EP4605537A1

EP4605537A1 - Compositions and methods for treating retinal degenerative disorders

Info

Publication number: EP4605537A1
Application number: EP23798347.3A
Authority: EP
Inventors: Deniz DALKARA; Hanen KHABOU; Florence LORGET; José-Alain Sahel; Stéphane BOISSEL; Mehdi Gasmi
Original assignee: Sparingvision; Centre National de la Recherche Scientifique CNRS; Institut National de la Sante et de la Recherche Medicale INSERM; Sorbonne Universite
Current assignee: Sparingvision; Centre National de la Recherche Scientifique CNRS; Institut National de la Sante et de la Recherche Medicale INSERM; Sorbonne Universite
Priority date: 2022-10-20
Filing date: 2023-10-20
Publication date: 2025-08-27
Also published as: AU2023362592A1; IL320351A; JP2025538863A; KR20250115381A; CN120303405A; WO2024084075A1

Abstract

The present invention relates to the combination of a nucleic acid encoding a short isoform of rod- derived cone viability factor (RdCVF), a nucleic acid encoding a long isoform of rod-derived cone viability factor (RdCVFL) and a nucleic acid encoding a mutated form of the subunit 1 of G-protein- gated inwardly rectifying potassium channel (GIRK1) (GIRK1 F137S) or a mutated form of the subunit 4 of G-protein-gated inwardly rectifying potassium channel (GIRK4) (GIRK4 S143T), the three nucleic acids being expressed through one, two or three viral vectors, and said vectors may be within a single pharmaceutical composition or within several different pharmaceutical compositions (two or three). It also deals with the treatment of a retinal degenerative disease, in particular retinitis pigmentosa, with said viral vectors or pharmaceutical compositions.

Description

Compositions and methods for treating retinal degenerative disorders

Field of the invention

[1] The present invention relates to the treatment of retinal neurodegenerative disorders, and more particularly to the treatment by maintaining the integrity of the cone photoreceptors and by reactivating cones which have already lost their outer segment.

Background Art

[2] Retina is the light sensitive tissue of the eye composed of three layers of neurons interconnected by synapses. The primary neurons of the retina are the light-sensing photoreceptors (PR), which are of two types: the rods for night vision and the cones for daylight vision. Cone-mediated vision is mostly supported by the fovea and is responsible for high acuity central vision most valuable to our daily visual tasks [1]. The light sensitive G protein coupled receptors that link photon capture to intracellular signaling leading to membrane hyperpolarization in photoreceptors are called opsins [2], There is one type of rod opsin found in rods and three types of cone opsins - responsible for trichromatic vision - in the primate retina. The structural properties and phototransduction cascades are similar between these opsins.

[3] Photoreceptors, such as rods and cones, are light-sensitive sensory neurons found on the posterior layer of the retina. They are also called photoreceptor cells or photoreceptor neurons.

[4] The phototransduction cascade is composed of several proteins that are concentrated in the photoreceptor outer segments in normal retinas (Figure 1A). The role of the photoreceptor is to sense light via this phototransduction cascade and induce an electrical signal that is then processed and transmitted towards downstream neurons [3].

[5] The absorption of a photon activates the opsin composed of two parts: the protein part, and the light absorbing part, which is the retinal - a derivative of vitamin A. The latter isomerizes from 1 1 -cis-retinal (dark adapted state) into all-trans-retinal configuration (light adapted state). As a result, the opsin becomes catalytically active recruiting the G protein transducin. The a-subunit of transducin is activated by the replacement of GDP by GTP. After, the a-subunit dissociates from the By-subunits to activate the membrane-associated phosphodiesterase 6 (PDE) by binding its two inhibitory y subunits. The activated PDE hydrolyses cGMP into GMP. The reduction of cGMP clones the nucleotide-gated channels (CNG) and this stops cation entry, resulting in PR hyperpolarization and reduction in glutamate release by the photoreceptor [4],

[6] In order to respond to another photon, this phototransduction cascade is deactivated by two mechanisms: (i) the transducin inactivates itself by hydrolyzing the bound GTP and (ii) the rhodopsin kinase (GRK) phosphorylates the opsin that interacts with the regulatory protein arrestin, leading to opsin inactivation. Retinal is then recycled by the retinal pigment epithelium (RPE) and Muller glial cells. Each and every protein of this cascade plays an important role in converting the light signal into an electrical signal conveyed to the second and third order neurons [5].

[7] Neurodegenerative disorder encompasses a range of seriously debilitating conditions that are characterized by neuron degeneration.

[8] Retinal neurodegenerative disorders or retinal degenerative diseases encompass different subgroups of pathologies: Rod-cone dystrophies, Cone dystrophies, Cone-rod dystrophies, and atrophic age-related macular degeneration.

[9] Rod-cone dystrophies (RCD), such as retinitis pigmentosa (RP), are genetically heterogeneous retinal neurodegenerative diseases characterized by the progressive death of rod photoreceptors followed by the consecutive loss of cones. RP is one of the most common forms of inherited retinal degeneration, affecting around 1 :3,500 people worldwide [6], which represents 2 million patients worldwide. Mutations causing RP in over 63 distinct genes have been identified to date with a significant proportion of these mutations in rodspecific transcripts.

[10] Cones dystrophies are characterized by the vision loss (age of onset ranging from the late teens to the sixties), sensitivity to bright lights, and poor color vision. Therefore, patients see better at dusk. Visual acuity usually deteriorates gradually, but it can deteriorate rapidly to 20/200. Later, in more severe cases, it drops to "counting fingers" vision. Color vision testing using color test plates (HRR series) reveals many errors on both red-green and blueyellow plates.

[11] Cone-Rod Dystrophies (CRD) refer to a group of inherited retinal degenerations (1 :30 - 40,000 people) that affect the photoreceptor (light sensing) cells that are responsible for capturing images from the visual field. These cells line the back of the eye in the region known as the retina. Cone photoreceptor cells are present throughout the retina but are concentrated in the central region (the macula). They are useful for central (reading) vision. Rod photoreceptor cells are present throughout the retina except for the very center of the macula called the fovea where only cones are present. They are responsible for night vision. [12] In contrast to typical retinitis pigmentosa (known as the Rod-Cone Dystrophies), which results from the loss of rod cells and later the cone cells, Cone-Rod Dystrophies can reflect the opposite sequence of events, where cone cells are primarily first affected with later loss of rods. The degree of vision loss becomes more severe over time. There are multiple types of Cone-Rod Dystrophies, which are determined by their genetic cause and pattern of inheritance.

[13] Atrophic age-related macular degeneration (AMD) or advanced dry AMD, is an advanced form of age-related macular degeneration that can result in the progressive and irreversible loss of retina (photoreceptors, retinal pigment epithelium, choriocapillaris) which can lead to a loss of visual function over time [27, 28, 29, 30]. It is estimated that atrophic AMD affects more than 5 million people worldwide and approximately 1 million patients in the US [31 , 32], which is similar to the prevalence of neovascular (wet) AMD, the other advanced form of the disease.

[14] In patients suffering from RCD, in particular from RP, vision loss develops in three successive steps.

[15] RP patients initially present with loss of vision under dim-light conditions (night vision loss), corresponding to the loss of function and degeneration of rods with relative preservation of macular cone-mediated vision. This is felt as a minor handicap, where patients retain an almost normal way of life [24],

[16] The disease then progresses through a second more incapacitating step resulting from the loss of function and degeneration of cones. In this later stage of the degeneration, cones degenerate in the periphery leading to the well-known tunnel vision. Indeed, the center of the retina represents 5% of all photoreceptors in human and most mammals, and when this part is conserved, patients maintain a high acuity but restricted field of vision [25].

[17] The final stage of the disease corresponds to the degeneration of the foveolar cone photoreceptors, which leads to a total loss of vision in the patient. In this stage, some of the cones present viable cell bodies despite the degeneration of their light sensing outer segments.

[18] In modern society, in which much of the environment is artificially lit, and many activities rely on high acuity color vision, thus the retention of cone-mediated sight in RP patients would lead to a significant improvement in quality of life.

[19] The loss of cones in RP subsets caused by rod-specific mutations is not perfectly understood, although several mechanisms, which are not necessarily mutually exclusive, have been proposed. Some hypothesized mechanisms implicate a ‘bystander effect’ whereby cone death is a consequence of the release of toxic byproducts from the degeneration of surrounding rods, or as a result of the loss of contact with rods, retinal pigment epithelium (RPE) or Muller glia. Alternatively, activation of Muller cells and the release of toxic molecules may play a role. Another hypothesis is that the quantities of oxygen or retinoids delivered to the photoreceptor layer by the RPE from the choroidal blood circulation are excessive and toxic as the metabolic load of rods is lost [7], Punzo et al. showed evidence that in murine models of retinal degeneration cones die in part as a result of starvation and nutritional imbalance, driven by the insulin/mammalian target of rapamycin pathway [8]. Additionally, it has been suggested that the loss of a survival factor secreted by rods and required for cone survival may contribute to cone loss [9, 10].

[20] In agreement with the last hypothesis, transplanted healthy retinal tissue has been shown to support cone survival in areas distant from the grafted tissue in the rd 1 mouse [11 , 12].

[21] International patent application W02008/148860A1 describes a family of trophic factors, called rod-derived cone viability factor (RdCVF) and RdCVF2 that are able to increase neuron survival and are useful for treating and/or preventing neurodegenerative disorders such as RP.

[22] The rod-derived cone viability factor (RdCVF) was originally identified from a high- throughput method of screening cDNA libraries as a candidate molecule responsible for this rescue effect [9]. Rods secrete RdCVF, and therefore, as rods die, the source of this paracrine factor is lost and RdCVF levels decrease. The loss of expression of RdCVF, and secreted factors like it, may therefore contribute to the secondary wave of cone degeneration observed in rod-cone dystrophies.

[23] RdCVF has been shown to mediate cone survival both in culture [13] and when injected subretinally in mouse and rat models of recessive and dominant forms of retinitis pigmentosa [9, 14], In 2010, Leveillard and Sahel [26] have shown that expression of RdCVF preserves cone-mediated vision by allowing the maintenance of cone outer segments, thereby increasing cone functional life.

[24] Besides, it has been shown that disruption of Nxnll , the gene encoding RdCVF, renders mouse photoreceptors increasingly susceptible to photoreceptor dysfunction and cone loss over time [15].

[25] Nxnll encodes two protein isoforms through differential splicing. The isoform mediating cone survival, RdCVF is a truncated thioredoxin-fold protein of its longer counterpart, RdCVFL, which includes a C-terminal extension conferring enzymatic thiol- oxidoreductase activity [16]. RdCVFL, which contains all the amino acids of RdCVF, is encoded by exons 1 and 2 of the Nxnll gene and is a member of the thioredoxin family [17], Thioredoxins have diverse functions, including maintaining the proper reducing environment in cells and participating in apoptotic pathways. These functions are accomplished via thioloxidoreductase reactions mediated by a conserved CXXC catalytic site within a thioredoxin fold [18].

[26] Byrne et al. [19] have shown that the two isoforms of encoding by Nxnll have complementary functions. Systemic administration of an adeno-associated virus (AAV) encoding RdCVF improved cone function and delayed cone loss, while RdCVFL increased rhodopsin mRNA and reduced oxidative stress. RdCVFL prevents photo-oxidative damage to the rods [21 ],

[27] International patent application WO 2016/185037 describes AAV vectors encoding both the short isoform RdCVF and the long isoform RdCVFL and the use of said vectors for treating retinal neurodegenerative pathologies such as retinitis pigmentosa.

[28] A beneficial effect between RdCVF and RdCVFL has been demonstrated [20]. On the one hand, RdCVF is produced and secreted by the retinal pigmented epithelium (RPE), protecting the cones by stimulating aerobic glycolysis through the RdCVF receptor at the cell surface of the cones by a non-cell autonomous mechanism [22], On the other hand, RdCVFL, protects the cones against oxidative damage in a cell autonomous manner, due to its thioloxidoreductase function.

[29] In a previous study, it has been shown that light-activation of animal cone opsins can stimulate the Gj/₀ signalling pathways in human kidney cells and in neuronal cells in vitro and in vivo [35]. This pathway is involved in fast dampening of neuronal activity and inhibition of intrinsic ion channels. However, it has also been shown that animal cone opsins can directly modulate the G protein-gated inwardly rectifying potassium channels (GIRK) upon co-expression in any given cell [34, 35]. GIRK channels are composed of two subunits. There are four types of subunits: GIRK1 to 4. GIRK1 , 4 and 3 cannot form homotetramers; they have to be associated with another subunit to be functional [36]. Conversely, GIRK2 alone can form homotetramers. A single point mutant GIRK1 at position F137 was suggested to form functional homomeric channels [37], GIRK channel is predominantly closed at resting membrane potentials. After its activation by the By subunit of a Gi/₀ protein, potassium ions flow out of the cell, thus, hyperpolarizing the neuron (Figure 1 B).

[30] Recently, it has been shown that the expression of G protein coupled inwardly rectifying potassium channel 2 (GIRK2) can delay vision loss, by preserving cone light-sensitivity in rd10 and RhoP347S mice and enhance visual acuity [23] (International application W02021/204407A1 ). Dormant cones, which are cones that have diminished outer segments and thus that became dysfunctional, could be rendered functional again thanks to the expression of GIRK2.

Summary of the invention

[31] The present invention relates to the combination of:

- a nucleic acid encoding a short isoform of rod-derived cone viability factor (RdCVF),

- a nucleic acid encoding a long isoform of rod-derived cone viability factor (RdCVFL) and

- a nucleic acid encoding a mutated form of the subunit 1 of G-protein-gated inwardly rectifying potassium channel (GIRK1 ) (GIRK1 F137S) or a mutated form of the subunit 4 of G-protein-gated inwardly rectifying potassium channel (GIRK4) (GIRK4 S143T).

[32] Indeed, the inventors have found that a mutated form of GIRK1 channel, GIRK1 F137S (Examples 3 and 4), and a mutated form of GIRK4 channel, GIRK4 S143T (Example 5), induce significantly more ion efflux than GIRK2 in the context of a short GIRK/opsin phototransduction cascade. These results suggest that incorporation of GIRK1 F137S or GIRK4 S143T in cones will provide for an improved gene therapy over GIRK2 gene therapy of RCD.

[33] The nucleic acid encoding RdCVF, the nucleic acid encoding RdCVFL, and the nucleic acid encoding GIRK1 F137S or GIRK4 S143T, may be expressed through one, two or three viral vectors. Said vectors may be within a single pharmaceutical composition or within several different pharmaceutical compositions (two or three).

[34] According to a first aspect, the present invention relates to a pharmaceutical composition comprising one or several viral vectors, wherein said one or several viral vectors comprise a nucleic acid encoding RdCVF, a nucleic acid encoding RdCVFL, and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[35] In particular, the pharmaceutical composition comprises a single viral vector.

[36] A second aspect of the invention deals with a viral vector comprising three nucleic acids respectively encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T.

[37] A third aspect of the invention relates to a kit comprising two or three pharmaceutical compositions.

[38] The invention also relates to a pharmaceutical composition, a viral vector or a kit above mentioned, for the treatment of a retinal degenerative disease. [39] The combination of RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T described in the present application, allows to both preserve cone cells along with keeping them light responsive. This overcomes the light sensitivity loss that occurs when only trophic factors such as RdCVF and RdCVFL, are used, by implementing an additional approach to increase light sensitivity.

Detailed description of the invention

[40] The present invention relates to a single or several viral vectors comprising a nucleic acid encoding a short isoform of rod-derived cone viability factor (RdCVF), a nucleic acid encoding a long isoform of rod-derived cone viability factor (RdCVFL), and a nucleic acid encoding a mutated form of the subunit 1 of G-protein-gated inwardly rectifying potassium channel (GIRK1 ) (GIRK1 F137S) or a mutated form of the subunit 4 of G-protein-gated inwardly rectifying potassium channel (GIRK4) (GIRK4 S143T), and the use thereof. When several, the viral vectors may be in a single or in separate pharmaceutical compositions such as distributed among two or three pharmaceutical compositions.

[41] In one aspect, the present invention relates to a pharmaceutical composition comprising one or several viral vectors, said one or several viral vectors comprising:

[42] By “one or several viral vectors”, it means that said nucleic acid encoding RdCVF, said nucleic acid encoding RdCVFL, and said nucleic acid encoding GIRK1 F137S or GIRK4 S143T, may be comprised in a single vector or in separate vectors such as 2 or 3 vectors.

[43] In a particular embodiment, the pharmaceutical composition comprises three viral vectors respectively comprising a nucleic acid encoding RdCVF, a nucleic acid encoding RdCVFL, and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[44] In a particular embodiment, the pharmaceutical composition comprises two viral vectors wherein the first viral vector comprises a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and the second viral vector comprises a nucleic acid encoding GIRK1 F137S or GIRK4 S143T. [45] In a particular embodiment, the pharmaceutical composition comprises two viral vectors wherein the first viral vector comprises a nucleic acid encoding RdCVF and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, and the second viral vector comprises a nucleic acid encoding RdCVFL.

[46] In a particular embodiment, the pharmaceutical composition comprises two viral vectors wherein the first viral vector comprises a nucleic acid encoding GIRK1 F137S or GIRK4 S143T and a nucleic acid encoding RdCVFL, and the second viral vector comprises a nucleic acid encoding RdCVF.

[47] In a particular embodiment, the pharmaceutical composition comprises a single viral vector, said single viral vector comprising three nucleic acids respectively encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T.

[48] In another aspect, the present invention relates to a kit comprising two or three pharmaceutical compositions.

[49] When the kit comprises two pharmaceutical compositions, each pharmaceutical composition comprises respectively one viral vector as follows:

- a viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T;

- a viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, and a viral vector comprising a nucleic acid encoding RdCVFL; or

- a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, and a nucleic acid encoding RdCVFL, and a viral vector comprising a nucleic acid encoding RdCVF.

[50] Thus, in a particular embodiment, the invention relates to a kit comprising two pharmaceutical compositions, wherein:

- the first pharmaceutical composition comprises a viral vector which comprises a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and

- the second pharmaceutical composition comprises a viral vector which comprises a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[51] In a particular embodiment, the invention also relates to a kit comprising two pharmaceutical compositions, wherein: - the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVF, and a viral vector comprising a nucleic acid encoding RdCVFL, and

[52] In a particular embodiment, the invention also relates to a kit comprising two pharmaceutical compositions, wherein:

- the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding RdCVF, and a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, and

- the second pharmaceutical composition comprises a viral vector which comprises a nucleic acid encoding RdCVFL.

[53] In a particular embodiment, the invention also relates to a kit comprising two pharmaceutical compositions, wherein:

- the first pharmaceutical composition comprises a viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, and a viral vector comprising a nucleic acid encoding RdCVFL, and

- the second pharmaceutical composition comprises a viral vector which comprises a nucleic acid encoding RdCVF.

[54] When the kit comprises three pharmaceutical compositions, each pharmaceutical composition comprises a single viral vector respectively comprising a nucleic acid encoding RdCVF, a nucleic acid encoding RdCVFL, and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[55] Thus, in a particular embodiment, the invention relates to kit comprising three pharmaceutical compositions, wherein:

- the first pharmaceutical composition comprises a viral vector, said viral vector comprising a nucleic acid encoding RdCVF,

- the second pharmaceutical composition comprises a viral vector, said viral vector comprising a nucleic acid encoding RdCVFL, and

- the third pharmaceutical composition comprises a viral vector, said viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T. [56] The pharmaceutical composition according to the present disclosure may further comprise an excipient pharmaceutically acceptable.

[57] According to the present disclosure, “pharmaceutically acceptable” means that said excipient is generally safe and well tolerated for human or animal use following ocular administration, and should not interfere with the efficacy of the active ingredient (i.e. a viral vector as described in the present disclosure). As example, excipients pharmaceutically acceptable may be isotonic, sterile, saline solutions such as monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts. These solutions may further comprise nonionic surfactants such as, e.g., Tween, Pluronic. In a particular embodiment, an excipient pharmaceutically acceptable is a phosphate-buffered saline (PBS) solution or a balanced-salt solution (BSS), even more particularly supplemented with 0.001 % Pluronic.

[58] In another aspect, the present invention relates to a viral vector comprising three nucleic acids respectively encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T.

[59] As used herein, the term Rod-derived Cone Viability Factor (RdCVF) refers to the short isoform encoded by the thioredoxin-like 6 (TXNL6) or Nucleoredoxin-like 1 (NXNL1 ) gene. It encompasses the RdCVF proteins of any animal species. Typically, the RdCVF proteins according to the present invention can be mammalian RdCVF proteins, including, but not limited to human, mice, rats, non-human primates, cats and dogs.

[60] Typically, in mice, the short isoform (RdCVF) is a 109 amino-acid long protein references under Uniprot accession number Q91 W38.

[61] In the present application, the short isoform RdCVF is in particular the human short isoform (hRdCVF) as set forth in SEQ ID NO:1 .

[62] In particular, said short isoform hRdCVF may be encoded by the nucleic acid as set forth in SEQ ID NO:3.

[63] Alternatively, the nucleic acid encoding the short isoform hRdCVF can be a nucleic acid which differs from SEQ ID NO: 3 but encodes the same amino acid sequence SEQ ID NO:1.

[64] Suitable nucleic acid sequences include but are not limited to: polymorphisms of the cDNA encoding human RdCVF;

- combinations of polymorphisms (rare haplotypes) of the cDNA encoding human RdCVF. An example of rare haplotype cDNA is set forth as SEQ ID NO: 6; - “optimized” sequences in which certain codons are replaced by codons that code for the same amino-acid. Suitable codon-optimized sequences encoding human RdCVF include, but are not limited to, the sequence as set forth in SEQ ID NO: 7;

- homologous sequences. For example, it has been found that the chimpanzee cDNA sequence encoding the short isoform of chimpanzee RdCVF can be used, since it encodes the same amino acid sequence as the human cDNA. The chimpanzee cDNA has the sequence as set forth in SEQ ID NO: 4.

[65] In particular, the short isoform hRdCVF is encoded by a nucleic acid corresponding to a codon-optimized cDNA as set forth in SEQ ID NO:7.

[66] As used herein, the term “RdCVFL” refers to the long isoform encoded by the thioredoxin-like 6 (TXNL6) or Nucleoredoxin-like 1 (NXNL1 ) gene. It encompasses the RdCVFL proteins of any animal species. Typically, the RdCVFL proteins according to the present invention can be mammalian RdCVFL proteins, including, but not limited to human, mice, rats, non-human primates, cats and dogs.

[67] Typically, in mice, the murine long isoform (RdCVFL) is a 217 amino-acid long protein referenced under Q8VC33.

[68] In the present application, the long isoform RdCVFL is in particular the human long isoform (hRdCVFL) having the sequence referenced under accession number Q96CM4 and as set forth in SEQ ID NO:2.

[69] In particular, said short isoform hRdCVFL may be encoded by the nucleic acid as set forth in SEQ ID NO:5.

[70] Alternatively, the nucleic acid encoding the long isoform hRdCVFL can be a nucleic acid which differs from SEQ ID NO:5 but encodes the same amino acid sequence SEQ ID NO:2.

[71] Suitable nucleic acid sequences include but are not limited to:

- polymorphisms of the cDNA encoding human RdCVFL or combinations thereof;

- “optimized” sequences in which certain codons are replaced by codons that code for the same amino-acid. Suitable codon-optimized sequences encoding human RdCVFL include, but are not limited to, the sequence as set forth in SEQ ID NO:8;

- homologous sequences in other species.

[72] In particular, said short isoform hRdCVFL is encoded by a nucleic acid corresponding to a codon-optimized cDNA as set forth in SEQ ID NO:8. [73] For the purposes of the present invention, “GIRK1 F137S” means a nucleotide sequence encoding a mutated form of the wild-type subunit 1 of G-protein-gated inwardly rectifying potassium channel (GIRK1 ) comprising a substitution of Phe137 by Ser and which retain the ability to respond to light when co-expressed with an opsin. In particular, it is a mutated form of the human wild type GIRK1 (SEQ ID NO: 9) or a mutated form of the mouse wild type GIRK1 (SEQ ID NO: 12).

[74] The GIRK1 F137S may differ from wild-type GIRK1 by the substitution of Phe137 by Ser, only (e.g. as in SEQ ID NO: 11 ), or by a limited number of mutation(s), e.g. substitution and/or deletion and/or insertion of at most 1 , 2, 3, 4, or 5 of an amino acid(s), in addition to the substitution of Phe137 by Ser.

[75] For example, a nucleotide sequence encoding GIRK1 F137S comprises or consists of a nucleotide sequence encoding the polypeptide of sequence SEQ ID NO:11 , or comprises or consists of the nucleotide sequence SEQ ID NO: 10, or comprises or consists of a nucleotide sequence encoding the polypeptide of sequence SEQ ID NO: 13.

[76] For the purposes of the present invention, “GIRK4 S143T” means a nucleotide sequence encoding a mutated form of the wild-type subunit 4 of G-protein-gated inwardly rectifying potassium channel (GIRK4) comprising a substitution of Ser143 by Thr and which retain the ability to respond to light when co-expressed with an opsin. In particular, it is a mutated form of the human wild type GIRK4 (SEQ ID NO: 38).

[77] The GIRK4 S143T may differ from wild-type GIRK4 by the substitution of Ser143 by Thr, only (e.g. as in SEQ ID NO: 38), or by a limited number of mutation(s), e.g. substitution and/or deletion and/or insertion of at most 1 , 2, 3, 4, or 5 of an amino acid(s), in addition to the substitution of Ser143 by Thr.

[78] For example, a nucleotide sequence encoding GIRK4 S143T comprises or consists of a nucleotide sequence encoding the polypeptide of sequence SEQ ID NQ:40 or comprises or consists of the nucleotide sequence SEQ ID NO: 39.

[79] Examples of cDNA sequences of the transgenes RdCVF, RdCVFL, GIRK1 F137S or GIRK4 S143T and amino acids sequences are provided at Tables 1 to 4 below. [80] Table 1 : cDNA sequences of RdCVF transgenes and encoded amino acid sequences

Table 2: cDNA sequences of RdCVF transgenes and encoded amino acid sequences

Table 3: cDNA sequences of GIRK1 transgenes and encoded amino acid sequences

Table 4: cDNA sequences of GIRK4 transgenes and encoded amino acid sequences

[81] Typically, the nucleic acids encoding respectively RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T are under the control of a promoter that allows the expression of said proteins in the target cells.

[82] Suitable promoters can be ubiquitous promoters, such as the Chicken beta actin (CBA) promoter, the chicken beta hybrid (CBh) promoter, the cytomegalovirus (CMV) promoter, the CMV/CBA promoter, CAG promoter. [83] In particular, the CBh promoter is as set forth in SEQ ID NO: 14. [84] Suitable promoters can be promoters that enable the expression in the retina, preferably in retinal pigmented epithelial cells and photoreceptor cells such as cones and rods.

[85] In one embodiment, the promoter allows nucleic acids expression in retinal pigmented epithelial cells and/or photoreceptor cells. Non-limiting examples are the rhodopsin kinase

(GRK) promoters which target the expression in cones and rods, such as GRK1 promoter, GRK1-93 promoter, IRBP promoter and mCAR promoter.

[86] In particular, the GRK1 promoter is as set forth in SEQ ID NO: 15.

[87] In particular, the GRK1 -93 promoter is as set forth in SEQ ID NO: 16. [88] In one embodiment, the promoter allows nucleic acids expression in cone photoreceptors. Non-limiting examples are the cone-opsin PR1 .7 promoter and the ProA7 promoter. In one embodiment, the promoter allows nucleic acids expression in cone photoreceptors. Non-limiting examples are cone-opsin PR1 .7 promoter or ProA7 promoter.

[89] In particular, the PR1.7 promoter is as set forth in SEQ ID NO: 17. [90] In particular, the ProA7 promoter is as set forth in SEQ ID NO: 18.

[91] Table 5 provides particular nucleic acids sequences of the promoters.

[92] Table 5: Promoters sequences

[93] Typically, the short isoform of the NXNL1 gene is expressed at least by retinal pigmented epithelial cells, and the long isoform of the NXNL1 gene, and GIRK1 F137S or GIRK4 S143T are expressed at least by cone photoreceptor cells.

[94] Typically, the expression of the nucleic acid encoding RdCVF is driven by a CBh promoter, in particular as set forth in SEQ ID NO:14. [95] Typically, the expression of the nucleic acid encoding RdCVFL is driven by the ProA7 promoter as set forth in SEQ ID NO:18 or the GRK1 promoter as set forth in SEQ ID NO:15.

[96] Typically, the expression of the nucleic acid encoding and GIRK1 F137S or GIRK4 S143T is driven by the GRK1 -93 promoter as set forth in SEQ ID NO:16.

[97] In a particular embodiment, when a viral vector above described comprises two or three nucleic acids encoding RdCVF, RdCVFL and/or GIRK1 F137S or GIRK4 S143T, each nucleic acid is under the control of a different promoter.

[98] Typically, when the viral vector comprises three nucleic acids respectively encoding RdCVF, RdCVFL, and GIRK1 F137S or GIRK4 S143T, the nucleic acid encoding RdCVF is under the control of a CBh promoter, the nucleic acid encoding RdCVFL is under the control of a ProA7 promotor or a GRK1 promoter, and the nucleic acid encoding GIRK1 F137S or GIRK4 S143T is under the control of a GRK1 -93 promoter.

[99] In a particular embodiment, when a viral vector above described comprises two or three nucleic acids encoding RdCVF, RdCVFL, and/or GIRK1 F137S or GIRK4 S143T, at least two nucleic acids may be under the control of a same promoter and linked by a nucleic acid sequence encoding a 2A self-cleaving peptide.

[100] 2A self-cleaving peptides, or 2A peptides, is a class of 18-22 amino acids- long peptides, which can induce ribosomal skipping during translation of a protein in a cell. These peptides share a core sequence motif of DxExNPGP (SEQ ID NO:19).

[101] As examples of 2A self-cleaving peptide P2A (SEQ ID NQ:20), T2A (SEQ ID NO:21 ), E2A (SEQ ID NO:22) and F2A (SEQ ID NO:23) may be cited. Sequences are provided at Table 6.

[102] Table 6: 2A self-cleaving peptides

[103] In particular, the 2A self-cleaving peptide is the P2A peptide as set forth in SEQ ID NO: 20. In a particular embodiment, this P2A peptide is encoded by the nucleic acid sequence as set forth in SEQ ID NO:24. [104] In a particular embodiment, the viral vector above described comprises three nucleic acids respectively encoding RdCVF, RdCVFL, and GIRKI F137S or GIRK4 S143T, wherein the nucleic acid encoding RdCVF is under control of a promoter, in particular a CBh promoter, the nucleic acid encoding RdCVFL is under control of a promoter, in particular a GRK1 promoter, and it is linked to the nucleic acid encoding GIRK1 F137S or GIRK4 S143T by a nucleic acid sequence encoding a 2A self-cleaving peptide, in particular the P2A peptide.

[105] In a particular embodiment, the viral vector above described comprises three nucleic acids respectively encoding RdCVF, RdCVFL, and GIRKI F137S or GIRK4 S143T, wherein the nucleic acid encoding RdCVF is under control of a promoter, in particular a CBh promoter, and it is linked to the nucleic acid encoding RdCVFL by a nucleic acid sequence encoding a 2A self-cleaving peptide, this latter being linked to the nucleic acid encoding GIRK1 F137S or GIRK4 S143T by a nucleic acid sequence encoding a 2A self-cleaving peptide, in particular the P2A peptide.

[106] In a particular embodiment, the viral vector above described comprises three nucleic acids respectively encoding RdCVF, RdCVFL, and GIRKI F137S or GIRK4 S143T, wherein the nucleic acid encoding RdCVF is under control of a promoter, in particular a CBh promoter, and it is linked to the nucleic acid encoding GIRK1 F137S or GIRK4 S143T by a nucleic acid sequence encoding a 2A self-cleaving peptide, in particular the P2A peptide, this latter being linked to the nucleic acid encoding RdCVFL by a nucleic acid sequence encoding a 2A self-cleaving peptide, in particular the P2A peptide.

[107] As in all AAV vectors, the viral vector according to the invention comprises an ITR sequence in 5’ and an ITR sequence in 3’.

[108] In a particular embodiment wherein the viral vector comprises two or three nucleic acids encoding RdCVF, RdCVFL, and/or GIRK1 F137S or GIRK4 S143T and wherein at least two nucleic acids are linked by a nucleic acid sequence encoding a 2A self-cleaving peptide, the nucleic acids are in any order following the 5’ITR. More particularly, the first nucleic acid following the 5’ITR is the nucleic acid encoding RdCVF.

[109] In a particular embodiment wherein the viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and/or GIRK1 F137S or GIRK4 S143T and wherein the nucleic acids are all linked by a nucleic acid sequence encoding a 2A self-cleaving peptide, the first nucleic acid following the 5’ITR is the nucleic acid encoding RdCVF and the second is the nucleic acid encoding RdCVFL.

[110] In a particular embodiment wherein the viral vector comprises three nucleic acids encoding RdCVF, RdCVFL, and/or GIRK1 F137S or GIRK4 S143T and wherein the nucleic acids are all linked by a nucleic acid sequence encoding a 2A self-cleaving peptide, the first nucleic acid following the 5’ITR is the nucleic acid encoding RdCVF and the second is the nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

[111] In a particular embodiment, the viral vector described in the present disclosure further comprises a posttranscriptional regulatory element (PRE). This is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. This type of sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors.

[112] In a more particular embodiment, it is a Woodchuck Hepatitis Virus PRE (WPRE), more particularly as set forth in SEQ ID NO:25.

SEQ ID NO:25 cgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgc ctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggc aacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttc cccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggt gttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccct caatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctcccttt gggccgcctccccgcatcgg

[113] As used herein, the term “viral vector” has its general meaning in the art. In particular, it encompasses a vector derived from an adeno-associated virus (AAV), a herpesvirus (e.g., herpes simplex virus (HSV)), an adenovirus, a retrovirus, a lentivirus, or a vaccinia/poxvirus.

[114] In the present disclosure, the expression “adeno-associated virus vector” or “AAV vector” has its general meaning in the art.

[115] AAV and AAV vectors have been extensively described in the art as suitable vectors for gene delivery.

[116] Indeed, AAV are non-pathogenic and display a broad range of tissue specificity, depending on their serotype. Typically, AAV according to the present invention are AAV able to target retinal cells. More particularly, AAV according to the present invention are AAV which efficiently transduce retinal cells through intravitreal injection.

[117] For example, it may be an AAV2 or modified versions thereof which efficiently transduce retinal cells through intravitreal injection. A modified version may be for example an AAV comprising an insertion peptide in the capsid protein such as AAV2-7M8 capsid variant as described in the international patent application WO 2012/145601 and in Dalkara et al. (2013) [38] which is an AAV2 comprising an insertion peptide called 7m8 in the capsid protein. Other modified versions may be NHP26 [39], NHP9, R100 [40], or other similar variants engineered through directed evolution, rational design and / or machine learning approaches that are commonly known in the art.

[118] Said AAV may also be AAV serotypes or variants which efficiently transduce retinal cells through subretinal injection such as AAV8 (also referred to as AAV2/8), AAV5 or AAV9- 7M8 capsid variant as described in the international patent application WO 2012/145601 , which is an AAV9 comprising an insertion peptide called 7m8 in the capsid protein.

[119] The above cited AAVs, AAV2, AAV5, AAV8, AAV9, may be modified by an insertion peptide in the capsid protein. Indeed, they may comprise a variant VP1 capsid protein, wherein the variant AAV capsid protein comprises an insertion peptide of from 7 amino acids to 1 1 amino acids in the GH loop of said capsid protein relative to a corresponding parental AAV capsid protein.

[120] Said insertion peptide may be as set forth in SEQ ID NO:26 (nicknamed 7m8), SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NQ:30, SEQ ID NO:31 , SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34 as described in WQ2019/077159 and at Table 7 below.

[121] The insertion peptide may also be as set forth in SEQ ID NO:35 [33] or SEQ ID NO:41.

[122] Table 7: Insertion peptide sequences

[123] The insertion peptide may also be as set forth in SEQ ID NO:36 (LAISDQTKHA). Thus, AAV serotypes as above mentioned may comprise an insertion peptide as set forth in SEQ ID NO:36. [124] Further examples of AAV are thus AAV serotypes as above mentioned , i. e. AAV2, AAV5, AAV8 or AAV9, comprising such an insertion peptide as above mentioned.

[125] In a particular embodiment, the above cited AAVs may comprise a variant AAV capsid protein as set forth in SEQ ID NO:37.

[126] In a particular embodiment, the above cited AAVs may comprise a variant AAV capsid protein as described in SEQ ID NO:42 of WO2019104279A1.

[127] In one embodiment, the AAV and the AAV vector according to the present invention is obtained according to the method described in international patent application WO2012/158757.

[128] In a particular embodiment, the AAV capsid is obtained according to the method described in patent application US9193956B2.

[129] In another aspect, the present invention deals with a pharmaceutical composition above described, a kit above described, or a viral vector above described for use in the treatment of a retinal degenerative disease.

[130] In the context of the invention, the term "treating" or "treatment", as used herein, means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition (e.g., retinal degenerative diseases).

[131] In the present application, the term “retinal degenerative disease” encompasses all diseases associated with rods and cones degeneration. It encompasses different subgroups of pathologies: Rod-cone dystrophies, Cone dystrophies, Cone-rod dystrophies, and atrophic age-related macular degeneration.

[132] Thus, in a particular embodiment, the present invention relates to a pharmaceutical composition above described, a kit above described, or a viral vector above described for treatment of a retinal degenerative disease, wherein said retinal degenerative disease is a rod-cone dystrophy (RCD), a cone dystrophy (CD), a cone-rod dystrophy (CRD) or an atrophic age-related macular degeneration (AMD).

[133] Retinal degenerative diseases include but are not limited to retinitis pigmentosa, age- related macular degeneration, Bardet-Biedel syndrome, Bassen-Kornzweig syndrome, Best disease, choroideremia, gyrate atrophy, Leber congenital amaurosis, Refsum disease, Stargardt disease or Usher syndrome. [134] In a particular embodiment, the retinal degenerative disease is a rod-cone dystrophy, more particularly retinitis pigmentosa, in particular non-syndromic X-linked Retinitis Pigmentosa (XLRP), autosomal recessive RP or autosomal dominant RP.

[135] In a particular embodiment, the retinal degenerative disease is a cone-rod dystrophy, more particularly Stargardt disease, X Linked cone dystrophy, and Bardet-Biedl syndrome.

[136] In a particular embodiment, the pharmaceutical composition, the kit or the viral vector is administered to a patient in need by subretinal injection, intravitreal and suprachoroidal injection. The delivery of the vector may be submacular or subfoveal or a distal bleb from the fovea without detaching said region.

[137] When the kit is administered to the patient for the treatment of a retinal degenerative disease, the pharmaceutical compositions of the kit may be administered simultaneously or separately over time.

[138] “Simultaneously” means that the compositions of the kit are administered at the same time, or one after the other within a time limit of one hour, more preferably within the time limit of fifteen minutes.

[139] “Separately over time” may mean that the time between the administration of two compositions is administered at two time points, in which the time between the two time points is greater than one day. In one embodiment, this may be within a timespan of one to six months. In another embodiment, this may be between a timespan of six months to one year. In a further embodiment, this may be within a timespan of one year to ten years.

[140] “Separately over time” may mean that each composition is administered at a different stage of the disease. In a preferred embodiment, the nucleic acid encoding RdCVF and RdCVFL is administered at an earlier stage of disease progression than the nucleic acid encoding GIRK1 F137S or GIRK4 S143T. In a further embodiment, the nucleic acid encoding RdCVF and RdCVFL is administered at a point of disease progression with moderate to severe loss of rod cells while the nucleic acid encoding GIRK1 F137S or GIRK4 S143T is administered at a point of further disease progression wherein the outer segment of cone cells exhibits moderate to serve degeneration.

[141] The stoichiometry between the pharmaceutical compositions of the kit may vary to obtain optimal protection and functional restoration.

[142] In particular, the composition(s) of the kit comprising a nucleic acid encoding RdCVF and RdCVFL are administered at a point of disease progression with moderate to severe loss of rod cells and the composition(s) of the kit comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T are administered at a point of further disease progression wherein the outer segment of cone cells exhibit moderate to serve degeneration.

[143] In particular, when the kit comprises two pharmaceutical compositions, wherein:

- the second pharmaceutical composition comprises a viral vector which comprises a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, or when the kit comprises three pharmaceutical compositions, wherein:

- the third pharmaceutical composition comprises a viral vector, said viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T, the composition(s) of the kit comprising vector(s) which comprise a nucleic acid encoding RdCVF and/or RdCVFL are administered at a point of disease progression with moderate to severe loss of rod cells, and the composition of the kit comprising a vector which comprises a nucleic acid encoding GIRK1 F137S or GIRK4 S143T is administered at a point of further disease progression wherein the outer segment of cone cells exhibits moderate to serve degeneration. The composition(s) of the kit comprising vector(s) which comprise a nucleic acid encoding RdCVF and/or RdCVFL is therefore administered at an earlier stage of disease progression than the composition of the kit comprising a vector which comprises a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

Depending on the development of the disease, the time between the administration of the composition(s) of the kit comprising vector(s) which comprise a nucleic acid encoding RdCVF and/or RdCVFL and the administration of the composition(s) of the kit comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T is one day, one to six months, six months to one year or one year to ten years.

[144] The present invention also relates to a method for the treatment of a retinal degenerative disease comprising a step of administering to a patient in need of a therapeutically effective amount of a pharmaceutical composition above described, of a viral vector above described, or of pharmaceutical compositions comprised in kits above described. [145] The term "therapeutically effective amount" as used herein means an amount sufficient to achieve a desired biological effect, in this case increasing the neuron viability, and thus to reduce symptoms or progression of the disease in a patient in need. It is understood that the effective dosage will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. However, the preferred dosage can be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation.

[146] The present invention also relates to the use of a pharmaceutical composition above described, a kit above described, or a viral vector above described, in the treatment of a retinal degenerative disease.

Brief Description of Drawings

Fig. 1

[147] [Fig. 1 ] represents phototransduction cascade (A) normal phototransduction cascade (B) short phototransduction cascade with an animal opsin and GIRK2 channel. PDE: phosphodiesterase. CNG: cyclic-nucleotic gated channels. cGMP: cyclic guanosine monophosphate.

Fig. 2

[148] [Fig. 2] represents plasmids (A) CMV-GIRK2-GFP and (B) CMV-SWO-mCherry

Fig. 3

[149] [Fig. 3] represents what remained in the phototransduction cascade in rd10 mice using immunohistochemistry (A-D) retinal cross-section of a control WT mouse stained with (A) opsin, (B) transducin, (C) PDE and (D) cone arrestin. (E-H) retinal cross-section of a rd10 mouse at P14 stained with (E) opsin, (F) transducin, (G) PDE and (H) cone arrestin. (I-L) Retinal cross-section of a rd10 mouse at P150 stained with (I) opsin, (J) transducin, (K) PDE and (L) cone arrestin. ONL: outer nuclear layer. INL: inner nuclear layer. GC: ganglion cells. Scale bar is 50pm. Inset scale bar is 25pm.

Fig. 4 1

[150] [Fig. 4] represents preliminary data. (A) Eye fundus of GIRK2-GFP expression in rd 10 mouse one week post-injection (*site of injection) (B) Photopic ERG amplitude in rd 10 mice at P33, injected with AAV-SWO-tdTomato and AAV-GIRK2-GFP. Control mice are injected with AAV-GFP (n=12). P=0,0002. (C) Representative flickers ERG at P33. (D) Measure of the visual acuity by optokinetic test in rd10 mice, injected with AAV-SWO-tdTomato and AAV-GIRK2-GFP. Control mice are injected with AAV-GFP. Control mice were injected with AAV-GFP (n=8).

Fig. 5

[151] [Fig. 5] represents GIRK2-mediated vision. (A) Photopic ERG amplitude in rd10 mice at P41 , injected with AAV-SWO-tdTomato and/or AAV-GIRK2-GFP. Control mice are injected with AAV-GFP (n=12). PSWO+GIRK2 = 0,0381 and PGIRK2=0,0021 . (B) Measure of the visual acuity by optokinetic test in rd10 mice, injected with AAV-SWO-tdTomato and/or AAV-GIRK2-GFP. Control mice are injected with AAV-GFP. Control mice were injected with AAV-GFP (n=7). (C) Representative flickers ERG at P41.

Fig. 6

[152] [Fig. 6] represents long term efficiency. (A) Photopic ERG amplitude in rd10 mice, injected with AAV-GIRK2-GFP. Control mice are injected with PBS (n=6). (B) Measure of the visual acuity by optokinetic test in rd10 mice, injected with AAV-GIRK2-GFP. Control mice are injected with PBS (n=6). (C) Number of cones of wild-type mice and non-injected rd10 mice over time (n=6). Pvalue (P50-P365) = 0.0022. (D) Linear regression correlation between the ERG amplitudes and the number of cones in rd10 mice (n=6). Pvalue noninjected = 0,0482. Pvalue AAV-GIRK2-GFP = 0,0007. Pvalue PBS = 0,0104.

Fig. 7

[153] [Fig. 7] represents what remained in the phototransduction cascade in huP347S+/- mice using immunohistochemistry. (A-D) Retinal cross-section of a control WT mouse stained with (A) opsin, (B) transducin, (C) PDE and (D) cone arrestin. (E-H) retinal crosssection of a huP347S+/- mouse at P14 stained with (E) opsin, (F) transducin, (G) PDE and (H) cone arrestin. (I-L) retinal cross-section of a huP347S+/- mouse at P150 stained with (I) opsin, (J) transducin, (K) PDE and (L) cone arrestin. ONL: outer nuclear layer. INL: inner nuclear layer. GC: ganglion cells. Scale bar is 50pm. Inset scale bar is 25pm.

Fig. 8 [154] [Fig. 8] represents universality of the approach. (A) Photopic ERG amplitude in huP347S+/- mice, injected with AAV-GIRK2-GFP. Control mice are injected with PBS (n=6). (B) Measure of the visual acuity by optokinetic test in huP347S+/- mice, injected with AAV- GIRK2-GFP. Control mice are injected with PBS (n=6). (C) Number of cones of wild-type mice and non-injected huP347S+/- mice over time (n=6). Pvalue (P50-P365) = 0,0022. (D) Linear regression correlation between the ERG amplitudes and the number of cones in huP347S+/- mice (n=5). Pvalue non-injected = 0,0313. Pvalue AAV-GIRK2-GFP = 0,0146. Pvalue PBS = 0,0497.

Fig. 9

[155] [Fig. 9] represents the efficiency of the mouse GIRK2 in HEK cells transfected with two plasmids: CMV-SWO-mCherry and CMV-GIRK2-GFP.

Fig. 10

[156] [Fig. 10] represents cone opsin and arrestin expression in normal and RCD human retinal tissue. (A) retinal cross-section of a 91 -year-old individual with no visual impairment (40x). 5B-E) Retinal cross-sections of human RCD maculae from 4 different donors (40x).

Fig. 11

[157] [Fig. 1 1] shows characterization of GIRK1 F137S currents elicited by activation of mOpn4L in HEK293 cells. A) When activated with blue light (471 nm, exposure from 10 to 20 s on the axis of abscissae) mOpn4L induces a strong GIRK1 F137S-mediated current that concludes upon stimulation with lime light (560 nm, exposure from 20 to 60 s on the axis of abscissae) and results in a statistically significant difference in B) the flux of ions through HEK293 membranes and C) the electrical current density per capacitance.

Fig. 12

[158] [Fig. 1 ] shows characterization of GIRK1 or GIRK2 currents elicited by activation of mOpn4L in HEK293 cells when activated with blue light (471 nm, exposure from 10 to 20 s on the axis of abscissae) and terminated upon stimulation with lime light (560 nm, exposure from 20 to 60 s on the axis of abscissae).

Fig. 13

[159] [Fig. 13] shows the current density per capacitance of HEK293 cells expressing A1) hGIRKI F137S, B1) hGIRK2 or C1) truncated rGIRK2. The current response, elicited by the activation of mOpn4, is shown in comparison to constructs with c-terminal eGFP fusion and untransfected cells. The current density of individual cells is illustrated by individual data points. Significant differences between conditions are marked with * (Kruskal-Wallis One Way Analysis of Variance on Ranks with all pairwise multiple comparison procedures (Dunn's Method) P<0.05). D1) Cells expressing hGIRK4 S143T are shown in comparison to untransfected cells. Significant differences between conditions are marked with * (Mann- Whitney Rank Sum Test; P = 0.002). When activated with blue light mOpn4 induces a GIRK- mediated current that concludes upon stimulation with lime light as visible in exemplary traces of A2) hGIRKI F137S, B2) hGIRK2, C2) truncated rGIRK2 and D2) hGIRK4 S143T constructs.

Fig. 14

[160] [Fig. 14] A) Stimulation of HEK293 cells expressing mOpn4 and either hGIRKI F137S, hGIRKI F137S - eGFP, hGIRK4 S143T or hGIRK2 produces a reliably observable current in whole-cell patch clamp recordings, while currents of hGIRK2-eGFP, rGIRK2 or rGIRK2-eGFP after mOpn4 activation are less likely to be observable. Results of “no induced current observable” are provided in the upper part of each graph bar. Results of “Induced current observable” are provided in the lower part of each graph bar. B) Current density per capacitance of HEK293 cells expressing the different GIRK constructs (top) or their eGFP tagged versions (bottom). The current density of individual cells is illustrated by individual data points. Significant differences between conditions are marked with * (Kruskal-Wallis One Way Analysis of Variance on Ranks with all pairwise multiple comparison procedures (Dunn's Method) P<0.05).

Fig. 15

[161] [Fig. 15] represents the visual acuity in rd10 mice after bilateral subretinal injection at P15 of AAV8-pR1 ,7-hGIRK1 F137S at 5E6 or 5E5 vg/eye compared to vehicle-injected rd 10 mice or naive (not injected) rd10 mice.

EXAMPLES

[162] EXAMPLE 1 : MATERIAL AND METHODS

[163] 1. Animals

[164] C57BL/6jrd10/rd10 (rd10) mice were used in these experiments. They have a mutation on the rod PDE gene leading to a dysfunctional phototransduction cascade and a rod-cone dystrophy. The second model used is the huRhoP347S+/- mouse. The homozygous strand of this mouse present a KO of mouse rhodopsin (mRho) gene and a KI of human rhodopsin (huRho) with a mutation (P347S) (Millington-Ward et al., 201 1 ) [30]. The homozygous males were crossed C57BL/6] (wild-type) females to obtain heterozygous mice. These mice have a similar phenotype as the rd10 mice but the degeneration rate is lower.

[165] 2. AAV injections

[166] Mice were first anesthetised with intraperitoneal injections of 0.2 ml/20g ketamine (Ketamine 500, Vibrac France) and xylazine (Xylazine 2%, Rompun) diluted in 0.9% NaCI. Eyes were dilated with 8% Neosynephrine (Neosynephrine Faure 10%, Europhta) and 42% Mydriaticum (Mydriaticum 0.5%, Thea) diluted in 0.9% NaCI.

[167] A total volume of 1 pl of vector solution was injected subretinally. Fradexam, an ophthalmic ointment, was applied after injection. The list of injected viral vectors is presented below:

[168] Table 8 [169] 3. Eye fundus examination

[170] One week after subretinal injection, mice were anesthetised by isofluorane inhalation. Eyes were dilated and then protected with Lubrithal eye gel (VetXX). Fundus imaging was performed with a fundus camera (Micron III; Phoenix research Lab) equipped with specific filters to monitor GFP or tdTomato expression in live anesthetised mice.

[171] 4. Electroretinography (ERG) recordings

[172] To evaluate retinal function, electroretinography recordings (ERG) were recorded (espion E2 ERG system; Diagnosys). Several tests were performed at different time points after injections of the viral vectors. Mice were anesthetised with intraperitoneal injections of 0.2 ml/20g ketamine (Ketamine 500, Vibrac France) and xylazine (Xylasine 2%, Rompun) diluted in 0.9% NaCI. Mice were then placed on a heated pad at 37°C. Eyes were dilated with Neosyhephrine (Neosynephrine Faure 10%, Europhta) and Mydriaticum (Mydriaticum 0.5%, Thea) diluted in 0.9% NaCI. Eyes were protected with Lubrithal eye gel before putting electrodes on the corneal surface of each eye. The reference electrode was inserted under the skin into the forehead and a ground electrode under the skin in the back.

[173] ERG recordings were done under two conditions: (i) photopic condition, which reflects con-driven light responses - 6ms light flashes were applied every second during 60 seconds at increasing light intensities (0.1/1/10/50cd s/m) after an adaptation of 5 minutes at 20cd s/m - and (ii) flicker condition, which are rapid frequency light stimuli that reflect cone function (70 flashes at 10Hz et 1cd s/m).

[174] Graph and statistical analysis were performed using GraphPad.

[175] 5. Optokinetic test

[176] Visual acuity was measured using an optokinetic test scoring the head turning movement of a mouse placed in front of moving bars. Testing was performed using a computer-based machine consisting of four computer monitors arranged in a square to form an optokinetic chamber. A computer program was designated to generate the optokinetic stimuli, consisting of moving alternate black and white stripes. The spatial frequency is ranging from 0.03 to 0.6 cyc/deg. The program enabled modulation of stripe width and direction of bar movement. [177] 6. Immunohistochemistry and confocal imaging

[178] Animals were sacrificed by CO2 inhalation, and the eyes were enucleated and fixed in 4% paraformaldehyde-PBS for 1 h at room temperature. The eyes were dissected either as eyecups for immunohistochemistry or prepared as flat mounts for cell counting. The eyecups were then cryoprotected with a gradient of PBS-Sucrose 10% for 1 h and then in PBS-Sucrose 30% overnight. The eyecups were embedded in OCT and 12 pm thick cryostat sections (ThermoFisher) were cut and mounted on glass slides. The sections were washed in PBS (3x5 mins) and stained against different antibodies (see table below) and DAPI (1 :2000). The sections were finally washed in PBS, mounted in Fluoromount Vactashield (Vector Laboratories) and coverslipped for imaging using laser-confocal microscopy (Olympus 1X81 ). For flat-mount retina stainings, the protocol is the same except that the tissue was not cryoprotected. Images were analysed using FIJI software.

[179] Table 9

[180] 7. Cell counts

[181] Flat mount retinas of rd10 and huRhoP347S+/- mice were stained using antibodies against mouse cone arrestin - mCAR (1 :10000) and DAPI (1 :2000). The double stained cells counted at different ages. Retinas from 5 animals (n=10) were used for each age and were oriented dorso-ventrally and naso-temporally. Serial optical sections were obtained to cover the thickness of the entire outer nuclear layer (ONL). Two scanning areas of 21 1 .97 x 21 1 .97 pm were made in each of the four regions in all retinas. Counts of cone cells were performed manually using the FIJI software by the reconstruction of the images (z stack) covering the entire thickness of the ONL. Average density values of each retina were calculated to obtain the number of cone cells per mm2 at different ages.

[182] 8. In vitro test of the efficiency of mouse GIRK2

[183] HEK cells were transfected with two plasmids: CMV-SWO-mCherry and CMV-GIRK2- GFP (Figure 2) according to a well-known procedure in the art. HEK293 cells were cultured and recorded in dark room conditions after transfection. Cells were placed in the recording chamber of a microscope equipped with a 25x water immersion objective (XLPIanN-25 x - W-MP/NA1 .05, Olympus) at 36 °C in oxygenated (95% 02/5% CO2) Ames medium (Sigma- Aldrich) enriched with an addition of 1 mM9-cis-retinal. KGIuconate was added to the external solution in order to get a high extracellular potassium concentration leading to a cell potassium reversal potential of -40mV.

[184] For Whole-cell recordings, the Axon Multiclamp 700B amplifier (Molecular Device Cellular Neurosciences) was used, GIRK-mediated K-i-currents were recorded in voltageclamp configuration at -80 mV, using borosilicate glass pipettes (BF100-50-10, Sutter Instrument) pulled to 5MQ and filled with 115 mMK Gluconate, 10 mM KCI, 1 mM MgCI2, 0.5 mM CaCI2, 1.5 mM EGTA, 10 mM HEPES, and 4 mM ATP-Na2 (pH 7.2).

[185] During experiments, a CCD camera (Hamamatsu Corp.) was used to visualize cells using a trans-illuminated infrared-light. A monochromatic light source (Polychrome V, TILL photonics) was used to stimulate cells during electrophysiological experiments with light flashes at 400 nm.

[186] 9. Patient eye fundus imaging

[187] Adaptive optics scanning laser ophthalmoscopy (AOSLO) (Roorda et al Opt Exp 2002) was used to image cone photoreceptor mosaic at cell resolution. The AOSLO device used (MAORI, PSI, Andover, MA, USA) allows simultaneous imaging over a 2-degree field of view of intact cones with both inner and outer segments (IS, OS) from light scattered along the optical axis (confocal mode) and inner segments (IS) from multiply scattered light scattered off axis (split detection mode). This allows us to evaluate cone presence and health, with differential imaging of IS versus IS+OS for each cone. [188] EXAMPLE 2: RESULTS

[189] 1. The changes in the phototransduction cascade in degenerating cones

[190] The phototransduction cascade was first analysed in the rd10 mouse model by studying its components using immunohistochemistry, at different time points during retinal degeneration. Immunofluorescence staining was performed against cone opsin, transducing, phosphodiesterase and cone arrestin proteins of the phototransduction cascade that interact directly with cone opsin.

[191] Figure 3 shows that only the cone opsin and arrestin were still expressed and localized around the cone cell body at late stage of the disease.

[192] 2. Cone opsin and GIRK2-mediated vision restoration

[193] Based on immunohistochemistry and previous findings with cone opsins expressed in neurons, it was first studied why delivering a mouse short wavelength cone opsin (SWO) fused with tdTomato and rat truncated GIRK2 fused with GFP using two AAV vectors mixed in equimolar ratios would enhance cone cell’s response to light. Thus two AAVs were injected subretinally to degenerating rd10 mouse retinas at p15 (Figure 4A). This led to a significant increase in phototpic ERG amplitudes in treated eyes compared to controls (Figure 4B). Flicker ERGs confirmed that the recovery mechanism was still active in these cone cells expressing GIRK2 allowing them to follow a fast stimulus (Figure 4C). The rd10 animals treated with GIRK2 showed also an improved optokinetic reflex compared to controls (Figure 4D).

[194] Next it was studied if the endogenous cone opsin, still present in degenerating cones, was functional and sufficient to activate GIRK2 channel in this mouse model. For this, a single AAV8 vector encoding GIRK2 in fusion with GFP was delivered. This led to similar increases in photopic ERG amplitudes and optokinetic reflex in treated eyes compared to controls confirming that GIRK2 alone was sufficient to increase light sensitivity via G protein coupled signalling involving cone opsin (Figure 5A-B). Flicker ERGs were also robustly amplified with this approach (Figure 5C).

[195] 3. GIRK2-mediated vision restoration: long-term efficacy

[196] Photopic ERG recordings were performed to monitor the cone response to light stimuli at different time points after treatment with GIRK2 and in absence of treatment. These ERGs were done under two conditions: (i) photopic with light flashes applied every second during 60 seconds at increasing light intensities and (ii) flicker stimulation with repetitive flashes during 60 seconds. Data were collected on a weekly basis until p50 and then every 10 to 13 days until 11 weeks of age and showed a gradual decline in ERG amplitudes for both controls and treated eyes (Figure 6A). Moreover, these results are consistent with the optokinetic test, both controls and treated eyes with GIRK2 show a decreased optokinetic reflex over time (Figure 6B). This decline was to be expected as cone numbers also decreased over time in the rd10 mice (Figure 6C). The number of cone photoreceptors remaining in rd10 retinas were counted to correlate decreases in cone numbers with decrease in ERG amplitudes. Indeed, the decrease in light responses was proportional to number of remaining photoreceptors (Figure 6D). It was thus concluded that GIRK2 increased light responses in remaining cones so long as cones remained alive but, as expected, it did not slow down the loss of cone cells.

[197] 4. GIRK2-mediated vision restoration in an RCD model caused by mutant rhodopsin

[198] Having in mind the goal of creating a mutation-independent therapy, the approach was tested in another mouse model - with a different causal mutation. To this aim experiments were done in a heterozygous mouse model called mRho7-huRhoP347S+/- carrying a knock in for P347S mutant human rhodopsin. Mutant human rhodopsin and absence of mouse rhodopsin led to a rod-cone dystrophy in this complementary model. Here, the same set of experiments was repeated as that was done in the rd 10 mouse model. First, the phototransduction cascade proteins interacting with cone opsin at different time points was analysed (Figure 7). It was noticed that: (i) the degeneration rate was slower compared to rd 10 and (ii) similar to the rd 10 model only the opsin and the arrestin persisted in cone cell bodies at P150.

[199] Next, mice were injected at P15 with the same AAV vectors encoding for GIRK2 fused with GFP and recorded ERGs to monitor cone response to light stimuli at various time points (Figure 8A). The response amplitudes of treated eyes were significantly higher than that of control eyes until P100. Moreover, flicker ERG responses were also similarly improved in this mouse model. Similarly to rd10 mice, this mouse model also shows an improved optokinetic reflex that decreases over time in both control and treated conditions (Figure 8B). This decline is to be expected as cone numbers also decreases over time in this RCD mouse model (Figure 8C). The decrease in time in ERG amplitudes also correlated with a decrease in cone numbers in this model (Figure 8D). This was again consistent with the fact that the approach did not stop the degeneration but allowed for enhanced light sensitivity via GIRK2.

[200] 5. Efficiency of the mouse GIRK2 in an in vitro test

[201] Light stimulations (400nm, 5 seconds, fullfield) activated GIRK currents in HEK cells expressing both GIRK and SWO (Short Wavelength Opsin) (Figure 9). GIRK channels are modulated in a membrane-delimited, fast manner via the Gi/o pathway and the expression of the mouse GIRK channel was membrane bound. The amplitudes and kinetics of light- induced activation and deactivation of GIRK channels with SWO, induce large GIRK current amplitudes during a 5 s light pulse.

[202] EXAMPLE 3: GIRK1 F137S elicits stronger current than GIRK2 upon stimulation with blue light (471 nm)

[203] Human embryonic kidney 293 (HEK293) stably expressing mouse Opn4L-mCherry are maintained at 37°C in Dulbecco’s modified Eagle’s medium (DMEM), 4.5 g/l D-glucose, supplemented with 10 % fetal bovine serum (Gibco) and penicillin/streptomycin in a humidified incubator under 5% CO2. HEK293 cells are transfected with FuGENE® HD (Promega) according to the manufacturer’s protocol and incubated for 18-24 h before recordings. Retinaldehyde are added to a final medium concentration of 1 pM.

[204] For GIRK channel recordings GIRK constructs are expressed in HEK293 cells stably expressing Opn4L-mCherry. Cells are cultured and recorded in dark room conditions after transfection. GIRK-mediated K -currents are measured and analyzed as described below. The external solution is as follows: 20 mM NaCI, 120 mM KCI, 2 mM CaCI2, 1 mM MgCI2, 10 mM HEPES-KOH, pH 7.3 (KOH). Patch pipettes (2-5 MQs) are filled with internal solution: 100 mM potassium aspartate, 40 mM KCI, 5 mM MgATP, 10 mM HEPES-KOH, 5 mM NaCI, 2 mM EGTA, 2 mM MgCI2, 0.01 mM GTP, pH 7.3 (KOH). Cells are recorded in external solution containing 1 pM 9-cis retinal (Sigma). Cells are visualized using a transilluminated red light (590 nm) or green light filter (480 nm) during experimental manipulations. Whole-cell patch clamp recordings of HEK293 cells are performed with an EPC10 amplifier (HEKA). Currents are digitized and filtered with the internal 10-kHz three- pole Bessel filter (filter 1 ) in series with a 2.9-kHz 4-pole Bessel filter (filter 2) of the EPC10 amplifier. Series resistances are partially compensated between 70 and 90%.

[205] For analyzing and comparing GIRK currents HEK293 cells are voltage clamped at - 60 mV. For determination of the baseline current a 500 ms long voltage ramp from -100 to +50 mV is applied before light application. Then a 10 sec light pulse of 471 nm is applied at -60 mV. The size of the GIRK currents is related to the conductance of the cell before and after light activation.

[206] For analyzing possible differences in the efficiency of G protein modulation and desensitization between the different GIRK currents we apply light pulses in the range between 0.1 - 60 sec and vary the intensity of light as described in our publications (Eickelbeck, D. et al. Commun. Biol. 2, (2019); Spoida, K. et al. Melanopsin Curr. Biol. 26, 1206-1212 (2016); Masseck, O. a. O. A. et al. Neuron 81 , 1263-1273 (2014)).

[207] As visible from the comparison of Figures 11 and 12, GIRK1 F137S induces significantly more ion efflux than truncated rat GIRK2 (about 17-fold higher) in the context of a short GIRK/opsin phototransduction cascade in HEK cells, while wild-type GIRK1 is ineffective at inducing ion efflux. This result suggests that incorporation of GIRK1 F137S in cones will provide for an improved gene therapy over GIRK2 gene therapy of RCD.

[208] Figures 13 and 14 also confirm that GIRK1 F137S (with or without GFP tag) induces significant ion efflux, as compared to either human or rat GIRK2 (with or without GFP tag).

[209] EXAMPLE 4: GIRK1 F137S vision restoration in an RCD model caused by mutant rhodopsin

[210] The same experimental model as in Example 2.2 was used in order to demonstrate that AAV-mediated expression of human GIRK1 F137S in the eyes of rd10 mice led to greater visual acuity at P37, as determined by an optokinetic test. The results are shown in Figure 15.

[211] P15 rd10/rd10 mice received a subretinal injection of AAV8-PR1 ,7-hGIRK1 F137S at a dose of 5e8vg/eye or 5e7vg/eye. At P30 and P37, OKT measurements were performed to assess visual function. Significant visual improvements were observed 3 weeks after administration with 5e8vg/eye, at P37.

[212] EXAMPLE 5: GIRK4 S143T induces significant ion efflux, as compared to either human or rat GIRK2

[213] Same method as in Example 3 has been carried.

[214] Figures 13 and 14 show that GIRK4 S143T (with or without GFP tag) induces significant ion efflux, as compared to either human or rat GIRK2 (with or without GFP tag). Cited references

1. Sinha R, Hoon M, Baudin J, Okawa H, Wong ROL, Rieke F. 2017. Cellular and Circuit Mechanisms Shaping the Perceptual Properties of the Primate Fovea. Cell. 168(3):413-426.e12

2. Yau KW, Hardie RC. 2009. Phototransduction motifs and variations. Cell. 139(2):246-64

3. Ebrey T, Koutalos Y. 2001. Vertebrate photoreceptors. Prog Retin Eye Res. 20(1 ):49-94

4. Larhammar D, Nordstrom K, Larsson T a. 2009. Evolution of vertebrate rod and cone phototransduction genes. Philosophical transactions of the Royal Society of London. Series B, Biological sciences. 364(1531 ):2867-80

5. Maeda T, Imanishi Y, Palczewski K. 2003. Rhodopsin phosphorylation: 30 Years later. Prog. Retin Eye Res. 22(4): 417-434

6. Buch H et al. Prevalence and causes of visual impairment and blindness among 9980 Scandinavian adults: the Copenhagen City Eye Study. Ophthalmology. 2004;1 11 (1 ) :53— 61 .

7. Bramall AN, Wright AF, Jacobson SG, Mclnnes RR. The genomic, biochemical, and cellular responses of the retina in inherited photoreceptor degenerations and prospects for the treatment of these disorders. Anna Rev Neurosci. 2010;33(1 ):441 — 472.

8. Punzo C, Kornacker K, Cepko CL. Stimulation of the insulin/mTOR pathway delays cone death in a mouse model of retinitis pigmentosa. Nat Neurosci. 2009 ;12(1 ):44-52.

9. Leveillard T et al. Identification and characterization of rod-derived cone viability factor. Nat Genet. 2004;36(7):755-759.

10. Mohand-Said S et al. Normal retina releases a diffusible factor stimulating cone survival in the retinal degeneration mouse. Proc Natl Acad Sci U S A. 1998;95(14):8357-8362.

1 1 . Mohand-Said S et al. Photoreceptor transplants increase host cone survival in the retinal degeneration (rd) mouse. Ophthalmic Res. 1997;29(5):290-297.

12. Mohand-Said S, Hicks D, Dreyfus H, Sahel J-A. Selective transplantation of rods delays cone loss in a retinitis pigmentosa model. Arch Ophthalmol. 2000;1 18(6):807-81 1 .

13. Wang XW, Tan BZ, Sun M, Ho B, Ding JL. Thioredoxin-like 6 protects retinal cell line from photooxidative damage by upregulating NF-kappaB activity. Free Radio Biol Med. 2008;45(3):336-344. 14. Yang Y et al. Functional Cone Rescue by RdCVF Protein in a Dominant Model of Retinitis Pigmentosa. Mol Ther. 2009;17(5):787-795.

15. Cronin T et al. The disruption of the rod-derived cone viability gene leads to photoreceptor dysfunction and susceptibility to oxidative stress. Cell Death Differ. 2010;17(7):1 199-1210.

16. Brennan LA, Lee W, Kantorow M. TXNL6 is a novel oxidative stress-induced reducing system for methionine sulfoxide reductase a repair of a-crystallin and cytochrome C in the eye lens. PLoS ONE. [published online ahead of print: 2010].

17. Funato Y, Miki H. Nucleoredoxin, a Novel Thioredoxin Family Member Involved in Cell Growth and Differentiation. Antioxid Redox Signal. 2007;9(8):1035-1058.

18. Lillig CH, Holmgren A. Thioredoxin and Related Molecules-From Biology to Health and Disease. Antioxid Redox Signal. 2007;9(1 ):25— 47.

19. Byrne LC, Dalkara D, Luna G, Fisher SK, Clerin E, Sahel JA, Leveillard T, Flannery JG. Viral-mediated RdCVF and RdCVFL expression protects cone and rod photoreceptors in retinal degeneration. J Clin Invest. 2015 125(1 ):105-16.

20. Mei X., Chaffiol, A., Kole, C., Yang Y., Millet-Puel G., Clerin E., ATt-Ali N., Bennett, J., Dalkara D., Sahel JA, Duebel, J., Leveillard T., The thioredoxin encoded by the Rod- derived Cone Viability Factor gene protects cone photoreceptors against oxidative stress. Antioxid Redox Signal. 2016 May 12.

21 . Elachouri G, Lee-Rivera I, Clerin E, Argentini M, Fridlich R, Blond F, Ferracane V, Yang Y, Raffelsberger W, Wan J, Bennett J, Sahel JA, Zack DJ, Leveillard T: Thioredoxin rod- derived cone viability factor protects against photooxidative retinal damage. Free radical biology & medicine 2015, 81 :22-29.

22. Ait-Ali N, Fridlich R, Millet-Puel G, Clerin E, Delalande F, Jaillard C, Blond F, Perrocheau L, Reichman S, Byrne LC, Olivier-Bandini A, Bellalou J, Moyse E, Bouillaud F, Nicol X, Dalkara D, van Dorsselaer A, Sahel JA, Leveillard T: Rod-derived cone viability factor promotes cone survival by stimulating aerobic glycolysis. Cell 2015, 161 (4) :817-832.

23. Simon C.-J. et al. Poster entitled G-protein gated K+ channel-mediated vision restoration in Rod-Cone dystrophy. ESGCT Barcelona, 24 October 2019.

24. Dryja et aL, Gene-based approach to human gene-phenotype correlations. Proc Natl Acad Sci U S A. 1997 Oct 28;94(22):121 17-21.

25. Sinha R, Hoon M, Baudin J, Okawa H, Wong ROL, Rieke F. 2017. Cellular and Circuit Mechanisms Shaping the Perceptual Properties of the Primate Fovea. Cell. 168(3):413-426. 26. Leveillard, T and Sahel, JA (2010). "Rod-derived cone viability factor for treating blinding diseases: from clinic to redox signaling." Sci Transl Med 2(26): 26ps16.

27. Lindblad, AS; Lloyd, PC; Clemons, TE; Gensler, GR; Ferris FL, 3rd; Klein, ML; Armstrong, JR; Age-Related Eye Disease Study Research, Group. (September 2009). "Change in area of geographic atrophy in the Age-Related Eye Disease Study: AREDS report number 26" (PDF). Archives of Ophthalmology. 127 (9): 1 168-74. doi : 10.1001/archophthalmoL2009.198.

28. Sunness, JS (3 November 1999). "The natural history of geographic atrophy, the advanced atrophic form of age-related macular degeneration". Molecular Vision. 5: 25.

29. Bonilha, Vera L (2008). "Age and disease-related structural changes in the retinal pigment epithelium". Clinical Ophthalmology (Auckland, N.Z.). 2 (2): 413—424.

30. Lindner, Moritz; Fleckenstein, Monika; Schmitz-Valckenberg, Steffen; Holz, Frank G. (2018), "Atrophy, Geographic", Encyclopedia of Ophthalmology, Springer Berlin Heidelberg, pp. 207-209.

31. Wong, Wan Ling; Su, Xinyi; Li, Xiang; Cheung, Chui Ming G; Klein, Ronald; Cheng, Ching-Yu; Wong, Tien Yin (February 2014). "Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: a systematic review and meta-analysis". The Lancet Global Health. 2 (2): e106-e116.

32. Rudnicka, Alicja R.; Kapetanakis, Venediktos V.; Jarrar, Zakariya; Wathern, Andrea K.; Wormaid, Richard; Fletcher, Astrid E.; Cook, Derek G.; Owen, Christopher G. (July 2015). "Incidence of Late-Stage Age-Related Macular Degeneration in American Whites: Systematic Review and Meta-analysis". American Journal of Ophthalmology. 160 (1 ): 85- 93. e3.

33. Dalkara et al., 2013. “In vivo-directed evolution of a new adeno-associated virus for therapeutic outer retinal gene delivery form the vitreous”. Science Translational Medecine, Vol 5, issue 189.

34. Berry MH, Holt A, Levitz J, Visel M, Aghi K, et al. Restoration of high-sensitivity , adapting , patterned vision with a cone opsin. Nature Communications. (2019):1— 12

35. Masseck OA, Spoida K, Dalkara D, Maejima T, Rubelowski JM, et al. 2014. Vertebrate Cone Opsins Enable Sustained and Highly Sensitive Rapid Control of G i/o Signaling in Anxiety Circuitry. Neuron. 81 (6):1263-73

36. Mark MD, Herlitze S. 2000. G-protein mediated gating of inward-rectifier K+ channels. Eur. J. Biochem. 267(19): 5830-5836 37. Kim W. Chan, Jin-Liang Sui, Michel Vivaudou, Diomedes E. Logothetis, 1996, Control of channel activity through a unique amino acid residue of a G protein-gated inwardly rectifying K⁺ channel subunit, Proc Natl Acad Sci U S A. ; 93(24): 14193-14198

38. Dalkara et al., 2013. In Vivo-Directed Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous. SCIENCE TRANSLATIONAL MEDICINE, Vol 5, Issue 189, p. 189ra76

39. Byrne et al. 2020, In vivo-directed evolution of adeno-associated virus in the primate retina. JCI Insight. 5(10)

40. Kotterman et al. 2021 , Directed Evolution of AAV Targeting Primate Retina by Intravitreal Injection Identifies R100, a Variant Demonstrating Robust Gene Delivery and

Therapeutic Efficacy in Non-Human Primates. BioRxiv.

Claims

1 . A pharmaceutical composition comprising one or several viral vectors, wherein said one or several viral vectors comprise a nucleic acid encoding a short isoform of rod-derived cone viability factor (RdCVF), a nucleic acid encoding a long isoform of rod-derived cone viability factor (RdCVFL) and a nucleic acid encoding a mutated form of the subunit 1 of G-protein- gated inwardly rectifying potassium channel (GIRK1 ) (GIRK1 F137S) or a mutated form of the subunit 4 of G-protein-gated inwardly rectifying potassium channel (GIRK4) (GIRK4 S143T).

2. A pharmaceutical composition according to claim 1 , wherein said composition comprises a first viral vector comprising a nucleic acid encoding RdCVF and a nucleic acid encoding RdCVFL, and a second viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

3. A pharmaceutical composition according to claim 1 , wherein said composition comprises three viral vectors respectively comprising a nucleic acid encoding RdCVF, a nucleic acid encoding RdCVFL, and a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

4. A pharmaceutical composition according to claim 1 , wherein said pharmaceutical composition comprises a single viral vector, said single viral vector comprising three nucleic acids respectively encoding RdCVF, RdCVFL and GIRK1 F137S or GIRK4 S143T.

5. A viral vector comprising three nucleic acids respectively encoding RdCVF, RdCVFL and GIRK1 F137S or GIRK4 S143T.

6. A kit comprising two pharmaceutical compositions, wherein:

7. A kit comprising three pharmaceutical compositions, wherein :

- the third pharmaceutical composition comprises a viral vector, said viral vector comprising a nucleic acid encoding GIRK1 F137S or GIRK4 S143T.

8. A pharmaceutical composition according to any one of claims 1 to 4, a viral vector according to claim 5, or a kit according to claim 6 or 7, wherein said RdCVF is the human short isoform hRdCVF as set forth in SEQ ID NO:1 .

9. A pharmaceutical composition according to any one of claims 1 to 4 or 8, or a viral vector according to claim 5 or 8, or a kit according to any one of claims 6 to 8, wherein said RdCVFL is the human long isoform hRdCVFL as set forth in SEQ ID NO:2.

10. A pharmaceutical composition according to any one of claims 1 to 4 or 8 to 9, or a viral vector according to any one of claims 5, 8 or 9, or a kit according to any one of claims 6 to 9, wherein said GIRK1 F137S or GIRK4 S143T are respectively the sequences as set forth in SEQ ID NO:1 1 and SEQ ID NQ:40.

11. A pharmaceutical composition according to any one of claims 1 to 4 or 8 to 10, or a viral vector according to any one of claims 5 or 8 to 10, or a kit according to any one of claims 6 to 10, for use in the treatment of a retinal degenerative disease.

12. A pharmaceutical composition according to any one of claims 1 to 4 or 8 to 10, or a viral vector according to any one of claims 5 or 8 to 10, or a kit according to any one of claims 6 to 10, for use according to claim 1 1 , wherein said retinal degenerative disease is a rod-cone dystrophy, a cone dystrophy, a cone-rod dystrophy or an atrophic age-related macular degeneration.

13. A pharmaceutical composition according to claims 1 to 4 or 8 to 10, or a viral vector according to any one of claims 5, 8 to 10, or a kit according to any one of claims 6 to 10, for use according to claim 1 1 , wherein said retinal degenerative disease is selected in the group consisting of retinitis pigmentosa, age-related macular degeneration, Bardet-Biedel syndrome, Bassen-Kornzweig syndrome, Best disease, choroideremia, gyrate atrophy, Leber congenital amaurosis, Refsum disease, Stargardt disease or Usher syndrome. A pharmaceutical composition according to any one of claims 1 to 4 or 8 to 10, a viral vector according to any one of claims 5, or 8 to 10, or a kit according to any one of claims 6 to 10, for use according to claim 11 , wherein said retinal degenerative disease is the retinitis pigmentosa. A pharmaceutical composition according to any one of claims 1 to 4 or 8 to 10, a viral vector according to any one of claims 5 or 8 to 10, or a kit according to any one of claims 6 to 10, for use according to any of claims 1 1 to 14, wherein said pharmaceutical composition or said viral vector is administered by subretinal injection, intravitreal injection or suprachoroidal injection. A kit according to any one of claims 6 to 10 for use according to any of claims 11 to 14, wherein the pharmaceutical compositions of the kit are administered simultaneously or separately over time such as in a range of one day, in a range of one to six months, in a range of six months to one year, or in a range of one year to ten years.