EP4612162A1 - Shortened cell-penetrating peptides - Google Patents

Shortened cell-penetrating peptides

Info

Publication number
EP4612162A1
EP4612162A1 EP23805112.2A EP23805112A EP4612162A1 EP 4612162 A1 EP4612162 A1 EP 4612162A1 EP 23805112 A EP23805112 A EP 23805112A EP 4612162 A1 EP4612162 A1 EP 4612162A1
Authority
EP
European Patent Office
Prior art keywords
seq
peptide
suitably
arginine
arginine rich
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23805112.2A
Other languages
German (de)
French (fr)
Inventor
Matthew Wood
Yahya JAD
Graham Mcclorey
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oxford University Innovation Ltd
Original Assignee
Oxford University Innovation Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford University Innovation Ltd filed Critical Oxford University Innovation Ltd
Publication of EP4612162A1 publication Critical patent/EP4612162A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A61K47/645Polycationic or polyanionic oligopeptides, polypeptides or polyamino acids, e.g. polylysine, polyarginine, polyglutamic acid or peptide TAT
    • A61K47/6455Polycationic oligopeptides, polypeptides or polyamino acids, e.g. for complexing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/08Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3513Protein; Peptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • the present invention relates to peptides, in particular cell-penetrating peptides, and to conjugates of such cell-penetrating peptides with a therapeutic molecule.
  • the present invention further relates to use of such peptides or conjugates in methods of treatment or as a medicament, especially in the treatment of genetic disorders and in particular neuromuscular diseases.
  • Nucleic acid drugs are genomic medicines with the potential to transform human healthcare. Research has indicated that such therapeutics could have applications across a broad range of disease areas including neuromuscular disease.
  • Duchenne muscular dystrophy (DMD) has placed this monogenic disorder at the forefront of advances in precision medicine.
  • viruses as delivery vehicles has been suggested, however their use is limited due to the immunotoxicity of the viral coat protein and potential oncogenic effects.
  • a range of non-viral delivery vectors have been developed, amongst which peptides have shown the most promise due to their small size, targeting specificity and ability of trans-capillary delivery of large bio-cargoes.
  • Several peptides have been reported fortheir ability to permeate cells either alone or carrying a bio-cargo.
  • CPPs cell-penetrating peptides
  • PMO charge neutral phosphorodiamidate morpholino oligomers
  • PNA peptide nucleic acids
  • CPPs were developed having two arginine-rich sequences separated by a central short hydrophobic sequence. These peptides were designed to improve serum stability whilst maintaining a relatively high level of exon skipping, initially by attachment to a PNA therapeutic. Further derivatives of these peptides were designed as conjugates with PMOs, which were shown to lead to body-wide skeletal muscle dystrophin production following systemic administration in mice. However, despite these CPPs being efficacious in delivery, their therapeutic application has been restricted by their associated toxicity.
  • the present inventors have now identified, synthesized and tested a number of improved CPPs which address at least this problem.
  • a conjugate comprising a peptide according to the first aspect, covalently linked to a therapeutic molecule.
  • a conjugate according to the second aspect, or pharmaceutical composition according to the third aspect for use as a medicament.
  • the inventors have successfully included an optimal number of arginine residues in the cell penetrating peptides (CPPs) described herein whilst maintaining good penetrance and lower toxicity. Contrary to previous belief in the art that the number of arginine residues is the most important factor in determining the efficacy/toxicity trade off of CPPs, and that one of these two factors must be a compromise, the inventors have found that it is the position of the arginine residues within the peptide structure that is key, rather than simply increasing the number of arginine residues.
  • the peptides of the invention offer improved suitability for use as therapies for humans than previously available peptides, and can be used in therapeutic conjugates for safe and effective treatment of human subjects.
  • the invention includes any combination of the aspects and features described except where such a combination is clearly impermissible or expressly avoided.
  • references to ‘X’ throughout denote any form of the artificial, synthetically produced amino acid aminohexanoic acid, but may preferably indicate 6-aminohexanoic acid.
  • the present invention relates to short cell-penetrating peptides having a particular structure in which there are at least two arginine-rich domains.
  • the peptide comprises up to 4 arginine-rich domains, up to 3 arginine-rich domains.
  • the peptide comprises 2 arginine-rich domains.
  • the peptide when present, comprises a first, second, third and fourth arginine rich domain.
  • the peptide comprises a first arginine rich domain and a second arginine rich domain.
  • any other arginine-rich domain present in the peptide is longer than the first arginine rich domain.
  • the second arginine rich domain is longer than the first arginine rich domain.
  • the second arginine rich domain may comprise more than 4 amino acid residues.
  • any other arginine rich domain present in the peptide may have a length of between 3 to 12 amino acid residues, suitably a length of between 3 to 8 amino acid residues.
  • any other arginine rich domain present in the peptide has a length of 5, 6, 7, or 8 amino acid residues.
  • the second arginine-rich domain has a length of 5, 6, 7, or 8 amino acid residues.
  • first arginine rich domain and any other arginine rich domain present in the peptide may have similar lengths or the same length.
  • first and second arginine rich domains may both have a length of 4, 3, or 2 amino acid residues.
  • the arginine rich arm domains comprise a plurality of arginine residues.
  • arginine rich it is meant that at least 30% of the domain is formed of said residue.
  • each arginine rich domain comprises a majority of arginine residues.
  • each arginine rich domain comprises at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, least 70% arginine residues.
  • an arginine rich domain may comprise 100% arginine residues.
  • each arginine rich domain comprises no more than 3 arginine residues.
  • each arginine rich domain may comprise between 1-3, suitably 2 or 3 arginine residues.
  • the first arginine rich domain comprises from at least 30% up to 100% arginine residues, and any value therebetween.
  • the first arginine rich domain comprises about 30%, 50%, 75% or 100% arginine residues.
  • the second arginine rich domain comprises from at least 50% up to 80% arginine residues, and any value therebetween.
  • the second arginine rich domain comprises about 50%, 55%, 60% or 70% arginine residues.
  • each arginine rich domain may comprise other amino acid residues in addition to arginine.
  • the other amino acid residues are cationic or neutral.
  • Cationic amino acids may be selected from: arginine, histidine, lysine.
  • cationic amino acids have a positive charge at physiological pH.
  • Neutral amino acids may be selected from: aminohexanoic acid, alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, phenylalanine.
  • neutral amino acids do not have a charge.
  • each arginine rich domain consists of arginine, beta-alanine, and/or aminohexanoic acid residues.
  • the arginine rich domains comprise a total of at least one beta-alanine residue, suitably more than one beta-alanine residue. By total it is meant the sum of the number of beta alanine residues present in all of the arginine rich domains.
  • each arginine rich domain comprises one or more beta-alanine residues.
  • the first and second arginine rich domains comprise a total of one or more beta-alanine residues.
  • each arginine rich domain may comprise a total of between 1-5 beta-alanine residues, suitably a total of 1 or 2 beta-alanine residues.
  • the peptide comprises at least one aminohexanoic acid residue (X).
  • it is the arginine rich domains which comprise a total of at least one aminohexanoic acid residue (X), in some cases there may be more than one aminohexanoic acid residue present in the peptide, or in the arginine rich domains.
  • total it is meant the sum of the number of aminohexanoic acid residues present in all of the arginine rich domains.
  • each arginine rich domain may comprise one or more aminohexanoic acid residues.
  • the first and second arginine rich domains comprise a total of one or more aminohexanoic acid residues.
  • each arginine rich domain may comprise a total of between 1-5 aminohexanoic acid residues, suitably a total of 1 or 2 aminohexanoic acid residues.
  • one of the first or second arginine rich domains comprises one or more aminohexanoic acid residues, suitably one aminohexanoic residue.
  • ‘at least one’ herein it is meant one, or more than one, of the feature referred to.
  • the peptide comprises at least two arginine rich domains, suitably these arginine rich domains form the arms of the peptide.
  • the arginine rich domains are located at the N and C terminus of the peptide.
  • the arginine rich domains may be known as the arm domains of the peptide. Any references herein to ‘arginine rich domain’ may be substituted with ‘arm domain’.
  • the peptide comprises two arginine rich domains, wherein one is located at the N-terminus of the peptide and one is located at the C-terminus of the peptide. Suitably at either end of the peptide.
  • the first arginine rich domain is located at the N-terminus of the peptide.
  • the first arginine rich domain is the N-terminus of the peptide.
  • the second arginine rich domain is located at the C-terminus of the peptide.
  • the second arginine rich domain is the C-terminus of the peptide.
  • the arginine rich domains comprise amino acid units selected from the following: R, B, X, RR, BB, XX, RB, RX, XR, BR, BX, XB, RBR, RBB, BRR, BBR, BRB, RBX, BRX, RXB, XRB, BXR, RXR, BXB, RXX, BXX, XXR, XXB, RRX, XRR, BBX, XBB, XRX, XBX, RRR, BBB, XXX or any combination thereof.
  • each arginine rich domain comprises any of the following sequences: RBRR (SEQ ID NO:1), RR, XR, R, RBRXR (SEQ ID NO:2), and RXR.
  • each arginine rich domain comprises any of the following sequences: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, and RXR.
  • each arginine rich domain comprises any of the following sequences: RXRBR (SEQ ID NO:3), RXRXR (SEQ ID NO:4), RRXBR (SEQ ID NO:5), RRBRX (SEQ ID NO:6), RRBXR (SEQ ID NO: 7), XRBRR (SEQ ID NO:8), RBRB (SEQ ID NO:9), RRBB (SEQ ID NQ:10), BBRR (SEQ ID NO:11), BRBR (SEQ ID NO:12), RRRB (SEQ ID NO:13), BBBR (SEQ ID NO:14), RXRB (SEQ ID NO:15), RXBR (SEQ ID NO:16), RBRX (SEQ ID NO:17), BRBX (SEQ ID NO:18), XRBR (SEQ ID NO:19), XBRB (SEQ ID NQ:20), RBXR (SEQ ID NO:21), RRXB (SEQ ID NO:22), RRBX (SEQ
  • each arginine rich domain consists of any of the following sequences: RBRR (SEQ ID NO:1), RR, XR, R, RBRXR (SEQ ID NO:2), and RXR.
  • each arginine rich domain consists of any of the following sequences: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, and RXR.
  • each arginine rich domain consists of any of the following sequences: RXRBR (SEQ ID NO:3), RXRXR (SEQ ID NO:4), RRXBR (SEQ ID NO:5), RRBRX (SEQ ID NO:6), RRBXR (SEQ ID NO:7), XRBRR (SEQ ID NO:8), RBRB (SEQ ID NO:9), RRBB (SEQ ID NQ:10), BBRR (SEQ ID NO:11), BRBR (SEQ ID NO:12), RRRB (SEQ ID NO:13), BBBR (SEQ ID NO:14), RXRB (SEQ ID NO: 15), RXBR (SEQ ID NO: 16), RBRX (SEQ ID NO:17), BRBX (SEQ ID NO:18), XRBR (SEQ ID NO:19), XBRB (SEQ ID NQ:20), RBXR (SEQ ID NO:21), RRXB (SEQ ID NO:22), RRBXR
  • the first arginine rich domain comprises a sequence selected from: RBRR (SEQ ID NO:1), RR, XR, R, RBRXR (SEQ ID NO:2), and RXR.
  • the first arginine rich domain comprises a sequence selected from: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, and RXR.
  • the first arginine rich domain comprises or consists of a sequence selected from: RBRR (SEQ ID NO:1), and RR.
  • the second arginine rich domain comprises a sequence selected from: RBRR (SEQ ID NO:1), RR, XR, R, RBRXR (SEQ ID NO:2),RXR, BRXR (SEQ ID NO:29), and RBXR (SEQ ID NO:21).
  • the second arginine rich domain comprises a sequence selected from: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, and RXR.
  • the second arginine rich domain comprises or consists of a sequence selected from: RBRXR (SEQ ID NO:2), and RXR.
  • the first arginine rich domain is RBRR (SEQ ID NO:1) or RR. In one embodiment, the first arginine rich domain is RBRR (SEQ ID NO:1). In one embodiment, the second arginine rich domain is RBRXR (SEQ ID NO: 2) or RXR. In one embodiment, the second arginine rich domain is RBRXR (SEQ ID NO: 2).
  • each arginine rich domain in the peptide may be identical or different.
  • each arginine rich domain in the peptide is different.
  • the present invention relates to short cell-penetrating peptides having a particular structure in which there is at least one hydrophobic domain.
  • references to ‘hydrophobic’ herein denote an amino acid or domain of amino acids having the ability to repel water or which do not mix with water.
  • the peptide comprises up to 3 hydrophobic domains, up to 2 hydrophobic domains.
  • the peptide comprises 1 hydrophobic domain.
  • the peptide comprises one or more hydrophobic domains each having a length of at least 3 amino acid residues.
  • each hydrophobic domain has a length of between 3-6 amino acids.
  • each hydrophobic domain has a length of 5 amino acids.
  • each hydrophobic domain may comprise nonpolar, polar, and hydrophobic amino acid residues.
  • Hydrophobic amino acid residues may be selected from: alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.
  • Non-polar amino acid residues may be selected from: proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, methionine.
  • Polar amino acid residues may be selected from: Serine, Asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine.
  • hydrophobic domains do not comprise hydrophilic amino acid residues.
  • each hydrophobic domain comprises a majority of hydrophobic amino acid residues.
  • each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids.
  • each hydrophobic domain consists of hydrophobic amino acid residues.
  • each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3.
  • each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45.
  • each hydrophobic domain comprises a hydrophobicity of at least 1.2, at least 1.25, at least 1.3, at least 1.35.
  • each hydrophobic domain comprises a hydrophobicity of between 0.4 and 1.4
  • hydrophobicity is as measured by White and Wimley: W.C. Wimley and S.H. White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces” Nature Struct Biol 3:842 (1996).
  • each hydrophobic domain comprises at least 3, at least 4 hydrophobic amino acid residues.
  • each hydrophobic domain comprises phenylalanine, leucine, Isoleucine, tyrosine, tryptophan, proline, arginine, and glutamine residues.
  • each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, arginine and/or glutamine residues.
  • each hydrophobic domain consists of phenylalanine, leucine, isoleucine, arginine, tyrosine and/or glutamine residues.
  • the peptide comprises one hydrophobic domain.
  • the or each hydrophobic domain is located substantially in the centre of the peptide.
  • the hydrophobic domain may be known as a ‘core domain’.
  • the or each hydrophobic domain is flanked on either side by an arginine rich domain, which may be termed an ‘arm domain’ as described above.
  • each arm domain comprises an arginine rich domain.
  • the peptide comprises two arginine rich domains flanking a hydrophobic domain. In one embodiment, the peptide consists of two arginine rich domains flanking a hydrophobic domain. In other words: the peptide may comprise two arm domains flanking a core domain, or the peptide may consist of two arm domains flanking a core domain.
  • the or each hydrophobic domain may comprise one of the following sequences: YQFLI (SEQ ID NO:32), FQILY (SEQ ID NO:35), YRFLI (SEQ ID NO:34), ILFQY (SEQ ID NO:33), FQIY (SEQ ID NO:36), WWW, WWPWW (SEQ ID NO:37), WPWW (SEQ ID NO:38), WWPW (SEQ ID NO:39) or any combination thereof.
  • the or each hydrophobic domain may consist of one of the following sequences: YQFLI (SEQ ID NO:32), FQILY (SEQ ID NO:35), YRFLI (SEQ ID NO:34), ILFQY (SEQ ID NO:33), FQIY (SEQ ID NO:36), WWW, WWPWW (SEQ ID NO:37), WPWW (SEQ ID NO:38), WWPW (SEQ ID NO:39) or any combination thereof.
  • the or each hydrophobic domain is selected from FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), and ILFQY (SEQ ID NO:33)
  • the or each hydrophobic domain consists of YQFLI (SEQ ID NO:32).
  • the or each hydrophobic domain consists of ILFQY (SEQ ID NO:33).
  • each hydrophobic domain in the peptide may have the same sequence or a different sequence.
  • the present invention relates to short cell-penetrating peptides for use in transporting therapeutic cargo molecules in the treatment of medical conditions.
  • the peptide has a sequence that is a contiguous single molecule, therefore the domains of the peptide are contiguous.
  • the peptide comprises several domains in a linear arrangement between the N-terminus and the C-terminus.
  • the domains are selected from arginine rich domains and hydrophobic domains described above.
  • the peptide consists of arginine rich domains and hydrophobic domains wherein the domains are as defined above.
  • Each domain has common sequence characteristics as described in the relevant sections above, but the exact sequence of each domain is capable of variation and modification. Thus a range of sequences is possible for each domain.
  • the combination of each possible domain sequence yields a range of peptide structures, each of which form part of the present invention. Features of the peptide structures are described below.
  • a hydrophobic domain separates any two arginine rich domains.
  • each hydrophobic domain is flanked by arginine rich domains on either side thereof.
  • no arginine rich domain is contiguous with another arginine rich domain.
  • the peptide comprises one hydrophobic domain flanked by two arginine rich domains in the following arrangement:
  • the hydrophobic domain may be known as the core domain and each of the arginine rich domains may be known as an arm domain.
  • the arginine rich arm domains flank the hydrophobic core domain on either side thereof.
  • the peptide consists of two arginine rich domains and one hydrophobic domain.
  • the peptide consists of one hydrophobic core domain flanked by two arginine rich arm domains.
  • the peptide comprises or consists of the structure:
  • the peptide comprises or consists of one hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), or ILFQY (SEQ ID NO:33), and two arginine rich domains each comprising a sequence selected from: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, RXR, XR,R, BRXR (SEQ ID NO:29), and RBXR (SEQ ID NO:21).
  • the peptide consists of one hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), or ILFQY (SEQ ID NO:33), and two arginine rich domains each comprising a sequence selected from: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, RXR, XR,R, BRXR (SEQ ID NO:29), and RBXR (SEQ ID NO:21).
  • the peptide comprises or consists of one hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), or ILFQY (SEQ ID NO:33), a first arginine rich domain comprising a sequence selected from: RBRR (SEQ ID NO:1), and RR, and a second arginine rich domain comprising a sequence selected from: RBRXR (SEQ ID NO:2) , XR, and RXR.
  • the peptide consists of one hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), or ILFQY (SEQ ID NO:33), a first arginine rich domain consisting of a sequence selected from: RBRR (SEQ ID NO:1), and RR, and a second arginine rich domain consisting of a sequence selected from: RBRXR (SEQ ID NO:2) , XR, and RXR.
  • further groups may be present such as a, linker, terminal modification and/or therapeutic molecule.
  • the peptide is N-terminally modified.
  • the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N- trifluoromethylsulfonylated, or N-methylsulfonylated.
  • the peptide is N-acetylated.
  • the N-terminus of the peptide may be unmodified.
  • the peptide is N-acetylated.
  • the peptide is C-terminal modified.
  • the C-terminal modification provides a means for linkage of the peptide to the therapeutic molecule.
  • the C-terminal modification may comprise the linker and vice versa.
  • the C-terminal modification may consist of the linker or vice versa. Suitable linkers are described herein elsewhere.
  • the peptide comprises a C-terminal carboxyl group.
  • the C-terminal carboxyl group is provided by a linker such as a glycine or betaalanine residue.
  • the C terminal carboxyl group is provided by a betaalanine residue.
  • the C terminal beta-alanine residue is also a linker.
  • the C-terminal modification may comprise a spacer.
  • the spacer if present, is located between the peptide and the linker. Suitable spacers are described elsewhere herein.
  • each arginine rich domain may further comprise an N or C terminal modification.
  • the arginine rich domain at the C terminus comprises a C-terminal modification.
  • the arginine rich domain at the N terminus comprises a N-terminal modification.
  • the argine rich domain at the C terminus comprises a linker group and optionally a spacer.
  • the arginine rich domain at the C terminus comprises a C- terminal beta-alanine.
  • the arginine rich domain at the N terminus is N-acetylated.
  • the peptide of the present invention is defined as having a total length of 40 amino acid residues or less.
  • the peptide may therefore be regarded as an oligopeptide.
  • the peptide is less than 35 AA long, preferably less than 30AA long, preferably less than 25AA long, preferably less than 20AA long.
  • the peptide has a total length of between 3-30 amino acid residues, suitably of between 5-30 amino acid residues, of between 10-30 amino acid residues, of between 10-20 amino acid residues, of between 10-15 amino acid residues.
  • the peptide has a total length of at least 10, at least 12, at least 13, at least 14, at least 15 amino acid residues.
  • the peptide of the present invention may comprise a total of 10 or fewer arginine residues.
  • total it is meant the sum of the number of arginine residues present in the entire peptide.
  • the peptide may comprise 9 or fewer, 8 or fewer, 7 or fewer arginine residues, suitably 6 or fewer arginine residues.
  • the peptide of the present invention may comprise a total of at least 3 arginine residues.
  • the peptide may comprise 3 or more arginine residues, suitably 4 or more arginine residues, suitably 5 or more arginine residues, suitably 6 or more arginine residues.
  • the peptide may comprise a total of between at least 3 and up to 10 (i.e. 10 or fewer) arginine residues, suitably between at least 3 and up to 7 arginine residues, suitably between at least 5 and up to 7 arginine residues, suitably between at least 6 and up to 7 arginine residues.
  • the peptide contains a total of 5 arginine residues.
  • the peptide contains a total of 6 arginine residues.
  • the peptide contains a total of 7 arginine residues.
  • the peptide is capable of penetrating cells. The peptide may therefore be regarded as a cell-penetrating peptide.
  • the peptide is for attachment to a therapeutic molecule.
  • the peptide is for transporting a therapeutic molecule into a target cell.
  • the peptide is for delivering a therapeutic molecule into a target cell.
  • the peptide may therefore be regarded as a carrier peptide.
  • the peptide is capable of penetrating into cells and tissues, suitably into the nucleus of cells. Suitably into muscle tissues.
  • the peptide may be selected from any of the following sequences:
  • the peptide is selected from one of the following sequences: RBRRFQILYRBRXR (Pip9b2del01) (SEQ ID NO:53), RBRRYQFLIRBRXR (Pip8b2del01) (SEQ ID NQ:40), and RBRRILFQYRBRXR (Pip5b2del01) (SEQ ID NO:44).
  • the peptide consists of the following sequence: RBRRYQFLIRBRXR (Pip8b2del01) (SEQ ID NQ:40).
  • the peptide consists of the following sequence: RBRRILFQYRBRXR (Pip5b2del01) (SEQ ID NO:44).
  • the present invention may relate to a peptide selected from one of the following sequences:
  • RXRRBRRYQFLIR (Pip8b2del04) (SEQ ID NO:51)
  • RBRRYRFLIRBRXR (Pip7b2del01) (SEQ ID NO:52)
  • the hydrophobic domain may comprise YRFLI (SEQ ID NO:34).
  • the peptide of the invention may be covalently linked to a therapeutic molecule in order to provide a conjugate.
  • the therapeutic molecule may be any molecule for treatment of a disease.
  • the therapeutic molecule may be selected from: a nucleic acid, peptide nucleic acid, antisense oligonucleotide (such as PNA, PMO), mRNA, gRNA (for example in the use of CRISPR/Cas9 technology), short interfering RNA, micro RNA, antagomiRNA, peptide, cyclic peptide, protein, pharmaceutical, drug, or nanoparticle.
  • the therapeutic molecule is an antisense oligonucleotide.
  • the antisense oligonucleotide is comprised of a phosphorodiamidate morpholino oligonucleotide (PMO).
  • PMO phosphorodiamidate morpholino oligonucleotide
  • the oligonucleotide may be a modified PMO or any other charge-neutral oligonucleotide such as a peptide nucleic acid (PNA), a chemically modified PNA such as a gamma-PNA (Bahai, Nat.Comm. 2016), oligonucleotide phosphoramidate (where the nonbridging oxygen of the phosphate is substituted by an amine or alkylamine such as those described in WO2016028187A1, or any other partially or fully charge-neutralized oligonucleotide.
  • PNA peptide nucleic acid
  • gamma-PNA gamma-PNA
  • oligonucleotide phosphoramidate where the nonbridging oxygen of the phosphate is substituted by an amine or alkylamine such as those described in WO2016028187A1, or any other partially or fully charge-neutralized oligonucleotide.
  • the therapeutic antisense oligonucleotide sequence may be selected from any that are available in the art, for example antisense oligonucleotides for exon skipping in DMD are described in https://research-repository.uwa.edu.au/en/publications/antisense- oligonucleotide-induced-exon-skipping-across-the-human- , or a therapeutic antisense oligonucleotide complementary to the ISSN1 or IN7 sequence for the treatment of SMA are described in Zhou, HGT, 2013; and Hammond et al, 2016; and Osman et al, HMG, 2014.
  • the therapeutic molecule of the conjugate is an oligonucleotide complementary to the pre-mRNA of a gene target.
  • the oligonucleotide complementary to the pre-mRNA of a gene target gives rise to a steric blocking event that alters the pre-mRNA leading to an altered mRNA and hence a protein of altered sequence.
  • the steric blocking event may be exon inclusion or exon skipping. In one embodiment, the steric blocking event is exon skipping.
  • lysine residues may be added to one or both ends of a therapeutic molecule (such as a PMO or PNA) before attachment to the peptide to improve water solubility.
  • a therapeutic molecule such as a PMO or PNA
  • the peptide is covalently linked to the therapeutic molecule at the C-terminus.
  • the peptide is covalently linked to the therapeutic molecule through a linker if required.
  • the linker may be selected from any suitable sequence.
  • the linker is present between the peptide and the therapeutic molecule.
  • the linker is a separate group to the peptide and the therapeutic molecule.
  • the conjugate comprises the peptide covalently linked via a linker to a therapeutic molecule. In one embodiment, the conjugate comprises the following structure:
  • the conjugate consists of the following structure:
  • Suitable linkers include, for example, a C-terminal cysteine residue that permits formation of a disulphide, thioether or thiol-maleimide linkage, a C-terminal aldehyde to form an oxime, a click reaction or formation of a morpholino linkage with a basic amino acid on the peptide or a carboxylic acid moiety on the peptide covalently conjugated to an amino group to form a carboxamide linkage.
  • the linker is between 1- 5 amino acids in length.
  • the linker may comprise any linker that is known in the art.
  • the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX and XB.
  • the linker may be selected from succinic acid, glutamate, glutamic acid, or gamma-amino butyric acid (GABA).
  • the linker is beta-alanine.
  • the peptide in combination with a linker may be selected from any of the following sequences:
  • the peptide in combination with a linker is selected from one of the following sequences: RBRRFQILYRBRXR-B (SEQ ID NO: 62), RBRRYQFLIRBRXR-B (SEQ ID NO:45), RBRRILFQYRBRXR-B (SEQ ID NO:49).
  • the peptide in combination with a linker consists of the following sequence: RBRRYQFLIRBRXR-B (SEQ ID NO:45).
  • the peptide in combination with a linker consists of the following sequence: RBRRILFQYRBRXR-B (SEQ ID NO:49).
  • the peptide is conjugated to the therapeutic molecule through a carboxamide linkage.
  • the linker of the conjugate may form part of the therapeutic molecule to which the peptide is attached.
  • the attachment of the therapeutic molecule may be directly linked to the C-terminus of the peptide.
  • no linker is required.
  • the peptide may be chemically conjugated to the therapeutic molecule.
  • Chemical linkage may be via a disulphide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphates, or thiol-maleimide linkage, for example.
  • cysteine may be added at the N- terminus of a therapeutic molecule to allow for disulphide bond formation to the peptide, or the N-terminus may undergo bromoacetylation for thioether conjugation to the peptide.
  • the peptide of the invention may equally be covalently linked to an imaging molecule in order to provide a conjugate.
  • the imaging molecule may be any molecule that enables visualisation of the conjugate.
  • the imaging molecule may indicate the location of the conjugate.
  • the location of the conjugate in vitro or in vivo.
  • a method of monitoring the location of a conjugate comprising an imaging molecule comprising: administering the conjugate to a subject and imaging the subject to locate the conjugate.
  • imaging molecules include detection molecules, contrast molecules, or enhancing molecules.
  • Suitable imaging molecules may be selected from radionuclides; fluorophores; nanoparticles (such as a nanoshell); nanocages; chromogenic agents (for example an enzyme), radioisotopes, dyes, radiopaque materials, fluorescent compounds, and combinations thereof.
  • imaging molecules are visualised using imaging techniques, these may be cellular imaging techniques or medical imaging techniques.
  • Suitable cellular imaging techniques include image cytometry, fluorescent microscopy, phase contrast microscopy, SEM, TEM, for example.
  • Suitable medical imaging techniques include X-ray, fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, FNRI, for example.
  • the imaging molecule may be regarded as a diagnostic molecule.
  • a diagnostic molecule enables the diagnosis of a disease using the conjugate.
  • diagnosis of a disease may be achieved through determining the location of the conjugate using an imaging molecule.
  • a method of diagnosis of a disease comprising administering an effective amount of a conjugate comprising an imaging molecule to a subject and monitoring the location of the conjugate.
  • a conjugate comprising an imaging molecule is the same as those described above in relation to a conjugate comprising a therapeutic molecule.
  • the peptide of the invention may be covalently linked to a therapeutic molecule and an imaging molecule in order to provide a conjugate.
  • a conjugate comprising a peptide according to the invention, covalently linked to a therapeutic molecule and an imaging molecule.
  • the conjugate is capable of penetrating into cells and tissues, suitably into the nucleus of cells. Suitably into muscle tissues.
  • any of the peptides listed herein may be used in a conjugate according to the invention.
  • the peptide may further comprise N-terminal modifications as described above.
  • the conjugate of the invention may formulated into a pharmaceutical composition.
  • the pharmaceutical composition comprises a conjugate of the invention.
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable diluent, adjuvant or carrier.
  • Suitable pharmaceutically acceptable diluents, adjuvants and carriers are well known in the art.
  • the phrase "pharmaceutically acceptable” refers to those ligands, materials, formulations, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically acceptable carrier refers to a pharmaceutically acceptable material, formulation or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the conjugate from one organ or portion of the body, to another organ or portion of the body.
  • a pharmaceutically acceptable material such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the conjugate from one organ or portion of the body, to another organ or portion of the body.
  • Each cell-penetrating peptide must be “acceptable” in the sense of being compatible with the other components of the composition e.g. the peptide and therapeutic molecule, and not injurious to the individual.
  • Lyophilized compositions which may be reconstituted and administered, are also within the scope of the present composition.
  • Pharmaceutically acceptable carriers may be, for example, excipients, vehicles, diluents, and combinations thereof.
  • compositions are to be administered orally, they may be formulated as tablets, capsules, granules, powders, or syrups; or for parenteral administration, they may be formulated as injections, drop infusion preparations, or suppositories.
  • these compositions can be prepared by conventional means, and, if desired, the active compound (i.e. conjugate) may be mixed with any conventional additive, such as an excipient, a binder, a disintegrating agent, a lubricant, a corrigent, a solubilizing agent, a suspension aid, an emulsifying agent, a coating agent, or combinations thereof.
  • compositions of the present disclosure can further include additional known therapeutic agents, drugs, modifications of compounds into prodrugs, and the like for alleviating, mediating, preventing, and treating the diseases, disorders, and conditions described herein under medical use.
  • the pharmaceutical composition is for use as a medicament.
  • a pharmaceutical composition according to the fourth aspect for use as a medicament.
  • a method of treating a subject for a disease or condition comprising administering an effective amount of a pharmaceutical composition according to the fourth aspect to the subject.
  • the conjugate comprising the peptide of the invention may be used as a medicament for the treatment of a disease.
  • the medicament may be in the form of a pharmaceutical composition as defined above.
  • a method of treatment of a patient or subject in need of treatment for a disease condition comprising the step of administering a therapeutically effective amount of the conjugate to the patient or subject.
  • the medical treatment requires delivery of the therapeutic molecule into a cell, suitably into the nucleus of the cell.
  • Diseases to be treated may include any disease where improved penetration of the cell and/or nuclear membrane by a therapeutic molecule may lead to an improved therapeutic effect.
  • the conjugate is for use in the treatment of diseases of the neuromuscular system.
  • Conjugates comprising peptides of the invention are suitable for the treatment of genetic diseases of the neuromuscular system. Conjugates comprising peptides of the invention are suitable for the treatment of genetic neuromuscular diseases.
  • a conjugate according to the second aspect for use in the treatment of genetic diseases of the neuromuscular system.
  • the conjugate is for use in the treatment of hereditary genetic diseases.
  • the conjugate is for use in the treatment of hereditary genetic diseases of the neuromuscular system.
  • the conjugate is for use in the treatment of hereditary genetic neuromuscular diseases.
  • the conjugate is for use in the treatment of hereditary X-linked genetic diseases of the neuromuscular system.
  • the conjugate is for use in the treatment of hereditary X-linked neuromuscular diseases.
  • the conjugate is for use in the treatment of diseases caused by splicing deficiencies.
  • the therapeutic molecule may comprise an oligonucleotide capable of preventing or correcting the splicing defect and/or increasing the production of correctly spliced mRNA molecules.
  • the conjugate is for use in the treatment of any of the following diseases: Duchenne Muscular Dystrophy (DMD), Bucher Muscular Dystrophy (BMD), Menkes disease, Betathalassemia, dementia, Parkinson’s Disease, Spinal Muscular Atrophy (SMA), myotonic dystrophy (DM1 or DM2), Huntington’s Disease, Hutchinson-Gilford Progeria Syndrome, Ataxia-telangiectasia, Facioscapulohumeral muscular dystrophy (FSHD) or cancer.
  • DMD Duchenne Muscular Dystrophy
  • BMD Bucher Muscular Dystrophy
  • Menkes disease Betathalassemia
  • dementia dementia
  • Parkinson’s Disease Spinal Muscular Atrophy
  • SMA Spinal Muscular Atrophy
  • DM1 or DM2 myotonic dystrophy
  • Huntington’s Disease Hutchinson-Gilford Progeria Syndrome
  • Ataxia-telangiectasia Ataxia-telangiectasia
  • the patient or subject to be treated may be any animal or human.
  • the patient or subject may be a non-human mammal.
  • the patient or subject may be male or female. In one embodiment, the subject is male.
  • the patient or subject to be treated may be any age.
  • the patient or subject to be treated is aged between 0-40 years, suitably 0-30, suitably 0-25, suitably 0-20 years of age.
  • the conjugate is for administration to a subject systemically for example by intramedullary, intrathecal, intraventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous, oral or nasal routes.
  • the conjugate is for administration to a subject intravenously.
  • the conjugate is for administration to a subject intravenously by injection.
  • the conjugate is for administration to a subject in a "therapeutically effective amount", by which it is meant that the amount is sufficient to show benefit to the individual.
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the disease being treated. Decisions on dosage are within the responsibility of general practitioners and other medical doctors. Examples of the techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.
  • Exemplary doses may be between 0.01mg/kg and 50mg/kg, 0.05mg/kg and 40mg/kg, 0.1mg/kg and 30mg/kg, 0.5mg/kg and 18mg/kg, 1mg/kg and 16mg/kg, 2mg/kg and 15mg/kg, 5mg/kg and 10mg/kg, 10mg/kg and 20mg/kg, 12mg/kg and 18mg/kg, 13mg/kg and 17mg/kg.
  • the dosage of the conjugates of the present invention is an order or magnitude lower than the dosage required to see any effect from the therapeutic molecule alone.
  • one or more markers of toxicity are significantly reduced compared to prior conjugates using currently available cell penetrating peptides.
  • Suitable markers of toxicity may be markers of nephrotoxicity.
  • Suitable markers of toxicity include KIM-1 , NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate aminotransferase.
  • the level of at least one of KIM-1, NGAL, and BUN is reduced after administration of the conjugates of the present invention when compared to prior conjugates using currently available cell penetrating peptides.
  • the levels of each of KIM-1 , NGAL, and BUN are reduced after administration of the conjugates of the present invention when compared to prior conjugates using currently available cell penetrating peptides.
  • the levels of each marker/s is significantly reduced when compared to prior conjugates using currently available cell penetrating peptides.
  • the levels of the or each marker/s is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% after administration of the conjugates of the present invention when compared to prior conjugates using currently available cell penetrating peptides.
  • the toxicity of the peptides and therefore the resulting conjugates is significantly reduced compared to prior cell-penetrating peptides and conjugates.
  • KIM-1 is a marker of toxicity and is significantly reduced by up to 30 fold compared to prior conjugates using currently available peptide carriers.
  • Peptides of the invention may be produced by any standard protein synthesis method, for example chemical synthesis, semi-chemical synthesis or through the use of expression systems.
  • the present invention also relates to the nucleotide sequences comprising or consisting of the DNA coding for the peptides, expression systems e.g. vectors comprising said sequences accompanied by the necessary sequences for expression and control of expression, and host cells and host organisms transformed by said expression systems.
  • nucleic acid encoding a peptide according to the present invention is also provided.
  • the nucleic acids may be provided in isolated or purified form.
  • An expression vector comprising a nucleic acid encoding a peptide according to the present invention is also provided.
  • the vector is a plasmid.
  • the vector comprises one or more regulatory sequences, e.g. promoter, operably linked to a nucleic acid encoding a peptide according to the present invention.
  • the expression vector is capable of expressing the peptide when transfected into a suitable cell, e.g. mammalian, bacterial or fungal cell.
  • a host cell comprising the nucleic acid or expression vector of the invention is also provided.
  • Expression vectors may be selected depending on the host cell into which the nucleic acids of the invention may be inserted. Such transformation of the host cell involves conventional techniques such as those taught in Sambrook et al [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA], Selection of suitable vectors is within the skills of the person knowledgeable in the field. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.
  • the peptides produced may be isolated and purified from the host cell by any suitable method e.g. precipitation or chromatographic separation e.g. affinity chromatography. Suitable vectors, hosts and recombinant techniques are well known in the art.
  • operably linked may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence are covalently linked in such a way as to place the expression of a nucleotide coding sequence under the control of the regulatory sequence, as such, the regulatory sequence is capable of effecting transcription of a nucleotide coding sequence which forms part or all of the selected nucleotide sequence.
  • the resulting transcript may then be translated into a desired peptide.
  • Figure 1 shows Dmd exon 23 skipping efficacy in four different tissues in a wild type mouse model of seven candidate peptides conjugated to exon 23 targeting PMO labelled Pip8b2del01-07 compared to parent Pip8b2-PMO compound. Efficacy is measured as percentage of exon 23 skipping in Dmd transcript assessed by RT-qPCR 7 days after administration of a single 30mg/kg dose.
  • Figure 2 shows nephrotoxicity in a wild type mouse model of seven candidate CPP-PMOs labelled Pip8b2del01-07 and parent Pip8b2-PMO relative to saline as measured by the fold change in urinary Kim-1 levels at 2 days and 7 days after single 30mg/kg dose administration.
  • FIG. 3 shows Dmd exon 23 skipping efficacy in three different tissues in a wild type mouse model of core variant peptides 5b2del01 , 7b2del01 and 9b2del01 conjugated to exon 23 targeting PMO. Efficacy is measured as percentage of exon 23 skipping in Dmd transcript assessed by RT-qPCR 7 days after administration of a single 30mg/kg dose.
  • D shows nephrotoxicity in a wild type mouse model of these peptide-PMO variants relative to saline as measured by the fold change in urinary Kim-1 levels at 2 days and 7 days after administration of a single 30mg/kg dose.
  • Figure 4 (A) Exon 7 inclusion in the SMN2 transcript in a SMA mouse model (SMN 1tm1Hun9/WT ;SMN2 t9/t9 ) with Pip8b2del01 conjugated to SMN2 targeting PMO, as assessed by ratio of full length SMN2 (including exon 7) to total SMN transcript by RT-qPCR 7 days after a single 30mg/kg dose. (B) nephrotoxicity in a SMA mice model of Pip8b2del01-PMO relative to saline as measured by the fold change in urinary Kim-1 levels at 2 days and 7 days after single 30mg/kg dose administration.
  • FIG. 5 shows Dmd exon 23 skipping efficacy in three different tissues in a wild type mouse model of two further candidate peptides Pip8b2del08 and Pip8b2del09 conjugated to exon 23 targeting PMO compared to parent Pip8b2-PMO compound. Efficacy is measured as percentage of exon 23 skipping in Dmd transcript assessed by RT-qPCR 7 days after administration of a single 30mg/kg dose.
  • D shows nephrotoxicity in a wild type mouse model of these peptide-PMO variants relative to saline as measured by the fold change in urinary Kim-1 levels at 2 days and 7 days after single 30mg/kg dose administration.
  • Figure 6 shows the same data as in Fig. 1A, Fig. 1C, Fig. 1 D, Fig. 2 and Fig. 5, arranged in order according to the number of arginine residues in the peptides as labelled on the x-axis (e.g. “7R” means 7 arginine residues).
  • the peptide resin was washed with DMF (3 x 5 mL) and DCM (3 x 5 mL). After drying the peptidyl resin, the peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA): H2O: triisopropylsilane (TIS) (95:2.5:2.5, 10 mL/g) for 1 h at room temperature followed by the typical diethyl ether precipitation, HPLC and MALDI-TOF analysis.
  • TFA trifluoroacetic acid
  • TIS triisopropylsilane
  • Peptides were purified by 1260 Infinity II preparative HPLC Agilent system on an RP-C18 column (21.2 x 250 mm, Phenomenex) using a linear gradient (5 to 50 over 30 min) of 0 .1 %TFA CH 3 CN in 0 .1 %TFA/H 2 O with a flow rate of 15 mL/min.
  • PMOs were obtained from Gene Tools, LLC and the conjugation occurred via amide bond formation between the 3’ end into the C-terminal of the peptide.
  • a 25-mer PMO antisense sequence for mouse dystrophin exon-23 (GGCCAAACCTCGGCTTACCTGAAAT) (SEQ ID NO:56) and a 25-mer PMO sequences for human SMN2 exon-7 inclusion (GTAAGATTCACTTTCATAATGCTGG) (SEQ ID NO:63), targeting intron splice silencer N1 (ISS-N1) at the 5 region of intron 7 were used.
  • the peptide was conjugated to the 3’-end of the PMO through its C-terminal carboxyl group.
  • the conjugates were dissolved in sterile water and filtered through a 0.22 m cellulose acetate membrane before use.
  • the concentration of the conjugates was determined by the molar absorption of the conjugates at 265 nm in 0.1 N HCI solution. Average yield was around 20- 40% calculated from PMO starting materials.
  • mice Male C57BL/6 mice aged 8-10 weeks were administered a single 30 mg/kg dose of peptide- PMO in 0.9% saline by bolus intravenous tail vein injection.
  • Urine was non-invasively collected under chilled conditions at Day 2 and Day 7 post-administration following 20 hours housing in metabolic cages (Tecniplast, UK). Serum was collected from jugular vein at Day 7 at necropsy, as was tibialis anterior (TA), diaphragm (DI A), triceps (TRI) and heart tissue.
  • TA tibialis anterior
  • DI A diaphragm
  • TRI triceps
  • Primer/probes were synthesised by Integrated DNA Technologies and designed to amplify a region spanning exon 23-24 representing unskipped product (mDMD23- 24), or to amplify specifically transcripts lacking exon 23 using a probe spanning the boundary of exon 22 and 24 (mDMD22-24) (see Table 1).
  • Levels of respective transcripts were determined by calibration to standard curves prepared using known transcript quantities, and skipping percentages derived by [skip]/[skip+unskip].
  • Results are shown in figures 1 , 3A, 3B, 3C, 5A, 5B, 5C, 6A, 6B and 6C.
  • RNA Polymerase II polypeptide J
  • KIM-1 Kidney injury molecule-1
  • ELISA KIM-1 R&D MKM100
  • Results are shown in figures 2, 3D, 4B, 5D and 6D.
  • RBRXR (SEQ ID NO:2)
  • RXRBR (SEQ ID NO:3)
  • RXRXR (SEQ ID NO:4)
  • RRBXR (SEQ ID NO:7)
  • RXRB (SEQ ID NO: 15)
  • RXBR (SEQ ID NO: 16) RBRX (SEQ ID NO: 17) BRBX (SEQ ID NO: 18) XRBR (SEQ ID NO: 19) XBRB (SEQ ID NO:20) RBXR (SEQ ID NO:21) RRXB (SEQ ID NO:22) RRBX (SEQ ID NO:23) XRBB (SEQ ID NO:24) XBRR (SEQ ID NO:25) RXBB (SEQ ID NO:26) XRRR (SEQ ID NO:27) RRRX (SEQ ID NO:28) BRXR (SEQ ID NO:29) BBXR (SEQ ID NO:30) BBRX (SEQ ID NO:31) Hydrophobic Domains YQFLI (SEQ ID NO:32) ILFQY (SEQ ID NO:33) YRFLI (SEQ ID NO:34) FQILY (SEQ ID NO:35) FQIY (SEQ ID NO:36) WWPW
  • RBRRYQFLIRBXR-B (SEQ ID NO: 73)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to peptides, in particular cell-penetrating peptides, with shortened arginine rich arm domains, and to conjugates of such cell-penetrating peptides with a therapeutic molecule. The present invention further relates to use of such peptides or conjugates in methods of treatment or as a medicament, especially in the treatment of genetic disorders and in particular neuromuscular diseases.

Description

SHORTENED CELL-PENETRATING PEPTIDES
Technical Field
The present invention relates to peptides, in particular cell-penetrating peptides, and to conjugates of such cell-penetrating peptides with a therapeutic molecule. The present invention further relates to use of such peptides or conjugates in methods of treatment or as a medicament, especially in the treatment of genetic disorders and in particular neuromuscular diseases.
Background
Nucleic acid drugs are genomic medicines with the potential to transform human healthcare. Research has indicated that such therapeutics could have applications across a broad range of disease areas including neuromuscular disease. The application of antisense oligonucleotide-based methods to modulate pre-mRNA splicing in the neuromuscular disease Duchenne muscular dystrophy (DMD), for example, has placed this monogenic disorder at the forefront of advances in precision medicine.
Whilst the field of antisense therapeutics for treating diseases resulting from splicing errors has progressed, the problem of delivering such therapeutics to the tissues which require them has hampered success. In September 2016 the Food and Drug Administration (FDA) granted accelerated approval for ‘eteplirsen’, a single-stranded oligonucleotide for modulating the splicing of exon 51 , the region responsible for causing DMD. Yet the levels of dystrophin restoration were disappointing with only approximately 1% of normal dystrophin levels. Comparisons with the allelic disorder Becker muscular dystrophy and experiments in the mdx mouse have indicated that homogenous sarcolemmal dystrophin expression of at least ~15% of wild-type is needed to protect muscle against exercise induced damage. The cause of the poor effectiveness is speculated to be due to poor delivery.
Therefore there is a strong and urgent need to improve the delivery of antisense oligonucleotides in order to provide a more effective therapy for devastating genetic diseases such as DMD.
The use of viruses as delivery vehicles has been suggested, however their use is limited due to the immunotoxicity of the viral coat protein and potential oncogenic effects. Alternatively, a range of non-viral delivery vectors have been developed, amongst which peptides have shown the most promise due to their small size, targeting specificity and ability of trans-capillary delivery of large bio-cargoes. Several peptides have been reported fortheir ability to permeate cells either alone or carrying a bio-cargo. For several years, cell-penetrating peptides (CPPs) have been conjugated to single stranded oligonucleotides (in particular charge neutral phosphorodiamidate morpholino oligomers (PMO) and peptide nucleic acids (PNA)) in order to enhance the cell delivery of such therapeutics by effectively carrying them across cell membranes to reach their pre-mRNA target sites in the cell nucleus. It has been shown that PMO therapeutics conjugated to certain arginine-rich CPPs (known as P-PMOs or peptide-PMOs) can enhance dystrophin production in skeletal muscles following systemic administration in the mdx mouse model of DMD.
In particular, a group of CPPs were developed having two arginine-rich sequences separated by a central short hydrophobic sequence. These peptides were designed to improve serum stability whilst maintaining a relatively high level of exon skipping, initially by attachment to a PNA therapeutic. Further derivatives of these peptides were designed as conjugates with PMOs, which were shown to lead to body-wide skeletal muscle dystrophin production following systemic administration in mice. However, despite these CPPs being efficacious in delivery, their therapeutic application has been restricted by their associated toxicity.
Alternative cell-penetrating peptides having only a single arginine rich domain such as RsGly have also been produced. These CPPs have been used to produce peptide conjugates with reduced toxicities, but in contrast to the dual arginine-rich domain CPPs, the ReGly conjugates exhibited lower efficacy.
Accordingly, the currently available CPPs have not yet been demonstrated as suitable for use in human treatments for diseases such as DMD. They have proven to be either ineffective or too toxic.
The challenge in the field of cell-penetrating peptide technology has been to de-couple efficacy and toxicity. Work on CPPs so far has suggested that longer peptides with high numbers of Arginine residues are key to cell penetration capability, with much evidence teaching towards increasing the number of Arginine residues. However research has shown that there is a tradeoff with toxicity, whereby simply increasing the total number of arginine residues increases toxicity. Research efforts in the field to date have not focussed on the positioning of arginine residues within the peptide, nor the overall structure of the CPP.
The present inventors have now identified, synthesized and tested a number of improved CPPs which address at least this problem.
Summary of the Invention
According to a first aspect of the present invention, there is provided a peptide having a total length of 40 amino acid residues or less, the peptide comprising at least a first and a second arginine rich domain, and at least one hydrophobic domain selected from FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32) or ILFQY (SEQ ID NO:33), wherein the peptide comprises at least one aminohexanoic acid (X) residue, each arginine rich domain comprises no more than 3 arginine residues, and wherein the first arginine rich domain is selected from one of the following sequences: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, RXR, XR, and R.
According to a second aspect, there is provided a conjugate comprising a peptide according to the first aspect, covalently linked to a therapeutic molecule.
According to a third aspect there is provided a pharmaceutical composition comprising the conjugate according to the second aspect.
According to a fourth aspect there is provided a conjugate according to the second aspect, or pharmaceutical composition according to the third aspect for use as a medicament.
According to a fifth aspect there is provided a conjugate according to the second aspect, or pharmaceutical composition according to the third aspect for use in the treatment of a diseases of the neuromuscular system or musculoskeletal system, preferably genetic diseases of the neuromuscular system or musculoskeletal system, preferably hereditary genetic diseases of the neuromuscular system or musculoskeletal system.
The inventors have successfully included an optimal number of arginine residues in the cell penetrating peptides (CPPs) described herein whilst maintaining good penetrance and lower toxicity. Contrary to previous belief in the art that the number of arginine residues is the most important factor in determining the efficacy/toxicity trade off of CPPs, and that one of these two factors must be a compromise, the inventors have found that it is the position of the arginine residues within the peptide structure that is key, rather than simply increasing the number of arginine residues. Surprisingly, the inventors have found that a peptide structure where the arginine rich domains do not contain more than 3 arginine resides each combined with particular hydrophobic domains, can achieve both favourable efficacy with good cell penetrance and favourable toxicity. These peptides maintain good levels of efficacy in skeletal muscles when tested in vitro and in vivo with a cargo therapeutic molecule, concurrent with low kidney toxicity through measurement of biochemical markers. Crucially, the present peptides are demonstrated to show a surprisingly reduced toxicity following similar systemic injection into mice when compared with previous CPPs. Accordingly, the peptides of the invention offer improved suitability for use as therapies for humans than previously available peptides, and can be used in therapeutic conjugates for safe and effective treatment of human subjects. The invention includes any combination of the aspects and features described except where such a combination is clearly impermissible or expressly avoided.
The section headings used herein are for organisational purposes only and are not to be construed as limiting the subject matter described.
References to ‘X’ throughout denote any form of the artificial, synthetically produced amino acid aminohexanoic acid, but may preferably indicate 6-aminohexanoic acid.
References to ‘B’ throughout denote the natural but non-genetically encoded amino acid betaalanine.
References to ‘Ac’ throughout denote acetylation of the relevant peptide.
References to other capital letters throughout denote the relevant genetically encoded amino acid residue in accordance with the accepted alphabetic amino acid code.
Arginine Rich Domain
The present invention relates to short cell-penetrating peptides having a particular structure in which there are at least two arginine-rich domains.
Suitably, the peptide comprises up to 4 arginine-rich domains, up to 3 arginine-rich domains.
Suitably, the peptide comprises 2 arginine-rich domains.
Suitably, when present, the peptide comprises a first, second, third and fourth arginine rich domain. Suitably the peptide comprises a first arginine rich domain and a second arginine rich domain.
Suitably any of the arginine rich domains may have a length of between 1 to 12 amino acid residues, suitably between 1 to 10 amino acid residues, suitably between 1 to 8 amino acid residues, suitably between 1 to 6 amino acid residues, suitably between 2 to 6 amino acid residues. Suitably any of the arginine rich domains may have a length of 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid residue.
Suitably one of the domains may consist of 4 amino acid residues or less. Suitably a first arginine rich domain may consist of 4 amino acid residues or less. Suitably therefore a first arginine rich domain may consists of 1 to 4 amino acid residues.
Suitably any other arginine-rich domain present in the peptide is longer than the first arginine rich domain. Suitably the second arginine rich domain is longer than the first arginine rich domain. Suitably therefore the second arginine rich domain may comprise more than 4 amino acid residues.
Suitably any other arginine rich domain present in the peptide may have a length of between 3 to 12 amino acid residues, suitably a length of between 3 to 8 amino acid residues. Suitably, any other arginine rich domain present in the peptide has a length of 5, 6, 7, or 8 amino acid residues.
Suitably the second arginine-rich domain has a length of 5, 6, 7, or 8 amino acid residues.
Alternatively, the first arginine rich domain and any other arginine rich domain present in the peptide may have similar lengths or the same length. For example, the first and second arginine rich domains may both have a length of 4, 3, or 2 amino acid residues.
Suitably the arginine rich arm domains comprise a plurality of arginine residues. By ‘arginine rich’ it is meant that at least 30% of the domain is formed of said residue.
Suitably, each arginine rich domain comprises a majority of arginine residues.
Suitably, each arginine rich domain comprises at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, least 70% arginine residues. In some cases an arginine rich domain may comprise 100% arginine residues.
Suitably, each arginine rich domain comprises no more than 3 arginine residues. Suitably each arginine rich domain may comprise between 1-3, suitably 2 or 3 arginine residues.
Suitably the first arginine rich domain comprises from at least 30% up to 100% arginine residues, and any value therebetween. Suitably the first arginine rich domain comprises about 30%, 50%, 75% or 100% arginine residues.
Suitably the second arginine rich domain comprises from at least 50% up to 80% arginine residues, and any value therebetween. Suitably the second arginine rich domain comprises about 50%, 55%, 60% or 70% arginine residues.
Suitably each arginine rich domain may comprise other amino acid residues in addition to arginine. Suitably the other amino acid residues are cationic or neutral. Cationic amino acids may be selected from: arginine, histidine, lysine. Suitably, cationic amino acids have a positive charge at physiological pH. Neutral amino acids may be selected from: aminohexanoic acid, alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, phenylalanine. Suitably neutral amino acids do not have a charge. Suitably each arginine rich domain consists of arginine, beta-alanine, and/or aminohexanoic acid residues.
Suitably the arginine rich domains comprise a total of at least one beta-alanine residue, suitably more than one beta-alanine residue. By total it is meant the sum of the number of beta alanine residues present in all of the arginine rich domains. Suitably, each arginine rich domain comprises one or more beta-alanine residues. Suitably the first and second arginine rich domains comprise a total of one or more beta-alanine residues. Suitably, each arginine rich domain may comprise a total of between 1-5 beta-alanine residues, suitably a total of 1 or 2 beta-alanine residues.
Suitably the peptide comprises at least one aminohexanoic acid residue (X). Suitably it is the arginine rich domains which comprise a total of at least one aminohexanoic acid residue (X), in some cases there may be more than one aminohexanoic acid residue present in the peptide, or in the arginine rich domains. By total it is meant the sum of the number of aminohexanoic acid residues present in all of the arginine rich domains. Suitably, each arginine rich domain may comprise one or more aminohexanoic acid residues. Suitably the first and second arginine rich domains comprise a total of one or more aminohexanoic acid residues. Suitably, each arginine rich domain may comprise a total of between 1-5 aminohexanoic acid residues, suitably a total of 1 or 2 aminohexanoic acid residues. In one embodiment, one of the first or second arginine rich domains comprises one or more aminohexanoic acid residues, suitably one aminohexanoic residue.
Suitably by ‘at least one’ herein it is meant one, or more than one, of the feature referred to.
Suitably, the peptide comprises at least two arginine rich domains, suitably these arginine rich domains form the arms of the peptide. Suitably, the arginine rich domains are located at the N and C terminus of the peptide. Suitably therefore, the arginine rich domains may be known as the arm domains of the peptide. Any references herein to ‘arginine rich domain’ may be substituted with ‘arm domain’.
In one embodiment, the peptide comprises two arginine rich domains, wherein one is located at the N-terminus of the peptide and one is located at the C-terminus of the peptide. Suitably at either end of the peptide. Suitably the first arginine rich domain is located at the N-terminus of the peptide. Suitably the first arginine rich domain is the N-terminus of the peptide. Suitably the second arginine rich domain is located at the C-terminus of the peptide. Suitably the second arginine rich domain is the C-terminus of the peptide. Suitably no further amino acids or domains are present at the N-terminus and C-terminus of the peptide, with the exception of other groups such as a terminal modification, linker and/or therapeutic molecule. For the avoidance of doubt, such other groups may be present in addition to ‘the peptide’ described and claimed herein. Suitably therefore each arginine rich domain forms the terminus of the peptide. Suitably, this does not preclude the presence of a further linker group as described herein.
Suitably, the arginine rich domains comprise amino acid units selected from the following: R, B, X, RR, BB, XX, RB, RX, XR, BR, BX, XB, RBR, RBB, BRR, BBR, BRB, RBX, BRX, RXB, XRB, BXR, RXR, BXB, RXX, BXX, XXR, XXB, RRX, XRR, BBX, XBB, XRX, XBX, RRR, BBB, XXX or any combination thereof.
Suitably each arginine rich domain comprises any of the following sequences: RBRR (SEQ ID NO:1), RR, XR, R, RBRXR (SEQ ID NO:2), and RXR. Suitably each arginine rich domain comprises any of the following sequences: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, and RXR. Alternatively each arginine rich domain comprises any of the following sequences: RXRBR (SEQ ID NO:3), RXRXR (SEQ ID NO:4), RRXBR (SEQ ID NO:5), RRBRX (SEQ ID NO:6), RRBXR (SEQ ID NO: 7), XRBRR (SEQ ID NO:8), RBRB (SEQ ID NO:9), RRBB (SEQ ID NQ:10), BBRR (SEQ ID NO:11), BRBR (SEQ ID NO:12), RRRB (SEQ ID NO:13), BBBR (SEQ ID NO:14), RXRB (SEQ ID NO:15), RXBR (SEQ ID NO:16), RBRX (SEQ ID NO:17), BRBX (SEQ ID NO:18), XRBR (SEQ ID NO:19), XBRB (SEQ ID NQ:20), RBXR (SEQ ID NO:21), RRXB (SEQ ID NO:22), RRBX (SEQ ID NO:23), XRBB (SEQ ID NO:24), XBRR (SEQ ID NO:25), RXBB (SEQ ID NO:26), XRRR (SEQ ID NO:27), RRRX (SEQ ID NO:28), BRXR (SEQ ID NO:29), BBXR (SEQ ID NQ:30), BBRX (SEQ ID NO:31), RBR, RBB, BRR, BBR, BRB, RBX, BRX, RXB, XRB, BXR, RXR, BXB, RXX, XXR, RRX, XRR, XRX, RRR, RX, RB, BR.
Suitably each arginine rich domain consists of any of the following sequences: RBRR (SEQ ID NO:1), RR, XR, R, RBRXR (SEQ ID NO:2), and RXR. Suitably each arginine rich domain consists of any of the following sequences: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, and RXR. Alternatively each arginine rich domain consists of any of the following sequences: RXRBR (SEQ ID NO:3), RXRXR (SEQ ID NO:4), RRXBR (SEQ ID NO:5), RRBRX (SEQ ID NO:6), RRBXR (SEQ ID NO:7), XRBRR (SEQ ID NO:8), RBRB (SEQ ID NO:9), RRBB (SEQ ID NQ:10), BBRR (SEQ ID NO:11), BRBR (SEQ ID NO:12), RRRB (SEQ ID NO:13), BBBR (SEQ ID NO:14), RXRB (SEQ ID NO: 15), RXBR (SEQ ID NO: 16), RBRX (SEQ ID NO:17), BRBX (SEQ ID NO:18), XRBR (SEQ ID NO:19), XBRB (SEQ ID NQ:20), RBXR (SEQ ID NO:21), RRXB (SEQ ID NO:22), RRBX (SEQ ID NO:23), XRBB (SEQ ID NO:24), XBRR (SEQ ID NO:25), RXBB (SEQ ID NO:26), XRRR (SEQ ID NO:27), RRRX (SEQ ID NO:28), BRXR (SEQ ID NO:29), BBXR (SEQ ID NO:30), BBRX (SEQ ID N0:31), RBR, RBB, BRR, BBR, BRB, RBX, BRX, RXB, XRB, BXR, RXR, BXB, RXX, XXR, RRX, XRR, XRX, RRR, RX, RB, BR.
Suitably the first arginine rich domain comprises a sequence selected from: RBRR (SEQ ID NO:1), RR, XR, R, RBRXR (SEQ ID NO:2), and RXR. Suitably the first arginine rich domain comprises a sequence selected from: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, and RXR. Suitably the first arginine rich domain comprises or consists of a sequence selected from: RBRR (SEQ ID NO:1), and RR.
Suitably the second arginine rich domain comprises a sequence selected from: RBRR (SEQ ID NO:1), RR, XR, R, RBRXR (SEQ ID NO:2),RXR, BRXR (SEQ ID NO:29), and RBXR (SEQ ID NO:21). Suitably the second arginine rich domain comprises a sequence selected from: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, and RXR. Suitably the second arginine rich domain comprises or consists of a sequence selected from: RBRXR (SEQ ID NO:2), and RXR.
In one embodiment, the first arginine rich domain is RBRR (SEQ ID NO:1) or RR. In one embodiment, the first arginine rich domain is RBRR (SEQ ID NO:1). In one embodiment, the second arginine rich domain is RBRXR (SEQ ID NO: 2) or RXR. In one embodiment, the second arginine rich domain is RBRXR (SEQ ID NO: 2).
Suitably each arginine rich domain in the peptide may be identical or different. Suitably each arginine rich domain in the peptide is different.
Hydrophobic Domain
The present invention relates to short cell-penetrating peptides having a particular structure in which there is at least one hydrophobic domain.
References to ‘hydrophobic’ herein denote an amino acid or domain of amino acids having the ability to repel water or which do not mix with water.
Suitably the peptide comprises up to 3 hydrophobic domains, up to 2 hydrophobic domains.
Suitably the peptide comprises 1 hydrophobic domain.
Suitably, the peptide comprises one or more hydrophobic domains each having a length of at least 3 amino acid residues.
Suitably, each hydrophobic domain has a length of between 3-6 amino acids. Suitably, each hydrophobic domain has a length of 5 amino acids. Suitably, each hydrophobic domain may comprise nonpolar, polar, and hydrophobic amino acid residues.
Hydrophobic amino acid residues may be selected from: alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan.
Non-polar amino acid residues may be selected from: proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, methionine.
Polar amino acid residues may be selected from: Serine, Asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine.
Suitably the hydrophobic domains do not comprise hydrophilic amino acid residues.
Suitably, each hydrophobic domain comprises a majority of hydrophobic amino acid residues. Suitably, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids. Suitably, each hydrophobic domain consists of hydrophobic amino acid residues.
Suitably, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3.
Suitably, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, at least 0.45.
Suitably, each hydrophobic domain comprises a hydrophobicity of at least 1.2, at least 1.25, at least 1.3, at least 1.35.
Suitably, each hydrophobic domain comprises a hydrophobicity of between 0.4 and 1.4
Suitably, hydrophobicity is as measured by White and Wimley: W.C. Wimley and S.H. White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces" Nature Struct Biol 3:842 (1996).
Suitably, each hydrophobic domain comprises at least 3, at least 4 hydrophobic amino acid residues.
Suitably, each hydrophobic domain comprises phenylalanine, leucine, Isoleucine, tyrosine, tryptophan, proline, arginine, and glutamine residues. Suitably, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, arginine and/or glutamine residues. In one embodiment, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, arginine, tyrosine and/or glutamine residues.
Suitably, the peptide comprises one hydrophobic domain. Suitably the or each hydrophobic domain is located substantially in the centre of the peptide. Suitably, therefore, the hydrophobic domain may be known as a ‘core domain’. Suitably, the or each hydrophobic domain is flanked on either side by an arginine rich domain, which may be termed an ‘arm domain’ as described above. Suitably, each arm domain comprises an arginine rich domain.
In one embodiment, the peptide comprises two arginine rich domains flanking a hydrophobic domain. In one embodiment, the peptide consists of two arginine rich domains flanking a hydrophobic domain. In other words: the peptide may comprise two arm domains flanking a core domain, or the peptide may consist of two arm domains flanking a core domain.
Suitably the or each hydrophobic domain may comprise one of the following sequences: YQFLI (SEQ ID NO:32), FQILY (SEQ ID NO:35), YRFLI (SEQ ID NO:34), ILFQY (SEQ ID NO:33), FQIY (SEQ ID NO:36), WWW, WWPWW (SEQ ID NO:37), WPWW (SEQ ID NO:38), WWPW (SEQ ID NO:39) or any combination thereof.
Suitably the or each hydrophobic domain may consist of one of the following sequences: YQFLI (SEQ ID NO:32), FQILY (SEQ ID NO:35), YRFLI (SEQ ID NO:34), ILFQY (SEQ ID NO:33), FQIY (SEQ ID NO:36), WWW, WWPWW (SEQ ID NO:37), WPWW (SEQ ID NO:38), WWPW (SEQ ID NO:39) or any combination thereof.
Suitably, the or each hydrophobic domain is selected from FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), and ILFQY (SEQ ID NO:33)
In one embodiment, the or each hydrophobic domain consists of YQFLI (SEQ ID NO:32).
In one embodiment, the or each hydrophobic domain consists of ILFQY (SEQ ID NO:33).
Suitably each hydrophobic domain in the peptide may have the same sequence or a different sequence.
Peptide
The present invention relates to short cell-penetrating peptides for use in transporting therapeutic cargo molecules in the treatment of medical conditions.
The peptide has a sequence that is a contiguous single molecule, therefore the domains of the peptide are contiguous. Suitably, the peptide comprises several domains in a linear arrangement between the N-terminus and the C-terminus. Suitably, the domains are selected from arginine rich domains and hydrophobic domains described above. Suitably, the peptide consists of arginine rich domains and hydrophobic domains wherein the domains are as defined above.
Each domain has common sequence characteristics as described in the relevant sections above, but the exact sequence of each domain is capable of variation and modification. Thus a range of sequences is possible for each domain. The combination of each possible domain sequence yields a range of peptide structures, each of which form part of the present invention. Features of the peptide structures are described below.
Suitably, a hydrophobic domain separates any two arginine rich domains. Suitably, each hydrophobic domain is flanked by arginine rich domains on either side thereof.
Suitably no arginine rich domain is contiguous with another arginine rich domain.
In one embodiment, the peptide comprises one hydrophobic domain flanked by two arginine rich domains in the following arrangement:
[arginine rich domain] - [hydrophobic domain] - [arginine rich domain]
Therefore, suitably the hydrophobic domain may be known as the core domain and each of the arginine rich domains may be known as an arm domain. Suitably, the arginine rich arm domains flank the hydrophobic core domain on either side thereof.
In one embodiment, the peptide consists of two arginine rich domains and one hydrophobic domain.
In one embodiment, the peptide consists of one hydrophobic core domain flanked by two arginine rich arm domains.
In one embodiment, therefore the peptide comprises or consists of the structure:
[first arginine rich domain] - [hydrophobic domain] - [second arginine rich domain]
In one embodiment, the peptide comprises or consists of one hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), or ILFQY (SEQ ID NO:33), and two arginine rich domains each comprising a sequence selected from: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, RXR, XR,R, BRXR (SEQ ID NO:29), and RBXR (SEQ ID NO:21). In one embodiment, the peptide consists of one hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), or ILFQY (SEQ ID NO:33), and two arginine rich domains each comprising a sequence selected from: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2), RR, RXR, XR,R, BRXR (SEQ ID NO:29), and RBXR (SEQ ID NO:21).
In one embodiment, the peptide comprises or consists of one hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), or ILFQY (SEQ ID NO:33), a first arginine rich domain comprising a sequence selected from: RBRR (SEQ ID NO:1), and RR, and a second arginine rich domain comprising a sequence selected from: RBRXR (SEQ ID NO:2) , XR, and RXR.
In one embodiment, the peptide consists of one hydrophobic domain comprising a sequence selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), or ILFQY (SEQ ID NO:33), a first arginine rich domain consisting of a sequence selected from: RBRR (SEQ ID NO:1), and RR, and a second arginine rich domain consisting of a sequence selected from: RBRXR (SEQ ID NO:2) , XR, and RXR.
In any such embodiment, further groups may be present such as a, linker, terminal modification and/or therapeutic molecule.
Suitably, the peptide is N-terminally modified.
Suitably the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N- trifluoromethylsulfonylated, or N-methylsulfonylated. Suitably, the peptide is N-acetylated.
Optionally, the N-terminus of the peptide may be unmodified.
In one embodiment, the peptide is N-acetylated.
Suitably, the peptide is C-terminal modified. Advantageously, the C-terminal modification provides a means for linkage of the peptide to the therapeutic molecule.
Accordingly, the C-terminal modification may comprise the linker and vice versa. Suitably, the C-terminal modification may consist of the linker or vice versa. Suitable linkers are described herein elsewhere.
Suitably, the peptide comprises a C-terminal carboxyl group.
Suitably, the C-terminal carboxyl group is provided by a linker such as a glycine or betaalanine residue. In one embodiment, the C terminal carboxyl group is provided by a betaalanine residue. Suitably, the C terminal beta-alanine residue is also a linker. Alternatively, or additionally, the C-terminal modification may comprise a spacer. Suitably the spacer, if present, is located between the peptide and the linker. Suitable spacers are described elsewhere herein.
Suitably, therefore each arginine rich domain may further comprise an N or C terminal modification. Suitably the arginine rich domain at the C terminus comprises a C-terminal modification. Suitably the arginine rich domain at the N terminus comprises a N-terminal modification. Suitably, the argine rich domain at the C terminus comprises a linker group and optionally a spacer. Suitably, the arginine rich domain at the C terminus comprises a C- terminal beta-alanine. Suitably, the arginine rich domain at the N terminus is N-acetylated.
The peptide of the present invention is defined as having a total length of 40 amino acid residues or less. The peptide may therefore be regarded as an oligopeptide.
Suitably the peptide is less than 35 AA long, preferably less than 30AA long, preferably less than 25AA long, preferably less than 20AA long.
Suitably, the peptide has a total length of between 3-30 amino acid residues, suitably of between 5-30 amino acid residues, of between 10-30 amino acid residues, of between 10-20 amino acid residues, of between 10-15 amino acid residues.
Suitably, the peptide has a total length of at least 10, at least 12, at least 13, at least 14, at least 15 amino acid residues.
The peptide of the present invention may comprise a total of 10 or fewer arginine residues. By total it is meant the sum of the number of arginine residues present in the entire peptide. Suitably, the peptide may comprise 9 or fewer, 8 or fewer, 7 or fewer arginine residues, suitably 6 or fewer arginine residues.
The peptide of the present invention may comprise a total of at least 3 arginine residues. Suitably, the peptide may comprise 3 or more arginine residues, suitably 4 or more arginine residues, suitably 5 or more arginine residues, suitably 6 or more arginine residues.
Suitably, the peptide may comprise a total of between at least 3 and up to 10 (i.e. 10 or fewer) arginine residues, suitably between at least 3 and up to 7 arginine residues, suitably between at least 5 and up to 7 arginine residues, suitably between at least 6 and up to 7 arginine residues. Suitably the peptide contains a total of 5 arginine residues. Suitably the peptide contains a total of 6 arginine residues. Suitably the peptide contains a total of 7 arginine residues. Suitably the peptide is capable of penetrating cells. The peptide may therefore be regarded as a cell-penetrating peptide.
Suitably, the peptide is for attachment to a therapeutic molecule. Suitably, the peptide is for transporting a therapeutic molecule into a target cell. Suitably, the peptide is for delivering a therapeutic molecule into a target cell. The peptide may therefore be regarded as a carrier peptide.
Suitably, the peptide is capable of penetrating into cells and tissues, suitably into the nucleus of cells. Suitably into muscle tissues.
Suitably, the peptide may be selected from any of the following sequences:
RBRRYQFLIRBRXR (Pip8b2del01) (SEQ ID NO:40)
RRYQFLIRBRXR (Pip8b2del02) (SEQ ID NO:41)
RBRRYQFLIRXR (Pip8b2del05) (SEQ ID NO:42)
RRYQFLIXR (Pip8b2del06) (SEQ ID NO:43)
RBRRILFQYRBRXR (Pip5b2del01) (SEQ ID NO:44)
RBRRFQILYRBRXR (Pip9b2del01) (SEQ ID NO:53)
RBRRYQFLIBRXR (Pip8b2del08) (SEQ ID NO: 70)
RBRRYQFLIRBXR (Pip8b2del09) SEQ ID NO: 71)
Suitably the peptide is selected from one of the following sequences: RBRRFQILYRBRXR (Pip9b2del01) (SEQ ID NO:53), RBRRYQFLIRBRXR (Pip8b2del01) (SEQ ID NQ:40), and RBRRILFQYRBRXR (Pip5b2del01) (SEQ ID NO:44).
In one embodiment the peptide consists of the following sequence: RBRRYQFLIRBRXR (Pip8b2del01) (SEQ ID NQ:40).
In one embodiment the peptide consists of the following sequence: RBRRILFQYRBRXR (Pip5b2del01) (SEQ ID NO:44).
In some alternative aspects, the present invention may relate to a peptide selected from one of the following sequences:
RXRRBRRYQFLIRXR (Pip8b2del03) (SEQ ID NQ:50)
RXRRBRRYQFLIR (Pip8b2del04) (SEQ ID NO:51) RBRRYRFLIRBRXR (Pip7b2del01) (SEQ ID NO:52)
RBRYQFLIRRBRXR (Pip8b2del07) (SEQ ID NO:54)
Optionally in combination with a linker as defined elsewhere herein. Suitably any of the statements herein, aspects or embodiments may equally apply to the peptides of the alternative aspect above.
Suitably therefore in some alternative aspects, the hydrophobic domain may comprise YRFLI (SEQ ID NO:34).
Conjugate
The peptide of the invention may be covalently linked to a therapeutic molecule in order to provide a conjugate.
The therapeutic molecule may be any molecule for treatment of a disease. The therapeutic molecule may be selected from: a nucleic acid, peptide nucleic acid, antisense oligonucleotide (such as PNA, PMO), mRNA, gRNA (for example in the use of CRISPR/Cas9 technology), short interfering RNA, micro RNA, antagomiRNA, peptide, cyclic peptide, protein, pharmaceutical, drug, or nanoparticle.
In one embodiment, the therapeutic molecule is an antisense oligonucleotide.
Suitably the antisense oligonucleotide is comprised of a phosphorodiamidate morpholino oligonucleotide (PMO).
Alternatively the oligonucleotide may be a modified PMO or any other charge-neutral oligonucleotide such as a peptide nucleic acid (PNA), a chemically modified PNA such as a gamma-PNA (Bahai, Nat.Comm. 2016), oligonucleotide phosphoramidate (where the nonbridging oxygen of the phosphate is substituted by an amine or alkylamine such as those described in WO2016028187A1, or any other partially or fully charge-neutralized oligonucleotide.
The therapeutic antisense oligonucleotide sequence may be selected from any that are available in the art, for example antisense oligonucleotides for exon skipping in DMD are described in https://research-repository.uwa.edu.au/en/publications/antisense- oligonucleotide-induced-exon-skipping-across-the-human- , or a therapeutic antisense oligonucleotide complementary to the ISSN1 or IN7 sequence for the treatment of SMA are described in Zhou, HGT, 2013; and Hammond et al, 2016; and Osman et al, HMG, 2014. In one embodiment, the therapeutic molecule of the conjugate is an oligonucleotide complementary to the pre-mRNA of a gene target.
Suitably, the oligonucleotide complementary to the pre-mRNA of a gene target gives rise to a steric blocking event that alters the pre-mRNA leading to an altered mRNA and hence a protein of altered sequence. Suitably the steric blocking event may be exon inclusion or exon skipping. In one embodiment, the steric blocking event is exon skipping.
Optionally, lysine residues may be added to one or both ends of a therapeutic molecule (such as a PMO or PNA) before attachment to the peptide to improve water solubility.
Suitably the therapeutic molecule has a molecular weight of less than 15,000 Da, suitably less than 13,000 Da or suitably less than 10,000 Da.
Suitably, the peptide is covalently linked to the therapeutic molecule at the C-terminus.
Suitably, the peptide is covalently linked to the therapeutic molecule through a linker if required.
The linker may be selected from any suitable sequence.
Suitably the linker is present between the peptide and the therapeutic molecule. Suitably the linker is a separate group to the peptide and the therapeutic molecule.
In one embodiment, the conjugate comprises the peptide covalently linked via a linker to a therapeutic molecule. In one embodiment, the conjugate comprises the following structure:
[peptide] - [linker]-[therapeutic molecule]
In one embodiment, the conjugate consists of the following structure:
[peptide] - [linker]-[therapeutic molecule]
Suitable linkers include, for example, a C-terminal cysteine residue that permits formation of a disulphide, thioether or thiol-maleimide linkage, a C-terminal aldehyde to form an oxime, a click reaction or formation of a morpholino linkage with a basic amino acid on the peptide or a carboxylic acid moiety on the peptide covalently conjugated to an amino group to form a carboxamide linkage.
Suitably, the linker is between 1- 5 amino acids in length. Suitably the linker may comprise any linker that is known in the art. Suitably the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX and XB. Suitably the linker may be selected from succinic acid, glutamate, glutamic acid, or gamma-amino butyric acid (GABA).
In one embodiment, the linker is beta-alanine.
Suitably, therefore the peptide in combination with a linker may be selected from any of the following sequences:
RBRRYQFLIRBRXR-B (SEQ ID NO:45)
RRYQFLIRBRXR-B (SEQ ID NO:46)
RBRRYQFLIRXR-B (SEQ ID NO:47)
RRYQFLIXR-B (SEQ ID NO:48)
RBRRILFQYRBRXR-B (SEQ ID NO:49)
RBRRFQILYRBRXR-B (SEQ ID NO: 62)
RBRRYQFLIBRXR-B (Pip8b2del08) (SEQ ID NO: 72)
RBRRYQFLIRBXR-B (Pip8b2del09) (SEQ ID NO: 73)
Suitably the peptide in combination with a linker is selected from one of the following sequences: RBRRFQILYRBRXR-B (SEQ ID NO: 62), RBRRYQFLIRBRXR-B (SEQ ID NO:45), RBRRILFQYRBRXR-B (SEQ ID NO:49).
In one embodiment the peptide in combination with a linker consists of the following sequence: RBRRYQFLIRBRXR-B (SEQ ID NO:45).
In one embodiment, the peptide in combination with a linker consists of the following sequence: RBRRILFQYRBRXR-B (SEQ ID NO:49).
In another embodiment, the peptide is conjugated to the therapeutic molecule through a carboxamide linkage.
The linker of the conjugate may form part of the therapeutic molecule to which the peptide is attached. Alternatively, the attachment of the therapeutic molecule may be directly linked to the C-terminus of the peptide. Suitably, in such embodiments, no linker is required.
Alternatively, the peptide may be chemically conjugated to the therapeutic molecule. Chemical linkage may be via a disulphide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphates, or thiol-maleimide linkage, for example.
Optionally, cysteine may be added at the N- terminus of a therapeutic molecule to allow for disulphide bond formation to the peptide, or the N-terminus may undergo bromoacetylation for thioether conjugation to the peptide.
The peptide of the invention may equally be covalently linked to an imaging molecule in order to provide a conjugate.
Suitably, the imaging molecule may be any molecule that enables visualisation of the conjugate. Suitably, the imaging molecule may indicate the location of the conjugate. Suitably the location of the conjugate in vitro or in vivo. Suitably, there is provided a method of monitoring the location of a conjugate comprising an imaging molecule comprising: administering the conjugate to a subject and imaging the subject to locate the conjugate.
Examples of imaging molecules include detection molecules, contrast molecules, or enhancing molecules. Suitable imaging molecules may be selected from radionuclides; fluorophores; nanoparticles (such as a nanoshell); nanocages; chromogenic agents (for example an enzyme), radioisotopes, dyes, radiopaque materials, fluorescent compounds, and combinations thereof.
Suitably imaging molecules are visualised using imaging techniques, these may be cellular imaging techniques or medical imaging techniques. Suitable cellular imaging techniques include image cytometry, fluorescent microscopy, phase contrast microscopy, SEM, TEM, for example. Suitable medical imaging techniques include X-ray, fluoroscopy, MRI, scintigraphy, SPECT, PET, CT, CAT, FNRI, for example.
In some cases, the imaging molecule may be regarded as a diagnostic molecule. Suitably, a diagnostic molecule enables the diagnosis of a disease using the conjugate. Suitably, diagnosis of a disease may be achieved through determining the location of the conjugate using an imaging molecule. Suitably, there is provided a method of diagnosis of a disease comprising administering an effective amount of a conjugate comprising an imaging molecule to a subject and monitoring the location of the conjugate.
Suitably, further details such as the linkage of a conjugate comprising an imaging molecule are the same as those described above in relation to a conjugate comprising a therapeutic molecule. Suitably, the peptide of the invention may be covalently linked to a therapeutic molecule and an imaging molecule in order to provide a conjugate. Suitably therefore there is provided a conjugate comprising a peptide according to the invention, covalently linked to a therapeutic molecule and an imaging molecule.
Suitably the conjugate is capable of penetrating into cells and tissues, suitably into the nucleus of cells. Suitably into muscle tissues.
Suitably any of the peptides listed herein may be used in a conjugate according to the invention.
Suitably, in any case, the peptide may further comprise N-terminal modifications as described above.
Pharmaceutical Composition
The conjugate of the invention may formulated into a pharmaceutical composition.
Suitably the pharmaceutical composition comprises a conjugate of the invention.
Suitably, the pharmaceutical composition may further comprise a pharmaceutically acceptable diluent, adjuvant or carrier.
Suitable pharmaceutically acceptable diluents, adjuvants and carriers are well known in the art.
As used herein, the phrase "pharmaceutically acceptable" refers to those ligands, materials, formulations, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The phrase "pharmaceutically acceptable carrier", as used herein, refers to a pharmaceutically acceptable material, formulation or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the conjugate from one organ or portion of the body, to another organ or portion of the body. Each cell-penetrating peptide must be "acceptable" in the sense of being compatible with the other components of the composition e.g. the peptide and therapeutic molecule, and not injurious to the individual. Lyophilized compositions, which may be reconstituted and administered, are also within the scope of the present composition. Pharmaceutically acceptable carriers may be, for example, excipients, vehicles, diluents, and combinations thereof. For example, where the compositions are to be administered orally, they may be formulated as tablets, capsules, granules, powders, or syrups; or for parenteral administration, they may be formulated as injections, drop infusion preparations, or suppositories. These compositions can be prepared by conventional means, and, if desired, the active compound (i.e. conjugate) may be mixed with any conventional additive, such as an excipient, a binder, a disintegrating agent, a lubricant, a corrigent, a solubilizing agent, a suspension aid, an emulsifying agent, a coating agent, or combinations thereof.
It should be understood that the pharmaceutical compositions of the present disclosure can further include additional known therapeutic agents, drugs, modifications of compounds into prodrugs, and the like for alleviating, mediating, preventing, and treating the diseases, disorders, and conditions described herein under medical use.
Suitably, the pharmaceutical composition is for use as a medicament. Suitably for use as a medicament in the same manner as described herein for the conjugate. All features described herein in relation to medical treatment using the conjugate apply to the pharmaceutical composition.
Accordingly, in a further aspect of the invention there is provided a pharmaceutical composition according to the fourth aspect for use as a medicament. In a further aspect, there is provided a method of treating a subject for a disease or condition comprising administering an effective amount of a pharmaceutical composition according to the fourth aspect to the subject.
Medical Uses
The conjugate comprising the peptide of the invention may be used as a medicament for the treatment of a disease.
The medicament may be in the form of a pharmaceutical composition as defined above.
A method of treatment of a patient or subject in need of treatment for a disease condition is also provided, the method comprising the step of administering a therapeutically effective amount of the conjugate to the patient or subject.
Suitably, the medical treatment requires delivery of the therapeutic molecule into a cell, suitably into the nucleus of the cell.
Diseases to be treated may include any disease where improved penetration of the cell and/or nuclear membrane by a therapeutic molecule may lead to an improved therapeutic effect. Suitably, the conjugate is for use in the treatment of diseases of the neuromuscular system.
Conjugates comprising peptides of the invention are suitable for the treatment of genetic diseases of the neuromuscular system. Conjugates comprising peptides of the invention are suitable for the treatment of genetic neuromuscular diseases. In a suitable embodiment, there is provided a conjugate according to the second aspect for use in the treatment of genetic diseases of the neuromuscular system. Suitably, the conjugate is for use in the treatment of hereditary genetic diseases. Suitably, the conjugate is for use in the treatment of hereditary genetic diseases of the neuromuscular system. Suitably, the conjugate is for use in the treatment of hereditary genetic neuromuscular diseases. Suitably, the conjugate is for use in the treatment of hereditary X-linked genetic diseases of the neuromuscular system. Suitably, the conjugate is for use in the treatment of hereditary X-linked neuromuscular diseases.
Suitably, the conjugate is for use in the treatment of diseases caused by splicing deficiencies. In such embodiments, the therapeutic molecule may comprise an oligonucleotide capable of preventing or correcting the splicing defect and/or increasing the production of correctly spliced mRNA molecules.
Suitably the conjugate is for use in the treatment of any of the following diseases: Duchenne Muscular Dystrophy (DMD), Bucher Muscular Dystrophy (BMD), Menkes disease, Betathalassemia, dementia, Parkinson’s Disease, Spinal Muscular Atrophy (SMA), myotonic dystrophy (DM1 or DM2), Huntington’s Disease, Hutchinson-Gilford Progeria Syndrome, Ataxia-telangiectasia, Facioscapulohumeral muscular dystrophy (FSHD) or cancer.
Suitably, the patient or subject to be treated may be any animal or human. Suitably, the patient or subject may be a non-human mammal. Suitably the patient or subject may be male or female. In one embodiment, the subject is male.
Suitably, the patient or subject to be treated may be any age. Suitably the patient or subject to be treated is aged between 0-40 years, suitably 0-30, suitably 0-25, suitably 0-20 years of age.
Suitably, the conjugate is for administration to a subject systemically for example by intramedullary, intrathecal, intraventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous, oral or nasal routes.
In one embodiment, the conjugate is for administration to a subject intravenously.
In one embodiment, the conjugate is for administration to a subject intravenously by injection. Suitably, the conjugate is for administration to a subject in a "therapeutically effective amount", by which it is meant that the amount is sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the disease being treated. Decisions on dosage are within the responsibility of general practitioners and other medical doctors. Examples of the techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.
Exemplary doses may be between 0.01mg/kg and 50mg/kg, 0.05mg/kg and 40mg/kg, 0.1mg/kg and 30mg/kg, 0.5mg/kg and 18mg/kg, 1mg/kg and 16mg/kg, 2mg/kg and 15mg/kg, 5mg/kg and 10mg/kg, 10mg/kg and 20mg/kg, 12mg/kg and 18mg/kg, 13mg/kg and 17mg/kg.
Advantageously, the dosage of the conjugates of the present invention is an order or magnitude lower than the dosage required to see any effect from the therapeutic molecule alone.
Suitably, after administration of the conjugates of the present invention, one or more markers of toxicity are significantly reduced compared to prior conjugates using currently available cell penetrating peptides.
Suitable markers of toxicity may be markers of nephrotoxicity.
Suitable markers of toxicity include KIM-1 , NGAL, BUN, creatinine, alkaline phosphatase, alanine transferase, and aspartate aminotransferase.
Suitably the level of at least one of KIM-1, NGAL, and BUN is reduced after administration of the conjugates of the present invention when compared to prior conjugates using currently available cell penetrating peptides.
Suitably the levels of each of KIM-1 , NGAL, and BUN are reduced after administration of the conjugates of the present invention when compared to prior conjugates using currently available cell penetrating peptides.
Suitably, the levels of each marker/s is significantly reduced when compared to prior conjugates using currently available cell penetrating peptides.
Suitably the levels of the or each marker/s is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% after administration of the conjugates of the present invention when compared to prior conjugates using currently available cell penetrating peptides. Advantageously, the toxicity of the peptides and therefore the resulting conjugates is significantly reduced compared to prior cell-penetrating peptides and conjugates. In particular, KIM-1 is a marker of toxicity and is significantly reduced by up to 30 fold compared to prior conjugates using currently available peptide carriers.
Nucleic Acids and Hosts
Peptides of the invention may be produced by any standard protein synthesis method, for example chemical synthesis, semi-chemical synthesis or through the use of expression systems.
Accordingly, the present invention also relates to the nucleotide sequences comprising or consisting of the DNA coding for the peptides, expression systems e.g. vectors comprising said sequences accompanied by the necessary sequences for expression and control of expression, and host cells and host organisms transformed by said expression systems.
Accordingly, a nucleic acid encoding a peptide according to the present invention is also provided.
Suitably, the nucleic acids may be provided in isolated or purified form.
An expression vector comprising a nucleic acid encoding a peptide according to the present invention is also provided.
Suitably, the vector is a plasmid.
Suitably the vector comprises one or more regulatory sequences, e.g. promoter, operably linked to a nucleic acid encoding a peptide according to the present invention. Suitably, the expression vector is capable of expressing the peptide when transfected into a suitable cell, e.g. mammalian, bacterial or fungal cell.
A host cell comprising the nucleic acid or expression vector of the invention is also provided.
Expression vectors may be selected depending on the host cell into which the nucleic acids of the invention may be inserted. Such transformation of the host cell involves conventional techniques such as those taught in Sambrook et al [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA], Selection of suitable vectors is within the skills of the person knowledgeable in the field. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.
The peptides produced may be isolated and purified from the host cell by any suitable method e.g. precipitation or chromatographic separation e.g. affinity chromatography. Suitable vectors, hosts and recombinant techniques are well known in the art.
In this specification the term "operably linked" may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence are covalently linked in such a way as to place the expression of a nucleotide coding sequence under the control of the regulatory sequence, as such, the regulatory sequence is capable of effecting transcription of a nucleotide coding sequence which forms part or all of the selected nucleotide sequence. Where appropriate, the resulting transcript may then be translated into a desired peptide.
Brief Description of the Drawings
Certain embodiments of the present invention will now be described with reference to the following figures and tables in which:
Figure 1 : shows Dmd exon 23 skipping efficacy in four different tissues in a wild type mouse model of seven candidate peptides conjugated to exon 23 targeting PMO labelled Pip8b2del01-07 compared to parent Pip8b2-PMO compound. Efficacy is measured as percentage of exon 23 skipping in Dmd transcript assessed by RT-qPCR 7 days after administration of a single 30mg/kg dose.
Figure 2: shows nephrotoxicity in a wild type mouse model of seven candidate CPP-PMOs labelled Pip8b2del01-07 and parent Pip8b2-PMO relative to saline as measured by the fold change in urinary Kim-1 levels at 2 days and 7 days after single 30mg/kg dose administration.
Figure 3: (A-C) shows Dmd exon 23 skipping efficacy in three different tissues in a wild type mouse model of core variant peptides 5b2del01 , 7b2del01 and 9b2del01 conjugated to exon 23 targeting PMO. Efficacy is measured as percentage of exon 23 skipping in Dmd transcript assessed by RT-qPCR 7 days after administration of a single 30mg/kg dose. (D) shows nephrotoxicity in a wild type mouse model of these peptide-PMO variants relative to saline as measured by the fold change in urinary Kim-1 levels at 2 days and 7 days after administration of a single 30mg/kg dose.
Figure 4: (A) Exon 7 inclusion in the SMN2 transcript in a SMA mouse model (SMN1tm1Hun9/WT;SMN2t9/t9) with Pip8b2del01 conjugated to SMN2 targeting PMO, as assessed by ratio of full length SMN2 (including exon 7) to total SMN transcript by RT-qPCR 7 days after a single 30mg/kg dose. (B) nephrotoxicity in a SMA mice model of Pip8b2del01-PMO relative to saline as measured by the fold change in urinary Kim-1 levels at 2 days and 7 days after single 30mg/kg dose administration.
Figure 5: (A-C) shows Dmd exon 23 skipping efficacy in three different tissues in a wild type mouse model of two further candidate peptides Pip8b2del08 and Pip8b2del09 conjugated to exon 23 targeting PMO compared to parent Pip8b2-PMO compound. Efficacy is measured as percentage of exon 23 skipping in Dmd transcript assessed by RT-qPCR 7 days after administration of a single 30mg/kg dose. (D) shows nephrotoxicity in a wild type mouse model of these peptide-PMO variants relative to saline as measured by the fold change in urinary Kim-1 levels at 2 days and 7 days after single 30mg/kg dose administration.
Figure 6: shows the same data as in Fig. 1A, Fig. 1C, Fig. 1 D, Fig. 2 and Fig. 5, arranged in order according to the number of arginine residues in the peptides as labelled on the x-axis (e.g. “7R” means 7 arginine residues).
Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.
Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.
The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed. The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.
Examples
1- Materials for CPP and PPMO synthesis
9-Fluroenylmethoxycarbonyl (Fmoc) protected L-amino acids, benzotriazole- 1-yl-oxy- trispyrrolidino-phosphonium (PyBOP), and the preloaded Fmoc- /AAla- Wang resin (0.19 or 0.46 mmol/g) were obtained from Merck (Hohenbrunn, Germany). HPLC grade acetonitrile, and synthesis grade A/-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis grade dimethylformamide (DMF) and diethyl ether were obtained from Merck (Hohenbrunn, Germany). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, England). PMO was purchased from Gene Tools Inc. (Philomath, USA). All other reagents were obtained from Sigma-Aldrich unless otherwise stated. MALDI-TOF mass spectrometry was carried out using a Voyager DE Pro BioSpectrometry workstation. A stock solution of 10 mg/mL of a-cyano-4-hydroxycinnamic acid or sinapinic acid in 50% acetonitrile in water was used as matrix. Error bars are + 0.1 %.
2- Peptide synthesis
Peptide chains were elongated on a 0.1 mmol scale using a CEM Liberty Blue™ microwave Peptide Synthesizer (Buckingham, UK) and Fmoc chemistry following manufacturer’s recommendations. Coupling condition utilised PyBOP and DIEA (5 and 10 equiv respectively) while Fmoc removal used 20 % piperidine in DMF). Once synthesis was complete, the resin was washed with DMF (3 x 5 mL) and the /V-terminus of the solid phase bound peptide was acetylated with acetic anhydride in the presence of DIEA at room temperature. After acetylation of the N-terminus, the peptide resin was washed with DMF (3 x 5 mL) and DCM (3 x 5 mL). After drying the peptidyl resin, the peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of trifluoroacetic acid (TFA): H2O: triisopropylsilane (TIS) (95:2.5:2.5, 10 mL/g) for 1 h at room temperature followed by the typical diethyl ether precipitation, HPLC and MALDI-TOF analysis. Peptides were purified by 1260 Infinity II preparative HPLC Agilent system on an RP-C18 column (21.2 x 250 mm, Phenomenex) using a linear gradient (5 to 50 over 30 min) of 0 .1 %TFA CH3CN in 0 .1 %TFA/H2O with a flow rate of 15 mL/min.
3- Synthesis of PMO-peptide conjugates by amide bond conjugation
PMOs were obtained from Gene Tools, LLC and the conjugation occurred via amide bond formation between the 3’ end into the C-terminal of the peptide. A 25-mer PMO antisense sequence for mouse dystrophin exon-23 (GGCCAAACCTCGGCTTACCTGAAAT) (SEQ ID NO:56) and a 25-mer PMO sequences for human SMN2 exon-7 inclusion (GTAAGATTCACTTTCATAATGCTGG) (SEQ ID NO:63), targeting intron splice silencer N1 (ISS-N1) at the 5 region of intron 7 were used. The peptide was conjugated to the 3’-end of the PMO through its C-terminal carboxyl group. This was achieved using 2.5 and 2-fold equivalents of PyBOP and HOAt in NMP respectively in the presence of 2.5 equiv of DIEA over peptide. PMO were dissolved in DMSO (10 mM) while all other reactants were dissolved in NMP (100 mM peptide in NMP, 300 mM of PyBOP and HOAt in NMP). The conjugation reaction mixture was incubated at 40 °C and the reaction was monitored by RP-HPLC upon completion (1 h) followed by quenching the reaction by hydrazide hydrate (50 uL per 2 umol of PMO) for 15 min. This solution was purified by ion exchange chromatography using a converted Gilson HPLC system and prepacked Resource S, GE Healthcare. A linear gradient of solvent B (25 mM sodium phosphate buffer, pH 7.0, 20 % CH3CN, 1 M sodium chloride solution) in solvent A (25 mM sodium phosphate buffer, pH 7.0, 20 % CH3CN) was used to elute the conjugate from the column at a flow rate of 6 mL/min. Only the pure fractions were combined and desalted immediately. The removal of excess salts from the peptide-PMO conjugate was afforded using an Amicon ultra-15 3K centrifugal filter device. After lyophilisation, the conjugate was analysed and characterised by MALDI-TOF and RP-HPLC. The conjugates were dissolved in sterile water and filtered through a 0.22 m cellulose acetate membrane before use. The concentration of the conjugates was determined by the molar absorption of the conjugates at 265 nm in 0.1 N HCI solution. Average yield was around 20- 40% calculated from PMO starting materials.
4- In vivo assessment of exon 23 skipping by P-PMO
Male C57BL/6 mice aged 8-10 weeks were administered a single 30 mg/kg dose of peptide- PMO in 0.9% saline by bolus intravenous tail vein injection. Urine was non-invasively collected under chilled conditions at Day 2 and Day 7 post-administration following 20 hours housing in metabolic cages (Tecniplast, UK). Serum was collected from jugular vein at Day 7 at necropsy, as was tibialis anterior (TA), diaphragm (DI A), triceps (TRI) and heart tissue.
Quantification of exclusion of exon 23 from the mouse DMD transcript was performed on skeletal muscle and heart tissue treated with peptide-PMO. Briefly, RNA was extracted from homogenised tissue using Maxwell simplyRNA extraction and cDNA synthesised using random primers. Primer/probes were synthesised by Integrated DNA Technologies and designed to amplify a region spanning exon 23-24 representing unskipped product (mDMD23- 24), or to amplify specifically transcripts lacking exon 23 using a probe spanning the boundary of exon 22 and 24 (mDMD22-24) (see Table 1). Levels of respective transcripts were determined by calibration to standard curves prepared using known transcript quantities, and skipping percentages derived by [skip]/[skip+unskip].
Results are shown in figures 1 , 3A, 3B, 3C, 5A, 5B, 5C, 6A, 6B and 6C.
5- In vivo assessment of exon 7 inclusion by P-PMO
Experiments were carried out in the Biomedical Sciences Unit, University of Oxford, according to procedures authorized by the UK Home Office. The PPMO of the lead peptide were diluted in 0.9 % saline (Sigma) and administered via single bolus i.v. tail vein injection of 30 mg/kg intravenous tail vein to SMA mice (SMN1tm1Hun9/WT;SMN2t9/t9). Saline treated control animals were selected from littermates and handled in the same manner as the treated animals to control for potential changes in SMN expression due to stress. Tissues were harvested 7 days post administration. The tissues harvested included: liver, kidney, TA, brain, cerebellum, and spinal cord. Spinal cord was divided into cervical, thoracic, and lumbar regions. Briefly, RNA was extracted from homogenised tissue using Maxwell simplyRNA extraction and cDNA synthesised using random primers. Primers were synthesised by Integrated DNA Technologies and designed to amplify a region amplifying SMN2 transcript containing specifically exon 7 as well as total SMN2 transcript levels. Transcripts were normalized to Polymerase (RNA) II polypeptide J (PolJ) levels. Exon 7 inclusion efficiency is presented as the fold increase in SMN2 exon 7 inclusion relative to saline treated controls.
Results are shown in figure 4A.
Table 1. Primer and probe sequences for quantification of Dmd exon 23 skipping and SMN2 exon 7 inclusion by quantitative RT-PCR methods FAM = 6 Carboxyfluorescein, Z = Zen™ modification, 3IABkFQ = Iowa Black® FQ
6- Toxicological assessment of peptide-PMO
Urinary levels of KIM-1 (Kidney injury molecule-1) were quantified by ELISA (KIM-1 R&D MKM100) following appropriate dilution of urine to fit standard curves. Values were normalised to urinary creatinine levels that were quantified at MRC Harwell Institute, Mary Lyon Centre, Oxfordshire, UK.
Results are shown in figures 2, 3D, 4B, 5D and 6D.
Sequences
Arginine Rich Domains
RBRR (SEQ ID NO:1)
RBRXR (SEQ ID NO:2)
RXRBR (SEQ ID NO:3)
RXRXR (SEQ ID NO:4)
RRXBR (SEQ ID NO:5)
RRBRX (SEQ ID NO:6)
RRBXR (SEQ ID NO:7)
XRBRR (SEQ ID NO:8)
RBRB (SEQ ID NO:9)
RRBB (SEQ ID NO: 10)
BBRR (SEQ ID NO:11)
BRBR (SEQ ID NO:12)
RRRB (SEQ ID NO:13)
BBBR (SEQ ID NO:14)
RXRB (SEQ ID NO: 15)
RXBR (SEQ ID NO: 16) RBRX (SEQ ID NO: 17) BRBX (SEQ ID NO: 18) XRBR (SEQ ID NO: 19) XBRB (SEQ ID NO:20) RBXR (SEQ ID NO:21) RRXB (SEQ ID NO:22) RRBX (SEQ ID NO:23) XRBB (SEQ ID NO:24) XBRR (SEQ ID NO:25) RXBB (SEQ ID NO:26) XRRR (SEQ ID NO:27) RRRX (SEQ ID NO:28) BRXR (SEQ ID NO:29) BBXR (SEQ ID NO:30) BBRX (SEQ ID NO:31) Hydrophobic Domains YQFLI (SEQ ID NO:32) ILFQY (SEQ ID NO:33) YRFLI (SEQ ID NO:34) FQILY (SEQ ID NO:35) FQIY (SEQ ID NO:36) WWPWW (SEQ ID NO:37) WPWW (SEQ ID NO:38) WWPW (SEQ ID NO:39) Peptides
RBRRYQFLIRBRXR (Pip8b2del01) (SEQ ID NO:40)
RRYQFLIRBRXR (Pip8b2del02) (SEQ ID N0:41)
RBRRYQFLIRXR (Pip8b2del05) (SEQ ID NO:42)
RRYQFLIXR (Pip8b2del06) (SEQ ID NO:43)
RBRRILFQYRBRXR (Pip5b2del01) (SEQ ID NO:44)
RBRRFQILYRBRXR (Pip9b2del01) (SEQ ID NO:53)
RBRRYQFLIBRXR (Pip8b2del08) (SEQ ID NO: 70)
RBRRYQFLIRBXR (Pip8b2del09) SEQ ID NO: 71)
Peptides + linkers
RBRRYQFLIRBRXR-B (SEQ ID NO:45)
RRYQFLIRBRXR-B (SEQ ID NO:46)
RBRRYQFLIRXR-B (SEQ ID NO:47)
RRYQFLIXR-B (SEQ ID NO:48)
RBRRILFQYRBRXR-B (SEQ ID NO:49)
RBRRFQILYRBRXR-B (SEQ ID NO:62)
RBRRYQFLIBRXR-B (SEQ ID NO: 72)
RBRRYQFLIRBXR-B (SEQ ID NO: 73)
Other Peptides used in the examples
RXRRBRRYQFLIRXR (Pip8b2del03) (SEQ ID NQ:50)
RXRRBRRYQFLIR (Pip8b2del04) (SEQ ID NO:51)
RBRRYRFLIRBRXR (Pip7b2del01) (SEQ ID NO:52)
RBRYQFLIRRBRXR (Pip8b2del07) (SEQ ID NO:54) Antisense sequence for mouse dystrophin exon-23
GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID NO:55) mDMD23-24 Primer 1
CAGGCCATTCCTCTTTCAGG (SEQ ID NO:56) mDMD23-24 Primer 2
GAAACTTTCCTCCCAGTTGGT (SEQ ID NO:57) mDMD23-24 Probe
/5FAM/TCAACTTCA/ZEN/GCCATCCATTTCTGTAAGGT/3IABkFQ/ (SEQ ID NO:58) mDMD22-24 Primer 1
CTGAATATGAAATAATGGAGGAGAGACTCG (SEQ ID NO:59) mDMD22-24 Primer 2
CTTCAGCCATCCATTTCTGTAAGGT (SEQ ID NQ:60) mDMD22-24 Probe
/5FAM/ATGTGATTC/ZEM/TGTAATTTCC/3IABkFQ/ (SEQ ID NO:61)
Antisense sequence for mouse SMN2
GTAAGATTCACTTTCATAATGCTGG (SEQ ID NO:63)
Full-length SMN2
Reverse Primer 5'-CTA TGC CAG CAT TTC TCC TTA ATT-3' (SEQ ID NO:64)
Forward Primer 5'-GCT TTG GGA AGT ATG TTA ATT TCA -3' (SEQ ID NO:65)
Total SMN2
Reverse Primer 5'-GGA AGC TGC AGT ATT CTT CT-3' (SEQ ID NO:66)
Forward Primer 5'-GCG ATG ATT CTG ACA TTT GG-3' (SEQ ID NO:67)
PolJ
Reverse Primer 5' -CTCGCTGATGAGGTCTGTGA-3' (SEQ ID NO:68)
Forward Primer 5'-ACCACACTCTGGGGAACATC-3' (SEQ ID NO:69)

Claims

1. A peptide having a total length of 40 amino acid residues or less, the peptide comprising at least a first and a second arginine rich domain, and at least one hydrophobic domain selected from FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32) or ILFQY (SEQ ID NO:33), wherein the peptide comprises at least one aminohexanoic acid (X) residue, each arginine rich domain comprises no more than 3 arginine residues, and wherein the first arginine rich domain is selected from one of the following sequences: RBRR (SEQ ID NO:1), RBRXR (SEQ ID NO:2) RR, RXR, XR, and R.
2. A peptide according to claim 1 , wherein the first and second arginine rich domains comprise amino acid residues selected from: arginine, beta-alanine and aminohexanoic acid residues, preferably wherein the first and second arginine rich domains consist of amino acid residues selected from: arginine, beta-alanine and aminohexanoic acid residues.
3. A peptide according to claim 1 or 2, wherein the first and second arginine rich domains comprise a plurality of arginine residues, preferably the first and second arginine rich domains each comprise at least 40%, least 50%, at least 60%, at least 70%, at least 80%, at least 90% arginine residues.
4. A peptide according to claim 1, wherein the first arginine rich domain is the N-terminal domain of the peptide.
5. A peptide according to any preceding claim, wherein first arginine rich domain is selected from one of the following sequences: RBRR (SEQ ID NO:1), and RR, preferably the first arginine rich domain is RBRR (SEQ ID NO:1).
6. A peptide according to any preceding claim, wherein the second arginine rich domain is the C-terminal domain of the peptide.
7. A peptide according to any preceding claim, wherein the second arginine rich domain is longer than the first arginine rich domain, preferably wherein the second arginine rich domain comprises more than 4 amino acid residues. A peptide according to any preceding claim wherein the second arginine rich domain comprises one of the following sequences: RBRXR (SEQ ID NO:2), RBRR (SEQ ID NO:1), RR, RXR, R, XR, BRXR (SEQ ID NO:29), and RBXR (SEQ ID NO:21), preferably wherein the second arginine rich domain consists of one of the following sequences: RBRXR (SEQ ID NO:2) , and RXR, more preferably wherein the second arginine rich domain is RBRXR (SEQ ID NO:2). A peptide according to any preceding claim wherein the hydrophobic domain is selected from: FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), ILFQY (SEQ ID NO:33), preferably the hydrophobic domain is YQFLI (SEQ ID NO:32). A peptide according to any preceding claim, wherein the at least one hydrophobic domain is flanked by first and second arginine rich domains, preferably wherein the peptide comprises the structure: [first arginine rich domain] - [hydrophobic domain] - [second arginine rich domain], A peptide according to any preceding claim, wherein the peptides is less than 35 amino acids long, preferably less than 30 amino acids long, preferably less than 25 amino acids long, preferably less than 20 amino acids long. A peptide according to any preceding claim, wherein the first arginine rich domain is selected from: RBRR (SEQ ID NO:1), and RR, and the second arginine rich domain is selected from RBRXR (SEQ ID NO:2), XR, and RXR. A peptide according to claim 12, wherein the hydrophobic domain is selected from FQILY (SEQ ID NO: 35), YQFLI (SEQ ID NO:32), and ILFQY (SEQ ID NO:33). A peptide according to any preceding claim, wherein the peptide comprises or consists of one of the following sequences:
RBRRYQFLI RBRXR (Pip8b2del01) (SEQ ID NQ:40)
RRYQFLIRBRXR (Pip8b2del02) (SEQ ID NO:41)
RBRRYQFLI RXR (Pip8b2del05) (SEQ ID NO:42) RRYQFLIXR (Pip8b2del06) (SEQ ID NO:43)
RBRRILFQYRBRXR (Pip5b2del01) (SEQ ID NO:44)
RBRRFQILYRBRXR (Pip9b2del01) (SEQ ID NO:53)
RBRRYQFLIBRXR (Pip8b2del08) (SEQ ID NO: 70)
RBRRYQFLIRBXR (Pip8b2del09) SEQ ID NO: 71)
15. A peptide according to any preceding claim, wherein the peptide comprises or consists of one of the following sequences: RBRRFQILYRBRXR (Pip9b2del01) (SEQ ID NO:53), RBRRYQFLIRBRXR (Pip8b2del01) (SEQ ID NQ:40), RBRRILFQYRBRXR (Pip5b2del01) (SEQ ID NO:44), preferably RBRRYQFLIRBRXR (Pip8b2del01) (SEQ ID NQ:40).
16. A conjugate comprising a peptide according to any preceding claim, covalently linked to a therapeutic molecule.
17. A conjugate according to claim 16, wherein the peptide is covalently linked by a linker, preferably the linker is selected from: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, XB, E, succinic acid and gamma-aminobutyric acid (GABA), more preferably the linker is B.
18. A conjugate according to any of claims 16 or 17, wherein the therapeutic molecule is selected from a nucleic acid, peptide nucleic acid, an antisense oligonucleotide, miRNA, siRNA, peptide, cyclic peptide, protein, pharmaceutical and drug, preferably the therapeutic molecule is an antisense oligonucleotide, preferably wherein the antisense oligonucleotide is a PMO.
19. A pharmaceutical composition comprising the conjugate according any of claims 16- 18.
20. A conjugate according to any of claims 16-18, or pharmaceutical composition according to claim 19 for use as a medicament. A conjugate according to any of claims 16-18, or pharmaceutical composition according to claim 19 for use in the treatment of a diseases of the neuromuscular system or musculoskeletal system, preferably genetic diseases of the neuromuscular system or musculoskeletal system, preferably hereditary genetic diseases of the neuromuscular system or musculoskeletal system.
EP23805112.2A 2022-11-01 2023-10-31 Shortened cell-penetrating peptides Pending EP4612162A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB2216207.7A GB202216207D0 (en) 2022-11-01 2022-11-01 Shortened cell-penetrating peptides
PCT/GB2023/052831 WO2024094980A1 (en) 2022-11-01 2023-10-31 Shortened cell-penetrating peptides

Publications (1)

Publication Number Publication Date
EP4612162A1 true EP4612162A1 (en) 2025-09-10

Family

ID=84839392

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23805112.2A Pending EP4612162A1 (en) 2022-11-01 2023-10-31 Shortened cell-penetrating peptides

Country Status (4)

Country Link
EP (1) EP4612162A1 (en)
CN (1) CN120418265A (en)
GB (1) GB202216207D0 (en)
WO (1) WO2024094980A1 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011064552A1 (en) * 2009-11-30 2011-06-03 Isis Innovation Limited Conjugates for delivery of biologically active compounds
CN103998458B (en) * 2011-08-30 2018-10-09 医学研究理事会 Cell-penetrating peptides with central hydrophibic domain
RU2708237C2 (en) 2014-08-22 2019-12-05 Общество с ограниченной ответственностью "НооГен" Modified oligonucleotides and method for production thereof

Also Published As

Publication number Publication date
CN120418265A (en) 2025-08-01
GB202216207D0 (en) 2022-12-14
WO2024094980A1 (en) 2024-05-10

Similar Documents

Publication Publication Date Title
US20250387498A1 (en) Cell-penetrating peptides
US20260091120A1 (en) Cell-penetrating peptides
JP7678654B2 (en) Conjugates and their uses
US12583889B2 (en) Cell penetrating peptides
EP4612162A1 (en) Shortened cell-penetrating peptides
US20250215053A1 (en) Lysine rich cell-penetrating peptides
RU2852222C2 (en) Cell-penetrating peptides
RU2852222C9 (en) Cell-penetrating peptides
HK40060220A (en) Cell-penetrating peptides

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250424

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)