID NO: 38), (HREGEGSK) (SEQ ID NO: 39), (TGRERGVN) Attorney Docket No.
  • an interrupted RAN protein comprises an amino acid sequence, wherein less 100% of the amino acid sequence comprises the RAN repeat units.
  • an interrupted RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
  • an interrupted RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted RAN comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.).
  • an interrupted RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units).
  • an interrupted RAN protein comprises at least two RAN repeats.
  • a repeat unit in an interrupted RAN protein comprises between about 2 and about 10,000 RAN repeats.
  • a repeat unit in an interrupted RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300- 1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000- 6000, 6000-7000, 7000-8000, 8000-9000, or 9000-10000 RAN repeats.
  • a repeat unit in an interrupted RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 RAN repeats.
  • repeat units comprising RAN repeats are separated by a plurality of amino acids comprising one or more RAN repeat units, wherein the one or more RAN repeat units are not contiguous (e.g., separated by one or more amino acids).
  • U1202.70128WO00 repeat units comprising RAN repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500- 1000, 1000-5000, or 5000-10000 RAN repeat units.
  • repeat units comprising RAN repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) RAN repeat units.
  • each of the one or more RAN repeat units between repeat units comprising RAN repeats are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more RAN repeat units are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.).
  • each of the one or more RAN repeat units are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100).
  • 2-100 amino acids e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
  • each of the one or more RAN repeat units are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.).
  • an interrupted RAN protein is an interrupted poly(GR) protein.
  • an interrupted poly(GR) RAN protein comprises an amino acid sequence, wherein less 100% of the amino acid sequence comprises repeat units.
  • an interrupted poly(GR) RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%
  • an interrupted poly(GR) RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units.
  • an interrupted poly(GR) RAN comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises Attorney Docket No. U1202.70128WO00 repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.).
  • an interrupted poly(GR) RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units).
  • an interrupted poly(GR) RAN protein comprises at least two poly(GR) repeats.
  • a repeat unit in an interrupted poly(GR) RAN protein comprises between about 2 and about 10,000 poly(GR) repeats.
  • a repeat unit in an interrupted poly(GR) RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600- 1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000-8000, 8000- 9000, or 9000-10000 poly(GR) repeats.
  • a repeat unit in an interrupted poly(GR) RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly(GR) repeats.
  • repeat units comprising poly(GR) repeats are separated by a plurality of amino acids comprising one or more (GR) repeat units, wherein the one or more (GR) repeat units are not contiguous (e.g., separated by one or more amino acids).
  • repeat units comprising poly(GR) repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-10000 (GR) repeat units.
  • repeat units comprising poly(GR) repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) (GR) repeat units.
  • each of the one or more (GR) repeat units between repeat units comprising poly(GR) are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more (GR) repeat units between repeat units comprising poly(GR) are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.).
  • each of the one or more (GR) repeat units between repeat units comprising poly(GR) are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, Attorney Docket No.
  • 2-100 amino acids e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52
  • each of the one or more (GR) repeat units between repeat units comprising poly(GR) are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.).
  • an interrupted RAN protein is an interrupted poly(GA) protein.
  • an interrupted poly(GA) RAN protein comprises an amino acid sequence, wherein less than 100% of the amino acid sequence comprises repeat units.
  • an interrupted poly(GA) RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%
  • an interrupted poly(GA) RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GA) RAN comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.).
  • an interrupted poly(GA) RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units).
  • an interrupted poly(GA) RAN protein comprises at least two poly(GA) repeats.
  • a repeat unit in an interrupted poly(GA) RAN protein comprises between about 2 and about 10,000 poly(GA) repeats.
  • a repeat unit in an interrupted poly(GA) RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700- 800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500- 1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000- 8000, 8000-9000, or 9000-10000 poly(GA) repeats.
  • a repeat unit in an Attorney Docket No. U1202.70128WO00 interrupted poly(GA) RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly(GA) repeats.
  • repeat units comprising poly(GA) repeats are separated by a plurality of amino acids comprising one or more (GA) repeat units, wherein the one or more (GA) repeat units are not contiguous (e.g., separated by one or more amino acids).
  • repeat units comprising poly(GA) repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-10000 (GA) repeat units.
  • repeat units comprising poly(GA) repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) (GA) repeat units.
  • each of the one or more (GA) repeat units between repeat units comprising poly(GA) are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more (GA) repeat units between repeat units comprising poly(GA) are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.).
  • each of the one or more (GA) repeat units between repeat units comprising poly(GA) are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100).
  • 2-100 amino acids e.g., 2, 3, 4, 5, 6, 7, 8,
  • each of the one or more (GA) repeat units between repeat units comprising poly(GA) are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.).
  • an interrupted RAN protein is an interrupted poly(GP) protein.
  • an interrupted poly(GP) RAN protein comprises an amino acid sequence, wherein less than 100% of the amino acid sequence comprises repeat units.
  • an interrupted poly(GP) RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, Attorney Docket No
  • an interrupted poly(GP) RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units.
  • an interrupted poly(GP) RAN comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.). However, in some embodiments, an interrupted poly(GP) RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units). In some embodiments, an interrupted poly(GP) RAN protein comprises at least two poly(GP) repeats.
  • a repeat unit in an interrupted poly(GP) RAN protein comprises between about 2 and about 10,000 poly(GP) repeats.
  • a repeat unit in an interrupted poly(GP) RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700- 800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500- 1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000- 8000, 8000-9000, or 9000-10000 poly(GP) repeats.
  • a repeat unit in an interrupted poly(GP) RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly(GP) repeats.
  • repeat units comprising poly(GP) repeats are separated by a plurality of amino acids comprising one or more (GP) repeat units, wherein the one or more (GP) repeat units are not contiguous (e.g., separated by one or more amino acids).
  • repeat units comprising poly(GP) repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-10000 (GP) repeat units.
  • repeat units comprising poly(GP) repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) (GP) repeat units.
  • each of the one or more (GP) repeat units between repeat units comprising poly(GP) are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more (GP) repeat units between Attorney Docket No. U1202.70128WO00 repeat units comprising poly(GP) are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.).
  • each of the one or more (GP) repeat units between repeat units comprising poly(GP) are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100).
  • 2-100 amino acids e.g., 2, 3, 4, 5, 6, 7, 8,
  • each of the one or more (GP) repeat units between repeat units comprising poly(GP) are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.).
  • an interrupted RAN protein is an interrupted poly(PR) protein.
  • an interrupted poly(PR) RAN protein comprises an amino acid sequence, wherein less than 100% of the amino acid sequence comprises repeat units.
  • an interrupted poly(PR) RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%
  • an interrupted poly(PR) RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(PR) RAN comprises an amino acid sequence, wherein 50-99%% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.).
  • an interrupted poly(PR) RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units).
  • an interrupted poly(PR) RAN protein comprises at least two poly(PR) repeats.
  • a repeat unit in an interrupted poly(PR) RAN protein comprises between about 2 and about Attorney Docket No. U1202.70128WO00 10,000 poly(PR) repeats.
  • a repeat unit in an interrupted poly(PR) RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700- 800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500- 1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000- 8000, 8000-9000, or 9000-10000 poly(PR) repeats.
  • a repeat unit in an interrupted poly(PR) RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly(PR) repeats.
  • repeat units comprising poly(PR) repeats are separated by a plurality of amino acids comprising one or more (PR) repeat units, wherein the one or more (PR) repeat units are not contiguous (e.g., separated by one or more amino acids).
  • repeat units comprising poly(PR) repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-10000 (PR) repeat units.
  • repeat units comprising poly(PR) repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) (PR) repeat units.
  • each of the one or more (PR) repeat units between repeat units comprising poly(PR) are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more (PR) repeat units between repeat units comprising poly(PR) are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.).
  • each of the one or more (PR) repeat units between repeat units comprising poly(PR) are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100).
  • 2-100 amino acids e.g., 2, 3, 4, 5, 6, 7, 8,
  • each of the one or more (PR) repeat units between repeat units comprising poly(PR) are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.).
  • Nucleic Acids Encoding Interrupted RAN Proteins Attorney Docket No. U1202.70128WO00 Aspects of the present disclosure also relate to nucleic acids encoding RAN proteins (e.g., interrupted RAN proteins) described herein.
  • a nucleic acid encoding an interrupted RAN protein comprises DNA.
  • a DNA encoding an interrupted RAN protein may be transcribed to produce an RNA (e.g., an RNA comprising expansion repeat units).
  • a nucleic acid encoding an interrupted RAN protein comprises RNA.
  • an RNA encoding an interrupted RAN protein is an mRNA.
  • an RNA encoding an interrupted RAN protein may be translated (e.g., inside a cell, such as a cell in a subject) to produce the interrupted RAN protein.
  • a nucleic acid encoding an interrupted RAN protein further comprises one or more non-coding sequences.
  • a nucleic acid encoding an interrupted RAN protein further comprises one or more regulatory sequences (e.g., enhancers, promoters, transcription start/stop sites, polyA signals, etc.).
  • a nucleic acid encoding an interrupted RAN protein comprises at least one of (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCG
  • RNA such as an mRNA
  • “x” comprises an integer between 2 and 200. In some embodiments, “x” comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc.
  • “x” is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
  • x comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000.
  • a nucleic acid encoding interrupted RAN proteins comprise one or more nucleotides between expansion repeat units. In some embodiments, the one or more nucleotides between expansion repeat units may comprise non-naturally occurring sequences (e.g., synthetic sequences, such as those not normally found in a gene).
  • the one or more nucleotides between expansion repeat units may comprise sequences corresponding to a protein coding region of a gene (e.g., exonic regions). In some embodiments, the one or more nucleotides between expansion repeat units may comprise sequences corresponding to non-coding regions of a gene or a chromosomal locus (e.g., intronic regions, untranslated regions such as 5’UTR or 3’UTR, etc.). In some embodiments, the one or more nucleotides between expansion repeat units may comprise sequences corresponding to intergenic regions (e.g., nucleic acid sequences positioned between genes on a chromosome).
  • intergenic regions e.g., nucleic acid sequences positioned between genes on a chromosome
  • a nucleic acid encoding an interrupted RAN protein comprises one or more nucleotides between expansion repeat units corresponding to a gene associated with a disease (e.g., a neurological disease).
  • a disease e.g., a neurological disease.
  • the gene is associated with a disease, such as amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Attorney Docket No.
  • a gene associated with amyotrophic lateral sclerosis is C9ORF72.
  • a gene associated with frontotemporal dementia is C9ORF72.
  • a gene associated with Alzheimer’s disease is APP, PSEN1, PSEN2, MAPT, or CASP8.
  • a gene associated with Fragile X Syndrome is FMR1.
  • a gene associated with Spinal Bulbar Muscular Atrophy is AR.
  • a gene associated with Dentatorubropallidoluysian Atrophy is ATN1.
  • a gene associated with Spinocerebellar Ataxia 1 is ATXN1.
  • a gene associated with Spinocerebellar Ataxia 2 is ATXN2.
  • a gene associated with Spinocerebellar Ataxia 3 is ATXN3.
  • a gene associated with Spinocerebellar Ataxia 6 (SCA6) CACNA1A.
  • a gene associated with Spinocerebellar Ataxia 7 (SCA7) is ATXN7.
  • a gene associated with Spinocerebellar Ataxia 8” is ATXN8 or ATXN8OS.
  • a gene associated with Spinocerebellar Ataxia 12 is PPP2R2B.
  • a gene associated with or Spinocerebellar Ataxia 17 is TBP.
  • a gene associated with Spinocerebellar ataxia type 36 is NOP56.
  • a gene associated with Spinocerebellar ataxia type 29 is ITPR1.
  • a gene associated with Spinocerebellar ataxia type 10 is ATXN10.
  • a gene associated with myotonic dystrophy type 1 is DMPK.
  • a gene associated with myotonic dystrophy type 2 is CNBP.
  • a gene associated with Fuch’s Corneal Dystrophy is TCF4 (e.g., a TCF4 gene comprising the CTG18.1 repeat expansion).
  • Attorney Docket No. U1202.70128WO00 a nucleic acid encoding an interrupted RAN protein is comprised in a genome (e.g., a human genome) at one or multiple loci.
  • a nucleic acid encoding an interrupted RAN protein is comprised a gene or chromosomal locus set forth in Table 1 or Table 6.
  • a nucleic acid encoding an interrupted RAN protein is comprised in a gene selected from a list consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12,
  • a nucleic acid encoding an interrupted RAN protein comprises a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the nucleic acid comprises a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F).
  • a gene or chromosomal locus encoding an interrupted RAN protein comprises at least one mutation relative to a wild-type counterpart of the gene.
  • the at least one mutation comprises an insertion, a substitution, a deletion, or a combination thereof. In some embodiments, the at least one mutation comprises one or more repeat units. In some embodiments, the at least one mutation comprises at least one of (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GG
  • “x” comprises an integer between 2 and 200. In some embodiments, “x” comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc.
  • “x” is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, Attorney Docket No.
  • x comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300- 400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000.
  • a nucleic acid comprises a sequence encoding an interrupted poly(GR) RAN protein.
  • a nucleic acid encoding an interrupted poly(GR) RAN protein comprises a plurality of (GGTCGT), (GGCCGT), (GGACGT), (GGGCGT), (GGTCGC), (GGCCGC), GGACGC), (GGGCGC), (GGTCGA), (GGCCGA), (GGACGA), (GGGCGA), (GGTCGG), (GGCCGG), (GGACGG), (GGGCGG), (GGTAGA), (GGCAGA), (GGAAGA), (GGGAGA), (GGTAGG), (GGCAGG), (GGAAGG), and/or (GGGAGG) repeat units.
  • a nucleic acid encoding an interrupted poly(GR) RAN protein comprises one or more repeat units comprising poly(GGTCGT), poly(GGCCGT), poly(GGACGT), poly(GGGCGT), poly(GGTCGC), poly(GGCCGC), poly(GGACGC), poly(GGGCGC), poly(GGTCGA), poly(GGCCGA), poly(GGACGA), poly(GGGCGA), poly(GGTCGG), poly(GGCCGG), poly(GGACGG), poly(GGGCGG), poly(GGTAGA), poly(GGCAGA), poly(GGAAGA), poly(GGGAGA), poly(GGTAGG), poly(GGCAGG), poly(GGAAGG), and/or poly(GGGAGG) expansion repeats.
  • a nucleic acid encoding an interrupted poly(GR) RAN protein is comprised in a gene associated with a disease described herein (e.g., a neurological disease).
  • a nucleic acid encoding an interrupted poly(GR) RAN protein is comprised in a CASP8 gene.
  • a CASP8 gene e.g., a mutated CASP8
  • the CASP8 RNA is mRNA which is translated to produce the poly(GR) RAN protein.
  • a nucleic acid encoding an interrupted poly(GR) RAN protein is comprised in a ARMCX4 gene.
  • a ARMCX4 gene e.g., a mutated ARMCX4
  • the ARMCX4 RNA is mRNA which is translated to produce the poly(GR) RAN protein.
  • a nucleic acid encoding an interrupted poly(GR) RAN protein is comprised in a ALK gene.
  • a ALK gene (e.g., a mutated ALK) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GR) RAN protein.
  • the ALK RNA is mRNA which is translated to produce the poly(GR) RAN protein.
  • a nucleic acid comprises a sequence encoding an interrupted poly(GA) RAN protein.
  • a nucleic acid encoding an interrupted poly(GA) RAN protein comprises a plurality of (GGTGCT), (GGCGCC), (GGAGCA), (GGGGCG), (GGTGCC), (GGCGCA), (GGAGCG), (GGGGCT), (GGTGCA), (GGCGCG), (GGAGCT), (GGGGCC), (GGTGCG), (GGCGCT), (GGAGCC), and/or (GGGGCA) repeat units.
  • a nucleic acid encoding an interrupted poly(GA) RAN protein comprises one or more repeat units comprising poly(GGTGCT), poly(GGCGCC), poly(GGAGCA), poly(GGGGCG), poly(GGTGCC), poly(GGCGCA), poly(GGAGCG), poly(GGGGCT), poly(GGTGCA), poly(GGCGCG), poly(GGAGCT), poly(GGGGCC), poly(GGTGCG), poly(GGCGCT), poly(GGAGCC), and/or poly(GGGGCA) expansion repeats.
  • a nucleic acid encoding an interrupted poly(GA) RAN protein is comprised in a gene associated with a disease described herein (e.g., a neurological disease).
  • a nucleic acid encoding an interrupted poly(GA) RAN protein is comprised in a CASP8 gene.
  • a CASP8 gene e.g., a mutated CASP8
  • the CASP8 RNA is mRNA which is translated to produce the poly(GA) RAN protein.
  • a nucleic acid encoding an interrupted poly(GA) RAN protein is comprised in a ARMCX4 gene.
  • a ARMCX4 gene (e.g., a mutated ARMCX4) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GA) RAN protein.
  • the ARMCX4 RNA is mRNA which is translated to produce the poly(GA) RAN protein.
  • a nucleic acid encoding an interrupted poly(GA) RAN protein is comprised in a ALK gene.
  • a ALK gene e.g., a mutated ALK
  • a nucleic acid comprises a sequence encoding an interrupted poly(GP) RAN protein.
  • a nucleic acid encoding an interrupted poly(GP) RAN protein comprises a plurality of (GGTCCT), (GGCCCC), (GGACCA), (GGGCCG), (GGTCCC), (GGCCCA), (GGACCG), (GGGCCT), (GGTCCA), (GGCCCG), (GGACCT), (GGGCCC), (GGTCCG), (GGCCCT), (GGACCC), and/or (GGGCCA) repeat units.
  • a nucleic acid encoding an interrupted poly(GP) RAN protein comprises one or more repeat units comprising poly(GGTCCT), poly(GGCCCC), poly(GGACCA), poly(GGGCCG), poly(GGTCCC), poly(GGCCCA), poly(GGACCG), poly(GGGCCT), poly(GGTCCA), poly(GGCCCG), poly(GGACCT), poly(GGGCCC), poly(GGTCCG), poly(GGCCCT), poly(GGACCC), and/or poly(GGGCCA) expansion repeats.
  • a nucleic acid encoding an interrupted poly(GP) RAN protein is comprised in a gene associated with a disease described herein (e.g., a neurological disease).
  • a nucleic acid encoding an interrupted poly(GP) RAN protein is comprised in a CASP8 gene.
  • a CASP8 gene e.g., a mutated CASP8
  • the CASP8 RNA is mRNA which is translated to produce the poly(GP) RAN protein.
  • a nucleic acid encoding an interrupted poly(GP) RAN protein is comprised in a ARMCX4 gene.
  • a ARMCX4 gene (e.g., a mutated ARMCX4) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GP) RAN protein.
  • the ARMCX4 RNA is mRNA which is translated to produce the poly(GP) RAN protein.
  • a nucleic acid encoding an interrupted poly(GP) RAN protein is comprised in a ALK gene.
  • a ALK gene e.g., a mutated ALK
  • a nucleic acid comprises a sequence encoding an interrupted poly(PR) RAN protein.
  • a nucleic acid encoding an interrupted poly(PR) RAN protein comprises a plurality of (CCTCGT), (CCCCGT), (CCACGT), (CCGCGT), (CCTCGC), (CCCCGC), (CCACGC), (CCGCGC), (CCTCGA), (CCCCGA), (CCACGA), (CCGCGA), (CCTCGG), (CCCCGG), (CCACGG), (CCGCGG), (CCTAGA), (CCCAGA), (CCAAGA), (CCGAGA), (CCTAGG), (CCCAGG), (CCAAGG), and/or Attorney Docket No.
  • a nucleic acid encoding an interrupted poly(PR) RAN protein comprises one or more repeat units comprising poly(CCTCGT), poly(CCCCGT), poly(CCACGT), poly(CCGCGT), poly(CCTCGC), poly(CCCCGC), poly(CCACGC), poly(CCGCGC), poly(CCTCGA), poly(CCCCGA), poly(CCACGA), poly(CCGCGA), poly(CCTCGG), poly(CCCCGG), poly(CCACGG), poly(CCGCGG), poly(CCTAGA), poly(CCCAGA), poly(CCAAGA), poly(CCGAGA), poly(CCTAGG), poly(CCCAGG), poly(CCAAGG), and/or poly(CCGAGG) expansion repeats.
  • a nucleic acid encoding an interrupted poly(PR) RAN protein is comprised in a gene associated with a disease described herein (e.g., a neurological disease).
  • a nucleic acid encoding an interrupted poly(PR) RAN protein is comprised in a CASP8 gene.
  • a CASP8 gene e.g., a mutated CASP8
  • the CASP8 RNA is mRNA which is translated to produce the poly(PR) RAN protein.
  • a nucleic acid encoding an interrupted poly(PR) RAN protein is comprised in a ARMCX4 gene.
  • a ARMCX4 gene e.g., a mutated ARMCX4
  • the ARMCX4 RNA is mRNA which is translated to produce the poly(PR) RAN protein.
  • a nucleic acid encoding an interrupted poly(PR) RAN protein is comprised in a ALK gene.
  • a ALK gene (e.g., a mutated ALK) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(PR) RAN protein.
  • the ALK RNA is mRNA which is translated to produce the poly(PR) RAN protein.
  • Diseases Associated with RAN Proteins A “subject having or suspected of having a disease (e.g., neurological diseases) associated with RAN protein expression, translation, and/or accumulation” generally refers to a subject exhibiting one or more signs and symptoms of a disease (e.g., a neurological disease, such as a neurodegenerative disease).
  • the signs and symptoms include, but are not limited to, memory deficit (e.g., short term memory loss), confusion, deficiencies of executive functions (e.g., attention, planning, flexibility, abstract thinking, etc.), loss of speech, degeneration or loss of motor skills, etc., or a subject having or being Attorney Docket No. U1202.70128WO00 identified as having one or more genetic mutations associated with RAN protein expression, translation, and/or accumulation.
  • memory deficit e.g., short term memory loss
  • confusion e.g., confusion
  • deficiencies of executive functions e.g., attention, planning, flexibility, abstract thinking, etc.
  • loss of speech e.g., degeneration or loss of motor skills, etc.
  • a subject having or suspected of having a disease may be a subject with a familial history of a disease (e.g., a neurological disease, such as a neurodegenerative disease), such as a subject that is suspected to be, expected to be, or presumed to be at greater risk for developing said disease.
  • a subject can be a mammal (e.g., human, mouse, rat, dog, cat, or pig).
  • a subject is a non-human animal, for example a mouse, rat, guinea pig, cat, dog, horse, camel, etc.
  • the subject is a human.
  • a subject having or suspected of having a disease e.g., neurological diseases
  • a disease associated with RAN protein expression, translation, and/or accumulation is characterized as having a mutation in a gene or a chromosomal locus described herein.
  • the mutation comprises (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCG)x, (GGTGCC)x, (GGCGCA)x, (GGAGCG)x, (GGCT)x, (GGTGCA)x, (GGCGCG)x, (GGAGCT)x, (GGTGCA)x,
  • “x” comprises an integer between 2 and 200. In some embodiments, “x” comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, “x” is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, Attorney Docket No.
  • “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500- 2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000.
  • the mutation is comprised in a gene associated with a disease (e.g., a neurological disease), such as amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar
  • the mutation is comprised in a chromosomal locus or gene set forth in Table 1 or Table 6.
  • the mutation is comprised in a gene selected from a group consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164,
  • the mutation is comprised in a ARMCX4, ALK, and/or CASP8 gene.
  • the mutation comprises a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the mutation is comprised in a nucleic acid comprising a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F).
  • a subject having or suspected of having a disease e.g., neurological diseases
  • a disease e.g., neurological diseases
  • RAN protein expression, translation, and/or accumulation is characterized as expressing one or more interrupted RAN proteins (e.g., as a result of a mutation in a gene or chromosomal locus).
  • the one or more interrupted RAN proteins comprises a poly(Proline-Arginine) [poly(PR)], poly(Glycine- Arginine) [poly(GR)], poly(Serine) [poly(Ser)], poly(Cysteine-Proline) [poly(CP)], poly(Glycine-Proline) [(poly(GP)], poly(Glycine) [poly(G)], poly(Ala) [polyAla], Attorney Docket No.
  • RAN protein e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins
  • RAN proteins e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins
  • RAN proteins that are >20, >48, or >80 residues in length aggregate differently in a subject (e.g., in brain tissue).
  • a subject having less than 10 repeats or 10 repeat units does not exhibit signs or symptoms of a RAN protein-associated disease characterized by RAN protein expression, translation, and/or accumulation.
  • a subject having between 10 and 40 repeats or repeat units may or may not exhibit one or more signs or symptoms of a RAN protein-associated disease characterized by RAN protein expression, translation, and/or accumulation.
  • a subject having more than 40 repeats or repeat units exhibits one or more signs or symptoms of a RAN protein-associated disease characterized by RAN protein expression, translation, and/or accumulation.
  • a subject is identified as having a RAN protein-associated disease associated with RAN protein expression, translation, and/or accumulation is characterized by a large (>100) number of repeats or Attorney Docket No. U1202.70128WO00 repeat units (e.g., poly-amino acid repeats/repeat units and/or nucleotidic expansion repeats/repeat units).
  • a disease associated with RAN protein is amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar
  • a disease associated with RAN protein e.g., interrupted RAN protein expression, translation, and/or accumulation is Alzheimer’s disease (AD).
  • a subject expressing one or more RAN proteins is a subject having or suspected of having Alzheimer’s disease (AD).
  • a “subject having or suspected of having Alzheimer’s disease (AD)” can be a subject exhibiting one or more signs and symptoms of AD, including but not limited to memory deficit (e.g., short term memory loss), confusion, deficiencies of executive functions (e.g., attention, planning, flexibility, abstract thinking, etc.), loss of speech, degeneration or loss of motor skills, etc.
  • a subject having or suspected of having AD may be a subject having or being identified as having one or more genetic mutations associated with AD.
  • a subject having or suspected of having AD may be a subject having or being identified as having one or more signs and symptoms associated with one or more mutations associated with AD.
  • mutations associated with AD include mutations in genes, such as apolipoprotein (APP), presenillin genes (PSEN1 and PSEN2), tau protein (MAPT), or caspase 8 (CASP8).
  • a subject having or suspected of having AD is characterized by the accumulation of ⁇ -amyloid (A ⁇ ) peptides and hyper-phosphorylated tau protein throughout brain tissue of the subject.
  • a ⁇ ⁇ -amyloid
  • a subject has been diagnosed as having AD by a medical professional, according to the NINCDS-ADRDA Alzheimer's Criteria, as described by McKhann et al. (1984) "Clinical diagnosis of Alzheimer's disease: report of the Attorney Docket No. U1202.70128WO00 NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease". Neurology.34 (7): 939–44.
  • a disease associated with RAN protein e.g., interrupted RAN protein expression, translation, and/or accumulation amyotrophic lateral sclerosis (ALS).
  • a subject expressing one or more interrupted RAN proteins is a subject having or suspected of having amyotrophic lateral sclerosis (ALS).
  • ALS amyotrophic lateral sclerosis
  • a “subject having or suspected of having amyotrophic lateral sclerosis (ALS)” can be a subject exhibiting one or more signs and symptoms of ALS, including but not limited to memory deficit (e.g., short term memory loss), confusion, deficiencies of executive functions (e.g., attention, planning, flexibility, abstract thinking, etc.), loss of speech, degeneration or loss of motor skills, etc.
  • a subject having or suspected of having ALS may be a subject having or being identified as having one or more genetic mutations associated with ALS.
  • a subject having or suspected of having ALS may be a subject having or being identified one or more signs and symptoms associated with one or more genetic mutations associated with ALS.
  • Non-limiting examples of mutations in genes associated with ALS include C9orf72.
  • a subject has been diagnosed as having ALS by a medical professional.
  • interrupted RAN proteins as well as embodiments of diseases and subjects comprising the same, the following sections relate to embodiments that may be useful for reducing the levels of interrupted RAN protein levels in a cell (e.g., an cell which is ex vivo or in a cell in vivo, such as would be targeted during treatment of a subject) and/or detecting interrupted RAN proteins (e.g., to identify subjects having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation) in biological samples.
  • a cell e.g., an cell which is ex vivo or in a cell in vivo, such as would be targeted during treatment of a subject
  • interrupted RAN proteins e.g., to identify subjects having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation
  • Agents e.g., therapeutic agents and/or anti-RAN protein agents
  • methods that have been previously described (see disclosures related to detection methods, therapeutic agents, and/or method of RAN protein-associated disease treatment, which are incorporated by reference herein, in WO2014159247A1, WO2016196324A1, WO2017176813A1, WO2018195110A1, WO2019067587A1, WO2019060918A1, WO2021007110A1, WO2021231887A1, WO2021055880A1, WO2021061537A1, WO2021072187A2, WO2023077153A1, WO2023102111A1, and WO2023164686A2) may also be useful in addition to or in combination with embodiments described herein.
  • agents e.g., therapeutic agents and/or anti-RAN protein agents
  • agents are useful for reducing RAN protein levels (e.g., interrupted RAN protein levels) in a cell (e.g., a cell in a subject).
  • methods of reducing interrupted RAN protein levels comprise administration of an agent described herein.
  • agents include small molecules, nucleic acids (e.g., inhibitory nucleic acids, genes or gene variants, transgenes, recombinant adeno-associated virus (rAAV) genomes, etc.), peptides, proteins (e.g., antibodies or antigen-binding fragments thereof), and rAAV particles.
  • nucleic acids e.g., inhibitory nucleic acids, genes or gene variants, transgenes, recombinant adeno-associated virus (rAAV) genomes, etc.
  • peptides e.g., proteins
  • proteins e.g., antibodies or antigen-binding fragments thereof
  • rAAV particles e.g., antibodies or antigen-binding fragments thereof
  • an agent described herein may be useful for detecting a RAN protein (e.g., an interrupted RAN protein).
  • embodiments of the present disclosure related to inhibitory nucleic acids and/or guide RNAs may also be applied to designing nucleic acids that are complementary to a target sequence, such as one present in in a biological sample comprising an RNA transcript encoding an interrupted RAN protein that is detected using a method described herein (e.g., a method comprising the use of a nucleic acid probe, primer, etc.).
  • a method described herein e.g., a method comprising the use of a nucleic acid probe, primer, etc.
  • Embodiments of the present disclosure related to antibodies and antigen-binding fragments may also be useful for detecting interrupted RAN proteins in biological samples.
  • an agent may reduce RAN protein levels (e.g., interrupted RAN protein levels) in a cell and/or tissue in a subject (e.g., when the agent is administered in an effective amount).
  • an agent e.g., a therapeutic agent
  • RAN proteins e.g., interrupted RAN proteins
  • an agent is capable of targeting one or more RAN proteins (e.g., interrupted RAN proteins) and/or modulating a gene or gene product (e.g., protein) that interacts with one or more RAN proteins (e.g., interrupted RAN proteins).
  • an agent capable of targeting one or more RAN proteins may be capable of reducing expression, activity, accumulation, and/or aggregation of RAN proteins (e.g., interrupted RAN proteins).
  • an agent capable of modulating a gene or gene product (e.g., protein) that interacts genetically and/or physically with one or more RAN Attorney Docket No. U1202.70128WO00 proteins (e.g., interrupted RAN proteins) or a gene or chromosomal locus thereof described herein (e.g., genes/chromosomal loci set forth in Tables 1 and 6).
  • a gene or gene product e.g., protein
  • that interacts e.g., genetically and/or physically interacts
  • one or more RAN proteins e.g., interrupted RAN proteins
  • a gene or chromosomal locus thereof may control the transcription and/or translation of a RAN protein, post- translationally modify a RAN protein, regulate the intracellular trafficking of a RAN proteins, etc.
  • a gene and gene product that interacts (e.g., genetically and/or physically interacts) with one or more RAN proteins (e.g., interrupted RAN proteins) or a gene or chromosomal locus thereof include eukaryotic initiation factor 2 (eIF2), eukaryotic initiation factor 3 (eIF3), protein kinase R (PKR), p62, LC3 I subunit, LC3 II subunit, the RISC loading complex subunit, TARBP2, and Toll-like receptor 3 (TLR3).
  • agents inhibit eukaryotic initiation factor 2 (eIF2) or a Protein Kinase R (PKR) (e.g., an inhibitor of eIF2 and/or PKR).
  • an inhibitor of eIF2 is an inhibitor of a serine/threonine kinase.
  • serine/threonine kinases include protein kinase A (PKA), protein kinase C (PKC), Mos/Raf kinases, mitogen-activated protein kinases (MAPKs), protein kinase B (AKT kinase), etc.
  • an eIF2 inhibitor is a protein kinase R (PKR) inhibitor.
  • PPKR protein kinase R
  • Inhibitors of eIF2 and PKR are described, for example in International Application Publication No. WO 2018/195110, the entire content of which is incorporated herein by reference.
  • an eIF2 inhibitor may be a direct inhibitor or an indirect inhibitor.
  • a direct modulator functions by interacting with (e.g., interacting with or binding to) a gene encoding eIF2 (or eIF2 ⁇ ), or an eIF2 protein complex.
  • an indirect modulator functions by interacting with a gene or protein that regulates the expression or activity of eIF2 or an eIF2 ⁇ (e.g., does not directly interact with a gene or protein encoding eIF2 or an eiF2 ⁇ ).
  • an inhibitor eIF2 or PKR is a selective inhibitor.
  • a “selective inhibitor” refers to an inhibitor of eIF2 or PKR that preferentially inhibits activity or expression of one type of eIF2 subunit compared with other types of eIF2 subunits, or inhibits activity or expression of PKR preferentially compared to other kinases.
  • an inhibitor of eIF2 is a selective inhibitor of eIF2 ⁇ .
  • an inhibitor of eIF2 is a selective Attorney Docket No. U1202.70128WO00 inhibitor of eIF2A.
  • an inhibitor of eIF2 is a selective inhibitor of protein kinase R (PKR), such as a selective PKR inhibitor.
  • PPKR protein kinase R
  • an agent e.g., a therapeutic agent
  • eIF3 eukaryotic initiation factor 3
  • eIF3 eukaryotic initiation factor 3
  • eIF3 eukaryotic initiation factor 3
  • Mammalian eIF3 the largest most complex initiation factor, comprises up to 13 non-identical subunits.
  • eIF3f is involved in many steps of translation initiation including stabilization of the ternary complex, mediating binding of mRNA to 40S subunit and facilitating dissociation of 40S and 60S ribosomal subunits.
  • therapeutic agents that inhibit expression or activity of an eIF3 subunit e.g., eIF3f, eIF3m, eIF3h, or other eIF3 subunit
  • eIF3 inhibitor may be a direct inhibitor or an indirect inhibitor.
  • a direct modulator functions by interacting with (e.g., interacting with or binding to) a gene encoding eIF3 (or an eIF3 subunit), or an eIF3 protein complex, or an eIF3 subunit.
  • an indirect modulator functions by interacting with a gene or protein that regulates the expression or activity of eIF3 or an eIF3 subunit (e.g., does not directly interact with a gene or protein encoding eIF3 or an eiF3 subunit).
  • an inhibitor of eIF3 is a selective inhibitor.
  • a “selective inhibitor” refers to a modulator of eIF3 that preferentially inhibits activity or expression of one type of eIF3 subunit compared with other types of eIF3 subunits.
  • an inhibitor of eIF3 is a selective inhibitor of eIF3f.
  • An eIF3 inhibitor can be a protein (e.g., antibody), nucleic acid, or small molecule.
  • proteins that inhibit eiF3 include but are not limited to polyclonal anti-eIF3 antibodies, monoclonal anti-eIF3 antibodies, Measles Virus N protein, Viral stress-inducible protein p56, etc.
  • a “therapeutic agent” may refer to an agent which is capable of producing a desirable result in a subject. In some embodiments, the desirable result will depend upon the active agent being administered.
  • an effective amount of rAAV particles may be an amount of the particles that are capable of transferring an expression construct to a host cell, tissue or organ.
  • a Attorney Docket No. U1202.70128WO00 therapeutically acceptable amount of an anti-RAN protein antibody may be an amount that is capable of treating a disease (e.g., a neurological disease, such as a neurodegenerative disease) by reducing expression and/or aggregation of interrupted RAN proteins and/or appearance or number of RNA foci comprising RAN protein-encoding microsatellite repeat sequences.
  • an effective amount is an amount effective in reducing the level of RAN proteins (e.g., interrupted RAN proteins) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of RAN proteins relative to the level of RAN proteins in a cell or subject that has not been administered a therapeutic agent).
  • RAN proteins e.g., interrupted RAN proteins
  • the effective amount is an amount effective in reducing the translation of RAN proteins (e.g., interrupted RAN proteins) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of RAN proteins relative the level of RAN proteins in a cell or subject that has not been administered a therapeutic agent).
  • RAN proteins e.g., interrupted RAN proteins
  • the level of RAN proteins relative the level of RAN proteins in a cell or subject that has not been administered a therapeutic agent e.g., the level of RAN proteins relative the level of RAN proteins in a cell or subject that has not been administered a therapeutic agent.
  • dosage for any one subject depends on many factors, including the subject's size, body surface area, age, the particular composition to be administered, the active ingredient(s) in the composition, time and route of administration, general health, and other drugs being administered concurrently.
  • methods of the present disclosure comprise administration of an agent (e.g., a therapeutic agent) in an amount effective for treatment of a subject (e.g., a subject having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation).
  • an agent e.g., a therapeutic agent
  • to "treat" a disease refers to reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
  • the at least one sign or symptom is experienced by subjects having a RAN- protein associated disease.
  • a RAN-protein associated disease is characterized by at least one sign or symptom associated with a disease selected from the group consisting of: amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Attorney Docket No.
  • ALS amyotrophic lateral sclerosis
  • FDD Frontotemporal dementia
  • HD Huntington’s disease
  • AD Alzheimer’s disease
  • FFAXA Fragile X Syndrome
  • a RAN- protein associated disease is characterized by expression of one or more RAN proteins (e.g., interrupted RAN proteins) from a gene or chromosomal locus listed in Table 1 or Table 6.
  • RAN proteins e.g., interrupted RAN proteins
  • a RAN-protein associated disease is characterized by expression of one or more RAN proteins (e.g., interrupted RAN proteins) from a gene selected from a group consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164
  • RAN proteins e.g
  • a RAN-protein associated disease is characterized by expression of one or more RAN proteins (e.g., interrupted RAN proteins) from a gene, such as ARMCX4, ALK, and/or CASP8.
  • RAN proteins e.g., interrupted RAN proteins
  • a subject comprising a RAN protein-associated disease has been diagnosed with said disease via a method described herein (e.g., a method of detecting interrupted RAN proteins or RNA transcripts or DNA sequences thereof).
  • a disease associated with RAN protein expression, translation, and/or accumulation is associated with expression, translation, and/or accumulation of one or more interrupted RAN proteins.
  • a therapeutic agent useful for treating a disease associated with RAN protein expression, translation, and/or accumulation may also be an agent which is therapeutic for treating a subject expressing one or more interrupted RAN proteins.
  • one or more therapeutic molecules are administered to a subject to treat a disease associated with RAN proteins, such as interrupted RAN proteins.
  • a subject is administered 2, 3, 4, 5, 6, 7, 8, 9, or 10 therapeutic agents (e.g., proteins, nucleic acids, small molecules, etc., or any combination thereof).
  • therapeutic agents e.g., proteins, nucleic acids, small molecules, etc., or any combination thereof.
  • agents e.g., therapeutic agents and/or anti-RAN protein agents
  • a small molecule inhibits expression (e.g., RNA and/or protein levels) or activity (e.g., aggregation) of one or more RAN proteins (e.g., interrupted RAN proteins).
  • an agent e.g., a therapeutic agent
  • a small molecule is small molecule which inhibits a gene or gene product that interacts (e.g., genetically and/or physically interacts) with a RAN protein or a gene or chromosomal locus thereof.
  • a small molecule is inhibitor of p62 (see, e.g., inhibitors in Leestemaker et al. (2017) Cell Chemical Biology 24, 725–736).
  • a small molecule is an inhibitor of eIF3 (or an eIF3 subunit), such as mTOR inhibitors (e.g., rapamycin, PP242), S6 kinase (S6K) inhibitors, Attorney Docket No. U1202.70128WO00 etc.
  • a small molecule is TLR3 inhibitor (see, e.g.,TLR3 inhibitors in Cheng et al. (2011) J Am Chem Soc 133(11):3764-7).
  • a small molecule inhibits expression or activity of eukaryotic initiation factor 2 (eIF2) or a subunit thereof (e.g., eIF2A), such as LY 364947, salubrinal, Sal003, ISRIB , etc.
  • eIF2A eukaryotic initiation factor 2
  • a small molecule is an inhibitor of PKR, such as metformin, also known as N,N-dimethylbiguanide (IUPAC N,N-Dimethylimidodicarbonimidic diamide and CAS 657- 24-9), 6-amino-3-methyl-2-oxo-N-phenyl-2,3-dihydro-1H-benzo[d]imidazole-1- carboxamide, N-[2-(1H-indol-3-yl)ethyl]-4-(2-methyl-1H-indol-3-yl)pyrimidin-2-amine, chloroguanide [1-[amino-(4-chloroanilino)methylidene]-2-propan-2-yl-guanidine, CAS 500- 92-5], Chlorproguanil [1-[Amino-(3,4-dichloroanilino)methylidene]-2-propan-2-ylguanidine, CAS 537
  • a small molecule is buformin or phenformin. In some embodiments, a small molecule in an inhibitor of TARBP2.
  • pharmaceutically acceptable salt refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1–19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases.
  • Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid or by using other methods known in the art such as ion exchange.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid
  • organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid or by using other methods known in the art such as ion exchange.
  • salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, Attorney Docket No.
  • Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N + (C 1–4 alkyl) 4 - salts.
  • Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
  • Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.
  • solvate refers to forms of the compound that are associated with a solvent, usually by a solvolysis reaction.
  • This physical association may include hydrogen bonding.
  • Conventional solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like.
  • Metformin may be prepared, e.g., in crystalline form, and may be solvated.
  • Suitable solvates include pharmaceutically acceptable solvates and further include both stoichiometric solvates and non-stoichiometric solvates.
  • the solvate will be capable of isolation, for example, when one or more solvent molecules are incorporated in the crystal lattice of a crystalline solid.
  • “Solvate” encompasses both solution- phase and isolable solvates.
  • Representative solvates include hydrates, ethanolates, and methanolates.
  • hydrate refers to a compound that is associated with water.
  • the number of the water molecules contained in a hydrate of a compound is in a definite ratio to the number of the compound molecules in the hydrate. Therefore, a hydrate of a compound may be represented, for example, by the general formula R ⁇ x H 2 O, wherein R is the compound and wherein x is a number greater than 0.
  • a given compound may form more than one type of hydrates, including, e.g., monohydrates (x is 1), lower hydrates (x is a number greater than 0 and smaller than 1, e.g., hemihydrates (R ⁇ 0.5 H2O)), and polyhydrates (x is a number greater than 1, e.g., dihydrates (R ⁇ 2 H2O) and hexahydrates (R ⁇ 6 H2O)).
  • monohydrates x is 1
  • lower hydrates x is a number greater than 0 and smaller than 1, e.g., hemihydrates (R ⁇ 0.5 H2O)
  • polyhydrates x is a number greater than 1, e.g., dihydrates (R ⁇ 2 H2O) and hexahydrates (R ⁇ 6 H2O)
  • tautomers or “tautomeric” refers to two or more interconvertible compounds resulting from at least one formal migration of a hydrogen atom and at least one change in valency (e.g., a single bond to a double bond, a triple bond to a single bond, or vice Attorney Docket No. U1202.70128WO00 versa).
  • the exact ratio of the tautomers depends on several factors, including temperature, solvent, and pH. Tautomerizations (i.e., the reaction providing a tautomeric pair) may catalyzed by acid or base.
  • Exemplary tautomerizations include keto-to-enol, amide-to-imide, lactam-to-lactim, enamine-to-imine, and enamine-to-(a different enamine) tautomerizations.
  • isomers compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed “isomers.” Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereomers” and those that are non-superimposable mirror images of each other are termed “enantiomers.” When a compound has an asymmetric center, for example, it is bonded to four different groups, a pair of enantiomers is possible.
  • An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R- and S-sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light and designated as dextrorotatory or levorotatory (i.e., as (+) or (-)-isomers respectively).
  • a chiral compound can exist as either individual enantiomer or as a mixture thereof.
  • a mixture containing equal proportions of the enantiomers is called a “racemic mixture.
  • the term “prodrugs” refers to compounds that have cleavable groups and become by solvolysis or under physiological conditions the compounds described herein, which are pharmaceutically active in vivo.
  • Such examples include, but are not limited to, choline ester derivatives and the like, N-alkylmorpholine esters and the like.
  • Other derivatives of the compounds described herein have activity in both their acid and acid derivative forms, but in the acid sensitive form often offer advantages of solubility, tissue compatibility, or delayed release in the mammalian organism (see, Bundgard, H., Design of Prodrugs, pp.7-9, 21-24, Elsevier, Amsterdam 1985).
  • Prodrugs include acid derivatives well known to practitioners of the art, such as, for example, esters prepared by reaction of the parent acid with a suitable alcohol, or amides prepared by reaction of the parent acid compound with a substituted or unsubstituted amine, or acid anhydrides, or mixed anhydrides.
  • Simple aliphatic or aromatic esters, amides, and anhydrides derived from acidic groups pendant on the compounds described herein are particular prodrugs.
  • double ester type prodrugs such as (acyloxy)alkyl esters or ((alkoxycarbonyl)oxy)alkylesters.
  • C 1 -C 8 alkyl Attorney Docket No. U1202.70128WO00
  • C 2 -C 8 alkenyl, C 2 -C 8 alkynyl, aryl, C 7 -C 12 substituted aryl, and C 7 -C 12 arylalkyl esters of the compounds described herein may be preferred.
  • agents are inhibitory nucleic acids.
  • an inhibitory nucleic acid is capable of hybridizing with a nucleic acid sequence (e.g., a target sequence, such as a target sequence in an RNA transcript).
  • a length and a degree of sequence complementarity that is sufficient for base-pairing with a nucleic acid sequence (e.g., a target sequence) in a specific and/or stable manner.
  • an inhibitory nucleic acid comprises about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-30, 30-40, 40-50, or more nucleotides.
  • the degree of sequence complementarity required for hybridization with a nucleic acid sequence is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%.
  • an inhibitory nucleic acid comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-30, 30-40, 40- 50, or more nucleotides that is complementary to a nucleic acid sequence (e.g., a target sequence).
  • an inhibitory nucleic acid is capable of hybridizing with encoding or a gene product that interacts with a RAN protein (e.g., eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3).
  • a eIF2 gene or gene product comprises the sequence set forth in GenBank Accession No. NM_004094.4.
  • an eIF2A gene or gene product comprises the sequence set forth in GenBank Accession No. NM_032025.4.
  • a eIF3 gene or gene product comprises the sequence set forth in include GenBank Accession No.
  • NM_003750.2 (eIF3a), GenBank Accession No. NM_003751.3 (eIF3b), GenBank Accession No. NM_003752.4 (eIF3c), GenBank Accession No. NM_003753.3 (eIF3d), GenBank Accession No. NM_001568.2 (eIF3e), GenBank Accession No. NM_003754.2 (eIF3f), GenBank Accession No. NM_003755.4 (eIF3g), GenBank Accession No. NM_003756.2 (eIF3h), GenBank Accession No. NM_003757.3 (eIF3i), GenBank Accession No. NM_003758.3 (eIF3j), GenBank Accession No.
  • a PKR gene or gene product comprises the sequence set forth in GenBank Accession No. NP_002750.1.
  • an inhibitory nucleic acid is an antisense oligonucleotide (ASO).
  • an ASO comprises a short (approximately 15 to 30 nucleotides) sequence that is complementary to a nucleic acid sequence (e.g., a target sequence, such as a target sequence in an RNA transcript encoding an interrupted RAN protein or a gene product that interacts with a RAN protein, such as an eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3).
  • ASOs comprise naturally occurring nucleotides and/or modified (e.g., chemically modified) nucleotides.
  • nucleotides could be modified by replacing the ribose with an alternate saccharide moiety such as 2’-deoxyribose, or 2’-O-(2-mehtoxyethyl)ribose, methylation, and/or replacing phosphodiester bonds between nucleotides with phosphorothioate linkages.
  • modifications of several nucleotides at both the 3’ and 5’ ends of ASOs inhibit degradation by ubiquitous terminally active RNA nucleases and, therefore, improve the stability and thus half-life of the antisense oligo.
  • an ASO targets an RNA (e.g., mRNA) corresponding to a gene comprising a microsatellite repeat sequence.
  • the antisense oligonucleotide inhibits translation of one or more interrupted RAN proteins.
  • antisense oligonucleotides block the translation of a target protein by hybridizing to an mRNA sequence encoding the target protein, thereby inhibiting protein synthesis by ribosomal machinery.
  • an inhibitory nucleic acid is an interfering RNA.
  • an interfering RNA comprises a sequence that is complementary with between 5 and 50 continuous nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12 ,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, about 30, about 35, about 40, or about 50 continuous nucleotides) of a nucleic acid sequence (e.g., a target sequence, such as a target sequence in an RNA transcript encoding an interrupted RAN protein or a gene product that interacts with a RAN protein, such as an eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3).
  • a target sequence such as a target sequence in an RNA transcript encoding an interrupted RAN protein or a gene product that interacts with a RAN protein, such as an eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62,
  • Non-limiting examples of interfering RNAs include dsRNA, Attorney Docket No. U1202.70128WO00 siRNA, shRNA, miRNA, and ami-RNA.
  • the inhibitory nucleic acid is a nucleic acid aptamer (e.g., an RNA aptamer or DNA aptamer).
  • an inhibitory RNA molecule can be unmodified or modified.
  • an inhibitory RNA molecule comprises one or more modified oligonucleotides, e.g., phosphorothioate-, 2'-O-methyl-, etc.-modified oligonucleotides, as such modifications have been recognized in the art as improving the stability of oligonucleotides in vivo.
  • modified oligonucleotides e.g., phosphorothioate-, 2'-O-methyl-, etc.-modified oligonucleotides, as such modifications have been recognized in the art as improving the stability of oligonucleotides in vivo.
  • an interfering RNA is an eIF3f siRNA (e.g., Dharmacon Cat # J-019535-08), eIF3m siRNA (e.g., Dharmacon Cat # J-016219-12), eIF3h siRNA (e.g., Dharmacon Cat # J- 003883-07), or a variant thereof, such as an shRNA comprising the same sense and/or antisense sequence and further comprising a suitable shRNA loop sequence.
  • an inhibitory nucleic acid is aptamer.
  • an aptamer comprises a sequence that is complementary and/or capable of binding a nucleic acid sequence (e.g., a target sequence, such as a target sequence in an RNA transcript encoding an interrupted RAN protein or a gene product that interacts with a RAN protein, such as an eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3).
  • a nucleic acid sequence e.g., a target sequence, such as a target sequence in an RNA transcript encoding an interrupted RAN protein or a gene product that interacts with a RAN protein, such as an eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3
  • an aptamer comprises a sequence that is complementary and/or capable of binding a RAN protein (e.g., an interrupted RAN protein) or a protein that interacts with a RAN protein (e.g., eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3).
  • a RAN protein e.g., an interrupted RAN protein
  • a protein that interacts with a RAN protein e.g., eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3
  • an inhibitory nucleic acid is capable of hybridizing with a nucleic acid sequence (e.g., target sequence) present in a gene, chromosomal, or RNA transcript (e.g., mRNA)
  • a target sequence comprises expansion repeat units.
  • an inhibitory nucleic acid is capable of hybridizing with a target sequence, or a portion thereof, comprising GGTCGT, GGCCGT, GGACGT, GGGCGT, GGTCGC, GGCCGC, GGACGC, GGGCGC, GGTCGA, GGCCGA, GGACGA, GGGCGA, GGTCGG, GGCCGG, GGACGG, GGGCGG, GGTAGA, GGCAGA, GGAAGA, GGGAGA, GGTAGG, GGCAGG, GGAAGG, GGGAGGTGCT, GGCGCC, GGAGCA, GGGGGGCG, GGTGCC, GGCGCA, GGAGCG, GGGGCT, GGTGCA, GGCGCG, GGAGCT, GGGGCC, GGTGCG, GGCGCT, GGAGCC, GGCA GGTCCT, GGCCCC, GGCC, GGTCCT, GG
  • CCGCGC U1202.70128WO00 CCGCGC, CCTCGA, CCCCGA, CCACGA, CCGCGA, CCTCGG, CCCCGG, CCACGG, CCGCGG, CCTAGA, CCCAGA, CCAAGA, CCGAGA, CCTAGG, CCCAGG, CCAAGG, CCGAGG TCT, TCC, TCA, TCG, AGT, AGC, CCTG, and/or CAGG repeat units.
  • the target sequence, or a portion thereof is present in a nucleic acid encoding an interrupted RAN protein comprising (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCGCA)x, (
  • x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
  • x comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400-500, 500- 750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000- 6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000.
  • an inhibitory nucleic acid is capable of hybridizing with a target sequence corresponding to a gene associated with a disease, such as amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar
  • an inhibitory nucleic acid is capable of hybridizing with a target sequence corresponding to a gene or a chromosomal locus set forth in Table 1 or Table 6. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a target sequence, or a portion thereof, corresponding to a gene selected from: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNP
  • an inhibitory nucleic acid is capable of hybridizing with a target sequence corresponding to ARMCX4, ALK, or CASP8. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the target sequence comprises a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F).
  • an agent e.g., a therapeutic agent
  • a guide RNA gRNA
  • an RNA-guided nuclease e.g., a complex comprising a gRNA and a Cas nuclease
  • gRNA guide RNA
  • guide RNA may be used interchangeably throughout to refer to a nucleic acid comprising a sequence that physically interacts with (e.g., binds to) an RNA- guided nuclease (e.g., Cas9 nuclease) and localizes it too a target sequence.
  • a gRNA comprises a targeting sequence which is 5’ relative to a scaffold sequence.
  • a “targeting sequence” refers to the sequence within the gRNA that is used to localize an RNA-guided nuclease (e.g., a Cas9 nuclease) to target DNA.
  • a “scaffold sequence” refers to the sequence within the gRNA that is responsible for RNA-guided nuclease binding and does not include the targeting sequence.
  • a “sgRNA” refers to a gRNA Attorney Docket No. U1202.70128WO00 comprising a scaffold sequence which is a fusion of the endogenous bacterial crRNA and tracrRNA.
  • a sgRNA comprises the targeting sequence.
  • a targeting sequence or a portion thereof hybridizes to (e.g., is partially or completely complementary to) a target sequence in a nucleic acid encoding an interrupted RAN protein.
  • the targeting sequence is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% complementary to a target sequence in a nucleic acid encoding an interrupted RAN protein.
  • the targeting sequence is 100% complementary to a target sequence in a nucleic acid encoding an interrupted RAN protein.
  • the targeting sequence or portion thereof that hybridizes to the target sequence in a nucleic acid encoding an interrupted RAN protein may be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides in length. In some embodiments, the targeting sequence or portion thereof that hybridizes to a target sequence in a nucleic acid encoding an interrupted RAN protein is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the targeting sequence or portion thereof that hybridizes to a target sequence in a nucleic acid encoding an interrupted RAN protein is between 10-30, or between 15-25, nucleotides in length.
  • a targeting sequence or portion thereof that hybridizes to a target sequence in a nucleic acid encoding an interrupted RAN protein is 20 nucleotides in length.
  • a targeting sequence comprises a sequence set forth in Table 4.
  • a gRNA is capable of hybridizing with a target sequence, or a portion thereof, comprising GGTCGT, GGCCGT, GGACGT, GGGCGT, GGTCGC, GGCCGC, GGACGC, GGGCGC, GGTCGA, GGCCGA, GGACGA, GGGCGA, GGTCGG, GGCCGG, GGACGG, GGGCGG, GGTAGA, GGCAGA, GGAAGA, GGGAGA, GGTAGG, GGCAGG, GGAAGG, GGGAGGTGCT, GGCGCC, GGAGCA, GGGGCG, GGTGCC, GGCGCA, GGAGCG, GGGGCT, GGTGCA
  • the target sequence is present in a nucleic Attorney Docket No. U1202.70128WO00 acid encoding an interrupted RAN protein comprising (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GG
  • x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
  • “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400- 500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000. In some embodiments, a target Attorney Docket No.
  • U1202.70128WO00 sequence, or a portion thereof, corresponds to a gene selected from: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR
  • a gRNA is a modified gRNA (e.g., a chemically modified gRNA).
  • a modified gRNA e.g., a chemically modified gRNA.
  • Methods of designing gRNAs and chemically modified gRNAs will be apparent to those of skill in the art (see, e.g., Jinek, et al. Science (2012) 337(6096):816-821, Ran, et al. Attorney Docket No. U1202.70128WO00 Nature Protocols (2013) 8:2281-2308, International Publication No. WO 2014/093694, and International Publication No. WO 2013/176772; Vanegas et al., Fungal Biol Biotechnol.
  • RNA-guided nuclease may be used to refer to any protein comprising a nuclease domain or a variant thereof (e.g., a catalytically inactive nuclease or partially catalytically inactive nuclease) that physically interacts with an RNA molecule (e.g., a guide RNA) that localizes the nuclease to a site in a target DNA sequence.
  • RNA molecule e.g., a guide RNA
  • a “ribonucleoprotein complex” or “RNP complex” may be used to refer to a an RNA-guided nuclease (e.g., a Cas nuclease, for example a Cas9 nuclease) bound to a gRNA.
  • RNA-guided nuclease which includes Cas nucleases, such as Cas9 nuclease, are known in the art (see, e.g., Gill et al. LIPSCOMB 2017. In United States: Inscripta Inc.; Price et al. Biotechnol. Bioeng. (2020) 117(60): 1805-1816; International Publication No. WO 2015/157070; See, e.g., Gao et al. Nat. Biotechnol. (2017) 35(8): 789- 792; Liang et al. Nat. Comm. (2022) 13: 3421; Walton et al.
  • an RNA-guided nuclease comprises a Cas nuclease variant (e.g., a Cas9 variant).
  • the Cas nuclease variant comprises one or more mutations, wherein the one or more mutations comprises a point mutation, a substitution, an insertion, and/or a deletion of one or more amino acids.
  • the Cas nuclease variant is a catalytically inactive or a partially catalytically inactive Cas nuclease variant (see, e.g., Yeh et al. Nat. Cell. Biol. (2019) 21: 1468-1478; e.g., Hsu et al. Cell (2014) 157: 1262-1278; Jasin et al. DNA Repair (2016) 44: 6-16; Sfeir et al. Trends Biochem. Sci.
  • the Cas nuclease variant is Cas9-NRTH, a dead Cas9 (dCas9), a Cas9-NG, or Cas9-NRCH.
  • the RNA-guided nuclease targets and deaminates a specific nucleobase.
  • the RNA-guided nuclease further comprises a deaminase.
  • the deaminase is fused to the RNA-guided nuclease on one end (e.g., Attorney Docket No. U1202.70128WO00 the N-terminus or C-terminus of the RNA-guided nuclease).
  • the RNA- guided nuclease comprises an adenosine deaminase. In some embodiments, the RNA-guided nuclease comprises a cytidine deaminase. In some embodiments, the RNA-guided nuclease comprises a cytidine deaminase and one or more uracil glycosylase inhibitor domains. In some embodiments, the RNA-guided nuclease is an adenine base editor (ABE) or a cytosine base editor (CBE).
  • ABE adenine base editor
  • CBE cytosine base editor
  • RNA-guided nucleases and/or deaminases that can be used to a Cas nuclease for base editing are known in the art (see, e.g., Komor et al. Nature (2016) 533: 420-424; Rees et al. Nat. Rev. Genet. (2016) 19(12): 770-788; Anzalone et al. Nat. Biotechnol. (2020) 38: 824-844; Eid et al. Biochem. J. (2016) 475(11): 1965-1964; Rees et al.
  • the RNA-guided nuclease is fused to an engineered reverse transcriptase (RT) domain.
  • RT reverse transcriptase
  • the RNA-guided nuclease is a prime editor (see, e.g., Anzalone et al. Nature (2019) 576 (7785): 149-157).
  • the RNA-guided nuclease is capable of recognizing (e.g., binding to) a PAM sequence.
  • the term “protospacer adjacent motif” or “PAM” refers to a DNA sequence that may be required for an RNA-guided nuclease and a gRNA (e.g., Cas9/sgRNA) to interrogate a specific DNA sequence through Watson-Crick pairing of its guide RNA with the genome.
  • the PAM specificity may be a function of the DNA-binding specificity of the RNA-guided nuclease, e.g., a “protospacer adjacent motif recognition domain” at the C-terminus of Cas9.
  • the PAM comprises a 2 to 8 base pair DNA sequence (e.g., 2, 3, 4, 5, 6, 7, or 8 base pair DNA sequence) immediately downstream or upstream of the target sequence, which may be recognized directly by an RNA-guided nuclease to promote cleavage of the target site, or in the case of nuclease-deficient Cas allows binding to the DNA at that locus.
  • recognition of the PAM sequence comprises an RNA-guided nuclease and a gRNA forming an R-loop.
  • the PAM can be a 5' PAM located upstream of the 5' end of the target sequence.
  • the PAM can be a 3' PAM located downstream of the 5' end of the target sequence. In some embodiments, the PAM is located on the same strand on the target sequence. In some embodiments, the PAM is 1-30 nucleotides upstream or downstream of the target sequence. In some embodiments, the PAM is 1, 2, 3, 4, 5, 6, 7, 8, Attorney Docket No. U1202.70128WO00 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides upstream or downstream of the target sequence.
  • a PAM comprises a sequence of NGG, NAG, NGCG, NGAG, NGAN, NGNG, NG, GAA, GAT, NNGRRT, NNGRR(N), TTTV, TYCV, TATV, NNNNRYAC, NNNNRYAC, NNNNRYAC, or NAAAAC, wherein “N” is any nucleotide or base, “R” is A or guanine (G), and “Y” is C or T.
  • a PAM is a present in a repeat unit comprising GGTCGT, GGCCGT, GGACGT, GGGCGT, GGTCGC, GGCCGC, GGACGC, GGGCGC, GGTCGA, GGCCGA, GGACGA, GGGCGA, GGTCGG, GGCCGG, GGACGG, GGGCGG, GGTAGA, GGCAGA, GGAAGA, GGGAGA, GGTAGG, GGCAGG, GGAAGG, GGGAGGTGCT, GGCGCC, GGAGCA, GGGGGGCG, GGTGCC, GGCGCA, GGAGCG, GGGGCT, GGTGCA, GGCGCG, GGAGCT, GGGGCC, GGTGCG, GGCGCT, GGAGCC, GGCAGGTCCT, GGCCCC, GGACCA, GGGCCG, GGTCCC, GGCCCA, GGACCG, GGGCCG, GGTCCC
  • a PAM is present a nucleic acid encoding an interrupted RAN protein comprising (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCGCA)x, (GGAGCG)x, (GGAGCG)x, (GGCT)x, (GGTGCA
  • x represents the number of repeat units present in a nucleic acid encoding an interrupted RAN protein.
  • x comprises an integer between 2 and 200.
  • x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc.
  • x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117
  • “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400-500, 500- 750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000- 6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000.
  • a PAM is present in a gene selected from: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX
  • a target sequence comprises a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the target sequence comprises a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F).
  • an RNA-guided nuclease and a gRNA are contacted with a target sequence or one or more cells comprising a target sequence.
  • contacting an RNA-guided nuclease and a gRNA with one or more cells comprises contacting the one or more cells a nucleic acid encoding the gRNA.
  • a nucleic acid encoding the RNA-guided nuclease is contacted with the one or more cells.
  • an RNA-guided nuclease and a gRNA are encoded on the same nucleic acid.
  • a nucleic acid for delivery of an RNA-guided nuclease and/or a gRNA comprises a regulatory sequence operably linked to the sequence(s) encoding the RNA-guided nuclease and/or the gRNA (e.g., a promoter sequence for increasing expression of the RNA-guided nuclease and the gRNA).
  • the RNA-guided nuclease and the gRNA are contacted with one or more cells, wherein the RNA-guided nuclease is in the form of a protein.
  • the gRNA is bound to the RNA- guided nuclease (e.g., as a ribonucleoprotein complex).
  • delivery of a Attorney Docket No. U1202.70128WO00 complex comprising an RNA-guided nuclease and a gRNA to one or more cells comprises electroporation.
  • agents e.g., therapeutic agents and/or anti-RAN protein agents
  • PLR protein kinase R
  • protein kinase R (PKR) variant refers to a protein comprising an amino acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a wild-type protein kinase R (PKR) (e.g., GenBank Accession No. NP_002750.1), wherein the variant protein comprises at least one amino acid variation (also referred to sometimes as “mutation”) relative to the amino acid sequence of the wild-type PKR.
  • PRR protein kinase R
  • the amino acid sequence of a PKR variant is at least 75%, at least 85%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the amino acid sequence of wild-type PKR. In some embodiments, the amino acid sequence is about 95- 99.9% identical to the amino acid sequence of wild-type PKR.
  • the protein comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 different amino acid sequence variations as compared to the sequence of amino acids set forth in the amino acid sequence of wild-type PKR.
  • a PKR variant comprises a mutation at position 296 (e.g., position 296 of a human wild-type PKR).
  • the mutation at position 296 is K296R.
  • a PKR variant is a dominant negative PKR variant.
  • PKR variants functions in a dominant negative manner to inhibit phosphorylation of eIF2 ⁇ .
  • an agent e.g., a therapeutic agent
  • a vector comprises a sequence encoding an inhibitory nucleic acid, a gene variant, a transgene, a gRNA, and/or an RNA- guided nuclease described herein.
  • any of said agent may be encoded by a sequence comprised in a vector and provided to a cell (e.g., a cell in a subject) and expressed off of the vector.
  • a cell e.g., a cell in a subject
  • vectors comprise deoxyribonucleotides.
  • vectors comprise ribonucleotides. In some embodiments, vectors comprise both deoxyribonucleotides and ribonucleotides. In some embodiments, vectors are single-stranded. In some embodiments, vectors are double-stranded. In some embodiments, vectors are circular (e.g., artificial chromosomes, such as artificial bacterial chromosomes, or plasmids, such as circular plasmids, nanoplasmids, and minicircle plasmids). In some embodiments, vectors are linear. In some embodiments, vectors are self-complementary.
  • a vector may be maintained in high levels in a cell using a selection method, such as one involving an antibiotic resistance gene.
  • a vector may comprise a partitioning sequence which ensures stable inheritance of the vector.
  • a vector is a high copy number vector.
  • a vector is about 1 to 60 kb in size, for example from 1 to 50kb, from 1 to 30 kb, such as from 1 to 20 kb, for example from 1 to 15 kb, such as from 1 to 10, for example from 1 to 8 kb, such as from 2 to 7 kb, for example from 3 to 6 kb, such as from 4 to 5 kb.
  • a vector is sufficiently small to be effectively packaged in an rAAV viral particle (e.g., shorter than 5kb, shorter than 4 kb shorter than 3 kb, shorter than 2 kb, etc.).
  • an agent e.g., a therapeutic agent
  • rAAV recombinant adeno- associated virus
  • AAV adeno-associated virus
  • AAV refers to the virus itself or derivatives thereof. The term covers all AAV subtypes including both naturally occurring and recombinant forms, unless otherwise indicated.
  • rAAV recombinant adeno-associated virus which refers to AAV comprising a nucleic acid sequence not of AAV origin (e.g., a heterologous nucleic acid).
  • a nucleic acid sequence found within an rAAV is an “rAAV genome” which refers to a nucleic acid comprising a heterologous nucleic acid flanked by 5’ and 3’ AAV inverted terminal repeats (ITRs).
  • ITRs AAV inverted terminal repeats
  • heterologous nucleic acid may refer to any DNA sequence that is not normally found between flanking AAV ITRs.
  • a heterologous nucleic acid comprises at least one transgene.
  • transgene refers to a DNA sequence which encodes at least one RNA to be expressed in a cell.
  • a heterologous nucleic acid e.g., a Attorney Docket No. U1202.70128WO00 transgene
  • the agent is an inhibitory nucleic acid, a gene variant, a gRNA, and/or an RNA-guided nuclease described herein.
  • a heterologous nucleic acid comprises a sequence encoding an antibody or an antigen- binding fragment described herein.
  • AAV particle or “rAAV particle” refers to a particle formed by one or more AAV capsid proteins.
  • AAV particles and rAAV particles comprise an encapsidated nucleic acid (e.g., an rAAV particle comprising an rAAV genome).
  • an rAAV particles comprises a nucleic acid (e.g., a heterologous nucleic acid found between AAV ITRs, such as a transgene) encoding an inhibitory nucleic acid, a gene variant, a gRNA, and/or an RNA-guided nuclease described herein.
  • rAAV particles are packaged using a packaging nucleic acid and/or a helper nucleic acid.
  • helper nucleic acid refers to a nucleic acid (e.g., a helper vector or a nucleic acid provided in a helper virus) comprising one or more genes (e.g., E1, E2A, E4, and/or VA) which functions in trans for productive AAV replication and encapsidation.
  • a “packaging nucleic acid” refers to a nucleic acid (e.g., a packaging vector) which provides nucleotide sequences (e.g., AAV rep and AAV capsid protein gene sequences) upon which an AAV is dependent for replication (e.g., accessory functions).
  • RNAs encoded by transgenes may be under the control (e.g., operably linked) to one or more regulatory sequences (e.g., enhancers, promoters, transcription start sites, translation start sites, splicing acceptor/donor sites, transcription termination sites, stop codons, polyA signals, etc.).
  • the regulatory sequence may be found between the AAV ITRs.
  • nucleic acids comprising transgenes may comprise one or more regulatory elements that are not operably linked to the transgene.
  • AAV particles and rAAV particles comprise an encapsidated nucleic acid (e.g., an rAAV particle comprising an rAAV genome).
  • the one or more capsid proteins correspond to an AAV serotype, AAV serotype derivative, or AAV pseudotype.
  • AAV particle and rAAV particle serotypes of the present disclosure include mammalian AAV1, mammalian AAV2, mammalian AAV3, mammalian AAV4, mammalian AAV5, mammalian AAV6, mammalian AAV7, mammalian Attorney Docket No. U1202.70128WO00 AAV8, mammalian AAV9, and mammalian AAV10.
  • Non-limiting examples of rAAV pseudotypes include mammalian AAV2/1, mammalian AAV2/5, mammalian AAV2/6, mammalian AAV2/8, mammalian AAV2/9, mammalian AAV3/1, mammalian AAV3/5, mammalian AAV3/8, and mammalian AAV 3/9, wherein the slash denotes an rAAV genome of one serotype packaged in the capsid from a different serotype (e.g., an rAAV genome comprising AAV2 ITRs packaged in a capsid of AAV5 would be AAV2/5).
  • rAAV particles may be engineered with hybrid or mutant mammalian AAV capsid protein derivates, such as AAVrh.10, AAVrh.74, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV- HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41, AAV9.45, AAV6(Y445F/Y731F), AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShHIO, AAV2 (Y->F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, AAV2(pentaYF), AAV2- BCDG(T491V+K556R), AAV5-M2, AAV5(Y719F), AAV6(T492V
  • rAAV particles are packaged using a packaging nucleic acid and/or a helper nucleic acid.
  • the AAV helper nucleic acid supports efficient AAV vector production without generating any detectable wild-type AAV particles (e.g., AAV particles containing functional rep and capsid protein genes).
  • nucleic acids and methods of making said nucleic acids, have been previously described and are commercially available (see, e.g., pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E/R585E), and pDP8.ape plasmids from PlasmidFactory, Bielefeld, Germany; other products and services available from Vector Biolabs, Philadelphia, PA; Cellbiolabs, San Attorney Docket No.
  • a packaging nucleic acid comprises a AAV rep nucleic acid sequence and an AAV cap nucleic acid sequence.
  • the AAV rep nucleic acid sequence and/or the AAV cap nucleic acid sequence is of the same AAV serotype as the AAV ITRs flanking the heterologous nucleic acid.
  • the AAV rep nucleic acid sequence and the AAV ITRs are of the same AAV serotype but are of a different serotype relative to the AAV cap sequence.
  • the components cultured in a cell to package a rAAV genome in a capsid may be provided to the cell in trans.
  • rAAV particles may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650).
  • rAAV particles are produced by transfecting a cell with an AAV vector (comprising a heterologous nucleic acid flanked by ITR elements) to be packaged into rAAV particles, and at least one AAV helper or packaging nucleic acid.
  • AAV vector comprising a heterologous nucleic acid flanked by ITR elements
  • two nucleic are used which include a helper nucleic acid and a packaging nucleic acid.
  • any one or more of the required components may be provided by a cell which has been engineered to stably contain one or more of the required components (e.g., via genomic integration of a packaging nucleic acid and/or a helper nucleic acid).
  • the cell will contain the required component(s) under the control of either an inducible promoter or a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the Attorney Docket No.
  • an agent may be an anti-RAN protein antibody or an antigen-binding fragment thereof.
  • an anti-RAN antibody can be a polyclonal antibody.
  • an anti-RAN antibody can be a monoclonal antibody.
  • an anti-RAN antigen-binding fragment can be derived from a polyclonal antibody.
  • an anti-RAN protein antibody or antigen-binding fragment may bind to an extracellular RAN protein, an intracellular RAN protein, or both extracellular and intracellular RAN proteins.
  • an agent e.g., a therapeutic agent
  • an antibody or an antigen-binding fragment is an antibody or antigen- binding fragment that is capable of recognizing a gene product that interacts with a RAN protein.
  • an antibody or an antigen-binding fragment is anti-eIF2.
  • an antibody or an antigen-binding fragment is anti-eIF2A.
  • an antibody or an antigen-binding fragment is anti-eIF3.
  • an antibody or an antigen-binding fragment is anti-eIF3a.
  • an antibody or an antigen-binding fragment is anti-eIF3b.
  • an antibody or an antigen-binding fragment is anti-eIF3c.
  • an antibody or an antigen-binding fragment is anti-eIF3d. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3e. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3f. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3g. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3h. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3i. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3j. In some Attorney Docket No.
  • an antibody or an antigen-binding fragment is anti-eIF3k. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3l. In some embodiments, an antibody or an antigen-binding fragment is anti-eiF3m. In some embodiments, an antibody or an antigen-binding fragment is anti-PKR. In some embodiments, an antibody or an antigen-binding fragment is anti-p62. In some embodiments, an antibody or an antigen-binding fragment is anti-LC3 I subunit. In some embodiments, an antibody or an antigen-binding fragment is anti-LC3 II subunit. In some embodiments, an antibody or an antigen-binding fragment is anti-TARBP2.
  • an antibody or an antigen-binding fragment is anti-or TLR3).
  • An “antibody” broadly refers to an immunoglobulin molecule or any functional mutant, variant, or derivation thereof. It is desired that functional mutants, variants, and derivations thereof, as well as antigen-binding fragments, retain the essential epitope binding features of an Ig molecule.
  • Antibodies are capable of specific binding to a target through at least one antigen recognition site, located in the variable region of the immunoglobulin molecule.
  • an intact or full-length antibody comprises two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and a first, second and third constant regions (CH1, CH2 and CH3).
  • Each light chain contains a light chain variable region (VL) and a constant region (CL).
  • VL variable region
  • CL constant region
  • the VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR constituents on the heavy chain are referred to as CDRH1, CDRH2, and CDRH3, while CDR constituents on the light chain are referred to as CDRL1, CDRL2, and CDRL3.
  • the CDRs typically refer to the Kabat CDRs, as described in Sequences of Proteins of Immunological Interest, US Department of Health and Human Services (1991), eds. Kabat et al.
  • Another standard for characterizing the antigen binding site is to refer to the hypervariable loops as described by Chothia. See, e.g., Chothia, D. et al. (1992) J. Mol. Biol. 227:799-817; and Tomlinson et al. (1995) EMBO J. 14:4628-4638. Still another standard is the AbM definition used by Oxford Molecular’s AbM antibody modeling software. See, generally, e.g., Protein Sequence and Structure Analysis of Antibody Variable Domains. In: Antibody Engineering Lab Manual (Ed.: Duebel, S, and Kontermann, R., Springer-Verlag, Heidelberg). Embodiments described with respect to Kabat CDRs can Attorney Docket No.
  • Each VH and VL is composed of three CDRs and four FRs, arranged from amino- terminus to carboxy-terminus in the following order: FRl, CDRl, FR2, CDR2, FR3, CDR3, FR4.
  • a full-length antibody can be an antibody of any class, such as IgD, IgE, IgG, IgA, or IgM (or sub-class thereof), and the antibody need not be of any particular class.
  • immunoglobulins can be assigned to different classes.
  • immunoglobulins There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.
  • the heavy-chain constant domains that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively.
  • the subunit structures and three- dimensional configurations of different classes of immunoglobulins are well known.
  • the term “antigen-binding fragment” refers to any derivative of an antibody which is less than full-length, and that can bind specifically to a target.
  • antigen-binding fragments retain the ability to specifically bind to RAN protein.
  • An antigen- binding fragment may comprise the heavy chain variable region (VH), the light chain variable region (VL), or both. Each of the VH and VL typically contains three complementarity determining regions CDR1, CDR2, and CDR3. Examples of antigen binding fragments include, but are not limited to, Fab, Fab’, F(ab’)2, scFv, Fv, dsFv, diabody, affibodies, and Fd fragments. Antigen binding fragments may be produced by any appropriate means.
  • an antigen binding fragment may be enzymatically or chemically produced by fragmentation of an intact antibody or it may be recombinantly produced from a gene encoding the partial antibody sequence.
  • an antigen binding fragment may be wholly or partially synthetically produced.
  • An antigen binding fragment may optionally be a single chain antibody fragment.
  • a fragment may comprise multiple chains which are linked together, for instance, by disulfide linkages.
  • An antigen binding fragment may also optionally be a multimolecular complex.
  • a functional antigen binding fragment will typically comprise at least about 50 amino acids and more typically will comprise at least about 200 amino acids.
  • Single-chain Fvs are recombinant antigen binding fragments consisting of only the variable light chain (VL) and variable heavy chain (VH) covalently connected to one Attorney Docket No. U1202.70128WO00 another by a polypeptide linker.
  • VL or VH may be the NH2-terminal domain.
  • the polypeptide linker may be of variable length and composition so long as the two variable domains are bridged without serious steric interference.
  • the linkers are comprised primarily of stretches of glycine and serine residues with some glutamic acid or lysine residues interspersed for solubility.
  • Diabodies are dimeric scFvs. The components of diabodies typically have shorter peptide linkers than most scFvs, and they show a preference for associating as dimers (see, e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R. J., et al. (1994) Structure 2: 1121-1123). Diabodies are also encompassed within the term “antigen- binding fragment.”
  • a Fv fragment is an antigen binding fragment which consists of one VH and one VL domain held together by noncovalent interactions.
  • the two domains of the Fv fragment, VL and VH can be coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody.
  • dsFv is used herein to refer to an Fv with an engineered intermolecular disulfide bond to stabilize the VH-VL pair.
  • dsFvs are also encompassed within the term “antigen-binding fragment.”
  • a F(ab’)2 fragment is an antigen binding fragment essentially equivalent to that obtained from immunoglobulins (typically IgG) by digestion with an enzyme pepsin at pH 4.0-4.5. The fragment may be recombinantly produced.
  • F(ab’)2 are also encompassed within the term “antigen-binding fragment.”
  • a Fab fragment is an antigen binding fragment essentially equivalent to that obtained by reduction of the disulfide bridge or bridges joining the two heavy chain pieces in the F(ab’)2 fragment.
  • the Fab’ fragment may be recombinantly produced.
  • Fab are also encompassed within the term “antigen-binding fragment.”
  • a Fab fragment is an antigen binding fragment essentially equivalent to that obtained by digestion of immunoglobulins (typically IgG) with the enzyme papain.
  • the Fab fragment Attorney Docket No. U1202.70128WO00 may be recombinantly produced.
  • the heavy chain segment of the Fab fragment is the Fd piece.
  • Fab fragments are also encompassed within the term “antigen-binding fragment.”
  • An affibody is a small protein comprising a three-helix bundle that functions as an antigen binding molecule (e.g., an antibody mimetic).
  • affibodies are approximately 58 amino acids in length and have a molar mass of approximately 6 kDa.
  • Affibody molecules with unique binding properties are acquired by randomization of 13 amino acids located in two alpha-helices involved in the binding activity of the parent protein domain.
  • Specific affibody molecules binding a desired target protein can be isolated from pools (libraries) containing billions of different variants, using methods such as phage display.
  • Affibodies are also encompassed within the term “antigen-binding fragment.”
  • the term “human antibody” refers to antibodies having variable and constant regions corresponding substantially to, or derived from, antibodies obtained from human subjects, e.g., encoded by human germline immunoglobulin sequences or variants thereof.
  • Human antibodies may include one or more amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). Such mutations may present in one or more of the CDRs, particularly CDR3, or in one or more of the framework regions.
  • the human antibodies may have at least one, two, three, four, five, or more positions replaced with an amino acid residue that is not encoded by the human germline immunoglobulin sequence.
  • the term "human antibody”, as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
  • recombinant human antibody is intended to include all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial human antibody library (Hoogenboom H. R., (1997) TIB Tech.15:62-70; Azzazy H., and Highsmith W. E., (2002) Clin. Biochem.35:425-445; Gavilondo J. V., and Larrick J. W. (2002) BioTechniques 29: 128-145; Hoogenboom H., and Chames P.
  • such recombinant human antibodies may be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies may be sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
  • the anti-RAN protein antibody or antigen-binding fragment is an anti-poly-Serine, anti-poly(GR), anti-poly(PR), anti-poly(CP), anti-poly(GP), anti- poly(G), anti-poly(A), anti-poly(GA), anti-poly(GD), anti-poly(GE), anti-poly(GQ), anti- poly(GT), anti-poly(L), anti-poly(LP), anti-poly(LPAC) (SEQ ID NO: 31), anti-poly(LS), anti-poly(P), anti-poly(PA), anti-poly(QAGR) (SEQ ID NO: 35), anti-poly(RE), anti- poly(SP), anti-poly(VP), anti-poly(FP), anti-poly(GK), anti-poly(FTPLSLPV) (SEQ ID NO: 36), anti-poly(LLPSPSRC) (SEQ ID NO: 37), anti-poly(YSPLPPGV)
  • the antibody or antigen-binding fragment specifically binds poly(GA). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(Ser). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(PR). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GR). In some embodiments, the antibody or antigen-binding fragment specifically binds polyLeu. In some embodiments, the antibody or antigen-binding fragment specifically binds polyAla. In some embodiments, the antibody or antigen-binding fragment specifically binds poly(LPAC) (SEQ ID NO: 31).
  • the antibody or antigen-binding fragment specifically binds poly(QAGR) (SEQ ID NO: 35). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(CP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(G). In Attorney Docket No. U1202.70128WO00 some embodiments, the antibody or antigen-binding fragment specifically binds poly(GD). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GE). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GQ).
  • the antibody or antigen-binding fragment specifically binds poly(GT). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(LP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(LS). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(P). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(PA). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(RE). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(SP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(VP).
  • the antibody or antigen-binding fragment specifically binds poly(FP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GK). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(FTPLSLPV) (SEQ ID NO: 36). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(LLPSPSRC) (SEQ ID NO: 37). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(YSPLPPGV) (SEQ ID NO: 38). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(HREGEGSK) (SEQ ID NO: 39).
  • the antibody or antigen- binding fragment specifically binds poly(TGRERGVN) (SEQ ID NO: 40). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(PGGRGE) (SEQ ID NO: 41). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GRQRGVNT) (SEQ ID NO: 42). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GSKHREAE) (SEQ ID NO: 43).
  • an anti-RAN antibody or antigen-binding fragment targets (e.g., specifically binds to) any portion of an interrupted RAN protein that does not comprise the poly-amino acid repeat, for example the C-terminus of an interrupted RAN protein (e.g., the C-terminus of a poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GR), poly(GT), poly(L), poly(LP), poly(LPAC) (SEQ ID NO:31), poly(LS), poly(P), poly(PA), poly(PR), poly(QAGR) (SEQ ID NO: 35), poly(RE), poly(Ser), poly(SP), poly(VP), poly(FP), poly(GK), poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ Attorney Docket No.
  • the C-terminus of an interrupted RAN protein e.g., the C-terminus of a poly(CP), poly
  • a set (or combination) of anti-RAN antibodies or antigen- binding fragments e.g., a combination of two or more anti-RAN antibodies selected from poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GR), poly(GT), poly(L), poly(LP), poly(LPAC) (SEQ ID NO: 31), poly(LS), poly(P), poly(PA), poly(PR), poly(QAGR) (SEQ ID NO: 32), poly(RE), poly(Ser), poly(SP), poly(VP), poly(FP), poly(GK), poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), poly(PGGRGE) (SEQ ID NO: 41), poly(GRCP), poly(
  • the disclosure contemplates variants (e.g., homologs) of amino acid and nucleic acid sequences for the heavy chain variable region and light chain variable region of the antibodies.
  • “Homology” refers to the percent identity between two polynucleotides or two polypeptide moieties.
  • substantially homology when referring to a nucleic acid, or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in about 90 to 100% of the aligned sequences.
  • nucleic acid sequences sharing substantial homology are at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98% at least 99% sequence identity.
  • substantially homology indicates that, when optimally aligned with appropriate gaps, insertions or deletions with another polypeptide, there is nucleotide sequence identity in about 90 to 100% of the aligned sequences.
  • the term "highly conserved" means at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. For example, in Attorney Docket No.
  • highly conserved proteins share at least 85%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98% at least 99% identity. In some cases, highly conserved may refer to 100% identity. Identity is readily determined by one of skill in the art by, for example, the use of algorithms and computer programs known by those of skill in the art.
  • RAN antibodies of the disclosure can bind to an interrupted RAN protein with high affinity, e.g., with a Kd less than 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M or lower.
  • anti-RAN antibodies or antigen binding fragments can bind to an interrupted RAN protein with an affinity between 5 pM and 500 nM, e.g., between 50 pM and 100 nM, e.g., between 500 pM and 50 nM.
  • the disclosure also includes antibodies or antigen binding fragments that compete with any of the antibodies described herein for binding to Interrupted RAN proteins and that have an affinity of 50 nM or lower (e.g., 20 nM or lower, 10 nM or lower, 500 pM or lower, 50 pM or lower, or 5 pM or lower).
  • anti-RAN antibodies of the present disclosure may comprise one or more of VH, VL, and CDR, amino acid sequences shown in the tables below.
  • anti-RAN protein antibodies may be produced using one or more of the nucleic acids shown in the tables below. Table 9 – Amino Acid Sequences of Anti-RAN Antibodies Attorney Docket No. U1202.70128WO00 Table 10 – Nucleic Acid Sequences of Anti-RAN Antibodies Attorney Docket No. U1202.70128WO00 Attorney Docket No.
  • antibody clone 27B11.A7 binds to polyGA. In some embodiments, clone 27B11.A7 is an IgG1 antibody. In some embodiments, antibody clone 23H2.D1.B5 binds to polyGA. In some embodiments, antibody clone 23H2.D1.B5 is an IgG3 antibody. In some embodiments, antibody clone 16A3.C8 binds to poly(Ser).
  • antibody clone 16A3.C8 is an IgG1 antibody.
  • antibody clone HL2362-2G4 binds to polyPR.
  • antibody clone HL2362-2G4 is IgG2A kappa antibody.
  • Anti-RAN Antibody Production Typically, polyclonal antibodies are produced by inoculation of a suitable mammal, such as a mouse, rabbit or goat. An antigen is injected into the mammal. This induces the B- lymphocytes to produce IgG immunoglobulins specific for the antigen. This polyclonal IgG is purified from the mammal's serum.
  • Monoclonal antibodies are generally produced by a single cell line (e.g., a hybridoma cell line).
  • an anti-RAN antibody is purified (e.g., isolated from serum).
  • Exemplary anti-RAN antibodies disclosed herein were produced using the antigens set forth in Table 13.
  • an antigen comprises an interrupted RAN protein repeat sequence selected from poly(Proline-Arginine) [poly(PR)]; poly(Glycine-Arginine) Attorney Docket No.
  • Antigens for producing RAN antibodies Numerous methods may be used for obtaining anti-RAN antibodies. For example, antibodies can be produced using recombinant DNA methods. Monoclonal antibodies may also be produced by generation of hybridomas (see, e.g., Kohler and Milstein (1975) Nature, 256: 495-499) in accordance with known methods.
  • Hybridomas formed in this manner are then screened using standard methods, such as enzyme-linked immunosorbent assay (ELISA; e.g., RCA-based ELISA or rtPCR-based ELISA) and surface plasmon resonance (e.g., OCTET or BIACORE) analysis, to identify one or more hybridomas that produce an antibody that specifically binds with a specified antigen.
  • ELISA enzyme-linked immunosorbent assay
  • OCTET or BIACORE surface plasmon resonance
  • U1202.70128WO00 making antibodies includes screening protein expression libraries that express antibodies or fragments thereof (e.g., scFv), e.g., phage or ribosome display libraries.
  • Phage display is described, for example, in Ladner et al., U.S. Pat. No.5,223,409; Smith (1985) Science 228: 1315-1317; Clackson et al. (1991) Nature, 352: 624-628; Marks et al. (1991) J. Mol.
  • a monoclonal antibody is obtained from the non-human animal, and then modified, e.g., made chimeric, using recombinant DNA techniques known in the art.
  • modified e.g., made chimeric, using recombinant DNA techniques known in the art.
  • a variety of approaches for making chimeric antibodies have been described. See, e.g., Morrison et al., Proc. Natl. Acad. Sci.
  • Antibodies can also be humanized by methods known in the art. For example, monoclonal antibodies with a desired binding specificity can be commercially humanized (Scotgene, Scotland; and Oxford Molecular, Palo Alto, Calif.).
  • Fully humanized antibodies such as those expressed in transgenic animals are within the scope of the invention (see, e.g., Green et al. (1994) Nature Genetics 7, 13; and U.S. Patent Nos.5,545,806 and 5,569,825).
  • Antibodies A Laboratory Manual, Second Edition. Edited by Edward A. Greenfield, Dana-Farber Cancer Institute, ⁇ 2014.
  • the present disclosure is not necessarily limited to any particular source, method of production, or other special characteristics of an antibody.
  • Some aspects of the present disclosure relate to isolated cells (e.g., host cells) transformed with a polynucleotide or vector. Host cells may be a prokaryotic or eukaryotic cell.
  • the polynucleotide or vector which is present in the host cell may either be integrated into the genome of the host cell or it may be maintained extrachromosomally.
  • the host cell can be any prokaryotic or eukaryotic cell, such as a bacterial, insect, fungal, plant, animal or human cell.
  • fungal cells are, for example, those of the genus Saccharomyces, in particular those of the species S. cerevisiae.
  • the term "prokaryotic" includes all bacteria which can be transformed or transfected with a DNA or RNA molecules for the expression of an antibody or the corresponding immunoglobulin chains.
  • Prokaryotic hosts may include gram negative as well as gram positive bacteria such as, for example, E. Attorney Docket No.
  • the term "eukaryotic” includes yeast, higher plants, insects and vertebrate cells, e.g., mammalian cells, such as NSO and CHO cells.
  • the antibodies or immunoglobulin chains encoded by the polynucleotide may be glycosylated or may be non-glycosylated.
  • Antibodies or the corresponding immunoglobulin chains may also include an initial methionine amino acid residue.
  • the host may be maintained under conditions suitable for high level expression of the nucleotide sequences, and, as desired, the collection and purification of the immunoglobulin light chains, heavy chains, light/heavy chain dimers or intact antibodies, antigen binding fragments or other immunoglobulin forms may follow; see, Beychok, Cells of Immunoglobulin Synthesis, Academic Press, N.Y., (1979).
  • polynucleotides or vectors are introduced into the cells which in turn produce the antibody or antigen binding fragments.
  • transgenic animals, preferably mammals, comprising the aforementioned host cells may be used for the large scale production of the antibody or antibody fragments.
  • the transformed host cells can be grown in fermenters and cultured according to techniques known in the art to achieve optimal cell growth.
  • the whole antibodies, their dimers, individual light and heavy chains, other immunoglobulin forms, or antigen binding fragments can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like; see, Scopes, "Protein Purification", Springer Verlag, N.Y. (1982).
  • the antibody or antigen binding fragments can then be isolated from the growth medium, cellular lysates, or cellular membrane fractions.
  • hybridoma provides an indefinitely prolonged source of monoclonal antibodies.
  • hybridoma cell refers to an immortalized cell derived from the fusion of B lymphoblasts with a myeloma fusion partner.
  • monoclonal antibody-producing cells e.g., hybridoma cells
  • an individual animal whose antibody titer has been confirmed e.g., a mouse
  • 2 days to 5 Attorney Docket No. U1202.70128WO00 days after the final immunization its spleen or lymph node is harvested and antibody- producing cells contained therein are fused with myeloma cells to prepare the desired monoclonal antibody producer hybridoma.
  • Measurement of the antibody titer in antiserum can be carried out, for example, by reacting the labeled protein, as described hereinafter and antiserum and then measuring the activity of the labeling agent bound to the antibody.
  • the cell fusion can be carried out according to known methods, for example, the method described by Kochler and Milstein (Nature 256:495 (1975)).
  • a fusion promoter for example, polyethylene glycol (PEG) or Sendai virus (HVJ) is used.
  • PEG polyethylene glycol
  • HVJ Sendai virus
  • myeloma cells include NS-1, P3U1, SP2/0, AP-1 and the like.
  • the proportion of the number of antibody producer cells (spleen cells) and the number of myeloma cells to be used is preferably about 1:1 to about 20:1.
  • PEG preferably PEG 1000- PEG 6000
  • Cell fusion can be carried out efficiently by incubating a mixture of both cells at about 20oC to about 40 oC, preferably about 30 oC to about 37 oC for about 1 minute to 10 minutes.
  • Various methods may be used for screening for a hybridoma producing the antibody (e.g., against a tumor antigen or autoantibody of the present invention).
  • a supernatant of the hybridoma is added to a solid phase (e.g., microplate) to which antibody is adsorbed directly or together with a carrier and then an anti-immunoglobulin antibody (if mouse cells are used in cell fusion, anti-mouse immunoglobulin antibody is used) or Protein A labeled with a radioactive substance or an enzyme is added to detect the monoclonal antibody against the protein bound to the solid phase.
  • a solid phase e.g., microplate
  • an anti-immunoglobulin antibody if mouse cells are used in cell fusion, anti-mouse immunoglobulin antibody is used
  • Protein A labeled with a radioactive substance or an enzyme is added to detect the monoclonal antibody against the protein bound to the solid phase.
  • a supernatant of the hybridoma is added to a solid phase to which an anti-immunoglobulin antibody or Protein A is adsorbed and then the protein labeled with a radioactive substance or an enzyme is added to detect the monoclonal antibody against the protein bound to the solid phase.
  • Selection of the monoclonal antibody can be carried out according to any known method or its modification. Normally, a medium for animal cells to which HAT (hypoxanthine, aminopterin, thymidine) are added is employed. Any selection and growth medium can be employed as long as the hybridoma can grow.
  • RPMI 1640 medium containing 1% to 20%, preferably 10% to 20% fetal bovine serum, GIT medium containing 1% to 10% fetal bovine serum, a serum free medium for cultivation of a hybridoma (SFM-101, Nissui Seiyaku) and the like can be used.
  • the cultivation is carried out at 20oC to 40oC, preferably 37oC for about 5 days to 3 weeks, preferably 1 week to Attorney Docket No. U1202.70128WO00 2 weeks under about 5% CO 2 gas.
  • the antibody titer of the supernatant of a hybridoma culture can be measured according to the same manner as described above with respect to the antibody titer of the anti-protein in the antiserum.
  • immortalized hybridoma cells can be used as a source of rearranged heavy chain and light chain loci for subsequent expression and/or genetic manipulation.
  • Rearranged antibody genes can be reverse transcribed from appropriate mRNAs to produce cDNA.
  • the heavy chain constant region can be exchanged for that of a different isotype or eliminated altogether.
  • the variable regions can be linked to encode single chain Fv regions. Multiple Fv regions can be linked to confer binding ability to more than one target or chimeric heavy and light chain combinations can be employed. Any appropriate method may be used for cloning of antibody variable regions and generation of recombinant antibodies.
  • an appropriate nucleic acid that encodes variable regions of a heavy and/or light chain is obtained and inserted into an expression vector which can be transfected into standard recombinant host cells.
  • a variety of such host cells may be used.
  • mammalian host cells may be advantageous for efficient processing and production. Typical mammalian cell lines useful for this purpose include CHO cells, 293 cells, or NSO cells.
  • the production of the antibody or antigen binding fragment may be undertaken by culturing a modified recombinant host under culture conditions appropriate for the growth of the host cells and the expression of the coding sequences.
  • the antibodies or antigen binding fragments may be recovered by isolating them from the culture.
  • the expression systems may be designed to include signal peptides so that the resulting antibodies are secreted into the medium; however, intracellular production is also possible.
  • the disclosure also includes a polynucleotide encoding at least a variable region of an immunoglobulin chain of the antibodies described herein.
  • the variable region encoded by the polynucleotide comprises at least one complementarity determining region (CDR) of the VH and/or VL of the variable region of the antibody produced by any one of the above described hybridomas.
  • Polynucleotides encoding antibody or antigen binding fragments may be, e.g., DNA, cDNA, RNA or synthetically produced DNA or RNA or a recombinantly produced chimeric nucleic acid molecule comprising any of those polynucleotides either alone or in combination.
  • a polynucleotide is part of a vector. Such vectors may Attorney Docket No. U1202.70128WO00 comprise further genes such as marker genes which allow for the selection of the vector in a suitable host cell and under suitable conditions.
  • a polynucleotide is operatively linked to expression control sequences allowing expression in prokaryotic or eukaryotic cells.
  • Expression of the polynucleotide comprises transcription of the polynucleotide into a translatable mRNA.
  • Regulatory elements ensuring expression in eukaryotic cells are well known to those skilled in the art. They may include regulatory sequences that facilitate initiation of transcription and optionally poly-A signals that facilitate termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers, and/or naturally associated or heterologous promoter regions. Possible regulatory elements permitting expression in prokaryotic host cells include, e.g., the PL, Lac, Trp or Tac promoter in E.
  • regulatory elements permitting expression in eukaryotic host cells are the AOX1 or GAL1 promoter in yeast or the CMV-promoter, SV40-promoter, RSV-promoter (Rous sarcoma virus), CMV- enhancer, SV40-enhancer or a globin intron in mammalian and other animal cells.
  • Beside elements which are responsible for the initiation of transcription such regulatory elements may also include transcription termination signals, such as the SV40- poly-A site or the tk-poly-A site, downstream of the polynucleotide.
  • leader sequences capable of directing the polypeptide to a cellular compartment or secreting it into the medium may be added to the coding sequence of the polynucleotide and are well known in the art.
  • the leader sequence(s) is (are) assembled in appropriate phase with translation, initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein, or a portion thereof, into, for example, the extracellular medium.
  • a heterologous polynucleotide sequence can be used that encode a fusion protein including a C- or N- terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • polynucleotides encoding at least the variable domain of the light and/or heavy chain may encode the variable domains of both immunoglobulin chains or only one.
  • polynucleotides may be under the control of the same promoter or may be separately controlled for expression.
  • vectors particularly plasmids, cosmids, viruses and bacteriophages used conventionally in genetic Attorney Docket No. U1202.70128WO00 engineering that comprise a polynucleotide encoding a variable domain of an immunoglobulin chain of an antibody or antigen binding fragment; optionally in combination with a polynucleotide that encodes the variable domain of the other immunoglobulin chain of the antibody.
  • expression control sequences are provided as eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells, but control sequences for prokaryotic hosts may also be used.
  • Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the polynucleotides or vector into targeted cell population (e.g., to engineer a cell to express an antibody or antigen binding fragment).
  • a variety of appropriate methods can be used to construct recombinant viral vectors.
  • polynucleotides and vectors can be reconstituted into liposomes for delivery to target cells.
  • the vectors containing the polynucleotides can be transferred into the host cell by suitable methods, which vary depending on the type of cellular host. Modifications Some aspects of the disclosure relate to antibody-drug conjugates targeted against one or more interrupted RAN proteins.
  • antibody drug conjugate refers to molecules comprising an antibody, or antigen binding fragment thereof, linked to a targeted molecule (e.g., a biologically active molecule, such as a therapeutic molecule, and/or a detectable label).
  • antibodies or antigen binding fragments of the disclosure may be modified with a detectable label, including, but not limited to, an enzyme, prosthetic group, fluorescent material, luminescent material, bioluminescent material, radioactive material, positron emitting metal, nonradioactive paramagnetic metal ion, and affinity label for detection and isolation of one or more Interrupted RAN proteins.
  • the detectable substance may be coupled or conjugated either directly to the polypeptides of the disclosure or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art.
  • Non-limiting examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ - galactosidase, glucose oxidase, or acetylcholinesterase; non-limiting examples of suitable Attorney Docket No.
  • U1202.70128WO00 prosthetic group complexes include streptavidin/biotin and avidin/biotin; non-limiting examples of suitable fluorescent materials include biotin, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; an example of a luminescent material includes luminol; non-limiting examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive material include a radioactive metal ion, e.g., alpha-emitters or other radioisotopes such as, for example, iodine ( 131 I, 125 I, 123 I, 121 I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium ( 115 mIn, 113 mIn, 112 In, 111 In), and tech
  • the detectable substance may be coupled or conjugated either directly to the anti-RAN antibodies or antigen-binding fragments of the disclosure or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art.
  • Anti-RAN antibodies conjugated to a detectable substance may be used for diagnostic assays as described herein.
  • antibodies or antigen binding fragments of the disclosure may be modified with a therapeutic moiety (e.g., therapeutic agent).
  • the antibody is coupled to the targeted agent via a linker.
  • linker refers to a molecule or sequence, such as an amino acid sequence, that attaches, as in a bridge, one molecule or sequence to another molecule or sequence.
  • Linked,” “conjugated,” or “coupled” means attached or bound by covalent bonds, or non-covalent bonds, or other bonds, such as van der Waals forces.
  • Antibodies described by the disclosure can be linked to the targeted agent (e.g., therapeutic moiety or detectable moiety) directly, e.g., as a fusion protein with protein or peptide detectable moieties (with or without an optional linking sequence, e.g., a flexible linker sequence) or via a chemical coupling moiety.
  • a number of such coupling moieties are known in the art, e.g., a peptide linker or a chemical linker, e.g., as described in International Patent Application Publication No. WO 2009/036092.
  • the linker is a flexible amino acid sequence.
  • flexible amino acid sequences include glycine and serine rich linkers, which comprise a stretch of two or more glycine residues.
  • the linker is a photolinker.
  • photolinkers Attorney Docket No. U1202.70128WO00 include ketyl-reactive benzophenone (BP), anthraquinone (AQ), nitrene-reactive nitrophenyl azide (NPA), and carbene-reactive phenyl-(trifluoromethyl)diazirine (PTD).
  • compositions in some embodiments, comprises one or more agents (e.g., therapeutic agents and/or anti-RAN protein agents) described herein. In some embodiments, a composition (e.g., a pharmaceutical composition) comprises a small molecule described herein. In some embodiments, a composition (e.g., a pharmaceutical composition) comprises a nucleic acid described herein. In some embodiments, a composition (e.g., a pharmaceutical composition) comprises an inhibitory nucleic acid, a gene variant, a gRNA, and/or an RNA-guided nuclease described herein.
  • a composition (e.g., a pharmaceutical composition) comprises antibodies (e.g., anti-RAN protein antibodies) or antigen binding fragments.
  • a composition comprises an agent (e.g., a therapeutic agent) described herein and a pharmaceutically acceptable carrier.
  • the composition comprises an anti-RAN antibody and a pharmaceutically acceptable carrier.
  • a composition is said to be a “pharmaceutically acceptable carrier” if its administration can be tolerated by a recipient patient.
  • Sterile phosphate-buffered saline is one example of a pharmaceutically acceptable carrier.
  • Other suitable carriers are well-known in the art. See, for example, REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Ed. (1990).
  • the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
  • Pharmaceutical compositions can be prepared as described below. The active ingredients may be admixed or compounded with any conventional, pharmaceutically acceptable carrier or excipient. The compositions may be sterile.
  • any mode of administration, vehicle or carrier conventionally employed and which is inert with respect to the active agent Attorney Docket No. U1202.70128WO00 may be utilized for preparing and administering the pharmaceutical compositions of the present disclosure.
  • Illustrative of such methods, vehicles and carriers are those described, for example, in Remington's Pharmaceutical Sciences, 4th ed. (1970), the disclosure of which is incorporated herein by reference.
  • Those skilled in the art, having been exposed to the principles of the disclosure, will experience no difficulty in determining suitable and appropriate vehicles, excipients and carriers or in compounding the active ingredients therewith to form the pharmaceutical compositions of the disclosure.
  • a composition e.g., a pharmaceutical composition
  • an effective amount of an active agent refers to an amount sufficient to elicit the desired biological response (e.g., ameliorating one or more symptoms of AD or ALS).
  • An effective amount of an agent may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated (e.g., AD or ALS, repeat expansion diseases, etc.), the mode of administration, and the patient.
  • the effective amount is an amount effective in reducing the level of RAN proteins (e.g., interrupted RAN proteins) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of interrupted RAN proteins relative to the level of interrupted RAN proteins in a cell or subject that has not been administered a therapeutic agent).
  • RAN proteins e.g., interrupted RAN proteins
  • the effective amount is an amount effective in reducing the translation of RAN proteins (e.g., interrupted RAN proteins) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of interrupted RAN proteins relative the level of RAN proteins in a cell or subject that has not been administered a therapeutic agent).
  • RAN proteins e.g., interrupted RAN proteins
  • an effective amount, also referred to as a therapeutically effective amount, of an agent is an amount sufficient to ameliorate at least one adverse effect associated with a disease associated with RAN proteins (e.g., interrupted RAN proteins), such as, e.g., memory loss, cognitive impairment, loss of coordination, speech impairment, etc.
  • RAN proteins e.g., interrupted RAN proteins
  • the neurological disease associated with RAN proteins is selected from the group consisting of: amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome Attorney Docket No.
  • the neurological disease associated with interrupted RAN proteins is ALS or AD.
  • the therapeutically effective amount to be included in pharmaceutical compositions depends, in each case, upon several factors, e.g., the type, size and condition of the patient to be treated, the intended mode of administration, the capacity of the patient to incorporate the intended dosage form, etc. Generally, an amount of active agent is included in each dosage form to provide from about 0.1 to about 250 mg/kg, and preferably from about 0.1 to about 100 mg/kg. One of ordinary skill in the art would be able to determine empirically an appropriate therapeutically effective amount.
  • an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject.
  • the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular therapeutic agent being administered, the size of the subject, or the severity of the disease or condition.
  • One of ordinary skill in the art can empirically determine the effective amount of a particular nucleic acid and/or other therapeutic agent without necessitating undue experimentation.
  • the pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients.
  • Such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
  • Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the Attorney Docket No. U1202.70128WO00 skin, or dried onto a sharp object to be scratched into the skin.
  • the pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
  • the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see, Langer R (1990) Science 249:1527-1533, which is incorporated herein by reference.
  • the compounds may be administered per se (neat) or in the form of a pharmaceutically acceptable salt.
  • the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof.
  • Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic.
  • such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
  • the compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
  • Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories.
  • biological samples may refer to any specimen derived or obtained from a subject having or suspected of having a disease (e.g., neurological disease) associated with RAN proteins expression, translation, and/or accumulation.
  • the biological sample is blood, serum (e.g., plasma from which the clotting proteins have been removed) or cerebrospinal fluid (CSF).
  • a biological sample is a tissue Attorney Docket No. U1202.70128WO00 sample, for example central nervous system (CNS) tissue, such as brain tissue or spinal cord tissue.
  • CNS central nervous system
  • a biological sample is obtained from a subject having or suspected of have a disease selected from the group consisting of: amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia
  • a biological sample is obtained from a subject expressing one or more interrupted RAN proteins from a gene or chromosomal locus listed in Table 1 or Table 6.
  • a biological sample is obtained from a subject expressing one or more interrupted RAN proteins from a gene selected from a group consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, M
  • a biological sample is obtained from a subject expressing one or more interrupted RAN proteins from a gene, such as ARMCX4, ALK, and/or CASP8.
  • a biological sample has been subjected to one or more processing steps prior to being used in a detection method.
  • a biological sample has been subjected to one or more of enzymatic digestion (e.g., with a nuclease and/or a protease), contacted with a chemical (e.g., for the purposes of cell permeabilization, cell lysis, and/or for improving sample stability), or storage for a given time period (e.g., about 6, 5, 4, 3, 2, or 1 weeks or 6, 5, 4, 3, 2, or 1 days) and/or at a given temperature (e.g., at 25 o C, 4 o C, -20 o C or lower).
  • a biological sample has been subjected to one or more steps that removes and/or enriches for one or more cell types in the biological sample.
  • a blood sample has been subjected to one or more steps to isolate and/or enrich for leukocytes and/or lymphocytes present in the blood sample.
  • methods described herein comprise detecting a RAN protein (e.g., an interrupted RAN protein) or an RNA transcript or a DNA sequence encoding the RAN protein in a biological sample.
  • methods described herein Attorney Docket No. U1202.70128WO00 comprise subjecting a biological sample to one or more detection methods to determine the presence, absence, or levels (e.g., levels relative to a control sample) of a RAN protein (e.g., an interrupted RAN protein).
  • methods described herein may comprise obtaining or having obtained a biological sample from a subject having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation. In some embodiments, methods described herein may comprise performing or having performed one or more detection methods on a biological sample obtained from a subject having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation. In some embodiments, differential aggregation properties of RAN proteins (e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins) having different lengths can be used to detect RAN proteins (e.g., interrupted RAN proteins) in a biological sample.
  • interrupted RAN proteins such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins
  • longer RAN proteins e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins
  • RAN proteins e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins
  • having poly-amino acid repeats >40, >50, >60, >70, or >80 amino acid residues in length are detectable in a biological sample.
  • methods described herein comprise detecting a RAN protein (e.g., an interrupted RAN protein) or an RNA transcript or a DNA sequence encoding the RAN protein in a biological sample and a control sample.
  • detecting the presence, absence, or levels (e.g., relative levels) of a RAN protein (e.g., an interrupted RAN protein) or an RNA transcript or a DNA sequence encoding the RAN protein in a biological sample further comprises subjecting a control sample to same detection conditions (e.g., the same assay) that the biological sample was subjected to.
  • a control sample may be a sample lacking the RAN protein (e.g., an interrupted RAN protein) or an RNA transcript or a DNA sequence encoding the RAN protein.
  • a control sample may be a sample comprising a nucleic acid with a normal amount (e.g., an amount which is not pathogenic or associated with a disease) of expansion repeats.
  • methods described herein comprise detecting a change in the level of a RAN protein (e.g., interrupted RAN protein) or RNA transcript or DNA sequence Attorney Docket No. U1202.70128WO00 thereof.
  • a RAN protein e.g., interrupted RAN protein
  • RNA transcript or DNA sequence thereof is detected (e.g., at an elevated level) when a signal corresponding to the presence of the RAN protein or RNA transcript or DNA sequence thereof in a biological sample is higher relative to a signal corresponding to the presence of the RAN protein or RNA transcript or DNA sequence thereof in a control sample (e.g., increased by at least 1.1-10.0 fold or at least 10%-1000%).
  • a RAN protein e.g., interrupted RAN protein
  • RNA transcript or DNA sequence thereof is detected (e.g., at a reduced level) when a signal corresponding to the presence of the RAN protein or RNA transcript or DNA sequence thereof in a biological sample is lower relative to a signal corresponding to the presence of the RAN protein or RNA transcript or DNA sequence thereof in a control sample (e.g., decreased by at least 1.1-10.0 fold or at least 10%- 1000%).
  • methods described herein comprise obtaining or having obtained a first biological sample from a subject at a first time point and obtaining or having obtained a second biological sample from the subject at a second time point.
  • the first biological sample or the second biological is a control sample.
  • the first time point occurs before the subject was administered a therapeutic agent and the second time point occurs after the subject was administered the therapeutic agent.
  • the first time point occurs during a course of treatment of the subject with a therapeutic agent and the second time point occurs after the subject has completed the course of treatment with the therapeutic agent.
  • the subject may be receiving treatment with a therapeutic agent during both the first time point and the second time point or not receiving treatment during either the first time point or the second time point.
  • methods described herein comprise performing or having performed a first assay on the first biological sample and performing or having performed a second assay on the second biological.
  • the first assay and the second assay are performed at the same or different time points.
  • the first assay and the second assay comprise a detection method described herein.
  • the first assay and the second assay comprise the same assay or a different assay.
  • methods of detecting one or more interrupted RAN proteins in a biological sample are useful for monitoring the progress of a disease associated with RAN Attorney Docket No. U1202.70128WO00 protein expression, translation, and/or accumulation.
  • the disease associated with interrupted RAN proteins is selected from the group consisting of: amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29),
  • ALS
  • the neurological disease associated with interrupted RAN proteins is Alzheimer’s Disease (AD) or amyotrophic lateral sclerosis (ALS).
  • AD Alzheimer’s Disease
  • ALS amyotrophic lateral sclerosis
  • biological samples are obtained from a subject prior to and after (e.g., 1 week, 2 weeks, 1 month, 6 months, or one year after) commencement of a therapeutic regimen and the amount of interrupted RAN proteins detected in the samples is compared.
  • the level (e.g., amount) of interrupted RAN protein in the post-treatment sample is reduced compared to the pre- treatment level (e.g., amount) of interrupted RAN protein, the therapeutic regimen is successful.
  • the level of interrupted RAN proteins in biological samples (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more samples) of a subject are continuously monitored during a therapeutic regimen (e.g., measured on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more separate occasions).
  • an agent e.g., a therapeutic agent
  • a RAN protein e.g., interrupted RAN protein
  • RNA transcript or DNA sequence thereof is detected at an increased level relative to a control sample.
  • methods described herein may comprise administering an agent (e.g., a therapeutic agent) to a subject without having performed a detection method prior to administration of the agent.
  • methods described herein may comprise subjecting a biological sample to one or more detection methods after administering an agent (e.g., a therapeutic agent) to the subject.
  • an agent e.g., a therapeutic agent
  • a sample e.g., a biological sample
  • the antibody-based capture methods include contacting the sample with one or more (e.g., 2, 3, 4, 5, or more) anti-RAN protein antibodies.
  • the one or more anti-RAN antibodies are conjugated to a solid support (e.g., a scaffold, resin beads, etc.).
  • antibody-based capture methods comprise physically separating and/or isolating interrupted RAN proteins that have been bound by the anti-RAN antibody(s), for example eluting the interrupted RAN proteins by a chromatographic method such as affinity chromatography or ion-exchange chromatography.
  • biological sample may be subjected to an antigen retrieval procedure prior to being contacted with an anti-RAN antibody.
  • antigen retrieval refers to a process in which a biological sample (e.g., blood, serum, CSF, etc.) are treated under conditions which expose antigens (e.g., epitopes) that were previously inaccessible to detection agents (e.g., antibodies, aptamers, and other binding molecules) prior to the process.
  • antigen retrieval methods comprise steps including but not limited to heating, pressure treatment, enzymatic digestion, treatment with reducing agents, treatment with oxidizing agents, treatment with crosslinking agents, treatment with denaturing agents (e.g., detergents, ethanol, acids), or changes in pH, or any combination of the foregoing.
  • antigen retrieval procedures reduce the background and increase the sensitivity of detection techniques (e.g., immunohistochemistry (IHC), immuno-blot (such as Western Blot), ELISA, etc.).
  • detection of RAN proteins e.g., interrupted RAN proteins
  • immunoassays comprising use of a detection agent or probe to identify the presence of a protein or peptide (e.g., interrupted RAN proteins).
  • detection of one or more interrupted RAN proteins is performed by immunoblot (e.g., dot blot, 2-D gel electrophoresis, Western Blot, etc.), electrochemiluminescence immunoassay (e.g., Meso-Scale Detection (MSD)), Attorney Docket No. U1202.70128WO00 immunohistochemistry (IHC), ELISA (e.g., RCA-based ELISA or RT-PCR-based ELISA), label free immunoassays such as surface plasmon resonance bio layer interferometry, immunoquantitative PCR, bead-based immunoassays, immunoprecipitation, immunostaining, or immunoelectrophoresis.
  • immunoblot e.g., dot blot, 2-D gel electrophoresis, Western Blot, etc.
  • electrochemiluminescence immunoassay e.g., Meso-Scale Detection (MSD)
  • MSD Meso-Scale
  • methods of detecting RAN proteins may also comprise mass spectrometry such as GC-MS, LC-MS, MALDI-TOF-MS.
  • a detection agent is an antibody or an antigen-binding fragment.
  • the antibody is an anti-RAN protein antibody or an antigen- binding fragment thereof, such as anti-poly(Ser), anti-poly(GR), anti-poly(PR), anti- poly(CP), anti-poly(GP), anti-poly(G), anti-poly(A), anti-poly(GA), anti-poly(GD), anti-poly(GE), anti-poly(GQ), anti-poly(GT), anti-poly(L), anti-poly(LP), anti-poly(LPAC) (SEQ ID NO: 31), anti-poly(LS), anti-poly(P), anti-poly(PA), anti-poly(QAGR) (SEQ ID NO: 35), anti-poly(RE), anti-poly(SP), anti-poly(VP), anti-poly(FP), anti-poly(GK), anti- poly(FTPLSLPV) (SEQ ID NO: 36), anti-poly(LLPSPSRC) (SEQ ID NO: 37), anti- poly(YSPLP
  • an anti-RAN protein antibody or antigen-binding fragment thereof targets (e.g., specifically binds to) the amino acid repeat region (e.g., PRPRPRPRPR (SEQ ID NO: 130), GRGRGRGRGR (SEQ ID NO: 131), SSSSSSSSS (SEQ ID NO: 132), etc.) of an interrupted RAN protein.
  • an anti-RAN protein antibody or antigen binding fragment thereof targets (e.g., specifically binds to) an epitope comprising amino acids in the characteristic reading frame specific C-terminus translated 3’ of the repeated amino acids.
  • an anti-RAN protein antibody or antigen binding fragment thereof targets (e.g., specifically binds to) an epitope comprising amino acids bridging the C terminus of the amino acid repeat region and the N terminus of the characteristic reading-frame specific C-terminus translated 3’ of the repeated amino acids.
  • an anti-RAN antibody or antigen binding fragment thereof targets (e.g., specifically binds to) any portion of an interrupted RAN protein that does not comprise the poly-amino acid repeat, for example the C-terminus of an interrupted RAN protein (e.g., the C-terminus of a poly(GR), poly(PR), poly(Ser), poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GT), poly(L), poly(LP), Attorney Docket No.
  • the C-terminus of an interrupted RAN protein e.g., the C-terminus of a poly(GR), poly(PR), poly(Ser), poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GT), poly(L), poly(LP), Attorney Docket No.
  • poly(LPAC) (SEQ ID NO: 31), poly(LS), poly(P), poly(PA), poly(QAGR) (SEQ ID NO: 35), poly(RE), poly(SP), poly(VP), poly(FP), poly(GK), poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), poly(PGGRGE) (SEQ ID NO: 41) protein), poly(GRQRGVNT) (SEQ ID NO: 42), and/or poly(GSKHREAE) (SEQ ID NO: 43).
  • a set (or combination) of anti-RAN antibodies or antigen binding fragments thereof e.g., a combination of two or more anti-RAN antibodies or antigen binding fragments thereof selected from anti-poly(Ser), anti-poly(GR), anti-poly(PR), anti-poly(CP), anti-poly(GP), anti-poly(G), anti-poly(A), anti-poly(GA), anti-poly(GD), anti- poly(GE), anti-poly(GQ), anti-poly(GT), anti-poly(L), anti-poly(LP), anti-poly(LPAC) (SEQ ID NO: 31), anti-poly(LS), anti-poly(P), anti-poly(PA), anti-poly(QAGR) (SEQ ID NO: 35), anti-poly(RE), anti-poly(SP), anti-poly(VP), anti-poly(FP), anti-poly(GK), anti- poly(FTPLSLPV) (SEQ ID NO: 36
  • a detection agent is an aptamer (e.g., RNA aptamer, DNA aptamer, or peptide aptamer).
  • an aptamer specifically binds to an interrupted RAN protein (e.g., poly(Ser), poly(PR), poly(GR), poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GT), poly(L), poly(LP), poly(LPAC) (SEQ ID NO: 31), poly(LS), poly(P), poly(PA), poly(QAGR) (SEQ ID NO: 35), poly(RE), poly(SP), poly(VP), poly(FP), poly(GK), poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN
  • an interrupted RAN protein
  • nucleic acid hybridization-based methods are used for identifying the presence of interrupted RAN proteins or microsatellite repeat sequences Attorney Docket No. U1202.70128WO00 encoding interrupted RAN proteins in a biological sample (e.g., a biological sample obtained from a subject).
  • nucleic hybridization-based methods involve nucleic acids that are capable of hybridizing with a nucleic acid sequence (e.g., target sequence) (e.g., a nucleotidic expansion repeat or a repeat unit thereof.
  • nucleic acid “capable of hybridizing with” or “capable of detecting” a nucleic acid sequence refers to a nucleic acid comprising a length and a degree of sequence complementarity that is sufficient for base-pairing with the nucleic acid sequence (e.g., target sequence) in a specific and/or stable manner.
  • the length required for hybridization is about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-30, 30- 40, 40-50, 50-75, 75-100, or more than 100 nucleotides.
  • the degree of sequence complementarity required for hybridization is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%.
  • a nucleic acids that are capable of hybridizing with a nucleic acid sequence include nucleic acid probes (e.g., detectable probes), guide RNAs (gRNAs), primers, aptamers (e.g., RNA or DNA aptamers), and other forms of antisense oligonucleotides.
  • sequences which may be useful for detection of nucleic acids encoding an interrupted RAN protein are found in Tables 4 and 8.
  • detecting nucleic acid sequences encoding interrupted RAN proteins involves detectable nucleic acid probes (e.g., fluorophore-conjugated DNA probes).
  • a “detectable nucleic acid probe” refers to a nucleic acid sequence that specifically binds to (e.g., hybridizes with) a target sequence, and comprises a detectable moiety, for example a fluorescent moiety, radioactive moiety, chemiluminescent moiety, electroluminescent moiety, biotin, peptide tag (e.g., poly-His tag, FLAG-tag, etc.), etc.
  • a detectable nucleic acid probe is a DNA or RNA probe.
  • the DNA or RNA probe is conjugated to a fluorophore.
  • a detectable nucleic acid probe is chemically modified.
  • detectable nucleic acid probes are useful for localization of RAN protein translation by Fluorescence In situ Hybridization (FISH).
  • FISH Fluorescence In situ Hybridization
  • a biological sample may be contacted with a plurality of detectable nucleic acid probes. The number of nucleic acid probes in a plurality varies. In some embodiments, a plurality of nucleic acid probes comprises between 2 and 100 (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, Attorney Docket No.
  • a plurality comprises more than 100 probes.
  • the nucleic acid probes may be the same or different sequences.
  • a plurality of detectable nucleic acid probes comprises probes which hybridize to target sequences that encode an interrupted RAN protein.
  • Methods for detecting a nucleic acid encoding an interrupted RAN protein may comprise an enrichment step. “Enrichment” refers to processes which increase the amount and/or concentration of a target nucleic acid in a sample relative to other nucleic acids in a sample.
  • enrichment may occur by increasing the number of target nucleic acid sequences in a sample (e.g., by amplifying the target sequence, for example by polymerase chain reaction (PCR), etc.), or by decreasing the amount or concentration of non-target nucleic acid sequences in the sample (e.g., by separating or isolating the target nucleic acid sequence from non-target sequences).
  • methods described herein comprise a step of enriching a biological sample for nucleic acid sequences (e.g., microsatellite repeat sequences) encoding interrupted RAN proteins.
  • the enrichment comprises contacting the biological sample with 1) a labeled (e.g., biotinylated) dCas9 protein, and 2) one or more single-stranded guide RNA (sgRNAs) that specifically bind to nucleic acid repeat sequences encoding interrupted RAN proteins.
  • a labeled (e.g., biotinylated) dCas9 protein and 2) one or more single-stranded guide RNA (sgRNAs) that specifically bind to nucleic acid repeat sequences encoding interrupted RAN proteins.
  • the labeled dCas9 protein and the one or more sgRNAs are provided together as a single molecule (e.g., a dCas9-sgRNA complex).
  • the nucleic acid sequences encoding one or more interrupted RAN proteins are isolated from the labeled dCas9 protein and the sgRNAs, for example by affinity chromatography, as described by Liu et al. (2017) Cell 170: 1028-1043.
  • the detection of the one or more interrupted RAN proteins comprises Next-Generation Sequencing (NGS).
  • NGS Next-Generation Sequencing
  • an enrichment step e.g., dCas9-based enrichment
  • the guide RNAs used in the enrichment target NGG protospacer adjacent motifs (PAM) containing repeats In other embodiments, the guide RNAs used in the enrichment target non-NGG PAM containing repeats. In some embodiments, the non-NGG Attorney Docket No. U1202.70128WO00 PAM containing repeats comprise expansion repeats. In some embodiments, the guide RNAs used in the enrichment enrich non-NGG PAM containing repeat expansions that are longer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100 repeats longer) than the corresponding normal allele.
  • PAM protospacer adjacent motifs
  • the guide RNAs used in the enrichment identify multiple repeat expansions simultaneously, including, in some embodiments, sequences with non-NGG PAMs.
  • the gRNA comprises a sequence set forth in Table 4.
  • a nucleic acid used for detection methods described herein are capable of hybridizing with a nucleic acid sequence (e.g., target sequence) present in a gene, chromosomal, or RNA transcript (e.g., mRNA) encoding an interrupted RAN protein.
  • a target sequence comprises one or more expansion repeats or repeat units.
  • a target sequence comprises GGTCGT, GGCCGT, GGACGT, GGGCGT, GGTCGC, GGCCGC, GGACGC, GGGCGC, GGTCGA, GGCCGA, GGACGA, GGGCGA, GGTCGG, GGCCGG, GGACGG, GGGCGG, GGTAGA, GGCAGA, GGAAGA, GGGAGA, GGTAGG, GGCAGG, GGAAGG, GGGAGGTGCT, GGCGCC, GGAGCA, GGGGGGCG, GGTGCC, GGCGCA, GGAGCG, GGGGCT, GGTGCA, GGCGCG, GGAGCT, GGGGCC, GGTGCG, GGCGCT, GGAGCC, GGCAGGTCCT, GGCCCC, GGACCA, GGGCCG, GGTCCC, GGCCCA, GGACCG, GGGCCT, GGCCCA, GGACCG, GGGCCT
  • a target sequence comprises (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGAGCG)x, (GGGGCT)x, (GGTGCA)x, (GGCGCG)x, (GGCGCT)x, (GGTGCA)x, (GGCGCG)x, (GGCGCG)x, (GGCT
  • x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
  • x comprises an integer greater than 200 (e.g., about 201-250, 250-300, 300-400, 400-500, 500-750, etc.). In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400- 500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000.
  • a target sequence comprises a sequence corresponding to a gene associated with a disease, such as amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 Attorney Docket No.
  • a disease such as amyotrophic lateral
  • a nucleic acid sequence (e.g., target sequence) is comprises a sequence corresponding to a gene or a chromosomal locus set forth in Table 1 or Table 6.
  • a target sequence comprises a sequence corresponding to a gene selected from: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CC
  • a target sequence is present or corresponds to ARMCX4, ALK, or CASP8.
  • a target sequence comprises a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the target sequence comprises a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F).
  • Example 1 This example describes investigating translation of interrupted RAN proteins in the context of RAN-protein associated diseases, such as Alzheimer’s disease (AD) and Amyotrophic Lateral Sclerosis (ALS).
  • AD Alzheimer’s disease
  • ALS Amyotrophic Lateral Sclerosis
  • a pull-down assay was used to enrich the specific repeat expansion mutation and the corresponding flanking sequences using a biotin-tagged nuclease-deficient Cas9 (dCas9) approach.
  • dCas9 biotin-tagged nuclease-deficient Cas9
  • This dCas9-based enrichment tool pulls down and enriches specific DNA sequences (e.g., DNA sequences encoding interrupted RAN proteins) by taking advantage of the rapid kinetics and high stability of single guide RNA/dCas9 (sgRNA-dCas9) complexes without the need to denature target DNA.
  • Expanded repeats provide multiple binding sites for sgRNAs, thus increasing the probability of interaction between sgRNA-dCas9 complexes and expanded repeats compared to shorter repeat tracts. Assays were performed on patient autopsy brains and cells, as well as HEK cells (where noted).
  • an interrupted repeat RAN protein (e.g., a poly-GA or poly- GR RAN protein) is translated from an mRNA transcript encoded by a genetic locus or one or more genes (e.g., is encoded by one or more genes) set forth in Table 1.
  • an interrupted poly-GA RAN protein is translated from an mRNA transcript encoded by a chromosomal locus in chrX beginning at 100748986 and ending at 100749205.
  • an interrupted poly-GA repeat RAN protein is translated from an mRNA transcript encoded by ARMCX4.
  • FIGs.1A and 1B show a predicted ARMCX4 poly-GA repeat protein.
  • FIG.1A shows alternative splicing variants, demonstrating that an ARMCX4 repeat expansion can be in an intron (left) or an exon (right).
  • FIG.1B shows a predicted GA-rich protein produced by an ARMCX4 repeat expansion.
  • the example amino acid sequence (SEQ ID NO: 4) shown in FIG.1B illustrates interrupted GA repeat motifs.
  • an interrupted poly-GA RAN protein is translated from an mRNA transcript encoded by ALK.
  • FIGs.2A and 2B show a predicted ALK poly-GA repeat protein.
  • FIG.2A shows the predicted coding region.
  • the expanded allele has expanded GGA repeats and contains ⁇ 143-156 repeats.
  • FIG.2B shows a predicted GA-rich protein produced by an ALK repeat expansion.
  • FIG.2B illustrates interrupted GA repeat motifs.
  • ARMCX4-RE and ALK-RE plasmids were designed and cloned in which FLAG tag expresses in frame with ARMCX4 and ALK GA-rich proteins.
  • FIG.3A shows example ARMCX4-RE and ALK-RE plasmids which were designed and cloned. FLAG tag expresses in frame with ARMCX4 and ALK GA-rich proteins.
  • an interrupted poly-GR RAN protein is translated from an mRNA transcript encoded by CASP8.
  • FIGs.4A-4C show a predicted CASP8 poly-GR repeat protein.
  • FIG.4A shows the predicted coding region.
  • FIG.4B shows a predicted GR- rich protein produced by an CASP8 repeat expansion.
  • the example amino acid sequence (SEQ ID NO: 8) shown in FIG.4B illustrates interrupted GR repeat motifs.
  • FIG.4C shows a predicted GR-rich protein produced by an CASP8 repeat expansion.
  • the example amino acid sequence (SEQ ID NO: 9) shown in FIG.4C illustrates interrupted GR repeat motifs.
  • Table 1 Interrupted RAN protein-encoding chromosomal loci and gene candidates Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No.
  • Example 2 This example relates to detection of polymeric glycine-arginine (polyGR)-containing aggregates in sporadic AD autopsy brains.
  • a CRISPR/deactivated-Cas9 repeat enrichment and detection (dCas9READ) strategy is used to identify a polyGR-encoding intronic CASP8 (GGGAGA) n expansion (CASP8-GGGAGAexp).
  • polyGR-encoding intronic CASP8 (GGGAGA) n expansion is associated with increased risk of neurogenerative disease such as AD .
  • locus-specific C-terminal antibodies are used to detect polyGR-containing proteins expressed by CASP8-GGGAGA exp which accumulate in AD brains.
  • polyGR aggregates are associated with increased pTau[S202,T205] in AD brains.
  • pTau is increased in cells overexpressing polyGR.
  • CASP8-GGGAGA exp is toxic to cells and CASP8-repeat associated non-AUG protein levels induced by stress are lowered by metformin.
  • AD brains includes extracellular ⁇ -amyloid (A ⁇ ) plaques, intracellular phosphorylated Tau (pTau)-positive neurofibrillary tangles (NFT) and dystrophic neurites, reactive gliosis, and neurodegeneration.
  • a ⁇ extracellular ⁇ -amyloid
  • pTau intracellular phosphorylated Tau
  • NFT neurofibrillary tangles
  • Microsatellite, or simple tandem-repeat expansion mutations cause >50 neurological diseases including the most common form of frontotemporal dementia (FTD). Overlapping pathology of several microsatellite expansion diseases (e.g.
  • Huntington’s disease and myotonic dystrophy type 1) with AD includes increased pTau and the accumulation of NFTs.
  • Molecular mechanisms of repeat expansion diseases involve protein loss-of-function (LOF), protein gain-of-function (GOF), RNA GOF, and toxic accumulation of polymeric proteins produced by repeat-associated non-AUG (RAN) translation .
  • RAN proteins can be expressed from microsatellite expansion mutations in all reading frames without AUG or AUG- like close cognate initiation codons. RAN proteins have been reported in 11 different Attorney Docket No. U1202.70128WO00 repeat expansion disorders, and in vitro and in vivo studies support their pathogenic roles in disease.
  • dCas9READ CRISPR/ deactivated Cas9-based repeat enrichment and detection
  • polyGR staining in AD autopsy brains was correlated with increased pTau, and overexpression of poly(GR) 60 or CASP8 GGGAGAexp minigene constructs in SH-SY5Y neuroblastoma cells increased pTau at S202 and T205.
  • a RAN pathology-to-genetics strategy, dCas9READ is used for Attorney Docket No. U1202.70128WO00 unbiased identification of candidate expansion mutations directly from the genomic DNA of RAN-protein positive samples.
  • Paraffin-embedded formalin fixed hippocampal sections from AD and control cases were obtained from the Johns Hopkins brain bank, the University of Florida Neuromedicine Human Brain Tissue Bank, the 1Florida ADRC.
  • Frozen frontal cortex (1Florida ADRC) and cerebellum tissue (Johns Hopkins University) samples for biochemical and histological analysis including samples from AD and controls cases were used in this research.
  • Frozen tissue samples were also used for genomic DNA extraction for the repeat expansion enrichment analysis and genotyping assays for the C9orf72 G4C2 locus and novel repeat expansion loci identified in this study.
  • Paraffin-embedded formalin fixed tissues from AD and controls cases were used for immunohistochemical (IHC) analyses.
  • Control LCLs (Coriell Institute) were used for genomic DNA extractions for genotyping assays.
  • the control plates from Coriell include NDPT079, NDPT084, NDPT093, NDPT094, NDPT095, NDPT096, NDPT098, and NDPT099.
  • 3xFLAG-(GR)60 SEQ ID NO: 133) and FLAG-(GGGAGA)30-CT-f1S (SEQ ID NO: 30) constructs were generated by subcloning EcoRI/XbaI fragements into p3xFLAG-Myc-CMV- 24 vector (Sigma- Aldrich, ref# E9283).
  • FLAG-(GGGAGA)30-CT-f3S SEQ ID NO: 30
  • Attorney Docket No. U1202.70128WO00 were then generated from FLAG-(GGGAGA)30- CT-f1S (SEQ ID NO: 30) construct by digesting with HindIII followed with T4 polymerase incubation and re- ligation.
  • p-TDP43 anti-p-TDP43 (1:5000, Cosmo Bio USA, CAC-TIP-PTD-M01).
  • locus-specific C- terminal antibodies were used.
  • sense frame 1 (SF1) protein anti-CT-f1S (K1785, 1:5000)
  • sense frame 3 (SF3) protein anti-CT-f3S (K1790, 1:5000).
  • polyGR and p-tau IHC co-staining after incubating with formic acid, slides were incubated with BLOXALL® solution (Vector lab, SP-6000-100) for 10 min, RT to block endogenous peroxidase and alkaline phosphatase.
  • slides were incubated with anti-GR (H3148, 1:5000) and anti-p-tau (AT8, 1:2000, Thermo Fisher Scientific, MN1020) for overnight at 4°C and then 1 h, RT on the following day.
  • anti-GR H3148, 1:5000
  • anti-p-tau AT8, 1:2000, Thermo Fisher Scientific, MN1020
  • the slides were incubated with HPR-anti-mouse IgG and AP-anti- rabbit IgG (Vector lab, MP-7724-15) for 20 min at RT. Slides then were developed with ImmPRESS® Duet Double Staining Polymer Kit following the manufacturer’s protocol (Vector lab, MP-7724-15).
  • Dot blot staining for polyGR using rat monoclonal ⁇ -GR antibody Frozen brain tissue from frontal cortex regions were homogenized in RIPA buffer (G Biosciences, 786-489) supplemented with proteinase inhibitor cocktail (TargetMol, C0001), phosphatase inhibitor cocktails I (TargetMol, C0002) and II (TargetMol, C0003) and DNase I (0.2 mg/mL, Sigma-Aldrich, 10104159001 Roche) in bead tubes. Homogenized samples Attorney Docket No.
  • U1202.70128WO00 were passed through 21.5G syringes and the soluble protein fraction were collected after the centrifugation at 13,000 rpm, 4°C, 15 min.
  • Dot blot staining approximate 5 ⁇ g of total protein per well was loaded onto nitrocellulose membrane (Amersham) using Bio-Dot 96- well microfiltration system (Bio-Rad, 1703938) under vacuum following the manufacturer’s protocol. The blot was blocked in 5% skim milk in 1XPBS containing 0.05% Tween®-20 (PBST) for 2h, RT.
  • PBST 0.05% Tween®-20
  • the blot was probed with rat monoclonal anti-GR antibody (1:2000, Sigma-Aldrich, MABN778) at 4 °C, overnight and then additional 1h, RT on the following day.
  • the blot was incubated with HRP-conjugated anti- rat antibody (1:2000, Jackson ImmunoResearch, 112-035-003) for 1 h, RT.
  • the protein signal was detected using Western Chemiluminescent Substrate system (PerkinElmer, NEL105001EA).
  • the total protein control on the blot was measured using RevertTM 700 Total Protein Stain Kit (LI-COR, 926-11010).
  • HEK293T cells were transfected with CASP8-RE1/2/3-3T or control plasmids as described above for 24 h. Next cells were treated with Tg (1 ⁇ M) or co-treated with Tg (1 ⁇ M) and Metformin (5 mM). After 24 h incubation, cells were harvested and Attorney Docket No. U1202.70128WO00 protein lysates were collected, and levels of HA and FLAG frame proteins were detected as described above and normalized to tubulin signal (1:2000, Abcam, ab52866).
  • cleaved caspase-8 in protein lysates from frontal cortex tissue from AD and control cases. Approximately 30 ⁇ g total protein was loaded per well on precast gel (4%–12% Bis- Tris, Criterion).
  • caspase-8 antibody (1:1000, Novus Biologicals, NB100-56116), overnight at 4 °C and 1h, RT.
  • IF assays after staining steps coverslips or slides were then mounted with mounting medium containing DAPI (ThermoFisher Scientific, P36935). The IF images were obtained using Confocal microscopy LSM 880 (Zeiss).
  • HEK293T cells were plated on glass coverslips in 12-well plates a day before the transfection. Cells were transfected with 500 ng of FLAG-(GGGAGA)30-CT-f1S (SEQ ID NO: 30) and FLAG- (GGGAGA)30-CT-f3S (SEQ ID NO: 30) or control plasmids using LipofectamineTM 3000 Transfection Reagent (Thermo Fisher Scientific, L3000015) following the manufacturer’s protocol.
  • Cells were transfected with 1 ⁇ g CASP8-RE1/2/3- 3T or control plasmids using LipofectamineTM 2000 Transfection Reagent (Thermo Fisher Attorney Docket No. U1202.70128WO00 Scientific, 11668019) following the manufacturer’s protocol. Forty-eight hours post- transfection, cells were fixed in 4% PFA in PBS for 30 min, RT and permeabilized in 0.5% triton X-100 in PBS for 30 min, RT. The cells were blocked in 1% normal goat serum (NGS) in PBS for 1 h, RT.
  • NGS normal goat serum
  • the cells were incubated with anti-HA (1:1000, Abcam, ab130275), anti-FLAG (1:1000, Sigma-Aldrich, A8592), or anti-Myc (1:1000, Abcam, ab9106 ) at 4 °C, overnight.
  • anti-HA 1:1000, Abcam, ab130275
  • anti-FLAG 1:1000, Sigma-Aldrich, A8592
  • anti-Myc 1:1000, Abcam, ab9106
  • Cells were incubated with anti-FLAG (1:1000, Sigma-Aldrich, F7425), anti- Myc (1:1000, Abcam, ab9106 ), and anti-p-tau (AT8, 1:2000, Thermo Fisher Scientific, MN1020) to detect CAPS8 polymeric proteins (both FLAG and Myc frame proteins) or polyGR and p-tau.
  • Secondary antibodies used were Alexa Fluor 488 conjugated goat anti- rabbit IgG (1:1000, ThermoFisher Scientific, A11008) and Alexa Fluor 594 conjugated goat anti-mouse IgG (1:1000, ThermoFisher Scientific, A-11032) antibodies.
  • T98 cells were transfected with 3xFlag-(GR)60 or GFP-hTau. After 48 h, cells were fixed as described above and then stained with rabbit polyclonal anti-GR antibody (H3148, 1:1000). The cells were incubated with Alexa Fluor 594 conjugated goat anti-rabbit IgG antibody (1:1000, ThermoFisher Scientific, A-11012).
  • Genomic DNA was extracted from frozen cerebellum or frontal cortex tissue from AD and control cases using Wizard Genomic DNA Purification Kit (Promega, A1125) or Monarch High Molecular Weight (HMW) DNA Extraction Kit (NEB, T3060L) following the manufacture’s protocols. Approximate 5 ⁇ g genomic DNA was digested with EcoRI-HF and HindIII-HF or EcoRI-HF and BamHI-HF for overnight at 37 °C.
  • dCas9 coated beads were washed three times with PBST (1XPBS, 0.05% Tween-20) prefiltered through 0.2 ⁇ m filters (fPBST) and then resuspended into 300 ⁇ L pulldown buffer.
  • PBST PBST
  • fPBST 0.2 ⁇ m filters
  • To refold rsgRNA, 5 ⁇ L rsgRNA (stock concentration 10 ⁇ M) was diluted in 45 ⁇ L RNAse-free water and heated at 95 °C for 5 min followed by cooling down for 30 min at RT.
  • dCas9 protein and rsgRNA complexes were formed by adding 30 ⁇ L folded rsgRNA or pooled rsgRNA mixture to dCas9 coated bead suspension and the mixture was incubated on the rotor at 37 °C for 10-15 min. After three washed with fPBST, dCas9-rsgRNA complexes on beads was suspended into 300 ⁇ L pulldown buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.1 mM EDTA, 10 mM MgCl2, 0.5 Attorney Docket No. U1202.70128WO00 mM DTT).
  • the bead suspension was treated with 4.5 ⁇ L of 4 mg/mL RNase A on the rotor for 1h at 37 °C followed by adding 5 ⁇ L of 10% SDA and 10 ⁇ L Proteinase K (10 mg/mL) and incubated for additional 1h at 45 °C. Eluted DNA samples were cleaned up and concentrated using using Genomic DNA Clean & ConcentratorTM Kit (Zymo Research, D4011).
  • C9orf72 GGGGCC or CNBP CCTC loci enriched DNA samples were subjected to qPCR assays using primers targeting unique flanking sequences of these loci: for the C9orf7 locus: AS-F (C9-FS-F) and AS-R (C9-FS-R) (25), for the CNBP locus: DM2-F (CNBP-FS-F) and DM2-R (CNBP-FS-R) (FIGs.15A-15C).
  • Two- step quantitative RT-PCR was performed on a MyCycler Thermal Cycler system (Bio-Rad) using SYBR Green PCR Master Mix (Bio-Rad) and Gene specific primer sets [95°C 3min, 40 cycles (95 °C 30 s, 60°C 30 s), 95°C 1min, 60°C 1min. Melting curve was performed [71 cycles (60°C - 95°C 10s per cycles)] in an optical 96-well plate with two technical replicates for each sample.
  • Illumina short-read sequencing Enriched DNA samples were used as template to generate short read sequencing libraries using Nextera DNA Flex Library Prep kit (Illumina, 20018704) following the manufacturer’s protocol.
  • tandem repeat profiles were generated using mTR with FASTA reads as input sequences and m of 0.9.
  • Repeat-primed PCR for novel repeat expansion loci Repeat-primed PCR assays were performed to characterize novel repeat loci. FAM labeled PCR products were analyzed on an ABI3730xl DNA analyzer (Applied Biosystems) and data was analyzed using GeneMarkers software (version 1.75, SoftGenetics). Primer sequences are listed in Table 8.
  • a PCR reaction consists of 1X PCR buffer (Sigma, P2192), 5% DMSO, dNTP (0.25 ⁇ M/each), 0.25 ⁇ M 7-deaza-2-dezoxy GTP, 0.5 ⁇ M CASP8-FAM, 0.5 ⁇ M SVA-repeat-1 or 0.5 ⁇ M SVA-repeat-2, 0.5 ⁇ M Tail primer, 1 M betaine, 1.25 U Apex Taq polymerase, 25 ng DNA template in a total of volume of 10 ⁇ L.
  • Cycling conditions were 95 °C for 5 min, followed by 10 cycles of 97 °C for 35 s, 64 °C for 2 min, 68 °C for 8 min, 25 cycles of 97 °C for 35 s, 64 °C for 2 min, 68 °C for 8 min (+ 20 s/cycle).
  • a PCR reaction consists of 1X Phusion Flash high-fidelity PCR master mix 2X buffer (Thermo-Fisher, F548L), 0.5 ⁇ M FAM primer, 0.5 ⁇ M SVA- repeat-1, 0.5 ⁇ M Tail primer, 3% DMSO, 50 ng DNA template, in a total volume of 20 ⁇ L. Cycling conditions were 98 °C for 3 min, followed by 35 cycles of 98 °C for 10 s, 62 °C for 15 s, 72 °C for 1 min, and a final extension at 75 °C for 5 min. Attorney Docket No.
  • a PCR reaction consists of 1X AccuPrime Pfx buffer, 0.16 mM dATP, 0.16 mM dTTP, 0.56 mM dCTP, 0.56 mM dGTP, 1 M Betaine, 1 U AccuPrime DNA Polymerase, 10-20 ng gDNA, 1 ⁇ M CASP8-LR-F, and 1 ⁇ M CASP8-LR-R with a total volume of 20 ⁇ L.
  • PCR cycling conditions were 94 °C for 7 min, followed by 30-32 cycles of 95 °C for 45 s, 98 °C for 10 s, 60 °C for 30 s, 78 °C (slow ramp 0.6 °C/s) for 6 min, and a final extension at 78 °C for 10 min.
  • Genotyping for rare variants pK148R and pI289V in CASP8 PCR assays were performed to examine pK148R and pI289V, two protein coding variants in CASP8 that were previously reported to associate with an increased AD risk.
  • a PCR reaction consists of 1X Phire reaction buffer, dNTP (200 ⁇ M/each), forward primer (0.5 ⁇ M), reverse primer (0.5 ⁇ M), 20-50 ng/reaction, 1U Phire Hot Start II DNA polymerase (Thermo Fisher).
  • PCR cycling conditions were 98 °C for 30 s, followed by 30cycles of 98 °C for 5 s, 63 °C for 10 s, 72 °C for 10 s, and a final extension at 72 °C for 1 min.
  • Primes sequences of pK148R-F, pK148R- R, pI289V-F, and pI289V-R were listed in Table 8.
  • Toxicity and cell viability T98 cells were transfected at 60% confluency with 700 ng of CASP8-RE1/2/3/-3T or control vector using Lipofectamine 2000 (Invitrogen) following manufacturer’s protocol. Cells were plated in 96 well plates and treated with chimeric antibodies (1 ⁇ M), and assays were performed in quadruplicate for each assay condition. Cell death was measured by quantifying the amount of lactate dehydrogenase (LDH) released into the media, using the CytoTox 96 nonradioactive cytotoxicity assay (Promega) following the manufacturer’s protocol. Absorbance was measured at 490 nm. Cell survival was measured using the MTT Attorney Docket No.
  • GR and p-Tau (AT8) staining detected by IHC in the CA, subiculum, and presubiculum regions of the hippocampal section was quantified using the whole scanned images and the QuPath version 0.2.3 followed the protocol modified from the analysis pipeline reported by Courtney et al (66). Images was analyzed by batch running using GR_staining_measurement.groovy and pTau_quantification.groovy (see attached script) to quantify polyGR and pTau staining, respectively. The analysis of individual images was then double checked by two researchers.
  • GR60(+) cells and pTau(+) cells were quantified using the QuPath version 0.2.3 and positive cell detection program.
  • Information on number (n) values and what n represents (e.g., cases, biological replicates) and definition of center and dispersion and precision measures [e.g., mean, median, standard error of the mean (SEM)] can be found in the figures and/or figure legends.
  • GraphPad Prism 9 was used to perform the statistical analyses with p ⁇ 0.05 considered statistically significant.
  • ns not significant p > 0.05, ⁇ (p ⁇ 0.05); ⁇ (p ⁇ 0.01); ⁇ (p ⁇ 0.001); ⁇ (p ⁇ 0.0001).
  • Statistical analyses were performed using one-way ANOVA with post hoc Holm-Sidak multiple comparison tests or unpaired two-tailed t-test with details included in the figure legends.
  • Data polyGR protein accumulates in AD autopsy brain tissue
  • IHC Immunohistochemistry
  • ⁇ -GR staining showed frequent perinuclear aggregates in both neurons and glia in the cornu ammonis (CA), subiculum, presubiculum and entorhinal cortex regions of the hippocampus (Fig. 1B).
  • increased levels of polyGR protein were detected in autopsy brain tissue from sporadic AD cases compared to age-similar control brains without AD pathology.
  • increased polyGR signal correlated with increased levels of pTau.
  • dCas9READ Development of dCas9READ to identify repeat expansion mutations Attorney Docket No. U1202.70128WO00
  • CRISPR/ deactivatedCas9-based repeat enrichment and detection (dCas9READ) was developed (FIG.6A).
  • dCas9READ works on the principle that repeat expansion sequences provide more binding sites for repeat-containing single guide RNAs (rsgRNAs) and dCas9 complexes to assemble compared to shorter repeats.
  • dCas9READ was optimized using human genomic DNA samples from C9orf72 ALS/FTD and myotonic dystrophy type 2 (DM2) patients. Biotin-streptavidin pulldowns using G4C2 or CAGG rsgRNAs were performed on enzymatically digested genomic DNA. The enrichment efficiency of expanded repeat containing DNAs was measured using primer sets that target unique flanking sequences of the C9orf72 G4C2 or CNBP CCTG loci (FIG. 6B and FIG.12A).
  • Quantitative PCR showed 4- to 6-fold increased levels of C9orf72 or CNBP flanking sequence in C9 ALS/FTD and DM2 patient samples, respectively, compared to controls (FIG.6C and FIG.12A).
  • An additional control assay performed without the G4C2 sgRNA showed no enrichment of the C9orf72 G4C2 locus. This demonstrated that pulldown specificity was determined by the repeat containing guide RNA (FIG.6D).
  • next- generation sequencing of enriched DNA samples showed significant increased total read counts at the C9orf72 G4C2 and CNBP CCTG loci (FIG.6E and FIG.12B).
  • dCas9READ assays were performed using a mixture of all possible rsgRNAs that would target sequences encoding polyGR (Table 4).
  • Next generation sequencing showed the C9orf72 G4C2 locus was enriched using genomic DNA samples from C9 ALS/FTD patient but not control subjects using mixtures of 8 or 24 GR-targeting rsgRNAs (FIG.6F and Table 4). Additionally, by measuring total read count of the 2-4kb regions around loci of interest and 6- 10kb nearby regions, enrichment scores were calculated for all enriched loci in the genomes of individual patients.
  • Ranking dCas9READ enrichment scores identified the C9orf72 G4C2 and CNBP CCTG as the most enriched loci in tested C9 ALS/FTD and DM2 cases, respectively (Table 5).
  • dCas9READ strategy successfully enriched the C9orf72 G4C2 and CNBP CCTG expansions and unique flanking sequences from genomic DNA samples of C9 ALS/FTD and DM2 patients, respectively.
  • dCas9READ can be Attorney Docket No. U1202.70128WO00 adapted to pull down tandem repeats across the human genome and to detect novel expansion mutations from individual patient samples.
  • dCas9READ was used to identify putative polyGR-expressing repeat expansion mutations from the genomic DNA of polyGR(+) AD cases (FIG.7A).
  • GR-encoding repeat motifs (Table 4) were used to design 24 repeat-containing sgRNAs for dCas9 pulldowns on genomic DNA from five polyGR(+) AD cases, one polyGR(-) AD, and one polyGR(-) non- AD control. Fragment analysis showed enriched DNA with a peak molecular weight at 6-7kb (FIG.12C). Short-read Illumina sequencing data of individual enriched DNA samples were collected.
  • the enriched DNA samples from 2-3 AD cases and 2 controls were combined into separate enrichment pools to provide enough input DNA for PacBio no-amplification long- read sequencing (FIG.14A).
  • Analysis of enriched sequences from short-read Illumina sequencing detected 2,024 GR repeat loci (58.2% intergenic, 33.1% intronic, and 8.7% exonic, FIG.12D) with a ⁇ 2- fold enrichment over background in any of the AD cases (Table 6). These candidate loci were further prioritized based on enrichment scores, read mapping patterns suggesting expanded repeats, and long read sequencing data.
  • CASP8 encodes a member of the cysteine-aspartic acid protease (caspase family).
  • Rare protein coding variants of CASP8 [K148R, 1/600 in AD and 1/1500 in controls] and [I298V, 1/300 in AD and 1/600 in controls] were previously reported to associate with increased risk of AD (28). These variants were not detected by PCR and Sanger sequencing of DNA from 24 CASP8 GGGAGA exp (+) cases (Table 8).
  • CASP8 repeat primed PCR (FIG.7E) showed at least two repeat expansion lengths were found at this locus.
  • long-read PacBio no- amplification sequencing was performed. The flanking sequences were used to map the repeat to the CASP8 locus (FIG.14B). Long-read sequencing reads showed the CASP8 repeat expansions have 44 or 64 GGGAGA repeats and were randomly interrupted by CG, C, G, CGG, GGG, GGGA, CGGG and combinations of these motifs (FIGs.14C-14D).
  • PacBio sequencing reads from 7 AD cases and 2 controls detected three distinct repeat expansion configurations: 64- repeat highly interrupted (hi64), 44-repeat interrupted (i44), and 64-repeat interrupted (i64) (FIGs.14C-14D).
  • dCas9READ and genomic DNA samples from control and polyGR(+) AD cases may be used to identify six novel candidate repeat expansion loci and/or show that the CASP8 GGGAGA exp mutation is associated with an increased risk of developing AD.
  • Increased cleaved CASP8 protein levels in CASP8 GGGAGA exp (+) AD To test if the CASP8 GGGAGA exp mutation affected the expression of CASP8 at the RNA level, qRT-PCR was performed.
  • Sense CASP8 RAN proteins were predicted to be chimeric proteins that contain glycine- Attorney Docket No. U1202.70128WO00 arginine (GR), arginine- glutamic acid (RE), and glycine-glutamic acid (GE) repeat tracts [(GR)n(RE)n(GE)n] and unique C-terminal amino acid sequences in each of the three reading frames (FIG.8C).
  • GR glycine- Attorney Docket No. U1202.70128WO00 arginine
  • RE arginine- glutamic acid
  • GE glycine-glutamic acid
  • minigenes containing 6XStop codons, 100-bp of unique upstream sequence, one of three CASP8 GGGAGA repeat expansions, and 3’-epitope tags in each reading frame were generated (6XStop-CASP8-RE-3T) (FIG.16A). Sequences upstream of the repeat contained an ATG codon in HA frame (FIG.16A). Transfection using 6XStop-CASP8-RE-3T plasmids show repetitive proteins were expressed in HEK293T cells across all three CASP8 GGGAGA expansion configurations tested (hi64, i44, i64).
  • Double IF assays on frozen frontal cortex tissue using ⁇ -polyGR (26, 27) and ⁇ -CT-f3 S antibodies showed polyGR partially co- localizes with ⁇ -CT-f3S staining (FIG.8E and FIG.19).
  • GR- containing polymeric proteins were expressed from the CASP8 GGGAGA exp and that CASP8 expansion proteins expressed from reading frame-3 caused at least part of polyGR pathology found in CASP8 GGGAGA exp (+) AD cases.
  • 27/36 were CASP8-GGGAGA exp (+) and nine CASP8-GGGAGA exp (-). This data indicated additional GR- encoding AD expansion mutations remain to be identified.
  • CASP8- GGGAGA exp (+) AD autopsy brains examined by IHC were positive for ⁇ -polyGR and the CASP8 C-terminal-specific ⁇ - CT-f3 S .
  • CASP8 GGGAGA exp mutation expressesed polymeric proteins in CASP8 GGGAGA exp (+) AD brains and provided a molecular explanation for a substantial portion of the polyGR staining found in AD autopsy brains.
  • CASP8 GGGAGA exp RAN protein levels were increased by stress Variable staining detected by ⁇ -CT-f3 S and ⁇ -CT-f1 S antibodies against unique C- terminal sequences of CASP8 RAN proteins and the lack of staining in CASP8 GGGAGA exp (+) age-matched controls without AD pathology indicated that environmental factors affected the expression and accumulation of these proteins.
  • the role of the integrated stress response which has been reported to increase RAN translation in other repeat expansion diseases (24, 29-33), on CASP8 RAN protein levels was tested.
  • FIG.16A Treatment of HEK293T cells transfected with 6XStop-CAPS8-RE-3T minigenes (FIG.16A) with thapsigargin (Tg), which increases endoplasmic reticulum (ER) stress (34, 35), significantly increased the steady-state levels of proteins expressed from the FLAG and HA frames (FIGs. 9A-9B and 20A-20B).
  • Tg thapsigargin
  • treatment with metformin an FDA-approved drug for type 2 diabetes recently shown to decrease RAN protein levels in other repeat expansion disorders (24), reduced Attorney Docket No.
  • CASP8 GGGAGA exp was toxic to cells and polyGR and CASP8 GGGAGA exp increase p-Tau at pathogenic sites S202 and T205 in cells
  • T98, SH-SY5Y, and HEK293T cells were transfected with 6XStop-CASP8-RE-3T or control minigenes, and cell death and viability were assessed as previously described (25, 36, 37).
  • results provided here indicate that ⁇ 50% of sporadic AD autopsy brains have elevated polyGR staining in neurons and glia in the hippocampus and frontal cortex compared to age-matched controls without AD pathology (p ⁇ 0.0001).
  • the development of dCas9READ allowed the enrichment and identification of the GR-encoding GGGAGA expansion mutation within an SVA-E element in intron 8 of CASP8. This expansion mutation was associated with an increased risk of AD, which explains a large portion of polyGR staining found in the AD brain cohort.
  • CASP8-GGGAGA exp was toxic when overexpressed and CASP8 RAN protein levels, which were increased by endoplasmic reticulum stress, were reduced by the FDA-approved type-2 diabetes drug metformin. Additionally, the data showed polyGR aggregates correlated with increased pTau in AD autopsy brains and that overexpression of polyGR proteins in cells increased pTau levels. Taken together, these indicated that CASP8 GGGAGA exp expressed polyGR-containing RAN proteins, which in turn led to increased pTau, and that this pathogenic cascade was exacerbated by stress and mitigated by metformin (FIGs.9F-9G).
  • the CASP8 GGGAGA exp repeat showed less somatic and intergenerational repeat length variation.
  • the insertion event itself may be a recent human event because long-range PCR identified a subset of cases that did not contain an SVA-E insertion in CASP8 (FIG.13E).
  • the CASP8 SVA repeats were fairly stable with minimal intergenerational or somatic repeat length instability.
  • the shorter 44 GGGAGA length SVA alleles were more toxic in cell toxicity and viability assays and showed greater risk for AD than longer 64 repeat alleles.
  • a potential similarity with other microsatellite expansion diseases is that interruptions within the CASP8 GGGAGA expansion can lead to cell- type specific increases in toxicity.
  • Caspase-8 is known to be involved in the amyloid metabolism, synaptic plasticity, learning, memory and the regulation of microglial pro-inflammatory activation. Protein loss of function caused by the CASP8 GGGAGA exp , would be consistent with the loss-of- function effects of previously reported rare CASP8 protein coding variants. Protein loss-of- function through haploinsufficiency is a common theme in repeat expansion disorders. Unexpectedly, increased levels of cleaved caspase 8 were detected in end-stage frontal cortex tissue from CASP8-GGGAGA exp (+) AD cases. The CASP8 GGGAGA expansion was strikingly different from other AD risk loci (FIG.9F).
  • AD genes (APP, PSEN1, PSEN2) and AD risk factors (TREM2, ABCA7, SORL1) that show strong increased risk for AD (OR>3) are relatively infrequent in the general population ( ⁇ 2%), except for APOE4 (OR>3, ⁇ 20%) (57, 58).
  • AD risk factors with the highest frequencies in the general population (e.g., ACE ( ⁇ 45%), ECHDC3 ( ⁇ 39%), PTK2B ( ⁇ 37%)) have the lowest odd ratios for increased AD risk ( ⁇ 1.2).
  • the CASP8 GGGAGA exp (+) which was frequently found in controls ( ⁇ 60%), also had a relatively high OR (1.75).
  • Table 4 GR encoding repeat motifs used for designing repeat-containing sgRNAs for dCas9-based pulldown. Repeat-containing sgRNAs were designed using the IDT gRNA design tool (https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM) or designed manually. Attorney Docket No. U1202.70128WO00 Table 5: Examples of dCas9READ enrichment ranking showing the top five most enriched loci in a C9 ALS/FTD (A) and a DM2 case (B). G4C2 sgRNAs were used to enrich C9orf72 ALS/FTD and control DNA samples (A).
  • CAGG sgRNAs were used to enrich DM2 and control DNA samples (B).
  • inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein.
  • any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
  • a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
  • “or” should be understood to have the same meaning as “and/or” as defined above.
  • the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.
  • the phrase “at least one,” in reference to a list of one or more elements should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
  • At least one of A and B can refer, in one embodiment, to at least one, optionally including more than one, Attorney Docket No.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

Aspects of the disclosure relate to compositions and methods for the diagnosis and/or treatment of certain neurodegenerative diseases, for example those diseases associated with repeat-associated non-ATG (RAN) translation proteins, such as Alzheimer's disease (AD). In some embodiments, the disclosure relates to identifying a subject having a RAN protein-associated disease by detecting expression or activity of interrupted repeat-associated non-ATG (RAN) translation proteins (e.g., interrupted RAN proteins). In some embodiments, the disclosure relates to methods of treating a RAN protein-associated disease by administering to a subject in need thereof an agent that reduces expression or activity of interrupted RAN proteins.

Description

Attorney Docket No. U1202.70128WO00 INTERRUPTED RAN PROTEINS IN DISEASE RELATED APPLICATIONS The application claims the benefit under 35 U.S.C.119(e) of U.S. Provisional Application number 63/421,533 filed on November 1, 2022, and U.S. Provisional Application number 63/456,405 filed on March 31, 2023, each of which is herein incorporated by reference in its entirety. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The contents of the electronic sequence listing (U120270128WO00-SEQ-KZM.txt; Size: 183,398 bytes; and Date of Creation: November 1, 2023) is herein incorporated by reference in its entirety. STATEMENT OF FEDERAL FUNDING This invention was made with government support under Grant Nos. K99 AG065511, NS126536 and R01 NS098819 awarded by the National Institutes of Health, and Grant No. W81XWH-22-1-0592 awarded by the U.S. Army Medical Acquisition Activity. The government has certain rights in the invention. BACKGROUND Microsatellite repeat expansions are known to cause more than forty neurodegenerative disorders. Molecular features common to many of these disorders include the accumulation of RNA foci containing sense and antisense expansion transcripts and the accumulation of proteins from repeat-associated non-AUG (RAN) translation. RAN translation can occur across a broad range of repeat lengths from pre-mutation lengths (~30 – 40 repeats) to full expansions (up to 10,000 repeats). While repetitive elements account for a Attorney Docket No. U1202.70128WO00 large portion of the human genome, the detection of repeats and repeat expansion mutations is challenging. SUMMARY Aspects of the disclosure relate to methods and compositions for identification and/or treatment of diseases associated with repeat-associated non-ATG (RAN) protein translation (e.g., RAN protein diseases). A “RAN protein (e.g., a repeat-associated non-ATG translated protein)” is a polypeptide translated from mRNA sequence carrying a nucleotidic expansion in the absence of an apparent AUG initiation codon. Generally, RAN proteins comprise expansion repeats of a single amino acid, di-amino acid, tri-amino acid, or quad-amino acid (e.g., tetra-amino acid), termed poly-amino acid repeats. However, the present inventors have surprisingly discovered that a novel class of RAN proteins, which comprise discontiguous or “interrupted” poly-amino acid repeat motifs, are expressed in certain RAN protein diseases. As used herein, an “interrupted RAN protein” or a “discontiguous RAN protein” refers to a RAN protein translated from an RNA transcript comprising a plurality of nucleotidic expansion repeat units (e.g., a GGGGCT repeat unit, a GAAGGA repeat unit, a GGGAGA repeat unit, etc.) having one or more amino acid alterations that causes a frameshift and results in production of a polypeptide comprising a non-contiguous, repeating pattern of poly- amino acid repeat units that extends for the length of the nucleotidic expansion. In some embodiments, an RNA transcript encoding an interrupted RAN protein comprises one or more nucleotides inserted between one or more expansion repeat units and/or one or more nucleotide substitutions within one or more expansion repeat units. As described further in the Example, the inventors have recognized that interrupted RAN proteins expressed from certain RNA transcripts are associated with RAN protein diseases, for example Alzheimer’s disease and amyotrophic lateral sclerosis (ALS). In some embodiments, one or more genes that may be transcribed to produce interrupted RAN proteins are listed in Table 1 or Table 6. Generally, an interrupted RAN protein may comprise between about 2 and about 10,000 discontiguous or “interrupted” amino acid repeats (in sum) (“RAN repeat units”). In some embodiments, an interrupted RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 discontiguous or “interrupted” Attorney Docket No. U1202.70128WO00 amino acid repeats, etc. (e.g., RAN repeat units). In some embodiments, an interrupted RAN protein comprises one or more poly-amino acid repeat(s) that is between 2 and 500, between 20 and 300, between 30 and 200, between 40 and 100, between 50 and 90, or between 60 and 80 amino acid residues in length. In some embodiments, an interrupted RAN protein comprises one or more poly-amino acid repeat(s) that is at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or at least 200 amino acid residues in length. In some embodiments, an interrupted RAN protein has one or more poly-amino acid repeat(s) more than 200 amino acid residues (e.g., 500, 1000, 5000, 10,000, etc.) in length. As will be understood, the poly-amino acid repeat(s) comprised within an interrupted RAN protein (e.g., RAN repeat units) are separated by one or more non-repeating amino acids (see, e.g., FIG.1B). In some embodiments, at least one of the interrupted RAN proteins comprises at least one amino acid residue between each RAN repeat unit. In some embodiments, the poly-amino acid repeat(s) comprised within an interrupted RAN protein (e.g., RAN repeat units) are separated by between about 2 and about 100 non-repeating amino acids. In some embodiments, at least one of the interrupted RAN proteins comprises between 2 and 20 amino acid residues between each RAN repeat unit. In some embodiments, the poly-amino acid repeat(s) comprised within an interrupted RAN proteins are separated by between about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 non-repeating amino acids. In some aspects, the disclosure provides a method for identifying a subject as having a RAN protein disease based upon the presence or absence of interrupted RAN proteins, as described herein. In some embodiments, said method comprises detecting one or more interrupted RAN proteins in a biological sample obtained from the subject, wherein the one or more interrupted RAN proteins each comprise multiple RAN repeat units. In some embodiments, the biological sample is tissue, blood, serum, or cerebrospinal fluid (CSF). In some embodiments, the tissue is brain tissue or spinal cord tissue. Aspects of the disclosure relate to a method of treating a subject having or suspected of having a RAN-protein associated disease, the method comprising administering to the Attorney Docket No. U1202.70128WO00 subject one or more anti-RAN protein agents. In some embodiments, the subject is identified as having a RAN protein disease according to the methods described herein for identifying a subject as having a RAN protein disease. In some embodiments, a subject is identified as having a RAN protein disease according to the methods described herein for identifying a subject as having a RAN protein disease, and a therapeutic agent (e.g., an anti-RAN protein agent) is administered to the identified subject. In some embodiments, the one or more anti-RAN protein agents target one or more interrupted RAN proteins. In some embodiments, the one or more anti-RAN protein agents reduce the transcription, translation, expression, aggregation or accumulation of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly-amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein transcription, translation, expression, aggregation or accumulation in the subject prior to the administration of the one or more anti-RAN protein agents. In some embodiments, the one or more anti-RAN protein agents reduce the transcription of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly-amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein transcription in the subject prior to the administration of the one or more anti- RAN protein agents. In some embodiments, the one or more anti-RAN protein agents reduce the translation of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly- amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein translation in the subject prior to the administration of the one or more anti-RAN protein agents. In some embodiments, the one or more anti-RAN protein agents reduce the expression of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly- amino acid repeat motifs (e.g., RAN repeat units), relative to the expression in the subject prior to the administration of the one or more anti-RAN protein agents. In some embodiments, the one or more anti-RAN protein agents reduce the aggregation of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly-amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein aggregation in the subject prior to the administration of the one or more anti-RAN protein agents. In some embodiments, the one or more anti-RAN protein agents reduce the accumulation of interrupted (e.g., discontiguous) RAN proteins comprising interrupted poly-amino acid repeat motifs (e.g., RAN repeat units), relative to the level of RAN protein accumulation in the subject prior to the administration of the one or more anti-RAN protein agents. Attorney Docket No. U1202.70128WO00 In some embodiments, the RAN protein is an interrupted poly-Glycine-Alanine (poly- GA) or a poly-Glycine-Arginine (poly-GR) repeat-containing RAN protein. Interrupted poly- GA and poly-GR RAN protein-encoding sequences can be found in the genome (e.g., human genome) at one or multiple loci, including but not limited to the loci and sequences set forth in Table 1 or Table 6. In some embodiments, a subject is characterized as having a mutation in one or more chromosomal loci or genes set forth in Table 1 or Table 6, where the one or more mutations results in translation of one or more interrupted poly-GA and/or poly(GR) RAN proteins. In some embodiments, expansion repeats encoding interrupted RAN proteins are located in protein coding regions of a gene (e.g., exonic regions). In some embodiments, expansion repeats encoding interrupted RAN proteins are located in non-coding regions of a gene (e.g., intronic regions, untranslated regions such as 5’UTR or 3’UTR, etc.). In some embodiments, expansion repeats encoding interrupted RAN proteins are located in intergenic regions of a chromosome (e.g., nucleic acid sequences positioned between genes on a chromosome). In some embodiments, the one or more interrupted RAN proteins comprises a poly- GA interrupted RAN protein. In some embodiments, at least one of the interrupted RAN proteins is translated from a (GGGGCT)x expansion repeat, a (GGGAGA)x expansion repeat, or a (GAAGGA)x expansion repeat, where x represents the number of repeat units present. In some embodiments, the one or more interrupted RAN proteins comprises a poly-GR interrupted RAN protein. In some embodiments, at least one of the interrupted RAN proteins is translated from a (GGGAGA)x expansion repeat. In some embodiments, x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, Attorney Docket No. U1202.70128WO00 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some embodiments, a poly- GA interrupted RAN protein comprises between 10 and 50 GA repeat units over a stretch of 100 amino acids (e.g., between 10% and 50%). In some embodiments, a poly-GR interrupted RAN protein comprises between 10 and 50 GR repeat units over a stretch of 100 amino acids (e.g., between 10% and 50%). In some embodiments, at least one of the interrupted RAN proteins is transcribed from a gene or chromosomal locus as set forth in Table 1. In some embodiments, at least one of the interrupted RAN proteins is transcribed from ARMCX4, ALK, and/or CASP8. In some embodiments, a ARMCX4, ALK, and/or CASP8 gene is transcribed to produce one or more interrupted RAN proteins. In some embodiments, an ARMCX4 gene is transcribed to produce one or more interrupted poly(GA) RAN proteins. In some embodiments, an ALK gene is transcribed to produce one or more interrupted poly(GA) RAN proteins. In some embodiments, a CASP8 gene is transcribed to produce one or more interrupted poly(GR) RAN proteins. In some embodiments, an interrupted poly(GA) or interrupted poly(GR) RAN protein is translated from an mRNA transcript encoded by a ARMCX4, ALK, and/or CASP8 gene, or a genetic locus thereof. In some embodiments, an interrupted poly(GA) RAN protein is translated from an mRNA transcript encoded by ARMCX4, or a genetic locus thereof. In some embodiments, an interrupted poly(GA) RAN protein is translated from an mRNA transcript encoded by ALK, or a genetic locus thereof. In some embodiments, an interrupted poly(GR) RAN protein is translated from an mRNA transcript encoded by CASP8, or a genetic locus thereof. In some embodiments, an ARMCX4 gene comprises an(GGGGCT)x expansion repeat, a (GGGAGA)x expansion repeat, or a (GAAGGA)x expansion repeat, where x represents the number of repeat units present. In some embodiments, an ALK gene comprises an (GGGGCT)x expansion repeat, a (GGGAGA)x expansion repeat, or a (GAAGGA)x expansion repeat, where x represents the number of repeat units present. In some embodiments, a CASP8 gene comprises an (GGGGCT)x expansion repeat, a (GGGAGA)x expansion repeat, or a (GAAGGA)x expansion repeat, where x represents the number of repeat units present. In some embodiments, a subject is a mammal. In some embodiments, a subject is a human. In some embodiments, a subject is a non-human mammal, such as a mouse, rat, dog, cat, or pig. Attorney Docket No. U1202.70128WO00 In some embodiments, detecting one or more interrupted RAN proteins comprises performing an assay on the biological sample. In some embodiments, the assay comprises an antibody-based capture assay, binding assay, hybridization assay (e.g., Fluorescence In situ Hybridization (FISH)), immunoblot analysis, Western blot analysis, immunohistochemistry, dCas9-based enrichment, label free immunoassays, immunoquantitative PCR, mass spectrometry, bead-based immunoassays, immunoprecipitation, immunostaining, immunoelectrophoresis, and/or ELISA. In some embodiments of methods described by the disclosure, a sample (e.g., a biological sample) is treated by an antibody-based capture process to isolate and/or detect one or more interrupted RAN proteins within the sample. Typically, the antibody-based capture methods include contacting the sample with one or more (e.g., 2, 3, 4, 5, or more) anti-RAN protein antibodies (e.g., anti-interrupted RAN protein antibodies). In some embodiments, the one or more anti-RAN antibodies are conjugated to a solid support (e.g., a scaffold, resin beads, etc.). In some embodiments, antibody-based capture methods comprise physically separating and/or isolating RAN proteins that have been bound by the anti-RAN antibody(s), for example eluting the RAN proteins by a chromatographic method such as affinity chromatography or ion-exchange chromatography. Detection of interrupted RAN proteins in a biological sample may be performed by Western blot. Western blots generally employ the use of a detection agent or probe to identify the presence of a protein or peptide. In some embodiments, detection of one or more interrupted RAN proteins is performed by immunoblot (e.g., dot blot, 2-D gel electrophoresis, Western Blot, etc.), immunohistochemistry (IHC), ELISA (e.g., RCA-based ELISA or RT-PCR-based ELISA), label free immunoassays such as surface plasmon resonance bio layer interferometry, immunoquantitative PCR, mass spectrometry such as GC- MS, LC-MS, MALDI-TOF-MS, bead-based immunoassays, immunoprecipitation, immunostaining, or immunoelectrophoresis. In some embodiments, the detection agent is an antibody. In some embodiments, the antibody is an anti-RAN protein antibody (e.g., an anti- interrupted RAN protein antibody), such as an anti-poly(GA) or anti-poly(GR) antibody. In some embodiments, an anti-RAN protein antibody targets (e.g., specifically binds to) the amino acid repeat region (e.g., GAGAGAGAGAGAGAGAGA (SEQ ID NO: 1), etc.) of a RAN protein. In some embodiments, an anti-RAN protein antibody targets (e.g., specifically binds to) an epitope comprising amino acids in the characteristic reading frame-specific C- Attorney Docket No. U1202.70128WO00 terminus translated 3’ of the repeated amino acids. In some embodiments, an anti-RAN protein antibody targets (e.g., specifically binds to) an epitope comprising amino acids bridging the C-terminus of the amino acid repeat region and the N-terminus of the characteristic reading-frame specific C-terminus translated 3’ of the repeated amino acids. In some embodiments, an anti-RAN antibody targets (e.g., specifically binds to) any portion of an interrupted RAN protein that does not comprise the poly-amino acid repeat, for example the C-terminus of an interrupted RAN protein (e.g., the C-terminus of an interrupted poly(GA) or poly(GR) repeat protein). Examples of anti-RAN antibodies targeting RAN protein poly-amino acid repeats are disclosed, for example, in International Application Publication No. WO 2014/159247, the entire content of which is incorporated herein by reference. Examples of anti-RAN antibodies targeting the C-terminus of RAN proteins are disclosed, for example, in U.S. Publication No.2013/0115603, the entire content of which is incorporated herein by reference. In some embodiments, the RAN protein disease is amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuch’s Corneal Dystrophy. In some embodiments, the method of identifying a subject as having a RAN protein disease further comprises administering to the subject one or more anti-RAN protein agents. In some embodiments, the one or more anti-RAN protein agents comprises a protein, peptide, nucleic acid, or small molecule. In some embodiments, the protein comprises an antibody. In some embodiments, the antibody is an anti-poly-GA or anti-poly-GR antibody. In some embodiments, the anti-poly- GA antibody specifically binds to a poly-GA repeat region of the RAN protein in the subject. In some embodiments, the anti-poly-GR antibody specifically binds to a poly-GR repeat region of the RAN protein in the subject. Attorney Docket No. U1202.70128WO00 An anti-RAN antibody can be a polyclonal antibody or a monoclonal antibody. In some embodiments, the anti-poly-GA or anti-poly-GR antibody is a polyclonal antibody. Typically, polyclonal antibodies are produced by inoculation of a suitable mammal, such as a mouse, rabbit or goat. Larger mammals are often preferred as the amount of serum that can be collected is greater. An antigen is injected into the mammal. This induces the B- lymphocytes to produce IgG immunoglobulins specific for the antigen. This polyclonal IgG is purified from the mammal’s serum. In some embodiments, the anti-poly-GA or anti-poly- GR antibody is a monoclonal antibody. Monoclonal antibodies are generally produced by a single cell line (e.g., a hybridoma cell line). In some embodiments, an anti-RAN antibody is purified (e.g., isolated from serum). In some embodiments, the antigen is 12-20 amino acids. For antibodies against repeat motifs, an antigen is a repeat sequence. For antibodies against C-terminal sequence of a RAN protein, an antigen is a C-terminal-specific sequence. In some embodiments, an antigen is a portion of a C-terminal sequence, for example, a fragment of the C-terminal sequences that is 3-5 or 5-10, or more amino acids in length, for example 6, 7, 8, 9, 10, 11, 12, 13, 1415, 16, 17, 18, 19, 20, 25, 30, 35, 40, or 50 amino acids in length. In some embodiments, the disclosure provides methods of producing an antibody, the method comprising administering to the subject a peptide antigen comprising a RAN protein repeat sequence, for example a poly(GA) or poly(GR) repeat sequence. In some embodiments, the subject is a mammal, for example a non-human primate, rodent (e.g., rat, hamster, guinea pig, etc.). In some embodiments, the subject is a human (e.g., a human subject is injected with a peptide antigen for the purposes of eliciting a host antibody response against the peptide antigen, for example a RAN protein). In some embodiments, an antibody is produced by expressing in a cell (e.g., a B-cell, hybridoma cell, etc.) one or more interrupted RAN proteins or interrupted RAN protein repeat sequences. Numerous methods may be used for obtaining anti-RAN antibodies. For example, antibodies can be produced using recombinant DNA methods. Monoclonal antibodies may also be produced by generation of hybridomas (see, e.g., Kohler and Milstein (1975) Nature, 256: 495-499) in accordance with known methods. Hybridomas formed in this manner are then screened using standard methods, such as enzyme-linked immunosorbent assay (ELISA; e.g., RCA-based ELISA or rtPCR-based ELISA) and surface plasmon resonance (e.g., OCTET or BIACORE) analysis, to identify one or more hybridomas that produce an antibody that specifically binds with a specified antigen. Any form of the specified antigen (e.g., an Attorney Docket No. U1202.70128WO00 interrupted RAN protein) may be used as the immunogen, e.g., recombinant antigen, naturally occurring forms, any variants or fragments thereof. One exemplary method of making antibodies includes screening protein expression libraries that express antibodies or fragments thereof (e.g., scFv), e.g., phage or ribosome display libraries. Phage display is described, for example, in Ladner et al., U.S. Pat. No.5,223,409; Smith (1985) Science 228:1315-1317; Clackson et al. (1991) Nature, 352: 624-628; Marks et al. (1991) J. Mol. Biol., 222: 581-597WO92/18619; WO 91/17271; WO 92/20791; WO 92/15679; WO 93/01288; WO 92/01047; WO 92/09690; and WO 90/02809. In addition to the use of display libraries, the specified antigen (e.g., one or more interrupted RAN proteins) can be used to immunize a non-human animal, e.g., a rodent, e.g., a mouse, hamster, or rat. In one embodiment, the non-human animal is a mouse. In another embodiment, a monoclonal antibody is obtained from the non-human animal, and then modified, e.g., made chimeric, using recombinant DNA techniques known in the art. A variety of approaches for making chimeric antibodies have been described. See, e.g., Morrison et al., Proc. Natl. Acad. Sci. U.S.A.81:6851, 1985; Takeda et al., Nature 314:452, 1985, Cabilly et al., U.S. Pat. No.4,816,567; Boss et al., U.S. Pat. No.4,816,397; Tanaguchi et al., European Patent Publication EP171496; European Patent Publication 0173494, United Kingdom Patent GB 2177096B. Antibodies can also be humanized by methods known in the art. For example, monoclonal antibodies with a desired binding specificity can be commercially humanized (Scotgene, Scotland; and Oxford Molecular, Palo Alto, Calif.). Fully humanized antibodies, such as those expressed in transgenic animals are within the scope of the invention (see, e.g., Green et al. (1994) Nature Genetics 7, 13; and U.S. Patent Nos.5,545,806 and 5,569,825). For additional antibody production techniques, see, Antibodies: A Laboratory Manual, Second Edition. Edited by Edward A. Greenfield, Dana-Farber Cancer Institute, ©2014. The present disclosure is not necessarily limited to any particular source, method of production, or other special characteristics of an antibody. In some embodiments, the one or more anti-RAN protein agents comprises a nucleic acid. In some embodiments, the nucleic acid is an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid is an interfering RNA. In some embodiments, the nucleic acid is double-stranded RNA (dsRNA), short-interfering RNA (siRNA), short-hairpin RNA (shRNA), microRNA (miRNA), artificial microRNA (amiRNA), an aptamer, or an Attorney Docket No. U1202.70128WO00 antisense oligonucleotide (ASO). In some embodiments, the inhibitory nucleic acid is a nucleic acid aptamer (e.g., an RNA aptamer or DNA aptamer). Generally, an inhibitory RNA molecule can be unmodified or modified. In some embodiments, an inhibitory RNA molecule comprises one or more modified oligonucleotides, e.g., phosphorothioate-, 2'-O- methyl-, etc.-modified oligonucleotides, as such modifications have been recognized in the art as improving the stability of oligonucleotides in vivo. In some embodiments, the nucleic acid comprises a region of complementarity with a nucleic acid sequence encoding a poly-GA or poly-GR repeat expansion in the subject. A region of complementarity may comprise between 2 and 50 nucleotides. In some embodiments, the region of complementarity comprises between 2 and 10, 2 and 15, 5 and 20, or 10 and 30 nucleotides in length. In some embodiments, the nucleic acid comprises a region of complementarity with a nucleic acid sequence present at a chromosomal locus or gene as set forth in Table 1 or Table 6. In some embodiments, the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by a gene, or a genetic locus thereof, selected from the group consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, CXADRP3, LINC00668, MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, Attorney Docket No. U1202.70128WO00 SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1-124K5.11, ABCB4, MFSD3, SOX17, MTDH, RRS1-AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5-8SN5, SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by a chromosomal locus in chrX beginning at 100748986 and ending at 100749205. In some embodiments, the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by ARMCX4. In some embodiments, the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by ALK. In some embodiments, the inhibitory nucleic acid comprises a region of complementarity with an RNA transcript encoded by CASP8. In some embodiments, the one or more anti-RAN protein agents comprises a small molecule. In some embodiments, the small molecule inhibits expression or activity of one or more RAN proteins. In some embodiments, a small molecule is an inhibitor of eIF3 (or an eIF3 subunit). Examples of small molecule inhibitors of eIF3 include but are not limited to mTOR inhibitors (e.g., rapamycin, PP242), S6 kinase (S6K) inhibitors, etc. In some embodiments, the small molecule inhibits expression or activity of eukaryotic initiation factor 2A (eIF2A) or eIF2α. Examples of small molecule inhibitors of eIF2A include but are not limited to salubrinal, Sal003, ISRIB , etc. In some embodiments, the small molecule in an inhibitor of TARBP2. Examples of TARBP2 inhibitors include anti-TARBP2 antibodies, interfering RNAs (e.g., dsRNA, siRNA, shRNA, miRNA, etc.) that target TARBP2, peptide inhibitors of TARBP2, and small molecule inhibitors of TARBP2. In some embodiments, the small molecule is metformin, also known as N,N-dimethylbiguanide (IUPAC N,N- Dimethylimidodicarbonimidic diamide and CAS 657-24-9), or an alternate bioactive biguanide including chloroguanide [1-[amino-(4-chloroanilino)methylidene]-2-propan-2-yl- Attorney Docket No. U1202.70128WO00 guanidine, CAS 500-92-5], Chlorproguanil [1-[Amino-(3,4-dichloroanilino)methylidene]-2- propan-2-ylguanidine, CAS 537-21-3], buformin [N-Butylimidodicarbonimidic diamide, CAS 692-13-7] or Phenformin [2-(N-phenethylcarbamimidoyl)guanidine, CAS 114-86-3] or a pharmaceutically acceptable salt, co-crystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotopically enriched derivative, or prodrug of any of the biguanides. In some embodiments, the small molecule is metformin. BRIEF DESCRIPTION OF DRAWINGS The accompanying drawings are not intended to be drawn to scale. In the drawings, each identical or nearly identical component that is illustrated in various figures is represented by a like numeral. For purposes of clarity, not every component may be labeled in every drawing. In the drawings: FIGs.1A and 1B show a predicted ARMCX4 poly-GA repeat protein. FIG.1A shows alternative splicing variants, demonstrating that an ARMCX4 repeat expansion can be in an intron (left) or an exon (right). FIG.1B shows a predicted GA-rich protein produced by an ARMCX4 repeat expansion. The example amino acid sequence (SEQ ID NO: 4) shown in FIG.1B illustrates interrupted GA repeat motifs. FIGs.2A and 2B show a predicted ALK poly-GA repeat protein. FIG.2A shows the predicted coding region. The expanded allele has expanded GGA repeats and contains ~143- 156 repeats. FIG.2B shows a predicted GA-rich protein produced by an ALK repeat expansion. The example amino acid sequence (SEQ ID NO: 7) shown in FIG.2B illustrates interrupted GA repeat motifs. FIGs.3A and 3B show representative data demonstrating that anti-GA antibodies recognize GA-rich proteins expressed from ARMCX4 and ALK repeat expansions. FIG.3A shows example ARMCX4-RE and ALK-RE plasmids which were designed and cloned. FLAG tag expresses in frame with ARMCX4 and ALK GA-rich proteins. FIG.3B shows data demonstrating that, in ARMCX4-RE and ALK-RE overexpressing HEK293T cells, anti-GA antibody staining co-localizes with FLAG tag. FIGs.4A-4C show a predicted CASP8 poly-GR repeat protein. FIG.4A shows the predicted coding region. FIG.4B shows a predicted GR-rich protein produced by an CASP8 Attorney Docket No. U1202.70128WO00 repeat expansion. The example amino acid sequence (SEQ ID NO: 8) shown in FIG.4B illustrates interrupted GR repeat motifs. FIG.4C shows a predicted GR-rich protein produced by an CASP8 repeat expansion. The example amino acid sequence (SEQ ID NO: 9) shown in FIG.4C illustrates interrupted GR repeat motifs. FIGs.5A-5I show representative data of distinct polyGR accumulation that correlates with p-Tau levels in AD and tauopathy-related autopsy brains. FIG.5A shows examples of polyGR immunohistochemical (IHC) staining (red) detected by a rabbit polyclonal α-polyGR antibody in the hippocampal sections (HC) from AD and control cases. FIG.5B shows a diagram showing location of polyGR aggregates (red dots) found in the hippocampal sections from AD cases; hc = hippocampus, erc = entorhinal cortex. FIG.5C shows quantification of polyGR aggregates in the hippocampus as outlined by red square in FIG.5B from AD (n = 80) and control (n = 18) cases. FIG.5D shows an example of a dot blot analysis of polyGR detected by a rat monoclonal α-polyGR antibody in protein extracts of frozen frontal cortex from AD (n = 65) and control (n = 20) cases. FIG.5E shows quantification polyGR levels in frontal cortex protein lysates from AD and control cases determined by dot blot analyses. FIG.5F shows examples of IHC staining analyses of polyGR, p-tau (S202 and T205) (detected by AT8 antibody), Aβ plaques, and p-TDP43 in Cornu Ammonis (CA) and dentate gyrus (DG) of hippocampus. Positive staining shown in red, scale bar = 20 μm. FIG.5G shows double IHC staining analyses showing polyGR (pink) detected in brain regions with both high and low p-tau (S202 and T205) (brown) sub- regions of the same AD brain section. Black arrows: cells with both polyGR and p-tau signal, open arrows: cells with polyGR staining. FIG.5H shows a plot of polyGR and p-tau (S202 and T205) staining detected in sequential slides from 21 randomly selected AD cases. Data represent mean ± SEM. Two- tailed, unpaired t-test. **** p < 0.0001. FIG.5I shows α-polyGR staining in autopsy brain tissue from tauopathy-related disease patients. IHC staining was performed using tissue samples from patients with dominant pathological signatures of progressive supranuclear palsy (PSP, n = 10), Pick’s disease (Pick’s, n=10), and lewy body dementia (LBD, n = 9), and AD (n = 3) as positive controls, and control cases with no pathology of dementia (n = 8). There are several cases with mixed pathologies including case 9 with a mixed pathology of LBD, Parkinson’s disease (PD), and AD (C9-LBD/PD/AD). This figure includes representative staining images from all cases that have polyGR staining and some examples that are negative for polyGR staining. The remaining cases (not shown) are all negative for Attorney Docket No. U1202.70128WO00 polyGR staining. We detected positive polyGR staining in a small subset of PSP, Pick’s, and LBD cases that accumulate in distinct patterns compared to C6-AD, C7-AD, and C8-AD. The two non-AD cases with strong polyGR staining are C14-LBD and C19-Pick’s. PolyGR staining is detected in only few cells and/or very faint for C9-LBD/PD/AD, C12-LBD/AD, C16-Pick’s, C18-Pick’s, and C24-PSP. FIGs.6A-6F show an example of a CRISPR deactivated Cas9-based repeat enrichment and detection (dCas9READ) strategy for pulling down repeat expansion mutations. FIG.6A Schematic diagram showing how dCas9READ method works. FIG.6B shows a examples of primers used in qPCR assays to measure levels of the C9orf72 flanking sequence in dCas9READ-enriched DNA samples. FIG.6C shows a quantification of C9orf72 flanking sequence levels in dCas9READ enriched C9 GGGGCCexp(+) (C9(+)) (n = 4) compared with C9 GGGGCCexp(-) (C9(-)) (n = 3). FIG.6D shows an enrichment plot of the C9orf72 GGGGCC flanking sequence in a control assay with and without G4C2 sgRNA (n =3). FIG.6E shows mapping of Illumina short-read sequencing reads and total read counts at the C9orf72 G4C2 locus of dCas9 enriched C9 (n = 4) and control (n = 4) samples with quantification of enriched locus and flanking regions. FIG.6F show mapping of Illumina short-read sequencing reads of C9 and control samples enriched with mixtures of 8 or 24 sgRNA containing GR-encoding repeat motifs. (E, F) Scale bar shows number of reads. Data represent mean ± SEM. Unpaired two-tailed t-test. ** p < 0.01, *** p < 0.001. FIGs.7A-7F show detection of GGGAGA·TCTCCC (SEQ ID NO: 10) repeat expansion mutation using dCas9READ. FIG.7A shows an example approach to identify novel repeat expansions using polyGR protein signature and dCas9READ and to determine association of novel repeat expansions with AD. FIG.7B shows a diagram of the genomic location of the CASP8 GGGAGA repeat expansion within an SVA-E retrotransposon element, reference repeat sequences, and repeat primed PCR (RP-PCR) primers used to characterize the repeat expansion (SEQ ID NOs: 11, 12). FIG.7C shows examples of dCas9READ fold enrichment of ten loci using genomic DNA from a polyGR(-) control (Cntl), a polyGR(-) AD (AD#1) and five polyGR(+) AD cases. FIG.7D shows mapping of Illumina short-read sequencing reads at the CASP8 locus shows increased enrichment in AD#2 and AD#3 cases. The red arrow indicates location of the repeat expansion in CASP8. FIG.7E shows RP-PCR data showing two positive repeat expansion patterns (~64-repeats (SEQ ID NO: 13) and 44-repeats (SEQ ID NO: 14)) for (GAGAGG)2GAGACG (SEQ ID Attorney Docket No. U1202.70128WO00 NO: 15) repeat primer at the CASP8 locus. FIG.7F shows percentage of long (~64-repeats (SEQ ID NO: 13)), intermediate (~44-repeats (SEQ ID NO: 14)) CASP8 GGGAGA repeats, and non-expanded CASP8 GGGAGA repeats in AD and control populations. FIGs.8A-8E shows representative data for increased cleaved caspase 8 levels and accumulation of expansion proteins expressed from the CASP8 GGGAGAexp in AD autopsy brain tissue. FIG.8A shows cleaved caspase-8 detected in the frontal cortex tissue from CASP8-GGGAGAexp(+) AD, CASP8-GGGAGAexp(-) AD, and non-AD control cases (free of AD pathology). FIG.8B shows a quantification of cleaved caspase-8 from FIG.8A. FIG. 8C shows a diagram of expansion proteins translated from sense and antisense transcripts from the CASP8 GGGAGAexp locus. Amino acid sequences highlighted in red were used to generate frame specific C-terminal (CT) antibodies. S, sense; AS, antisense; f1–3, reading frames 1–3; * stop codon. FIG.8D shows IHC detection of CASP8 RAN Sf3 protein aggregate staining (red) in the hippocampus of CASP8-GGGAGAexp(+) AD patients detected with α-CT-f3S antibody. FIG.8E shows a double IF analysis of co-localization of polyGR (red) and α-CT-f3S (green) staining in the frontal cortex from CASP8- GGGAGAexp(+) AD patients. Data represent mean ± SEM. One- way ANOVA Holm- Sidak’s multiple comparisons test. ** p < 0.01. FIGs.9A-9J show the effects of stress on RAN translation of CASP8 GGGAGAexp and effects of CASP8 GGGAGAexp and polyGR on cells and tau phosphorylation. FIG.9A shows a representative protein blot of FLAG-tagged RAN proteins expressed from 6XStop- CASP8-RE-3T minigenes in HEK293T cells.6XStop-CASP8-RE-3T minigenes: CASP8- hi64-3T (highly interrupted with 64 GGGAGA repeats (SEQ ID NO: 13)); CASP8-i44-3T (interrupted with 44 GGGAGA repeats (SEQ ID NO: 14)); CASP8-i64-3T (interrupted with 64 GGGAGA repeats (SEQ ID NO: 13)). FIG.9B shows effects of Thapsigargin (Tg) and metformin (M) on CASP8 RAN protein expression (n = 3-4). FIG.9C shows effects of CASP8 GGGAGAexp minigenes on survival and viability of T98 cells measured by LDH and MTT assays, respectively (n = 4). FIG.9D show increased tau phosphorylation (S202 and T205) in polyGR overexpressing SH-SY5Y cells overexpressing FLAG-GR60 using alternative codon minigenes. FIG.9E shows quantification of p-tau in polyGR(+) (n = 46) and polyGR(-) SH-SY5Y cells (n = 287). FIG.9F shows a diagram of RAN repeat units and corresponding flanking sequences including an insertion in the VNTR sequence identified in CASP8 that are associated with a higher risk of AD. This variant is associated with an Attorney Docket No. U1202.70128WO00 increased risk of AD with an odds ratio of 2.3 (p=0.0001). This specific repeat configuration may be used for diagnostic screening and for therapeutic targeting with ASOs, RNAi, CRISPR/Cas and other methods etc. FIG.9G shows a schematic of the assay used to analyze polyGR aggregates in HEK293T cells transfected with CASP8 SVA cloned from AD or control cases. FIG.9H shows representative confocal images showing polyGR staining (in red) in cells transfected with AD SVA or control SVA (Cntl SVA) plasmids. FIG.9I shows quantification of polyGR detected in HEK293T cells transfected with AD SVA (n = 7) and control SVA (n = 3) plasmids. FIG.9J shows schmatic representation describing the contribution of CASP8 and other repeat expansion mutations in AD and in triggering pathogenic tau phosphorylation. Data represent mean ± SEM. For FIGs.9B-9C: One-way ANOVA Holm-Sidak’s multiple comparisons test and unpaired two-tailed t-test (E). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. For FIG.9I: Data represent mean ± SEM. unpaired two-tailed t-test** p < 0.01. FIG.10 shows repeat primer PCR analysis of Casp8 repeat gene sequences encoding interrupted dipeptides comprising poly(GR) that were performed using a primer containing (GGGAGA)3 (SEQ ID NO: 23). FIGs.11A-11C show polyGR protein pathology in AD patient autopsy brain tissue. FIG.11A shows examples of broader field microscopy analyses of polyGR IHC staining detected by the rabbit polyclonal α-polyGR antibody in hippocampus (HC) in AD sections but not control sections. FIG.11B shows an example of a 3xFLAG-(GR)60 construct and immunofluorescence analyses wherein rabbit polyclonal α-polyGR antibody was used to stain T98 cells overexpressing 3xFLAG-(GR)60 plasmids. FIG.11C show dot blot analyses of polyGR detected by rat monoclonal polyGR antibody. Total protein control detected by LICOR Revert™ 700 Total Protein Stain Kit. FIGs.12A-12D show an example of a CRISPR deactivated Cas9-based repeat enrichment and detection (dCas9READ) strategy for pulling down repeat expansion mutations. FIG.12A shows a diagram wherein qPCR assays were to measure levels of the CNBP CCTG flanking sequence in dCas9READ enriched DNA samples and a quantification of CNPB flanking sequence levels in dCas9READ enriched DM2 samples (n = 4) compared with DM2 (-) controls (n = 3). FIG.12B shows mapping of Illumina short-read sequencing reads and total repeat counts at the CNBP CCTG locus of dCas9 enriched DM2 (n = 4) and control samples (n = 4). FIG.12C shows representative fragment analysis plots showing the Attorney Docket No. U1202.70128WO00 molecular weight range of DNA fragments enriched in a dCas9READ pulldown assay using 24 GR-encoding repeat sgRNAs. LM: lower marker. FIG.12D shows a summary graph showing fractions of enriched GR repeat loci in intergenic, intronic, and exonic regions. Data represent mean ± SEM. Unpaired two-tailed t-test. ** p < 0.01, **** p < 0.0001. FIGs.13A-13E show GGGAGA·TCTCCC (SEQ ID NO: 10) repeat expansions within SVA retrotransposon elements detected by dCas9READ. FIG.13A shows repeat primed (RP) PCR (RP-PCR) analyses showing an example of negative repeat expansion pattern for (GAGAGG)4 (SEQ ID NO: 24) repeat primer (left) and an example of biallelic CASP8 GGGAGAexp repeat pattern for (GAGAGG)2GAGACG (SEQ ID NO: 15) repeat primer (right) from a homozygous case. FIG.13B show genomic location and RP-PCR patterns of five repeat expansion loci of samples with (+) or without (-) repeat expansion at the specific locus. FIG.13C shows RP-PCR analyses of repeat patterns for genomic DNA (gDNA) samples extracted from blood monocytes or frontal cortex tissue from the same individuals. FIG.13D Diagram showing long-range PCR (LR-PCR) primers used to amplify the CASP8 GGGAGAexp. FIG.13E shows an EtBR gel analysis of LR-PCR products using gDNA extracted from blood monocytes or frontal cortex tissue from three different cases. Cases A and B have ~70 CASP8-GGGAGA repeats. There was no amplified product for Case C, indicating there was no SVA insertion at the CASP8 locus in this case. Normal allele size = 586 bp (~10 GGGAGA repeats (SEQ ID NO: 25)). FIGs.14A-14D show characterization of CASP8 GGGAGAexp by long-read sequencing. FIG.14A shows an example of an approach for long read sequencing of dCas9 enriched DNA samples. FIG.14B shows mapping of PacBio long-read sequencing reads at the CASP8 GGGAGA repeat locus of polyGR(+) AD groups 1 and 2. Purple lines or bars show insertions, orange/red/green/blue lines show single nucleotide polymorphisms (SNPs). FIG.14C shows interruption percentages in the CASP8 GGGAGAexp in 18 long-read sequencing reads from two cognitively normal controls and in 31 long-read sequencing reads from seven AD cases. FIG.14D shows three representative repeat expansion sequences (RE1, RE2, and RE3) of the CASP8 GGGAGAexp detected by long-read sequencing. Interruptions within the repeat region highlighted in red and bold, flanking sequences in bold. FIGs.15A-15F shows analyses of CASP8 RNA transcript levels in CASP8- GGGAGAexp(+) and CASP8- GGGAGAexp(-) AD cases. FIG.15A shows an example of a qRT-PCR strategy to detect CASP8 exon 7-8 and exon 9. FIG.15B shows the levels of Attorney Docket No. U1202.70128WO00 CASP8 exon 7-8 in the frontal cortex tissue from CASP8-GGGAGAexp(+) (n = 3), CASP8- GGGAGAexp (-) (n = 3-4), and normal control cases (n = 2). FIG.15C shows the levels of CASP8 exon 9 in the frontal cortex tissue from CASP8-GGGAGAexp(+) (n = 3), CASP8- GGGAGAexp (-) (n = 3-4), and normal control cases (n = 2). Data represent mean ± SEM. One-way ANOVA Holm-Sidak’s multiple comparisons test. ns p > 0.05. FIG.15D shows a western blot showing caspase-8 levels in CASP8-GGGAGAexp(+) AD, CASP8- GGGAGAexp(-) AD, and controls without AD pathologies. FIG.15E is a plot showing levels of full-length caspase-8 relative to actin. Data represent mean ± SEM. One-way ANOVA Holm-Sidak’s multiple comparisons test. ns p > 0.05, * p < 0.05, ** p < 0.01. FIG. 15F is a plot showing levels of cleaved caspase-8 relative to actin. Data represent mean ± SEM. One-way ANOVA Holm-Sidak’s multiple comparisons test. ns p > 0.05, * p < 0.05, ** p < 0.01. FIGs.16A-16I show RAN translation from CASP8 GGGAGAexp in cultured cells and characterization of C-terminal antibodies. FIG.16A shows examples of constructs containing 100-bp of upstream flanking sequence and three repeat expansions in CASP8 repeat expansion configurations, and 3 tag epitopes corresponding to three reading frames (6XStop-CASP8-RE- 3T: CASP8-hi64-3T, CASP8-i44-3T, CASP8-i64-3T). The upstream flanking sequence contained ATG codons in frame with HA tags. FIG.16B show protein blot analysis of mutant proteins from the CASP8 GGGAGAexp minigenes that were detected in FLAG (upper blot) and HA(AUG) (lower blot) frames in HEK293T cells transfected with 6XStop-CASP8-RE-3T plasmids. FIG.16C show protein blot analysis of mutant proteins from the CASP8 GGGAGAexp minigenes that were detected as being expressed from the FLAG frame in HEK293T cells transfected with 6XStop-CASP8-RE-3T plasmids and treated with thapsigargin and/or metformin. FIG.16D show quantifications from protein blot analysis of mutant proteins from the CASP8 GGGAGAexp minigenes that were detected as being expressed from the FLAG or HA frames in HEK293T cells transfected with 6XStop- CASP8-RE-3T plasmids and treated with thapsigargin and/or metformin. FIG.16E shows LDH and MTT assay analysis of T98 cell viability as a result of transfection and expression of interrupted RAN proteins from 6XStop-CASP8-RE-3T plasmids. FIG.16F shows immunofluorescence (IF) analysis of mutant proteins expressed in all three reading frames (FLAG, HA(AUG), and Myc) in HEK293T cells transfected with 6XStop-CASP8-RE-3T plasmids of all repeat expansion configurations. FIG.16G shows IF analysis using α-CT-f1S Attorney Docket No. U1202.70128WO00 C-terminal antibody that recognizes unique C- terminal sequences in expansion proteins expressed from the CASP8 GGGAGAexp locus. FIG.16H shows IF analysis using α-CT- f3S C-terminal antibody that recognizes unique C- terminal sequences in expansion proteins expressed from the CASP8 GGGAGAexp locus. FIG.16I shows α-polyGR antibody recognizes CASP8 chimeric expansion proteins containing polyGR tracts. The top panel is a diagram showing minigenes containing 100-bp of upstream flanking sequence and three repeat expansions in CASP8 repeat expansion configurations expressing AUG-FLAG tagged CASP8 chimeric polymeric proteins (AUG-FLAG-hi64/i44/i64). The bottom panel shows representative confocal images from double IF experiments showing α-polyGR antibody signal colocalizes with FLAG tag staining in SH-SY5Y transfected with AUG-FLAG- hi64/i44/i64 plasmids. FIGs.17A-17C show IHC staining analyses with α-CT-F3S and α-CT-F1S C- terminal CASP8 locus-specific antibodies in hippocampal and frontal cortex regions from AD and control cases. FIG.17A shows examples of IHC images showing CASP8-RAN-Sf3 protein aggregate staining (red) detected in the hippocampal tissue from CASP8 GGGAGAexp(+) AD, but not in CASP8 GGGAGAexp(-) AD and controls (free of Alzheimer’s pathologic changes). FIG.17B shows examples of IHC detection of CASP8- RAN-Sf3 protein aggregates in frontal cortex gray and white matter regions from CASP8 GGGAGAexp(+) AD cases. FIG.17C shows IHC detection of CASP8-RAN-Sf1 protein aggregates in frontal cortex gray matter region from CASP8 GGGAGAexp(+) AD cases. FIGs.18A-18B show IHC staining analyses with α-CT-f3S antibody in hippocampal regions (HC) from AD and control cases. FIG.18A shows IHC analyses α-CT-F3S staining in CA, Sub, and DG in AD#2 in addition to staining of pre-bleed control. FIG.18B shows additional α-CT-f3S IHC analyses of hippocampal sections from CASP8 GGGAGAexp(+) controls (free of Alzheimer’s pathologic changes). FIG.19 shows co-localization analyses of polyGR and α-CT-f3S antibody staining detected by immunofluorescence. Broader field images indicate polyGR staining partially co- localized with α- CT-f3S antibody staining in frontal cortex of CASP8 GGGAGAexp(+) and polyGR(+) but not in CASP8 GGGAGAexp(-) AD cases. FIGs.20A-20E show effects of stress on translation of CASP8 GGGAGAexp and toxicity of CASP8 GGGAGA repeat expansion in cells. FIG.20A shows an example of western blot analysis results of mutant protein in HA frame expressed from 6XStop-CASP8- Attorney Docket No. U1202.70128WO00 RE-3T (CASP8-i44-3T and CASP8-i64-3T) plasmids in HEK293T cells with or without Thapsigargin (Tg) and with and without metformin (M) treatment (n = 3-4). FIG.20B shows quantification of the data in FIG.20A. FIG.20C shows qRT-PCR analysis of transcript levels of 6XStop-CASP8-RE-3T plasmids in transfected cells treated with Tg or with Tg and metformin (n = 3). FIG.20D shows toxicity of 6XStop-CASP8-RE-3T minigenes in SH- SY5Y cells (n=4). FIG.20E shows toxicity of 6XStop-CASP8-RE-3T minigenes in HEK293T cells (n = 4). Cell survival was measured by LDH assay. Data represent mean ± SEM. One-way ANOVA Holm-Sidak’s multiple comparisons test. ns p > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001. FIGs.21A-21B show analyses of pTau protein in SH-SY5Y cells transfected with FLAG-GR60 or 6XStop-CASP8-RE-3T minigenes. FIG.21A shows IF analyses of endogenous pTau levels at S202 and T205 in polyGR(+) SH-SY5Y cells compared to polyGR(-) SH-SY5Y in cells transfected with FLAG-GR60 minigenes containing an alternative codon DNA sequence expressing AUG-initiated 3xFLAG-GR60 proteins. FIG. 21B shows examples of IF analyses of pTau levels at S202 and T205 in SH-SY5Y cells expressing FLAG/Myc CASP8 RAN polymeric proteins compared with control cells. pTau (S202 and T205) was detected using AT8 antibody. FIG.22 shows IF co-localization analyses of polyGR and human tau proteins in HEK293T cells. FIGs.23A-23B shows long-range PCR of CASP8 GGGAGAexp. FIG.23A shows a schematic diagram showing the primers for long-range PCR (LR-PCR) experiments, the reverse primer is conjugated with FAM fluorophore, which enables down-stream fragment analysis. FIG.23B shows fragment analysis of LR-PCR products of CASP8 GGGAGAexp. Case AD #1 showed two expansion alleles with LR-PCR product size of 919 and 946 bp. Case AD #2 showed a single expanded allele with product size of 946 bp. Case AD #3 showed no expansion alleles. BG: background peaks. DETAILED DESCRIPTION A “RAN protein (e.g., a repeat-associated non-ATG translated protein)” refers to a polypeptide translated from mRNA sequence comprising repeat sequences in the absence of an AUG initiation codon. Repeat sequences in nucleic acids encoding RAN proteins may be referred to as “microsatellite repeats” or “expansion repeats”. Translation of expansion Attorney Docket No. U1202.70128WO00 repeats may produce RAN proteins comprising single amino acid, di-amino acid, tri-amino acid, quad-amino acid, penta-amino acid, hexa-amino acid, hepta-amino acid, octa-amino acid, nona-amino acid, or deca-amino acid repeat sequences which may be referred to “poly- amino acid repeats.” Non-limiting examples of expansion repeats found in a nucleic acid encoding a RAN protein include those encoding poly(GR) RAN proteins (e.g., poly(GGTCGT), poly(GGCCGT), poly(GGACGT), poly(GGGCGT), poly(GGTCGC), poly(GGCCGC), poly(GGACGC), poly(GGGCGC), poly(GGTCGA), poly(GGCCGA), poly(GGACGA), poly(GGGCGA), poly(GGTCGG), poly(GGCCGG), poly(GGACGG), poly(GGGCGG), poly(GGTAGA), poly(GGCAGA), poly(GGAAGA), poly(GGGAGA), poly(GGTAGG), poly(GGCAGG), poly(GGAAGG), and/or poly(GGGAGG) repeats), poly(GA) RAN proteins (e.g., (GGTGCT), poly(GGCGCC), poly(GGAGCA), poly(GGGGCG), poly(GGTGCC), poly(GGCGCA), poly(GGAGCG), poly(GGGGCT), poly(GGTGCA), poly(GGCGCG), poly(GGAGCT), poly(GGGGCC), poly(GGTGCG), poly(GGCGCT), poly(GGAGCC), and/or poly(GGGGCA) repeats), poly(GP) RAN proteins (e.g., poly(GGTCCT), poly(GGCCCC), poly(GGACCA), poly(GGGCCG), poly(GGTCCC), poly(GGCCCA), poly(GGACCG), poly(GGGCCT), poly(GGTCCA), poly(GGCCCG), poly(GGACCT), poly(GGGCCC), poly(GGTCCG), poly(GGCCCT), poly(GGACCC), and/or poly(GGGCCA) repeats), and poly(PR) RAN proteins (e.g., poly(CCTCGT), poly(CCCCGT), poly(CCACGT), poly(CCGCGT), poly(CCTCGC), poly(CCCCGC), poly(CCACGC), poly(CCGCGC), poly(CCTCGA), poly(CCCCGA), poly(CCACGA), poly(CCGCGA), poly(CCTCGG), poly(CCCCGG), poly(CCACGG), poly(CCGCGG), poly(CCTAGA), poly(CCCAGA), poly(CCAAGA), poly(CCGAGA), poly(CCTAGG), poly(CCCAGG), poly(CCAAGG), and/or poly(CCGAGG) repeats). RAN proteins may comprise a plurality of poly-amino acid repeats (e.g., at least 10- 10,000 repeats. RAN proteins comprising poly-amino acid repats may be capable of forming insoluble aggregates inside cells and/or tissues. Without wishing to be bound by any particular theory or belief, expression of RAN proteins comprising about 10 poly-amino acid repeats may not lead to a disease in a subject. However, expression of RAN proteins comprising more than 10 poly-amino acid repeats (e.g., 40 or more) may result a RAN protein-associated disease, for example, a neurological disease, such as a neurodegenerative disease. Attorney Docket No. U1202.70128WO00 The present disclosure relates, at least in part, to the surprising discovery of a novel class of RAN proteins which comprise discontiguous or interrupted poly-amino acid repeat motifs. Aspects of the present disclosure further relate to the surprising discovery that said interrupted poly-amino acid repeat motifs are expressed in certain RAN protein diseases. In some embodiments, the present disclosure provides for methods of identifying a subject as having a RAN protein disease and/or treating a subject having or suspected of having a RAN- protein associated disease. In some embodiments, methods described herein comprise detecting one or more interrupted RAN proteins in a subject. In some embodiments, methods described herein comprise administering to the subject one or more anti-RAN protein agents. Interrupted RAN Proteins In some embodiments, an interrupted RAN protein or a discontiguous RAN protein is a RAN protein comprising a plurality of repeat units, wherein each repeat unit of the plurality is separated by one or more amino acids. In some embodiments, repeat units, repeat motifs, or RAN repeats refers to poly-amino acid repeats (e.g., poly(GA) or poly(GR)) and/or sequences comprising amino acids which are of the same sequence as the poly-amino acid repeats but are not contiguous (e.g., (GA) or (GR), (LPAC) (SEQ ID NO: 31), etc.). In some embodiments (e.g., with reference to nucleic acid sequences, such as DNA or RNA transcripts), repeat motifs, repeat units, and RAN repeats may be referred to as nucleotidic expansions in the nucleic acids (e.g., DNA, such as genomic DNA, and RNA, such as mRNA) encoding interrupted RAN proteins. In some embodiments, an interrupted RAN protein comprises an amino acid sequence, wherein less than 100% of the amino acid sequence comprises repeat units. As non-limiting examples, an interrupted RAN protein comprising GAGAGAFGAGA (SEQ ID NO: 32), GAGAGAFGADGAGA (SEQ ID NO: 33), or GRGRGRFGRVYGRRKDGRGR (SEQ ID NO: 34) would have 90.9% (10 out of 11 residues are comprised in repeat units), 85.7% (12 out of 14 residues are comprised in repeat units), or 30% (6 out of 20 residues are comprised in repeat units) of its sequence comprising repeat units, respectively. In some embodiments, an interrupted RAN protein comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, Attorney Docket No. U1202.70128WO00 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted RAN protein comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted RAN protein comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.). However, in some embodiments, an interrupted RAN protein comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units). In some embodiments, an interrupted RAN protein comprises at least 2 repeat units. In some embodiments, an interrupted RAN protein may comprise between about 2 and about 10,000 repeat units. In some embodiments, an interrupted RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000- 1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500- 4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, or 9000-10000 repeat units. In some embodiments, an interrupted RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 repeat units. In some embodiments, repeat units comprise one or more amino acids residues in length. In some embodiments, repeat units comprise at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or at least 200 amino acid residues in length. In some embodiments, repeat units are 2-10,000 amino acid residues in length. In some embodiments, repeat units comprise between 2 and 500, between 20 and 300, between 30 and 200, between 40 and 100, between 50 and 90, or between 60 and 80 amino acid residues in length. In some embodiments, repeat units comprise more than 200 amino acid residues (e.g., 250, 500, 1000, 5000, 10,000, etc.) in length. In some embodiments, an interrupted RAN protein comprises a Attorney Docket No. U1202.70128WO00 plurality of repeat units comprising the same length and/or a plurality of repeat units comprising different lengths. In some embodiment, repeat units comprise single amino acid, di-amino acid, tri- amino acid, or quad-amino acid (e.g., tetra-amino acid) sequences. In some embodiments, repeat units comprise (PR), (GR), (S), (CP), (GP), (G), (A), (GA), (GD), (GE), (GQ), (GT), (L), (LP), (LPAC) (SEQ ID NO: 31), (LS), (P), (PA), (QAGR) (SEQ ID NO: 35), (RE), (SP), (VP), (FP), (GK), (FTPLSLPV) (SEQ ID NO: 36), (LLPSPSRC) (SEQ ID NO: 37), (YSPLPPGV) (SEQ ID NO: 38), (HREGEGSK) (SEQ ID NO: 39), (TGRERGVN) (SEQ ID NO: 40), (PGGRGE) (SEQ ID NO: 41), (GRQRGVNT) (SEQ ID NO: 42), or (GSKHREAE) (SEQ ID NO: 43). In some embodiments, repeat units comprise at least two poly-amino acid repeats. In some embodiments, repeat units comprise between about 2-10,000 poly-amino acid repeats. In some embodiments, repeat units comprise 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200- 1300, 1300-1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500- 5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, or 9000-10000 poly-amino acids repeats. In some embodiments, repeat units comprise between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly-amino acid repeats. In some embodiments, repeat units comprise poly(Proline-Arginine) [poly(PR)], poly(Glycine- Arginine) [poly(GR)], poly(Serine) [poly(Ser)], poly(Cysteine-Proline) [poly(CP)], poly(Glycine-Proline) [(poly(GP)], poly(Glycine) [poly(G)], poly(Ala) [polyAla], poly(Glycine-Alanine) [poly(GA)], poly(Glycine-Aspartate) [poly(GD)], poly(Glycine- Glutamate) [poly(GE)], poly(Glycine-Glutamine) [poly(GQ)], poly(Glycine-Threonine) [poly(GT)], poly(Leucine) [polyLeu], poly(Leucine-Proline) [poly(LP)], poly(Leucine- Proline-Alanine-Cysteine) [poly(LPAC)] (SEQ ID NO: 31), poly(Leucine-Serine) [poly(LS)], poly(Proline) [poly(P)], poly(Proline-Alanine) [poly(PA)], poly(Glutamine- Alanine-Glycine-Arginine) [poly(QAGR)] (SEQ ID NO: 35), poly(Arginine-Glutamate) [poly(RE)], poly(Serine-Proline) [poly(SP)], poly(Valine-Proline) [poly(VP)], poly(phenylalanine-proline) [poly(FP)], poly(glycine-lysine) [poly(GK)], poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), Attorney Docket No. U1202.70128WO00 poly(PGGRGE) (SEQ ID NO: 41), poly(GRQRGVNT) (SEQ ID NO: 42), or poly(GSKHREAE) (SEQ ID NO: 43) repeats. In some embodiments, repeat units are separated by one or more amino acid residues (e.g., non-repeating amino acids). In some embodiments, repeat units are separated by a plurality of amino acids (e.g., non-repeating amino acids). In some embodiments, repeat units are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acids. In some embodiments, repeat units are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, repeat units are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.). In some embodiments, repeat units are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.). In some embodiments, repeat units comprising poly-amino acid repeats are separated by a plurality of amino acids comprising one or more repeat units. In some embodiments, the plurality of amino acids comprises 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30- 50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-1000 repeat units. In some embodiments, the one or more repeat units in the plurality of amino acids comprise amino acids that are not contiguous. In some embodiments, the plurality of amino acids comprise one or more (PR), (GR), (S), (CP), (GP), (G), (A), (GA), (GD), (GE), (GQ), (GT), (L), (LP), (LPAC) (SEQ ID NO: 31), (LS), (P), (PA), (QAGR) (SEQ ID NO: 35), (RE), (SP), (VP), (FP), (GK), (FTPLSLPV) (SEQ ID NO: 36), (LLPSPSRC) (SEQ ID NO: 37), (YSPLPPGV) (SEQ ID NO: 38), (HREGEGSK) (SEQ ID NO: 39), (TGRERGVN) (SEQ ID NO: 40), (PGGRGE) (SEQ ID NO: 41), (GRQRGVNT) (SEQ ID NO: 42), or (GSKHREAE) (SEQ ID NO: 43) repeat units that are not contiguous. In some embodiments, an interrupted RAN protein comprises one or more of the following RAN repeat units: (PR), (GR), (S), (CP), (GP), (G), (A), (GA), (GD), (GE), (GQ), (GT), (L), (LP), (LPAC) (SEQ ID NO: 31), (LS), (P), (PA), (QAGR) (SEQ ID NO: 35), (RE), (SP), (VP), (FP), (GK), (FTPLSLPV) (SEQ ID NO: 36), (LLPSPSRC) (SEQ ID NO: 37), (YSPLPPGV) (SEQ ID NO: 38), (HREGEGSK) (SEQ ID NO: 39), (TGRERGVN) Attorney Docket No. U1202.70128WO00 (SEQ ID NO: 40), (PGGRGE) (SEQ ID NO: 41), (GRQRGVNT) (SEQ ID NO: 42), or (GSKHREAE) (SEQ ID NO: 43). In some embodiments, an interrupted RAN protein comprises an amino acid sequence, wherein less 100% of the amino acid sequence comprises the RAN repeat units. In some embodiments, an interrupted RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted RAN comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.). However, in some embodiments, an interrupted RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units). In some embodiments, an interrupted RAN protein comprises at least two RAN repeats. In some embodiments, a repeat unit in an interrupted RAN protein comprises between about 2 and about 10,000 RAN repeats. In some embodiments, a repeat unit in an interrupted RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300- 1400, 1400-1500, 1500-1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000- 6000, 6000-7000, 7000-8000, 8000-9000, or 9000-10000 RAN repeats. In some embodiments, a repeat unit in an interrupted RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 RAN repeats. In some embodiments, repeat units comprising RAN repeats are separated by a plurality of amino acids comprising one or more RAN repeat units, wherein the one or more RAN repeat units are not contiguous (e.g., separated by one or more amino acids). In some embodiments, Attorney Docket No. U1202.70128WO00 repeat units comprising RAN repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500- 1000, 1000-5000, or 5000-10000 RAN repeat units. In some embodiments, repeat units comprising RAN repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) RAN repeat units. In some embodiments, each of the one or more RAN repeat units between repeat units comprising RAN repeats are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more RAN repeat units are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.). In some embodiments, each of the one or more RAN repeat units are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100). In some embodiments, each of the one or more RAN repeat units are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.). In some embodiments, an interrupted RAN protein is an interrupted poly(GR) protein. In some embodiments, an interrupted poly(GR) RAN protein comprises an amino acid sequence, wherein less 100% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GR) RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GR) RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GR) RAN comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises Attorney Docket No. U1202.70128WO00 repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.). However, in some embodiments, an interrupted poly(GR) RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units). In some embodiments, an interrupted poly(GR) RAN protein comprises at least two poly(GR) repeats. In some embodiments, a repeat unit in an interrupted poly(GR) RAN protein comprises between about 2 and about 10,000 poly(GR) repeats. In some embodiments, a repeat unit in an interrupted poly(GR) RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600- 1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000-8000, 8000- 9000, or 9000-10000 poly(GR) repeats. In some embodiments, a repeat unit in an interrupted poly(GR) RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly(GR) repeats. In some embodiments, repeat units comprising poly(GR) repeats are separated by a plurality of amino acids comprising one or more (GR) repeat units, wherein the one or more (GR) repeat units are not contiguous (e.g., separated by one or more amino acids). In some embodiments, repeat units comprising poly(GR) repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-10000 (GR) repeat units. In some embodiments, repeat units comprising poly(GR) repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) (GR) repeat units. In some embodiments, each of the one or more (GR) repeat units between repeat units comprising poly(GR) are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more (GR) repeat units between repeat units comprising poly(GR) are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.). In some embodiments, each of the one or more (GR) repeat units between repeat units comprising poly(GR) are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, Attorney Docket No. U1202.70128WO00 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100). In some embodiments, each of the one or more (GR) repeat units between repeat units comprising poly(GR) are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.). In some embodiments, an interrupted RAN protein is an interrupted poly(GA) protein. In some embodiments, an interrupted poly(GA) RAN protein comprises an amino acid sequence, wherein less than 100% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GA) RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GA) RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GA) RAN comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.). However, in some embodiments, an interrupted poly(GA) RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units). In some embodiments, an interrupted poly(GA) RAN protein comprises at least two poly(GA) repeats. In some embodiments, a repeat unit in an interrupted poly(GA) RAN protein comprises between about 2 and about 10,000 poly(GA) repeats. In some embodiments, a repeat unit in an interrupted poly(GA) RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700- 800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500- 1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000- 8000, 8000-9000, or 9000-10000 poly(GA) repeats. In some embodiments, a repeat unit in an Attorney Docket No. U1202.70128WO00 interrupted poly(GA) RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly(GA) repeats. In some embodiments, repeat units comprising poly(GA) repeats are separated by a plurality of amino acids comprising one or more (GA) repeat units, wherein the one or more (GA) repeat units are not contiguous (e.g., separated by one or more amino acids). In some embodiments, repeat units comprising poly(GA) repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-10000 (GA) repeat units. In some embodiments, repeat units comprising poly(GA) repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) (GA) repeat units. In some embodiments, each of the one or more (GA) repeat units between repeat units comprising poly(GA) are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more (GA) repeat units between repeat units comprising poly(GA) are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.). In some embodiments, each of the one or more (GA) repeat units between repeat units comprising poly(GA) are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100). In some embodiments, each of the one or more (GA) repeat units between repeat units comprising poly(GA) are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.). In some embodiments, an interrupted RAN protein is an interrupted poly(GP) protein. In some embodiments, an interrupted poly(GP) RAN protein comprises an amino acid sequence, wherein less than 100% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GP) RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, Attorney Docket No. U1202.70128WO00 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GP) RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(GP) RAN comprises an amino acid sequence, wherein 50-99% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.). However, in some embodiments, an interrupted poly(GP) RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units). In some embodiments, an interrupted poly(GP) RAN protein comprises at least two poly(GP) repeats. In some embodiments, a repeat unit in an interrupted poly(GP) RAN protein comprises between about 2 and about 10,000 poly(GP) repeats. In some embodiments, a repeat unit in an interrupted poly(GP) RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700- 800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500- 1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000- 8000, 8000-9000, or 9000-10000 poly(GP) repeats. In some embodiments, a repeat unit in an interrupted poly(GP) RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly(GP) repeats. In some embodiments, repeat units comprising poly(GP) repeats are separated by a plurality of amino acids comprising one or more (GP) repeat units, wherein the one or more (GP) repeat units are not contiguous (e.g., separated by one or more amino acids). In some embodiments, repeat units comprising poly(GP) repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-10000 (GP) repeat units. In some embodiments, repeat units comprising poly(GP) repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) (GP) repeat units. In some embodiments, each of the one or more (GP) repeat units between repeat units comprising poly(GP) are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more (GP) repeat units between Attorney Docket No. U1202.70128WO00 repeat units comprising poly(GP) are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.). In some embodiments, each of the one or more (GP) repeat units between repeat units comprising poly(GP) are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100). In some embodiments, each of the one or more (GP) repeat units between repeat units comprising poly(GP) are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.). In some embodiments, an interrupted RAN protein is an interrupted poly(PR) protein. In some embodiments, an interrupted poly(PR) RAN protein comprises an amino acid sequence, wherein less than 100% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(PR) RAN comprises an amino acid sequence, wherein about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(PR) RAN comprises an amino acid sequence, wherein between 10% and 50% (e.g., 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, etc.) of the amino acid sequence comprises repeat units. In some embodiments, an interrupted poly(PR) RAN comprises an amino acid sequence, wherein 50-99%% of the amino acid sequence comprises repeat units (e.g., 51-55%, 55-60%, 60-70%, 70-80%, etc.). However, in some embodiments, an interrupted poly(PR) RAN comprises an amino acid sequence wherein less than 1% (e.g., about 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8% or 0.9%) comprises repeat units (e.g., a RAN protein comprising 10,000 amino acids, wherein less than 100 of the 10,000 amino acids are comprised in repeat units). In some embodiments, an interrupted poly(PR) RAN protein comprises at least two poly(PR) repeats. In some embodiments, a repeat unit in an interrupted poly(PR) RAN protein comprises between about 2 and about Attorney Docket No. U1202.70128WO00 10,000 poly(PR) repeats. In some embodiments, a repeat unit in an interrupted poly(PR) RAN protein comprises 3-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700- 800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500- 1600, 1600-1700, 1700-1800, 1800-1900, 2000-2200, 2200-2400, 2400-2600, 2600-2800, 2800-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-6000, 6000-7000, 7000- 8000, 8000-9000, or 9000-10000 poly(PR) repeats. In some embodiments, a repeat unit in an interrupted poly(PR) RAN protein comprises between 20 and 100, 50 and 200, 100 and 500, 400 and 800, 700 and 1000, or 800 and 1500 poly(PR) repeats. In some embodiments, repeat units comprising poly(PR) repeats are separated by a plurality of amino acids comprising one or more (PR) repeat units, wherein the one or more (PR) repeat units are not contiguous (e.g., separated by one or more amino acids). In some embodiments, repeat units comprising poly(PR) repeats are separated by a plurality of amino acids comprising 1, 2, 3, 4, 5, 6-10, 10-14, 14-18, 18-22, 22-26, 26-30, 30-50, 50-100, 100-250, 250-500, 500-1000, 1000-5000, or 5000-10000 (PR) repeat units. In some embodiments, repeat units comprising poly(PR) repeats are separated by a plurality of amino acids comprising 2-20 (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) (PR) repeat units. In some embodiments, each of the one or more (PR) repeat units between repeat units comprising poly(PR) are separated by about 2-20 amino acid residues (e.g.2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids). In some embodiments, each of the one or more (PR) repeat units between repeat units comprising poly(PR) are separated by more than 20 amino acid residues (e.g., 21-25, 25-30, 30-40, 40-50, etc.). In some embodiments, each of the one or more (PR) repeat units between repeat units comprising poly(PR) are separated by about 2-100 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100). In some embodiments, each of the one or more (PR) repeat units between repeat units comprising poly(PR) are separated by more than 100 amino acids (e.g., 101-150, 150-200, 200-300, 300-400, etc.). Nucleic Acids Encoding Interrupted RAN Proteins Attorney Docket No. U1202.70128WO00 Aspects of the present disclosure also relate to nucleic acids encoding RAN proteins (e.g., interrupted RAN proteins) described herein. In some embodiments, a nucleic acid encoding an interrupted RAN protein comprises DNA. In some embodiments, a DNA encoding an interrupted RAN protein may be transcribed to produce an RNA (e.g., an RNA comprising expansion repeat units). In some embodiments, a nucleic acid encoding an interrupted RAN protein comprises RNA. In some embodiments, an RNA encoding an interrupted RAN protein is an mRNA. In some embodiments, an RNA encoding an interrupted RAN protein may be translated (e.g., inside a cell, such as a cell in a subject) to produce the interrupted RAN protein. In some embodiments, a nucleic acid encoding an interrupted RAN protein further comprises one or more non-coding sequences. In some embodiments, a nucleic acid encoding an interrupted RAN protein further comprises one or more regulatory sequences (e.g., enhancers, promoters, transcription start/stop sites, polyA signals, etc.). In some embodiments, the one or more regulatory sequences are operably linked to the sequence encoding the interrupted RAN protein (e.g., linked in a manner that is capable of controlling the expression level of the interrupted RAN protein). In some embodiments, a nucleic acid encoding an interrupted RAN protein comprises at least one of (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCG)x, (GGTGCC)x, (GGCGCA)x, (GGAGCG)x, (GGGGCT)x, (GGTGCA)x, (GGCGCG)x, (GGAGCT)x, (GGGGCC)x, (GGTGCG)x, (GGCGCT)x, (GGAGCC)x, (GGGGCA)x, (GGTCCT)x, (GGCCCC)x, (GGACCA)x, (GGGCCG)x, (GGTCCC)x, (GGCCCA)x, (GGACCG)x, (GGGCCT)x, (GGTCCA)x, (GGCCCG)x, (GGACCT)x, (GGGCCC)x, (GGTCCG)x, (GGCCCT)x, (GGACCC)x, (GGGCCA)x, (CCTCGT)x, (CCCCGT)x, (CCACGT)x, (CCGCGT)x, (CCTCGC)x, (CCCCGC)x, (CCACGC)x, (CCGCGC)x, (CCTCGA)x, (CCCCGA)x, (CCACGA)x, (CCGCGA)x, (CCTCGG)x, (CCCCGG)x, (CCACGG)x, (CCGCGG)x, (CCTAGA)x, (CCCAGA)x, (CCAAGA)x, (CCGAGA)x, (CCTAGG)x, (CCCAGG)x, (CCAAGG)x, (CCGAGG)x, (CCTG)x, (TCT)x, (TCC)x, (TCA)x, (TCG)x, (AGT)x, and/or (AGC)x, wherein “x” represents the number of repeat units present in the nucleic acid (e.g., a nucleic acid corresponding to a gene, a chromosomal locus, and/or an Attorney Docket No. U1202.70128WO00 RNA, such as an mRNA). In some embodiments, “x” comprises an integer between 2 and 200. In some embodiments, “x” comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, “x” is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some embodiments, “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000. In some embodiments, a nucleic acid encoding interrupted RAN proteins comprise one or more nucleotides between expansion repeat units. In some embodiments, the one or more nucleotides between expansion repeat units may comprise non-naturally occurring sequences (e.g., synthetic sequences, such as those not normally found in a gene). In some embodiments, the one or more nucleotides between expansion repeat units may comprise sequences corresponding to a protein coding region of a gene (e.g., exonic regions). In some embodiments, the one or more nucleotides between expansion repeat units may comprise sequences corresponding to non-coding regions of a gene or a chromosomal locus (e.g., intronic regions, untranslated regions such as 5’UTR or 3’UTR, etc.). In some embodiments, the one or more nucleotides between expansion repeat units may comprise sequences corresponding to intergenic regions (e.g., nucleic acid sequences positioned between genes on a chromosome). In some embodiments, a nucleic acid encoding an interrupted RAN protein comprises one or more nucleotides between expansion repeat units corresponding to a gene associated with a disease (e.g., a neurological disease). In some embodiments, the gene is associated with a disease, such as amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Attorney Docket No. U1202.70128WO00 Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuch’s Corneal Dystrophy. In some embodiments, “a gene associated with amyotrophic lateral sclerosis” (ALS) is C9ORF72. In some embodiments, “a gene associated with frontotemporal dementia” (FTD) is C9ORF72. In some embodiments, “a gene associated with Alzheimer’s disease” (AD) is APP, PSEN1, PSEN2, MAPT, or CASP8. In some embodiments, “a gene associated with Fragile X Syndrome” (FRAXA) is FMR1. In some embodiments, “a gene associated with Spinal Bulbar Muscular Atrophy” (SBMA) is AR. In some embodiments, “a gene associated with Dentatorubropallidoluysian Atrophy” (DRPLA) is ATN1. In some embodiments, “a gene associated with Spinocerebellar Ataxia 1” (SCA1) is ATXN1. In some embodiments, “a gene associated with Spinocerebellar Ataxia 2” (SCA2) is ATXN2. In some embodiments, “a gene associated with Spinocerebellar Ataxia 3” (SCA3) is ATXN3. In some embodiments, “a gene associated with Spinocerebellar Ataxia 6” (SCA6) CACNA1A. In some embodiments, “a gene associated with Spinocerebellar Ataxia 7” (SCA7) is ATXN7. In some embodiments, “a gene associated with Spinocerebellar Ataxia 8” (SCA8) is ATXN8 or ATXN8OS. In some embodiments, “a gene associated with Spinocerebellar Ataxia 12” (SCA12) is PPP2R2B. In some embodiments, “a gene associated with or Spinocerebellar Ataxia 17” (SCA17) is TBP. In some embodiments, “a gene associated with Spinocerebellar ataxia type 36” (SCA36) is NOP56. In some embodiments, “a gene associated with Spinocerebellar ataxia type 29” (SCA29) is ITPR1. In some embodiments, “a gene associated with Spinocerebellar ataxia type 10” (SCA10) is ATXN10. In some embodiments, “a gene associated with myotonic dystrophy type 1” (DM1) is DMPK. In some embodiments, “a gene associated with myotonic dystrophy type 2” (DM2) is CNBP. In some embodiments, “a gene associated with Fuch’s Corneal Dystrophy” is TCF4 (e.g., a TCF4 gene comprising the CTG18.1 repeat expansion). Attorney Docket No. U1202.70128WO00 In some embodiments, a nucleic acid encoding an interrupted RAN protein is comprised in a genome (e.g., a human genome) at one or multiple loci. In some embodiments, a nucleic acid encoding an interrupted RAN protein is comprised a gene or chromosomal locus set forth in Table 1 or Table 6. In some embodiments, a nucleic acid encoding an interrupted RAN protein is comprised in a gene selected from a list consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, CXADRP3, LINC00668, MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1-124K5.11, ABCB4, MFSD3, SOX17, MTDH, RRS1-AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5-8SN5, Attorney Docket No. U1202.70128WO00 SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, a nucleic acid encoding an interrupted RAN protein comprises a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the nucleic acid comprises a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F). In some embodiments, a gene or chromosomal locus encoding an interrupted RAN protein comprises at least one mutation relative to a wild-type counterpart of the gene. In some embodiments, the at least one mutation comprises an insertion, a substitution, a deletion, or a combination thereof. In some embodiments, the at least one mutation comprises one or more repeat units. In some embodiments, the at least one mutation comprises at least one of (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCG)x, (GGTGCC)x, (GGCGCA)x, (GGAGCG)x, (GGGGCT)x, (GGTGCA)x, (GGCGCG)x, (GGAGCT)x, (GGGGCC)x, (GGTGCG)x, (GGCGCT)x, (GGAGCC)x, (GGGGCA)x, (GGTCCT)x, (GGCCCC)x, (GGACCA)x, (GGGCCG)x, (GGTCCC)x, (GGCCCA)x, (GGACCG)x, (GGGCCT)x, (GGTCCA)x, (GGCCCG)x, (GGACCT)x, (GGGCCC)x, (GGTCCG)x, (GGCCCT)x, (GGACCC)x, (GGGCCA)x, (CCTCGT)x, (CCCCGT)x, (CCACGT)x, (CCGCGT)x, (CCTCGC)x, (CCCCGC)x, (CCACGC)x, (CCGCGC)x, (CCTCGA)x, (CCCCGA)x, (CCACGA)x, (CCGCGA)x, (CCTCGG)x, (CCCCGG)x, (CCACGG)x, (CCGCGG)x, (CCTAGA)x, (CCCAGA)x, (CCAAGA)x, (CCGAGA)x, (CCTAGG)x, (CCCAGG)x, (CCAAGG)x, (CCGAGG)x, (CCTG)x, (TCT)x, (TCC)x, (TCA)x, (TCG)x, (AGT)x, and/or (AGC)x, wherein “x” represents the number of repeat units present in the gene or chromosomal locus. In some embodiments, “x” comprises an integer between 2 and 200. In some embodiments, “x” comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, “x” is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, Attorney Docket No. U1202.70128WO00 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some embodiments, “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300- 400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000. In some embodiments, a nucleic acid comprises a sequence encoding an interrupted poly(GR) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GR) RAN protein comprises a plurality of (GGTCGT), (GGCCGT), (GGACGT), (GGGCGT), (GGTCGC), (GGCCGC), GGACGC), (GGGCGC), (GGTCGA), (GGCCGA), (GGACGA), (GGGCGA), (GGTCGG), (GGCCGG), (GGACGG), (GGGCGG), (GGTAGA), (GGCAGA), (GGAAGA), (GGGAGA), (GGTAGG), (GGCAGG), (GGAAGG), and/or (GGGAGG) repeat units. In some embodiments, a nucleic acid encoding an interrupted poly(GR) RAN protein comprises one or more repeat units comprising poly(GGTCGT), poly(GGCCGT), poly(GGACGT), poly(GGGCGT), poly(GGTCGC), poly(GGCCGC), poly(GGACGC), poly(GGGCGC), poly(GGTCGA), poly(GGCCGA), poly(GGACGA), poly(GGGCGA), poly(GGTCGG), poly(GGCCGG), poly(GGACGG), poly(GGGCGG), poly(GGTAGA), poly(GGCAGA), poly(GGAAGA), poly(GGGAGA), poly(GGTAGG), poly(GGCAGG), poly(GGAAGG), and/or poly(GGGAGG) expansion repeats. In some embodiments, a nucleic acid encoding an interrupted poly(GR) RAN protein is comprised in a gene associated with a disease described herein (e.g., a neurological disease). In some embodiments, a nucleic acid encoding an interrupted poly(GR) RAN protein is comprised in a CASP8 gene. In some embodiments, a CASP8 gene (e.g., a mutated CASP8) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GR) RAN protein. In some embodiments, the CASP8 RNA is mRNA which is translated to produce the poly(GR) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GR) RAN protein is comprised in a ARMCX4 gene. In some embodiments, a ARMCX4 gene (e.g., a mutated ARMCX4) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GR) RAN protein. In some Attorney Docket No. U1202.70128WO00 embodiments, the ARMCX4 RNA is mRNA which is translated to produce the poly(GR) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GR) RAN protein is comprised in a ALK gene. In some embodiments, a ALK gene (e.g., a mutated ALK) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GR) RAN protein. In some embodiments, the ALK RNA is mRNA which is translated to produce the poly(GR) RAN protein. In some embodiments, a nucleic acid comprises a sequence encoding an interrupted poly(GA) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GA) RAN protein comprises a plurality of (GGTGCT), (GGCGCC), (GGAGCA), (GGGGCG), (GGTGCC), (GGCGCA), (GGAGCG), (GGGGCT), (GGTGCA), (GGCGCG), (GGAGCT), (GGGGCC), (GGTGCG), (GGCGCT), (GGAGCC), and/or (GGGGCA) repeat units. In some embodiments, a nucleic acid encoding an interrupted poly(GA) RAN protein comprises one or more repeat units comprising poly(GGTGCT), poly(GGCGCC), poly(GGAGCA), poly(GGGGCG), poly(GGTGCC), poly(GGCGCA), poly(GGAGCG), poly(GGGGCT), poly(GGTGCA), poly(GGCGCG), poly(GGAGCT), poly(GGGGCC), poly(GGTGCG), poly(GGCGCT), poly(GGAGCC), and/or poly(GGGGCA) expansion repeats. In some embodiments, a nucleic acid encoding an interrupted poly(GA) RAN protein is comprised in a gene associated with a disease described herein (e.g., a neurological disease). In some embodiments, a nucleic acid encoding an interrupted poly(GA) RAN protein is comprised in a CASP8 gene. In some embodiments, a CASP8 gene (e.g., a mutated CASP8) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GA) RAN protein. In some embodiments, the CASP8 RNA is mRNA which is translated to produce the poly(GA) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GA) RAN protein is comprised in a ARMCX4 gene. In some embodiments, a ARMCX4 gene (e.g., a mutated ARMCX4) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GA) RAN protein. In some embodiments, the ARMCX4 RNA is mRNA which is translated to produce the poly(GA) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GA) RAN protein is comprised in a ALK gene. In some embodiments, a ALK gene (e.g., a mutated ALK) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GA) RAN protein. In some embodiments, the ALK RNA is mRNA which is translated to produce the poly(GA) RAN protein. Attorney Docket No. U1202.70128WO00 In some embodiments, a nucleic acid comprises a sequence encoding an interrupted poly(GP) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GP) RAN protein comprises a plurality of (GGTCCT), (GGCCCC), (GGACCA), (GGGCCG), (GGTCCC), (GGCCCA), (GGACCG), (GGGCCT), (GGTCCA), (GGCCCG), (GGACCT), (GGGCCC), (GGTCCG), (GGCCCT), (GGACCC), and/or (GGGCCA) repeat units. In some embodiments, a nucleic acid encoding an interrupted poly(GP) RAN protein comprises one or more repeat units comprising poly(GGTCCT), poly(GGCCCC), poly(GGACCA), poly(GGGCCG), poly(GGTCCC), poly(GGCCCA), poly(GGACCG), poly(GGGCCT), poly(GGTCCA), poly(GGCCCG), poly(GGACCT), poly(GGGCCC), poly(GGTCCG), poly(GGCCCT), poly(GGACCC), and/or poly(GGGCCA) expansion repeats. In some embodiments, a nucleic acid encoding an interrupted poly(GP) RAN protein is comprised in a gene associated with a disease described herein (e.g., a neurological disease). In some embodiments, a nucleic acid encoding an interrupted poly(GP) RAN protein is comprised in a CASP8 gene. In some embodiments, a CASP8 gene (e.g., a mutated CASP8) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GP) RAN protein. In some embodiments, the CASP8 RNA is mRNA which is translated to produce the poly(GP) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GP) RAN protein is comprised in a ARMCX4 gene. In some embodiments, a ARMCX4 gene (e.g., a mutated ARMCX4) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GP) RAN protein. In some embodiments, the ARMCX4 RNA is mRNA which is translated to produce the poly(GP) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(GP) RAN protein is comprised in a ALK gene. In some embodiments, a ALK gene (e.g., a mutated ALK) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(GP) RAN protein. In some embodiments, the ALK RNA is mRNA which is translated to produce the poly(GP) RAN protein. In some embodiments, a nucleic acid comprises a sequence encoding an interrupted poly(PR) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(PR) RAN protein comprises a plurality of (CCTCGT), (CCCCGT), (CCACGT), (CCGCGT), (CCTCGC), (CCCCGC), (CCACGC), (CCGCGC), (CCTCGA), (CCCCGA), (CCACGA), (CCGCGA), (CCTCGG), (CCCCGG), (CCACGG), (CCGCGG), (CCTAGA), (CCCAGA), (CCAAGA), (CCGAGA), (CCTAGG), (CCCAGG), (CCAAGG), and/or Attorney Docket No. U1202.70128WO00 (CCGAGG) repeat units. In some embodiments, a nucleic acid encoding an interrupted poly(PR) RAN protein comprises one or more repeat units comprising poly(CCTCGT), poly(CCCCGT), poly(CCACGT), poly(CCGCGT), poly(CCTCGC), poly(CCCCGC), poly(CCACGC), poly(CCGCGC), poly(CCTCGA), poly(CCCCGA), poly(CCACGA), poly(CCGCGA), poly(CCTCGG), poly(CCCCGG), poly(CCACGG), poly(CCGCGG), poly(CCTAGA), poly(CCCAGA), poly(CCAAGA), poly(CCGAGA), poly(CCTAGG), poly(CCCAGG), poly(CCAAGG), and/or poly(CCGAGG) expansion repeats. In some embodiments, a nucleic acid encoding an interrupted poly(PR) RAN protein is comprised in a gene associated with a disease described herein (e.g., a neurological disease). In some embodiments, a nucleic acid encoding an interrupted poly(PR) RAN protein is comprised in a CASP8 gene. In some embodiments, a CASP8 gene (e.g., a mutated CASP8) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(PR) RAN protein. In some embodiments, the CASP8 RNA is mRNA which is translated to produce the poly(PR) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(PR) RAN protein is comprised in a ARMCX4 gene. In some embodiments, a ARMCX4 gene (e.g., a mutated ARMCX4) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(PR) RAN protein. In some embodiments, the ARMCX4 RNA is mRNA which is translated to produce the poly(PR) RAN protein. In some embodiments, a nucleic acid encoding an interrupted poly(PR) RAN protein is comprised in a ALK gene. In some embodiments, a ALK gene (e.g., a mutated ALK) may be transcribed to produce an RNA (e.g., an mRNA) encoding an interrupted poly(PR) RAN protein. In some embodiments, the ALK RNA is mRNA which is translated to produce the poly(PR) RAN protein. Diseases Associated with RAN Proteins A “subject having or suspected of having a disease (e.g., neurological diseases) associated with RAN protein expression, translation, and/or accumulation” generally refers to a subject exhibiting one or more signs and symptoms of a disease (e.g., a neurological disease, such as a neurodegenerative disease). In some embodiments, the signs and symptoms include, but are not limited to, memory deficit (e.g., short term memory loss), confusion, deficiencies of executive functions (e.g., attention, planning, flexibility, abstract thinking, etc.), loss of speech, degeneration or loss of motor skills, etc., or a subject having or being Attorney Docket No. U1202.70128WO00 identified as having one or more genetic mutations associated with RAN protein expression, translation, and/or accumulation. However, in some embodiments, a subject having or suspected of having a disease (e.g., neurological diseases) associated with RAN protein expression, translation, and/or accumulation may be a subject with a familial history of a disease (e.g., a neurological disease, such as a neurodegenerative disease), such as a subject that is suspected to be, expected to be, or presumed to be at greater risk for developing said disease. In some embodiments, a subject can be a mammal (e.g., human, mouse, rat, dog, cat, or pig). In some embodiments, a subject is a non-human animal, for example a mouse, rat, guinea pig, cat, dog, horse, camel, etc. In some embodiments, the subject is a human. In some embodiments, a subject having or suspected of having a disease (e.g., neurological diseases) associated with RAN protein expression, translation, and/or accumulation is characterized as having a mutation in a gene or a chromosomal locus described herein. In some embodiments, the mutation comprises (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCG)x, (GGTGCC)x, (GGCGCA)x, (GGAGCG)x, (GGGGCT)x, (GGTGCA)x, (GGCGCG)x, (GGAGCT)x, (GGGGCC)x, (GGTGCG)x, (GGCGCT)x, (GGAGCC)x, (GGGGCA)x, (GGTCCT)x, (GGCCCC)x, (GGACCA)x, (GGGCCG)x, (GGTCCC)x, (GGCCCA)x, (GGACCG)x, (GGGCCT)x, (GGTCCA)x, (GGCCCG)x, (GGACCT)x, (GGGCCC)x, (GGTCCG)x, (GGCCCT)x, (GGACCC)x, (GGGCCA)x, (CCTCGT)x, (CCCCGT)x, (CCACGT)x, (CCGCGT)x, (CCTCGC)x, (CCCCGC)x, (CCACGC)x, (CCGCGC)x, (CCTCGA)x, (CCCCGA)x, (CCACGA)x, (CCGCGA)x, (CCTCGG)x, (CCCCGG)x, (CCACGG)x, (CCGCGG)x, (CCTAGA)x, (CCCAGA)x, (CCAAGA)x, (CCGAGA)x, (CCTAGG)x, (CCCAGG)x, (CCAAGG)x, (CCGAGG)x, (CCTG)x, (TCT)x, (TCC)x, (TCA)x, (TCG)x, (AGT)x, or (AGC)x repeat units, wherein “x” represents the number of repeat units present in the mutated gene and/or the chromosomal locus or an RNA (e.g., mRNA) transcript thereof. In some embodiments, “x” comprises an integer between 2 and 200. In some embodiments, “x” comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, “x” is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, Attorney Docket No. U1202.70128WO00 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some embodiments, “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400-500, 500-750, 750-1,000, 1,000-1,500, 1,500- 2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000. In some embodiments, the mutation is comprised in a gene associated with a disease (e.g., a neurological disease), such as amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuch’s Corneal Dystrophy. In some embodiments, the mutation is comprised in a chromosomal locus or gene set forth in Table 1 or Table 6. In some embodiments, the mutation is comprised in a gene selected from a group consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, Attorney Docket No. U1202.70128WO00 TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, CXADRP3, LINC00668, MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1-124K5.11, ABCB4, MFSD3, SOX17, MTDH, RRS1-AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5- 8SN5, SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, the mutation is comprised in a ARMCX4, ALK, and/or CASP8 gene. In some embodiments, the mutation comprises a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the mutation is comprised in a nucleic acid comprising a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F). In some embodiments, a subject having or suspected of having a disease (e.g., neurological diseases) associated with RAN protein expression, translation, and/or accumulation is characterized as expressing one or more interrupted RAN proteins (e.g., as a result of a mutation in a gene or chromosomal locus). In some embodiments, the one or more interrupted RAN proteins comprises a poly(Proline-Arginine) [poly(PR)], poly(Glycine- Arginine) [poly(GR)], poly(Serine) [poly(Ser)], poly(Cysteine-Proline) [poly(CP)], poly(Glycine-Proline) [(poly(GP)], poly(Glycine) [poly(G)], poly(Ala) [polyAla], Attorney Docket No. U1202.70128WO00 poly(Glycine-Alanine) [poly(GA)], poly(Glycine-Aspartate) [poly(GD)], poly(Glycine- Glutamate) [poly(GE)], poly(Glycine-Glutamine) [poly(GQ)], poly(Glycine-Threonine) [poly(GT)], poly(Leucine) [polyLeu], poly(Leucine-Proline) [poly(LP)], poly(Leucine- Proline-Alanine-Cysteine) [poly(LPAC)] (SEQ ID NO: 31), poly(Leucine-Serine) [poly(LS)], poly(Proline) [poly(P)], poly(Proline-Alanine) [poly(PA)], poly(Glutamine- Alanine-Glycine-Arginine) [poly(QAGR)] (SEQ ID NO: 35), poly(Arginine-Glutamate) [poly(RE)], poly(Serine-Proline) [poly(SP)], poly(Valine-Proline) [poly(VP)], poly(phenylalanine-proline) [poly(FP)], poly(glycine-lysine) [poly(GK)], poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), poly(PGGRGE) (SEQ ID NO: 41), poly(GRQRGVNT) (SEQ ID NO: 42), or a poly(GSKHREAE) (SEQ ID NO: 43) interrupted RAN protein. In some embodiments, RAN protein (e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins) aggregation patterns in a cell or tissue (e.g., a cell or tissue located in a subject) are length-dependent. For example, RAN proteins (e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins) that are >20, >48, or >80 residues in length aggregate differently in a subject (e.g., in brain tissue). In some embodiments, a subject having less than 10 repeats or 10 repeat units (e.g., poly-amino acid repeats/repeat units and/or nucleotidic expansion repeats/repeat units) does not exhibit signs or symptoms of a RAN protein-associated disease characterized by RAN protein expression, translation, and/or accumulation. In some embodiments, a subject having between 10 and 40 repeats or repeat units (e.g., poly-amino acid repeats/repeat units and/or nucleotidic expansion repeats/repeat units) may or may not exhibit one or more signs or symptoms of a RAN protein-associated disease characterized by RAN protein expression, translation, and/or accumulation. In some embodiments, a subject having more than 40 repeats or repeat units (e.g., poly-amino acid repeats/repeat units and/or nucleotidic expansion repeats/repeat units) exhibits one or more signs or symptoms of a RAN protein-associated disease characterized by RAN protein expression, translation, and/or accumulation. In some embodiments, a subject is identified as having a RAN protein-associated disease associated with RAN protein expression, translation, and/or accumulation is characterized by a large (>100) number of repeats or Attorney Docket No. U1202.70128WO00 repeat units (e.g., poly-amino acid repeats/repeat units and/or nucleotidic expansion repeats/repeat units). In some embodiments, a disease associated with RAN protein (e.g., interrupted RAN protein) expression, translation, and/or accumulation is amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuch’s Corneal Dystrophy. In some embodiments, a disease associated with RAN protein (e.g., interrupted RAN protein) expression, translation, and/or accumulation is Alzheimer’s disease (AD). In some embodiments, a subject expressing one or more RAN proteins is a subject having or suspected of having Alzheimer’s disease (AD). A “subject having or suspected of having Alzheimer’s disease (AD)” can be a subject exhibiting one or more signs and symptoms of AD, including but not limited to memory deficit (e.g., short term memory loss), confusion, deficiencies of executive functions (e.g., attention, planning, flexibility, abstract thinking, etc.), loss of speech, degeneration or loss of motor skills, etc. In some embodiments, a subject having or suspected of having AD may be a subject having or being identified as having one or more genetic mutations associated with AD. In some embodiments, a subject having or suspected of having AD may be a subject having or being identified as having one or more signs and symptoms associated with one or more mutations associated with AD. Non-limiting examples of mutations associated with AD include mutations in genes, such as apolipoprotein (APP), presenillin genes (PSEN1 and PSEN2), tau protein (MAPT), or caspase 8 (CASP8). In some embodiments, a subject having or suspected of having AD is characterized by the accumulation of β-amyloid (Aβ) peptides and hyper-phosphorylated tau protein throughout brain tissue of the subject. In some embodiments, a subject has been diagnosed as having AD by a medical professional, according to the NINCDS-ADRDA Alzheimer's Criteria, as described by McKhann et al. (1984) "Clinical diagnosis of Alzheimer's disease: report of the Attorney Docket No. U1202.70128WO00 NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease". Neurology.34 (7): 939–44. In some embodiments, a disease associated with RAN protein (e.g., interrupted RAN protein) expression, translation, and/or accumulation amyotrophic lateral sclerosis (ALS). In some embodiments, a subject expressing one or more interrupted RAN proteins is a subject having or suspected of having amyotrophic lateral sclerosis (ALS). A “subject having or suspected of having amyotrophic lateral sclerosis (ALS)” can be a subject exhibiting one or more signs and symptoms of ALS, including but not limited to memory deficit (e.g., short term memory loss), confusion, deficiencies of executive functions (e.g., attention, planning, flexibility, abstract thinking, etc.), loss of speech, degeneration or loss of motor skills, etc. In some embodiments, a subject having or suspected of having ALS may be a subject having or being identified as having one or more genetic mutations associated with ALS. In some embodiments, a subject having or suspected of having ALS may be a subject having or being identified one or more signs and symptoms associated with one or more genetic mutations associated with ALS. Non-limiting examples of mutations in genes associated with ALS include C9orf72. In some embodiments, a subject has been diagnosed as having ALS by a medical professional. Having described embodiments related to interrupted RAN proteins as well as embodiments of diseases and subjects comprising the same, the following sections relate to embodiments that may be useful for reducing the levels of interrupted RAN protein levels in a cell (e.g., an cell which is ex vivo or in a cell in vivo, such as would be targeted during treatment of a subject) and/or detecting interrupted RAN proteins (e.g., to identify subjects having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation) in biological samples. Agents (e.g., therapeutic agents and/or anti-RAN protein agents) and methods that have been previously described (see disclosures related to detection methods, therapeutic agents, and/or method of RAN protein-associated disease treatment, which are incorporated by reference herein, in WO2014159247A1, WO2016196324A1, WO2017176813A1, WO2018195110A1, WO2019067587A1, WO2019060918A1, WO2021007110A1, WO2021231887A1, WO2021055880A1, WO2021061537A1, WO2021072187A2, WO2023077153A1, WO2023102111A1, and WO2023164686A2) may also be useful in addition to or in combination with embodiments described herein. Attorney Docket No. U1202.70128WO00 Agents In some embodiments, agents (e.g., therapeutic agents and/or anti-RAN protein agents) described herein are useful for reducing RAN protein levels (e.g., interrupted RAN protein levels) in a cell (e.g., a cell in a subject). In some embodiments, methods of reducing interrupted RAN protein levels comprise administration of an agent described herein. Non- limiting examples of agents (e.g., therapeutic agents and/or anti-RAN protein agents) include small molecules, nucleic acids (e.g., inhibitory nucleic acids, genes or gene variants, transgenes, recombinant adeno-associated virus (rAAV) genomes, etc.), peptides, proteins (e.g., antibodies or antigen-binding fragments thereof), and rAAV particles. In other embodiments, an agent described herein may be useful for detecting a RAN protein (e.g., an interrupted RAN protein). For example, embodiments of the present disclosure related to inhibitory nucleic acids and/or guide RNAs may also be applied to designing nucleic acids that are complementary to a target sequence, such as one present in in a biological sample comprising an RNA transcript encoding an interrupted RAN protein that is detected using a method described herein (e.g., a method comprising the use of a nucleic acid probe, primer, etc.). Embodiments of the present disclosure related to antibodies and antigen-binding fragments may also be useful for detecting interrupted RAN proteins in biological samples. Accordingly, the skilled artisan will recognize that embodiments of agents (e.g., therapeutic agents and/or anti-RAN protein agents) described herein should not be considered limiting and may be useful in methods, compositions, and kits provided by the present disclosure. In some embodiments, an agent may reduce RAN protein levels (e.g., interrupted RAN protein levels) in a cell and/or tissue in a subject (e.g., when the agent is administered in an effective amount). In some embodiments, an agent (e.g., a therapeutic agent) is capable of targeting one or more RAN proteins (e.g., interrupted RAN proteins) and/or modulating a gene or gene product (e.g., protein) that interacts with one or more RAN proteins (e.g., interrupted RAN proteins). In some embodiments, an agent (e.g., a therapeutic agent) capable of targeting one or more RAN proteins may be capable of reducing expression, activity, accumulation, and/or aggregation of RAN proteins (e.g., interrupted RAN proteins). In some embodiments, an agent (e.g., a therapeutic agent) capable of modulating a gene or gene product (e.g., protein) that interacts genetically and/or physically with one or more RAN Attorney Docket No. U1202.70128WO00 proteins (e.g., interrupted RAN proteins) or a gene or chromosomal locus thereof described herein (e.g., genes/chromosomal loci set forth in Tables 1 and 6). In some embodiments, a gene or gene product (e.g., protein) that interacts (e.g., genetically and/or physically interacts) with one or more RAN proteins (e.g., interrupted RAN proteins) or a gene or chromosomal locus thereof may control the transcription and/or translation of a RAN protein, post- translationally modify a RAN protein, regulate the intracellular trafficking of a RAN proteins, etc. In some embodiments, a gene and gene product that interacts (e.g., genetically and/or physically interacts) with one or more RAN proteins (e.g., interrupted RAN proteins) or a gene or chromosomal locus thereof include eukaryotic initiation factor 2 (eIF2), eukaryotic initiation factor 3 (eIF3), protein kinase R (PKR), p62, LC3 I subunit, LC3 II subunit, the RISC loading complex subunit, TARBP2, and Toll-like receptor 3 (TLR3). In some embodiments, agents (e.g., therapeutic agents and/or anti-RAN protein agents) inhibit eukaryotic initiation factor 2 (eIF2) or a Protein Kinase R (PKR) (e.g., an inhibitor of eIF2 and/or PKR). In some embodiments, an inhibitor of eIF2 is an inhibitor of a serine/threonine kinase. Non-limiting examples of serine/threonine kinases include protein kinase A (PKA), protein kinase C (PKC), Mos/Raf kinases, mitogen-activated protein kinases (MAPKs), protein kinase B (AKT kinase), etc. In some embodiments, an eIF2 inhibitor is a protein kinase R (PKR) inhibitor. Inhibitors of eIF2 and PKR are described, for example in International Application Publication No. WO 2018/195110, the entire content of which is incorporated herein by reference. In some embodiments, an eIF2 inhibitor may be a direct inhibitor or an indirect inhibitor. In some embodiments, a direct modulator functions by interacting with (e.g., interacting with or binding to) a gene encoding eIF2 (or eIF2α), or an eIF2 protein complex. In some embodiments, an indirect modulator functions by interacting with a gene or protein that regulates the expression or activity of eIF2 or an eIF2α (e.g., does not directly interact with a gene or protein encoding eIF2 or an eiF2α). In some embodiments, an inhibitor eIF2 or PKR is a selective inhibitor. A “selective inhibitor” refers to an inhibitor of eIF2 or PKR that preferentially inhibits activity or expression of one type of eIF2 subunit compared with other types of eIF2 subunits, or inhibits activity or expression of PKR preferentially compared to other kinases. In some embodiments, an inhibitor of eIF2 is a selective inhibitor of eIF2α. In some embodiments, an inhibitor of eIF2 is a selective Attorney Docket No. U1202.70128WO00 inhibitor of eIF2A. In some embodiments, an inhibitor of eIF2 is a selective inhibitor of protein kinase R (PKR), such as a selective PKR inhibitor. In some embodiments, an agent (e.g., a therapeutic agent) is an inhibitor of eukaryotic initiation factor 3 (eIF3), which is a multiprotein complex that is involved with the initiation phase of eukaryotic protein translation. Generally, in humans eIF3 comprises 13 non- identical subunits (e.g., eIF3a-m). Mammalian eIF3, the largest most complex initiation factor, comprises up to 13 non-identical subunits. Typically, eIF3f is involved in many steps of translation initiation including stabilization of the ternary complex, mediating binding of mRNA to 40S subunit and facilitating dissociation of 40S and 60S ribosomal subunits. In some embodiments, therapeutic agents that inhibit expression or activity of an eIF3 subunit (e.g., eIF3f, eIF3m, eIF3h, or other eIF3 subunit) can be used to reduce or inhibit RAN translation in a cell or in a subject (e.g., a subject having Alzheimer’s disease characterized by RAN protein translation). Inhibitors of eIF3 subunits are further described, for example in International Application Publication No. WO 2017/176813, the entire content of which is incorporated herein by reference. An eIF3 inhibitor may be a direct inhibitor or an indirect inhibitor. Generally, a direct modulator functions by interacting with (e.g., interacting with or binding to) a gene encoding eIF3 (or an eIF3 subunit), or an eIF3 protein complex, or an eIF3 subunit. Generally, an indirect modulator functions by interacting with a gene or protein that regulates the expression or activity of eIF3 or an eIF3 subunit (e.g., does not directly interact with a gene or protein encoding eIF3 or an eiF3 subunit). In some embodiments, an inhibitor of eIF3 is a selective inhibitor. A “selective inhibitor” refers to a modulator of eIF3 that preferentially inhibits activity or expression of one type of eIF3 subunit compared with other types of eIF3 subunits. In some embodiments, an inhibitor of eIF3 is a selective inhibitor of eIF3f. An eIF3 inhibitor can be a protein (e.g., antibody), nucleic acid, or small molecule. Examples of proteins that inhibit eiF3 (e.g., an eIF3 subunit) include but are not limited to polyclonal anti-eIF3 antibodies, monoclonal anti-eIF3 antibodies, Measles Virus N protein, Viral stress-inducible protein p56, etc. As used herein, a “therapeutic agent” may refer to an agent which is capable of producing a desirable result in a subject. In some embodiments, the desirable result will depend upon the active agent being administered. For example, in some embodiments, an effective amount of rAAV particles may be an amount of the particles that are capable of transferring an expression construct to a host cell, tissue or organ. In some embodiments, a Attorney Docket No. U1202.70128WO00 therapeutically acceptable amount of an anti-RAN protein antibody may be an amount that is capable of treating a disease (e.g., a neurological disease, such as a neurodegenerative disease) by reducing expression and/or aggregation of interrupted RAN proteins and/or appearance or number of RNA foci comprising RAN protein-encoding microsatellite repeat sequences. In certain embodiments, an effective amount is an amount effective in reducing the level of RAN proteins (e.g., interrupted RAN proteins) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of RAN proteins relative to the level of RAN proteins in a cell or subject that has not been administered a therapeutic agent). In certain embodiments, the effective amount is an amount effective in reducing the translation of RAN proteins (e.g., interrupted RAN proteins) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of RAN proteins relative the level of RAN proteins in a cell or subject that has not been administered a therapeutic agent). As is well known in the medical and veterinary arts, dosage for any one subject depends on many factors, including the subject's size, body surface area, age, the particular composition to be administered, the active ingredient(s) in the composition, time and route of administration, general health, and other drugs being administered concurrently. In some embodiments, methods of the present disclosure comprise administration of an agent (e.g., a therapeutic agent) in an amount effective for treatment of a subject (e.g., a subject having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation). As used herein, to "treat" a disease refers to reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. In some embodiments, the at least one sign or symptom is experienced by subjects having a RAN- protein associated disease. In some embodiments, a RAN-protein associated disease is characterized by at least one sign or symptom associated with a disease selected from the group consisting of: amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Attorney Docket No. U1202.70128WO00 Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), and Fuch’s Corneal Dystrophy. In some embodiments, a RAN- protein associated disease is characterized by expression of one or more RAN proteins (e.g., interrupted RAN proteins) from a gene or chromosomal locus listed in Table 1 or Table 6. In some embodiments, In some embodiments, a RAN-protein associated disease is characterized by expression of one or more RAN proteins (e.g., interrupted RAN proteins) from a gene selected from a group consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, CXADRP3, LINC00668, MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1-124K5.11, ABCB4, Attorney Docket No. U1202.70128WO00 MFSD3, SOX17, MTDH, RRS1-AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5- 8SN5, SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, a RAN-protein associated disease is characterized by expression of one or more RAN proteins (e.g., interrupted RAN proteins) from a gene, such as ARMCX4, ALK, and/or CASP8. In some embodiments, a subject comprising a RAN protein-associated disease has been diagnosed with said disease via a method described herein (e.g., a method of detecting interrupted RAN proteins or RNA transcripts or DNA sequences thereof). In some embodiments, a disease associated with RAN protein expression, translation, and/or accumulation is associated with expression, translation, and/or accumulation of one or more interrupted RAN proteins. In some embodiments, a therapeutic agent useful for treating a disease associated with RAN protein expression, translation, and/or accumulation may also be an agent which is therapeutic for treating a subject expressing one or more interrupted RAN proteins. In some embodiments, one or more therapeutic molecules are administered to a subject to treat a disease associated with RAN proteins, such as interrupted RAN proteins. For example, in some embodiments, a subject is administered 2, 3, 4, 5, 6, 7, 8, 9, or 10 therapeutic agents (e.g., proteins, nucleic acids, small molecules, etc., or any combination thereof). Small Molecules In some embodiments, agents (e.g., therapeutic agents and/or anti-RAN protein agents) are small molecules. In some embodiments, a small molecule inhibits expression (e.g., RNA and/or protein levels) or activity (e.g., aggregation) of one or more RAN proteins (e.g., interrupted RAN proteins). In some embodiments, an agent (e.g., a therapeutic agent) is small molecule which inhibits a gene or gene product that interacts (e.g., genetically and/or physically interacts) with a RAN protein or a gene or chromosomal locus thereof. In some embodiments, a small molecule is inhibitor of p62 (see, e.g., inhibitors in Leestemaker et al. (2017) Cell Chemical Biology 24, 725–736). In some embodiments, a small molecule is an inhibitor of eIF3 (or an eIF3 subunit), such as mTOR inhibitors (e.g., rapamycin, PP242), S6 kinase (S6K) inhibitors, Attorney Docket No. U1202.70128WO00 etc. In some embodiments, a small molecule is TLR3 inhibitor (see, e.g.,TLR3 inhibitors in Cheng et al. (2011) J Am Chem Soc 133(11):3764-7). In some embodiments, a small molecule inhibits expression or activity of eukaryotic initiation factor 2 (eIF2) or a subunit thereof (e.g., eIF2A), such as LY 364947, salubrinal, Sal003, ISRIB , etc. In some embodiments, a small molecule is an inhibitor of PKR, such as metformin, also known as N,N-dimethylbiguanide (IUPAC N,N-Dimethylimidodicarbonimidic diamide and CAS 657- 24-9), 6-amino-3-methyl-2-oxo-N-phenyl-2,3-dihydro-1H-benzo[d]imidazole-1- carboxamide, N-[2-(1H-indol-3-yl)ethyl]-4-(2-methyl-1H-indol-3-yl)pyrimidin-2-amine, chloroguanide [1-[amino-(4-chloroanilino)methylidene]-2-propan-2-yl-guanidine, CAS 500- 92-5], Chlorproguanil [1-[Amino-(3,4-dichloroanilino)methylidene]-2-propan-2-ylguanidine, CAS 537-21-3], buformin [N-Butylimidodicarbonimidic diamide, CAS 692-13-7] or Phenformin [2-(N-phenethylcarbamimidoyl)guanidine, CAS 114-86-3] or a pharmaceutically acceptable salt, co-crystal, tautomer, stereoisomer, solvate, hydrate, polymorph, isotopically enriched derivative, or prodrug of any of the biguanides. In some embodiments, a small molecule is buformin or phenformin. In some embodiments, a small molecule in an inhibitor of TARBP2. The term “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1–19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid or by using other methods known in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, Attorney Docket No. U1202.70128WO00 hemisulfate, heptanoate, hexanoate, hydroiodide, 2–hydroxy–ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2– naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3–phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C1–4 alkyl)4- salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate. The term “solvate” refers to forms of the compound that are associated with a solvent, usually by a solvolysis reaction. This physical association may include hydrogen bonding. Conventional solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like. Metformin may be prepared, e.g., in crystalline form, and may be solvated. Suitable solvates include pharmaceutically acceptable solvates and further include both stoichiometric solvates and non-stoichiometric solvates. In certain instances, the solvate will be capable of isolation, for example, when one or more solvent molecules are incorporated in the crystal lattice of a crystalline solid. “Solvate” encompasses both solution- phase and isolable solvates. Representative solvates include hydrates, ethanolates, and methanolates. The term “hydrate” refers to a compound that is associated with water. Typically, the number of the water molecules contained in a hydrate of a compound is in a definite ratio to the number of the compound molecules in the hydrate. Therefore, a hydrate of a compound may be represented, for example, by the general formula R⋅x H2O, wherein R is the compound and wherein x is a number greater than 0. A given compound may form more than one type of hydrates, including, e.g., monohydrates (x is 1), lower hydrates (x is a number greater than 0 and smaller than 1, e.g., hemihydrates (R⋅0.5 H2O)), and polyhydrates (x is a number greater than 1, e.g., dihydrates (R⋅2 H2O) and hexahydrates (R⋅6 H2O)). The term “tautomers” or “tautomeric” refers to two or more interconvertible compounds resulting from at least one formal migration of a hydrogen atom and at least one change in valency (e.g., a single bond to a double bond, a triple bond to a single bond, or vice Attorney Docket No. U1202.70128WO00 versa). The exact ratio of the tautomers depends on several factors, including temperature, solvent, and pH. Tautomerizations (i.e., the reaction providing a tautomeric pair) may catalyzed by acid or base. Exemplary tautomerizations include keto-to-enol, amide-to-imide, lactam-to-lactim, enamine-to-imine, and enamine-to-(a different enamine) tautomerizations. It is also to be understood that compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed “isomers.” Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereomers” and those that are non-superimposable mirror images of each other are termed “enantiomers.” When a compound has an asymmetric center, for example, it is bonded to four different groups, a pair of enantiomers is possible. An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R- and S-sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light and designated as dextrorotatory or levorotatory (i.e., as (+) or (-)-isomers respectively). A chiral compound can exist as either individual enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is called a “racemic mixture. The term “prodrugs” refers to compounds that have cleavable groups and become by solvolysis or under physiological conditions the compounds described herein, which are pharmaceutically active in vivo. Such examples include, but are not limited to, choline ester derivatives and the like, N-alkylmorpholine esters and the like. Other derivatives of the compounds described herein have activity in both their acid and acid derivative forms, but in the acid sensitive form often offer advantages of solubility, tissue compatibility, or delayed release in the mammalian organism (see, Bundgard, H., Design of Prodrugs, pp.7-9, 21-24, Elsevier, Amsterdam 1985). Prodrugs include acid derivatives well known to practitioners of the art, such as, for example, esters prepared by reaction of the parent acid with a suitable alcohol, or amides prepared by reaction of the parent acid compound with a substituted or unsubstituted amine, or acid anhydrides, or mixed anhydrides. Simple aliphatic or aromatic esters, amides, and anhydrides derived from acidic groups pendant on the compounds described herein are particular prodrugs. In some cases, it is desirable to prepare double ester type prodrugs such as (acyloxy)alkyl esters or ((alkoxycarbonyl)oxy)alkylesters. C1-C8 alkyl, Attorney Docket No. U1202.70128WO00 C2-C8 alkenyl, C2-C8 alkynyl, aryl, C7-C12 substituted aryl, and C7-C12 arylalkyl esters of the compounds described herein may be preferred. Inhibitory Nucleic Acids In some embodiments, agents (e.g., therapeutic agents and/or anti-RAN protein agents) are inhibitory nucleic acids. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a nucleic acid sequence (e.g., a target sequence, such as a target sequence in an RNA transcript). In some embodiments, a length and a degree of sequence complementarity that is sufficient for base-pairing with a nucleic acid sequence (e.g., a target sequence) in a specific and/or stable manner. In some embodiments, an inhibitory nucleic acid comprises about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-30, 30-40, 40-50, or more nucleotides. In some embodiments, the degree of sequence complementarity required for hybridization with a nucleic acid sequence (e.g., a target sequence) is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%. In some embodiments, an inhibitory nucleic acid comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-30, 30-40, 40- 50, or more nucleotides that is complementary to a nucleic acid sequence (e.g., a target sequence). In some embodiments, an inhibitory nucleic acid is capable of hybridizing with encoding or a gene product that interacts with a RAN protein (e.g., eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3). In some embodiments, a eIF2 gene or gene product comprises the sequence set forth in GenBank Accession No. NM_004094.4. n some embodiments, an eIF2A gene or gene product comprises the sequence set forth in GenBank Accession No. NM_032025.4. In some embodiments, a eIF3 gene or gene product comprises the sequence set forth in include GenBank Accession No. NM_003750.2 (eIF3a), GenBank Accession No. NM_003751.3 (eIF3b), GenBank Accession No. NM_003752.4 (eIF3c), GenBank Accession No. NM_003753.3 (eIF3d), GenBank Accession No. NM_001568.2 (eIF3e), GenBank Accession No. NM_003754.2 (eIF3f), GenBank Accession No. NM_003755.4 (eIF3g), GenBank Accession No. NM_003756.2 (eIF3h), GenBank Accession No. NM_003757.3 (eIF3i), GenBank Accession No. NM_003758.3 (eIF3j), GenBank Accession No. NM_013234.3 (eIF3k), GenBank Accession No. NM_016091.3 (eIF3l), GenBank Accession No. Attorney Docket No. U1202.70128WO00 NM_006360.5 (eiF3m), etc. In some embodiments, a PKR gene or gene product comprises the sequence set forth in GenBank Accession No. NP_002750.1. In some embodiments, an inhibitory nucleic acid is an antisense oligonucleotide (ASO). In some embodiments, an ASO comprises a short (approximately 15 to 30 nucleotides) sequence that is complementary to a nucleic acid sequence (e.g., a target sequence, such as a target sequence in an RNA transcript encoding an interrupted RAN protein or a gene product that interacts with a RAN protein, such as an eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3). In some embodiments, ASOs comprise naturally occurring nucleotides and/or modified (e.g., chemically modified) nucleotides. In some embodiments, nucleotides could be modified by replacing the ribose with an alternate saccharide moiety such as 2’-deoxyribose, or 2’-O-(2-mehtoxyethyl)ribose, methylation, and/or replacing phosphodiester bonds between nucleotides with phosphorothioate linkages. In some embodiments, modifications of several nucleotides at both the 3’ and 5’ ends of ASOs inhibit degradation by ubiquitous terminally active RNA nucleases and, therefore, improve the stability and thus half-life of the antisense oligo. However, in some embodiments, it may be desirable that at least some part of the ASO will, once complexed with the mRNA encoding the RAN protein (e.g., an interrupted RAN protein) promote the activity of Ribonuclease H to promote the enzymatic degradation of the mRNA once it is complexed with the ASO. In some embodiments, an ASO targets an RNA (e.g., mRNA) corresponding to a gene comprising a microsatellite repeat sequence. In some embodiments, the antisense oligonucleotide inhibits translation of one or more interrupted RAN proteins. In some embodiments, antisense oligonucleotides block the translation of a target protein by hybridizing to an mRNA sequence encoding the target protein, thereby inhibiting protein synthesis by ribosomal machinery. In some embodiments, an inhibitory nucleic acid is an interfering RNA. In some embodiments, an interfering RNA comprises a sequence that is complementary with between 5 and 50 continuous nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12 ,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, about 30, about 35, about 40, or about 50 continuous nucleotides) of a nucleic acid sequence (e.g., a target sequence, such as a target sequence in an RNA transcript encoding an interrupted RAN protein or a gene product that interacts with a RAN protein, such as an eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3). Non-limiting examples of interfering RNAs include dsRNA, Attorney Docket No. U1202.70128WO00 siRNA, shRNA, miRNA, and ami-RNA. In some embodiments, the inhibitory nucleic acid is a nucleic acid aptamer (e.g., an RNA aptamer or DNA aptamer). In some embodiments, an inhibitory RNA molecule can be unmodified or modified. In some embodiments, an inhibitory RNA molecule comprises one or more modified oligonucleotides, e.g., phosphorothioate-, 2'-O-methyl-, etc.-modified oligonucleotides, as such modifications have been recognized in the art as improving the stability of oligonucleotides in vivo. In some embodiments, an interfering RNA is an eIF3f siRNA (e.g., Dharmacon Cat # J-019535-08), eIF3m siRNA (e.g., Dharmacon Cat # J-016219-12), eIF3h siRNA (e.g., Dharmacon Cat # J- 003883-07), or a variant thereof, such as an shRNA comprising the same sense and/or antisense sequence and further comprising a suitable shRNA loop sequence. In some embodiments, an inhibitory nucleic acid is aptamer. In some embodiments, an aptamer comprises a sequence that is complementary and/or capable of binding a nucleic acid sequence (e.g., a target sequence, such as a target sequence in an RNA transcript encoding an interrupted RAN protein or a gene product that interacts with a RAN protein, such as an eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3). In some embodiments, an aptamer comprises a sequence that is complementary and/or capable of binding a RAN protein (e.g., an interrupted RAN protein) or a protein that interacts with a RAN protein (e.g., eIF2 or a subunit thereof, eIF3 or a subunit thereof, PKR, p62, LC3 I subunit, LC3 II subunit, TARBP2, or TLR3). In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a nucleic acid sequence (e.g., target sequence) present in a gene, chromosomal, or RNA transcript (e.g., mRNA) encoding an interrupted RAN protein. In some embodiments, a target sequence comprises expansion repeat units. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a target sequence, or a portion thereof, comprising GGTCGT, GGCCGT, GGACGT, GGGCGT, GGTCGC, GGCCGC, GGACGC, GGGCGC, GGTCGA, GGCCGA, GGACGA, GGGCGA, GGTCGG, GGCCGG, GGACGG, GGGCGG, GGTAGA, GGCAGA, GGAAGA, GGGAGA, GGTAGG, GGCAGG, GGAAGG, GGGAGG GGTGCT, GGCGCC, GGAGCA, GGGGCG, GGTGCC, GGCGCA, GGAGCG, GGGGCT, GGTGCA, GGCGCG, GGAGCT, GGGGCC, GGTGCG, GGCGCT, GGAGCC, GGGGCA GGTCCT, GGCCCC, GGACCA, GGGCCG, GGTCCC, GGCCCA, GGACCG, GGGCCT, GGTCCA, GGCCCG, GGACCT, GGGCCC, GGTCCG, GGCCCT, GGACCC, GGGCCA CCTCGT, CCCCGT, CCACGT, CCGCGT, CCTCGC, CCCCGC, CCACGC, Attorney Docket No. U1202.70128WO00 CCGCGC, CCTCGA, CCCCGA, CCACGA, CCGCGA, CCTCGG, CCCCGG, CCACGG, CCGCGG, CCTAGA, CCCAGA, CCAAGA, CCGAGA, CCTAGG, CCCAGG, CCAAGG, CCGAGG TCT, TCC, TCA, TCG, AGT, AGC, CCTG, and/or CAGG repeat units. In some embodiments, the target sequence, or a portion thereof, is present in a nucleic acid encoding an interrupted RAN protein comprising (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCG)x, (GGTGCC)x, (GGCGCA)x, (GGAGCG)x, (GGGGCT)x, (GGTGCA)x, (GGCGCG)x, (GGAGCT)x, (GGGGCC)x, (GGTGCG)x, (GGCGCT)x, (GGAGCC)x, (GGGGCA)x, (GGTCCT)x, (GGCCCC)x, (GGACCA)x, (GGGCCG)x, (GGTCCC)x, (GGCCCA)x, (GGACCG)x, (GGGCCT)x, (GGTCCA)x, (GGCCCG)x, (GGACCT)x, (GGGCCC)x, (GGTCCG)x, (GGCCCT)x, (GGACCC)x, (GGGCCA)x, (CCTCGT)x, (CCCCGT)x, (CCACGT)x, (CCGCGT)x, (CCTCGC)x, (CCCCGC)x, (CCACGC)x, (CCGCGC)x, (CCTCGA)x, (CCCCGA)x, (CCACGA)x, (CCGCGA)x, (CCTCGG)x, (CCCCGG)x, (CCACGG)x, (CCGCGG)x, (CCTAGA)x, (CCCAGA)x, (CCAAGA)x, (CCGAGA)x, (CCTAGG)x, (CCCAGG)x, (CCAAGG)x, (CCGAGG)x, (CCTG)x, (TCT)x, (TCC)x, (TCA)x, (TCG)x, (AGT)x, and/or (AGC)x repeat units, wherein x represents the number of repeat units present in a nucleic acid encoding an interrupted RAN protein. In some embodiments, x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, Attorney Docket No. U1202.70128WO00 199, or 200. In some embodiments, “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400-500, 500- 750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000- 6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a target sequence corresponding to a gene associated with a disease, such as amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuch’s Corneal Dystrophy. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a target sequence corresponding to a gene or a chromosomal locus set forth in Table 1 or Table 6. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a target sequence, or a portion thereof, corresponding to a gene selected from: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, CXADRP3, LINC00668, Attorney Docket No. U1202.70128WO00 MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1-124K5.11, ABCB4, MFSD3, SOX17, MTDH, RRS1- AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5-8SN5, SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a target sequence corresponding to ARMCX4, ALK, or CASP8. In some embodiments, an inhibitory nucleic acid is capable of hybridizing with a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the target sequence comprises a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F). Guide Nucleic Acids and RNA-Guided Nucleases In some embodiments, an agent (e.g., a therapeutic agent) is a guide RNA (gRNA) and/or an RNA-guided nuclease (e.g., a complex comprising a gRNA and a Cas nuclease). The terms “gRNA” and “guide RNA” may be used interchangeably throughout to refer to a nucleic acid comprising a sequence that physically interacts with (e.g., binds to) an RNA- guided nuclease (e.g., Cas9 nuclease) and localizes it too a target sequence. In some embodiments, a gRNA comprises a targeting sequence which is 5’ relative to a scaffold sequence. A “targeting sequence” refers to the sequence within the gRNA that is used to localize an RNA-guided nuclease (e.g., a Cas9 nuclease) to target DNA. A “scaffold sequence” refers to the sequence within the gRNA that is responsible for RNA-guided nuclease binding and does not include the targeting sequence. A “sgRNA” refers to a gRNA Attorney Docket No. U1202.70128WO00 comprising a scaffold sequence which is a fusion of the endogenous bacterial crRNA and tracrRNA. In some embodiments, a sgRNA comprises the targeting sequence. In some embodiments, a targeting sequence or a portion thereof hybridizes to (e.g., is partially or completely complementary to) a target sequence in a nucleic acid encoding an interrupted RAN protein. In some embodiments, the targeting sequence is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or at least 99% complementary to a target sequence in a nucleic acid encoding an interrupted RAN protein. In some embodiments, the targeting sequence is 100% complementary to a target sequence in a nucleic acid encoding an interrupted RAN protein. In some embodiments, the targeting sequence or portion thereof that hybridizes to the target sequence in a nucleic acid encoding an interrupted RAN protein may be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides in length. In some embodiments, the targeting sequence or portion thereof that hybridizes to a target sequence in a nucleic acid encoding an interrupted RAN protein is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In some embodiments, the targeting sequence or portion thereof that hybridizes to a target sequence in a nucleic acid encoding an interrupted RAN protein is between 10-30, or between 15-25, nucleotides in length. In some embodiments, the targeting sequence or portion thereof that hybridizes to a target sequence in a nucleic acid encoding an interrupted RAN protein is 20 nucleotides in length. In some embodiments, a targeting sequence comprises a sequence set forth in Table 4. In some embodiments, a gRNA is capable of hybridizing with a target sequence, or a portion thereof, comprising GGTCGT, GGCCGT, GGACGT, GGGCGT, GGTCGC, GGCCGC, GGACGC, GGGCGC, GGTCGA, GGCCGA, GGACGA, GGGCGA, GGTCGG, GGCCGG, GGACGG, GGGCGG, GGTAGA, GGCAGA, GGAAGA, GGGAGA, GGTAGG, GGCAGG, GGAAGG, GGGAGG GGTGCT, GGCGCC, GGAGCA, GGGGCG, GGTGCC, GGCGCA, GGAGCG, GGGGCT, GGTGCA, GGCGCG, GGAGCT, GGGGCC, GGTGCG, GGCGCT, GGAGCC, GGGGCA GGTCCT, GGCCCC, GGACCA, GGGCCG, GGTCCC, GGCCCA, GGACCG, GGGCCT, GGTCCA, GGCCCG, GGACCT, GGGCCC, GGTCCG, GGCCCT, GGACCC, GGGCCA CCTCGT, CCCCGT, CCACGT, CCGCGT, CCTCGC, CCCCGC, CCACGC, CCGCGC, CCTCGA, CCCCGA, CCACGA, CCGCGA, CCTCGG, CCCCGG, CCACGG, CCGCGG, CCTAGA, CCCAGA, CCAAGA, CCGAGA, CCTAGG, CCCAGG, CCAAGG, CCGAGG TCT, TCC, TCA, TCG, AGT, AGC, CCTG, and/or CAGG repeat units. In some embodiments, the target sequence is present in a nucleic Attorney Docket No. U1202.70128WO00 acid encoding an interrupted RAN protein comprising (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCG)x, (GGTGCC)x, (GGCGCA)x, (GGAGCG)x, (GGGGCT)x, (GGTGCA)x, (GGCGCG)x, (GGAGCT)x, (GGGGCC)x, (GGTGCG)x, (GGCGCT)x, (GGAGCC)x, (GGGGCA)x, (GGTCCT)x, (GGCCCC)x, (GGACCA)x, (GGGCCG)x, (GGTCCC)x, (GGCCCA)x, (GGACCG)x, (GGGCCT)x, (GGTCCA)x, (GGCCCG)x, (GGACCT)x, (GGGCCC)x, (GGTCCG)x, (GGCCCT)x, (GGACCC)x, (GGGCCA)x, (CCTCGT)x, (CCCCGT)x, (CCACGT)x, (CCGCGT)x, (CCTCGC)x, (CCCCGC)x, (CCACGC)x, (CCGCGC)x, (CCTCGA)x, (CCCCGA)x, (CCACGA)x, (CCGCGA)x, (CCTCGG)x, (CCCCGG)x, (CCACGG)x, (CCGCGG)x, (CCTAGA)x, (CCCAGA)x, (CCAAGA)x, (CCGAGA)x, (CCTAGG)x, (CCCAGG)x, (CCAAGG)x, (CCGAGG)x, (CCTG)x, (TCT)x, (TCC)x, (TCA)x, (TCG)x, (AGT)x, and/or (AGC)x repeat units, wherein x represents the number of repeat units present in a nucleic acid encoding an interrupted RAN protein. In some embodiments, x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some embodiments, “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400- 500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000. In some embodiments, a target Attorney Docket No. U1202.70128WO00 sequence, or a portion thereof, corresponds to a gene selected from: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, CXADRP3, LINC00668, MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1-124K5.11, ABCB4, MFSD3, SOX17, MTDH, RRS1- AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5-8SN5, SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, a gRNA is a modified gRNA (e.g., a chemically modified gRNA). Methods of designing gRNAs and chemically modified gRNAs will be apparent to those of skill in the art (see, e.g., Jinek, et al. Science (2012) 337(6096):816-821, Ran, et al. Attorney Docket No. U1202.70128WO00 Nature Protocols (2013) 8:2281-2308, International Publication No. WO 2014/093694, and International Publication No. WO 2013/176772; Vanegas et al., Fungal Biol Biotechnol. 2019; 6: 6; Fu Y et al, Nat Biotechnol 2014 (doi: 10.1038/nbt.2808); Sternberg SH et al., Nature 2014 (doi: 10.1038/naturel3011); Rahdar et al. PNAS (2015) 112 (51) E7110-E7117 and Hendel et al., Nat Biotechnol. (2015); 33(9): 985–989; International Publication Nos. WO 2017/214460, WO 2016/089433, and WO 2016/164356). As used herein, an “RNA-guided nuclease” may be used to refer to any protein comprising a nuclease domain or a variant thereof (e.g., a catalytically inactive nuclease or partially catalytically inactive nuclease) that physically interacts with an RNA molecule (e.g., a guide RNA) that localizes the nuclease to a site in a target DNA sequence. A “ribonucleoprotein complex” or “RNP complex” may be used to refer to a an RNA-guided nuclease (e.g., a Cas nuclease, for example a Cas9 nuclease) bound to a gRNA. A variety of RNA-guided nuclease which includes Cas nucleases, such as Cas9 nuclease, are known in the art (see, e.g., Gill et al. LIPSCOMB 2017. In United States: Inscripta Inc.; Price et al. Biotechnol. Bioeng. (2020) 117(60): 1805-1816; International Publication No. WO 2015/157070; See, e.g., Gao et al. Nat. Biotechnol. (2017) 35(8): 789- 792; Liang et al. Nat. Comm. (2022) 13: 3421; Walton et al. Science (2020) 368 (6488): 290- 296; Slaymaker et al. Science (2016) 351 (6268): 84-88; Kleinstiver et al. Nature (2016) 529: 490-495; Stella et al. Nature Structural & Molecular Biology (2017); Shmakov et al. Mol Cell (2015) 60: 385-397; Strohkendl et al. Mol. Cell (2018) 71: 1-9). In some embodiments, an RNA-guided nuclease comprises a Cas nuclease variant (e.g., a Cas9 variant). In some embodiments, the Cas nuclease variant comprises one or more mutations, wherein the one or more mutations comprises a point mutation, a substitution, an insertion, and/or a deletion of one or more amino acids. In some embodiments, the Cas nuclease variant is a catalytically inactive or a partially catalytically inactive Cas nuclease variant (see, e.g., Yeh et al. Nat. Cell. Biol. (2019) 21: 1468-1478; e.g., Hsu et al. Cell (2014) 157: 1262-1278; Jasin et al. DNA Repair (2016) 44: 6-16; Sfeir et al. Trends Biochem. Sci. (2015) 40: 701-714). In some embodiments, the Cas nuclease variant is Cas9-NRTH, a dead Cas9 (dCas9), a Cas9-NG, or Cas9-NRCH. In some embodiments, the RNA-guided nuclease targets and deaminates a specific nucleobase. In some embodiments, the RNA-guided nuclease further comprises a deaminase. In some embodiments, the deaminase is fused to the RNA-guided nuclease on one end (e.g., Attorney Docket No. U1202.70128WO00 the N-terminus or C-terminus of the RNA-guided nuclease). In some embodiments, the RNA- guided nuclease comprises an adenosine deaminase. In some embodiments, the RNA-guided nuclease comprises a cytidine deaminase. In some embodiments, the RNA-guided nuclease comprises a cytidine deaminase and one or more uracil glycosylase inhibitor domains. In some embodiments, the RNA-guided nuclease is an adenine base editor (ABE) or a cytosine base editor (CBE). Various RNA-guided nucleases and/or deaminases that can be used to a Cas nuclease for base editing are known in the art (see, e.g., Komor et al. Nature (2016) 533: 420-424; Rees et al. Nat. Rev. Genet. (2018) 19(12): 770-788; Anzalone et al. Nat. Biotechnol. (2020) 38: 824-844; Eid et al. Biochem. J. (2018) 475(11): 1965-1964; Rees et al. Nature Reviews Genetics (2018) 19:770-788; US Publication No.2018/0312825A1, US Publication No.2018/0312828A1, and International Publication No. WO 2018/165629A1). In some embodiments, the RNA-guided nuclease is fused to an engineered reverse transcriptase (RT) domain. In some embodiments, the RNA-guided nuclease is a prime editor (see, e.g., Anzalone et al. Nature (2019) 576 (7785): 149-157). In some embodiments, the RNA-guided nuclease is capable of recognizing (e.g., binding to) a PAM sequence. As used herein, the term “protospacer adjacent motif” or “PAM” refers to a DNA sequence that may be required for an RNA-guided nuclease and a gRNA (e.g., Cas9/sgRNA) to interrogate a specific DNA sequence through Watson-Crick pairing of its guide RNA with the genome. In some embodiments, the PAM specificity may be a function of the DNA-binding specificity of the RNA-guided nuclease, e.g., a “protospacer adjacent motif recognition domain” at the C-terminus of Cas9. In some embodiments, the PAM comprises a 2 to 8 base pair DNA sequence (e.g., 2, 3, 4, 5, 6, 7, or 8 base pair DNA sequence) immediately downstream or upstream of the target sequence, which may be recognized directly by an RNA-guided nuclease to promote cleavage of the target site, or in the case of nuclease-deficient Cas allows binding to the DNA at that locus. In some embodiments, recognition of the PAM sequence comprises an RNA-guided nuclease and a gRNA forming an R-loop. In some embodiments, the PAM can be a 5' PAM located upstream of the 5' end of the target sequence. In other embodiments, the PAM can be a 3' PAM located downstream of the 5' end of the target sequence. In some embodiments, the PAM is located on the same strand on the target sequence. In some embodiments, the PAM is 1-30 nucleotides upstream or downstream of the target sequence. In some embodiments, the PAM is 1, 2, 3, 4, 5, 6, 7, 8, Attorney Docket No. U1202.70128WO00 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides upstream or downstream of the target sequence. In some embodiments, a PAM comprises a sequence of NGG, NAG, NGCG, NGAG, NGAN, NGNG, NG, GAA, GAT, NNGRRT, NNGRR(N), TTTV, TYCV, TATV, NNNNRYAC, NNNNRYAC, NNNNRYAC, or NAAAAC, wherein “N” is any nucleotide or base, “R” is A or guanine (G), and “Y” is C or T. In some embodiments, a PAM is a present in a repeat unit comprising GGTCGT, GGCCGT, GGACGT, GGGCGT, GGTCGC, GGCCGC, GGACGC, GGGCGC, GGTCGA, GGCCGA, GGACGA, GGGCGA, GGTCGG, GGCCGG, GGACGG, GGGCGG, GGTAGA, GGCAGA, GGAAGA, GGGAGA, GGTAGG, GGCAGG, GGAAGG, GGGAGG GGTGCT, GGCGCC, GGAGCA, GGGGCG, GGTGCC, GGCGCA, GGAGCG, GGGGCT, GGTGCA, GGCGCG, GGAGCT, GGGGCC, GGTGCG, GGCGCT, GGAGCC, GGGGCA GGTCCT, GGCCCC, GGACCA, GGGCCG, GGTCCC, GGCCCA, GGACCG, GGGCCT, GGTCCA, GGCCCG, GGACCT, GGGCCC, GGTCCG, GGCCCT, GGACCC, GGGCCA CCTCGT, CCCCGT, CCACGT, CCGCGT, CCTCGC, CCCCGC, CCACGC, CCGCGC, CCTCGA, CCCCGA, CCACGA, CCGCGA, CCTCGG, CCCCGG, CCACGG, CCGCGG, CCTAGA, CCCAGA, CCAAGA, CCGAGA, CCTAGG, CCCAGG, CCAAGG, CCGAGG TCT, TCC, TCA, TCG, AGT, AGC, CCTG, and/or CAGG repeat units. In some embodiments, a PAM is present a nucleic acid encoding an interrupted RAN protein comprising (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCG)x, (GGTGCC)x, (GGCGCA)x, (GGAGCG)x, (GGGGCT)x, (GGTGCA)x, (GGCGCG)x, (GGAGCT)x, (GGGGCC)x, (GGTGCG)x, (GGCGCT)x, (GGAGCC)x, (GGGGCA)x, (GGTCCT)x, (GGCCCC)x, (GGACCA)x, (GGGCCG)x, (GGTCCC)x, (GGCCCA)x, (GGACCG)x, (GGGCCT)x, (GGTCCA)x, (GGCCCG)x, (GGACCT)x, (GGGCCC)x, (GGTCCG)x, (GGCCCT)x, (GGACCC)x, (GGGCCA)x, (CCTCGT)x, (CCCCGT)x, (CCACGT)x, (CCGCGT)x, (CCTCGC)x, (CCCCGC)x, (CCACGC)x, (CCGCGC)x, (CCTCGA)x, (CCCCGA)x, (CCACGA)x, (CCGCGA)x, (CCTCGG)x, (CCCCGG)x, (CCACGG)x, (CCGCGG)x, (CCTAGA)x, (CCCAGA)x, (CCAAGA)x, (CCGAGA)x, (CCTAGG)x, (CCCAGG)x, (CCAAGG)x, (CCGAGG)x, (CCTG)x, (TCT)x, Attorney Docket No. U1202.70128WO00 (TCC)x, (TCA)x, (TCG)x, (AGT)x, and/or (AGC)x repeat units, wherein x represents the number of repeat units present in a nucleic acid encoding an interrupted RAN protein. In some embodiments, x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some embodiments, “x” comprises an integer greater than 200. In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400-500, 500- 750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000- 6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000. In some embodiments, a PAM is present in a gene selected from: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, Attorney Docket No. U1202.70128WO00 CXADRP3, LINC00668, MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1-124K5.11, ABCB4, MFSD3, SOX17, MTDH, RRS1-AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5-8SN5, SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, a target sequence comprises a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the target sequence comprises a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F). In some embodiments, an RNA-guided nuclease and a gRNA are contacted with a target sequence or one or more cells comprising a target sequence. In some embodiments, contacting an RNA-guided nuclease and a gRNA with one or more cells comprises contacting the one or more cells a nucleic acid encoding the gRNA. In some embodiments, a nucleic acid encoding the RNA-guided nuclease is contacted with the one or more cells. In some embodiments, an RNA-guided nuclease and a gRNA are encoded on the same nucleic acid. In some embodiments, a nucleic acid for delivery of an RNA-guided nuclease and/or a gRNA comprises a regulatory sequence operably linked to the sequence(s) encoding the RNA-guided nuclease and/or the gRNA (e.g., a promoter sequence for increasing expression of the RNA-guided nuclease and the gRNA). In some embodiments, the RNA-guided nuclease and the gRNA are contacted with one or more cells, wherein the RNA-guided nuclease is in the form of a protein. In some embodiments, the gRNA is bound to the RNA- guided nuclease (e.g., as a ribonucleoprotein complex). In some embodiments, delivery of a Attorney Docket No. U1202.70128WO00 complex comprising an RNA-guided nuclease and a gRNA to one or more cells comprises electroporation. Gene Variants In some embodiments, agents (e.g., therapeutic agents and/or anti-RAN protein agents) comprise a protein kinase R (PKR) variant. As used herein, “protein kinase R (PKR) variant” refers to a protein comprising an amino acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a wild-type protein kinase R (PKR) (e.g., GenBank Accession No. NP_002750.1), wherein the variant protein comprises at least one amino acid variation (also referred to sometimes as “mutation”) relative to the amino acid sequence of the wild-type PKR. In some embodiments, the amino acid sequence of a PKR variant is at least 75%, at least 85%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the amino acid sequence of wild-type PKR. In some embodiments, the amino acid sequence is about 95- 99.9% identical to the amino acid sequence of wild-type PKR. In some embodiments, the protein comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 different amino acid sequence variations as compared to the sequence of amino acids set forth in the amino acid sequence of wild-type PKR. In some embodiments, a PKR variant comprises a mutation at position 296 (e.g., position 296 of a human wild-type PKR). In some embodiments, the mutation at position 296 is K296R. In some embodiments, a PKR variant is a dominant negative PKR variant. In some embodiments, PKR variants functions in a dominant negative manner to inhibit phosphorylation of eIF2α. Vectors In some embodiments, an agent (e.g., a therapeutic agent) is a vector or is expressed from a sequence comprised in a vector. In some embodiments, a vector comprises a sequence encoding an inhibitory nucleic acid, a gene variant, a transgene, a gRNA, and/or an RNA- guided nuclease described herein. In some embodiments, any of said agent may be encoded by a sequence comprised in a vector and provided to a cell (e.g., a cell in a subject) and expressed off of the vector. Attorney Docket No. U1202.70128WO00 In some embodiments, vectors comprise deoxyribonucleotides. In some embodiments, vectors comprise ribonucleotides. In some embodiments, vectors comprise both deoxyribonucleotides and ribonucleotides. In some embodiments, vectors are single-stranded. In some embodiments, vectors are double-stranded. In some embodiments, vectors are circular (e.g., artificial chromosomes, such as artificial bacterial chromosomes, or plasmids, such as circular plasmids, nanoplasmids, and minicircle plasmids). In some embodiments, vectors are linear. In some embodiments, vectors are self-complementary. In some embodiments, a vector may be maintained in high levels in a cell using a selection method, such as one involving an antibiotic resistance gene. In some embodiments, a vector may comprise a partitioning sequence which ensures stable inheritance of the vector. In some embodiments, a vector is a high copy number vector. In some embodiments, a vector is about 1 to 60 kb in size, for example from 1 to 50kb, from 1 to 30 kb, such as from 1 to 20 kb, for example from 1 to 15 kb, such as from 1 to 10, for example from 1 to 8 kb, such as from 2 to 7 kb, for example from 3 to 6 kb, such as from 4 to 5 kb. In some embodiments, a vector is sufficiently small to be effectively packaged in an rAAV viral particle (e.g., shorter than 5kb, shorter than 4 kb shorter than 3 kb, shorter than 2 kb, etc.). Recombinant Adeno-associated Virus (rAAV) Nucleic Acids and Particles Thereof In some embodiments, an agent (e.g., a therapeutic agent) is a recombinant adeno- associated virus (rAAV) particle. As used herein, the term “adeno-associated virus” or the abbreviation “AAV” refers to the virus itself or derivatives thereof. The term covers all AAV subtypes including both naturally occurring and recombinant forms, unless otherwise indicated. The term “recombinant AAV (rAAV)” refers to recombinant adeno-associated virus which refers to AAV comprising a nucleic acid sequence not of AAV origin (e.g., a heterologous nucleic acid). In some embodiments, a nucleic acid sequence found within an rAAV is an “rAAV genome” which refers to a nucleic acid comprising a heterologous nucleic acid flanked by 5’ and 3’ AAV inverted terminal repeats (ITRs). In such contexts, the term “heterologous nucleic acid” may refer to any DNA sequence that is not normally found between flanking AAV ITRs. In some embodiments, a heterologous nucleic acid comprises at least one transgene. As used herein, “transgene” refers to a DNA sequence which encodes at least one RNA to be expressed in a cell. In some embodiments, a heterologous nucleic acid (e.g., a Attorney Docket No. U1202.70128WO00 transgene) comprises a sequence encoding an agent (e.g., a therapeutic agent) described herein. In some embodiments, the agent is an inhibitory nucleic acid, a gene variant, a gRNA, and/or an RNA-guided nuclease described herein. In some embodiments, a heterologous nucleic acid (e.g., a transgene) comprises a sequence encoding an antibody or an antigen- binding fragment described herein. The term “AAV particle” or “rAAV particle” refers to a particle formed by one or more AAV capsid proteins. In some embodiments, AAV particles and rAAV particles comprise an encapsidated nucleic acid (e.g., an rAAV particle comprising an rAAV genome). In some embodiments, an rAAV particles comprises a nucleic acid (e.g., a heterologous nucleic acid found between AAV ITRs, such as a transgene) encoding an inhibitory nucleic acid, a gene variant, a gRNA, and/or an RNA-guided nuclease described herein. In some embodiments, rAAV particles are packaged using a packaging nucleic acid and/or a helper nucleic acid. As used herein, a “helper nucleic acid” refers to a nucleic acid (e.g., a helper vector or a nucleic acid provided in a helper virus) comprising one or more genes (e.g., E1, E2A, E4, and/or VA) which functions in trans for productive AAV replication and encapsidation. As used herein, a “packaging nucleic acid” refers to a nucleic acid (e.g., a packaging vector) which provides nucleotide sequences (e.g., AAV rep and AAV capsid protein gene sequences) upon which an AAV is dependent for replication (e.g., accessory functions). In some embodiments, expression of RNAs encoded by transgenes may be under the control (e.g., operably linked) to one or more regulatory sequences (e.g., enhancers, promoters, transcription start sites, translation start sites, splicing acceptor/donor sites, transcription termination sites, stop codons, polyA signals, etc.). In some embodiments, the regulatory sequence may be found between the AAV ITRs. However, in some embodiments, nucleic acids comprising transgenes may comprise one or more regulatory elements that are not operably linked to the transgene. In some embodiments, AAV particles and rAAV particles comprise an encapsidated nucleic acid (e.g., an rAAV particle comprising an rAAV genome). In some embodiments, the one or more capsid proteins correspond to an AAV serotype, AAV serotype derivative, or AAV pseudotype. Non-limiting examples of AAV particle and rAAV particle serotypes of the present disclosure include mammalian AAV1, mammalian AAV2, mammalian AAV3, mammalian AAV4, mammalian AAV5, mammalian AAV6, mammalian AAV7, mammalian Attorney Docket No. U1202.70128WO00 AAV8, mammalian AAV9, and mammalian AAV10. Non-limiting examples of rAAV pseudotypes include mammalian AAV2/1, mammalian AAV2/5, mammalian AAV2/6, mammalian AAV2/8, mammalian AAV2/9, mammalian AAV3/1, mammalian AAV3/5, mammalian AAV3/8, and mammalian AAV 3/9, wherein the slash denotes an rAAV genome of one serotype packaged in the capsid from a different serotype (e.g., an rAAV genome comprising AAV2 ITRs packaged in a capsid of AAV5 would be AAV2/5). In some embodiments, rAAV particles may be engineered with hybrid or mutant mammalian AAV capsid protein derivates, such as AAVrh.10, AAVrh.74, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15, AAV- HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15/17, AAVM41, AAV9.45, AAV6(Y445F/Y731F), AAV2.5T, AAV-HAE1/2, AAV clone 32/83, AAVShHIO, AAV2 (Y->F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, AAV2(pentaYF), AAV2- BCDG(T491V+K556R), AAV5-M2, AAV5(Y719F), AAV6(T492V+S663V), AAV6(T492V+Y705F+Y731F), AAV6(S551V+S663V), AAV8-C&G(T494V), AAV8-M3, AAV8(Y733F), AAV8(T494V+Y733F), AAV8(Y275F+Y447F+Y733F), AAV9-PHP.B, and AAVr3.45. Such AAV serotypes and derivatives/pseudotypes as well as methods for producing them have been previously described (see, e.g., Mol. Ther.2012 Apr;20(4):699- 708. doi: 10.1038/mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan Al, Schaffer DV, Samulski RJ; Duan et al, J. Virol., 75:7662- 7671, 2001; Halbert et al, J. Virol., 74:1524-1532, 2000; Zolotukhin et al, Methods, 28:158- 167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001; see, e.g., US Patent Publication No.: US 2005/0100890 A1; International Publication No.: WO 01/83692 A2; US Patent Publication No.: US 2003/0103939 A1; and Miller (1996). Proc. Natl. Acad. Sci., 93: 11407-11413). In some embodiments, rAAV particles are packaged using a packaging nucleic acid and/or a helper nucleic acid. Preferably, the AAV helper nucleic acid supports efficient AAV vector production without generating any detectable wild-type AAV particles (e.g., AAV particles containing functional rep and capsid protein genes). Helper nucleic acids, and methods of making said nucleic acids, have been previously described and are commercially available (see, e.g., pDM, pDG, pDP1rs, pDP2rs, pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG(R484E/R585E), and pDP8.ape plasmids from PlasmidFactory, Bielefeld, Germany; other products and services available from Vector Biolabs, Philadelphia, PA; Cellbiolabs, San Attorney Docket No. U1202.70128WO00 Diego, CA; Agilent Technologies, Santa Clara, Ca; and Addgene, Cambridge, MA; pxx6; Grimm et al. (1998), Novel Tools for Production and Purification of Recombinant Adenoassociated Virus Vectors, Human Gene Therapy, Vol.9, 2745-2760; Kern, A. et al. (2003), Identification of a Heparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids, Journal of Virology, Vol.77, 11072-11081.; Grimm et al. (2003), Helper Virus Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6, Molecular Therapy, Vol.7, 839-850; Kronenberg et al. (2005), A Conformational Change in the Adeno-Associated Virus Type 2 Capsid Leads to the Exposure of Hidden VP1 N Termini , Journal of Virology, Vol.79, 5296-5303; and Moullier, P. and Snyder, R.O. (2008), International efforts for recombinant adenoassociated viral vector reference standards, Molecular Therapy, Vol.16, 1185-1188). In some embodiments, a packaging nucleic acid comprises a AAV rep nucleic acid sequence and an AAV cap nucleic acid sequence. In some embodiments, the AAV rep nucleic acid sequence and/or the AAV cap nucleic acid sequence is of the same AAV serotype as the AAV ITRs flanking the heterologous nucleic acid. In some embodiments, the AAV rep nucleic acid sequence and the AAV ITRs are of the same AAV serotype but are of a different serotype relative to the AAV cap sequence. In some embodiments, the components cultured in a cell to package a rAAV genome in a capsid may be provided to the cell in trans. In some embodiments, rAAV particles may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650). In some embodiments, rAAV particles are produced by transfecting a cell with an AAV vector (comprising a heterologous nucleic acid flanked by ITR elements) to be packaged into rAAV particles, and at least one AAV helper or packaging nucleic acid. In some embodiments, two nucleic are used which include a helper nucleic acid and a packaging nucleic acid. Alternatively, in some embodiments, any one or more of the required components (e.g., heterologous nucleic acid flanked by AAV ITRs, rep sequences, cap sequences, and/or helper nucleic acids) may be provided by a cell which has been engineered to stably contain one or more of the required components (e.g., via genomic integration of a packaging nucleic acid and/or a helper nucleic acid). In some embodiments, the cell will contain the required component(s) under the control of either an inducible promoter or a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the Attorney Docket No. U1202.70128WO00 discussion of regulatory sequence suitable for use with a heterologous nucleic acid. Methods used to construct any engineered nucleic acid or rAAV particle thereof have also been previously described (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation of this disclosure. See, e.g., K. Fisher et al., J. Virol., 70:520-532 (1993) and U.S. Pat. No. 5,478,745). Antibodies and Antigen-Binding Fragments In some embodiments, an agent (e.g., therapeutic agent and/or an anti-RAN protein agent) may be an anti-RAN protein antibody or an antigen-binding fragment thereof. In some embodiments, an anti-RAN antibody can be a polyclonal antibody. In some embodiments, an anti-RAN antibody can be a monoclonal antibody. In some embodiments, an anti-RAN antigen-binding fragment can be derived from a polyclonal antibody. In some embodiments, can be derived from a monoclonal antibody. In some embodiments, an anti-RAN protein antibody or antigen-binding fragment may bind to an extracellular RAN protein, an intracellular RAN protein, or both extracellular and intracellular RAN proteins. In some embodiments, an agent (e.g., a therapeutic agent) is an antibody or antigen- binding fragment that is capable of recognizing a gene product that interacts with a RAN protein. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF2. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF2A. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3a. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3b. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3c. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3d. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3e. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3f. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3g. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3h. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3i. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3j. In some Attorney Docket No. U1202.70128WO00 embodiments, an antibody or an antigen-binding fragment is anti-eIF3k. In some embodiments, an antibody or an antigen-binding fragment is anti-eIF3l. In some embodiments, an antibody or an antigen-binding fragment is anti-eiF3m. In some embodiments, an antibody or an antigen-binding fragment is anti-PKR. In some embodiments, an antibody or an antigen-binding fragment is anti-p62. In some embodiments, an antibody or an antigen-binding fragment is anti-LC3 I subunit. In some embodiments, an antibody or an antigen-binding fragment is anti-LC3 II subunit. In some embodiments, an antibody or an antigen-binding fragment is anti-TARBP2. In some embodiments, an antibody or an antigen-binding fragment is anti-or TLR3). An “antibody” broadly refers to an immunoglobulin molecule or any functional mutant, variant, or derivation thereof. It is desired that functional mutants, variants, and derivations thereof, as well as antigen-binding fragments, retain the essential epitope binding features of an Ig molecule. Antibodies are capable of specific binding to a target through at least one antigen recognition site, located in the variable region of the immunoglobulin molecule. Generally, an intact or full-length antibody comprises two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and a first, second and third constant regions (CH1, CH2 and CH3). Each light chain contains a light chain variable region (VL) and a constant region (CL). The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). CDR constituents on the heavy chain are referred to as CDRH1, CDRH2, and CDRH3, while CDR constituents on the light chain are referred to as CDRL1, CDRL2, and CDRL3. The CDRs typically refer to the Kabat CDRs, as described in Sequences of Proteins of Immunological Interest, US Department of Health and Human Services (1991), eds. Kabat et al. Another standard for characterizing the antigen binding site is to refer to the hypervariable loops as described by Chothia. See, e.g., Chothia, D. et al. (1992) J. Mol. Biol. 227:799-817; and Tomlinson et al. (1995) EMBO J. 14:4628-4638. Still another standard is the AbM definition used by Oxford Molecular’s AbM antibody modeling software. See, generally, e.g., Protein Sequence and Structure Analysis of Antibody Variable Domains. In: Antibody Engineering Lab Manual (Ed.: Duebel, S, and Kontermann, R., Springer-Verlag, Heidelberg). Embodiments described with respect to Kabat CDRs can Attorney Docket No. U1202.70128WO00 alternatively be implemented using similar described relationships with respect to Chothia hypervariable loops or to the AbM-defined loops, or combinations of any of these methods. Each VH and VL is composed of three CDRs and four FRs, arranged from amino- terminus to carboxy-terminus in the following order: FRl, CDRl, FR2, CDR2, FR3, CDR3, FR4. A full-length antibody can be an antibody of any class, such as IgD, IgE, IgG, IgA, or IgM (or sub-class thereof), and the antibody need not be of any particular class. Depending on the antibody amino acid sequence of the constant domain of its heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. The heavy-chain constant domains that correspond to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively. The subunit structures and three- dimensional configurations of different classes of immunoglobulins are well known. The term “antigen-binding fragment” refers to any derivative of an antibody which is less than full-length, and that can bind specifically to a target. Preferably, antigen-binding fragments provided herein retain the ability to specifically bind to RAN protein. An antigen- binding fragment may comprise the heavy chain variable region (VH), the light chain variable region (VL), or both. Each of the VH and VL typically contains three complementarity determining regions CDR1, CDR2, and CDR3. Examples of antigen binding fragments include, but are not limited to, Fab, Fab’, F(ab’)2, scFv, Fv, dsFv, diabody, affibodies, and Fd fragments. Antigen binding fragments may be produced by any appropriate means. For instance, an antigen binding fragment may be enzymatically or chemically produced by fragmentation of an intact antibody or it may be recombinantly produced from a gene encoding the partial antibody sequence. Alternatively, an antigen binding fragment may be wholly or partially synthetically produced. An antigen binding fragment may optionally be a single chain antibody fragment. Alternatively, a fragment may comprise multiple chains which are linked together, for instance, by disulfide linkages. An antigen binding fragment may also optionally be a multimolecular complex. A functional antigen binding fragment will typically comprise at least about 50 amino acids and more typically will comprise at least about 200 amino acids. Single-chain Fvs (scFvs) are recombinant antigen binding fragments consisting of only the variable light chain (VL) and variable heavy chain (VH) covalently connected to one Attorney Docket No. U1202.70128WO00 another by a polypeptide linker. Either VL or VH may be the NH2-terminal domain. The polypeptide linker may be of variable length and composition so long as the two variable domains are bridged without serious steric interference. Typically, the linkers are comprised primarily of stretches of glycine and serine residues with some glutamic acid or lysine residues interspersed for solubility. ScFvs are encompassed within the term “antigen-binding fragment.” Diabodies are dimeric scFvs. The components of diabodies typically have shorter peptide linkers than most scFvs, and they show a preference for associating as dimers (see, e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R. J., et al. (1994) Structure 2: 1121-1123). Diabodies are also encompassed within the term “antigen- binding fragment.” A Fv fragment is an antigen binding fragment which consists of one VH and one VL domain held together by noncovalent interactions. Although the two domains of the Fv fragment, VL and VH, can be coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). Such single chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. The term dsFv is used herein to refer to an Fv with an engineered intermolecular disulfide bond to stabilize the VH-VL pair. dsFvs are also encompassed within the term “antigen-binding fragment.” A F(ab’)2 fragment is an antigen binding fragment essentially equivalent to that obtained from immunoglobulins (typically IgG) by digestion with an enzyme pepsin at pH 4.0-4.5. The fragment may be recombinantly produced. F(ab’)2 are also encompassed within the term “antigen-binding fragment.” A Fab fragment is an antigen binding fragment essentially equivalent to that obtained by reduction of the disulfide bridge or bridges joining the two heavy chain pieces in the F(ab’)2 fragment. The Fab’ fragment may be recombinantly produced. Fab’ are also encompassed within the term “antigen-binding fragment.” A Fab fragment is an antigen binding fragment essentially equivalent to that obtained by digestion of immunoglobulins (typically IgG) with the enzyme papain. The Fab fragment Attorney Docket No. U1202.70128WO00 may be recombinantly produced. The heavy chain segment of the Fab fragment is the Fd piece. Fab fragments are also encompassed within the term “antigen-binding fragment.” An affibody is a small protein comprising a three-helix bundle that functions as an antigen binding molecule (e.g., an antibody mimetic). Generally, affibodies are approximately 58 amino acids in length and have a molar mass of approximately 6 kDa. Affibody molecules with unique binding properties are acquired by randomization of 13 amino acids located in two alpha-helices involved in the binding activity of the parent protein domain. Specific affibody molecules binding a desired target protein can be isolated from pools (libraries) containing billions of different variants, using methods such as phage display. Affibodies are also encompassed within the term “antigen-binding fragment.” The term “human antibody” refers to antibodies having variable and constant regions corresponding substantially to, or derived from, antibodies obtained from human subjects, e.g., encoded by human germline immunoglobulin sequences or variants thereof. Human antibodies may include one or more amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo). Such mutations may present in one or more of the CDRs, particularly CDR3, or in one or more of the framework regions. In some embodiments, the human antibodies may have at least one, two, three, four, five, or more positions replaced with an amino acid residue that is not encoded by the human germline immunoglobulin sequence. However, the term "human antibody", as used herein, is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences. The term "recombinant human antibody", as used herein, is intended to include all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial human antibody library (Hoogenboom H. R., (1997) TIB Tech.15:62-70; Azzazy H., and Highsmith W. E., (2002) Clin. Biochem.35:425-445; Gavilondo J. V., and Larrick J. W. (2002) BioTechniques 29: 128-145; Hoogenboom H., and Chames P. (2000) Immunology Today 21:371-378), antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes (see, e.g., Taylor, L. D., et al. (1992) Nucl. Acids Res.20:6287-6295; Kellermann S-A., and Green L. L. (2002) Current Opinion in Biotechnology 13:593-597; Attorney Docket No. U1202.70128WO00 Little M. et al (2000) Immunology Today 21:364-370) or antibodies prepared, expressed, created or isolated by any other means that involves splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable and constant regions as defined above. In certain embodiments, however, such recombinant human antibodies may be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies may be sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo. In some embodiments, the anti-RAN protein antibody or antigen-binding fragment is an anti-poly-Serine, anti-poly(GR), anti-poly(PR), anti-poly(CP), anti-poly(GP), anti- poly(G), anti-poly(A), anti-poly(GA), anti-poly(GD), anti-poly(GE), anti-poly(GQ), anti- poly(GT), anti-poly(L), anti-poly(LP), anti-poly(LPAC) (SEQ ID NO: 31), anti-poly(LS), anti-poly(P), anti-poly(PA), anti-poly(QAGR) (SEQ ID NO: 35), anti-poly(RE), anti- poly(SP), anti-poly(VP), anti-poly(FP), anti-poly(GK), anti-poly(FTPLSLPV) (SEQ ID NO: 36), anti-poly(LLPSPSRC) (SEQ ID NO: 37), anti-poly(YSPLPPGV) (SEQ ID NO: 38), anti-poly(HREGEGSK) (SEQ ID NO: 39), anti-poly(TGRERGVN) (SEQ ID NO: 40), anti- poly(PGGRGE) (SEQ ID NO: 41), anti-poly(GRQRGVNT) (SEQ ID NO: 42), and/or anti- poly(GSKHREAE) (SEQ ID NO: 43) antibody (also referred to as α-poly(Ser), α-poly(PR), α-poly(GR), etc.) or antigen-binding fragment. In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GA). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(Ser). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(PR). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GR). In some embodiments, the antibody or antigen-binding fragment specifically binds polyLeu. In some embodiments, the antibody or antigen-binding fragment specifically binds polyAla. In some embodiments, the antibody or antigen-binding fragment specifically binds poly(LPAC) (SEQ ID NO: 31). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(QAGR) (SEQ ID NO: 35). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(CP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(G). In Attorney Docket No. U1202.70128WO00 some embodiments, the antibody or antigen-binding fragment specifically binds poly(GD). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GE). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GQ). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GT). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(LP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(LS). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(P). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(PA). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(RE). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(SP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(VP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(FP). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GK). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(FTPLSLPV) (SEQ ID NO: 36). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(LLPSPSRC) (SEQ ID NO: 37). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(YSPLPPGV) (SEQ ID NO: 38). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(HREGEGSK) (SEQ ID NO: 39). In some embodiments, the antibody or antigen- binding fragment specifically binds poly(TGRERGVN) (SEQ ID NO: 40). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(PGGRGE) (SEQ ID NO: 41). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GRQRGVNT) (SEQ ID NO: 42). In some embodiments, the antibody or antigen-binding fragment specifically binds poly(GSKHREAE) (SEQ ID NO: 43). In some embodiments, an anti-RAN antibody or antigen-binding fragment targets (e.g., specifically binds to) any portion of an interrupted RAN protein that does not comprise the poly-amino acid repeat, for example the C-terminus of an interrupted RAN protein (e.g., the C-terminus of a poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GR), poly(GT), poly(L), poly(LP), poly(LPAC) (SEQ ID NO:31), poly(LS), poly(P), poly(PA), poly(PR), poly(QAGR) (SEQ ID NO: 35), poly(RE), poly(Ser), poly(SP), poly(VP), poly(FP), poly(GK), poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ Attorney Docket No. U1202.70128WO00 ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), poly(PGGRGE) (SEQ ID NO: 41) protein, poly(GRQRGVNT) (SEQ ID NO: 42), and/or poly(GSKHREAE) (SEQ ID NO: 43)). Examples of anti-RAN antibodies targeting the C-terminus of RAN proteins are disclosed, for example, in U.S. Publication No.2013/0115603, the entire content of which is incorporated herein by reference. In some embodiments, a set (or combination) of anti-RAN antibodies or antigen- binding fragments (e.g., a combination of two or more anti-RAN antibodies selected from poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GR), poly(GT), poly(L), poly(LP), poly(LPAC) (SEQ ID NO: 31), poly(LS), poly(P), poly(PA), poly(PR), poly(QAGR) (SEQ ID NO: 32), poly(RE), poly(Ser), poly(SP), poly(VP), poly(FP), poly(GK), poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), poly(PGGRGE) (SEQ ID NO: 41), poly(GRQRGVNT) (SEQ ID NO: 42), and poly(GSKHREAE) (SEQ ID NO: 43) etc.) are administered to a subject for the purpose of treating a disease associated with RAN proteins (e.g., interrupted RAN proteins). It should be appreciated that, in some embodiments, the disclosure contemplates variants (e.g., homologs) of amino acid and nucleic acid sequences for the heavy chain variable region and light chain variable region of the antibodies. “Homology” refers to the percent identity between two polynucleotides or two polypeptide moieties. The term "substantial homology", when referring to a nucleic acid, or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in about 90 to 100% of the aligned sequences. For example, in some embodiments, nucleic acid sequences sharing substantial homology are at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98% at least 99% sequence identity. When referring to a polypeptide, or fragment thereof, the term “substantial homology” indicates that, when optimally aligned with appropriate gaps, insertions or deletions with another polypeptide, there is nucleotide sequence identity in about 90 to 100% of the aligned sequences. The term "highly conserved" means at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. For example, in Attorney Docket No. U1202.70128WO00 some embodiments, highly conserved proteins share at least 85%, at least 90%, at least 91%, at least 92% at least 93%, at least 94%, at least 95%, at least 96% at least 97%, at least 98% at least 99% identity. In some cases, highly conserved may refer to 100% identity. Identity is readily determined by one of skill in the art by, for example, the use of algorithms and computer programs known by those of skill in the art. In some embodiments, RAN antibodies of the disclosure can bind to an interrupted RAN protein with high affinity, e.g., with a Kd less than 10-7 M, 10-8 M, 10-9 M, 10-10 M, 10-11 M or lower. For example, anti-RAN antibodies or antigen binding fragments can bind to an interrupted RAN protein with an affinity between 5 pM and 500 nM, e.g., between 50 pM and 100 nM, e.g., between 500 pM and 50 nM. The disclosure also includes antibodies or antigen binding fragments that compete with any of the antibodies described herein for binding to Interrupted RAN proteins and that have an affinity of 50 nM or lower (e.g., 20 nM or lower, 10 nM or lower, 500 pM or lower, 50 pM or lower, or 5 pM or lower). The affinity and binding kinetics of the anti-RAN protein antibody can be tested using any method known in the art including but not limited to biosensor technology (e.g., OCTET or BIACORE). In some embodiments, anti-RAN antibodies of the present disclosure may comprise one or more of VH, VL, and CDR, amino acid sequences shown in the tables below. In some embodiments, anti-RAN protein antibodies may be produced using one or more of the nucleic acids shown in the tables below. Table 9 – Amino Acid Sequences of Anti-RAN Antibodies Attorney Docket No. U1202.70128WO00 Table 10 – Nucleic Acid Sequences of Anti-RAN Antibodies Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Table 11 – Nucleic Acid and Amino Acid Framework Sequences of Anti-RAN Antibodies Attorney Docket No. U1202.70128WO00 Table 12 – Constant Region Sequences Attorney Docket No. U1202.70128WO00 In some embodiments, antibody clone 27B11.A7 binds to polyGA. In some embodiments, clone 27B11.A7 is an IgG1 antibody. In some embodiments, antibody clone 23H2.D1.B5 binds to polyGA. In some embodiments, antibody clone 23H2.D1.B5 is an IgG3 antibody. In some embodiments, antibody clone 16A3.C8 binds to poly(Ser). In some embodiments, antibody clone 16A3.C8 is an IgG1 antibody. In some embodiments, antibody clone HL2362-2G4 binds to polyPR. In some embodiments, antibody clone HL2362-2G4 is IgG2A kappa antibody. Anti-RAN Antibody Production Typically, polyclonal antibodies are produced by inoculation of a suitable mammal, such as a mouse, rabbit or goat. An antigen is injected into the mammal. This induces the B- lymphocytes to produce IgG immunoglobulins specific for the antigen. This polyclonal IgG is purified from the mammal's serum. Monoclonal antibodies are generally produced by a single cell line (e.g., a hybridoma cell line). In some embodiments, an anti-RAN antibody is purified (e.g., isolated from serum). Exemplary anti-RAN antibodies disclosed herein were produced using the antigens set forth in Table 13. In some embodiments, an antigen comprises an interrupted RAN protein repeat sequence selected from poly(Proline-Arginine) [poly(PR)]; poly(Glycine-Arginine) Attorney Docket No. U1202.70128WO00 [poly(GR)]; poly(Serine) [poly(Ser)]; poly(Cysteine-Proline) [poly(CP)]; poly(Glycine- Proline) [(poly(GP)]; poly(Glycine) [poly(G)]; poly(Ala) [polyAla]; poly(Glycine-Alanine) [poly(GA)]; poly(Glycine-Aspartate) [poly(GD)]; poly(Glycine-Glutamate) [poly(GE)]; poly(Glycine-Glutamine) [poly(GQ)]; poly(Glycine-Threonine) [poly(GT)]; poly(Leucine) [polyLeu]; poly(Leucine-Proline) [poly(LP)]; poly(Leucine-Proline-Alanine-Cysteine) [poly(LPAC)] (SEQ ID NO: 31); poly(Leucine-Serine) [poly(LS)]; poly(Proline) [poly(P)]; poly(Proline-Alanine) [poly(PA)]; poly(Glutamine-Alanine-Glycine-Arginine) [poly(QAGR)] (SEQ ID NO: 35); poly(Arginine-Glutamate) [poly(RE)]; poly(Serine-Proline) [poly(SP)], poly(Valine-Proline) [poly(VP)], poly(phenylalanine-proline) [poly(FP)], poly(glycine-lysine) [poly(GK)], poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), poly(PGGRGE) (SEQ ID NO: 41), poly(GRQRGVNT) (SEQ ID NO: 42), and poly(GSKHREAE) (SEQ ID NO: 43). Table 13 – Antigens for producing RAN antibodies Numerous methods may be used for obtaining anti-RAN antibodies. For example, antibodies can be produced using recombinant DNA methods. Monoclonal antibodies may also be produced by generation of hybridomas (see, e.g., Kohler and Milstein (1975) Nature, 256: 495-499) in accordance with known methods. Hybridomas formed in this manner are then screened using standard methods, such as enzyme-linked immunosorbent assay (ELISA; e.g., RCA-based ELISA or rtPCR-based ELISA) and surface plasmon resonance (e.g., OCTET or BIACORE) analysis, to identify one or more hybridomas that produce an antibody that specifically binds with a specified antigen. Any form of the specified antigen (e.g., an interrupted RAN protein) may be used as the immunogen, e.g., recombinant antigen, naturally occurring forms, any variants or fragments thereof. One exemplary method of Attorney Docket No. U1202.70128WO00 making antibodies includes screening protein expression libraries that express antibodies or fragments thereof (e.g., scFv), e.g., phage or ribosome display libraries. Phage display is described, for example, in Ladner et al., U.S. Pat. No.5,223,409; Smith (1985) Science 228: 1315-1317; Clackson et al. (1991) Nature, 352: 624-628; Marks et al. (1991) J. Mol. Biol., 222: 581-597W092/18619; WO 91/17271 ; WO 92/20791; WO 92/15679; WO 93/01288; WO 92/01047; WO 92/09690; and WO 90/02809. In another embodiment, a monoclonal antibody is obtained from the non-human animal, and then modified, e.g., made chimeric, using recombinant DNA techniques known in the art. A variety of approaches for making chimeric antibodies have been described. See, e.g., Morrison et al., Proc. Natl. Acad. Sci. U.S.A.81:6851, 1985; Takeda et al., Nature 314:452, 1985, Cabilly at al., U.S. Pat. No.4,816,567; Boss et al., U.S. Pat. No.4,816,397; Tanaguchi et al., European Patent Publication EP171496; European Patent Publication 0173494, United Kingdom Patent GB 2177096B. Antibodies can also be humanized by methods known in the art. For example, monoclonal antibodies with a desired binding specificity can be commercially humanized (Scotgene, Scotland; and Oxford Molecular, Palo Alto, Calif.). Fully humanized antibodies, such as those expressed in transgenic animals are within the scope of the invention (see, e.g., Green et al. (1994) Nature Genetics 7, 13; and U.S. Patent Nos.5,545,806 and 5,569,825). For additional antibody production techniques, see, Antibodies: A Laboratory Manual, Second Edition. Edited by Edward A. Greenfield, Dana-Farber Cancer Institute, ©2014. The present disclosure is not necessarily limited to any particular source, method of production, or other special characteristics of an antibody. Some aspects of the present disclosure relate to isolated cells (e.g., host cells) transformed with a polynucleotide or vector. Host cells may be a prokaryotic or eukaryotic cell. The polynucleotide or vector which is present in the host cell may either be integrated into the genome of the host cell or it may be maintained extrachromosomally. The host cell can be any prokaryotic or eukaryotic cell, such as a bacterial, insect, fungal, plant, animal or human cell. In some embodiments, fungal cells are, for example, those of the genus Saccharomyces, in particular those of the species S. cerevisiae. The term "prokaryotic" includes all bacteria which can be transformed or transfected with a DNA or RNA molecules for the expression of an antibody or the corresponding immunoglobulin chains. Prokaryotic hosts may include gram negative as well as gram positive bacteria such as, for example, E. Attorney Docket No. U1202.70128WO00 coli, S. typhimurium, Serratia marcescens and Bacillus subtilis. The term "eukaryotic" includes yeast, higher plants, insects and vertebrate cells, e.g., mammalian cells, such as NSO and CHO cells. Depending upon the host employed in a recombinant production procedure, the antibodies or immunoglobulin chains encoded by the polynucleotide may be glycosylated or may be non-glycosylated. Antibodies or the corresponding immunoglobulin chains may also include an initial methionine amino acid residue. In some embodiments, once a vector has been incorporated into an appropriate host, the host may be maintained under conditions suitable for high level expression of the nucleotide sequences, and, as desired, the collection and purification of the immunoglobulin light chains, heavy chains, light/heavy chain dimers or intact antibodies, antigen binding fragments or other immunoglobulin forms may follow; see, Beychok, Cells of Immunoglobulin Synthesis, Academic Press, N.Y., (1979). Thus, polynucleotides or vectors are introduced into the cells which in turn produce the antibody or antigen binding fragments. Furthermore, transgenic animals, preferably mammals, comprising the aforementioned host cells may be used for the large scale production of the antibody or antibody fragments. The transformed host cells can be grown in fermenters and cultured according to techniques known in the art to achieve optimal cell growth. Once expressed, the whole antibodies, their dimers, individual light and heavy chains, other immunoglobulin forms, or antigen binding fragments, can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like; see, Scopes, "Protein Purification", Springer Verlag, N.Y. (1982). The antibody or antigen binding fragments can then be isolated from the growth medium, cellular lysates, or cellular membrane fractions. The isolation and purification of the, e.g., microbially expressed antibodies or antigen binding fragments may be by any conventional means such as, for example, preparative chromatographic separations and immunological separations such as those involving the use of monoclonal or polyclonal antibodies directed, e.g., against the constant region of the antibody. Aspects of the disclosure relate to a hybridoma, which provides an indefinitely prolonged source of monoclonal antibodies. As used herein, “hybridoma cell” refers to an immortalized cell derived from the fusion of B lymphoblasts with a myeloma fusion partner. For preparing monoclonal antibody-producing cells (e.g., hybridoma cells), an individual animal whose antibody titer has been confirmed (e.g., a mouse) is selected, and 2 days to 5 Attorney Docket No. U1202.70128WO00 days after the final immunization, its spleen or lymph node is harvested and antibody- producing cells contained therein are fused with myeloma cells to prepare the desired monoclonal antibody producer hybridoma. Measurement of the antibody titer in antiserum can be carried out, for example, by reacting the labeled protein, as described hereinafter and antiserum and then measuring the activity of the labeling agent bound to the antibody. The cell fusion can be carried out according to known methods, for example, the method described by Kochler and Milstein (Nature 256:495 (1975)). As a fusion promoter, for example, polyethylene glycol (PEG) or Sendai virus (HVJ) is used. Examples of myeloma cells include NS-1, P3U1, SP2/0, AP-1 and the like. The proportion of the number of antibody producer cells (spleen cells) and the number of myeloma cells to be used is preferably about 1:1 to about 20:1. PEG (preferably PEG 1000- PEG 6000) is preferably added in concentration of about 10% to about 80%. Cell fusion can be carried out efficiently by incubating a mixture of both cells at about 20ºC to about 40 ºC, preferably about 30 ºC to about 37 ºC for about 1 minute to 10 minutes. Various methods may be used for screening for a hybridoma producing the antibody (e.g., against a tumor antigen or autoantibody of the present invention). For example, where a supernatant of the hybridoma is added to a solid phase (e.g., microplate) to which antibody is adsorbed directly or together with a carrier and then an anti-immunoglobulin antibody (if mouse cells are used in cell fusion, anti-mouse immunoglobulin antibody is used) or Protein A labeled with a radioactive substance or an enzyme is added to detect the monoclonal antibody against the protein bound to the solid phase. Alternately, a supernatant of the hybridoma is added to a solid phase to which an anti-immunoglobulin antibody or Protein A is adsorbed and then the protein labeled with a radioactive substance or an enzyme is added to detect the monoclonal antibody against the protein bound to the solid phase. Selection of the monoclonal antibody can be carried out according to any known method or its modification. Normally, a medium for animal cells to which HAT (hypoxanthine, aminopterin, thymidine) are added is employed. Any selection and growth medium can be employed as long as the hybridoma can grow. For example, RPMI 1640 medium containing 1% to 20%, preferably 10% to 20% fetal bovine serum, GIT medium containing 1% to 10% fetal bovine serum, a serum free medium for cultivation of a hybridoma (SFM-101, Nissui Seiyaku) and the like can be used. Normally, the cultivation is carried out at 20ºC to 40ºC, preferably 37ºC for about 5 days to 3 weeks, preferably 1 week to Attorney Docket No. U1202.70128WO00 2 weeks under about 5% CO2 gas. The antibody titer of the supernatant of a hybridoma culture can be measured according to the same manner as described above with respect to the antibody titer of the anti-protein in the antiserum. As an alternative to obtaining immunoglobulins directly from the culture of hybridomas, immortalized hybridoma cells can be used as a source of rearranged heavy chain and light chain loci for subsequent expression and/or genetic manipulation. Rearranged antibody genes can be reverse transcribed from appropriate mRNAs to produce cDNA. If desired, the heavy chain constant region can be exchanged for that of a different isotype or eliminated altogether. The variable regions can be linked to encode single chain Fv regions. Multiple Fv regions can be linked to confer binding ability to more than one target or chimeric heavy and light chain combinations can be employed. Any appropriate method may be used for cloning of antibody variable regions and generation of recombinant antibodies. In some embodiments, an appropriate nucleic acid that encodes variable regions of a heavy and/or light chain is obtained and inserted into an expression vector which can be transfected into standard recombinant host cells. A variety of such host cells may be used. In some embodiments, mammalian host cells may be advantageous for efficient processing and production. Typical mammalian cell lines useful for this purpose include CHO cells, 293 cells, or NSO cells. The production of the antibody or antigen binding fragment may be undertaken by culturing a modified recombinant host under culture conditions appropriate for the growth of the host cells and the expression of the coding sequences. The antibodies or antigen binding fragments may be recovered by isolating them from the culture. The expression systems may be designed to include signal peptides so that the resulting antibodies are secreted into the medium; however, intracellular production is also possible. The disclosure also includes a polynucleotide encoding at least a variable region of an immunoglobulin chain of the antibodies described herein. In some embodiments, the variable region encoded by the polynucleotide comprises at least one complementarity determining region (CDR) of the VH and/or VL of the variable region of the antibody produced by any one of the above described hybridomas. Polynucleotides encoding antibody or antigen binding fragments may be, e.g., DNA, cDNA, RNA or synthetically produced DNA or RNA or a recombinantly produced chimeric nucleic acid molecule comprising any of those polynucleotides either alone or in combination. In some embodiments, a polynucleotide is part of a vector. Such vectors may Attorney Docket No. U1202.70128WO00 comprise further genes such as marker genes which allow for the selection of the vector in a suitable host cell and under suitable conditions. In some embodiments, a polynucleotide is operatively linked to expression control sequences allowing expression in prokaryotic or eukaryotic cells. Expression of the polynucleotide comprises transcription of the polynucleotide into a translatable mRNA. Regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells, are well known to those skilled in the art. They may include regulatory sequences that facilitate initiation of transcription and optionally poly-A signals that facilitate termination of transcription and stabilization of the transcript. Additional regulatory elements may include transcriptional as well as translational enhancers, and/or naturally associated or heterologous promoter regions. Possible regulatory elements permitting expression in prokaryotic host cells include, e.g., the PL, Lac, Trp or Tac promoter in E. coli, and examples of regulatory elements permitting expression in eukaryotic host cells are the AOX1 or GAL1 promoter in yeast or the CMV-promoter, SV40-promoter, RSV-promoter (Rous sarcoma virus), CMV- enhancer, SV40-enhancer or a globin intron in mammalian and other animal cells. Beside elements which are responsible for the initiation of transcription such regulatory elements may also include transcription termination signals, such as the SV40- poly-A site or the tk-poly-A site, downstream of the polynucleotide. Furthermore, depending on the expression system employed, leader sequences capable of directing the polypeptide to a cellular compartment or secreting it into the medium may be added to the coding sequence of the polynucleotide and are well known in the art. The leader sequence(s) is (are) assembled in appropriate phase with translation, initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein, or a portion thereof, into, for example, the extracellular medium. Optionally, a heterologous polynucleotide sequence can be used that encode a fusion protein including a C- or N- terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product. In some embodiments, polynucleotides encoding at least the variable domain of the light and/or heavy chain may encode the variable domains of both immunoglobulin chains or only one. Likewise, polynucleotides may be under the control of the same promoter or may be separately controlled for expression. Furthermore, some aspects relate to vectors, particularly plasmids, cosmids, viruses and bacteriophages used conventionally in genetic Attorney Docket No. U1202.70128WO00 engineering that comprise a polynucleotide encoding a variable domain of an immunoglobulin chain of an antibody or antigen binding fragment; optionally in combination with a polynucleotide that encodes the variable domain of the other immunoglobulin chain of the antibody. In some embodiments, expression control sequences are provided as eukaryotic promoter systems in vectors capable of transforming or transfecting eukaryotic host cells, but control sequences for prokaryotic hosts may also be used. Expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, or bovine papilloma virus, may be used for delivery of the polynucleotides or vector into targeted cell population (e.g., to engineer a cell to express an antibody or antigen binding fragment). A variety of appropriate methods can be used to construct recombinant viral vectors. In some embodiments, polynucleotides and vectors can be reconstituted into liposomes for delivery to target cells. The vectors containing the polynucleotides (e.g., the heavy and/or light variable domain(s) of the immunoglobulin chains encoding sequences and expression control sequences) can be transferred into the host cell by suitable methods, which vary depending on the type of cellular host. Modifications Some aspects of the disclosure relate to antibody-drug conjugates targeted against one or more interrupted RAN proteins. As used herein, “antibody drug conjugate” refers to molecules comprising an antibody, or antigen binding fragment thereof, linked to a targeted molecule (e.g., a biologically active molecule, such as a therapeutic molecule, and/or a detectable label). Accordingly, in some embodiments, antibodies or antigen binding fragments of the disclosure may be modified with a detectable label, including, but not limited to, an enzyme, prosthetic group, fluorescent material, luminescent material, bioluminescent material, radioactive material, positron emitting metal, nonradioactive paramagnetic metal ion, and affinity label for detection and isolation of one or more Interrupted RAN proteins. The detectable substance may be coupled or conjugated either directly to the polypeptides of the disclosure or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. Non-limiting examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β- galactosidase, glucose oxidase, or acetylcholinesterase; non-limiting examples of suitable Attorney Docket No. U1202.70128WO00 prosthetic group complexes include streptavidin/biotin and avidin/biotin; non-limiting examples of suitable fluorescent materials include biotin, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; an example of a luminescent material includes luminol; non-limiting examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive material include a radioactive metal ion, e.g., alpha-emitters or other radioisotopes such as, for example, iodine (131I, 125I, 123I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (115mIn, 113mIn, 112In, 111In), and technetium (99Tc, 99mTc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F), 153Sm, Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 86R, 188Re, 142Pr, 105Rh, 97Ru, 68Ge, 57Co, 65Zn, 85Sr, 32P, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, and tin (113Sn, 117Sn). The detectable substance may be coupled or conjugated either directly to the anti-RAN antibodies or antigen-binding fragments of the disclosure or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. Anti-RAN antibodies conjugated to a detectable substance may be used for diagnostic assays as described herein. In some embodiments, antibodies or antigen binding fragments of the disclosure may be modified with a therapeutic moiety (e.g., therapeutic agent). In some embodiments, the antibody is coupled to the targeted agent via a linker. As used herein, the term "linker" refers to a molecule or sequence, such as an amino acid sequence, that attaches, as in a bridge, one molecule or sequence to another molecule or sequence. "Linked," "conjugated," or "coupled" means attached or bound by covalent bonds, or non-covalent bonds, or other bonds, such as van der Waals forces. Antibodies described by the disclosure can be linked to the targeted agent (e.g., therapeutic moiety or detectable moiety) directly, e.g., as a fusion protein with protein or peptide detectable moieties (with or without an optional linking sequence, e.g., a flexible linker sequence) or via a chemical coupling moiety. A number of such coupling moieties are known in the art, e.g., a peptide linker or a chemical linker, e.g., as described in International Patent Application Publication No. WO 2009/036092. In some embodiments, the linker is a flexible amino acid sequence. Examples of flexible amino acid sequences include glycine and serine rich linkers, which comprise a stretch of two or more glycine residues. In some embodiments, the linker is a photolinker. Examples of photolinkers Attorney Docket No. U1202.70128WO00 include ketyl-reactive benzophenone (BP), anthraquinone (AQ), nitrene-reactive nitrophenyl azide (NPA), and carbene-reactive phenyl-(trifluoromethyl)diazirine (PTD). Compositions In some embodiments, a composition (e.g., a pharmaceutical composition) comprises one or more agents (e.g., therapeutic agents and/or anti-RAN protein agents) described herein. In some embodiments, a composition (e.g., a pharmaceutical composition) comprises a small molecule described herein. In some embodiments, a composition (e.g., a pharmaceutical composition) comprises a nucleic acid described herein. In some embodiments, a composition (e.g., a pharmaceutical composition) comprises an inhibitory nucleic acid, a gene variant, a gRNA, and/or an RNA-guided nuclease described herein. In some embodiments, a composition (e.g., a pharmaceutical composition) comprises antibodies (e.g., anti-RAN protein antibodies) or antigen binding fragments. In some embodiments, a composition comprises an agent (e.g., a therapeutic agent) described herein and a pharmaceutically acceptable carrier. In some embodiments, the composition comprises an anti-RAN antibody and a pharmaceutically acceptable carrier. A composition is said to be a “pharmaceutically acceptable carrier” if its administration can be tolerated by a recipient patient. Sterile phosphate-buffered saline is one example of a pharmaceutically acceptable carrier. Other suitable carriers are well-known in the art. See, for example, REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Ed. (1990). As used herein the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions. Pharmaceutical compositions can be prepared as described below. The active ingredients may be admixed or compounded with any conventional, pharmaceutically acceptable carrier or excipient. The compositions may be sterile. It will be understood by those skilled in the art that any mode of administration, vehicle or carrier conventionally employed and which is inert with respect to the active agent Attorney Docket No. U1202.70128WO00 may be utilized for preparing and administering the pharmaceutical compositions of the present disclosure. Illustrative of such methods, vehicles and carriers are those described, for example, in Remington's Pharmaceutical Sciences, 4th ed. (1970), the disclosure of which is incorporated herein by reference. Those skilled in the art, having been exposed to the principles of the disclosure, will experience no difficulty in determining suitable and appropriate vehicles, excipients and carriers or in compounding the active ingredients therewith to form the pharmaceutical compositions of the disclosure. Typically, a composition (e.g., a pharmaceutical composition) is formulated for delivering an effective amount of an agent (e.g., an anti-RAN antibody). In general, an “effective amount” of an active agent refers to an amount sufficient to elicit the desired biological response (e.g., ameliorating one or more symptoms of AD or ALS). An effective amount of an agent may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated (e.g., AD or ALS, repeat expansion diseases, etc.), the mode of administration, and the patient. In certain embodiments, the effective amount is an amount effective in reducing the level of RAN proteins (e.g., interrupted RAN proteins) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of interrupted RAN proteins relative to the level of interrupted RAN proteins in a cell or subject that has not been administered a therapeutic agent). In certain embodiments, the effective amount is an amount effective in reducing the translation of RAN proteins (e.g., interrupted RAN proteins) by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% (e.g., the level of interrupted RAN proteins relative the level of RAN proteins in a cell or subject that has not been administered a therapeutic agent). In some embodiments, an effective amount, also referred to as a therapeutically effective amount, of an agent (e.g., a therapeutic agent, such as an anti-RAN antibody) is an amount sufficient to ameliorate at least one adverse effect associated with a disease associated with RAN proteins (e.g., interrupted RAN proteins), such as, e.g., memory loss, cognitive impairment, loss of coordination, speech impairment, etc. In some embodiments, the neurological disease associated with RAN proteins (e.g., interrupted RAN proteins) is selected from the group consisting of: amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome Attorney Docket No. U1202.70128WO00 (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), and Fuch’s Corneal Dystrophy. In some embodiments, the neurological disease associated with interrupted RAN proteins is ALS or AD. The therapeutically effective amount to be included in pharmaceutical compositions depends, in each case, upon several factors, e.g., the type, size and condition of the patient to be treated, the intended mode of administration, the capacity of the patient to incorporate the intended dosage form, etc. Generally, an amount of active agent is included in each dosage form to provide from about 0.1 to about 250 mg/kg, and preferably from about 0.1 to about 100 mg/kg. One of ordinary skill in the art would be able to determine empirically an appropriate therapeutically effective amount. Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and selected mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular therapeutic agent being administered, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular nucleic acid and/or other therapeutic agent without necessitating undue experimentation. The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols. Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the Attorney Docket No. U1202.70128WO00 skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see, Langer R (1990) Science 249:1527-1533, which is incorporated herein by reference. The compounds may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group. The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories. Detection Methods As used herein, “biological samples” may refer to any specimen derived or obtained from a subject having or suspected of having a disease (e.g., neurological disease) associated with RAN proteins expression, translation, and/or accumulation. In some embodiments, the biological sample is blood, serum (e.g., plasma from which the clotting proteins have been removed) or cerebrospinal fluid (CSF). In some embodiments, a biological sample is a tissue Attorney Docket No. U1202.70128WO00 sample, for example central nervous system (CNS) tissue, such as brain tissue or spinal cord tissue. The skilled artisan will recognize other biological samples, such as cells (e.g., brain cells, neuronal cells, skin cells, etc.) suitable for methods described by the disclosure. In some embodiments, methods of detecting one or more interrupted RAN proteins in a biological sample are useful for monitoring the progress of a disease associated with RAN protein expression, translation, and/or accumulation. In some embodiments, a biological sample is obtained from a subject having or suspected of have a disease selected from the group consisting of: amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), and Fuch’s Corneal Dystrophy. In some embodiments, a biological sample is obtained from a subject expressing one or more interrupted RAN proteins from a gene or chromosomal locus listed in Table 1 or Table 6.. In some embodiments, a biological sample is obtained from a subject expressing one or more interrupted RAN proteins from a gene selected from a group consisting of: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, Attorney Docket No. U1202.70128WO00 METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, CXADRP3, LINC00668, MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1- 124K5.11, ABCB4, MFSD3, SOX17, MTDH, RRS1-AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5-8SN5, SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, a biological sample is obtained from a subject expressing one or more interrupted RAN proteins from a gene, such as ARMCX4, ALK, and/or CASP8. In some embodiments, a biological sample has been subjected to one or more processing steps prior to being used in a detection method. In some embodiments, a biological sample has been subjected to one or more of enzymatic digestion (e.g., with a nuclease and/or a protease), contacted with a chemical (e.g., for the purposes of cell permeabilization, cell lysis, and/or for improving sample stability), or storage for a given time period (e.g., about 6, 5, 4, 3, 2, or 1 weeks or 6, 5, 4, 3, 2, or 1 days) and/or at a given temperature (e.g., at 25 oC, 4 oC, -20 oC or lower). In some embodiments, a biological sample has been subjected to one or more steps that removes and/or enriches for one or more cell types in the biological sample. In some embodiments, a blood sample has been subjected to one or more steps to isolate and/or enrich for leukocytes and/or lymphocytes present in the blood sample. In some embodiments, methods described herein comprise detecting a RAN protein (e.g., an interrupted RAN protein) or an RNA transcript or a DNA sequence encoding the RAN protein in a biological sample. In some embodiments, methods described herein Attorney Docket No. U1202.70128WO00 comprise subjecting a biological sample to one or more detection methods to determine the presence, absence, or levels (e.g., levels relative to a control sample) of a RAN protein (e.g., an interrupted RAN protein). In some embodiments, methods described herein may comprise obtaining or having obtained a biological sample from a subject having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation. In some embodiments, methods described herein may comprise performing or having performed one or more detection methods on a biological sample obtained from a subject having or suspected of having a disease associated with RAN protein expression, translation, and/or accumulation. In some embodiments, differential aggregation properties of RAN proteins (e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins) having different lengths can be used to detect RAN proteins (e.g., interrupted RAN proteins) in a biological sample. In some embodiments, longer RAN proteins (e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins) are found at higher levels in biological samples, such as blood, serum, or CSF. In some embodiments, RAN proteins (e.g., interrupted RAN proteins, such as interrupted poly(GR) RAN proteins or interrupted poly(GA) RAN proteins) having poly-amino acid repeats >40, >50, >60, >70, or >80 amino acid residues in length are detectable in a biological sample. In some embodiments, methods described herein comprise detecting a RAN protein (e.g., an interrupted RAN protein) or an RNA transcript or a DNA sequence encoding the RAN protein in a biological sample and a control sample. In some embodiments, detecting the presence, absence, or levels (e.g., relative levels) of a RAN protein (e.g., an interrupted RAN protein) or an RNA transcript or a DNA sequence encoding the RAN protein in a biological sample further comprises subjecting a control sample to same detection conditions (e.g., the same assay) that the biological sample was subjected to. In some embodiments, a control sample may be a sample lacking the RAN protein (e.g., an interrupted RAN protein) or an RNA transcript or a DNA sequence encoding the RAN protein. In some embodiments, a control sample may be a sample comprising a nucleic acid with a normal amount (e.g., an amount which is not pathogenic or associated with a disease) of expansion repeats. In some embodiments, methods described herein comprise detecting a change in the level of a RAN protein (e.g., interrupted RAN protein) or RNA transcript or DNA sequence Attorney Docket No. U1202.70128WO00 thereof. In some embodiments, a RAN protein (e.g., interrupted RAN protein) or RNA transcript or DNA sequence thereof is detected (e.g., at an elevated level) when a signal corresponding to the presence of the RAN protein or RNA transcript or DNA sequence thereof in a biological sample is higher relative to a signal corresponding to the presence of the RAN protein or RNA transcript or DNA sequence thereof in a control sample (e.g., increased by at least 1.1-10.0 fold or at least 10%-1000%). In some embodiments, a RAN protein (e.g., interrupted RAN protein) or RNA transcript or DNA sequence thereof is detected (e.g., at a reduced level) when a signal corresponding to the presence of the RAN protein or RNA transcript or DNA sequence thereof in a biological sample is lower relative to a signal corresponding to the presence of the RAN protein or RNA transcript or DNA sequence thereof in a control sample (e.g., decreased by at least 1.1-10.0 fold or at least 10%- 1000%). In some embodiments, methods described herein comprise obtaining or having obtained a first biological sample from a subject at a first time point and obtaining or having obtained a second biological sample from the subject at a second time point. In some embodiments, the first biological sample or the second biological is a control sample. In some embodiments, the first time point occurs before the subject was administered a therapeutic agent and the second time point occurs after the subject was administered the therapeutic agent. In some embodiments, the first time point occurs during a course of treatment of the subject with a therapeutic agent and the second time point occurs after the subject has completed the course of treatment with the therapeutic agent. However, in other embodiments, the subject may be receiving treatment with a therapeutic agent during both the first time point and the second time point or not receiving treatment during either the first time point or the second time point. In some embodiments, methods described herein comprise performing or having performed a first assay on the first biological sample and performing or having performed a second assay on the second biological. In some embodiments, the first assay and the second assay are performed at the same or different time points. In some embodiments, the first assay and the second assay comprise a detection method described herein. In some embodiments, the first assay and the second assay comprise the same assay or a different assay. In some embodiments, methods of detecting one or more interrupted RAN proteins in a biological sample are useful for monitoring the progress of a disease associated with RAN Attorney Docket No. U1202.70128WO00 protein expression, translation, and/or accumulation. In some embodiments, the disease associated with interrupted RAN proteins is selected from the group consisting of: amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), and Fuch’s Corneal Dystrophy. In some embodiments, the neurological disease associated with interrupted RAN proteins is Alzheimer’s Disease (AD) or amyotrophic lateral sclerosis (ALS). For example, in some embodiments, biological samples are obtained from a subject prior to and after (e.g., 1 week, 2 weeks, 1 month, 6 months, or one year after) commencement of a therapeutic regimen and the amount of interrupted RAN proteins detected in the samples is compared. In some embodiments, if the level (e.g., amount) of interrupted RAN protein in the post-treatment sample is reduced compared to the pre- treatment level (e.g., amount) of interrupted RAN protein, the therapeutic regimen is successful. In some embodiments, the level of interrupted RAN proteins in biological samples (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more samples) of a subject are continuously monitored during a therapeutic regimen (e.g., measured on 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more separate occasions). In some embodiments, an agent (e.g., a therapeutic agent) may be administered to a subject when a RAN protein (e.g., interrupted RAN protein) or RNA transcript or DNA sequence thereof is detected at an increased level relative to a control sample. However, in some embodiments, methods described herein may comprise administering an agent (e.g., a therapeutic agent) to a subject without having performed a detection method prior to administration of the agent. In some embodiments, methods described herein may comprise subjecting a biological sample to one or more detection methods after administering an agent (e.g., a therapeutic agent) to the subject. Attorney Docket No. U1202.70128WO00 Detection of Proteins In some embodiments, of methods described by the disclosure, a sample (e.g., a biological sample) is treated by an antibody-based capture process to isolate one or more interrupted RAN proteins within the sample. Typically, the antibody-based capture methods include contacting the sample with one or more (e.g., 2, 3, 4, 5, or more) anti-RAN protein antibodies. In some embodiments, the one or more anti-RAN antibodies are conjugated to a solid support (e.g., a scaffold, resin beads, etc.). In some embodiments, antibody-based capture methods comprise physically separating and/or isolating interrupted RAN proteins that have been bound by the anti-RAN antibody(s), for example eluting the interrupted RAN proteins by a chromatographic method such as affinity chromatography or ion-exchange chromatography. In some embodiments, biological sample may be subjected to an antigen retrieval procedure prior to being contacted with an anti-RAN antibody. As used herein, “antigen retrieval” (also referred to as epitope retrieval, or antigen unmasking) refers to a process in which a biological sample (e.g., blood, serum, CSF, etc.) are treated under conditions which expose antigens (e.g., epitopes) that were previously inaccessible to detection agents (e.g., antibodies, aptamers, and other binding molecules) prior to the process. Generally, antigen retrieval methods comprise steps including but not limited to heating, pressure treatment, enzymatic digestion, treatment with reducing agents, treatment with oxidizing agents, treatment with crosslinking agents, treatment with denaturing agents (e.g., detergents, ethanol, acids), or changes in pH, or any combination of the foregoing. Several antigen retrieval methods are known in the art, including but not limited to protease-induced epitope retrieval (PIER) and heat-induced epitope retrieval (HIER). In some embodiments, antigen retrieval procedures reduce the background and increase the sensitivity of detection techniques (e.g., immunohistochemistry (IHC), immuno-blot (such as Western Blot), ELISA, etc.). In some embodiments, detection of RAN proteins (e.g., interrupted RAN proteins) in a biological sample may be performed by immunoassays comprising use of a detection agent or probe to identify the presence of a protein or peptide (e.g., interrupted RAN proteins). In some embodiments, detection of one or more interrupted RAN proteins is performed by immunoblot (e.g., dot blot, 2-D gel electrophoresis, Western Blot, etc.), electrochemiluminescence immunoassay (e.g., Meso-Scale Detection (MSD)), Attorney Docket No. U1202.70128WO00 immunohistochemistry (IHC), ELISA (e.g., RCA-based ELISA or RT-PCR-based ELISA), label free immunoassays such as surface plasmon resonance bio layer interferometry, immunoquantitative PCR, bead-based immunoassays, immunoprecipitation, immunostaining, or immunoelectrophoresis. However, in some embodiments, methods of detecting RAN proteins may also comprise mass spectrometry such as GC-MS, LC-MS, MALDI-TOF-MS. In some embodiments, a detection agent is an antibody or an antigen-binding fragment. In some embodiments, the antibody is an anti-RAN protein antibody or an antigen- binding fragment thereof, such as anti-poly(Ser), anti-poly(GR), anti-poly(PR), anti- poly(CP), anti-poly(GP), anti-poly(G), anti-poly(A), anti-poly(GA), anti-poly(GD), anti- poly(GE), anti-poly(GQ), anti-poly(GT), anti-poly(L), anti-poly(LP), anti-poly(LPAC) (SEQ ID NO: 31), anti-poly(LS), anti-poly(P), anti-poly(PA), anti-poly(QAGR) (SEQ ID NO: 35), anti-poly(RE), anti-poly(SP), anti-poly(VP), anti-poly(FP), anti-poly(GK), anti- poly(FTPLSLPV) (SEQ ID NO: 36), anti-poly(LLPSPSRC) (SEQ ID NO: 37), anti- poly(YSPLPPGV) (SEQ ID NO: 38), anti-poly(HREGEGSK) (SEQ ID NO: 39), anti- poly(TGRERGVN) (SEQ ID NO: 40), anti-poly(PGGRGE) SEQ ID NO: 41), anti- poly(GRQRGVNT) (SEQ ID NO: 42), and/or anti-poly(GSKHREAE) (SEQ ID NO: 43) (also referred to as α-poly(Ser), α-poly(PR), α-poly(GR), etc.). In some embodiments, an anti-RAN protein antibody or antigen-binding fragment thereof targets (e.g., specifically binds to) the amino acid repeat region (e.g., PRPRPRPRPR (SEQ ID NO: 130), GRGRGRGRGR (SEQ ID NO: 131), SSSSSSSSS (SEQ ID NO: 132), etc.) of an interrupted RAN protein. In some embodiments, an anti-RAN protein antibody or antigen binding fragment thereof targets (e.g., specifically binds to) an epitope comprising amino acids in the characteristic reading frame specific C-terminus translated 3’ of the repeated amino acids. In some embodiments, an anti-RAN protein antibody or antigen binding fragment thereof targets (e.g., specifically binds to) an epitope comprising amino acids bridging the C terminus of the amino acid repeat region and the N terminus of the characteristic reading-frame specific C-terminus translated 3’ of the repeated amino acids. In some embodiments, an anti-RAN antibody or antigen binding fragment thereof targets (e.g., specifically binds to) any portion of an interrupted RAN protein that does not comprise the poly-amino acid repeat, for example the C-terminus of an interrupted RAN protein (e.g., the C-terminus of a poly(GR), poly(PR), poly(Ser), poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GT), poly(L), poly(LP), Attorney Docket No. U1202.70128WO00 poly(LPAC) (SEQ ID NO: 31), poly(LS), poly(P), poly(PA), poly(QAGR) (SEQ ID NO: 35), poly(RE), poly(SP), poly(VP), poly(FP), poly(GK), poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), poly(PGGRGE) (SEQ ID NO: 41) protein), poly(GRQRGVNT) (SEQ ID NO: 42), and/or poly(GSKHREAE) (SEQ ID NO: 43). In some embodiments, a set (or combination) of anti-RAN antibodies or antigen binding fragments thereof (e.g., a combination of two or more anti-RAN antibodies or antigen binding fragments thereof selected from anti-poly(Ser), anti-poly(GR), anti-poly(PR), anti-poly(CP), anti-poly(GP), anti-poly(G), anti-poly(A), anti-poly(GA), anti-poly(GD), anti- poly(GE), anti-poly(GQ), anti-poly(GT), anti-poly(L), anti-poly(LP), anti-poly(LPAC) (SEQ ID NO: 31), anti-poly(LS), anti-poly(P), anti-poly(PA), anti-poly(QAGR) (SEQ ID NO: 35), anti-poly(RE), anti-poly(SP), anti-poly(VP), anti-poly(FP), anti-poly(GK), anti- poly(FTPLSLPV) (SEQ ID NO: 36), anti-poly(LLPSPSRC) (SEQ ID NO: 37), anti- poly(YSPLPPGV) (SEQ ID NO: 38), anti-poly(HREGEGSK) (SEQ ID NO: 39), anti- poly(TGRERGVN) (SEQ ID NO: 40), anti-poly(PGGRGE) (SEQ ID NO: 41), anti- poly(GRQRGVNT) (SEQ ID NO: 42), and/or anti-poly(GSKHREAE) (SEQ ID NO: 43), is used to detect one or more interrupted RAN proteins in a biological sample. In some embodiments, a detection agent is an aptamer (e.g., RNA aptamer, DNA aptamer, or peptide aptamer). In some embodiments, an aptamer specifically binds to an interrupted RAN protein (e.g., poly(Ser), poly(PR), poly(GR), poly(CP), poly(GP), poly(G), poly(A), poly(GA), poly(GD), poly(GE), poly(GQ), poly(GT), poly(L), poly(LP), poly(LPAC) (SEQ ID NO: 31), poly(LS), poly(P), poly(PA), poly(QAGR) (SEQ ID NO: 35), poly(RE), poly(SP), poly(VP), poly(FP), poly(GK), poly(FTPLSLPV) (SEQ ID NO: 36), poly(LLPSPSRC) (SEQ ID NO: 37), poly(YSPLPPGV) (SEQ ID NO: 38), poly(HREGEGSK) (SEQ ID NO: 39), poly(TGRERGVN) (SEQ ID NO: 40), poly(PGGRGE) (SEQ ID NO: 41), poly(GRQRGVNT) (SEQ ID NO: 42), and/or poly(GSKHREAE) (SEQ ID NO: 43)). Detection of Nucleic Acids In some embodiments, nucleic acid hybridization-based methods are used for identifying the presence of interrupted RAN proteins or microsatellite repeat sequences Attorney Docket No. U1202.70128WO00 encoding interrupted RAN proteins in a biological sample (e.g., a biological sample obtained from a subject). In some embodiments, nucleic hybridization-based methods involve nucleic acids that are capable of hybridizing with a nucleic acid sequence (e.g., target sequence) (e.g., a nucleotidic expansion repeat or a repeat unit thereof. As used herein, a nucleic acid “capable of hybridizing with” or “capable of detecting” a nucleic acid sequence (e.g., target sequence) refers to a nucleic acid comprising a length and a degree of sequence complementarity that is sufficient for base-pairing with the nucleic acid sequence (e.g., target sequence) in a specific and/or stable manner. In some embodiments, the length required for hybridization is about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 20-30, 30- 40, 40-50, 50-75, 75-100, or more than 100 nucleotides. In some embodiments, the degree of sequence complementarity required for hybridization is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%. Non-limiting examples of a nucleic acids that are capable of hybridizing with a nucleic acid sequence (e.g., target sequence) include nucleic acid probes (e.g., detectable probes), guide RNAs (gRNAs), primers, aptamers (e.g., RNA or DNA aptamers), and other forms of antisense oligonucleotides. Non-limiting examples of sequences which may be useful for detection of nucleic acids encoding an interrupted RAN protein are found in Tables 4 and 8. In some embodiments, detecting nucleic acid sequences encoding interrupted RAN proteins involves detectable nucleic acid probes (e.g., fluorophore-conjugated DNA probes). Generally, a “detectable nucleic acid probe” refers to a nucleic acid sequence that specifically binds to (e.g., hybridizes with) a target sequence, and comprises a detectable moiety, for example a fluorescent moiety, radioactive moiety, chemiluminescent moiety, electroluminescent moiety, biotin, peptide tag (e.g., poly-His tag, FLAG-tag, etc.), etc. In some embodiments, a detectable nucleic acid probe is a DNA or RNA probe. In some embodiments, the DNA or RNA probe is conjugated to a fluorophore. In some embodiments, a detectable nucleic acid probe is chemically modified. In some embodiments, detectable nucleic acid probes are useful for localization of RAN protein translation by Fluorescence In situ Hybridization (FISH). In some embodiments, a biological sample may be contacted with a plurality of detectable nucleic acid probes. The number of nucleic acid probes in a plurality varies. In some embodiments, a plurality of nucleic acid probes comprises between 2 and 100 (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, Attorney Docket No. U1202.70128WO00 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100) nucleic acid probes. In some embodiments, a plurality comprises more than 100 probes. The nucleic acid probes may be the same or different sequences. In some embodiments, a plurality of detectable nucleic acid probes comprises probes which hybridize to target sequences that encode an interrupted RAN protein. Methods for detecting a nucleic acid encoding an interrupted RAN protein may comprise an enrichment step. “Enrichment” refers to processes which increase the amount and/or concentration of a target nucleic acid in a sample relative to other nucleic acids in a sample. Generally, enrichment may occur by increasing the number of target nucleic acid sequences in a sample (e.g., by amplifying the target sequence, for example by polymerase chain reaction (PCR), etc.), or by decreasing the amount or concentration of non-target nucleic acid sequences in the sample (e.g., by separating or isolating the target nucleic acid sequence from non-target sequences). In some embodiments, methods described herein comprise a step of enriching a biological sample for nucleic acid sequences (e.g., microsatellite repeat sequences) encoding interrupted RAN proteins. In some embodiments, the enrichment comprises contacting the biological sample with 1) a labeled (e.g., biotinylated) dCas9 protein, and 2) one or more single-stranded guide RNA (sgRNAs) that specifically bind to nucleic acid repeat sequences encoding interrupted RAN proteins. In some embodiments, the labeled dCas9 protein and the one or more sgRNAs are provided together as a single molecule (e.g., a dCas9-sgRNA complex). In some embodiments after the biological sample with the labeled dCas9 protein and the one or more sgRNAs, the nucleic acid sequences encoding one or more interrupted RAN proteins are isolated from the labeled dCas9 protein and the sgRNAs, for example by affinity chromatography, as described by Liu et al. (2017) Cell 170: 1028-1043. In some embodiments, the detection of the one or more interrupted RAN proteins comprises Next-Generation Sequencing (NGS). In some embodiments, an enrichment step (e.g., dCas9-based enrichment) is performed on the sample, using guide RNAs. In some embodiments, the guide RNAs used in the enrichment target NGG protospacer adjacent motifs (PAM) containing repeats. In other embodiments, the guide RNAs used in the enrichment target non-NGG PAM containing repeats. In some embodiments, the non-NGG Attorney Docket No. U1202.70128WO00 PAM containing repeats comprise expansion repeats. In some embodiments, the guide RNAs used in the enrichment enrich non-NGG PAM containing repeat expansions that are longer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100 repeats longer) than the corresponding normal allele. In some embodiments, the guide RNAs used in the enrichment identify multiple repeat expansions simultaneously, including, in some embodiments, sequences with non-NGG PAMs. In some embodiments, the gRNA comprises a sequence set forth in Table 4. In some embodiments, a nucleic acid used for detection methods described herein are capable of hybridizing with a nucleic acid sequence (e.g., target sequence) present in a gene, chromosomal, or RNA transcript (e.g., mRNA) encoding an interrupted RAN protein. In some embodiments, a target sequence comprises one or more expansion repeats or repeat units. In some embodiments, a target sequence, or a portion thereof, comprises GGTCGT, GGCCGT, GGACGT, GGGCGT, GGTCGC, GGCCGC, GGACGC, GGGCGC, GGTCGA, GGCCGA, GGACGA, GGGCGA, GGTCGG, GGCCGG, GGACGG, GGGCGG, GGTAGA, GGCAGA, GGAAGA, GGGAGA, GGTAGG, GGCAGG, GGAAGG, GGGAGG GGTGCT, GGCGCC, GGAGCA, GGGGCG, GGTGCC, GGCGCA, GGAGCG, GGGGCT, GGTGCA, GGCGCG, GGAGCT, GGGGCC, GGTGCG, GGCGCT, GGAGCC, GGGGCA GGTCCT, GGCCCC, GGACCA, GGGCCG, GGTCCC, GGCCCA, GGACCG, GGGCCT, GGTCCA, GGCCCG, GGACCT, GGGCCC, GGTCCG, GGCCCT, GGACCC, GGGCCA CCTCGT, CCCCGT, CCACGT, CCGCGT, CCTCGC, CCCCGC, CCACGC, CCGCGC, CCTCGA, CCCCGA, CCACGA, CCGCGA, CCTCGG, CCCCGG, CCACGG, CCGCGG, CCTAGA, CCCAGA, CCAAGA, CCGAGA, CCTAGG, CCCAGG, CCAAGG, CCGAGG TCT, TCC, TCA, TCG, AGT, AGC, CCTG, or CAGG repeat units. In some embodiments, a target sequence, or a portion thereof, comprises (GGTCGT)x, (GGCCGT)x, (GGACGT)x, (GGGCGT)x, (GGTCGC)x, (GGCCGC)x, (GGACGC)x, (GGGCGC)x, (GGTCGA)x, (GGCCGA)x, (GGACGA)x, (GGGCGA)x, (GGTCGG)x, (GGCCGG)x, (GGACGG)x, (GGGCGG)x, (GGTAGA)x, (GGCAGA)x, (GGAAGA)x, (GGGAGA)x, (GGTAGG)x, (GGCAGG)x, (GGAAGG)x, (GGGAGG)x, (GGTGCT)x, (GGCGCC)x, (GGAGCA)x, (GGGGCG)x, (GGTGCC)x, (GGCGCA)x, (GGAGCG)x, (GGGGCT)x, (GGTGCA)x, (GGCGCG)x, (GGAGCT)x, (GGGGCC)x, (GGTGCG)x, (GGCGCT)x, (GGAGCC)x, (GGGGCA)x, (GGTCCT)x, (GGCCCC)x, (GGACCA)x, (GGGCCG)x, (GGTCCC)x, (GGCCCA)x, (GGACCG)x, (GGGCCT)x, (GGTCCA)x, (GGCCCG)x, Attorney Docket No. U1202.70128WO00 (GGACCT)x, (GGGCCC)x, (GGTCCG)x, (GGCCCT)x, (GGACCC)x, (GGGCCA)x, (CCTCGT)x, (CCCCGT)x, (CCACGT)x, (CCGCGT)x, (CCTCGC)x, (CCCCGC)x, (CCACGC)x, (CCGCGC)x, (CCTCGA)x, (CCCCGA)x, (CCACGA)x, (CCGCGA)x, (CCTCGG)x, (CCCCGG)x, (CCACGG)x, (CCGCGG)x, (CCTAGA)x, (CCCAGA)x, (CCAAGA)x, (CCGAGA)x, (CCTAGG)x, (CCCAGG)x, (CCAAGG)x, (CCGAGG)x, (CCTG)x, (TCT)x, (TCC)x, (TCA)x, (TCG)x, (AGT)x, or (AGC)x repeat units, wherein x represents the number of repeat units present in a gene and/or a chromosomal locus or an RNA (e.g., mRNA) transcript thereof. In some embodiments, x comprises an integer between 2 and 200. In some embodiments, x comprises an integer between 2 and 175, 2 and 150, 2 and 125, 2 and 100, 2 and 75, 2 and 50, 2 and 25, 2 and 10, 2 and 5, etc. In some embodiments, x is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 152, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some embodiments, x comprises an integer greater than 200 (e.g., about 201-250, 250-300, 300-400, 400-500, 500-750, etc.). In some embodiments, “x” comprises an integer between 200-250, 250-300, 300-400, 400- 500, 500-750, 750-1,000, 1,000-1,500, 1,500-2,000, 2,000-3,000, 3,000-4,000, 4,000-5,000, 5,000-6,000, 6,000-7,000, 8,000-9,000, or 9,000-10,000. In some embodiments, a target sequence, or a portion thereof, comprises a sequence corresponding to a gene associated with a disease, such as amyotrophic lateral sclerosis (ALS), Frontotemporal dementia (FTD), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 Attorney Docket No. U1202.70128WO00 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuch’s Corneal Dystrophy. In some embodiments, a nucleic acid sequence (e.g., target sequence) is comprises a sequence corresponding to a gene or a chromosomal locus set forth in Table 1 or Table 6. In some embodiments, a target sequence, or a portion thereof, comprises a sequence corresponding to a gene selected from: PSEN1, PSEN2, MAPT, FMR1, AR, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATXN8 ATXN8OS, PPP2R2B, TBP, NOP56, ITPR1, ATXN10, DMPK, CNBP, TCF4, HTT, APP, ARMCX4, PEX14, PTPRF, ACTA1, DNAH14, PFN1P2, C1orf61, WASF2, PGBD2, NBPF15, DDX11L1, BARHL2, MIR1976, CASZ1, SLC44A3, GPR137B, SOX13, CROCC, RNPEP, MIR3121, MPZ, MCL1, HYDIN2, AIFM2, MGMT, LINC01164, KNDC1, ANK3, MLLT10, TBC1D12, LRMDA, CCNY, MIR3156-1, DUX4L2, AGAP12P, C10orf53, SMPD1, IFITM10, BUD13, TSPAN18, CD82, OTUB1, NADSYN1, MIR4492, CHID1, SMUG1, LINC00938, LINC01257, SLC15A4, ASIC1, DCP1B, TMTC2, TNS2, LOC100240735, SOX1, LATS2, RAB20, ANKRD20A9P, FLT1, RCBTB1, ELK2AP, STON2, FOXN3, TTLL5, BCL11B, BRMS1L, SMAD3, RPLP1, BAHD1, MYO5A, DNM1P46, DNM1P35, TUBGCP4, C16orf95, OSGIN1, LINC00311, MIR4718, RBFOX1, SBK1, MIR4722, BANP, C16orf78, MIR5189, ADGRG5, NPRL3, ZDHHC1, MIR662, LINC00482, MRPL12, TBC1D3H, WSCD1, TBC1D3B, TBC1D3, TBC1D3C, METRNL, DNAH9, ASGR1, FOXK2, NPEPPS, SARM1, CLUH, TIAF1, LOC440434, PHOSPHO1, TBCD, CYP4F35P, CXADRP3, LINC00668, MEX3C, COX7A1, SCAF1, RFPL4AL1, SIX5, DIRAS1, POLRMT, ZNF554, MED16, SIPA1L3, DOT1L, KMT5C, PDE4C, ZNF480, CEBPA, PTPN18, HAAO, LOC654342, RGPD2, RAB3GAP1, TNS1, FAM95A, NTSR1, FRG1BP, FAM182B, CDH4, PRNP, MIR1257, MIR4758, OGFR, SRC, COL9A3, ZNF512B, PICSAR, SIK1, CYP4F29P, MX1, LARGE1, CRELD2, UPK3A, RRP7A, MIR4762, SHANK3, SHISA8, CCDC188, NPTXR, ZNF621, TPRA1, PIGZ, LHFPL4, OSTN, GAP43, CACNA2D2, TNK2, IQSEC1, RAD18, PARP14, PLXNA1, DOCK3, DUX4L8, PCDH10, TNIP3, ZFYVE28, MSMO1, ANKRD50, FGFR4, IRX1, ZNF622, SPOCK1, PLEKHG4B, LCP2, SLC34A1, CXXC5, PPARGC1B, LOC643201, P4HA2, THBS2, SEC63, SLC17A5, MEA1, RIMS1, ARID1B, PRKAG2, EN2, NXPH1, NUB1, DPP6, MYL10, GS1-124K5.11, ABCB4, MFSD3, SOX17, MTDH, RRS1-AS1, SDCBP, DOCK5, SHARPIN, LINC00051, LRRC6, NAPRT, FOXE1, C9orf139, FAM27C, AQP7P1, TLE4, NCS1, FAM27B, C9orf50, TOR1A, PNPLA7, MIR4473, PRRX2, DAB2IP, C9orf72, GPSM1, FAM230C, RNA (E.G., MRNA)5- Attorney Docket No. U1202.70128WO00 8SN5, SUPT20HL2, SUPT20HL1, FAM236A, RPL10, AVPR2, SHROOM2, FAM226A, ALK, and CASP8. In some embodiments, a target sequence is present or corresponds to ARMCX4, ALK, or CASP8. In some embodiments, a target sequence comprises a configuration of RAN repeat units as shown in FIG.9F (e.g., wherein the target sequence comprises a CASP8 sequence, such as one comprising an insertion of RAN repeat units into the VNTR sequence (SEQ ID NO: 194) as shown in FIG.9F). EXAMPLES In order that the invention described in this application may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the methods provided in this application and is not to be construed as limiting their scope. Example 1 This example describes investigating translation of interrupted RAN proteins in the context of RAN-protein associated diseases, such as Alzheimer’s disease (AD) and Amyotrophic Lateral Sclerosis (ALS). To identify a specific locus containing the repeat expansion mutations in RAN and RNA foci positive candidate AD cases, a pull-down assay was used to enrich the specific repeat expansion mutation and the corresponding flanking sequences using a biotin-tagged nuclease-deficient Cas9 (dCas9) approach. This dCas9-based enrichment tool pulls down and enriches specific DNA sequences (e.g., DNA sequences encoding interrupted RAN proteins) by taking advantage of the rapid kinetics and high stability of single guide RNA/dCas9 (sgRNA-dCas9) complexes without the need to denature target DNA. Expanded repeats provide multiple binding sites for sgRNAs, thus increasing the probability of interaction between sgRNA-dCas9 complexes and expanded repeats compared to shorter repeat tracts. Assays were performed on patient autopsy brains and cells, as well as HEK cells (where noted). In some embodiments, an interrupted repeat RAN protein (e.g., a poly-GA or poly- GR RAN protein) is translated from an mRNA transcript encoded by a genetic locus or one or more genes (e.g., is encoded by one or more genes) set forth in Table 1. Attorney Docket No. U1202.70128WO00 In some embodiments, an interrupted poly-GA RAN protein is translated from an mRNA transcript encoded by a chromosomal locus in chrX beginning at 100748986 and ending at 100749205. In some embodiments, an interrupted poly-GA repeat RAN protein is translated from an mRNA transcript encoded by ARMCX4. FIGs.1A and 1B show a predicted ARMCX4 poly-GA repeat protein. FIG.1A shows alternative splicing variants, demonstrating that an ARMCX4 repeat expansion can be in an intron (left) or an exon (right). FIG.1B shows a predicted GA-rich protein produced by an ARMCX4 repeat expansion. The example amino acid sequence (SEQ ID NO: 4) shown in FIG.1B illustrates interrupted GA repeat motifs. In some embodiments, an interrupted poly-GA RAN protein is translated from an mRNA transcript encoded by ALK. FIGs.2A and 2B show a predicted ALK poly-GA repeat protein. FIG.2A shows the predicted coding region. The expanded allele has expanded GGA repeats and contains ~143-156 repeats. FIG.2B shows a predicted GA-rich protein produced by an ALK repeat expansion. The example amino acid sequence (SEQ ID NO: 7) shown in FIG.2B illustrates interrupted GA repeat motifs. To test if an anti-GA antibody recognizes GA-rich proteins expressed from the ARMCX4 and/or ALK repeat expansions, ARMCX4-RE and ALK-RE plasmids were designed and cloned in which FLAG tag expresses in frame with ARMCX4 and ALK GA-rich proteins. FIG.3A shows example ARMCX4-RE and ALK-RE plasmids which were designed and cloned. FLAG tag expresses in frame with ARMCX4 and ALK GA-rich proteins. In ARMCX4-RE and ALK-RE overexpressing HEK293T cells, anti-GA antibody staining co- localizes with FLAG tag (FIG.3B). No similar staining was detected in cells transfected with control plasmids. In some embodiments, an interrupted poly-GR RAN protein is translated from an mRNA transcript encoded by CASP8. FIGs.4A-4C show a predicted CASP8 poly-GR repeat protein. FIG.4A shows the predicted coding region. FIG.4B shows a predicted GR- rich protein produced by an CASP8 repeat expansion. The example amino acid sequence (SEQ ID NO: 8) shown in FIG.4B illustrates interrupted GR repeat motifs. FIG.4C shows a predicted GR-rich protein produced by an CASP8 repeat expansion. The example amino acid sequence (SEQ ID NO: 9) shown in FIG.4C illustrates interrupted GR repeat motifs. Table 1: Interrupted RAN protein-encoding chromosomal loci and gene candidates Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Example 2 This example relates to detection of polymeric glycine-arginine (polyGR)-containing aggregates in sporadic AD autopsy brains. In some embodiments, a CRISPR/deactivated-Cas9 repeat enrichment and detection (dCas9READ) strategy is used to identify a polyGR-encoding intronic CASP8 (GGGAGA)n expansion (CASP8-GGGAGAexp). In some embodiments, polyGR-encoding intronic CASP8 (GGGAGA)n expansion (CASP8-GGGAGAexp) is associated with increased risk of neurogenerative disease such as AD . In some embodiments, locus-specific C-terminal antibodies are used to detect polyGR-containing proteins expressed by CASP8-GGGAGAexp which accumulate in AD brains. In some embodiments, polyGR aggregates are associated with increased pTau[S202,T205] in AD brains. In some embodiments, pTau is increased in cells overexpressing polyGR. In some embodiments, CASP8-GGGAGAexp is toxic to cells and CASP8-repeat associated non-AUG protein levels induced by stress are lowered by metformin. Introduction Alzheimer’s disease (AD), the most common form of dementia, is characterized by progressive cognitive decline and affects 13% of the population greater than 65 years of age. Mutations in amyloid precursor protein (APP), presenilin 1 and 2 (PSEN1 and PSEN2) cause <1% of early-onset AD and apolipoprotein E variant 4 (APOE ε4) is a major risk factor for late onset AD. Hallmark pathology in AD brains includes extracellular β-amyloid (Aβ) plaques, intracellular phosphorylated Tau (pTau)-positive neurofibrillary tangles (NFT) and dystrophic neurites, reactive gliosis, and neurodegeneration. Microsatellite, or simple tandem-repeat expansion mutations cause >50 neurological diseases including the most common form of frontotemporal dementia (FTD). Overlapping pathology of several microsatellite expansion diseases (e.g. Huntington’s disease and myotonic dystrophy type 1) with AD includes increased pTau and the accumulation of NFTs. Molecular mechanisms of repeat expansion diseases involve protein loss-of-function (LOF), protein gain-of-function (GOF), RNA GOF, and toxic accumulation of polymeric proteins produced by repeat-associated non-AUG (RAN) translation . RAN proteins can be expressed from microsatellite expansion mutations in all reading frames without AUG or AUG- like close cognate initiation codons. RAN proteins have been reported in 11 different Attorney Docket No. U1202.70128WO00 repeat expansion disorders, and in vitro and in vivo studies support their pathogenic roles in disease. Although repetitive elements are abundant in the human genome, the isolation of disease-causing expansion mutations has been technically challenging because they are difficult to sequence and mapping repeat sequences back to specific sites in the genome without flanking sequence is often not possible. Recent advances in long read sequencing are promising, but costly and the identification of repeat expansion mutations still requires families with a strong history of disease. Computational tools have been developed to identify repeat expansions in short read, next-generation sequencing data (eg STRetch and ExpansionHunter DeNovo). While promising, these tools are only partially concordant with long read sequencing data. New tools are needed to fully explore the contributions of the tandem repeatome to disease. Here, data was generated which showed that poly(glycine-arginine), or polyGR, aggregates were frequently found in postmortem brains from sporadic AD cases but not in age-similar controls without AD pathology. To identify mutations that could cause this polyGR pathology, a CRISPR/ deactivated Cas9 (dCas9)-based repeat enrichment and detection (dCas9READ) methodology was developed. dCas9READ allows the enrichment of DNA fragments containing microsatellite repeat expansions and corresponding flanking sequences from individual genomic DNA samples. To enrich for GR-encoding repeat expansions, dCas9READ and genomic DNA isolated from AD autopsy brains that were positive for polyGR-containing aggregates were used. Intronic GGGAGA repeat expansion in CASP8 (CASP8-GGGAGAexp), a repeat which encodesGR-containing RAN proteins was identified. Intronic CASP8 GGGAGA expansions > 40 repeats were more frequently found in AD cases (73%) compared to age-similar controls (60%) [OR=1.75, z=3.832, p = 0.0001]. In cells, CASP8-GGGAGAexp was toxic and CASP8- RAN protein levels, which were increased by stress, were reduced by the FDA-approved type-2 diabetes and RAN-protein lowering drug (24) metformin. Moreover, polyGR staining in AD autopsy brains was correlated with increased pTau, and overexpression of poly(GR) 60 or CASP8 GGGAGAexp minigene constructs in SH-SY5Y neuroblastoma cells increased pTau at S202 and T205. These data demonstrated a prominent and novel type of pathology involving the accumulation of polyGR-containing RAN proteins and support their role in AD. In some embodiments, a RAN pathology-to-genetics strategy, dCas9READ, is used for Attorney Docket No. U1202.70128WO00 unbiased identification of candidate expansion mutations directly from the genomic DNA of RAN-protein positive samples. Methods Patient samples Paraffin-embedded formalin fixed hippocampal sections from AD and control cases were obtained from the Johns Hopkins brain bank, the University of Florida Neuromedicine Human Brain Tissue Bank, the 1Florida ADRC. Frozen frontal cortex (1Florida ADRC) and cerebellum tissue (Johns Hopkins University) samples for biochemical and histological analysis including samples from AD and controls cases were used in this research. Frozen tissue samples were also used for genomic DNA extraction for the repeat expansion enrichment analysis and genotyping assays for the C9orf72 G4C2 locus and novel repeat expansion loci identified in this study. Paraffin-embedded formalin fixed tissues from AD and controls cases were used for immunohistochemical (IHC) analyses. Patient and control LCLs (Coriell Institute) were used for genomic DNA extractions for genotyping assays. The control plates from Coriell include NDPT079, NDPT084, NDPT093, NDPT094, NDPT095, NDPT096, NDPT098, and NDPT099. Constructs 3xFLAG-(GR)60 (SEQ ID NO: 133), FLAG-(GGGAGA)30-CT-f1S (SEQ ID NO: 30) and FLAG-(GGGAGA)30-CT-f3S (SEQ ID NO: 30) constructs: GAATTCAAGCTTGATATCCCCGGG(GGACGA)60CTCGAGTCGACTAGTCTAGAGG ATCC (SEQ ID NO: 134) fragment (for 3xFLAG-(GR)60) (SEQ ID NO: 133) and GAATTC(GGGAGA)30GGTCTGTCAAATTCTTATCTATCAATGTTATGCCCACTCTG CTCTCCA (SEQ ID NO: 135) GCTGTGGTCTGTGAATTACTGTGGTATAACGTGACTGTTCAAATTTCACTTTTCAG GGGCTTTGACCACGACCTTTTCTAGA (SEQ ID NO: 136) (for FLAG-(GGGAGA)30- CT-f1S) (SEQ ID NO: 30) were synthesized and cloned into pUC57 vector (GenScript). 3xFLAG-(GR)60 (SEQ ID NO: 133) and FLAG-(GGGAGA)30-CT-f1S (SEQ ID NO: 30) constructs were generated by subcloning EcoRI/XbaI fragements into p3xFLAG-Myc-CMV- 24 vector (Sigma- Aldrich, ref# E9283). FLAG-(GGGAGA)30-CT-f3S (SEQ ID NO: 30) Attorney Docket No. U1202.70128WO00 were then generated from FLAG-(GGGAGA)30- CT-f1S (SEQ ID NO: 30) construct by digesting with HindIII followed with T4 polymerase incubation and re- ligation. The desired ligation and constructs were confirmed using Sanger sequencing (Sequetech). 6XStop-CASP8-RE-3T constructs: TTAAGCTTAAAAACTAGTGCTAGCTAGGTAACTAAGTAAGCCTGCAATCGCAGG CACTCGGCAGGCTGAGGCAGGAGAATCAGGCAGGGAGGTTGCAGTGAGCCGAG ATGGCAGCAGTACCGTCCAGCTTTGGCTCGGCATGAGAGGGAGAGGGAGACGGG GAGAGGGAGAGGGAGAGGGAGACGGGGGAGAGGGGAGAGGGGGGAGAGGGAG ACGGGGGGAGAGGGGAGAGGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGAG GGAGACGGGGAGAGGGGAGAGGGAGACGGGGGAGAGGGAGAGGGAGACGGGA GACGGGGAGAGGGAGAGGGAGACGGGAGACGGGGAGAGGGAGAGGGAGACGG GGGAGAGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGACGGGGAGA GGGAGAGGGAGACGGGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGCG AGGAGCGGGGAGAGGGAGAGGGGGAGGGCGGGGAGAGGGAGAGGGAGACGGG GAGAGGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGACGAGAGGGA GAGGGAGAGGGGAGAGGGAGAGGGAGAGGGAGAGGGGTCAAATTCTTATCTAT CTAC TCGAGAGCGC (for CASP8-hi64-3T) (SEQ ID NO: 137), TTAAGCTTAAAAACTAGTGCTAGCTAGGTAACTAAGTAAGCCTGCAATCGCAGG CACTCGGCAGGCTGAGGCAGGAGAATCAGGCAGGGAGGTTGCAGTGAGCCGAG ATGGCAGCAGTACCGTCCAGCTTTGGCTCGGCATGAGAGGGAGAGGGAGACGGG GAGAGGGAGAGGGAGACGGGGAGAGGGGAGAGGGAGGGAGACGGGAGACGGG GAGAGGGAGAGGGAGACGGGAGACGGGGAGAGGGAGAGGGAGAGGGAGACGG GGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAG GGAGACGGGGAGAGGGAGAGGGAGGCGGGGAGAGGGAGAGGGAGACGGGGAG AGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGACGAGAGGGAGAGGGAGAGG GAGAGGGAGAGGGAGAGGGAGAGGGAGAGGGGTCAAATTCTTATCTATCATACT CGAGAGCGC (for CASP8-i44-3T) (SEQ ID NO: 138), and TTAAGCTTAAAAACTAGTGCTAGCTAGGTAACTAAGTAAGCCTGCAATCGCAGG CACTCGGCAGGCTGAGGCAGGAGAATCAGGCAGGGAGGTTGCAGTGAGCCGAG Attorney Docket No. U1202.70128WO00 ATGGCAGCAGTACCGTCCAGCTTTGGCTCGGCATGAGAGGGAGAGGGAGACGGG GAGAGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGAGAGGGAGACGGGG AGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGAGGGAGACGGGGAGAGGG AGAGGGAGACGGGGAGAGGGAGAGGGAGAGGGAGACGGGAGACGGGGAGAGG GAGAGGGAGACGGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGAGG GAGACGGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGACGGGGAGA GGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGA GGGAGGCGGGGAGAGGGAGAGGGAGACGGGGAGAGGGAGAGGGAGACGGGGA GAGGGAGAGGGAGACGAGAGGGAGAGGGAGAGGGAGAGGGAGAGGGAGAGGG GTCAAATTCTTATCTATCTACTCGAGAGCGC (for CASP8-i64-3T) (SEQ ID NO: 139) Fragments were synthesized and cloned into pUC57 vector (GenScript).6XStop-CASP8-RE- 3T constructs were generated by subcloning HindIII-XhoI fragments into pcDNA3.1 vector containing triple epitopes (FLAG/HA/Myc) (Zu et al., 2013). Cell culture HEK293T, SH-SY5Y or T98 cells were cultured using DMEM supplemented with 10% FBS and incubated at 37°C, 5% CO2. Transfection was performed using Lipofectamine 2000 or 3000 reagent (Invitrogen) according to the manufacturer’s protocols. Immunohistochemical (IHC) staining For IHC staining, all washes were done for 5 min at room temperature (RT) except otherwise stated. Seven-μm sections were deparaffinized in xylene and rehydrated through graded ethanol. Antigen retrieval was performed by incubating the slides in a steamer with 10 mM citrate buffer (pH 6.0) for 30 min. After cooled down, the slides were washed for 10 min in running tap water. Slides were then incubated in 95%–100% formic acid for 5 min, followed by 10 min washing in running tap water. To block endogenous peroxidase activity, slides were incubated in 3% H2O2 (in 1X PBS) for 15 min, followed by washing in tap running water for 15 min. To block nonspecific binding and excessive background, slides were blocked with a serum free block (Biocare Medical) for 15 min. Primary antibody was applied on the slides and incubated overnight at 4°C and then 1 h, RT on the following day Attorney Docket No. U1202.70128WO00 (see below for dilution information). Slides were washed three times with 1XPBS and incubated with HRP conjugated secondary antibody (see below for dilution information) or with rabbit or mouse linking reagent (Biolegend, Ref# 93030 and 93029) for 30 min at RT. After rabbit or mouse linking reagent incubation step, USA-HRP universal labeling reagent (Biolegend, Ref# 93028) was then applied to the slides for 30 min at RT. After three washes with 1XPBS, slides were developed with NovaRed, DAB, or Vector ® Red (Vector Labs). The slides were then washed in running tap water, counterstained with hematoxylin for 1-2 mins (modified Harris, Sigma Aldrich) and then rehydrated in graded alcohol and coverslipped for visualization. Images were taken on the Olympus BX51 microscope using the cellSens software or the slide scanner (Motic Digital Pathology). For detecting polyGR staining, anti-GR (H3148, 1:5000). For p-tau staining, anti-p-tau (AT8, 1:2000, Thermo Fisher Scientific, MN1020). For Aβ staining, anti-Aβ (1:1000, Abcam, ab2539). For p-TDP43, anti-p-TDP43 (1:5000, Cosmo Bio USA, CAC-TIP-PTD-M01). For detecting polymeric proteins expressed from the CASP8 GGGAGAexp locus, locus-specific C- terminal antibodies were used. For sense frame 1 (SF1) protein: anti-CT-f1S (K1785, 1:5000), for sense frame 3 (SF3) protein: anti-CT-f3S (K1790, 1:5000). For polyGR and p-tau IHC co-staining, after incubating with formic acid, slides were incubated with BLOXALL® solution (Vector lab, SP-6000-100) for 10 min, RT to block endogenous peroxidase and alkaline phosphatase. After three washes with 1XPBS, slides were incubated with anti-GR (H3148, 1:5000) and anti-p-tau (AT8, 1:2000, Thermo Fisher Scientific, MN1020) for overnight at 4°C and then 1 h, RT on the following day. After three washes with 1XPBS, the slides were incubated with HPR-anti-mouse IgG and AP-anti- rabbit IgG (Vector lab, MP-7724-15) for 20 min at RT. Slides then were developed with ImmPRESS® Duet Double Staining Polymer Kit following the manufacturer’s protocol (Vector lab, MP-7724-15). Dot blot staining for polyGR using rat monoclonal α-GR antibody Frozen brain tissue from frontal cortex regions were homogenized in RIPA buffer (G Biosciences, 786-489) supplemented with proteinase inhibitor cocktail (TargetMol, C0001), phosphatase inhibitor cocktails I (TargetMol, C0002) and II (TargetMol, C0003) and DNase I (0.2 mg/mL, Sigma-Aldrich, 10104159001 Roche) in bead tubes. Homogenized samples Attorney Docket No. U1202.70128WO00 were passed through 21.5G syringes and the soluble protein fraction were collected after the centrifugation at 13,000 rpm, 4°C, 15 min. For Dot blot staining, approximate 5 μg of total protein per well was loaded onto nitrocellulose membrane (Amersham) using Bio-Dot 96- well microfiltration system (Bio-Rad, 1703938) under vacuum following the manufacturer’s protocol. The blot was blocked in 5% skim milk in 1XPBS containing 0.05% Tween®-20 (PBST) for 2h, RT. After three washes with PBST, the blot was probed with rat monoclonal anti-GR antibody (1:2000, Sigma-Aldrich, MABN778) at 4 °C, overnight and then additional 1h, RT on the following day. After three washes with PBST, the blot was incubated with HRP-conjugated anti- rat antibody (1:2000, Jackson ImmunoResearch, 112-035-003) for 1 h, RT. The protein signal was detected using Western Chemiluminescent Substrate system (PerkinElmer, NEL105001EA). The total protein control on the blot was measured using Revert™ 700 Total Protein Stain Kit (LI-COR, 926-11010). Western blot (WB) Detection of polymeric proteins expressed from the CASP8 GGGAGAexp locus using WB. HEK293T cells were transfected with 4 μg of CASP8-RE1/2/3-3T or control plasmids using Lipofectamine™ 2000 Transfection Reagent (ThermoFisher, 11668019) following the manufacturer’s protocol. After 2 days, cells were harvested and washed with 1x PBS, and then homogenized in RIPA buffer (G Biosciences, 786-489) supplemented with proteinase inhibitor cocktail (TargetMol, C0001), phosphatase inhibitor cocktails I (TargetMol, C0002) and II (TargetMol, C0003). Approximate 15 μg of total protein/well was loaded on precast gel (4%– 12% Bis-Tris, Criterion) and transferred to a nitrocellulose membrane (Amersham). After the blocking step in 5% skim milk in PBST (2h, RT), the membrane was probed with antibodies to detect proteins of interest, overnight at 4 °C, and then additional 1h, RT. HA and FLAG frame proteins were detected using anti-HA (1:1000, Abcam, ab130275) and anti-FLAG (1:1000, Sigma-Aldrich, A8592), respectively. Effects of Thapsigargin (Tg) and Metformin on levels of CASP8 RAN proteins. To study effects of Thapsigargin (Tg) and Metformin on the expression of CASP8 polymeric proteins, HEK293T cells were transfected with CASP8-RE1/2/3-3T or control plasmids as described above for 24 h. Next cells were treated with Tg (1 μM) or co-treated with Tg (1 μM) and Metformin (5 mM). After 24 h incubation, cells were harvested and Attorney Docket No. U1202.70128WO00 protein lysates were collected, and levels of HA and FLAG frame proteins were detected as described above and normalized to tubulin signal (1:2000, Abcam, ab52866). Detection of cleaved caspase-8 in protein lysates from frontal cortex tissue from AD and control cases. Approximately 30 μg total protein was loaded per well on precast gel (4%–12% Bis- Tris, Criterion). For detecting cleaved caspase-8 levels, caspase-8 antibody (1:1000, Novus Biologicals, NB100-56116), overnight at 4 °C and 1h, RT. For IF assays, after staining steps coverslips or slides were then mounted with mounting medium containing DAPI (ThermoFisher Scientific, P36935). The IF images were obtained using Confocal microscopy LSM 880 (Zeiss). Characterization of rabbit antibodies against unique C-terminal sequences in CASP8 polymeric protein. HEK293T cells were plated on glass coverslips in 12-well plates a day before the transfection. Cells were transfected with 500 ng of FLAG-(GGGAGA)30-CT-f1S (SEQ ID NO: 30) and FLAG- (GGGAGA)30-CT-f3S (SEQ ID NO: 30) or control plasmids using LipofectamineTM 3000 Transfection Reagent (Thermo Fisher Scientific, L3000015) following the manufacturer’s protocol. After 48 h incubation, cells were fixed in in 4% PFA in PBS for 30 min, RT and permeabilized in 0.5% triton X-100 in PBS for 30 min, RT. Cells were blocked in 1% normal goat serum (NGS) in PBS for 1 h, RT. After blocking, cells were incubated with anti-FLAG (1:1000, Sigma-Aldrich, A8592) and anti-CT-f1S (K1785, 1:500) or anti-CT-f3S (K1790, 1:500) or pre-bleed sera (1:500) at 4 °C, overnight. Next day after three washed with 1XPBS, cells were incubated with goat anti-mouse conjugated with Alexa Fluor 488 (1:1000, ThermoFisher Scientific, A-11001) and goat anti-rabbit conjugated with Alexa Fluor 594 (1:1000, ThermoFisher Scientific, A-11012) for 1 h, RT. Detection of CASP8 polymeric proteins in HEK293T cells using IF. Approximate 100,000 HEK293T cells per well were plated on glass coverslips in 12- well plates a day before the transfection. Cells were transfected with 1 μg CASP8-RE1/2/3- 3T or control plasmids using Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Attorney Docket No. U1202.70128WO00 Scientific, 11668019) following the manufacturer’s protocol. Forty-eight hours post- transfection, cells were fixed in 4% PFA in PBS for 30 min, RT and permeabilized in 0.5% triton X-100 in PBS for 30 min, RT. The cells were blocked in 1% normal goat serum (NGS) in PBS for 1 h, RT. After blocking, the cells were incubated with anti-HA (1:1000, Abcam, ab130275), anti-FLAG (1:1000, Sigma-Aldrich, A8592), or anti-Myc (1:1000, Abcam, ab9106 ) at 4 °C, overnight. Next day after three washed with 1XPBS, cells were incubated with goat anti-mouse conjugated with Alexa Fluor 594 (1:1000, ThermoFisher Scientific, A- 11032) or goat anti-rabbit conjugated with Alexa Fluor 488 (1:1000, ThermoFisher Scientific, A11008) for 1 h, RT. Effects of polyGR and CASP8 GGGAGAexp on phosphorylation of tau protein in SH- SY5Y. Approximate 175,000 SH-SY5Y cells per well were seeded on glass coverslips in 12- well plates a day before the transfection. Cells were transfected with 2 μg CASP8-RE1/2/3- 3T or control plasmids or 500 ng 3xFlag-(GR)60 and control plasmids using Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, 11668019) following the manufacturer’s protocol. After 2 days incubation, cells were fixed and permeabilized as described above. Cells were incubated with anti-FLAG (1:1000, Sigma-Aldrich, F7425), anti- Myc (1:1000, Abcam, ab9106 ), and anti-p-tau (AT8, 1:2000, Thermo Fisher Scientific, MN1020) to detect CAPS8 polymeric proteins (both FLAG and Myc frame proteins) or polyGR and p-tau. Secondary antibodies used were Alexa Fluor 488 conjugated goat anti- rabbit IgG (1:1000, ThermoFisher Scientific, A11008) and Alexa Fluor 594 conjugated goat anti-mouse IgG (1:1000, ThermoFisher Scientific, A-11032) antibodies. Co-staining of polyGR and CT-SF3 using rat monoclonal α-GR antibody and rabbit polyclonal α-CT-f3S antibody. Ten μm frozen frontal cortex tissue sections were warmed up to RT and fixed in 10% formalin for 15 min, RT and immediately placed in pre-chilled Methanol/Acetone (1:1, v/v) at -20 °C, 5 min. After three washed with 1XPBS, slides were blocked with Background Sniper (Biocare Medical, BS966L) for 1 h, RT. Slides were incubated with rabbit polyclonal anti-CT-f3S (1: 1000, K1790) and rat monoclonal anti-GR antibody (1:1000, Sigma-Aldrich, MABN778) in 10% Background Sniper at 4 °C, overnight. After three washed with 1XPBS, slides were incubated with Alexa Fluor 633 conjugated goat anti-rat (1:1000, ThermoFisher Attorney Docket No. U1202.70128WO00 Scientific, A-21094) and Alexa Fluor 555 conjugated goat anti-rabbit (1:1000, ThermoFisher Scientific, A21430) antibodies in 10% Background Sniper for 1 h, RT. After washing step, slides were incubated with 0.1% Sudan Black in ethanol, 10 min, RT and washed 6 times with 1XPBS. Testing if anti-GR antibody has cross reactivity with tau protein. T98 cells were transfected with 3xFlag-(GR)60 or GFP-hTau. After 48 h, cells were fixed as described above and then stained with rabbit polyclonal anti-GR antibody (H3148, 1:1000). The cells were incubated with Alexa Fluor 594 conjugated goat anti-rabbit IgG antibody (1:1000, ThermoFisher Scientific, A-11012). Enrichment of tandem repeat DNA fragments using deactivated CRISPR/Cas9 protein (dCas9) and repeat containing single guide RNA (rsgRNA) Genomic DNA was extracted from frozen cerebellum or frontal cortex tissue from AD and control cases using Wizard Genomic DNA Purification Kit (Promega, A1125) or Monarch High Molecular Weight (HMW) DNA Extraction Kit (NEB, T3060L) following the manufacture’s protocols. Approximate 5 µg genomic DNA was digested with EcoRI-HF and HindIII-HF or EcoRI-HF and BamHI-HF for overnight at 37 °C. Digested DNA samples which were cleaned up and concentrated using Genomic DNA Clean & Concentrator™ Kit (Zymo Research, D4011) were subjected to the enrichment step using CRISPR deactivated Cas9 (dCas9) protein and rsgRNAs. For each enrichment reaction, 2 µg of biotin conjugated, 3xFLAG tagged dCas9 protein (Sigma-Aldrich, DCAS9PROT) was incubated with streptavidin magnetic beads (NEB, S1420S) in PBSTB (1XPBS, 0.05% Tween-20, 0.1% BSA) buffer on the rotor for 30 min, RT. dCas9 coated beads were washed three times with PBST (1XPBS, 0.05% Tween-20) prefiltered through 0.2 µm filters (fPBST) and then resuspended into 300 µL pulldown buffer. To refold rsgRNA, 5 µL rsgRNA (stock concentration = 10 µM) was diluted in 45 µL RNAse-free water and heated at 95 °C for 5 min followed by cooling down for 30 min at RT. dCas9 protein and rsgRNA complexes were formed by adding 30 µL folded rsgRNA or pooled rsgRNA mixture to dCas9 coated bead suspension and the mixture was incubated on the rotor at 37 °C for 10-15 min. After three washed with fPBST, dCas9-rsgRNA complexes on beads was suspended into 300 µL pulldown buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.1 mM EDTA, 10 mM MgCl2, 0.5 Attorney Docket No. U1202.70128WO00 mM DTT). Approximate 1-1.5 µg enzymatically digested DNA was added to the dCas9- rsgRNA-bead suspension and the mixture was incubated on the rotor for 20 min, 37 °C. The enriched DNA on beads was then washed once with fPBT followed by three washes with the post-pulldown wash buffer (20 mM Tris pH 8, 150 mM NaCl, 2 mM EDTA, and 0.1% Triton X- 100). Beads containing enriched DNA were re-suspended in 200 µL elution buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.1$ Triton X-100). To elute enriched DNA, the bead suspension was treated with 4.5 µL of 4 mg/mL RNase A on the rotor for 1h at 37 °C followed by adding 5 µL of 10% SDA and 10 µL Proteinase K (10 mg/mL) and incubated for additional 1h at 45 °C. Eluted DNA samples were cleaned up and concentrated using using Genomic DNA Clean & Concentrator™ Kit (Zymo Research, D4011). To measure the enrichment of C9orf72 GGGGCC or CNBP CCTC loci, enriched DNA samples were subjected to qPCR assays using primers targeting unique flanking sequences of these loci: for the C9orf7 locus: AS-F (C9-FS-F) and AS-R (C9-FS-R) (25), for the CNBP locus: DM2-F (CNBP-FS-F) and DM2-R (CNBP-FS-R) (FIGs.15A-15C). Two- step quantitative RT-PCR was performed on a MyCycler Thermal Cycler system (Bio-Rad) using SYBR Green PCR Master Mix (Bio-Rad) and Gene specific primer sets [95°C 3min, 40 cycles (95 °C 30 s, 60°C 30 s), 95°C 1min, 60°C 1min. Melting curve was performed [71 cycles (60°C - 95°C 10s per cycles)] in an optical 96-well plate with two technical replicates for each sample. Illumina short-read sequencing: Enriched DNA samples were used as template to generate short read sequencing libraries using Nextera DNA Flex Library Prep kit (Illumina, 20018704) following the manufacturer’s protocol. After Qubit and fragment analysis for quantity and quality control, barcoded Illumina DNA libraries were pooled and loaded on the Illumina NextSeq 550 system using NextSeq 500/550 High Output Kit v2.5 (300 Cycles) as per the manufacturer’s protocol. The resulting sequencing reads in FASTQ format were mapped against the hg19 reference genome obtained from https://genome.ucsc.edu/ using the Burrow- Wheeler aligner (bwa) (59). The sequencing reads containing GR encoding motifs (4 repeats) (Table 4) were extracted from the FASTQ files using Extracting_repeat_sequences.py (see attached script) and Python3 (http://www.python.org). These extracted sequences were mapped against the hg19 reference genome using BWA as described above. The peaks were called using MACS2 (61). Fold enrichment for individual peaks was measured as below. The peaks were annotated using HOMER and the fold enrichment of individual peaks was compared across samples. Fold Attorney Docket No. U1202.70128WO00 enrichment (FE) = Read counts (peak surrounding regions)/Read counts (background regions) Peak surrounding regions = (peak - 2-4 Kb, peak), (peak, peak + 2-4 Kb), or (peak – 2-4 Kb, peak + 2-4 Kb). Background regions = (peak - 6-8 Kb, peak), (peak, peak + 6-8 Kb), or (peak – 6-8 Kb, peak + 6-8 Kb) subtracted to corresponding peak surrounding region. PacBio long-read sequencing: For long-read sequencing, enriched DNA samples from controls or AD cases were combined to provide enough inputs (70-120 ng) to generate PacBio circular consensus sequence libraries using no-amp low input DNA library preparation kit 2.0 (Pacbio). The libraries were sequenced using PacBio Sequel II system (University of Louisville) to generate HiFi reads for downstream analysis. The resulting HiFi reads in the format of FASTQ were mapped against the hg19 reference genome using minimap2. The tandem repeat profiles were generated using mTR with FASTA reads as input sequences and m of 0.9. Repeat-primed PCR for novel repeat expansion loci Repeat-primed PCR assays were performed to characterize novel repeat loci. FAM labeled PCR products were analyzed on an ABI3730xl DNA analyzer (Applied Biosystems) and data was analyzed using GeneMarkers software (version 1.75, SoftGenetics). Primer sequences are listed in Table 8. For genotyping CASP8 GGGAGA repeat expansion, a PCR reaction consists of 1X PCR buffer (Sigma, P2192), 5% DMSO, dNTP (0.25 μM/each), 0.25 μM 7-deaza-2-dezoxy GTP, 0.5 μM CASP8-FAM, 0.5 μM SVA-repeat-1 or 0.5 μM SVA-repeat-2, 0.5 μM Tail primer, 1 M betaine, 1.25 U Apex Taq polymerase, 25 ng DNA template in a total of volume of 10 μL. Cycling conditions were 95 °C for 5 min, followed by 10 cycles of 97 °C for 35 s, 64 °C for 2 min, 68 °C for 8 min, 25 cycles of 97 °C for 35 s, 64 °C for 2 min, 68 °C for 8 min (+ 20 s/cycle). For genotyping LOC100499227, Linc00486, CYP2A7, ADAMTS14, and PKHD1 repeat expansion loci, a PCR reaction consists of 1X Phusion Flash high-fidelity PCR master mix 2X buffer (Thermo-Fisher, F548L), 0.5 μM FAM primer, 0.5 μM SVA- repeat-1, 0.5 μM Tail primer, 3% DMSO, 50 ng DNA template, in a total volume of 20 μL. Cycling conditions were 98 °C for 3 min, followed by 35 cycles of 98 °C for 10 s, 62 °C for 15 s, 72 °C for 1 min, and a final extension at 75 °C for 5 min. Attorney Docket No. U1202.70128WO00 Fragment analysis Fragment analysis was performed on dCas9READ enriched DNA samples and Illumina DNA libraries using Agilent fragment analysis kits DNF464 and DNF474, respectively as per the manufacturer’s protocol. Samples were analyzed on a 5200 Fragment Analyzer (Advanced Analytical Technologies, Inc.). Long-range PCR for CASP8 GGGAGA repeat locus Long-range PCR (LR-PCR) assays were performed to detect the CASP8 GGGAGA repeat expansion mutation and measure repeat lengths. A PCR reaction consists of 1X AccuPrime Pfx buffer, 0.16 mM dATP, 0.16 mM dTTP, 0.56 mM dCTP, 0.56 mM dGTP, 1 M Betaine, 1 U AccuPrime DNA Polymerase, 10-20 ng gDNA, 1 μM CASP8-LR-F, and 1 μM CASP8-LR-R with a total volume of 20 μL. PCR cycling conditions were 94 °C for 7 min, followed by 30-32 cycles of 95 °C for 45 s, 98 °C for 10 s, 60 °C for 30 s, 78 °C (slow ramp 0.6 °C/s) for 6 min, and a final extension at 78 °C for 10 min. Genotyping for rare variants pK148R and pI289V in CASP8 PCR assays were performed to examine pK148R and pI289V, two protein coding variants in CASP8 that were previously reported to associate with an increased AD risk. A PCR reaction consists of 1X Phire reaction buffer, dNTP (200 μM/each), forward primer (0.5 μM), reverse primer (0.5 μM), 20-50 ng/reaction, 1U Phire Hot Start II DNA polymerase (Thermo Fisher). PCR cycling conditions were 98 °C for 30 s, followed by 30cycles of 98 °C for 5 s, 63 °C for 10 s, 72 °C for 10 s, and a final extension at 72 °C for 1 min. Primes sequences of pK148R-F, pK148R- R, pI289V-F, and pI289V-R were listed in Table 8. Toxicity and cell viability (LDH cytotoxicity and MTT assays) T98 cells were transfected at 60% confluency with 700 ng of CASP8-RE1/2/3/-3T or control vector using Lipofectamine 2000 (Invitrogen) following manufacturer’s protocol. Cells were plated in 96 well plates and treated with chimeric antibodies (1 μM), and assays were performed in quadruplicate for each assay condition. Cell death was measured by quantifying the amount of lactate dehydrogenase (LDH) released into the media, using the CytoTox 96 nonradioactive cytotoxicity assay (Promega) following the manufacturer’s protocol. Absorbance was measured at 490 nm. Cell survival was measured using the MTT Attorney Docket No. U1202.70128WO00 assay (Affymetrix) as per the manufacturer’s protocol. The absorbance was measured at 550 nm. Transcript level determination Total RNA was isolated from mouse cerebellum and spinal cord tissue or 3xFlag- CASP8-RE-3T overexpressing HEK293T cells and Thapsigargin or Thapsigargin and metformin treated cells with TRIzol (Invitrogen) or miRNeasy Mini Kit (Qiagen, 217004) following the manufacturer’s protocol. DNA contamination was eliminated by treating the RNA samples with TURBO™ DNase (Invitrogen, cat# AM1907) and followed by inactivation with DNase inactivation reagent. Total RNA was reverse-transcribed using SuperScript III RT kit (Invitrogen) and random- hexamer primers (Applied Biosystems). Quantitative RT-PCR was performed using the PowerSYBR system (Applied Biosystems) using the AB Step One Plus Real time PCR system following manufacturer’s protocol and the PCR program described above. For 3xFlag-CASP8- RE-3T transcript levels: 3Tag-F and 3Tag-R, for CASP8 exon7-exon8: CASP8-Ex7Ex8-F and CASP8-Ex7Ex8-R, for CASP8 exon9: CASP8-Exon9-F and CASP8-Exon9-R, for GAPDH: GAPDH-F and GAPDH-R (see Table 8). Statistical analyses of genetics studies RP-PCR frequency for the screening for all the candidate loci in Table 7 identified the CASP8 repeat expansion as the only promising candidate, which was marginally associated with a higher risk of AD an initial odds ratio (OR) of 1.647 (95% CI [0.993, 2.732], z statistic 1.932, p = 0.053; Table 7). Thus, further genotyping of an additional 222 AD cases and 399 controls for CASP8 GGGAGAexp mutation were performed and detected a significant association in this second independent AD cohort with OR 1.767, 95% CI [1.237, 2.523], z statistic 3.132, p = 0.0017 using the validation sample. A two-sided power calculation using NCSS PATH v14 to detect an OR of 1.6 indicated that a sample size of 289 in each group would provide >80% power at the 0.05 significance level. This power calculation was consistent with the findings presented here and the CASP8 GGGAGAexp mutation was highly significantly associated with increased AD risk with an OR of 1.748 (95% CI [1.314, 2.326], z statistic 3.832, p = 0.0001) in the entire cohort, n=382 AD and n=521 controls Attorney Docket No. U1202.70128WO00 (Table 2). Statistical analysis for molecular studies All the quantification steps were performed using greater than three biological replicates per assay. Analyses were performed by QuPath (version 0.2.3) (65): IHC staining of pTau and polyGR, classification of GR60(+) and GR60(-) cells in the assay to study the effects of polyGR on pTau levels, pTau staining in GR60(+) and GR60(-) cells. Dot blot and Western blot data were quantified using ImageJ (National Institute of Health). Whole slide IHC quantification (QuPath). GR and p-Tau (AT8) staining detected by IHC in the CA, subiculum, and presubiculum regions of the hippocampal section was quantified using the whole scanned images and the QuPath version 0.2.3 followed the protocol modified from the analysis pipeline reported by Courtney et al (66). Images was analyzed by batch running using GR_staining_measurement.groovy and pTau_quantification.groovy (see attached script) to quantify polyGR and pTau staining, respectively. The analysis of individual images was then double checked by two researchers. In the assays that tested effects of polyGR on phosphorylation of tau protein in SH-SY5Y, GR60(+) cells and pTau(+) cells were quantified using the QuPath version 0.2.3 and positive cell detection program. Information on number (n) values and what n represents (e.g., cases, biological replicates) and definition of center and dispersion and precision measures [e.g., mean, median, standard error of the mean (SEM)] can be found in the figures and/or figure legends. GraphPad Prism 9 was used to perform the statistical analyses with p < 0.05 considered statistically significant. The significance values in figures were indicated as follows: ns = not significant p > 0.05, ∗ (p ≤ 0.05); ∗∗ (p ≤ 0.01); ∗∗∗(p ≤ 0.001); ∗∗∗∗ (p ≤ 0.0001). Statistical analyses were performed using one-way ANOVA with post hoc Holm-Sidak multiple comparison tests or unpaired two-tailed t-test with details included in the figure legends. Data polyGR protein accumulates in AD autopsy brain tissue To test the potential role of repeat expansions in AD, previously developed antibodies against RAN protein repeat motifs were used to test if RAN protein aggregates accumulate in AD autopsy brains. Immunohistochemistry (IHC) staining using formalin-fixed hippocampal Attorney Docket No. U1202.70128WO00 sections at the level of the lateral geniculate nuclei and a previously characterized rabbit α-GR polyclonal antibody, showed polyGR aggregates in sporadic AD cases but not age-similar controls (free of Alzheimer’s pathologic changes) (FIG. 5A and FIG. 11A). To rule out the possibility that the α-GR antibody was not simply cross reacting with intracellular Tau aggregates, immunofluorescence (IF) assays were performed on transfected cells and demonstrated that the α-GR antibody recognizes GR60 but not GFP-tagged human tau (FIG. 11B). In polyGR(+) AD cases, α-GR staining showed frequent perinuclear aggregates in both neurons and glia in the cornu ammonis (CA), subiculum, presubiculum and entorhinal cortex regions of the hippocampus (Fig. 1B). Quantification of α-GR IHC in hippocampal sections from 80 sporadic AD cases [(age at death (AAD): 79.0 +/- 11.9 (median ± SD), 46.3% females/53.7% males)] showed increased α-polyGR staining in 45 of 80 (56%) AD cases (p < 0.0001) (Fig.1C) compared to 18 age-similar controls [(AAD): 78.0 +/- 12.9 (median ± SD), 61.9% females/38.1% males]. To further assay the accumulation of polyGR proteins in AD, protein dot blots of frontal cortex lysates from a subset of the same patient and control cohorts with available frozen tissue were performed. Blots of protein lysates probed with a rat monoclonal α-GR antibody showed increased levels of polyGR signal in AD cases compared to age-similar controls (p < 0.0001) (FIGs.5D-5E, and FIG.11C). Similar to the polyGR IHC screening 31/65 (48%) of AD cases had increased polyGR signal compared to controls. To test the accumulation patterns of the polyGR-containing aggregates compared to known AD pathological hallmarks, IHC staining of adjacent tissue from sequential hippocampal sections from the same AD cases was performed. These assays showed distinct accumulation patterns of polyGR compared to pTau tangles (AT8), Aβ plaques, and p- TDP43 (e.g. Fig.1F). Co-staining IHC assays detected polyGR and pTau (AT8) in both overlapping and distinct sub-regions of the hippocampus (Fig.1G). Plotting polyGR and AT8 pTau signal showed a positive correlation (Pearson’s r = 0.5760, R2 = 0.332, p = 0.0063) (Fig.1H), in which higher polyGR staining was detected in AD cases with higher AT8 pTau signal. In summary, increased levels of polyGR protein were detected in autopsy brain tissue from sporadic AD cases compared to age-similar control brains without AD pathology. Furthermore, increased polyGR signal correlated with increased levels of pTau. Development of dCas9READ to identify repeat expansion mutations Attorney Docket No. U1202.70128WO00 The unexpected finding that polyGR aggregates accumulated in a substantial fraction of the tested sporadic AD cases indicated that one or more unidentified repeat expansion mutations produce this pathology. To identify putative polyGR-encoding expansion mutations, a repeat enrichment method called CRISPR/ deactivatedCas9-based repeat enrichment and detection (dCas9READ) was developed (FIG.6A). dCas9READ works on the principle that repeat expansion sequences provide more binding sites for repeat-containing single guide RNAs (rsgRNAs) and dCas9 complexes to assemble compared to shorter repeats. dCas9READ was optimized using human genomic DNA samples from C9orf72 ALS/FTD and myotonic dystrophy type 2 (DM2) patients. Biotin-streptavidin pulldowns using G4C2 or CAGG rsgRNAs were performed on enzymatically digested genomic DNA. The enrichment efficiency of expanded repeat containing DNAs was measured using primer sets that target unique flanking sequences of the C9orf72 G4C2 or CNBP CCTG loci (FIG. 6B and FIG.12A). Quantitative PCR showed 4- to 6-fold increased levels of C9orf72 or CNBP flanking sequence in C9 ALS/FTD and DM2 patient samples, respectively, compared to controls (FIG.6C and FIG.12A). An additional control assay performed without the G4C2 sgRNA showed no enrichment of the C9orf72 G4C2 locus. This demonstrated that pulldown specificity was determined by the repeat containing guide RNA (FIG.6D). Similarly, next- generation sequencing of enriched DNA samples showed significant increased total read counts at the C9orf72 G4C2 and CNBP CCTG loci (FIG.6E and FIG.12B). To test if dCas9READ can be used to screen multiple types of repeats simultaneously, dCas9READ assays were performed using a mixture of all possible rsgRNAs that would target sequences encoding polyGR (Table 4). Next generation sequencing showed the C9orf72 G4C2 locus was enriched using genomic DNA samples from C9 ALS/FTD patient but not control subjects using mixtures of 8 or 24 GR-targeting rsgRNAs (FIG.6F and Table 4). Additionally, by measuring total read count of the 2-4kb regions around loci of interest and 6- 10kb nearby regions, enrichment scores were calculated for all enriched loci in the genomes of individual patients. Ranking dCas9READ enrichment scores identified the C9orf72 G4C2 and CNBP CCTG as the most enriched loci in tested C9 ALS/FTD and DM2 cases, respectively (Table 5). In summary, dCas9READ strategy successfully enriched the C9orf72 G4C2 and CNBP CCTG expansions and unique flanking sequences from genomic DNA samples of C9 ALS/FTD and DM2 patients, respectively. In some embodiments, dCas9READ can be Attorney Docket No. U1202.70128WO00 adapted to pull down tandem repeats across the human genome and to detect novel expansion mutations from individual patient samples. Novel intronic GGGAGA repeat expansion in CASP8 associated with AD Next, dCas9READ was used to identify putative polyGR-expressing repeat expansion mutations from the genomic DNA of polyGR(+) AD cases (FIG.7A). GR-encoding repeat motifs (Table 4) were used to design 24 repeat-containing sgRNAs for dCas9 pulldowns on genomic DNA from five polyGR(+) AD cases, one polyGR(-) AD, and one polyGR(-) non- AD control. Fragment analysis showed enriched DNA with a peak molecular weight at 6-7kb (FIG.12C). Short-read Illumina sequencing data of individual enriched DNA samples were collected. The enriched DNA samples from 2-3 AD cases and 2 controls were combined into separate enrichment pools to provide enough input DNA for PacBio no-amplification long- read sequencing (FIG.14A). Analysis of enriched sequences from short-read Illumina sequencing detected 2,024 GR repeat loci (58.2% intergenic, 33.1% intronic, and 8.7% exonic, FIG.12D) with a ≥ 2- fold enrichment over background in any of the AD cases (Table 6). These candidate loci were further prioritized based on enrichment scores, read mapping patterns suggesting expanded repeats, and long read sequencing data. Based on these analyses, six intronic GGGAGA•TCTCCC candidate GR-encoding expansion loci: LOC100499227, Linc00486, CYP2A7, ADAMTS14, PKHD1, and CASP8 were focused on in further assays. All six of these candidate repeats were located within composite repetitive elements containing short interspersed nuclear element (SINE), variable number tandem repeat (VNTR), and Alu sequences referred to as SVA elements (FIG.7B and FIG.13A-13E; Table 7). Example enrichment data for the CASP8 locus compared to nine unenriched loci as assessed by total read count from Illumina sequencing are shown in FIGs.7C-7D. Repeat length measurements based on long-read sequencing data showed expanded GGGAGA repeats at all of these loci ranging in size from 19 to 80 repeats (Table 7). Next, repeat primed PCR (RP-PCR) assays were developed to test if repeat expansion alleles at these loci were found more frequently in AD patients vs controls. Five of six loci, LOC100499227, Linc00486, CYP2A7, ADAMTS14, PKHD1 showed positive expansion patterns for (GAGAGG)4 repeats (FIG.13B). Because the repeat at the CASP8 locus was Attorney Docket No. U1202.70128WO00 interrupted, the RP-PCR assay required a repeat primer with mixed repeats (GAGAGG)2GAGACG (SEQ ID NO: 15) (FIG.7E and FIG.13A). To test if any of these repeat expansions were associated with an increased risk of developing AD, an initial set of locus specific, high-throughput RP-PCR assays and compared expansion frequencies using DNA from cohorts of AD patients and cognitively unaffected non-Hispanic White controls from Coriell (Table 7) were performed. RP-PCR frequency screening showed only CASP8 repeat expansion mutation was associated with a higher risk of AD, with an initial odds ratio (OR) of 1.65 (95% CI [0.9927 to 2.7321], z statistic 1.932, p = 0.0534), Table 2A and Table 7. To further analyze this association, an additional AD (n=222) and control (n=399) sample for the CASP8 GGGAGAexp mutation were genotyped and detected a significant association with AD with an OR 1.77, 95% CI [1.2374, 2.5231], z statistic 3.132, p = 0.0017 (Table 2B). Additionally, RP-PCR analyses showed that the repeat length is approximately 55 nucleotides in length (FIG.11). Taken together, the CASP8 GGGAGAexp mutation was significantly associated with increased AD risk with an OR of 1.748 (95% CI [1.314, 2.326], z statistic 3.832, p = 0.0001) in the whole sample (Table 2C and Table 7). CASP8 encodes a member of the cysteine-aspartic acid protease (caspase family). Rare protein coding variants of CASP8 [K148R, 1/600 in AD and 1/1500 in controls] and [I298V, 1/300 in AD and 1/600 in controls] were previously reported to associate with increased risk of AD (28). These variants were not detected by PCR and Sanger sequencing of DNA from 24 CASP8 GGGAGAexp(+) cases (Table 8). Given the frequent polyGR pathology in AD cases and the discovery of an expanded repeat in CASP8 SVA-E, additional assays were used to characterize the CASP8 GGGAGA repeat. CASP8 repeat primed PCR (FIG.7E) showed at least two repeat expansion lengths were found at this locus. To further characterize the CASP8 repeat, long-read PacBio no- amplification sequencing was performed. The flanking sequences were used to map the repeat to the CASP8 locus (FIG.14B). Long-read sequencing reads showed the CASP8 repeat expansions have 44 or 64 GGGAGA repeats and were randomly interrupted by CG, C, G, CGG, GGG, GGGA, CGGG and combinations of these motifs (FIGs.14C-14D). Further analyses of PacBio sequencing reads from 7 AD cases and 2 controls detected three distinct repeat expansion configurations: 64- repeat highly interrupted (hi64), 44-repeat interrupted (i44), and 64-repeat interrupted (i64) (FIGs.14C-14D). RP-PCR was used to detect CASP8 GGGAGA repeat configurations, which showed 63% of AD cases (n = 382) had alleles with Attorney Docket No. U1202.70128WO00 64-repeats and 10% with 44-repeats (Fig.3F). Odd ratios for the 44-repeat and 64-repeat alleles were 2.5 (95% CI [1.4708, 4.2221], z statistic 3.394, p = 0.0007) and 1.7 (95% CI [1.2450, 2.2319], z statistic 3.431, p = 0.0006), respectively (Table 2D). Conversely, there was a protective effect of alleles that were negative for CASP8 expanded repeats by RP-PCR (OR 0.5720, 95% Cl [0.4299 to 0.7612], z statistic 3.832, p = 0.0001). These alleles were negative for the CASP8 GGGAGAexp RP-PCR assay, either because they lacked an SVA-E element or because they had a normal allele (10 repeats), which was not detected by this assay. RP-PCR using genomic DNA samples extracted from frontal cortex tissue or blood monocytes from the same individuals showed similar repeat lengths and configuration patterns for the CASP8 GGGAGAexp (FIGs.13C-13E), which suggested minimal somatic repeat instability. Additionally, long-range PCR identified a subset of individuals with no SVA-E insertion in CASP8 (FIGs.13D-13E). In some embodiments, dCas9READ and genomic DNA samples from control and polyGR(+) AD cases may be used to identify six novel candidate repeat expansion loci and/or show that the CASP8 GGGAGAexp mutation is associated with an increased risk of developing AD. Increased cleaved CASP8 protein levels in CASP8 GGGAGAexp(+) AD To test if the CASP8 GGGAGAexp mutation affected the expression of CASP8 at the RNA level, qRT-PCR was performed. Although no significant differences in CASP8 transcripts were found in frontal cortex tissue from CASP8-GGGAGAexp(+) and CASP8- GGGAGAexp (-) AD cases, there was a trend toward increased transcript levels in the CASP8- GGGAGAexp(+) cases (FIGs.15A-15C). Protein blotting detected ~20% higher levels of cleaved caspase-8 in the frontal cortex tissue from CASP8-GGGAGAexp(+) AD compared to CASP8-GGGAGAexp(-) AD (p = 0.007) or controls without AD pathology (p = 0.007) (FIGs. 8A-8B). Polymeric proteins expressed from CASP8 GGGAGA expansions accumulate in cells and AD autopsy brains Based on the sequence flanking the CASP8 expansion, expression of both RAN and ATG- initiated proteins from the CASP8 GGGAGAexp locus was investigated (Fig 4C). Sense CASP8 RAN proteins were predicted to be chimeric proteins that contain glycine- Attorney Docket No. U1202.70128WO00 arginine (GR), arginine- glutamic acid (RE), and glycine-glutamic acid (GE) repeat tracts [(GR)n(RE)n(GE)n] and unique C-terminal amino acid sequences in each of the three reading frames (FIG.8C). To test if CASP8 RAN proteins were expressed in cells, minigenes containing 6XStop codons, 100-bp of unique upstream sequence, one of three CASP8 GGGAGA repeat expansions, and 3’-epitope tags in each reading frame were generated (6XStop-CASP8-RE-3T) (FIG.16A). Sequences upstream of the repeat contained an ATG codon in HA frame (FIG.16A). Transfection using 6XStop-CASP8-RE-3T plasmids show repetitive proteins were expressed in HEK293T cells across all three CASP8 GGGAGA expansion configurations tested (hi64, i44, i64). Western blotting detected proteins in the FLAG and HA frames (FIGs.16B-16D) and immunofluorescence (IF) assays showed signals for all three frames FLAG, HA, and Myc (FIG.16F), with fewer positive cells for Myc compared to FLAG and HA. To test if polymeric proteins expressed from the CASP8 locus accumulated in polyGR(+) AD autopsy brains, rabbit polyclonal antibodies were developed against unique C-terminal amino acid sequences from CASP8 sense frames 1 (Sf1) and 3 (Sf3) (CT-f1S and CT-f3S, respectively). Immunogenic epitopes are highlighted in red (Fig 4C). Antibody validation assays showed these CASP8 Sf1 (α-CT-f1S) and Sf3 (α-CT-f3S) C-terminal antibodies co- localized with 5’ FLAG epitope-tagged recombinant proteins expressing the corresponding unique C-terminal regions from frames 1 and 3 (FIGs.16G-16H). No similar signal was detected in cells transfected with control plasmids or in cells overexpressing FLAG-tagged CT-f1S or CT-f3S incubated with pre-immune sera (FIGs.16G-16H). In some embodiments, α-CT-f1S and α- CT-f3S antibodies may be used to specifically recognize their CT-f1S and CT-f3S targets, respectively. Next, the novel C-terminal antibodies were used to test if polyGR staining in CASP8 GGGAGAexp(+) AD cases results from the expression of CASP8-GGGAGA encoded proteins. IHC assays on hippocampal sections with α-CT-f3S detected aggregate- or fibril- like staining in all CASP8-GGGAGAexp(+) AD cases but not in CASP8-GGGAGAexp(+) unaffected controls, or CASP8-GGGAGAexp(-) AD or control autopsy brains (FIG.8D, FIG. 17A, and FIGs. 18A-18B). α-CT- f3 S staining in the hippocampus varied among AD cases and was abundantly found in some cases and less frequent in others (Table 3). In contrast, IHC staining using the α-CT-f1 S antibody detected no or minimal staining in hippocampal regions in CASP8-GGGAGA exp (+) cases (data not shown). In the frontal cortex, α-CT-f3 S Attorney Docket No. U1202.70128WO00 and α-CT-f1S staining was found in gray and white matter regions from a subset of CASP8- GGGAGAexp(+) but not CASP8-GGGAGAexp(-) AD cases nor CASP8-GGGAGAexp(+) or CASP8-GGGAGA exp (-) controls (FIGs. 17B-17C). Double IF assays on frozen frontal cortex tissue using α-polyGR (26, 27) and α-CT-f3S antibodies showed polyGR partially co- localizes with α-CT-f3S staining (FIG.8E and FIG.19). These results demonstrated that GR- containing polymeric proteins were expressed from the CASP8 GGGAGAexp and that CASP8 expansion proteins expressed from reading frame-3 caused at least part of polyGR pathology found in CASP8 GGGAGAexp(+) AD cases. Of the 36 polyGR(+) autopsy brains with DNA available for genotyping, 27/36 were CASP8-GGGAGAexp(+) and nine CASP8-GGGAGAexp(-). This data indicated additional GR- encoding AD expansion mutations remain to be identified. Additionally, 10 CASP8- GGGAGAexp(+) AD autopsy brains examined by IHC were positive for α-polyGR and the CASP8 C-terminal-specific α- CT-f3S. These data demonstrated that the CASP8 GGGAGAexp mutation expressesed polymeric proteins in CASP8 GGGAGAexp(+) AD brains and provided a molecular explanation for a substantial portion of the polyGR staining found in AD autopsy brains. CASP8 GGGAGAexp RAN protein levels were increased by stress Variable staining detected by α-CT-f3S and α-CT-f1S antibodies against unique C- terminal sequences of CASP8 RAN proteins and the lack of staining in CASP8 GGGAGAexp(+) age-matched controls without AD pathology indicated that environmental factors affected the expression and accumulation of these proteins. Thus, the role of the integrated stress response, which has been reported to increase RAN translation in other repeat expansion diseases (24, 29-33), on CASP8 RAN protein levels was tested. Treatment of HEK293T cells transfected with 6XStop-CAPS8-RE-3T minigenes (FIG.16A) with thapsigargin (Tg), which increases endoplasmic reticulum (ER) stress (34, 35), significantly increased the steady-state levels of proteins expressed from the FLAG and HA frames (FIGs. 9A-9B and 20A-20B). For example, the basal levels of RAN proteins were upregulated approximately 2-3- fold with thapsigargin treatment in the FLAG frame (hi64: p = 0.028; i44: p = 0.003; i64: p = 0.032), and 1.5 fold in the HA frame (i44: p = 0.022; i64: p = 0.033). Additionally, treatment with metformin, an FDA-approved drug for type 2 diabetes recently shown to decrease RAN protein levels in other repeat expansion disorders (24), reduced Attorney Docket No. U1202.70128WO00 CASP8 RAN protein levels induced by Tg in the FLAG frame (hi64: p = 0.030; i44: p = 0.003; i64: p = 0.008) and in the HA frame (i44: p = 0.022; i64: p = 0.008) (FIGs.9A-9B, FIGs.16C-16D, and FIGs.20A-20C). In summary, ER stress induced by Tg increases CASP8 RAN protein levels, which suggested stress conditions contributed to the variable expression or accumulation of CASP8 RAN proteins. In some embodiments, metformin may be used to decrease CASP8 polymeric protein production induced by stress. CASP8 GGGAGAexp was toxic to cells and polyGR and CASP8 GGGAGAexp increase p-Tau at pathogenic sites S202 and T205 in cells To test if the CASP8 GGGAGAexp was toxic to cells, T98, SH-SY5Y, and HEK293T cells were transfected with 6XStop-CASP8-RE-3T or control minigenes, and cell death and viability were assessed as previously described (25, 36, 37). Transfection of 6XStop-CASP8- RE-3T constructs led to 12-35% increased lactate dehydrogenase (LDH) levels in T98 cells compared to cells transfected with control plasmids (hi64: p = 0.0001, i44: p < 0.0001, i64: p = 0.0001) (FIG.9C). Additionally, a significant reduction in cell viability was detected as measured by NAD(P)H-dependent oxidoreductase activity in mitochondria (MTT) assays in T98 cells transfected with 6XStop-CASP8-RE-3Tags plasmids compared to controls (hi64: p = 0.0074; i44: p < 0.0001; i64: p = 0.0098) (FIG.9C). Similarly, 6XStop-CASP8-RE-3T constructs were toxic to SH-SY5Y and HEK293T cells but to a lesser extent (FIGs.20D- 20E). Because higher polyGR levels were detected in AD cases with higher pTau (S202 and T205) (Fig.1H), the role of polyGR or CASP8 GGGAGAexp in altered p-Tau in cell overexpression models was tested. In cells transfected with an alternative codon plasmid expressing AUG-initiated 3xFLAG-(GR)60 protein (FIG.11B), double IF showed that pTau levels at S202 and T205 sites were significantly higher in polyGR(+) transfected SH-SY5Y cells compared to polyGR(-) SH- SY5Y cells (p < 0.0001) (FIGs.9D-9E and FIG.21A). Similarly, transfected SH-SY5Y cells that showed positive RAN protein staining, had increased S202 and T205 pTau staining compared to RAN negative cells (FIG.21B). In HEK293T overexpressing polyGR and GFP-hTau (38), co-localization of polyGR and tau proteins (FIG.22) was detected. In summary, this data demonstrated that CASP8 GGGAGAexp was toxic to multiple cell types and that the expression of polyGR or CASP8 GGGAGAexp containing constructs Attorney Docket No. U1202.70128WO00 led to increased levels of pTau at pathologically relevant phosphorylation sites, S202 and T205. The results provided here indicate that ~50% of sporadic AD autopsy brains have elevated polyGR staining in neurons and glia in the hippocampus and frontal cortex compared to age-matched controls without AD pathology (p < 0.0001). The development of dCas9READ allowed the enrichment and identification of the GR-encoding GGGAGA expansion mutation within an SVA-E element in intron 8 of CASP8. This expansion mutation was associated with an increased risk of AD, which explains a large portion of polyGR staining found in the AD brain cohort. In cells, the CASP8-GGGAGAexp was toxic when overexpressed and CASP8 RAN protein levels, which were increased by endoplasmic reticulum stress, were reduced by the FDA-approved type-2 diabetes drug metformin. Additionally, the data showed polyGR aggregates correlated with increased pTau in AD autopsy brains and that overexpression of polyGR proteins in cells increased pTau levels. Taken together, these indicated that CASP8 GGGAGAexp expressed polyGR-containing RAN proteins, which in turn led to increased pTau, and that this pathogenic cascade was exacerbated by stress and mitigated by metformin (FIGs.9F-9G). The accumulation of intracellular pTau tangles is a pathological hallmark of AD, however the cause of this pathology in most sporadic AD cases is unclear. The data presented here suggested that the accumulation of GR-containing RAN proteins was an upstream event that led to the AD- associated pathological hallmark of pTau accumulation. In the related neurodegenerative disorder C9orf72 ALS/FTD, polyGR aggregation has been reported to induce TDP-43 proteinopathy (39). The positive aggregate staining found in CASP8-GGGAGAexp(+) brains using two different locus specific C-terminal antibodies and the co-localization of α-polyGR staining with staining from the CASP8-locus-specific C-terminal antibody α-CT-f3S demonstrated that the CASP8 GGGAGAexp(+) causes a substantial portion of polyGR pathology detected in AD autopsy brains. In contrast to the GR-positive CASP8 GGGAGAexp(+) AD cases, all five CASP8 GGGAGAexp(+) control brains were negative for polyGR and CASP8-locus specific C- terminal antibody staining. The observation that oxidative stress increases CASP8 RAN protein levels in cells indicates stress conditions may increase susceptibility to AD in CASP8- GGGAGAexp(+) carriers by increasing CASP8 RAN protein levels. Attorney Docket No. U1202.70128WO00 While SVA elements encompass approximately 3000 loci in the human genome and have been linked to X-linked dystonia parkinsonism (XDP), Fukuyama congenital muscular dystrophy and Parkinson’s disease, there is limited knowledge about SVA biology. This data showed that expanded GGGAGA repeats within the CASP8 SVA-E element produced polymeric proteins that accumulated in AD brains, indicating a novel mechanism of how SVA elements contribute to disease. In contrast to most microsatellite repeat expansions, the CASP8 GGGAGAexp repeat showed less somatic and intergenerational repeat length variation. First, the insertion event itself may be a recent human event because long-range PCR identified a subset of cases that did not contain an SVA-E insertion in CASP8 (FIG.13E). Second, the CASP8 SVA repeats were fairly stable with minimal intergenerational or somatic repeat length instability. Third, the shorter 44 GGGAGA length SVA alleles were more toxic in cell toxicity and viability assays and showed greater risk for AD than longer 64 repeat alleles. A potential similarity with other microsatellite expansion diseases is that interruptions within the CASP8 GGGAGA expansion can lead to cell- type specific increases in toxicity. Caspase-8 is known to be involved in the amyloid metabolism, synaptic plasticity, learning, memory and the regulation of microglial pro-inflammatory activation. Protein loss of function caused by the CASP8 GGGAGAexp, would be consistent with the loss-of- function effects of previously reported rare CASP8 protein coding variants. Protein loss-of- function through haploinsufficiency is a common theme in repeat expansion disorders. Unexpectedly, increased levels of cleaved caspase 8 were detected in end-stage frontal cortex tissue from CASP8-GGGAGAexp(+) AD cases. The CASP8 GGGAGA expansion was strikingly different from other AD risk loci (FIG.9F). Most AD genes (APP, PSEN1, PSEN2) and AD risk factors (TREM2, ABCA7, SORL1) that show strong increased risk for AD (OR>3) are relatively infrequent in the general population (<2%), except for APOE4 (OR>3, <20%) (57, 58). In contrast, AD risk factors with the highest frequencies in the general population (e.g., ACE (~45%), ECHDC3 (~39%), PTK2B (~37%)) have the lowest odd ratios for increased AD risk (<1.2). In contrast, the CASP8 GGGAGAexp(+), which was frequently found in controls (~60%), also had a relatively high OR (1.75). These data, combined with pathological data showing the CASP8 polymeric proteins detected with locus-specific antibodies accumulate in CASP8 GGGAGAexp(+) AD but not control brains, identified the CASP8 GGGAGA expansion as a Attorney Docket No. U1202.70128WO00 common risk factor for AD. Table 2. Summary of statistical analysis of CASP8 GGGAGAexp in an AD and control cohort. (A) Initial cohort (B) Validation cohort (C) Combined AD and control cohorts (D) Repeat length effects in the combined AD and control cohorts Attorney Docket No. U1202.70128WO00 Table 2 legend: Combined AD cohort (total = 382): 369 autopsy-confirmed cases from UF and JHU ADRCs, Age at death (AAD): 82.0 ± 10.8 years (median ± SD), 58% females and 42% males, race: White, and 13 Coriell-NINDS AD cases, Age at sampling (AAS): 72.0 ± 6.6 years, AAS cutoff >= 65 years old. Combined control cohort (total = 521): 64 autopsy-confirmed controls without AD pathology (AAD: 81.5 ± 9.2 years, with 33% females and 67% males, race: White), and 457 cognitively normal Coriell- NINDS controls (AAS: 72 ± 6.2 years, AAS cutoff >= 65 years old, 49% females and 51% males, race: White), F: Female, M: Male Table 3: Summary of α-CT-f3S and α-CT-f1S staining detected in AD & control cases Attorney Docket No. U1202.70128WO00 CASP8 GGGAGAexp: CASP8 GGGAGA repeat expansion genotyping by repeat-primed Attorney Docket No. U1202.70128WO00 PCR, + CASP8 GGGAGA repeat expansion carrier, - not carrying CASP8 repeat expansion (in blue); HC: hippocampus; FCX: frontal cortex; CA: Cornu Ammonis; Sub: Subiculum; DG: dentate gyrus; GM: gray matter; WM: white matter; AAD: age at death; yo: years old; PMD: postmortem duration; M: Male; F: Female; W: White/ Caucasian; A: Asian; +++ strong frequent staining, ++ moderate staining, + occasional positive staining, +* positive but rare, - negative staining, n/a: not available. Table 4: GR encoding repeat motifs used for designing repeat-containing sgRNAs for dCas9-based pulldown. Repeat-containing sgRNAs were designed using the IDT gRNA design tool (https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM) or designed manually. Attorney Docket No. U1202.70128WO00 Table 5: Examples of dCas9READ enrichment ranking showing the top five most enriched loci in a C9 ALS/FTD (A) and a DM2 case (B). G4C2 sgRNAs were used to enrich C9orf72 ALS/FTD and control DNA samples (A). CAGG sgRNAs were used to enrich DM2 and control DNA samples (B). (A) (B) Attorney Docket No. U1202.70128WO00 Table 6: List of 225 polyGR dCas9 enriched loci and fold enrichment over background of the enriched loci in AD and control cases Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Table 7: Initial frequency screening of novel repeat expansion loci in AD and control cases by RP-PCR Attorney Docket No. U1202.70128WO00 Attorney Docket No. U1202.70128WO00 Ref size: repeat size (in number of repeats) found in the reference genome (hg19, UCSC, https://genome.ucsc.edu). ND = not done AD cohort: DNA samples extracted from autopsy-confirmed AD cases from UF and JHU ADRCs. Attorney Docket No. U1202.70128WO00 Control cohort: Cognitively normal Coriell-NINDS controls Table 8: Examples of primers Attorney Docket No. U1202.70128WO00 EQUIVALENTS While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure. All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms. All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document. The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” Attorney Docket No. U1202.70128WO00 The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc. As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e., “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law. As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, Attorney Docket No. U1202.70128WO00 A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc. It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited. In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., “comprising”) are also contemplated, in alternative embodiments, as “consisting of” and “consisting essentially of” the feature described by the open-ended transitional phrase. For example, if the disclosure describes “a composition comprising A and B”, the disclosure also contemplates the alternative embodiments “a composition consisting of A and B” and “a composition consisting essentially of A and B”.

Claims

Attorney Docket No. U1202.70128WO00 CLAIMS We claim: 1. A method for identifying a subject as having a RAN protein disease, the method comprising detecting one or more interrupted RAN proteins in a biological sample obtained from the subject, wherein the one or more interrupted RAN proteins each comprise multiple RAN repeat units. 2. The method of claim 1, wherein the one or more interrupted RAN proteins comprises a poly-GA interrupted RAN protein. 3. The method of claim 1 or 2, wherein at least one of the interrupted RAN proteins is translated from a (GGGGCT)x expansion repeat or a (GAAGGA)x expansion repeat, wherein x comprises an integer between 2 and 200. 4. The method of any one of claims 1 to 3, wherein the one or more interrupted RAN proteins comprises a poly-GR interrupted RAN protein. 5. The method of claim 1 to 4, wherein at least one of the interrupted RAN proteins is translated from a (GGGAGA)x expansion repeat, wherein x comprises an integer between 2 and 200. 6. The method of any one of claims 1 to 5, wherein at least one of the interrupted RAN proteins is transcribed from a gene or chromosomal locus set forth in Table 1, optionally wherein at least one of the interrupted RAN proteins is transcribed from ARMCX4, ALK, and/or CASP8. 7. The method of any one of claims 1 to 6, wherein at least one of the interrupted RAN proteins comprises at least one amino acid residue between each RAN repeat unit. 8. The method of claim 7, wherein at least one of the interrupted RAN proteins comprises between 2 and 20 amino acid residues between each RAN repeat unit. Attorney Docket No. U1202.70128WO00 9. The method of any one of claims 1 to 8, wherein the subject is a human. 10. The method of any one of claims 1 to 9, wherein the detecting comprises performing an assay on the biological sample. 11. The method of claim 10, wherein the assay comprises an antibody-based capture assay, binding assay, hybridization assay, immunoblot analysis, Western blot analysis, immunohistochemistry, dCas9-based enrichment, label free immunoassays, immunoquantitative PCR, mass spectrometry, bead-based immunoassays, immunoprecipitation, immunostaining, immunoelectrophoresis, and/or ELISA. 12. The method of any one of claims 1 to 11, wherein the RAN protein disease is amyotrophic lateral sclerosis (ALS), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), Alzheimer’s disease (AD), or Fuch’s Corneal Dystrophy (e.g., CTG181). 13. The method of claim 12, wherein the RAN protein disease is Alzheimer’s disease (AD) or amyotrophic lateral sclerosis (ALS). 14. The method of any one of claims 1 to 13, further comprising administering to the subject one or more anti-RAN protein agents. 15. The method of claim 14, wherein the one or more anti-RAN protein agents comprises a protein, peptide, nucleic acid, or small molecule. Attorney Docket No. U1202.70128WO00 16. The method of claim 15, wherein the protein comprises an antibody, optionally wherein the antibody is an anti-poly-GA or anti-poly-GR antibody, optionally wherein the anti-poly-GA antibody specifically binds to a poly-GA repeat region of the RAN protein in the subject, optionally wherein the anti-poly-GR antibody specifically binds to a poly-GR repeat region of the RAN protein in the subject, optionally wherein the anti-poly-GA or anti- poly-GR antibody is a monoclonal antibody. 17. The method of claim 14, wherein the one or more anti-RAN protein agents comprises a nucleic acid, optionally wherein the nucleic acid is double-stranded RNA (dsRNA), short- interfering RNA (siRNA), short-hairpin RNA (shRNA), microRNA (miRNA), artificial microRNA (amiRNA), an aptamer, or an antisense oligonucleotide (ASO), optionally wherein the nucleic acid comprises a region of complementarity with a nucleic acid sequence encoding a poly-GA or poly-GR repeat expansion in the subject, optionally wherein the nucleic acid comprises a region of complementarity with a nucleic acid sequence present at a chromosomal locus or gene as set forth in Table 1. 18. The method of claim 14, wherein the one or more anti-RAN protein agents comprises a small molecule, optionally wherein the small molecule is metformin. 19. The method of any one of claims 14 to 18, wherein the administration results in reduction of RAN protein transcription, translation, expression, accumulation, or aggregation in the subject, relative to the level of RAN protein transcription, translation, expression, aggregation or accumulation in the subject prior to the administration. 20. A method of treating a subject having or suspected of having a RAN-protein associated disease or disorder, the method comprising administering to the subject one or more anti-RAN protein agents. 21. The method of claim 20, wherein the one or more anti-RAN protein agents target one or more interrupted RAN proteins, wherein the one or more interrupted RAN proteins each comprise multiple RAN repeat units. Attorney Docket No. U1202.70128WO00 22. The method of claim 21, wherein the one or more interrupted RAN proteins comprises a poly-GA interrupted RAN protein. 23. The method of claim 22, wherein at least one of the interrupted RAN proteins is translated from a (GGGGCT)x expansion repeat or a (GAAGGA)x expansion repeat, wherein x comprises an integer between 2 and 200. 24. The method of claim 21, wherein the one or more interrupted RAN proteins comprises a poly-GR interrupted RAN protein. 25. The method of claim 24, wherein at least one of the interrupted RAN proteins is translated from a (GGGAGA)x expansion repeat, wherein x comprises an integer between 2 and 200. 26. The method of any one of claims 21 to 25, wherein at least one of the interrupted RAN proteins is transcribed from a gene or chromosomal locus set forth in Table 1, optionally wherein at least one of the interrupted RAN proteins is transcribed from ARMCX4, ALK, and/or CASP8. 27. The method of any one of claims 21 to 26, wherein at least one of the interrupted RAN proteins comprises at least one amino acid residue between each RAN repeat unit. 28. The method of claim 27, wherein at least one of the interrupted RAN proteins comprises between 2 and 20 amino acid residues between each RAN repeat unit. 29. The method of any one of claims 20 to 28, wherein the subject is a human. 30. The method of any one of claims 20 to 29, wherein the RAN protein disease is amyotrophic lateral sclerosis (ALS), Huntington’s disease (HD), Alzheimer’s disease (AD), Fragile X Syndrome (FRAXA), Spinal Bulbar Muscular Atrophy (SBMA), Dentatorubropallidoluysian Atrophy (DRPLA), Spinocerebellar Ataxia 1 (SCA1), Spinocerebellar Ataxia 2 (SCA2), Spinocerebellar Ataxia 3 (SCA3), Spinocerebellar Ataxia 6 Attorney Docket No. U1202.70128WO00 (SCA6), Spinocerebellar Ataxia 7 (SCA7), Spinocerebellar Ataxia 8 (SCA8), Spinocerebellar Ataxia 12 (SCA12), Spinocerebellar Ataxia 17 (SCA17), Spinocerebellar ataxia type 36 (SCA36), Spinocerebellar ataxia type 29 (SCA29), Spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), Alzheimer’s disease (AD), or Fuch’s Corneal Dystrophy (e.g., CTG181). 31. The method of claim 30, wherein the RAN protein disease is Alzheimer’s disease (AD) or amyotrophic lateral sclerosis (ALS). 32. The method of any one of claims 20 to 31, wherein the one or more anti-RAN protein agents comprises a protein, peptide, nucleic acid, or small molecule. 33. The method of claim 32, wherein the protein comprises an antibody, optionally wherein the antibody is an anti-poly-GA or anti-poly-GR antibody, optionally wherein the anti-poly-GA antibody specifically binds to a poly-GA repeat region of the RAN protein in the subject, optionally wherein the anti-poly-GR antibody specifically binds to a poly-GR repeat region of the RAN protein in the subject, optionally wherein the anti-poly-GA or anti- poly-GR antibody is a monoclonal antibody. 34. The method of claim 32, wherein the one or more anti-RAN protein agents comprises a nucleic acid, optionally wherein the nucleic acid is double-stranded RNA (dsRNA), short- interfering RNA (siRNA), short-hairpin RNA (shRNA), microRNA (miRNA), artificial microRNA (amiRNA), an aptamer, or an antisense oligonucleotide (ASO), optionally wherein the nucleic acid comprises a region of complementarity with a nucleic acid sequence encoding a poly-GA or poly-GR repeat expansion in the subject, optionally wherein the nucleic acid comprises a region of complementarity with a nucleic acid sequence present at a chromosomal locus or gene as set forth in Table 1. 35. The method of claim 32, wherein the one or more anti-RAN protein agents comprises a small molecule, optionally wherein the small molecule is metformin. Attorney Docket No. U1202.70128WO00 36. The method of any one of claims 20 to 35, wherein the administration results in reduction of RAN protein transcription, translation, expression, accumulation, or aggregation in the subject, relative to the level of RAN protein transcription, translation, expression, aggregation or accumulation in the subject prior to the administration. 37. The method of any one of claims 20-36, wherein the subject is identified as having a RAN protein disease according to the method of any one of claims 1 to 19. 38. The method of any one of claim 1 to 19 or 37, wherein the biological sample is tissue, blood, serum, or cerebrospinal fluid (CSF), optionally wherein the tissue is brain tissue or spinal cord tissue.
EP23886931.7A 2022-11-01 2023-11-01 Interrupted ran proteins in disease Pending EP4612175A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202263421533P 2022-11-01 2022-11-01
US202363456405P 2023-03-31 2023-03-31
PCT/US2023/078353 WO2024097756A1 (en) 2022-11-01 2023-11-01 Interrupted ran proteins in disease

Publications (1)

Publication Number Publication Date
EP4612175A1 true EP4612175A1 (en) 2025-09-10

Family

ID=90931519

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23886931.7A Pending EP4612175A1 (en) 2022-11-01 2023-11-01 Interrupted ran proteins in disease

Country Status (4)

Country Link
EP (1) EP4612175A1 (en)
JP (1) JP2026503198A (en)
AU (1) AU2023373378A1 (en)
WO (1) WO2024097756A1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RS59283B1 (en) * 2013-01-22 2019-10-31 Deutsches Zentrum Fuer Neurodegenerative Erkrankungen E V Dipeptide-repeat proteins as therapeutic target in neurodegenerative diseases with hexanucleotide repeat expansion
EP3994159A4 (en) * 2019-07-05 2023-08-09 University of Florida Research Foundation, Incorporated METHODS OF TREATMENT OF RAN PROTEIN-ASSOCIATED NEUROLOGICAL DISEASES

Also Published As

Publication number Publication date
JP2026503198A (en) 2026-01-28
AU2023373378A1 (en) 2025-04-24
WO2024097756A1 (en) 2024-05-10

Similar Documents

Publication Publication Date Title
JP7579589B2 (en) Methods for treating ran protein-associated neurological diseases
JP7803925B2 (en) Anti-transferrin receptor (TfR) antibodies and uses thereof
US20230226212A1 (en) Muscle-targeting complexes and uses thereof
CN115427059A (en) Anti-transferrin receptor (TFR) antibodies and uses thereof
CA3186752A1 (en) Muscle targeting complexes and uses thereof for treating dystrophinopathies
US20250243263A1 (en) Tau binding compounds
KR20230020394A (en) TAU binding compound
US12291565B2 (en) Tau binding compounds
JP2021521896A (en) Human-derived anti- (polyGA) dipeptide repeat (DPR) antibody
JP2025530892A (en) Compositions and methods for non-genotoxic cell pretreatment
JP2021502977A (en) Use of SRSF3 agonists for the treatment and / or prevention of neurological conditions, cancer, bacterial or viral infections
US20250164489A1 (en) Ran proteins in sporadic amyotrophic lateral sclerosis
AU2023373378A1 (en) Interrupted ran proteins in disease
US20250237666A9 (en) Poly-ga proteins in alzheimer’s disease
WO2023077153A1 (en) Poly-ga proteins in alzheimer&#39;s disease
CN121909216A (en) Anti-TfR: acid sphingomyelinase for the treatment of acid sphingomyelinase deficiency
EP4223878A1 (en) Sars-cov-2-binding peptide
JP2026077638A (en) Anti-transferrin receptor (TfR) antibodies and their use
WO2025128551A9 (en) Aav-based anti-ga therapy
WO2025019730A1 (en) Engineered ga antibodies for therapy development
WO2025122634A1 (en) Compositions and methods for the treatment of tau-related disorders

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250415

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)