EP4604933A1 - Methods and uses associated with liquid compositions - Google Patents

Methods and uses associated with liquid compositions

Info

Publication number
EP4604933A1
EP4604933A1 EP23794304.8A EP23794304A EP4604933A1 EP 4604933 A1 EP4604933 A1 EP 4604933A1 EP 23794304 A EP23794304 A EP 23794304A EP 4604933 A1 EP4604933 A1 EP 4604933A1
Authority
EP
European Patent Office
Prior art keywords
liquid
lipid
mixing chamber
liquid composition
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23794304.8A
Other languages
German (de)
French (fr)
Inventor
Christian Reinsch
Steffen Panzner
Martin KIRCHBERG
Patrick KREIDEWEIß
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biontech SE
Original Assignee
Biontech SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biontech SE filed Critical Biontech SE
Publication of EP4604933A1 publication Critical patent/EP4604933A1/en
Pending legal-status Critical Current

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01F—MIXING, e.g. DISSOLVING, EMULSIFYING OR DISPERSING
    • B01F33/00—Other mixers; Mixing plants; Combinations of mixers
    • B01F33/30—Micromixers
    • B01F33/301—Micromixers using specific means for arranging the streams to be mixed, e.g. channel geometries or dispositions
    • B01F33/3017—Mixing chamber
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
    • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
    • A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers comprising non-phosphatidyl surfactants as bilayer-forming substances, e.g. cationic lipids or non-phosphatidyl liposomes coated or grafted with polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5192—Processes
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01F—MIXING, e.g. DISSOLVING, EMULSIFYING OR DISPERSING
    • B01F2215/00—Auxiliary or complementary information in relation with mixing
    • B01F2215/04—Technical information in relation with mixing
    • B01F2215/0413—Numerical information
    • B01F2215/0418—Geometrical information
    • B01F2215/0431—Numerical size values, e.g. diameter of a hole or conduit, area, volume, length, width, or ratios thereof

Definitions

  • the present disclosure relates to improvements associated with liquid compositions, in particular lipid nanoparticle compositions and their manufacture.
  • lipid nanoparticle compositions comprising or consisting of lipid nanoparticles (LNPs) is a key aspect for nucleic acid therapeutics.
  • Properties of the LNPs which are provided may influence the stability or quality of the therapeutic or intermediate products and/or have decisive influences on the yield during the production process.
  • the improvements may relate to the method of providing or producing liquid compositions, e.g. lipid nanoparticle compositions, as such, to components, e.g. components configured to be used in the method or configured to be used in the method, to uses associated with the method and/or preparations, e.g. comprising lipid nanoparticles, such as lipid nanoparticle compositions obtainable or obtained with the method.
  • One aspect of the present disclosure relates to a method of forming, providing or producing a liquid composition, e.g. by mixing a first liquid and a second liquid.
  • Another aspect of the present disclosure relates to a use of a mixing component for forming, providing or producing a liquid composition, e.g. by mixing a first liquid and a second liquid and/or with the method(s) described herein.
  • Yet another aspect of the present disclosure relates to a preparation comprising lipid nanoparticles, e.g. particles of the liquid composition obtainable or obtained with the method and/or with the use of the mixing component.
  • the preparation may be the liquid composition or be obtained or obtainable from the liquid composition.
  • the method and/or the use comprises:
  • a mixing chamber e.g. a region in the mixing component
  • the mixing chamber is provided in a mixing component, the mixing component having a first inlet in fluid communication with the mixing chamber and a second inlet in fluid communication with the mixing chamber.
  • the first and second inlets may be fluidically separated from one another.
  • the first and second liquid may be separated from one another until they meet in the mixing chamber.
  • the mixing chamber may be that region of the mixing component where the two liquids meet.
  • the mixing chamber and/or the mixing component has an outlet.
  • the outlet of the mixing chamber may be a passage where the liquid composition flow, after mixing, enters a section of a flow path or conduit with constant cross sectional area or diameter.
  • the cross sectional area (or cross section) may be less than or equal to the (maximum, minimum and/or average) cross sectional area or diameter of the mixing chamber.
  • the outlet of the mixing component may be the passage to a region of the flow path of the liquid composition downstream of the mixing chamber where the cross section or diameter of the flow path increases (e.g. as compared to the outlet of the mixing chamber).
  • the outlet of the mixing component may be located at an interface between the mixing component and another component, e.g. a tubing.
  • the cross section or diameter of the outlet of the mixing component may be equal to the cross section of the outlet of the mixing chamber.
  • the flow path from the mixing chamber outlet to the mixing component outlet may have a constant cross section or diameter.
  • Reynolds numbers are used to classify a liquid flow.
  • the Reynolds number R of a liquid flow can be calculated by using the following formula:
  • the respective Reynolds number for the liquid composition flow discussed herein may relate to Reynolds numbers based on values for the relevant quantities which are calculated as set forth below or based on values for the relevant quantities which have been measured.
  • D being the inner diameter of the flow path at the relevant location, e.g. at the outlet of the mixing chamber or of the mixing component,
  • F_2 being the flow rate of the second liquid into the mixing chamber (the sum of F_1 and F_2_being the flow rate of the liquid composition at the outlet of the mixing chamber).
  • Vis_dyn F_1 / (F_l + F_2) * Vis_l + F_21 (F_l + F_2) * Vis_2, with
  • the first liquid and/or the second liquid is guided into the mixing chamber and/or into the mixing component with a flow rate of greater than or equal to any one of the following: 10 ml/min, 20 ml/min, 30 ml/min, 40 ml/min, 50 ml/min, 60 ml/min, 70 ml/min, 80 ml/min, 90 ml/min, 100 ml/min, 110 ml/min, 120 ml/min, 130 ml/min, 140 ml/min, 150 ml/min, 160 ml/min, 170 ml/min, 180 ml/min, 190 ml/min, 200 ml/min, 210 ml/min, 220 ml/min.
  • the flow rate of the first liquid and/or the flow rate of the second liquid may be between 10 and 660 ml/min.
  • Arbitrary sub-ranges may be formed by the disclosed values.
  • the flow may be driven by an associated flow driver, e.g. a pump.
  • One flow driver may be assigned to each liquid, i.e. the first liquid or the second liquid.
  • the liquid composition may be driven by the flow drivers in combination.
  • the liquid composition is guided or driven away from the mixing chamber and/or leaves the mixing chamber or the mixing component via the respective outlet with a flow rate of greater than or equal to any one of the following: 10 ml/min, 20 ml/min, 30 ml/min, 40 ml/min, 50 ml/min, 60 ml/min, 70 ml/min, 80 ml/min, 90 ml/min, 100 ml/min, 110 ml/min, 120 ml/min, 130 ml/min, 140 ml/min, 150 ml/min, 160 ml/min, 170 ml/min, 180 ml/min, 190 ml/min, 200 ml/min, 210 ml/min, 220 ml/min, 230 ml/min, 240 ml/min, 250 ml/min, 260 ml/min, 270 ml/min, 280 ml/min, 290
  • the flow rate of the liquid composition away from the mixing chamber or at its outlet may be defined by, e.g. equal to, the sum of the flow rates with which the first liquid and the second liquid enter the mixing chamber.
  • the same flow drivers may be used to drive the first and second liquid flow and also the liquid composition flow.
  • 140 ml/min, 130 ml/min, 120 ml/min, 110 ml/min, 100 ml/min, 90 ml/min, 80 ml/min, 70 ml/min, 60 ml/min, 50 ml/min, 40 ml/min, 30 ml/min, 20 ml/min, 10 ml/min.
  • the nanoparticles of the lipid nanoparticle composition have a size of less than or equal to any one of the following: 195 nm, 190 nm, 185 nm, 180 nm, 175 nm, 170 nm, 165 nm, 160 nm, 155 nm, 150 nm, 145 nm, 140 nm, 135 nm, 130 nm, 125 nm, 120 nm, 115 nm, 110 nm, 105 nm, 100 nm, 95 nm, 90 nm, 85 nm, 80 nm, 75 nm, 70 nm, 65 nm, 60 nm, 55 nm, 50 nm, 45 nm, 40 nm.
  • the nanoparticles of the lipid nanoparticle composition have a size of greater than or equal to any one of the following: 20 nm, 25 nm, 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, 155 nm, 160 nm, 165 nm, 170 nm, 175 nm, 180 nm, 185 nm,
  • the nanoparticles of the lipid nanoparticle composition have a size, e.g. an average size, of greater than or equal to any one of the following: 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, 50 nm (nm: nanometers).
  • the nanoparticles of the lipid nanoparticle composition have a size, e.g. an average size, of less than or equal to any one of the following: 100 nm, 99 nm, 98 nm, 97 nm, 96 nm, 95 nm, 94 nm, 93 nm, 92 nm, 91 nm, 90 nm, 89 nm, 88 nm, 87 nm, 86 nm, 85 nm, 84 nm, 83 nm, 82 nm, 81 nm, 80 nm, 79 nm, 78 nm, 77 nm, 76 nm, 75 nm, 74 nm, 73 nm, 72 nm, 71 nm, 70 nm, 69 nm, 68 nm, 67 nm, 66 nm, 65 nm, 64 nm,
  • the size may be defined by the diameter of the nanoparticles, e.g. based on the maximum, minimum or average diameter of the particles.
  • the size of the nanoparticles may be between 20 nm and 195 nm or be in any sub-range derived from the values stated above, e.g. between 40 nm and 100 nm.
  • the size depends on whether and what substance the nanoparticles encapsulate. The greater the substance, the greater the nanoparticles, of course.
  • the outlet of the mixing chamber or of the mixing component has a diameter of greater than or equal to any one of the following: 0.1 mm, 0.15 mm, 0.2 mm, 0.25 mm, 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm (mm: millimeters).
  • the respective diameters for inlets, openings or flow paths specified herein are expediently inner diameters.
  • the diameter of the flow path or conduit varies, e.g. azimuthally or circumferentially, the diameter at a certain position of the flow path may be the maximum, minimum or average diameter at the certain position.
  • the outlet of the mixing chamber or of the mixing component has a diameter of less than or equal to any one of the following: 4 mm, 3.5 mm, 3 mm, 2.5 mm, 2 mm, 1.5 mm, 1 mm, 0.95 mm, 0.9 mm, 0.85 mm, 0.8 mm, 0.75 mm, 0.7 mm, 0.65 mm, 0.6 mm, 0.55 mm, 0.5 mm.
  • the outlet of the mixing chamber or of the mixing component may have a diameter of between 0.1 mm and 4 mm or be in any sub-range derived from the values stated above.
  • the first inlet and/or the second inlet of the mixing chamber or of the mixing component has a diameter of greater than or equal to any one of the following: 0.1 mm, 0.15 mm, 0.2 mm, 0.25 mm, 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm.
  • the first inlet and/or the second inlet of the mixing chamber or of the mixing component has a diameter of less than or equal to any one of the following: 4 mm, 3.5 mm, 3 mm, 2.5 mm, 2 mm, 1.5 mm, 1 mm, 0.95 mm, 0.9 mm, 0.85 mm, 0.8 mm, 0.75 mm, 0.7 mm, 0.65 mm, 0.6 mm, 0.55 mm, 0.5 mm.
  • the first inlet and the second inlet may have the same or different diameters.
  • the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of greater than or equal to any one of the following: 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22.
  • PDI polydispersity index
  • the first liquid comprises RNA or DNA.
  • the second liquid is an organic phase.
  • the second liquid comprises an organic solvent.
  • the second liquid comprises
  • the liquid composition comprises lipid nanoparticles, the respective lipid nanoparticle encapsulating nucleic acid, e.g. RNA or DNA.
  • the liquid composition is a dispersion.
  • the liquid composition may be a homogeneous dispersion. That is to say, the dispersed phase (e.g. the nanoparticles) is homogeneous, e.g. with a low PDI, such as below 0.13, or below 0.12 or below 0.11.
  • the first liquid is a solution and/or the second liquid is a solution.
  • Another aspect of the disclosure relates to a method of processing a liquid composition obtainable or obtained with the method of providing or forming the liquid composition described further above.
  • the processed liquid composition still comprises the LNPs.
  • the processed liquid composition may be the preparation set forth below.
  • the processed liquid composition may be a drug product and/or a pharmaceutical product.
  • a third liquid is added to the liquid composition downstream of the mixing chamber.
  • the length of a flow path fluidly connecting the outlet of the mixing chamber or the mixing component and an inlet of the further mixing chamber or of the further mixing component, the inlet being provided for the liquid composition is greater than or equal to one of the following: 5 cm, 6 cm, 7 cm, 8 cm, 9 cm, 10 cm, 11 cm, 12 cm, 13 cm, 14 cm, 15 cm, 16 cm, 17 cm, 18 cm, 19 cm, 20 cm (cm: centimeters).
  • the liquid composition may enter the further mixing chamber or mixing component through the inlet.
  • the length of a flow path fluidly connecting the outlet of the mixing chamber or the mixing component and an inlet of the further mixing chamber or of the further mixing component, the inlet being provided for the liquid composition is less than or equal to one of the following: 40 cm, 39 cm, 38 cm, 37 cm, 36 cm, 35 cm, 34 cm, 33 cm, 32 cm, 31 cm, 30 cm, 29 cm, 28 cm, 27 cm, 26 cm, 25 cm, 24 cm, 23 cm, 22 cm, 21 cm, 20 cm.
  • the liquid composition e.g. the processed or unprocessed liquid composition
  • a filter may be a 0.2 pm filter, i.e. a filter which is designed to allow particles with a size or diameter below 200 nm to pass through the filter.
  • the pore size may be 0.2 pm.
  • a filter area of the filter is greater than or equal to A cm 2 per gram of RNA in the lipid nanoparticles, where A is any one of the following values: 80, 90, 100, 110, 120.
  • an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of: 0.030, 0.025, 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005.
  • the liquid composition e.g. the filtered or unfiltered liquid composition, is frozen to a predetermined temperature, e.g. to - 20 °C or - 70 °C.
  • the frozen liquid composition may be thawed, e.g. until the thawed liquid composition has reached room temperature.
  • the frozen liquid may be thawed after a predetermined time. That is to say, the liquid composition is kept frozen for the predetermined time. After that time, the frozen composition may be allowed to thaw at room temperature, e.g. without applying additional heat.
  • the predetermined time is less than or equal to any one of: one week, two weeks, four weeks, five weeks, six weeks, one month, two months, three months, six months, twelve months, 24 months, 36 months.
  • the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, and/or the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition, e.g. directly before the (first) freeze cycle or in a fully processed liquid composition, is less than or equal to any one of the following: 0.2, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06.
  • particles with advantageously low PDI can be obtained and maintained at low PDI throughout different process steps.
  • the respective deviation or difference mentioned above may be greater than zero or zero.
  • processing steps like filtering, freezing and/or thawing may not change the PDI significantly or lower the PDI, when the processes, uses and/or components proposed herein are applied.
  • the composition may be the one with or without addition of the third liquid or a further processed composition.
  • the liquid composition e.g. before filtering, may be purified and/or the organic solvent may be reduced or removed.
  • a preparation e.g. a pharmaceutical preparation, the preparation comprising lipid nanoparticles, the lipid nanoparticles or the preparation being obtainable or obtained with any one of the methods described herein above or below or with the use as described herein above or below.
  • the preparation may be the (unprocessed or processed) liquid composition.
  • features described for the composition or its nanoparticles also apply for the preparation and its nanoparticles.
  • the mixing component used herein does not introduce spatial oscillations in the fluid flow.
  • an analog refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an “analog” shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways.
  • an analog is a substance that can be generated from the reference substance, e.g.. by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance. In some embodiments, an analog is or can be generated through performance of a synthetic process different from that used to generate the reference substance.
  • an antibody may lack a covalent modification (e.g., attachment of a glycan) that it would have if produced naturally.
  • an antibody may contain a covalent modification (e.g. , attachment of a glycan, a payload [e.g., a detectable moiety, a therapeutic moiety, a catalytic moiety, etc. ⁇ , or other pendant group [e.g., poly-ethylene glycol, etc. ⁇ .
  • an antibody agent is a polypeptide protein having a binding domain which is homologous or largely homologous to an immunoglobulin-binding domain.
  • Antibody agents can be made by the skilled person using methods and commercially available services and kits known in the art. For example, methods of preparation of monoclonal antibodies are well known in the art and include hybridoma technology and phage display technology. Further antibodies suitable for use in the present disclosure are described, for example, in the following publications: Antibodies A Laboratory Manual, Second edition. Edward A. Greenfield. Cold Spring Harbor Laboratory Press (September 30, 2013); Making and Using Antibodies: A Practical Handbook, Second Edition. Eds. Gary C. Howard and Matthew R. Kaser. CRC Press (July 29, 2013); Antibody Engineering: Methods and Protocols, Second Edition (Methods in Molecular Biology). Patrick Chames. Humana Press (August 21,
  • Antibodies may be produced by standard techniques, for example by immunization with the appropriate polypeptide or portion(s) thereof, or by using a phage display library. If polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc.) is immunized with an immunogenic polypeptide bearing a desired epitope(s), optionally haptenized to another polypeptide. Depending on the host species, various adjuvants may be used to increase immunological response.
  • a selected mammal e.g., mouse, rabbit, goat, horse, etc.
  • an immunogenic polypeptide bearing a desired epitope(s) optionally haptenized to another polypeptide.
  • various adjuvants may be used to increase immunological response.
  • Antigen- refers to an agent that elicits an immune response; and/or (ii) an agent that binds to a T cell receptor (e.g., when presented by an MHC molecule) or to an antibody.
  • an antigen elicits a humoral response (e.g., including production of antigenspecific antibodies); in some embodiments, an antigen elicits a cellular response (e.g., involving T-cells whose receptors specifically interact with the antigen).
  • an antigen binds to an antibody and may or may not induce a particular physiological response in an organism.
  • an antigen may be or include any chemical entity such as, for example, a small molecule, a nucleic acid, a polypeptide, a carbohydrate, a lipid, a polymer (in some embodiments other than a biologic polymer [e.g., other than a nucleic acid or amino acid polymer) etc.
  • an antigen is or comprises a polypeptide.
  • an antigen is or comprises a glycan.
  • Binding typically refers to a non-covalent association between or among two or more entities. “Direct” binding involves physical contact between entities or moieties; indirect binding involves physical interaction by way of physical contact with one or more intermediate entities. Binding between two or more entities can typically be assessed in any of a variety of contexts - including where interacting entities or moieties are studied in isolation or in the context of more complex systems (e.g., while covalently or otherwise associated with a carrier entity and/or in a biological system or cell).
  • cap refers to a structure comprising or essentially consisting of a nucleoside-5 '-triphosphate that is typically joined to a 5'-end of an uncapped RNA (e.g., an uncapped RNA having a 5'- diphosphate).
  • a cap is or comprises a guanine nucleotide.
  • a cap is or comprises a naturally-occurring RNA 5’ cap, including, e.g., but not limited to a N7-methylguanosine cap, which has a structure designated as "m7G.”
  • a cap is or comprises a synthetic cap analog that resembles an RNA cap structure and possesses the ability to stabilize RNA if attached thereto, including, e.g., but not limited to anti-reverse cap analogs (ARCAs) known in the art).
  • ARCAs anti-reverse cap analogs
  • a capped RNA may be obtained by in vitro capping of RNA that has a 5' triphosphate group or RNA that has a 5' diphosphate group with a capping enzyme system (including, e.g., but not limited to vaccinia capping enzyme system or Saccharomyces cerevisiae capping enzyme system).
  • a capped RNA can be obtained by in vitro transcription (IVT) of a DNA template, wherein, in addition to the GTP, an IVT system also contains a cap analog, e.g., as known in the art.
  • Non-limiting examples of a cap analog include a m7GpppG cap analog or an N7-methyl-, 2’-O- methyl -GpppG ARCA cap analog or an N7-methyl-, 3'- O-methyl-GpppG ARCA cap analog, or any commercially available cap analogs, including, e.g., CleanCap (Trilink), EZ Cap, etc..
  • a cap analog is or comprises a trinucleotide cap analog.
  • Comparable refers to two or more agents, entities, situations, sets of conditions, etc., that may not be identical to one another but that are sufficiently similar to permit comparison there between so that one skilled in the art will appreciate that conclusions may reasonably be drawn based on differences or similarities observed.
  • comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features.
  • Complementary As used herein, the term “complementary” is used in reference to oligonucleotide hybridization related by base -pairing rules. For example, the sequence “C-A-G-T” is complementary to the sequence “G-T-C-A.” Complementarity can be partial or total. Thus, any degree of partial complementarity is intended to be included within the scope of the term “complementary” provided that the partial complementarity permits oligonucleotide hybridization. Partial complementarity is where one or more nucleic acid bases is not matched according to the base pairing rules. Total or complete complementarity between nucleic acids is where each and every nucleic acid base is matched with another base under the base pairing rules.
  • detecting is used broadly herein to include appropriate means of determining the presence or absence of an entity of interest or any form of measurement of an entity of interest in a sample. Thus, “detecting” may include determining, measuring, assessing, or assaying the presence or absence, level, amount, and/or location of an entity of interest. Quantitative and qualitative determinations, measurements or assessments are included, including semi-quantitative. Such determinations, measurements or assessments may be relative, for example when an entity of interest is being detected relative to a control reference, or absolute. As such, the term “quantifying” when used in the context of quantifying an entity of interest can refer to absolute or to relative quantification.
  • Absolute quantification may be accomplished by correlating a detected level of an entity of interest to known control standards (e.g., through generation of a standard curve).
  • relative quantification can be accomplished by comparison of detected levels or amounts between two or more different entities of interest to provide a relative quantification of each of the two or more different entities of interest, i.e.. relative to each other.
  • determining involves manipulation of a physical sample.
  • determining involves consideration and/or manipulation of data or information, for example utilizing a computer or other processing unit adapted to perform a relevant analysis.
  • determining involves receiving relevant information and/or materials from a source.
  • determining involves comparing one or more features of a sample or entity to a comparable reference.
  • Dosage form or unit dosage form may be used to refer to a physically discrete unit of an active agent (e.g. , a therapeutic or diagnostic agent) for administration to a subject.
  • each such unit contains a predetermined quantity of active agent.
  • such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen).
  • the total amount of a therapeutic composition or agent administered to a particular subject is determined by one or more attending physicians and may involve administration of multiple dosage forms.
  • Encapsulate The term “encapsulate” or “encapsulation” is used herein to refer to at least a portion of a component is enclosed or surrounded by another material or another component in a composition. In some embodiments, a component can be fully enclosed or surrounded by another material or another component in a composition.
  • a gene, a cDNA, or a single-stranded RNA encodes a polypeptide if transcription and translation of mRNA corresponding to that gene produces the polypeptide in a cell or other biological system.
  • a coding region of a single-stranded RNA encoding a target polypeptide agent refers to a coding strand, the nucleotide sequence of which is identical to the mRNA sequence of such a target polypeptide agent.
  • Fed-batch process refers to a process in which one or more components are introduced into a vessel, e.g., a bioreactor, at some time subsequent to the beginning of a reaction.
  • a vessel e.g., a bioreactor
  • one or more components are introduced by a fed-batch process to maintain its concentration low during a reaction.
  • one or more components are introduced by a fed-batch process to replenish what is depleted during a reaction.
  • Five prime untranslated region refers to a sequence of an mRNA molecule that begins at the transcription start site and ends one nucleotide (nt) before the start codon (usually AUG) of the coding region of an RNA.
  • a “functional” biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized.
  • a biological molecule may have two functions (i.e., bifunctional) or many functions (i.e., multifunctional).
  • a gene refers to a DNA sequence in a chromosome that codes for a product (e.g., an RNA product and/or a polypeptide product).
  • a gene includes coding sequence (i.e., sequence that encodes a particular product); in some embodiments, a gene includes non-coding sequence.
  • a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequences.
  • a gene may include one or more regulatory elements that, for example, may control or impact one or more aspects of gene expression (e.g., cell-type -specific expression, inducible expression, etc.).
  • Gene product or expression product generally refers to an RNA transcribed from the gene (pre-and/or post-processing) or a polypeptide (pre- and/or post-modification) encoded by an RNA transcribed from the gene.
  • homolog refers to the overall relatedness between polynucleotide molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules.
  • polynucleotide molecules e.g., DNA molecules and/or RNA molecules
  • polypeptide molecules are considered to be “homologous” to one another if their sequences are at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical.
  • polynucleotide molecules e.g., DNA molecules and/or RNA molecules
  • polypeptide molecules are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar (e.g., containing residues with related chemical properties at corresponding positions).
  • certain amino acids are typically classified as similar to one another as “hydrophobic” or “hydrophilic” amino acids, and/or as having “polar” or “non-polar” side chains. Substitution of one amino acid for another of the same type may often be considered a “homologous” substitution.
  • Exemplary cells include those of prokaryotes and eukaryotes (single-cell or multiple-cell), bacterial cells (e.g., strains of E. coli, Bacillus spp., Streptomyces spp., etc.), mycobacteria cells, fungal cells, yeast cells (e.g., 5. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions such as, for example, hybridomas or quadromas.
  • bacterial cells e.g., strains of E. coli, Bacillus spp., Streptomyces spp., etc.
  • mycobacteria cells e.g., fungal cells, yeast cells (e.g., 5. cerevis
  • a host cell is a human, monkey, ape, hamster, rat, or mouse cell.
  • a host cell is eukaryotic.
  • an eukaryotic host cell may be CHO (e.g., CHO KI, DXB-1 1 CHO, Veggie -CHO), COS (e.g., COS-7), retinal cell, Vero, CV1, kidney (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, Colo205, HB 8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cell, C127 cell, SP2/0, NS-0, MMT 060562, Sertoli cell, BRL 3 A cell, HT1080 cell, myeloma cell, tumor cell, or a cell
  • identity refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules.
  • polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical.
  • Calculation of the percent identity of two nucleic acid or polypeptide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CAB IOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0).
  • nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
  • these terms or grammatically comparable comparative terms, indicate values that are relative to a comparable reference measurement. For example, in some embodiments, an assessed value achieved with an agent of interest may be “improved” relative to that obtained with a comparable reference agent.
  • an assessed value achieved in a subject or system of interest may be “improved” relative to that obtained in the same subject or system under different conditions (e.g., prior to or after an event such as administration of an agent of interest), or in a different, comparable subject (e.g., in a comparable subject or system that differs from the subject or system of interest in presence of one or more indicators of a particular disease, disorder or condition of interest, or in prior exposure to a condition or agent, etc.).
  • comparative terms refer to statistically relevant differences (e.g., that are of a prevalence and/or magnitude sufficient to achieve statistical relevance). Those skilled in the art will be aware, or will readily be able to determine, in a given context, a degree and/or prevalence of difference that is required or sufficient to achieve such statistical significance.
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel (e.g., a bioreactor), in cell culture, etc., rather than within a multi-cellular organism.
  • in vitro transcription refers to the process whereby transcription occurs in vitro in a non-cellular system to produce a synthetic RNA product for use in various applications, including, e.g., production of protein or polypeptides.
  • synthetic RNA products can be translated in vitro or introduced directly into cells, where they can be translated.
  • synthetic RNA products include, e.g., but not limited to mRNAs, antisense RNA molecules, shRNA molecules, long non-coding RNA molecules, ribozymes, aptamers, guide RNAs (e.g., for CRISPR), ribosomal RNAs, small nuclear RNAs, small nucleolar RNAs, and the like.
  • an in vitro transcription RNA composition may have been treated and/or processed prior to a purification processes that ultimately produces an RNA transcript preparation comprising RNA transcript at a desired concentration in an appropriate buffer for formulation and/or further manufacturing and/or processing.
  • an in vitro transcription RNA composition may have been treated to remove or digest DNA template (e.g., using a DNase).
  • an in vitro transcription RNA composition may have been treated to remove or digest polypeptides (e.g. , enzymes such as RNA polymerases, RNase inhibitors, etc.) present in an in vitro transcription reaction (e.g., using a protease).
  • Nanoparticle refers to a particle having a diameter of less than 1000 nanometers (nm). In some embodiments, a nanoparticle has a diameter of less than 300 nm, as defined by the National Science Foundation. In some embodiments, a nanoparticle has a diameter of less than 100 nm as defined by the National Institutes of Health. In some embodiments, a nanoparticle has a diameter of less than 80 nm as defined by the National Institutes of Health. In some embodiments, a nanoparticle comprises one or more enclosed compartments, separated from the bulk solution by a membrane, which surrounds and encloses a space or compartment.
  • a nucleic acid may comprise a backbone that comprises one or more phosphorothioate or 5'-N-phosphoramidite linkages and/or one or more peptide bonds, e.g., as in a “peptide nucleic acid”.
  • a nucleic acid comprises one or more, or all, natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxy thymidine, guanine, thymine, uracil).
  • a nucleic acid comprises on or more, or all, non-natural residues.
  • a non-natural residue comprises one or more modified sugars (e.g., 2'- fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared to those in natural residues.
  • a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or polypeptide.
  • a nucleic acid has a nucleotide sequence that comprises one or more introns.
  • Polypeptide typically has its art-recognized meaning of a polymer of at least three amino acids or more. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional, biologically active, or characteristic fragments, portions or domains (e.g., fragments, portions, or domains retaining at least one activity) of such complete polypeptides. In some embodiments, polypeptides may contain L-amino acids, D-amino acids, or both and/or may contain any of a variety of amino acid modifications or analogs known in the art.
  • an agent or entity is “pure” or “purified” if it is substantially free of other components.
  • a preparation that contains more than about 90% of a particular agent or entity is typically considered to be a pure preparation.
  • an agent or entity is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% pure in a preparation.
  • sample refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample.
  • a “processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to one or more techniques such as amplification or reverse transcription of nucleic acid, isolation and/or purification of certain components, etc.
  • the term “stable” is used in reference to a nanoparticle composition (e.g., a lipid nanoparticle composition).
  • a stable nanoparticle composition e.g., a stable nanoparticle composition
  • component(s) thereof maintain one or more aspects of its characteristics (e.g., physical and/or structural characteristics, function(s), and/or activity) over a period of time under a designated set of conditions.
  • a stable nanoparticle composition e.g.
  • a lipid nanoparticle composition is characterized in that average particle size, particle size distribution, and/or polydispersity of nanoparticles is substantially maintained (e.g., within 10% or less, as compared to the initial characteristic(s)) over a period of time (e.g., as described herein) under a designated set of conditions (e.g., as described herein).
  • a stable nanoparticle composition e.g. , a lipid nanoparticle composition
  • no detectable amount of degradation products e.g., associated with hydrolysis and/or enzymatic digestion
  • a synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule that is chemically synthesized, e.g., in some embodiments by solid-phase synthesis.
  • the term “synthetic” refers to an entity that is made outside of biological cells.
  • a synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule (e.g., an RNA) that is produced by in vitro transcription using a template.
  • Vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded DNA into which additional DNA segments may be ligated.
  • viral vector refers to a viral vector, wherein additional DNA segments may be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g.
  • non-episomal mammalian vectors can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors.” Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g.. electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein.
  • Figure 1 illustrates a system for and a method of forming or providing a liquid composition comprising lipid nanoparticles.
  • Figure 2 illustrates a system for and a method of forming or providing a liquid composition comprising lipid nanoparticles using a T-mixer as mixing component.
  • Figures 3A and 3B depict results obtained for the setting shown in figure 2 for different flow rates and two different first liquids.
  • Figure 4 depicts an exemplary process flow charts of manufacturing an RNA (e.g., for encapsulation in LNPs).
  • Figure 5 depicts an overview of an exemplary LNP drug product manufacturing process.
  • Figure 6 depicts an overview of an exemplary process of DNA template manufacture via a PCR-based process.
  • Figure 7 depicts an exemplary LNP manufacturing process.
  • Figure 8 depicts an exemplary process by which a drug product composition can be filled/finished.
  • Figure 9 depicts a Pareto effects chart illustrating relative influences of various factors on LNP particle size and stability.
  • Figure 10 depicts an exemplary process for LNP manufacturing (e.g., of RNA-LNPs), according to aspects of the present embodiments.
  • Figure 11 depicts an exemplary system for LNP manufacturing (e.g., of RNA-LNPs), according to aspects of the present embodiments.
  • FIGS 12 A to 12 C depict images of LNP samples, the images being obtained by transmission electron microscopy (TEM), particularly Cryo-TEM.
  • TEM transmission electron microscopy
  • FIG. 1 schematically illustrates an embodiment of a system 300 for forming or providing a liquid composition comprising lipid nanoparticles.
  • the system is expediently provided for conducting the methods described herein above and below.
  • the system 300 comprises a mixing chamber 302.
  • the mixing chamber has a first inlet 304 and a second inlet 306.
  • the inlets 304 and 306 are provided to permit entry of a first liquid 308 and a second liquid 310 into the mixing chamber.
  • the liquids may be provided in associated reservoirs which are in fluid communication with the associated inlet, e.g. via associated flow paths or the system may be connectable to such reservoirs.
  • a first reservoir 312 in the depicted embodiment holds the first liquid 308 and a second reservoir 314 holds the second liquid 310.
  • a first flow path 309 guides the first liquid 308 and a second flow path 311 guides the second liquid 310 towards the respective inlet.
  • the respective flow path may be defined by one or more conduits, tubings and/or other structures limiting the flow path laterally with respect to the flow direction (e.g. by the mixing component mentioned below).
  • the mixing chamber 302 is part of a mixing component, device or unit 316.
  • the respective inlet (first or second inlet) of the mixing chamber 302 may coincide with the inlet of the mixing component or an associated inlet of the mixing component (e.g. first inlet 318 or second inlet 320) may be arranged upstream of the mixing chamber (i.e. closer to the associated reservoir as seen along the flow path counter to the flow direction).
  • first inlet 318 or second inlet 320 e.g. first inlet 318 or second inlet 320
  • a first flow driver 322 may be provided to move the first liquid 308 into the mixing chamber 302 or the component 316.
  • a second flow driver 324 may be provided to move the second liquid 310 into the mixing chamber 302 or the component 316.
  • the respective flow driver may be a pump.
  • the flow of the first liquid 308 towards and into the mixing chamber 302 or the mixing component 316 is highlighted by arrow 326
  • the flow of the second liquid 310 towards and into the mixing chamber 302 or the mixing component 316 is highlighted by arrow 328.
  • the flow of the first and second liquids may be continuously driven into the mixing chamber.
  • the first and second liquids can mix for the liquid composition 330.
  • the liquid composition 330 leaves the mixing chamber 302 via an outlet 332 of the mixing chamber.
  • the outlet of the mixing component 316 may coincide with the outlet of the mixing chamber or be arranged downstream of the outlet 332 of the mixing chamber 302 (see outlet 334, for example).
  • the flow rate of the liquid composition 330 at the respective outlet may be defined by the flow rates of the first liquid and the second liquid into the mixing chamber 302, e.g. be equal to the sum of these flow rates.
  • the liquid composition as indicated by arrow 336 continues its flow and can be further processed, e.g. buffered, purified, filtered and/or diluted.
  • a further liquid 338 may be added to the flow of the liquid composition downstream of the mixing component or mixing chamber, e.g. a buffer, such as a quench buffer.
  • the third liquid may be a citrate buffer.
  • the third liquid 338 can be added to the liquid composition flow 336 at an angle to the liquid composition flow 336, e.g. less than 160°, such as about 90°.
  • the liquid flow of the third liquid 338 is illustrated by arrow 340.
  • the third liquid can be continuously guided into the liquid flow.
  • the flow rate of the third liquid may be less than the one for the first liquid and/or the second liquid or less than the sum of these flow rates.
  • the processed lipid nanoparticle composition flow 342 may be guided towards a further processing step or unit and/or leave the system 300 via a system outlet (not explicitly shown).
  • the first and second liquids entering the mixing chamber 302 are chosen so as to, when mixed, provide a lipid nanoparticle composition comprising lipid nanoparticles, expediently lipid nanoparticles encapsulating a pharmaceutically active substance, e.g. comprising RNA, such as mRNA.
  • the respective liquids may be solutions.
  • the lipid nanoparticle composition expediently is a dispersed phase or, in other words, a dispersion with lipid nanoparticles being the dispersed phase in a liquid. Both, the nanoparticles and the liquid expediently result from mixing the first liquid and the second liquid with one another in the mixing chamber.
  • a preparation may comprise the processed lipid nanoparticle composition or the unprocessed lipid nanoparticle composition.
  • the first liquid 308 comprises the entity to be encapsulated by the nanoparticles, e.g. RNA, such as mRNA.
  • the first liquid expediently has a pH of between 2 and 7, e.g. between 4 and 7 or between 4 and 6 (e.g. adjusted via citric acid or acetic acid).
  • the first liquid may be an aqueous phase or solution. More detailed examples on the first liquid are given further below.
  • the second liquid 310 expediently comprises further ingredients for the nanoparticle formation.
  • the second liquid comprises one of, more of, or all of: a cationic lipid, a non-cationic or second cationic lipid or helper lipid, a PEG-lipid (sometimes also termed: PEGylated lipid), and cholesterol. More detailed examples on the second liquid are given further below.
  • the second liquid 310 may be an organic phase and/or comprise an organic solvent, e.g. ethanol, propanol, isopropanol or acetone.
  • lipid nanoparticles encapsulating RNA i.e. RNA-LNPs
  • the (average) size of the nanoparticles could be decreased (as compared to regimes with higher Reynolds numbers) and/or homogeneity of the dispersion with the nanoparticles could be increased (e.g. as the nanoparticles are more uniform in size which entails a smaller PDI).
  • Having smaller particles and/or a more homogeneous particle size distribution facilitates further processing of any preparation comprising the nanoparticles formed. For example, less particles are lost during a filtration step or finer filters can be used.
  • Figure 2 shows a setting which is very similar to the one shown in figure 1 but with more details on the flow paths and some associated data. Hence, features described in conjunction with figure l also apply for figure 2 and vice versa. Features from figure 1 are not repeated here.
  • the flow rate of the first liquid may be greater than the flow rate of the second liquid.
  • a ratio of the flow rate of the first liquid to the one of the second liquid may be less than or equal to one of the following: 7, 6, 5, 4, 3.
  • the flow rate of the first liquid is about or equal to 3 times the flow rate of the second liquid.
  • the combined flow rate of the first and second liquids into the mixing chamber may then determine the flow rate of the liquid composition away from the mixing chamber 302.
  • the first and second liquids are mixed using a T-mixer in an impingement liquid setting.
  • the flow directions of the liquid flows are diametrically opposite and the liquids hit one another (frontally) in the mixing chamber.
  • the two impinging liquid streams may create some turbulences which may enhance the mixing in the chamber.
  • laminar flow in the mixing chamber may also be possible.
  • the liquid composition leaves the mixing component 316 at its outlet 334 in a flow direction which is at an angle of 90° or about 90° relative to the flow directions of the first and second liquid into the mixing chamber.
  • the densities (denoted “D” in kg/m 3 ) and viscosities (denoted "V” in centipoise) specified in figure 2 are typical values occurring when forming lipid nanoparticle compositions from mixing two liquids.
  • the diameters of the inlets and the outlet of the mixing chamber or the mixing component are equal. However, it is also conceivable that the inlets have different diameters.
  • the measurements for the PDI and the average particle size were made using dynamic light scattering, e.g. using a Zetasizer available from Malvern.
  • the Zetasizer calculates the PDI and the average particle size.
  • the cuvette was set as ZEN0040, material was set as protein (refractive index RI 1.45, absorption 0.001) and RI and viscosity for PBS were 1.34 and 0.91 cP, respectively. Choice of all other measurement parameters was set to "automatic”. Measurement of each sample was repeated three times. Cumulants fit with the model “General Purpose” was used for data evaluation.
  • the “general purpose model” is a model which needs to be selected as a pre-setting for measurement of a “standard, non-deviating, known and expected” sample of nanoparticles and uses a certain cumulant fit for calculation of size and distribution in the Zetasizer defined by the software of the Zetasizer.
  • the data point at 240 ml/min with the Reynolds number of 9949 was qualified as likely resulting from an irregularity during the measurement.
  • the advantageous effects for the formed nanoparticles were achieved independent from the buffer used for the first liquid (citrate and acetate were used for Liquids 1 and 2, respectively) and also independent from the flow drivers which were used.
  • a syringe pump system or SPS was used (e.g. available from Cetoni)
  • a piston pump system e.g. available from Knauer
  • LNP compositions and associated processes for which the proposed concepts having a Reynolds number of the liquid composition flow (particularly after the initial mixing of the first and second liquids and/or before the liquid composition is further processed, e.g. before the third liquid is added) of 10000 and below are advantageous are set forth below.
  • Further processing of the liquid composition may include filtering using a 0.2 pm filter, e.g. a Sartopore 2 filter.
  • a filter area of the filter can be less than or equal to A m 2 per gram of lipid nanoparticles in the liquid composition, where A is 120, for example.
  • Nucleic acid therapeutics, and particularly RNA therapeutics represent a particularly promising class of therapies for treatment and prevention of various diseases such as cancer, infectious diseases, and/or diseases or disorders associated with overabundance or deficiency in certain proteins.
  • RNA therapeutics in particular have proven remarkably effective as vaccines to address the COVID 19 pandemic. Particularly given the promise of this technology, and its adaptability to a wide variety of clinical contexts, including massively large scale (e.g., vaccination and/or treatment on a global scale such as is under development for SARS-CoV-2), improvements to manufacturing technologies, especially those applicable to large-scale production, are especially valuable.
  • massively large scale e.g., vaccination and/or treatment on a global scale such as is under development for SARS-CoV-2
  • improvements to manufacturing technologies especially those applicable to large-scale production, are especially valuable.
  • lipid nanoparticle technologies have proven to be particularly effective (reviewed in, for example, Cullis et al. Molecular Therapy 25:1467, July 5, 2017; See also, US Patent 8058069), specifically including for RNA therapeutics (reviewed in, for example, Hou et al., Nat. Rev. Mater doi.org/10.1038/s41578-021-00358-0, August 10, 2021).
  • LNP preparations and/or compositions e.g., nucleic acid-LNP preparations, and specifically RNA- LNP preparations.
  • provided technologies permit and/or facilitate achievement of requirements unique to pharmaceutical-grade (and/or scale) production such as, for example, batch size and/or rate of production, pre -determined in-process controls and/or lot release specifications (e.g., high purity, integrity, potency, and/or stability, etc.), etc.
  • LNP compositions e.g., including RNA, e.g., therapeutic RNA such as therapeutic mRNA.
  • provided technologies are useful for manufacturing pharmaceutical-grade RNA-LNP therapeutics.
  • LNP nucleic acid-LNP
  • RNA-LNP nucleic acid-LNP
  • technologies provided herein can be used to produce a pharmaceutical-grade batch throughput of at least 10,000 vials of LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) therapeutics (including, e.g., at least 20,000 vials, at least 30,000 vials, at least 40,000 vials, at least 50,000 vials, at least 60,000 vials, at least 70,000 vials, at least 80,000 vials, at least 90,000 vials, at least 100,000 vials, at least 200,000 vials, at least 300,000 vials, at least 400,000 vials, at least 500,000 vials, or more).
  • LNP e.g., nucleic acid-LNP, e.g., RNA-LNP
  • technologies provided herein can be used to produce a pharmaceutical-grade batch throughput of at least 10,000 vials of L
  • technologies provided herein can be used to produce a pharmaceutical-grade batch throughput of at least 50 L of LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) therapeutics (including e.g., at least 50L, at least 60L, at least 70L, at least 80L, at least 100L, at least 110 L, at least 120 L, at least 130 L, at least 140 L, at least 150 L or more.
  • LNP e.g., nucleic acid-LNP, e.g., RNA-LNP
  • therapeutics including e.g., at least 50L, at least 60L, at least 70L, at least 80L, at least 100L, at least 110 L, at least 120 L, at least 130 L, at least 140 L, at least 150 L or more.
  • each vial can comprise an RNA drug product in an amount of 0.01 mg to 0.5 mg (e.g., 0.01 mg, 0.02 mg, 0.03 mg, 0.04 mg, 0.05 mg, 0.06 mg, 0.07 mg, 0.08 mg, 0.09 mg, 0.1 mg, 0.15 mg, 0.2 mg, 0.25 mg, 0.3 mg, 0.35 mg, 0.4 mg, 0.45 mg, 0.5 mg).
  • LNP e.g., nucleic acid-LNP, e.g., RNA- LNP
  • technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions that comprise or deliver (e.g., by comprising and/or delivering a nucleic acid, such as an RNA, that encodes it) a polypeptide.
  • technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions for inducing an immune response to an antigen.
  • technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions for treatment and/or prevention of coronavirus infection, e.g., SARS-CoV-2 infection, as described in Walsh et al. “RNA-based COVID-19 vaccine BNT162b2 selected for a pivotal efficacy study” medRxiv preprint (2020), which is online accessible at: https://doi.org/10.
  • administered LNPs are delivered to and/or taken up by antigen-presenting cells (e.g., as may be present in skin, muscle, mucosal tissues, etc. f, such administration may be particularly useful or effective for induction of T cell immunity (e.g., for treatment of infectious diseases and/or cancers).
  • antigen-presenting cells e.g., as may be present in skin, muscle, mucosal tissues, etc. f, such administration may be particularly useful or effective for induction of T cell immunity (e.g., for treatment of infectious diseases and/or cancers).
  • lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2.5 mol% of the total lipids; the cationic lipid is present in 35-65 mol% of the total lipids; and the neutral lipid is present in 35-65 mol% of the total lipids.
  • lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2 mol% of the total lipids; the cationic lipid is present in 45-48.5 mol% of the total lipids; and the neutral lipid is present in 45-55 mol% of the total lipids.
  • a polymer-conjugated lipid e.g., PEG-conjugated lipid
  • lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid comprising a non-steroid neutral lipid and a steroid neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2 mol% of the total lipids; the cationic lipid is present in 45-48.5 mol% of the total lipids; the non-steroid neutral lipid is present in 9-11 mol% of the total lipids; and the steroid neutral lipid is present in about 36-44 mol% of the total lipids.
  • a PEG-conjugated lipid is or comprises a structure as described in WO
  • a neutral lipid comprises DSPC (l,2-distearoyl-sn-glycero-3-phosphocholine) and cholesterol, wherein DSPC is a non-steroid neutral lipid and cholesterol is a steroid neutral lipid.
  • DSPC l,2-distearoyl-sn-glycero-3-phosphocholine
  • a lipid nanoparticle described herein comprises a neutral helper lipid.
  • neutral helper lipids include, but are not limited to phosphotidylcholines such as 1 ,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), l,2-Dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), 1,2- Dimyristoyl-sn-glycero-3-phosphocholine (DMPC), l-palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC), 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phophatidylethanolamines such as 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), sphingomyelins (SM), ceramides, cholesterol, steroids such as steadylcho
  • Neutral lipids may be synthetic or naturally derived.
  • Other neutral helper lipids that are known in the art, e.g., as described in WO 2017/075531 and WO 2018/081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein, can also be used in lipid nanoparticles described herein.
  • a lipid nanoparticle for delivery of RNA(s) described herein comprises DSPC and/or cholesterol.
  • a lipid nanoparticle described herein comprises at least two helper lipids (e.g., ones described herein).
  • a lipid nanoparticle may comprise DSPC and cholesterol.
  • a relevant RNA includes a polypeptide -encoding portion or a plurality of polypeptide -encoding portions.
  • such a portion or portions may encode a polypeptide or polypeptides that is or comprises an antigen (or an epitope thereof), a cytokine, an enzyme, etc.
  • an encoded polypeptide or polypeptides may be or include one or more neoantigens or neoepitopes associated with a tumor.
  • an encoded polypeptide or polypeptides may be or include one or more antigens (or epitopes thereof) of an infectious agent (e.g., a bacterium, fungus, virus, etc.).
  • an encoded polypeptide may be a variant of a wild type polypeptide.
  • RNA refers to a structure found on the 5'-end of an RNA, e.g., mRNA, and generally includes a guanosine nucleotide connected to an RNA, e.g., mRNA, via a 5'- to 5'-triphosphate linkage (also referred to as Gppp or G(5')ppp(5')).
  • a guanosine nucleoside included in a 5’ cap may be modified, for example, by methylation at one or more positions (e.g., at the 7- position) on a base (guanine), and/or by methylation at one or more positions of a ribose.
  • providing an RNA with a 5'-cap disclosed herein or a 5'-cap analog may be achieved by in vitro transcription, in which a 5'-cap is co-transcriptionally expressed into an RNA strand, or may be attached to an RNA post-transcriptionally using capping enzymes.
  • co- transcriptional capping with a cap disclosed herein e.g., with a capl or a capl analog, improves the capping efficiency of an RNA compared to co-transcriptional capping with an appropriate reference comparator.
  • improving capping efficiency can increase a translation efficiency and/or translation rate of an RNA, and/or increase expression of an encoded polypeptide.
  • an RNA described herein comprises a 5’-cap or a 5’ cap analog, e.g. , a CapO, a Capl or a Cap2.
  • a provided RNA does not have uncapped 5'-triphosphates.
  • an RNA may be capped with a 5'- cap analog.
  • an RNA described herein comprises a CapO.
  • an RNA described herein comprises a Capl, e.g., as described herein.
  • an RNA described herein comprises a Cap2.
  • alterations to polynucleotides generates a non-hydrolyzable cap structure which can, for example, prevent decapping and increase RNA half-life.
  • a CapO structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G).
  • a CapO structure is connected to an RNA via a 5'- to 5'- triphosphate linkage and is also referred to herein as m7Gppp or m7G(5')ppp(5').
  • a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine ( m7 G or 7m G) and a 2'0 methylated first nucleotide in an RNA (2'0MeNi or Nj2'0Me or Ni 20Me ).
  • a Capl structure is connected to an RNA via a 5'- to 5 '-triphosphate linkage; in some embodiments, a Capl structure may be represented as m7 Gppp(Ni 2OMe ) or m7 G(5')ppp(5')(Ni 2OMe ) or 7m G(5')ppp(5')Ni 2 0Me ).
  • Ni is chosen from A, C, G, or U.
  • Nj is A.
  • Ni is C.
  • Ni is G.
  • Ni is U.
  • methylation of one or more positions in a cap structure may impact or reflect mode of incorporation (e.g., co-transcriptional vs post-transcriptional), as presence of a methyl group (e.g., a 2'OMe group) at certain positions (e.g., Ni) may interfere with elongation, e.g., by a particular polymerase (e.g., T7), as underlies the ARCA technology.
  • Capl structure comprises a second nucleotide, Nz which is a cap proximal A, G, C, or U at position +2.
  • Capl structures are represented as ( m7 G(5')ppp(5')(Ni 2OMe )pNz).
  • Nzis A In some embodiments, Nzis C. In some embodiments, Nzis G. In some embodiments, Nzis U.
  • a Capl structure is or comprises m7 G(5')ppp(5')(A i 20Me )pGz wherein Ai is a cap proximal A at position +1 and Gz is a cap proximal G at position +2. and has the following structure:
  • a Capl structure is or comprises m7 G(5')ppp(5')(Ai 2OMe )pUz wherein Ai is a cap proximal A at position +1 and Uz is a cap proximal U at position +2, and has the following structure:
  • a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine ( m7 G) and one or more additional modifications, e.g., methylation on a ribose, and a 2'0 methylated first nucleotide in an RNA.
  • a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine and a 3'0 methylation at a ribose (m7G3'OMe) or 7m G 3 ' OMe ); an j a 2'Q methylated first nucleotide in an RNA (Ni 20Me ).
  • a Capl structure is connected to an RNA via a 5'- to 5 '-triphosphate linkage and is also referred to herein as (m7G3'OMe)ppp(2'OMeNi) or ( m7 G 3 OMi: )(5')ppp(5')( 2 ' OMe Ni).
  • Ni is chosen from A, C, G, or U.
  • Ni is A.
  • Ni is C.
  • Ni is G.
  • Ni is U.
  • a ( m7 G 3 OMc )(5')ppp(5')(Nj 2OMe ) Capl structure comprises a second nucleotide, Ni which is a cap proximal nucleotide at position 2 and is chosen from A, G, C, or U ( m7 G 3 OMe )(5')ppp(5')(Ni 2OMe )pN2).
  • Ni is A.
  • N? is C.
  • N is G.
  • Ni is U.
  • a Capl structure is or comprises ( m7 G 3 OMe )(5')ppp(5')(Ai 2OMe )pG2 wherein Ai is a cap proximal A at position +1 and G2 is a cap proximal G at position +2. and has the following structure:
  • a second nucleotide in a Capl structure can comprise one or more modifications, e.g., methylation.
  • a Capl structure comprising a second nucleotide comprising a 2'0 methylation is a Cap2 structure.
  • untranslated region or "UTR” is commonly used in the art to a region in a DNA molecule which is transcribed but is not translated into an amino acid sequence, or to the corresponding region in an RNA polynucleotide, such as an mRNA molecule.
  • An untranslated region (UTR) can be present 5' (upstream) of an open reading frame (5'-UTR) and/or 3' (downstream) of an open reading frame (3'- UTR).
  • a 5'-UTR if present, is located at the 5' end, upstream of the start codon of a polypeptide- (e.g., protein)-encoding region.
  • a 5'-UTR is downstream of the 5'-cap (if present), e.g., directly adjacent to the 5'-cap.
  • IE 1 immediate -early 1 gene
  • HSD17B4 RPL32, ASAHI , ATP5A1, MP68, NDUFA4, NOSIP, RPL31 , SLC7A3, TUBB4B, UBQLN2, PSMB3, RPS9, CASP1, COX6B1, NDUFA1, Rpl31, GNAS, ALB7.
  • a 5’ UTR is or comprises a 5’ UTR from an a- globin gene, or a variant thereof.
  • embodiment utilized 5' UTR is a 5’ UTR of a TOP gene, for example a 5' UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract) (e.g., as described, for example, in WO/2015/101414, W02015/101415, WO/2015/062738, WO2015/024667, WO2015/024667); a 5' UTR element of a ribosomal protein Large 32 (L32) gene (e.g., as described, for example, in WO/2015/101414, W02015/101415, WO/2015/062738), a 5' UTR element of an hydroxysteroid (17-P) dehydrogenase 4 gene (HSD17B4) (e.g., as described, for example, in WO2015/024667), or a 5' UTR element of ATP5A1 (e.g., as described, for example, in WO2015/024667) can be
  • a 5’ UTR may be or comprise a sequence GGGAUCCUACC (see, e.g., WO2014/144196).
  • a 5’ UTR may be or comprise a sequence as set forth in one of SEQ ID NOs: 231-252, or 22848-22875 of WO2021/156267, or a fragment or a variant of any of the foregoing.
  • a 5’ UTR may be or comprise a sequence as set forth in claim 9 of and/or of one or more of SEQ ID NOs: 1 -20 of W02019/077001 Al, or a fragment or variant of any of the foregoing.
  • a cap proximal sequence comprises a sequence adjacent to a 5’ cap. In some embodiments, a cap proximal sequence comprises nucleotides in positions +1, +2, +3, +4, and/or +5 of an RNA polynucleotide.
  • N1 is A and N2 is A. In some embodiments, Nl is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, Nl is A and N2 is U.
  • N1 is C and N2 is A. In some embodiments, Nl is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, Nl is C and N2 is U.
  • N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.
  • N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is A.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is G.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is U.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is A.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is G.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is U.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is A.
  • N5 is C.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is C.
  • N5 is C.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is G.
  • N5 is C.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is C. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is C.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is G.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is A.
  • N4 is U.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is C.
  • N4 is A.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is C.
  • N4 is C.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is C.
  • N4 is U.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is C.
  • N4 is U.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is C.
  • N4 is U.
  • N5 is C.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is C.
  • N4 is A.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is U. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is C.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is G.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is U.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is A.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is C.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is U.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is A.
  • N5 is C.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is C.
  • N5 is C.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is G.
  • N5 is C.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is A.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is C.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is G.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is G.
  • N4 is U.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is U.
  • N4 is A.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is U.
  • N4 is C.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is U.
  • N4 is U.
  • N5 is A.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is U.
  • N4 is G.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is U.
  • N4 is U.
  • N5 is G.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is U.
  • N4 is A.
  • N5 is U.
  • Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U.
  • Nl is A and N2 is G.
  • N3 is U.
  • N4 is U.
  • N5 is U.
  • a 5’ UTR disclosed herein comprises a cap proximal sequence, e.g., as disclosed herein.
  • a cap proximal sequence comprises a sequence adjacent to a 5’ cap.
  • a cap proximal sequence comprises nucleotides in positions +1, +2, +3, +4, and/or +5 of an RNA polynucleotide.
  • N1 and N2 are each independently chosen from: A, C, G, or U.
  • N1 is A.
  • N1 is C.
  • N1 is G.
  • N1 is U.
  • N2 is A.
  • N2 is C.
  • N2 is G.
  • N2 is U.
  • N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.
  • a 3'-UTR if present, is located at the 3' end, downstream of the termination codon of a polypeptide- (e.g., protein-) encoding region, but the term "3'-UTR" does preferably not include the poly(A) sequence. Thus, the 3'-UTR is upstream of the poly(A) sequence (if present), e.g. directly adjacent to the poly(A) sequence.
  • a 3’UTR is an FI element as described in W02017/060314.
  • exemplary 3' UTRs include that of bovine or human growth hormone (wild type or modified) (W02013/185069, US2014/0206753, W02014152774), rabbit 0 globin and hepatitis B virus (HBV), a-globin 3' UTR and Viral VEEV 3' UTR sequences are also known in the art.
  • the sequence UUUGAAUU (W02014/144196) is used.
  • 3' UTRs of human and/or mouse ribosomal protein are used.
  • examples include rps9 3’UTR (W02015/101414), FIG4 (W02015/101415), and human albumin 7 (W02015/101415).
  • a 3’ UTR utilized in accordance with the present disclosure comprises a sequence: ugauaauagg cuggagccuc gguggccuag cuucuugccc cuugggccuc cccccagccc cuccuccccu uccugcaccc guacccccgu ggucuuugaa uaaagucuga gugggcggc.
  • a polynucleotide e.g., DNA, RNA
  • a polyadenylate sequence e.g., as described herein.
  • a PolyA sequence is situated downstream of a 3'-UTR, e.g., adjacent to a 3'-UTR.
  • poly(A) sequence or "poly-A tail” refers to an uninterrupted or interrupted sequence of adenylate residues which is typically located at the 3'-end of an RNA polynucleotide.
  • Poly(A) sequences are known to those of skill in the art and may follow the 3 ’-UTR in the RNAs described herein.
  • An uninterrupted poly(A) sequence is characterized by consecutive adenylate residues. In nature, an uninterrupted poly(A) sequence is typical.
  • polynucleotides disclosed herein comprise an uninterrupted Poly(A) sequence.
  • polynucleotides disclosed herein comprise interrupted Poly(A) sequence.
  • a poly (A) sequence in accordance with the present disclosure is not limited to a particular length; in some embodiments, a poly(A) sequence is any length.
  • a poly(A) sequence comprises, essentially consists of, or consists of at least 10, at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 1000, up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, and, in particular, about 120 A nucleotides.
  • a poly(A) sequence is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand.
  • the DNA sequence encoding a poly(A) sequence (coding strand) is referred to as poly(A) cassette.
  • the poly(A) cassette present in the coding strand of DNA essentially consists of dA nucleotides, but is interrupted by a random sequence of the four nucleotides (dA, dC, dG, and dT). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.
  • a cassette is disclosed in WO 2016/005324 Al, hereby incorporated by reference. Any poly(A) cassette disclosed in WO 2016/005324 Al may be used in accordance with the present disclosure.
  • a poly(A) cassette that essentially consists of dA nucleotides, but is interrupted by a random sequence having an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of e.g., 5 to 50 nucleotides shows, on DNA level, constant propagation of plasmid DNA in E. coli and is still associated, on RNA level, with the beneficial properties with respect to supporting RNA stability and translational efficiency is encompassed.
  • the poly(A) sequence contained in an RNA polynucleotide described herein essentially consists of A nucleotides, but is interrupted by a random sequence of the four nucleotides (A, C, G, U). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.
  • no nucleotides other than A nucleotides flank a poly(A) sequence at its 3'-end, i.e., the poly(A) sequence is not masked or followed at its 3'-end by a nucleotide other than A.
  • the poly(A) sequence may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may essentially consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 150 nucleotides. In some embodiments, the poly(A) sequence comprises about 120 nucleotides.
  • the poly(A) sequence may comprise about 10 to about 500 adenosine nucleotides, about 10 to about 200 adenosine nucleotides, about 40 to about 200 adenosine nucleotides, or about 40 to about 150 adenosine nucleotides.
  • the length of the poly(A) sequence may be at least about or even more than about 10, 50, 64, 75, 100, 200, 300, 400, or 500 adenosine nucleotides.
  • the nucleic acid comprises at least one poly(A) sequence comprising about 30 to about 200 adenosine nucleotides. In some embodiments, the poly(A) sequence comprises about 64 adenosine nucleotides (A64). In some embodiments, the poly(A) sequence comprises about 100 adenosine nucleotides (A100). In some embodiments, the poly(A) sequence comprises about 150 adenosine nucleotides.
  • the nucleic acid comprises at least one poly (A) sequence comprising about 100 adenosine nucleotides, wherein the poly(A) sequence is interrupted by non-adenosine nucleotides, preferably by 10 non adenosine nucleotides (A30-N10-A70).
  • an encoded polypeptide may be or comprise an antigen or epitope thereof, so that, when expressed in a subject to which a provided RNA is administered, an immune response (e.g., characterized by antibodies and/or T cells specifically directed to the antigen or one or more epitopes thereof); in some such embodiments, an encoded polypeptide may be polyepitopic, for example including multiple polypeptide elements, each of which includes at least one epitope, linked to one another and optionally separated by linkers. As is understood in the art, in some embodiments, a polyepitopic construct may include individual epitopes found in different portions of the same protein in nature.
  • a polyepitopic construct may include individual epitopes found in different proteins in nature.
  • Those skilled in the art will be aware of a variety of considerations relevant to selection of desirable polyepitopic constructs, and/or antigens and/or epitopes for inclusion therein, useful in accordance with the present disclosure (see, for example, WO2014082729, WO2012159754, WO2017173321, WO2014180659, WO20161283762, W02017194610, WO2011143656, WO2015103037, Nielsen JS, et al. J Immunol Methods. 2010 Aug 31 ;360(l-2): 149-56.
  • a relevant antigen may be or comprise comprise an infectious antigen (i.e., an antigen associated with an infectious agent such as an infectious virus, a bacterium, a fungus, etc.) and/or a cancer antigen (e.g., an antigen associated with a class of tumors or a specific tumor; in some embodiments, a cancer-associated antigen may be or comprise a neoantigen or neoepitope), or epitope thereof.
  • infectious antigen i.e., an antigen associated with an infectious agent such as an infectious virus, a bacterium, a fungus, etc.
  • a cancer antigen e.g., an antigen associated with a class of tumors or a specific tumor
  • a cancer-associated antigen may be or comprise a neoantigen or neoepitope, or epitope thereof.
  • an ORF may encode, for example, an antibody or portion (e.g., antigen-binding portion) thereof, an enzyme, a cytokine, a therapeutic protein, etc. (see, for example, 02017186928, WO2017191274, US10669322, Dammes et al Trens Pharmacol Sci 4:755, 2020-10-01, Wang et al Nature Reviews Drug Discovery 19, 441-442 (2020), Damase et al Front. Bioeng. Biotechnol., 18 March 2021).
  • an antibody or portion e.g., antigen-binding portion
  • an ORF for use in accordance with the present disclosure encodes a polypeptide that includes a signal sequence, e.g., that is functional in mammalian cells.
  • a utilized signal sequence is “intrinsic” in that it is , in nature, it is associated with (e.g., linked to) the encoded polypeptide.
  • a utilized signal sequence is heterologous to the encoded polypeptide - e.g., is not naturally part of a polypeptide (e.g., protein) whose sequences are included in the encoded polypeptide.
  • signal peptides are sequences, which are typically characterized by a length of about 15 to 30 amino acids.
  • signal peptides are positioned at the N-terminus of an encoded polypeptide as described herein, without being limited thereto.
  • signal peptides preferably allow the transport of the polypeptide encoded by RNAs of the present disclosure with which they are associated into a defined cellular compartment, preferably the cell surface, the endoplasmic reticulum (ER) or the endosomal-lysosomal compartment.
  • a signal sequence is selected from an S1S2 signal peptide (aa 1-19), an immunoglobulin secretory signal peptide (aa 1-22), an HSV-1 gD signal peptide (MGGAAARLGAVILFVVIVGLHGVRSKY), an HSV-2 gD signal peptide (MGRLTSGVGTAALLVVAVGLRVVCA); a human SPARC signal peptide, a human insulin isoform 1 signal peptide, a human albumin signal peptide, etc.
  • an RNAsequence encodes an epitope that may comprise or otherwise be linked to a signal sequence (e.g., secretory sequence), such as those listed in Table 1, or at least a sequence having 1, 2, 3, 4, or 5 amino acid differences relative thereto.
  • a signal sequence such as MFVFLVLLPLVSSQCVNLT, or at least a sequence having 1, 2, 3, 4, or at the most 5 amino acid differences relative thereto is utilized.
  • a sequence such as MFVFLVLLPLVSSQCVNLT, or a sequence having 1, 2, 3, 4, or at the most 5 amino acid differences relative thereto, is utilized.
  • a signal sequence is selected from those included in the Table 1 below and/or those encoded by the sequences in Table 2 below:
  • a multimerization element is one described in W02017/081082 (e.g., SEQ ID NOs: 1116-1167, or fragments or variants thereof).
  • trimerization and tetramerization elements include, but are not limited to, engineered leucine zippers, fibritin foldon domain from enterobacteria phage T4, GCN4pll, GCN4-pll, and p53.
  • a provided encoded polypeptide(s) is able to form a trimeric complex.
  • a utilized encoded polypeptide(s) may comprise a domain allowing formation of a multimeric complex, such as for example particular a trimeric complex of an amino acid sequence comprising an encoded polypeptide(s) as described herein.
  • a domain allowing formation of a multimeric complex comprises a trimerization domain, for example, a trimerization domain as described herein.
  • an encoded polypeptide(s) can be modified by addition of a T4-fibri tin-derived “foldon” trimerization domain, for example, to increase its immunogenicity.
  • an RNAas described herein encodes a membrane association element (e.g., a heterologous membrane association element), such as a transmembrane domain.
  • a transmembrane domain can be N-terminal, C-terminal, or internal to an encoded polypeptide.
  • a coding sequence of a transmembrane element is typically placed in frame (i.e., in the same reading frame), 5', 3', or internal to coding sequences of sequences (e.g., sequences encoding polypeptide(s)) with which it is to be linked.
  • a transmembrane domain comprises or is a transmembrane domain of Hemagglutinin (HA) of Influenza virus, Env of HIV- 1, equine infectious anaemia virus (EIAV), murine leukaemia virus (MLV), mouse mammary tumor virus, G protein of vesicular stomatitis virus (VSV), Rabies virus, or a seven transmembrane domain receptor.
  • HA Hemagglutinin
  • EIAV equine infectious anaemia virus
  • MMV murine leukaemia virus
  • VSV vesicular stomatitis virus
  • Rabies virus or a seven transmembrane domain receptor.
  • an ORF encoding polypeptide of the disclosure is codon optimized.
  • Various codon optimization methods are known in the art.
  • an ORF of any one or more of the sequences provided herein may be codon optimized.
  • Codon optimization in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove polypeptide trafficking sequences; remove/add post translation modification sites in encoded polypeptide (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the polypeptide to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide.
  • Codon optimization tools, algorithms and services are known in the art - non limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods.
  • the open reading frame (ORF) sequence is optimized using optimization algorithms.
  • a codon optimized sequence shares less than 95% sequence identity to a naturally - occurring or wild-type sequence ORF (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 90% sequence identity to a naturally-occurring or wild- type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 85% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wildtype mRNA sequence encoding a polypeptide).
  • a codon optimized sequence shares less than 80% sequence identity to a naturally -occurring or wild-type sequence (e.g., a naturally- occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 75% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide).
  • a codon optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85% or between about 67% and about 80%) sequence identity to a naturally-occurring or wild- type sequence (e.g., a naturally -occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares between 65% and 75% or about 80% sequence identity to a naturally -occurring or wild-type sequence (e.g. , a naturally-occurring or wild-type mRNA sequence encoding a polypeptide).
  • a codon-optimized sequence encodes polypeptide (e.g., an antigen) that is as immunogenic as, or more immunogenic than (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% more), than a polypeptide encoded by a non-codon- optimized sequence.
  • polypeptide e.g., an antigen
  • immunogenic e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% more
  • the modified mRNAs when transfected into mammalian host cells, have a stability of between 12-18 hours, or greater than 18 hours, e.g., 24, 36, 48, 60, 72, or greater than 72 hours and are capable of being expressed by the mammalian host cells.
  • a codon optimized RNA may be one in which the levels of G/C are enhanced and/or A/U are enhanced.
  • the G/C-content of nucleic acid molecules may influence the stability of the RNA.
  • RNA having an increased amount of guanine (G) and/or cytosine (C) residues may be functionally more stable than RNA containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides.
  • WO02/098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translated region.
  • a single-stranded RNA comprises a nucleotide sequence that encodes a SARS- CoV-2 polypeptide (including, e.g., a spike (S) protein, a nucleocapsid (N) protein, envelope (E) protein, and a membrane (M) protein) or an immunogenic fragment thereof.
  • a singlestranded RNA comprises a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide or an immunogenic fragment thereof (e.g., a receptor binding domain of a S protein).
  • such a SARS-CoV-2 S polypeptide or an immunogenic fragment thereof may be a mutant protein.
  • such a SARS-CoV-2 S protein or an immunogenic fragment thereof may be one as described in Walsh et al. “RNA-based COVID-19 vaccine BNT162b2 selected for a pivotal efficacy study” medRxiv preprint (2020), which is online accessible at: https://doi.org/10.1 101/2020.08.17.20176651 ; and Milligan et al. “Phase I/II study of COVID-19 RNA vaccine BNT162bl in adults” Nature (2020 August), which is online accessible at: https://doi.org/10.1038/s41586-020-2639-4, the contents of each of which are incorporated by reference in their entirety.
  • a single-stranded RNA comprises a nucleotide sequence that encodes a SARS- CoV-2 polypeptide as shown in Example 10.
  • a single-stranded RNA may comprise a secretion signal-encoding region (e.g., a secretion signal-encoding region that allows an encoded target entity to be secreted upon translation by cells).
  • a secretion signal-encoding region may be or comprise a non-human secretion signal.
  • such a secretion signalencoding region may be or comprise a human secretion signal.
  • a single-stranded RNA may comprise at least one non-coding sequence element (e.g., to enhance RNA stability and/or translation efficiency).
  • non-coding sequence elements include but are not limited to a 3’ untranslated region (UTR), a 5’ UTR, a cap structure for co-transcriptional capping of mRNA, a poly adenine (poly A) tail, and any combinations thereof.
  • RNA can comprise a nucleotide sequence that encodes a 5 ’UTR of interest and/or a 3’ UTR of interest.
  • untranslated regions e.g., 3’ UTR and/or 5’ UTR
  • mRNA sequence can contribute to mRNA stability, mRNA localization, and/or translational efficiency.
  • a single-stranded RNA can comprise a 5’ UTR nucleotide sequence and/or a 3’ UTR nucleotide sequence.
  • such a 5’ UTR sequence can be operably linked to a 3’ of a coding sequence (e.g. , encompassing one or more coding regions).
  • a 3’ UTR sequence can be operably linked to 5’ of a coding sequence (e.g., encompassing one or more coding regions).
  • 5' and 3' UTR sequences included in a single-stranded RNA can consist of or comprise naturally occurring or endogenous 5' and 3' UTR sequences for an open reading frame of a gene of interest.
  • 5’ and/or 3’ UTR sequences included in a singlestranded RNA are not endogenous to a coding sequence (e.g., encompassing one or more coding regions); in some such embodiments, such 5’ and/or 3’ UTR sequences can be useful for modifying the stability and/or translation efficiency of an RNA sequence transcribed.
  • a skilled artisan will appreciate that AU-rich elements in 3' UTR sequences can decrease the stability of mRNA. Therefore, as will be understood by a skilled artisan, 3' and/or 5’ UTRs can be selected or designed to increase the stability of the transcribed RNA based on properties of UTRs that are well known in the art.
  • a nucleotide sequence consisting of or comprising a Kozak sequence of an open reading frame sequence of a gene or nucleotide sequence of interest can be selected and used as a nucleotide sequence encoding a 5’ UTR.
  • Kozak sequences are known to increase the efficiency of translation of some RNA transcripts, but are not necessarily required for all RNAs to enable efficient translation.
  • a single-stranded RNA can comprise a nucleotide sequence that encodes a 5' UTR derived from an RNA virus whose RNA genome is stable in cells.
  • various modified ribonucleotides can be used in the 3' and/or 5' UTRs, for example, to impede exonuclease degradation of the transcribed RNA sequence.
  • a 5’ UTR included in a single-stranded RNA may be derived from human a- globin mRNA combined with Kozak region.
  • a 5’ UTR comprises the nucleotide sequence of SEQ ID NO: 12 as shown in Example 10.
  • a single-stranded RNA may comprise one or more 3 ’UTRs.
  • a single-stranded RNA may comprise two copies of 3'-UTRs derived from a globin mRNA, such as, e.g., alpha2-globin, alpha 1 -globin, beta-globin (e.g., a human beta-globin) mRNA.
  • a globin mRNA such as, e.g., alpha2-globin, alpha 1 -globin, beta-globin (e.g., a human beta-globin) mRNA.
  • two copies of 3’ UTR derived from a human beta-globin mRNA may be used, e.g.
  • a 3’ UTR included in a single-stranded RNA may be or comprise one or more (e.g., 1, 2, 3, or more) of the 3 ’UTR sequences disclosed in WO 2017/060314, the entire content of which is incorporated herein by reference for the purposes described herein.
  • a 3‘-UTR may be a combination of at least two sequence elements (FI element) derived from the "amino terminal enhancer of split" (AES) mRNA (called F) and the mitochondrial encoded 12S ribosomal RNA (called I). These were identified by an ex vivo selection process for sequences that confer RNA stability and augment total protein expression (see WO 2017/060314, herein incorporated by reference).
  • FI element comprises the nucleotide sequence of SEQ ID NO: 13 as shown in Example 10.
  • a polyA tail is a nucleotide sequence comprising at least 30 adenosine nucleotides or more, including, e.g., at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, or more adenosine nucleotides.
  • a polyA tail is or comprises a polyA homopolymeric tail.
  • a polyA tail may comprise one or more modified adenosine nucleosides, including, but not limited to, cordycepin and 8-azaadenosine.
  • a modified polyA sequence may comprise: a linker sequence comprising at least ten nucleotides (e.g., U, G, and/or C nucleotides); a first sequence of at least 30 consecutive A nucleotides, which is 5’ of the linker sequence; and a second sequence of at least 70 consecutive A nucleotides, which is 3’ of the linker sequence.
  • a polyA tail comprises the nucleotide sequence of SEQ ID NO: 14 as shown in Example 10.
  • a single-stranded RNA described herein may comprise a 5’ cap, which may be incorporated into such a single-stranded RNA during transcription, or joined to such a singlestranded RNA post-transcription.
  • a single-stranded RNA may comprise a 5’ cap structure for co-transcriptional capping of mRNA. Examples of a cap structure for co-transcriptional capping are known in the art, including, e.g., as described in WO 2017/053297, the entire content of which is incorporated herein by reference for the purposes described herein.
  • a 5’ cap included in a single-stranded RNA described herein is or comprises a capl structure.
  • a master cell bank or a master cell stock may be established.
  • a cell bank or cell stock may be established, for example, by transforming a stock of competent bacterial cells (e.g., E. coli cells) with a pDNA of interest.
  • a pure culture of transformed cells may be produced, for example, by growth on selective medium.
  • a single colony isolate may be selected and grown in liquid culture and, in some embodiments, used to inoculate larger cultures volumes.
  • culture growth is stopped at a predetermined threshold (e.g., optical density (OD) threshold).
  • OD optical density
  • cryoprotectant e.g., glycerol
  • cryoprotectant e.g., glycerol
  • a modified ribonucleotide may have at least one nucleoside ("base") modification or substitution.
  • base nucleoside
  • nucleoside modifications or substitutions are known in the art; one of skill in the art will appreciate that modified nucleosides include, for example, but not limited to synthetic and natural nucleobases such as inosine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine, 2- (halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2- (amino)adenine, 2-(aminoalkyll)adenine, 2- (aminopropyl)adenine, 2-(methylthio)-N6-(isopentenyl)adenine, 6-(alkyl)adenine, 6- (methyl) adenine, 7- (deaza)adenine, 8-(alkenyl)adenine, 8-(alkyl)aden
  • pseudouracil 2- (thio)pseudouracil,4- (thio)pseudouracil, 2,4-(dithio)psuedouracil,5-(alkyl)pseudouracil, 5-(methyl)pseudouracil, 5-(alkyl)- 2- (thio)pseudouracil, 5-(methyl)-2-(thio)pseudouracil, 5-(alkyl)-4 (thio)pseudouracil, 5-(methyl)-4 (thio)pseudouracil, 5-(alkyl)-2,4 (dithio)pseudouracil, 5-(methyl)-2,4 (dithio)pseudouracil, 1 -substituted pseudouracil (e.g., 1-methyl-pseudouridine), C-5 propynyl-uridine, 2-aminoadenosine,
  • a modified nucleotide utilized in IVT systems and/or methods described herein may disrupt binding of an RNA to one or more mammalian (e.g. , human) endogenous RNA sensors (e.g. , innate immune RNA sensors), including, e.g., but not limited to toll-like receptor (TLR)3, TLR7, TLR8, retinoic acid-inducible gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA5), protein kinase R (PKR), 2’ -5’ oligoadenylate synthetase (OAS), and laboratory of genetics and physiology 2 (LGP2), and combinations thereof.
  • mammalian e.g. , human
  • endogenous RNA sensors e.g. innate immune RNA sensors
  • RLR toll-like receptor
  • MDA5 melanoma differentiation-associated gene 5
  • PSR protein kinase R
  • OAS oligoaden
  • modified ribonucleotides may include modifications as described in US 9,334,328, the contents of which are incorporated herein by reference in their entireties for the purposes described herein.
  • Modified nucleosides are typically desirable to be translatable in a host cell (e.g., presence of a modified nucleoside does not prevent translation of an RNA sequence into a respective protein sequence). Effects of modified nucleotides on translation can be assayed, by one of ordinary skill in the art using, for example, a rabbit reticulocyte lysate translation assay.
  • a modified ribonucleotide may include a modified internucleoside linkage.
  • modified internucleoside linkages are known in the art; one of skill in the art will appreciate that non-limiting examples of modified intemucleoside linkages that may be used in technologies provided herein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalky Iphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the
  • Modified internucleoside linkages that do not include a phosphorus atom therein may have internucleoside linkages that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • alkene containing backbones sulfamate backbones
  • sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH2 component parts.
  • a modified ribonucleotide may include one or more substituted sugar moieties.
  • modified sugar moieties are known in the art; one of skill in the art will appreciate that, in some embodiments, a sugar moiety of a ribonucleotide may include one of the following at the 2' position: H (deoxyribose); OH (ribose); F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted.
  • a sugar moiety of a ribonucleotide may include a 2' methoxyethoxy (2'-O- CH2CH2OCH3, also known as 2'-O-(2 -methoxyethyl) or 2-MOE), 2'- dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMA0E, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'0-dimethylaminoethoxyethyl or 2'- DMAEOE), i.e.
  • 2' methoxyethoxy 2'-O- CH2CH2OCH3, also known as 2'-O-(2 -methoxyethyl) or 2-MOE
  • 2'- dimethylaminooxyethoxy i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMA0E
  • a mixture of ribonucleotides that are useful for an in vitro transcription reaction may comprise ATP, CTP, GTP, and Nl-methylpseudouridine-5’ triphosphate (ml TTP).
  • the ratio of ATP, CTP, GTP, and ml TTP for an in vitro transcription reaction is 1:1:1: 1.
  • the ratio of ATP, CTP, GTP, and ml TTP for an in vitro transcription is optimized such that relative proportions of nucleotides correspond to fractions of the respective nucleotides in an mRNA molecule, e.g., as described in the International Patent Publication No. WO 2015188933.
  • an RNA produced by technologies described herein may comprise a cap at its 5’ end.
  • RNA e.g., mRNA
  • addition of a 5' cap to an RNA can facilitate recognition and attachment of the RNA to a ribosome to initiate translation and enhances translation efficiency.
  • a 5' cap can also protect an RNA product from 5' exonuclease mediated degradation and thus increases half-life.
  • a 5’ capping agent may be or comprise a dinucleotide cap analog (including, e.g., a m7GpppG cap analog or an N7-methyl, 2’-O- methyl -GpppG anti-reverse cap analog (ARCA) cap analog or an N7-methyl, 3'-O-methyl-GpppG ARCA cap analog).
  • a 5’ capping agent comprises a 5' N7-Methyl-3'-O-Methylguanosine structure, e.g., CleanCap® Reagents (Trilink BioTechnologies).
  • an in vitro transcription reaction is conducted, e.g., in a bioreactor described herein for a period of time (e.g., as described herein) at a temperature at which a selected RNA polymerase is functionally active.
  • a temperature at which a selected RNA polymerase is functionally active e.g., a selected RNA polymerase is functionally active.
  • typical phage RNA polymerases e.g., T7 polymerases
  • thermostable RNA polymerases e.g., thermostable variants of T7 RNA polymerases such as ones as described in US10519431, the contents of which are incorporated by reference for purposes described herein
  • an in vitro transcription is conducted e.g., in a bioreactor described herein at a pH of about 6, 6.5, 7, 7.5, 8, or 9.
  • a suitable pH for an in vitro transcription may be approximately 7.5 -8.5.
  • an in vitro transcription reaction comprises UTP or a functional thereof at a limiting concentration in combination with at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof.
  • a functional analog of UTP is or comprises Nl- methylpseudouridine-5 ’ triphosphate (ml TTP).
  • ml TTP Nl- methylpseudouridine-5 ’ triphosphate
  • maintaining a low concentration of UTP or functional analog thereof can be useful for reducing generation of double-stranded RNA.
  • UTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that limits the rate of transcription.
  • UTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that is lower than the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof.
  • the starting concentration of UTP or a functional analog thereof is at least 30% lower (including, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof.
  • the ratio of the starting concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof is about 1:1.3 or lower, including, e.g., 1:1.4; 1:1.5; 1:2, 1:2.5; 1:3; 1:3.5; 1:4; 1:4.5; 1:5; 1:6; 1:7; 1:8, 1:9; 1:10; 1:11; 1:12; 1:13; 1:14; 1:15; 1:16; 1:17; 1:18; 1:19; 1:20, or lower.
  • the ratio of the starting concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof is about 1:1.3 to about 1:20, or about 1:1.5 to about 1:15, or about 1:5 to about 1:15, or about 1:8 to about 1:12.
  • the starting concentration of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof may be the same.
  • an in vitro transcription reaction is supplemented at least once with UTP or a functional analog thereof over the course of the reaction.
  • an in vitro transcription reaction is supplemented multiple times (e.g., at least 2 or more, including, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) with UTP or a functional analog thereof over the course of the transcription reaction.
  • supplementation of UTP or a functional analog thereof is performed when its concentration in the reaction mixture is near depletion.
  • supplementation of UTP or a functional analog thereof is performed when its concentration in the reaction mixture is less than 100 uM, 90 uM, 80 uM, 70 uM, 60 uM, 50 uM, 40 uM, 30 uM, 20 uM, 10 uM, 5 uM, 3 uM, 2, uM, 1 uM, 500 nM, 250 nM, 200 nM, 100 nM, 50 nM, 25 nM, or lower.
  • UTP (or a functional analog thereof) supplementation may be performed continuously during the course of the transcription reaction.
  • UTP (or a functional analog thereof) supplementation may be performed in a continuous manner at a rate that is comparable to (e.g., within 10% or lower) of its consumption rate.
  • UTP (or a functional analog thereof) supplementation may be performed at a rate such that after such supplementation, UTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, GTP or functional analog thereof, and/or CTP or functional analog thereof.
  • UTP (or a functional analog thereof) supplementation may be performed periodically during the course of the transcription reaction.
  • UTP (or a functional analog thereof) supplementation may be performed in a periodic manner such that after each addition, UTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, GTP or functional analog thereof, and/or CTP or functional analog thereof.
  • such periodic supplementation may be performed as one or more bolus or batch addition(s), including, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more bolus or batch addition(s).
  • such periodic supplementation may be performed by a fed-batch process.
  • the concentration of UTP or a functional analog thereof added during supplementation is same as the starting concentration of UTP or a functional analog thereof. In some embodiments, the concentration of UTP or a functional analog thereof added during supplementation is lower than the starting concentration of UTP or a functional analog thereof, e.g., at least 10% lower (including, e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of UTP or a functional analog thereof.
  • UTP (or a functional analog thereof) supplementation is performed at a concentration and/or at a rate or manner such that the ratio of the concentration of UTP or a functional analog thereof to the concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof (during the course of the reaction) is maintained substantially the same (e.g., within 10% or less) as the initial ratio of the concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof (at the beginning of the reaction).
  • UTP or a functional analog thereof is supplemented until the end of the transcription reaction.
  • UTP or a functional analog thereof is present in an initial transcription reaction at a starting concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 rnM. In some embodiments, UTP or a functional analog thereof is maintained during the course of an in vitro transcription reaction at a concentration of 0.1 to 2 mM or 0.1 to 1.5 rnM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM.
  • Optional additional non-UTP limitation and/or supplementation' is optionally a concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM.
  • At least one of non-UTP is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription reaction (e.g., the beginning of the in vitro transcription reaction).
  • at least one of ATP or a functional analog thereof, CTP or a functional analog thereof, or GTP or a functional analog thereof is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription reaction (e.g., the beginning of the in vitro transcription reaction).
  • GTP or a functional analog thereof is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription (e.g., the beginning of the in vitro transcription reaction).
  • GTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that limits the rate of transcription. In some embodiments, GTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that is lower than the starting concentration of at least one or all of ATP or a functional analog thereof and/or CTP or a functional analog thereof. In some embodiments, the starting concentration of GTP or a functional analog thereof is at least 30% lower (including, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of at least one or all of ATP or a functional analog thereof and/or CTP or a functional analog thereof.
  • the ratio of the starting concentration of GTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof and/or CTP or a functional analog thereof is about 1:1.3 or lower, including, e.g., 1:1.4; 1:1.5; 1:2, 1:2.5; 1:3; 1:3.5; 1:4; 1:4.5; 1:5; 1:6; 1:7; 1:8, 1:9; 1:10; 1:11; 1:12; 1:13; 1:14; 1:15; 1:16; 1:17; 1:18; 1:19; 1:20, or lower.
  • the ratio of the starting concentration of GTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof and/or CTP or a functional analog thereof is about 1:1.3 to about 1:20, or about 1:1.5 to about 1:15, or about 1:5 to about 1:15, or about 1:8 to about 1:12. In some such embodiments, the starting concentration of ATP or a functional analog thereof and/or CTP or a functional analog thereof.
  • supplementation of GTP or a functional analog thereof is performed when its concentration in the reaction mixture is less than 100 uM, 90 uM, 80 uM, 70 uM, 60 uM, 50 uM, 40 uM, 30 uM, 20 uM, 10 uM, 5 uM, 3 uM, 2, uM, 1 uM, 500 nM, 250 nM, 200 nM, 100 nM, 50 nM, 25 nM, or lower.
  • GTP (or a functional analog thereof) supplementation may be performed continuously during the course of the transcription reaction.
  • GTP (or a functional analog thereof) supplementation may be performed in a continuous manner at a rate that is comparable to (e.g., within 10% or lower) of its consumption rate.
  • GTP (or a functional analog thereof) supplementation may be performed at a rate such that after such supplementation, GTP or functional analog thereof is present in the reaction at a concentration lower than that of ATP or functional analog thereof and/or CTP or functional analog thereof.
  • GTP (or a functional analog thereof) supplementation may be performed periodically during the course of the transcription reaction.
  • GTP (or a functional analog thereof) supplementation may be performed in a periodic manner such that after each addition, GTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, and/or CTP or functional analog thereof.
  • such periodic supplementation may be performed as one or more bolus or batch addition(s), including, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more bolus or batch addition(s).
  • such periodic supplementation may be performed by a fed-batch process.
  • the concentration of GTP or a functional analog thereof added during supplementation is same as the starting concentration of GTP or a functional analog thereof. In some embodiments, the concentration of GTP or a functional analog thereof added during supplementation is lower than the starting concentration of GTP or a functional analog thereof, e.g., at least 10% lower (including, e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of GTP or a functional analog thereof.
  • GTP (or a functional analog thereof) supplementation is performed at a concentration and/or at a rate or manner such that the ratio of the concentration of GTP or a functional analog thereof to the concentration of ATP or a functional analog thereof, and/or CTP or a functional analog thereof (during the course of the reaction) is maintained substantially the same (e.g., within 10% or less) as the initial ratio of the concentration of GTP or a functional analog thereof to the starting concentration of ATP or a functional analog thereof and/or CTP or a functional analog thereof (at the beginning of the reaction).
  • GTP or a functional analog thereof is supplemented until the end of the transcription reaction.
  • GTP or a functional analog thereof is present in an initial transcription reaction at a starting concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM. In some embodiments, GTP or a functional analog thereof is maintained during the course of an in vitro transcription reaction at a concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM.
  • non-UTP supplementation does not include supplementation of CTP or functional analog thereof or ATP or functional analog thereof.
  • non-UTP supplementation can be performed concurrently with UTP supplementation over the course of the reaction.
  • non-UTP or functional analog thereof and UTP or functional analog thereof can be added to a reaction mixture as a single composition.
  • non-UTP or functional analog thereof and UTP or functional analog thereof can be added to a reaction mixture as separate compositions, for example, each at the same or different concentrations and/or each introduced at the same or different flow rates to a reaction mixture).
  • such non-UTP supplementation and UTP supplementation can be performed by different methods, e.g., one is performed continuously (e.g., as described herein) while another is performed periodically (e.g., as described herein).
  • in vitro transcription in accordance with the present disclosure is carried out, e.g., in a bioreactor as described herein, using a fed-batch process and the present disclosure teaches that such fed-batch process may have certain advantages including, for example, ability to maintain one or more reagents or components within a particular concentration range.
  • a fed-batch process may involve multiple additions of a nucleotide that competes with a cap analog (a “competing nucleotide”) such as, e.g., a GTP, in the course of an in vitro transcription reaction, for example to maintain a low concentration of GTP (e.g., 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM) in order to effectively cap a synthesized RNA.
  • a nucleotide such as, e.g., a GTP
  • a fed- batch process may involve supplementation of an in vitro transcription reaction with a competing nucleotide at a ratio between about 1 : 1 and about 1 :50 relative to the concentration of a cap analog in the reaction, e.g., as described in the International Patent Publication No. WO 2006004648.
  • the concentration of a competing nucleotide in an in vitro transcription reaction is maintained at a level that is less than the concentration of a cap analog throughout the reaction but is not a limiting component.
  • a programmable pump may be used.
  • a programmable syringe pump may be used, for example, to automatically perform step-wise addition of one or more reaction components.
  • a monitor e.g., a sensor
  • a monitor may be utilized to detect level(s) of one or more components; in some such embodiments, a monitor may communicate automatically with a pump, for example so that additional feeds may be released upon detection of a reduced amount of such component(s).
  • an in vitro transcription reaction is optimized such that relative proportions of nucleotides correspond to fractions of the respective nucleotides in an mRNA molecule, e.g., as described in the International Patent Publication No. WO 2015188933.
  • a DNA template can be removed or separated from an in vitro transcription RNA composition, for example using methods known in the art, e.g., DNA hydrolysis.
  • DNase e.g., DNase I
  • DNase I may be added to remove or digest or fragment DNA template under appropriate conditions (e.g., in the presence of divalent salt such as a calcium salt and/or incubation at an optimum temperature for DNase).
  • DNA removal is performed for a period of 15-20 minutes, 15-25 minutes, 20-25 minutes, 20-30 minutes, 25-30 minutes, 25-35 minutes, 30-35 minutes, 30-40 minutes, 35-40 minutes, 35-45 minutes, 45-50 minutes, SO- 55 minutes, or 55-60 minutes.
  • DNA removal is performed at a temperature of approximately 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31 °C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, or 45°C.
  • DNA removal is performed at a temperature of 30-40 °C.
  • agitation rate is maintained during DNA removal (e.g., DNA hydrolysis) from the previous IVT step.
  • an RNase inhibitor may be added during DNA removal or digestion to protect RNA from potential degradation.
  • a chelating agent may be added to a DNase- treated transcription mixtures to complex with divalent ions that may be added during in vitro transcription reaction.
  • An exemplary chelating agent may be or comprise ethylenediaminetetraacetic acid (EDTA).
  • EDTA ethylenediaminetetraacetic acid
  • the temperature upon addition of chelating agent, the temperature may be shifted at least 1°C (including e.g., at least 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C or more).
  • an in vitro transcription RNA composition (e.g., in some embodiments after DNA removal and/or digestion) can be subjected to a protein digestion or fragmentation process.
  • an exemplary protein digestion or fragmentation may comprise use of a proteinase (e.g., but not limited to proteinase K).
  • protein digestion utilizes a relative amount of enzyme (e.g., proteinase) to starting IVT volume, for example, at least 0.5 mL/L, at least 0.75 mL/L, at least 1 mL/L, at least 1.25 mL/L, or more.
  • an in vitro transcription RNA composition following in vitro transcription and optional pre-purification processing may be maintained at 2-8°C for a period of time before further processing (e.g. , removal of impurities).
  • the maintained period of time may be at least 6 hours or longer, including, e.g., at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or longer.
  • a RNA preparation may be held in a container, for example, a bag, tube, vial, etc.
  • the container is a polymer-based container (e.g., polyethylene, ethylene vinyl acetate).
  • RNA concentration and/or integrity may be monitored during or after in vitro transcription.
  • RNA concentration may be assessed following purification of an aliquot of a transcription mixture with a commercial kit after in vitro transcription.
  • RNA concentration and/or integrity of a produced RNA solution after in vitro transcription may be assessed before maintaining at 2-8°C for a period of time (e.g., as described herein).
  • an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by an affinity-based purification method, chromatography-based purification methods (e.g., size exclusion chromatography (SEC), high-performance liquid chromatography (HPLC), ion exchange chromatography (EC)), and/or filtration methods (e.g., centrifugal ultrafiltration, membrane filtration, etc.').
  • SEC size exclusion chromatography
  • HPLC high-performance liquid chromatography
  • EC ion exchange chromatography
  • filtration methods e.g., centrifugal ultrafiltration, membrane filtration, etc.'.
  • a solid substrate e.g., magnetic beads or particles coated with a substance or composition that has a high binding affinity for high-molecular weight nucleic acids
  • RNA will bind to the solid substrate, while any other undesirable components present in an RNA transcription mixture, including, e.g., short hydrolyzed DNA fragments, free nucleotide triphosphates (NTPs), 5’ capping agent, proteins, divalent ions complexed with a chelating agent, will remain in solution.
  • a silicate -coated solid substrate e.g. , particles or magnetic beads
  • a silicate -coated solid substrate may be used.
  • a carboxylate-coated solid substrate e.g., particles or magnetic beads
  • an RNA transcription mixture may be divided into a plurality of (e.g., at least two, at least three, at least four, or more) portions such that they can be purified in parallel (e.g., in batch mode).
  • magnetic bead- or particle-based purification (e.g., as described herein) is carried out at room temperature (e.g. , about 18°C-3O°C, e.g. , about 18°C-25°C, or about 20°C-25°C, or about 20- 30°C, or about 23-27°C or about 25°C).
  • magnetic bead- or particle-based purification is performed under a suitable binding condition (e.g., in the presence of salt and organic solvent (e.g., ethanol)).
  • magnetic beads or particles may be added to an RNA transcription mixture with a magnetic bead or particle -to-RNA ratio of approximately 1:1 to 1:5, or 1:1 to 1:3 under a suitable binding condition.
  • the solid substrate can be separated from supernatant.
  • a magnet can be used to retain RNA-bound magnetic beads in a batch reaction vessel, while supernatant is subsequently removed.
  • the RNA is then eluted from the magnetic beads under a suitable eluting condition (e.g., in the presence of a buffer and/or a chelating agent at a suitable pH).
  • a suitable eluting condition e.g., in the presence of a buffer and/or a chelating agent at a suitable pH.
  • such bind-and-elute process may be performed for a number of cycles (e.g. , at least two, at least three, at least four or more cycles).
  • an in vitro transcription RNA composition is divided into aliquots.
  • such RNA aliquots are purified in parallel in batch mode with wash steps prior to the elution of purified RNA.
  • one, two, three, four, five, or six wash steps are carried out.
  • different buffers are utilized in different wash steps.
  • the same solution is utilized in initial wash step or steps and a different solution is utilized in a final wash step.
  • RNA bound magnetic beads can be washed in multiple steps (e.g., three consecutive steps) with a first wash buffer comprising an organic solvent (e.g., ethanol) and a salt (e.g., sodium salt).
  • such a first wash buffer may comprise a 20-40% (v/v) ethanol/O.lM- 1M NaCl.
  • RNA bound magnetic beads can be further subjected to a final wash with an organic solvent (e.g., 80% ethanol).
  • RNA that is bound on magnetic beads is subsequently eluted (e.g., after wash steps) by addition of an elution buffer.
  • an elution buffer comprises a chelating agent to complex and thus remove residual divalent ions (e.g., magnesium and/or calcium ions) that may be added during RNA synthesis process.
  • an elution buffer may comprise EDTA. While a skilled artisan will be able to select an appropriate buffer for elution, in some embodiments, an elution buffer may comprise HEPES buffer. In some embodiments, an elution buffer is a buffer selected for use in a pharmaceutical-grade composition comprising RNA.
  • an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by a chromatography method.
  • a chromatography purification method may be performed with a chromatographic method known in the art (e.g. HPLC, SEC, IEC, etc.), wherein components of a mixture travel through a stationary phase at different speeds, resulting in separation from one another.
  • a variety of solid substrates e.g., beads, particles, microspheres, resins, etc.
  • silica silica, dextran polymers, agarose, polyacrylamide, etc.
  • a solid substrate has properties such that, in accordance with the present disclosure, permits a different retention time for RNA relative to any other undesirable components present in an RNA transcription mixture, including, e.g., short hydrolyzed DNA fragments, free nucleotide triphosphates (NTPs), 5’ capping agent, proteins, divalent ions complexed with a chelating agent.
  • NTPs free nucleotide triphosphates
  • 5’ capping agent proteins, divalent ions complexed with a chelating agent.
  • an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by high performance liquid chromatography (HPLC).
  • HPLC high performance liquid chromatography
  • RNA is purified by HPLC using a column matrix of alkylated non- porous polystyrene -divinvylbenzene copolymer microspheres, e.g., in triethylammonium acetate (TEAA) buffers, e.g., as described in Kariko et al. “Generating the optimal mRNA for therapy: HPLC purification eliminates immune activation and improves translation of nucleoside-modified, protein-encoding mRNA” Nucleic Acids Res.
  • TEAA triethylammonium acetate
  • RNA content from desired fractions is concentrated and/or desalted (e.g., in some embodiments, using centrifugal filtration).
  • RNA is recovered by precipitation.
  • RNA is purified by HPLC using a diethylaminoethyl anion exchange column, e.g., as described in Anderson et al. “HPLC purification of RNA for crystallography and NMR” RNA. 1996;2(2): 110-117.
  • buffer comprising salt and sodium acetate is used for RNA elution.
  • RNA from RNA containing fractions is precipitated (e.g., by ethanol precipitation) and dried to a powder.
  • a dried powder comprising RNA is re-suspended, for example, in water.
  • HPLC is not used to purify an in vitro transcription RNA composition.
  • precipitation is not used to purify an in vitro transcription RNA composition.
  • an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by size exclusion chromatography (SEC).
  • SEC size exclusion chromatography
  • RNA is purified by using a gel filtration matrix, e.g., as described in Lukavsky and Puglisi. “Large-scale preparation and purification of polyacrylamide-free RNA oligonucleotides” RNA. 2004;10(5):889-893. doi:10.1261/rna.5264804.
  • fractions are collected and/or analyzed by denaturing polyacrylamide gel electrophoresis.
  • RNA-containing fractions are combined.
  • RNA-containing fractions are concentrated, for example, using centrifugal filtration.
  • filtered RNA is washed twice with buffer (e.g. , 10 mM sodium phosphate, pH 6.4).
  • buffer e.g. 10 mM sodium phosphate, pH 6.4.
  • RNA is concentrated a second time.
  • RNA concentration process e.g., centrifugal filtration
  • RNA is washed again (e.g., 1 additional wash, 2 additional washes, 3 additional washes, etc.) with buffer (e.g., 10 mM sodium phosphate, pH 6.4).
  • a final concentration step is conducted using centrifugal filtration.
  • an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by ion-exchange chromatography (IEC).
  • RNA is purified by applying a transcription reaction mixture to a pre-equilibrated column and eluted using a linear salt gradient (e.g., using sodium chloride), e.g., as described in Koubek et al. “Strong anion-exchange fast performance liquid chromatography as a versatile tool for preparation and purification of RNA produced by in vitro transcription” RNA. 2013; 19(10): 1449-1459. doi:10.1261/rna.038117.113) .
  • fractions are collected.
  • RNA is purified by directly applying a transcription reaction mixture to a Sepharose column (e.g. , a diethylaminoethanol (DEAE) Sepharose column).
  • a Sepharose column e.g. , a diethylamino
  • an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by membrane filtration.
  • Membrane filtration is a separation technique widely used in the life science separation/purification. Depending on membrane porosity, it can be classified as a microfiltration or ultrafiltration process.
  • Microfiltration membranes with pore sizes typically between 0.1 pm and 10 pm, are generally used for clarification, sterilization, and/or removal of microparticulates, while ultrafiltration membranes, with much smaller pore sizes between 0.001 and 0.1 pm, can be useful for removing, concentrating and/or desalting dissolved molecules (proteins, peptides, nucleic acids, carbohydrates, and other biomolecules), exchanging buffers, and gross fractionation.
  • ultrafiltration membranes are typically classified by molecular weight cutoff (MWCO) rather than pore size.
  • MWCO molecular weight cutoff
  • filtration membranes can be of different suitable materials, including, e.g., polymeric, cellulose, ceramic, etc., depending upon the application. In some embodiments, membrane filtration may be more desirable for large-volume purification process.
  • DFF Direct Flow Filtration
  • TFF Tangential Flow Filtration
  • an in vitro transcription RNA composition can be purified by membrane filtration may be purified by a process comprising direct flow filtration.
  • an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by a process comprising tangential flow filtration (TFF).
  • a filtration membrane with an appropriate molecular weight cut-off (MWCO) may be selected for TFF.
  • the MWCO of a TFF membrane determines which solutes can pass through the membrane (i.e. into the filtrate) and which are retained (i.e. in the retentate).
  • the MWCO of a TFF membrane used in accordance with the present disclosure is selected such that substantially all of the solutes of interest (e.g.
  • desired synthesized RNA species remains in the retentate, whereas undesired components (e.g., excess ribonucleotides, small nucleic acid fragments such as digested or hydrolyzed DNA template, peptide fragments such as digested proteins and/or other impurities) pass into the filtrate.
  • undesired components e.g., excess ribonucleotides, small nucleic acid fragments such as digested or hydrolyzed DNA template, peptide fragments such as digested proteins and/or other impurities
  • the retentate comprising desired synthesized RNA species may be re-circulated to a feed reservoir to be re-filtered in additional cycles.
  • a TFF membrane may have a MWCO of at least 30 kDa (including, e.g., at least 40 kDa, at least 50 kDa, at least 60 kDa, at least 70 kDa, at least 80 kDa, at least 90 kDa, or more). In some embodiments, a TFF membrane may have a MWCO of at least 100 kDa (including, e.g., at least 150 kDa, at least 200 kDa, at least 250 kDa, at least 300 kDa, at least 350 kDa, at least 400 kDa, or more).
  • a TFF membrane may have a MWCO of about 250-350 kDa.
  • a TFF membrane e.g., a cellulose-based membrane
  • a filtration membrane that is particularly useful for TFF purification in accordance with the present disclosure is or comprises a cellulose -based membrane.
  • a filtration membrane is not a thermoplastic membrane (e.g., polysulfone or poly ether sulfone).
  • a filtration membrane is a filter cassette.
  • TFF is performed at a transmembrane pressure that is less than, for example, 2 bar (including, e.g., less than 2 bar, less than 1.9 bar, less than 1.8 bar, less than 1.7 bar, less than 1.6 bar, less than 1.5 bar, less than 1.4 bar, less than 1.3 bar, less than 1.2 bar, less than 1.1 bar, less than 1.0 bar, less than 0.9 bar, less than 0.8 bar, less than 0.7 bar, less than 0.6 bar, or lower). In some embodiments, TFF is performed at a transmembrane pressure in a range of about 0.5 bar to 2 bar. In some embodiments, TFF is performed at a transmembrane pressure of about 1 bar.
  • TFF is performed with a feed flow rate of less than, for example, 400 liters/m 2 /hour (LMH) (including, e.g., less than 400 LMH, less than 350 LMH, less than 300 LMH, less than 250 LMH, less than 200 LMH, less than 150 LMH, less than 100 LMH, or less). In some embodiments, TFF is performed with a feed flow rate of about 75 LMH to about 500 LMH, or about 50 LMH to about 400 LMH.
  • LMH 400 liters/m 2 /hour
  • an in vitro transcription RNA composition following RNA transcription that is subject to TFF purification has not be treated with a protein denaturing agent such as, e.g. , urea, guanidinium chloride thiocyanate, salts of alkali metals (e.g., potassium chloride), sodium dodecyl sulfate, sarcosyl, and combinations thereof.
  • a protein denaturing agent such as, e.g. , urea, guanidinium chloride thiocyanate, salts of alkali metals (e.g., potassium chloride), sodium dodecyl sulfate, sarcosyl, and combinations thereof.
  • a purification buffer may be fed into a TFF process in addition to an RNA preparation comprising an RNA transcription mixture.
  • the choice and composition of the purification buffer may influence the efficiency of RNA purification, levels of protein aggregation, RNA-protein separation, and/or RNA stability.
  • Typical buffers may include Tris buffer and citrate buffers.
  • a purification buffer that may be particularly useful for TFF purification in accordance with the present disclosure may be or comprise HEPES buffer.
  • a purification buffer may further comprise a chelating agent (e.g., as described herein) and/or a salt(s) (e.g., ammonium acetate, ammonium sulfate, potassium acetate, potassium chloride, potassium sulfate, sodium acetate, sodium chloride, and/or sodium sulfate).
  • a chelating agent e.g., as described herein
  • a salt(s) e.g., ammonium acetate, ammonium sulfate, potassium acetate, potassium chloride, potassium sulfate, sodium acetate, sodium chloride, and/or sodium sulfate.
  • TFF purification may be performed without a buffer change.
  • TFF purification is performed in a buffer that has been utilized for in vitro transcription; in some such embodiments, TFF purification may be performed in a HEPES buffer.
  • a TFF purification process may comprise at least two separate steps of tangential flow filtration.
  • a first step of tangential flow filtration and a second step of tangential flow filtration may utilize different buffers.
  • an in vitro transcription RNA composition described herein (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be subjected to a suitable purification method known to one of ordinary skill in the art.
  • an in vitro transcription RNA composition described herein can be subjected to precipitation followed by membrane filtration (e.g., as described in WO2015164773).
  • an in vitro transcription RNA composition described herein can be subjected to one or more steps of TFF, wherein at least one or more steps of TFF comprises use of a TFF membrane cassette (e.g., as described in WO2016193206).
  • an in vitro transcription RNA composition described herein can be subjected to a high salt condition chromatography (e.g., by hydrophobic interaction chromatography).
  • an in vitro transcription RNA composition described herein can be a crude RNA reaction IVT mixture or high performance liquid chromatography purified RNA which is subsequently subjected to a high salt condition chromatography (e.g., as described in WO2018096179).
  • an in vitro transcription RNA composition described herein can be subjected to filtering centrifugation.
  • an RNA is precipitated prior to centrifugation (e.g., as described in WO2018157141).
  • an in vitro transcription RNA composition described herein can be subjected to a stirred cell or agitated Nutsche filtration device.
  • a high concentration of salt is added to a RNA composition to denature and solubilize contaminating proteins prior to subjection to a stirred cell or agitated Nutsche filtration device (e.g., as described in WO2018157133).
  • an in vitro transcription RNA composition described herein can be subjected to standard flow filtration (e.g., a filtration process in which the material to be purified flows in a direction normal, i.e. perpendicular, to the surface of the filter).
  • RNA is precipitated prior to standard flow filtration (e.g., as described in W02020041793).
  • an in vitro transcription RNA composition described herein can be subjected to precipitation in a buffer comprising high concentration of salts (e.g., guanidinium salts) and a detergent (e.g., as described in W02020097509).
  • an in vitro transcription RNA composition described herein can be subjected to a protein digestion or fragmentation process prior to one or more additional purification methods known in the art (including, e.g., precipitation, affinity-based purification, ion exchange chromatography methods, high performance liquid chromatography, hydrophobic interaction chromatography, size exclusion-based methods such as size exclusion chromatography, filtration methods such as, e.g., centrifugal ultrafiltration and/or membrane filtration (e.g., direct flow filtration or tangential flow filtration), etc., or combinations thereof).
  • an exemplary protein digestion or fragmentation may comprise use of a proteinase (e.g., but not limited to proteinase K).
  • an in vitro transcription RNA composition described herein can be subjected to a method of removing or reducing bioburden (e.g., microbial contamination).
  • a method for bioburden removal or reduction may be or comprise filtration.
  • filtration may be or comprise gravity filtration.
  • gravity filtration may be performed using a filter with pore size that is small enough to capture bioburden (e.g., a filter with 0.45 pm pore size or smaller, a filter with 0.2 pm pore size or smaller).
  • filtration may be performed using a 0.45 pm pore filter.
  • filtration may be performed using a 0.2 pm pore filter. In some embodiments, filtration may be performed first using a 0.45 pm pore filter and subsequently using a 0.2 pm pore filter. In some embodiments, filtration may be performed first using a 0.2 pm pore filter and subsequently using a 0.45 pm pore filter.
  • an in vitro transcription RNA composition described herein can be subjected to at least one or more of purification methods described herein, including, e.g., bind-and elute process (e.g., utilizing solid substrate with high RNA affinity such as magnetic bead-based purification, membrane filtration (e.g., tangential flow filtration), and/or filtration (e.g., gravity filtration).
  • purification methods described herein including, e.g., bind-and elute process (e.g., utilizing solid substrate with high RNA affinity such as magnetic bead-based purification, membrane filtration (e.g., tangential flow filtration), and/or filtration (e.g., gravity filtration).
  • an in vitro transcription RNA composition described herein may be purified by magnetic -bead-based purification (e.g., as described herein) followed by bioburden filtration (e.g., as described herein), to produce an RNA transcript preparation.
  • an in vitro transcription RNA composition described herein may be purified by a TFF process that may comprise one or a plurality of (e.g., at least two) TFF steps (e.g., as described herein) followed by bioburden filtration (e.g., as described herein), to produce an in vitro transcription RNA composition.
  • purification methods described herein can be sufficient to remove or reduce residual host cell proteins by a factor of at least 100, 200, 250, 300, 350, 400, 450, 500, 550, or 600.
  • a starting RNA in vitro transcription mixture contains an amount of host cell proteins of approximately 400 ng/mg RNA
  • subsequent purification of the RNA by a reduction factor of 400 decreases this amount theoretically to 1 ng/mg RNA.
  • Residual host cell proteins e.g., residual bacterial host cell proteins such as E.
  • coli proteins may be present in an in vitro transcription RNA composition as impurity from a DNA template or as a recombinant protein expressed in host cells.
  • recombinant proteins may include recombinant enzymes added during in vitro transcription, including, e.g., RNA polymerase, pyrophosphatase, DNases, and/or RNase inhibitors.
  • an in vitro transcription RNA composition described herein (e.g., in some embodiments after DNA removal and/or digestion) after one or more purification methods described herein can be maintained at 2-8 °C for a period of time before further purification/processing.
  • the maintained period of time may be at least 6 hours or longer, including, e.g., at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or longer.
  • RNA concentration and/or integrity of an in vitro transcription RNA composition may be monitored during or after each purification method described herein.
  • RNA concentration and/or integrity of an in vitro transcription RNA composition may be assessed before or after maintaining at 2-8°C for a period of time (e.g., as described herein).
  • impurities such as Fe 2+ can be derived from magnetic beads.
  • residual Fe 2+ ions in an in vitro transcription RNA composition can be analyzed.
  • filter integrity after gravity filtration may be assessed.
  • an RNA transcript preparation ⁇ e.g., as described herein may comprise RNA at a concentration of at least 1 mg/mL (including, e.g.. at least 1.5 mg/mL, at least 2 mg/mL, at least 2.5 mg/mL, at least 3 mg/mL, at least 3.5 mg/mL, at least 4 mg/mL, at least 4.5 mg/mL, at least 5 mg/mL, at least 6 mg/mL, or higher).
  • an RNA transcript preparation may comprise RNA at a concentration of 1.5 mg/mL to 5 mg/mL or 2 mg/mL to 4 mg/mL.
  • an RNA transcript preparation may comprise an aqueous buffer.
  • An exemplary aqueous buffer may comprise HEPES ⁇ e.g., at a concentration of 5 mM- 15 mM) at an RNA-compatible pH ⁇ e.g., pH 7.0).
  • an RNA transcript preparation may comprise a chelating agent, e.g., EDTA.
  • an RNA transcript preparation ⁇ e.g., as described herein may be characterized to determine one or more ⁇ e.g., at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or more) product quality attributes of RNA drug substance.
  • product quality attributes include, but are not limited to appearance, RNA length, identity of drug substance as RNA, RNA integrity, RNA sequence, RNA concentration, pH, osmolality, residual DNA template, residual double stranded RNA, bacterial endotoxins, bioburden, degree of capping, presence and composition of poly(A)-tail, nucleotide composition, secondary and tertiary structure, residual salt contaminants, protein contamination, residual solvent contamination, residual bacterial DNA contamination, and combinations thereof.
  • a skilled artisan will understand that various methods known in the art can be used to characterize such product quality attributes, certain examples of which are described below with exemplary release and/or acceptance criteria.
  • an RNA transcript preparation ⁇ e.g., as described herein) that has been determined to meet a set of pre-determined acceptance criteria can be maintained for further steps of manufacturing, and/or formulation and/or distribution.
  • a qualified RNA transcript preparation can be dispensed in a bioprocessing bag ⁇ e.g., with a bag chamber volume of at least 5 L, including, e.g., at least 6 L, at least 7 L, at least 8 L, at least 9 L, at least 10 L, at least 15 L, at least 20 L, at least 25 L, or more).
  • a RNA preparation can be dispensed in a bioprocessing processing polymer bag, e.g., comprising ethylene vinyl acetate copolymer, polyethylene copolymer.
  • predetermined specifications are not met ⁇ e.g., post-integrity filter testing, integrity of holding vessel post-sterile filtration) and refiltration may be utilized.
  • a RNA preparation may be refiltered ⁇ e.g., through a filter).
  • refiltration is performed in the same manner as the initial final filtration.
  • re filtration is performed in a different manner than the initial final filtration.
  • each RNA transcript preparation can be manufactured, filled, and stored as an independent batch, e.g. RNA from one production run forms one batch of composition comprising RNA.
  • each batch can be identified by a unique batch number.
  • an RNA transcript preparation can be transported from its manufacturing facility for further characterization and/or processing.
  • RNA preparation(s) are transported from its manufacturing facility in a container, for example, a bag, tube, vial, etc.
  • a RNA preparation may be transported in a bioprocessing polymer bag, e.g., comprising ethylene vinyl acetate copolymer.
  • a RNA preparation is held in a container with a volume of at least 4 L, at least 5 L, at least 10 L, at least 15 L, or larger.
  • a RNA preparation may be transported at a refrigerated or frozen temperature, e.g., at least less than or equal to 15°C, 10°C, 5°C, 0°C, -5°C, -10°C, - 15°C, -20°C or less for a period of time (e.g., up to 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 hours or more).
  • a freezing process may utilize controlled freeze equipment and/or temperature controlled freezers.
  • monitoring one or more of the parameters described herein may improve product output and/or provide increased reproducibility of composition comprising RNA between batches.
  • an exemplary process to produce an RNA transcript preparation involves a three step process comprising cell-free in vitro transcription from a DNA template, purification of in vitro transcription product, and concentration adjustment and filtration as outlined in Figure 4.
  • RNA quality control may be performed and/or monitored at any time during production process of RNAs and/or compositions comprising the same.
  • RNA quality control parameters including one or more of RNA identity (e.g., sequence, length, and/or RNA natures), RNA integrity, RNA concentration, residual DNA template, and residual dsRNA, may be assessed and/or monitored after each or certain steps of an RNA manufacturing process, e.g., after in vitro transcription, and/or each purification step.
  • RNAs e.g., produced by in vitro transcription
  • compositions comprising RNAs can be assessed under various test storage conditions, for example, at room temperatures vs. refrigerated or sub-zero temperatures over a period of time (e.g., at least 3 months, at least 6 months, at least 9 months, at least 12 months, or longer).
  • RNAs e.g., ones described herein
  • compositions thereof may be stored stable at a fridge temperature (e.g.
  • RNAs e.g., ones described herein
  • compositions thereof may be stored stable at a sub-zero temperature (e.g., - 15°C or below) for at least 1 month or longer including, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months or longer.
  • a sub-zero temperature e.g., - 15°C or below
  • RNAs e.g., ones described herein
  • compositions thereof may be stored stable at room temperature (about 18°C- 30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C) for at least 1 month or longer.
  • one or more assessments as described in Example 4 may be utilized during manufacture, or other preparation or use of RNAs (e.g., as a release test).
  • one or more quality control parameters may be assessed to determine whether linear DNA templates described herein meet or exceed acceptance criteria (e.g., for subsequent IVT).
  • quality control parameters may include, but are not limited to, DNA concentration, DNA identity, identity of transcribed region, identity of PolyA tail, plasmid topology, residual host cell RNA, residual host cell DNA, residual selection drug, appearance, coloration, pH, polyA tail integrity, linearization efficiency, residual protein, bioburden, and/or endotoxins.
  • Certain methods for assessing linear DNA template quality are known in the art; for example, one of skill in the art will recognize that in some embodiments, one or more analytical tests can be used for DNA quality assessment. Examples of such analytical tests may include, but are not limited to, gel electrophoresis, sequencing, and/or UV absorption.
  • one or more quality control parameters may be assessed to determine whether RNAs described herein meet or exceed acceptance criteria (e.g., for subsequent formulation and/or release for distribution).
  • quality control parameters may include, but are not limited to RNA integrity, RNA concentration, residual DNA template and/or residual dsRNA.
  • Certain methods for assessing RNA quality are known in the art; for example, one of skill in the art will recognize that in some embodiments, one or more analytical tests can be used for RNA quality assessment. Examples of such certain analytical tests may include but are not limited to gel electrophoresis, UV absorption, and/or PCR assay.
  • a batch of RNAs may be assessed for one or more features as described herein to determine next action step(s). For example, a batch of RNAs can be designated for one or more further steps of manufacturing and/or formulation and/or distribution if RNA quality assessment indicates that such a batch of RNAs meet or exceed the relevant acceptance criteria. Otherwise, an alternative action can be taken (e.g., discarding the batch) if such a batch of single stranded RNAs does not meet or exceed the acceptance criteria.
  • a batch of RNAs that satisfy assessment results can be utilized for one or more further steps of manufacturing and/or formulation and/or distribution.
  • manufacturing methods described herein may further comprise monitoring one or more features of a RNA preparation including, e.g., appearance, identity (RNA length), identity (as RNA), RNA integrity, RNA sequence, content (RNA concentration), pH, osmolality, residual DNA template, residual double-stranded RNA (dsRNA), bacterial endotoxins, bioburden, degree of capping, presence and composition of poly(A)-tail, nucleotide composition, secondary and tertiary structure, residual salt contamination, protein contamination, bacterial DNA contamination and/or residual solvent contamination.
  • at least one or more features e.g.
  • At least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen) described herein can be characterized and/or monitored for quality control.
  • RNA substance appearance of RNA substance is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, visual inspection is utilized to monitor appearance.
  • an RNA substance is clear ( ⁇ 6 NTU, ⁇ 5 NTU, ⁇ 4 NTU, or ⁇ 3 NTU). In some embodiments, an RNA substance is a colorless liquid. In some embodiments, an RNA substance is a clear ( ⁇ 6 NTU) and colorless liquid.
  • RNA length is determined by denaturing agarose gel electrophoresis in comparison to a standard ladder with RNAs of known lengths. In some embodiments, sizes obtained must be consistent with theoretically expected lengths, e.g., transcripts from the respective DNA template used, and with reference RNAs.
  • the electrophoresis gel is a precast and buffered agarose gel prestained with a nucleic-acid specific dye.
  • RNA identity is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, RNA identity is determined by incubating an RNA sample for a defined period of time with an RNase, separating by gel-electrophoresis, and comparing to an RNA sample that has been incubated under identical conditions except for the addition of RNase. In some embodiments, disappearance of the RNA band upon incubation with RNase verifies the identity as RNA. In some embodiments, gel-electrophoresis is completed on a precast and pre-stained agarose gel. In some embodiments, the RNase is RNase A.
  • RNA identity is determined by reverse transcribing (RT) said RNA into cDNA and amplifying said cDNA (e.g., by PCR) using primers and/or a probe specific to the cDNA sequence.
  • RT-PCR is conducted in a single-step.
  • RNA integrity is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, RNA integrity can be assessed and/or monitored by agarose gel electrophoresis. In some embodiments, RNA integrity can be assessed and/or monitored by capillary gel electrophoresis. In some embodiments, RNA integrity can be quantitatively determined using capillary electrophoresis. In some embodiments, RNA solution must give rise to a single peak at the expected retention time consistent with the expected lengths as compared to the retention times of a standard ladder. In some embodiments, RNA integrity is above 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, quantification of the main RNA peak is calculated in relation to signal intensities in the electropherogram where degradation products are detectable.
  • the sequence of RNA is assessed and/or monitored (e.g., determined at one or more points over time).
  • the RNA sequence can be deduced from sequencing the DNA template which serves as a template for in vitro transcription and defines the primary structure of each RNA.
  • identity of the starting material, and thus the identity of the transcribed RNA is controlled by automated sequencing of the RNA encoding region of the template.
  • RNA sequence is determined by reverse transcribing said RNA into cDNA, amplifying (e.g., by PCR), and sequencing the amplified product.
  • RT-PCR is conducted in a single-step.
  • the sequencing method is Sanger sequencing.
  • the sequencing method is next generation sequencing.
  • the sequence of an RNA has 100% identity to the corresponding DNA from which it was generated.
  • RNA sequence is determined by RNA sequencing using Next Generation Sequencing technology (e.g., Illumina MiSeq).
  • the sequence of RNA can be determined by liquid chromatography tandem mass spectrometry (LC/MS/MS)-oligonucleotide mapping.
  • LC/MS/MS liquid chromatography tandem mass spectrometry
  • an RNA preparation is fragmented (e.g., by RNase) and separated (e.g., by liquid chromatography).
  • major and minor peaks in the oligonucleotide map can be identified, for example, by MS/MS. Observed masses and MS/MS fragmentation patterns of oligonucleotides in each peak can be mapped to expected RNA fragments.
  • oligonucleotide maps can be assigned via software using decoy sequences to confirm correct peak assignments.
  • protein size after expression of a RNA preparation or RNA preparation(s) are evaluated using Western blot.
  • expressed protein size is compared to that of a known protein standard.
  • RNA concentration is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, RNA concentration is determined using UV absorption spectrophotometry. In some embodiments, RNA concentration is determined according to the method described within Ph. Eur. 2.2.25. In some embodiments, a desirable RNA concentration can vary with the batch scale. For example, a high RNA concentration may be desirable for a large-scale manufacturing process.
  • an RNA concentration may be at least 1 mg/mL (including, e.g., at least 1.5 mg/mL, at least 2 mg/mL, at least 2.5 mg/mL, at least 3 mg/mL, at least 3.5 mg/mL, at least 4 mg/mL, at least 4.5 mg/mL, at least 5 mg/mL, at least 6 mg/mL, or higher).
  • an RNA concentration may be 1.5 mg/mL to 5 mg/mL or 2 mg/mL to 4 mg/mL.
  • pH value of the RNA solution is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, the pH value is determined according to the method described within Ph. Eur. 2.2.3. In some embodiments, pH value of the RNA solution is 6-8.
  • osmolality of an RNA solution is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, osmolality of an RNA solution is determined according to the method described within Ph. Eur. 2.2.35. In some embodiments, osmolality of an RNA solution is less than 500 mOsmol/kg, 400 mOsmol/kg, 300 mOsmol/kg, 200 mOsmol/kg, 100 mOsmol/kg, or lower. In some embodiments, osmolality of an RNA solution may be less than 200 mOsmol/kg.
  • residual DNA template is assessed and/or monitored (e.g., determined at one or more points over time).
  • residual DNA template content is assessed and/or monitored (e.g., determined at one or more points over time) using, for example, PCR, absorbance, fluorescent dyes, and/or or gel electrophoresis.
  • residual DNA template content is determined using a real-time quantitative PCR (qPCR) test method.
  • qPCR is completed using a pre -mixed Sybr Green master mix according to the manufacturer’s recommendations.
  • the amplification and detection of DNA is performed in a real-time thermocycler.
  • residual DNA template in a sample is quantified in comparison to a standard or reference.
  • a standard is a serial dilution of pDNA.
  • results are reported in ng DNA/mg RNA.
  • the qPCR method comprises one or more of using a pre-mixed Sybr Green master mix according to the manufacturer’s recommendations, amplifying and detecting DNA in a real-time thermocycler, and quantifying residual DNA template in comparison to a standard (serial dilution of plasmid DNA).
  • residual dsRNA can be assessed and/or monitored (e.g., determined at one or more points over time).
  • residual dsRNA level is determined using a test limit. For example, RNA samples and a dsRNA reference (2000 pg dsRNA/pg RNA, 1500 pg dsRNA/pg RNA, 1000 pg dsRNA/pg RNA, 500 pg dsRNA/pg RNA, or lower) representing the upper limit of accepted residual dsRNA content) are immobilized on a positively charged nylon membrane and incubated with a dsRNA-specific monoclonal antibody.
  • a dsRNA reference 2000 pg dsRNA/pg RNA, 1500 pg dsRNA/pg RNA, 1000 pg dsRNA/pg RNA, 500 pg dsRNA/pg RNA, or lower
  • HRP horseradish peroxidase
  • ECL enhanced chemiluminescence
  • HRP-conjugated secondary is an anti-mouse IgG secondary.
  • bacterial endotoxins are assessed and/or monitored (e.g., determined at one or more points over time), for example, using an analytical kinetic turbidimetric limulus amebocyte lysate (LAL) procedure.
  • Gram-negative bacterial endotoxins are assessed and/or monitored (e.g., determined at one or more points over time).
  • Gram-negative bacterial endotoxins are determined to have an acceptable level if the acceptance criteria in regional pharmacopoeia (e.g., Ph. Eur. 2.6.14, USP ⁇ 85>, JP 4.01) are met when the level of Gram-negative bacterial endotoxins is determined according to the method described therein.
  • RNA solutions have ⁇ 12.5 EU/mL (including, e.g., ⁇ 10 EU/mL, ⁇ 7.5 EU/mL, or ⁇ 5.0 EU/mL) of bacterial endotoxins.
  • bioburden is assessed and/or monitored (e.g., determined at one or more points over time) using a membrane filtration method.
  • bioburden is determined to have an acceptable level if the acceptance criteria in regional pharmacopoeia (e.g., Ph. Eur. 2.6.12, USP ⁇ 61>, JP 4.05) are met when the bioburden is determined according to the method described therein.
  • bioburden of an RNA solution is ⁇ 1 CFU per 10 mL.
  • bioburden of an RNA solution is ⁇ 100 CFU per 10 mL when assessed prior to, or during, the process of removing impurities.
  • percentage of capped RNA can be assessed and/or monitored (e.g., determined at one or more points over time).
  • characterization of percentage of capped RNA is conducted by an RNase based assay.
  • characterization of percentage of capped RNA comprises one or more of the following steps: annealing RNA samples to a probe or probes binding close to the 5’ end of the RNA, digesting the RNA-probe complex with RNase generating a short fragment corresponding to the 5’ part of the RNA, purifying for sample clean-up, subjecting the purified samples with the 5’ part of the RNA to mass spectrometry (MS), capped and non-capped species are identified, and/or the percentage of capped RNA is calculated.
  • MS mass spectrometry
  • percentage of capped RNA is characterized by an RNase H based assay.
  • characterization of percentage of capped RNA comprises one or more of the following steps: annealing RNA samples to customized biotinylated nucleic acid probe binding close to the 5’ end of the RNA, digesting the RNA- probe complex with RNase H generating a short fragment corresponding to the 5’ part of the RNA, purifying the sample for sample clean-up with streptavidin-coated spin columns or magnetic beads, subjecting the purified samples with the 5’ part of the RNA to LC-MS, identifying capped and noncapped species by the observed mass values, and calculating the percentage of capped RNA using MS signals.
  • an RNase is RNase H.
  • a probe is a customizable biotinylated nucleic acid probe.
  • a purification step comprises use of streptavidin coated spin columns.
  • purification comprises use of magnetic beads.
  • the 5’ part of an RNA is subjected to LC-MS.
  • capped and/or noncapped species can be identified by the observed mass values.
  • MS signals are used to calculate percentage of capped RNA.
  • percentage of capped RNA can be assessed and/or monitored by contacting a RNA preparation with a DNA oligonucleotide complementary to a sequence in the 5’ untranslated region of a RNA adjacent to the cap or the uncapped penultimate base of RNA under conditions that permit annealing of the DNA oligonucleotide to the sequence, providing one or more nucleases that selectively degrade DNA/RNA hybrid and/or unannealed RNA, resulting in capped and uncapped fragments, separating capped and uncapped fragments by chromatography, and determining relative amount of capped and uncapped fragments (e.g., as described in EP2971102).
  • measurement of the percentage of polyadenylation attached to the 3’ end of the RNA construct uses droplet digital PCR (ddPCR) and comprises one or more of the following steps: generating cDNA using a reverse transcription primer that spans the polyA and 3’ sequence of the RNA construct and requires both for binding, and/or quantitating based on normalization to the theoretical input of the test sample as measured by UV absorption at 260 nm.
  • polyadenylation is characterized by liquid chromatography-spectrometry (LC-MS).
  • LC-MS utilizes a particular detector (e.g., an ultraviolet detector).
  • a polyA tail of a RNA is cleaved off (e.g., by a ribonucleases) and isolated, for example, by affinity purification.
  • the higher order structure of an RNA preparation is assessed and/or monitored (e.g., determined at one or more points over time).
  • higher order structure is evaluated using circular dichroism (CD) spectroscopy.
  • a CD spectrum is a measure of differential absorption of the left- and right-circularly polarized light by the test article (e.g., RNA preparation).
  • the ordered structure of RNA yields a CD spectrum that may contain positive and/or negative signals, while absence of CD signal is indicative of a lack of ordered structure.
  • a CD spectrum for a RNA preparation exhibits an expected profile for an RNA molecule (e.g., contains both negative and positive signals between approximately 200 and 300 nm), indicating quality of folding.
  • RNA preparation comprises 5% or less, 4% or less, 3% or less, 2% or less, 1% or less, or is substantially free of salt contaminants.
  • protein contamination is assessed and/or monitored.
  • protein content in an RNA preparation is determined using one or more of UV absorbance at 280 nm (due to presence of aromatic amino acids), a Lowry assay, a Bradford assay and/or a Bichinonic Acid assay.
  • an RNA preparation comprises less than a predetermined threshold of protein contamination.
  • bacterial DNA contamination is assessed and/or monitored.
  • residual bacterial DNA may be detected by PCR or quantitative PCR using primers and/or probes specific for bacterial genomic sequences.
  • technologies provided by the present disclosure achieve production of LNP preparations (e.g., pharmaceutical-grade LNP preparations, including large batch preparations), in particular including nucleic acids, e.g., RNA.
  • the present disclosure includes technologies for manufacturing a pharmaceutical-grade LNP that include, for example, (i) generating a preparation (e.g. , a stable, dispersion preparation) comprising LNPs at a mass batch throughput of about 5 g to 100 g; and (ii) processing the preparation (which in some embodiments may include, e.g., but not limited to purification, concentration adjustment, formulation for storage, aseptic filling, labelling, storage, or combinations thereof).
  • an LNP preparation (e.g., comprising an agent, such as a pharmaceutical agent, for delivery, and particularly comprising a nucleic acid agent such as an RNA agent) is manufactured by controlled mixing of a relevant agent (e.g., a nucleic acid agent, and particularly an RNA agent, often as an aqueous solution) and lipids (e.g. , as described herein) in a solvent environment conducive to formation of agent-encapsulating-LNPs (e.g., as described herein).
  • a relevant agent e.g., a nucleic acid agent, and particularly an RNA agent, often as an aqueous solution
  • lipids e.g., as described herein
  • one or more in- process hold (e.g., storage) steps are conducted at 15-25°C unless otherwise specified.
  • lipid(s) to be included in lipid nanoparticles are selected based on at least one or more factors including, but not limited to, minimum encapsulation of RNA, apparent pKa, size, and/or polydispersity of resulting lipid nanoparticles.
  • lipids to be included in lipid nanoparticles comprise at least one helper lipid described herein, at least one cationic lipid described herein, and at least one PEG-conjugated lipid described herein.
  • lipids are selected to a lipid particle composition described herein.
  • frozen lipids are thawed using a temperature-controlled thawing unit.
  • frozen lipids are thawed at controlled room temperature (e.g., about 18°C-30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
  • controlled room temperature e.g., about 18°C-30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C.
  • periodic monitoring is conducted throughout the duration of thawing.
  • a thawed lipid preparation is transferred to a manufacturing vessel.
  • one or more lipid components e.g., cationic lipids, neutral lipids (e.g., DSPC, and/or cholesterol) and polymer-conjugated lipids
  • lipid components e.g., cationic lipids, neutral lipids (e.g., DSPC, and/or cholesterol) and polymer-conjugated lipids
  • ethanol e.g., 100% ethanol
  • pre-determined molar ratio e.g., ones described herein
  • lipids are combined (e.g., at relevant molar ratios) at a concentration above that at which they are combined with an agent to be encapsulated (e.g., a nucleic acid agent such as an RNA), and may be diluted prior to combination with such agent. In some embodiments, lipids are combined at an appropriate concentration for combination with a relevant agent without further dilution.
  • an agent to be encapsulated e.g., a nucleic acid agent such as an RNA
  • lipids are combined at an appropriate concentration for combination with a relevant agent without further dilution.
  • a lipid solution for combination with an aqueous solution can have a total lipid concentration of at least 10 mg/mL (including, e.g., at least 15 mg/mL, at least 20 mg/mL, at least 25 mg/mL, at least 30 mg/mL, at least 35 mg/mL, at least 40 mg/mL, or higher).
  • a lipid solution for combination with an aqueous solution can have a total lipid concentration of about 10-50 mg/mL, or about 10-40 mg/mL, or about 15 to 35 mg/mL/.
  • a solvent is selected such that it can support dissolution of all lipid components in a selected combination and has a minimal toxicity risk for any residual solvent remaining after completion of manufacturing.
  • a solvent can be or comprise ethanol.
  • a lipid solution is warmed, for example to improve or achieve lipid dissolution.
  • a lipid solution may be warmed for a period of time, for example within a range of minutes to hours; in some embodiments, such period may be within a range of 10 mins to 6 hours, 30 mins to 4 hours, or 1 to 3 hours.
  • a lipid solution may be warmed for 10 minutes to 2 hours, 1 to 3 hours, 2 to 4 hours, or 3 to 5 hours.
  • a lipid solution is warmed to and/or maintained at a temperature above approximately 25°C; in some embodiments, a lipid solution can be warmed to and/or maintained at a temperature of about 26°C, 27°C, 28°C, 29°C, 30°C, 31 °C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C. In some embodiments, a lipid solution can be warmed to and/or maintained at a temperature of about 30-40°C, or about 33-37°C.
  • a lipid solution is subsequently allowed to cool, e.g.. to a reduced temperature, e.g., at or near room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
  • a reduced temperature e.g., at or near room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
  • a lipid solution is purified (e.g., before, during, and/or after warming and/or cooling) by methods known in the art.
  • a prepared lipid solution can be purified by gravity filtration (e.g. , filtration by passage through a filter with a pore size within a range of about 0.1 to 0.3
  • a prepared lipid solution can be filtered by passage through a filter with a pore size of about 0.2 pm or smaller.
  • a lipid solution (e.g., before and/or after purification) is stored and/or maintained at an appropriate temperature for a period time.
  • a lipid solution is stored and/or maintained at a temperature of about -25°C to about 40°C or about -10°C to about 40°C or about 0°C to about 30°C, or about 10°C to about 25°C, or about 20°C to about 25°C.
  • a lipid solution is stored and/or maintained at room temperature (e.g., about 18°C-30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
  • a monitor e.g., a sensor
  • a monitor may be utilized to maintain lipid temperature within a particular range (e.g., as described herein); in some such embodiments, a monitor may communicate automatically with a temperature controller, for example so that appropriate warming or cooling may be provided upon detection of a temperature that falls outside of the particular range.
  • a lipid solution e.g., before and/or after purification
  • a selected temperature e.g. , as described herein
  • a lipid solution prepared for combination with an RNA transcript as described herein is referred to as a lipid stock solution.
  • Nucleic acid preparations (e.g. for or as the first liquid mentioned further above)
  • a preparation of a therapeutic nucleic acid (e.g., of an RNA such as an RNA transcript preparation or a dilution thereof) is combined with a lipid preparation described herein (e.g., a lipid stock solution) to provide a nucleic acid-LNP preparation.
  • LNP manufacture begins with a frozen nucleic acid preparation.
  • such a frozen preparation is thawed, for example using a temperature-controlled thawing unit.
  • a nucleic acid preparation may comprise nucleic acid (e.g., RNA) in an aqueous buffer at an appropriate pH (e.g., pH 2 to pH 8, or pH 4 to pH 7).
  • aqueous buffer may include, but are not limited to Tris buffers, phosphate buffers (e.g., PBS), HEPES, citrate buffers, acetate buffers, etc., or combinations thereof.
  • a nucleic acid preparation for combination with a lipid preparation can be prepared by weighing a desired amount of nucleic acid (e.g. , by volume or weight if liquid or weight if solid or powder).
  • relevant nucleic acid can be dissolved or diluted in an appropriate aqueous buffer (e.g. , as described herein).
  • an aqueous buffer can be or comprise an acidic buffer, e.g., a buffer below pH 7 (e.g., pH 2-pH 6), such as, e.g., in some embodiments, a buffer at pH 4.
  • an aqueous buffer can be or comprise an acidic buffer at a concentration of 10-100 mM, or 25-75 mM, or 30-60 mM, or 40-60 mM. In some embodiments, an aqueous buffer can be or comprise an acidic buffer at a concentration of 40-60 mM. In some embodiments, an acidic buffer can be or comprise a citrate buffer at pH 4.
  • a nucleic acidpreparation for combination with a lipid preparation is prepared by diluting with an aqueous buffer described above at an appropriate pH (e.g. , pH 2 to pH 8, or pH 4 to pH 7).
  • an aqueous buffer is or comprise a citrate buffer at pH 4.
  • such an aqueous buffer is or comprises a citrate buffer at a concentration of 10-100 mM, or 25-75 mM, or 30-60 mM, or 40-60 mM, or 30-50 mM; in particular embodiments, such an aqueous buffer is or comprises a citrate buffer at a concentration of 30-60 mM or 30-50 mM.
  • mixing speed is controlled during dilution of RNA preparation.
  • mixing speed is, for example, at least 10 rpm, 25 rpm, 50 rpm, 75 rpm, 100 rpm, 125 rpm, 150 rpm, 175 rpm, 200 rpm, 250 rpm, 300 rpm, 350 rpm, 400 rpm, 450 rpm, 500 rpm or more.
  • RNA is diluted to a particular concentration prior to mixing (e.g., 0.1 mg/mL-1 mg/mL).
  • preparation of a nucleic acid preparation for combination with a lipid preparation can be performed at about 2- 25°C.
  • preparation of a nucleic acid preparation for combination with a lipid preparation can be performed at room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
  • preparation of a nucleic acid preparation for combination with a lipid preparation can be performed at a temperature that is below room temperature, including, e.g. , at a temperature of about 2- 8 °C.
  • a nucleic acid preparation has been stored prior to combination with a lipid preparation. In some embodiments, a nucleic acid preparation has been stored and/or maintained as a frozen preparation. In some embodiments, a nucleic acid preparation has been stored and/or maintained as a liquid preparation. For example, in some embodiments, a nucleic acid preparation has been stored and/or maintained at an appropriate temperature for a period time. In some embodiments, a nucleic acid preparation has been stored and/or maintained at zero or subzero temperatures (e.g., a temperature of about -80°C to 0 °C, or about -80°C to -60°C, or about -80°C to -25°C).
  • zero or subzero temperatures e.g., a temperature of about -80°C to 0 °C, or about -80°C to -60°C, or about -80°C to -25°C.
  • a nucleic acid preparation has been stored and/or maintained at a fridge temperature (e.g., above 0°C, or about 2- 10°C, about 2-8°C or about 4-6°C). In some embodiments, a nucleic acid preparation has been stored and/or maintained at a temperature of about 10 °C to 25°C. In some embodiments, an a nucleic acid preparation has been stored and/or maintained at room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
  • room temperature e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C.
  • a monitor e.g., a sensor
  • a monitor may be utilized to maintain temperature within a particular range (e.g., as described herein); in some such embodiments, a monitor may communicate automatically with a temperature controller, for example so that appropriate cooling may be provided upon detection of a temperature that falls outside of the particular range.
  • a nucleic acid has been stored and/or maintained at a selected temperature (e.g., as described herein) for a period of time, which may vary from hours to days to weeks to months, depending on the selected temperature.
  • a frozen nucleic acid preparation may be stored and/or maintained (e.g., at zero or subzero temperatures) for days to weeks to months or longer, while a liquid nucleic acid preparation may be stored and/or maintained (e.g., at 4°C or above, including room temperature) for a shorter period of time.
  • a frozen nucleic acid preparation may be stored (e.g., at zero or subzero temperatures) for at least 2 weeks, including, e.g., at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or longer.
  • a liquid nucleic acid preparation may be stored and/or maintained (e.g.
  • a liquid nucleic acid preparation may be stored and/or maintained at 4-6°C for a period of 30 mins to 3 hours. In some embodiments, a liquid nucleic acid preparation may be stored and/or maintained at room temperature for a period of 30 mins to 3 hours.
  • a charge -based interaction between the phosphate backbone of the nucleic acid and the amine moiety of a cationic lipid can facilitate efficient encapsulation of nucleic acid payload upon mixing.
  • columbic interaction may be achieved and/or supported, for example, by controlling pH of a mixing solution (e.g. , a solution comprising a nucleic acid, such as an RNA, as described herein and lipid components) for example with an appropriate buffer, within a range or otherwise at a pH that maintains ionization of both a nucleic acid backbone and a cationic lipid.
  • a mixing solution e.g. , a solution comprising a nucleic acid, such as an RNA, as described herein and lipid components
  • a desired pH may be between the pKa of a nucleic acid backbone (which is approximately 2 in some embodiments) and the pKa of a selected cation lipid (e.g., with a pKa of approximately 6 in some embodiments can be found at pH 4).
  • lipid components may be prepared in an organic solvent
  • nucleic acid may be prepared in a buffer (e.g. , an aqueous buffer, such as for example a citrate buffer) at an appropriate pH (e.g., at a pH between about 2 and about 6, for example at a pH of about 4.0).
  • a buffer e.g. , an aqueous buffer, such as for example a citrate buffer
  • an appropriate pH e.g., at a pH between about 2 and about 6, for example at a pH of about 4.0.
  • an aqueous buffer e.g., such as may be used to dissolve nucleic acid may have a buffer strength of at least 10 mM, including, e.g., at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, or higher, provided that excess buffering capacity does not significantly impact the size and/or polydispersity of resulting nucleic acid-lipid nanoparticles after mixing and/or encapsulation efficiency.
  • an aqueous buffer that may be useful to prepare a nucleic acid stock solution may have a buffer strength of 10 mM-50 mM.
  • nucleic acid is maintained at acidic pH for only a minimal time prior to combination with a lipid preparation as described herein.
  • a nucleic acid solution is prepared at an pH between about 2 and about 6, for example at a pH of about 4.0, (e.g., in a citrate buffer), and is promptly combined with a lipid preparation (e.g., in an organic solvent).
  • a nucleic acid solution is combined within a time period of not more than several hours of exposure to such acidic pH.
  • such time period is not more than 4, 3, 2, or 1 hour(s); in some embodiments, such time period is less than 60, 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 minute(s). In some embodiments, such time period is less than about 5 hours, preferably less than about 4 hours or about 3 hours. In some embodiments, such time period is as short as is reasonably feasible.
  • concentrations of stock solutions for mixing can be determined based on a target ratio of cationic lipid to nucleic acid (e.g., RNA), a target ratio of organic to aqueous component in a mixing output, and/or a target output lipid concentration.
  • the lipid concentration is controlled in terms of the mole ratio of cationic lipid (N) to nucleotide groups (P) in the nucleic acid RNA (e.g., RNA); with the other lipid components calculated according the target molar lipid proportions (e.g., as described herein) relative to the cationic lipid.
  • a target ratio of cationic lipid to nucleic acid can be represented by an N/P ratio where N represents an ionized or ionizable amine in a cationic lipid and P represents a phosphate associated with each nucleotide in a nucleic acid (e.g., RNA).
  • N an ionized or ionizable amine in a cationic lipid
  • P a phosphate associated with each nucleotide in a nucleic acid (e.g., RNA).
  • efficient encapsulation can be achieved when there is sufficient cationic lipid (N) to interact with the entire phosphodiester backbone (P) and/or there is a molar excess of cationic lipid relative to the nucleotides.
  • such a target N/P ratio can be selected by determining effects of various N/P ratios on size and/or polydispersity of resulting LNP preparations and/or encapsulation efficiency (EE).
  • a target N/P ratio is selected that such that size of LNPs is less than 80 nm, polydispersity of LNPs is less than or equal to 0.3, and encapsulation is at least 80%.
  • a target N/P ratio may be in a range of approximately 3 to 35, approximately 3 to 30, approximately 4 to 25, approximately 4 to 20, approximately 4 to 15, approximately 3 to 10.
  • a target N/P ratio may be approximately 4 to 7.
  • a nucleic acid preparation for combination with a lipid preparation can comprise nucleic acid described herein at a concentration of 0.1 -0.6 mg/mL, 0.1 -0.5 mg/mL, 0.2-0.4 mg/mL, or 0.3-0.5 mg/mL.
  • a lipid preparation for combination with a nucleic acid preparation can comprise lipids at a total concentration of about 10-50 mg/mL, or about 10-40 mg/mL, or about 15 to 35 mg/mL.
  • a nucleic acid (e.g., RNA) preparation for combination with a lipid preparation can comprise nucleic acid (e.g., RNA) described herein at a concentration of 0.1-0.6 mg/mL, and the lipid preparation can comprise lipids at a total concentration of about 10-40 mg/mL.
  • LNP preparations can be produced by rapid mixing of an aqueous solution described herein (e.g. , comprising a nucleic acid, e.g., an RNA and/or in an acidic buffer) and a lipid preparation described herein (comprising, e.g., at least one cationic lipid and optionally one or more other lipid components, in an organic solvent) under conditions such that a sudden change in solubility of lipid component(s) is triggered, which drives the lipids towards self-assembly in form of LNPs.
  • an aqueous solution described herein e.g. , comprising a nucleic acid, e.g., an RNA and/or in an acidic buffer
  • a lipid preparation described herein comprising, e.g., at least one cationic lipid and optionally one or more other lipid components, in an organic solvent
  • properties of a cationic lipid are chosen such that nascent formation of particles occurs by association with an oppositely charged backbone of a nucleic acid (e.g., RNA).
  • a nucleic acid e.g., RNA
  • particles are formed around the nucleic acid, which, for example in some embodiments can result in much higher encapsulation efficiency (EE) than it is achieved in the absence of interactions between nucleic acids and at least one of the lipid components.
  • nucleic acid preparation for producing an LNP preparation encapsulating the nucleic acid can be combined with an acidic buffer.
  • An exemplary such buffer is or comprises a citrate buffer.
  • flow rate ratio of an acidic buffer (e.g., a citrate buffer) to transcript nucleic acid preparation (e.g., an RNA preparation) can be 2:1, 3:1, 4:1, or 5:1.
  • a ratio of organic to aqueous component can be controlled such that LNPs effectively form as a precipitation of lipid components upon rapid change of the solubility characteristics of the lipids in a solution when the aqueous component is introduced.
  • proportion of organic component in a combined solution is sufficiently low to induce precipitation with kinetics that are fast enough to support nanoscale particles.
  • a combining volumetric ratio of a lipid preparation and a nucleic acid (e.g., RNA) preparation is about 1:5, 1:4, 1:3, 1:2, or 1:1.
  • a combining volumetric ratio of a lipid preparation and a nucleic acid (e.g., RNA) preparation is about 1:3.
  • the final concentration of organic solvent in a combined solution may be approximately 25% (v/v).
  • a lipid preparation described herein and a nucleic acid (e.g., RNA) preparation described herein can be introduced into a mixing unit or assembly.
  • a mixing unit or assembly may comprise one or more fluidic components or devices.
  • a mixing unit or assembly may comprise one or more components/parts of a high- performance liquid chromatography (HPLC) and/or other fluidic devices.
  • HPLC high- performance liquid chromatography
  • a mixing unit or assembly may comprise a T mixer comprising an inner diameter suitable for selected flow rate.
  • mixing dynamics for example, are controlled by orifices at the outlet of each stream and by the internal diameters of the tubing.
  • lipid and aqueous (e.g., nucleic acid, e.g., RNA) preparations can be mixed at room temperature by pumping each solution independently at controlled flow rates into a mixing unit or assembly, for example, using piston pumps.
  • the volumetric flow rates of a lipid preparation and an aqueous (e.g., nucleic acid, e.g., RNA) preparation into a mixing unit or assembly are maintained at a ratio of 1:5, 1:4, 1:3, 1:2, or 1:1.
  • volumetric flow rates of a lipid preparation and an aqueous (e.g., nucleic acid, e.g., RNA) preparation into a mixing unit or assembly are maintained at a ratio of 1 :3.
  • volumetric flow rate of a combined preparation is 100-800, 200-800, 200-700, 200-600, 200-500, 100-600, 100-500, or 150-500 mL/min, which in some embodiments may be particularly useful for large-scale production.
  • volumetric flow rate of a combined preparation is 300- 600 mL/min.
  • an aqueous (e.g., nucleic acid, e.g., RNA) preparation is introduced into a mixing unit or assembly such that a mass flow rate is 10-200, 20-180, 20-160, 20-150, 30-160, 40-160, 50-200, 70-200, or 100-200 mg/min.
  • an aqueous (e.g., nucleic acid, e.g., RNA) preparation is introduced into a mixing unit or assembly such that a mass flow rate is 100-300 mg/min.
  • volumetric flow rate of a lipid preparation is 15-50, 25- 75, 50-100, 75-125, 100-150, 100-200, 50-200, or 15-200 mL/min. In some embodiments, volumetric flow rate of a lipid preparation (e.g., in an organic phases) is about 80-160 mL/min.
  • volumetric flow rate of an aqueous (e.g., nucleic acid, e.g., RNA) preparation (e.g., in an aqueous phase) is 15-500, 30-500, 30-400, 50-500, 40-500, 100-400, 100-500, or 200-500 mL/min, which in some embodiments may be particularly useful for large-scale production.
  • volumetric flow rate of an aqueous (e.g., nucleic acid, e.g., RNA) preparation is 240-480 mL/min.
  • a flow rate of 360:120 mL/min (total 480 mL/min) is utilized.
  • a flow rate (aqueous preparation: lipid preparation) of 360:120 mL/min (total 480 mL/min) is utilized.
  • an aqueous (e.g., nucleic acid, e.g., RNA) preparation and/or a lipid preparation may be introduced into a mixing unit or assembly (e.g. , as described herein) at room temperature.
  • an aqueous (e.g., nucleic acid, e.g., RNA) preparation and/or a lipid preparation may be introduced into a mixing unit or assembly (e.g., as described herein) at a temperature of about 13-28°C, or 15-26°C, or 15-25°C, or 16-26°C.
  • homogenous LNP formation with appropriate sizes may require fast and efficient mixing of aqueous and organic components.
  • the present disclosure recognizes that at lower flow rates particles have larger sizes and higher polydispersity characteristics with variable encapsulation efficiency (EE).
  • flow rates of organic and aqueous components are controlled independently by two pumps.
  • the two pumps are two separate pumps.
  • the pump speeds are related to each other.
  • the pump speeds are related to each other, for example, by the target final organic component concentration (e.g., described herein) and by the same ratio as the stock solution volumes (e.g., described herein) to continuously provide the same dilution at the mixing interface throughout the mixing process.
  • total output flow rates (combining volumetric flow rates of aqueous and lipid preparations) of 10 to 30, 15-35, 18-40, 25-45, or 30-50 mL/minute are utilized.
  • total output flow rates (combining volumetric flow rates of aqueous and lipid preparations) of 65-700, 130-550, 130-400, 130-275, 250-400, 200-700, 260-700, or 260-550 mL/min are utilized, which in some embodiments may be particularly useful for large-scale production.
  • nucleic acid (e.g., RNA) concentration post-mixing is 0.05-0.5, 0.1-0.4, 0.1-0.35, or 0.15-0.30 mg/mL.
  • lipid concentration post-mixing is 2-10, 2-8, or 3-9 mg/mL.
  • the concentration of organic solvent in a combined solution may be approximately 25% (v/v).
  • a preparation comprising nucleic acid (e.g., RNA)-LNPs is diluted with an aqueous buffer at an appropriate pH (e.g., pH 2 to pH 6, or pH 4 to pH 6), for example, to decrease the concentration of organic solvent present in the lipid preparation and/or to maintain physiochemical stability of LNPs.
  • aqueous buffer may include, but are not limited to, citrate buffers, acetate buffers, etc., or combinations thereof.
  • an aqueous buffer for dilution of such a preparation can be or comprise an acidic buffer, e.g., a buffer below pH 7 (e.g., pH 2-pH 6), such as, e.g., in some embodiments, a buffer at pH 4.
  • an aqueous buffer can be or comprise an acidic buffer at a concentration of 10-100 mM, or 25-75 mM, or 30-60 mM, or 40-60 mM, or 10-50 mM.
  • such an aqueous buffer can be or comprise an acidic buffer at a concentration of 40-60 mM; in some embodiments, such an aqueous buffer can be or comprise an acidic buffer (e.g., a citrate buffer) at a concentration of 50 mM. In some embodiments, an acidic buffer can be or comprise a citrate buffer at pH 4.
  • dilution of an LNP preparation with an aqueous buffer described herein can be performed in-line immediately after LNP formation in a mixing unit or assembly, e.g., as a continuous process.
  • flow rate ratio of a preparation comprising LNPs to an acidic buffer can be 1:1 or 3:2 or 2: 1.
  • dilution of a preparation comprising LNPs with an aqueous buffer can be performed at room temperature (e.g. , about 18°C-3O°C, e.g. , about 18°C- 25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
  • an LNP preparation contains approximately 15-20% ethanol.
  • flow rate of such an aqueous buffer described herein can be 50-300, 60-275, 70- 250, 80-240, or 150-400 mL/minute.
  • nucleic acid concentration of an LNP preparation after such dilution can be 0.01-1, 0.05-0.5, 0.075-0.03, 0.05-0.25, or 0.09-0.21 mg/mL.
  • lipid concentration of an LNP preparation after such dilution can be 1-10, 1-7, 2-6, or 2.5-5.5 mg/mL.
  • the concentration of organic solvent, if present can be further reduced to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24% after dilution.
  • an LNP suspension is collected in a vessel which is cooled to approximately 2- 8°C.
  • an LNP preparation may be collected at a higher temperature, e.g., at a temperature of above 8°C, including, e.g., 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, or higher.
  • an LNP preparation may be collected at room temperature (e.g., as described herein).
  • an LNP preparation may be collected at a temperature of 2-28°C, 2-25°C, 5-28°C, 10-28°C, 15-28°C, or 16-26°C.
  • in process-controls and/or monitoring of one or more of preparation of lipid and/or nucleic acid preparations and LNP formation can be conducted.
  • filter integrity after lipid stock filtration and/or dilution of a nucleic acid preparation with an acidic buffer can be assessed.
  • LNP size and/or polydispersity, lipid and/or nucleic acid (e.g., RNA) content (e.g., concentration), and/or encapsulation can be assessed and/or monitored during and/or after LNP formation.
  • an LNP preparation (e.g. , a dispersion preparation) described herein can be processed by one or more of buffer exchange, concentration adjustment, purification, formulation for storage, aseptic filling, labelling, storage, or combinations thereof.
  • an LNP preparation e.g., a dispersion preparation
  • an LNP preparation in some embodiments after dilution with an acidic buffer described herein, can be subjected to one or more steps of ultrafiltration and/or diafiltration processes, or combinations thereof.
  • an LNP preparation e.g., a dispersion preparation
  • an acidic buffer described herein can be subjected to at least two, three, four, five, six, seven, or eight steps of ultrafiltration and/or diafiltration processes, or combinations thereof.
  • 3-5 steps of ultrafiltration and/or diafiltration processes, or combinations thereof can be performed.
  • an LNP preparation e.g., a dispersion preparation
  • Ultrafiltration is a membrane filtration process during which external forces, e.g., pressure or concentration gradients lead to a separation through a semipermeable membrane. Suspended solids and solutes of high molecular weight are retained in the so-called retentate, while water and low molecular weight solutes pass through the membrane in the permeate. Ultrafiltration membranes typically have pore sizes between 0.001 and 0.1 pm and/or MWCO between 10-300 kDa, and can be applied in cross-flow or dead-end mode.
  • Diafiltration can be performed either discontinuously or alternatively, continuously.
  • a diafiltration solution can be added to a sample feed reservoir at the same rate as filtrate is generated.
  • small molecules e.g. salts, solvents, etc.,
  • each additional diafiltration volume reduces the solvent concentration further.
  • a solution is first diluted and then concentrated back to the starting volume. This process is then repeated until the desired concentration of small molecules (e.g. salts, solvents, etc.) remaining in the reservoir is reached.
  • Each additional diafiltration volume (DV) reduces the small molecule (e.g., solvent) concentration further.
  • Continuous diafiltration typically requires a minimum volume for a given reduction of molecules to be filtered.
  • Discontinuous diafiltration permits fast changes of the retentate condition, such as pH, salt content and the Eke.
  • an LNP preparation is subjected to a diafiltration process.
  • a diafiltration process with a defined number of volume exchanges e.g.
  • At least one, at least two, at least three, or more volume exchanges) using an aqueous buffer described herein e.g., a dilution buffer described herein used in dilution of an LNP preparation such as, e.g., an acidic buffer at pH 4
  • an aqueous buffer described herein e.g., a dilution buffer described herein used in dilution of an LNP preparation such as, e.g., an acidic buffer at pH 4
  • a diafiltration process comprises multiple volume exchanges (e.g., 1-10 volume exchanges, 3-10 volume exchanges, 5-9 volume exchanges, 6-10 volume exchanges) to perform buffer exchange, e.g., in some embodiments replacing the supernatant in a first aqueous buffer with a different aqueous buffer described herein (e.g., a formulation buffer).
  • a formulation may have a pH 6-8 (e.g., pH 7.4).
  • a formulation buffer may comprise one or more salts (e.g., sodium salts, potassium salts, phosphate salts, etc.).
  • a formulation buffer may be or comprise phosphate ions.
  • multivalent anions e.g., from buffer components such as, e.g., citrate, and/or chelating agents (e.g., EDTA) added during processing
  • buffer components such as, e.g., citrate, and/or chelating agents (e.g., EDTA) added during processing
  • chelating agents e.g., EDTA
  • displacement of such multivalent anions by phosphate may further reduce the amount of bound ions in a bulk LNP product.
  • a formulation buffer may be or comprise PBS.
  • a first combination of diafiltration and ultrafiltration is employed using a first buffer, wherein said first buffer is identical to the LNP preparation, so that this first combination of diafiltration and ultrafiltration is removing the solvent and concentrating the LNP preparation and this first combination is followed by a second combination of diafiltration and ultrafiltration steps using a second buffer so that the buffer type and pH are adjusted.
  • the first ultrafiltration is concentrating the LNP preparation to a concentration of between 0.1 and 2mg/mL, preferably between 0.2 and Img/mL and/or the second diafiltration is using phosphate buffer in an amount to change the pH of the LNP preparation to pH7.0 or higher and the second ultrafiltration is concentrating the LNP preparation to a concentration of between 0.5 and 4mg/mL, preferably between 0.66 and 2mg/mL.
  • the required amount of phosphate buffer of the second diafiltration depends on the buffering capacity of the same.
  • the second buffer may needto overcompensate (i) the buffering capacity of the cationic lipid making up the LNP phase and/or (ii) a certain portion of the buffering capacity of the first buffer.
  • a phosphate buffer having a strength of about lOmM phosphate are used for the second diafiltration and the second ultrafiltration is not started before the pH of the LNP preparation is 6.5 or higher.
  • an LNP preparation can be subjected to an ultrafiltration process.
  • an ultrafiltration process can be performed after a diafiltration, e.g., for concentration.
  • an LNP preparation can be concentrated by ultrafiltration by a factor of at least 2 (including, e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more). In some embodiments, an LNP preparation can be concentrated by ultrafiltration by a factor within a range of about 2 to about 6-fold.
  • an LNP preparation can be subject to a process comprising at least two cycles (including, e.g., at least three, at least four, or more) of diafiltration followed by ultrafiltration.
  • Each cycle can comprise diafiltration using a different diafiltration volume and/or buffer and ultrafiltration with a different concentration factor.
  • the concentration of an LNP preparation following a process comprising diafiltration and/or ultrafiltration can be in the range of 0.1-1, 0.2-0.8, or 0.4-0.6 mg/mL. In some embodiments, such concentration can be 0.5 mg RNA-LNPs/mL.
  • diafiltration and/or ultrafiltration can be performed at room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25 °C).
  • room temperature e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25 °C.
  • a TFF system comprises hollow fiber membranes, which can be polymeric, ceramic, or cellulose.
  • a TFF system used for diafiltration and/or ultrafiltration comprises hollow fiber polymeric membranes, e.g., thermoplastic membranes (e.g., polysulfone or polyethersulfone).
  • thermoplastic membranes e.g., polysulfone or polyethersulfone
  • planar membranes are used.
  • membranes can be stacked.
  • TFF membranes can be several square meters in size depending on the actual scale of the preparation and in some embodiments, a TFF membrane has a filter area requirement of below Im 2 per gram nucleic acid (e.g., RNA). In some embodiments, a TFF membrane has a filter area requirement of between 0.1 and 0.8 m 2 /g or between 0.25 and 0.5m 2 /g.
  • transmembrane pressure is less than, for example, 500 mbar (including, e.g., less than 450 mbar, less than 400 mbar, less than 350 mbar, less than 300 mbar, less than 250 mbar, less than 200 mbar, less than 150 mbar, less than 100 mbar, less than 50 mbar, or less).
  • shear rate is less than 10,000/s, less than 9,000/s, less than 8,000 per second, less than 7,000 per second, less than 6,000/s, less than 5,000/s, less than 4,000/s, less than 3,000/s, less than 2,000/s, less than 1,000/s or lower.
  • an LNP preparatoin e.g., after ultrafiltration/diafiltration described herein
  • gravity filtration e.g., filtration by passage through a filter with a pore size within a range of about 0.1 to 0.3 pm
  • an LNP preparation e.g., after ultrafiltration/diafiltration described herein
  • filtration is completed over a period of less than 5 hours (including, e.g., less than 4 hours, less than 3 hours, less than 2 hours, or less than 1 hour).
  • filtration is conducted at a particular pressure. In some embodiments, filtration pressure is less than 30 psig, less than 25 psig, less than 20 psig, less than 15 psig, less than 10 psig, or less than 5 psig.
  • a purified LNP preparation can be adjusted with a formulation buffer to a desired concentration (e.g., nucleic acid concentration).
  • a formulation buffer may have a pH 6-8 (e.g., pH 7).
  • a formulation buffer may comprise one or more salts (e.g., sodium salts, potassium salts, phosphate salts, etc.).
  • a formulation buffer may be or comprise PBS.
  • a formulation buffer may comprise a cryoprotectant.
  • a cryoprotectant may be present in a formulation buffer at a concentration of about 100-500 mM, or 200-400 mM, or 250-350 mM.
  • cryoprotectants include a sugar (e.g., sucrose, trehalose), glycerin, ethylene glycol, or combinations thereof.
  • a cryoprotectant included in a formulation buffer includes a sugar (e.g., sucrose, trehalose, etc.). In some embodiments, cryoprotected is added with mixing.
  • mixing occurs for a particular duration of time, for example, at least 10 minutes (including e.g., at least 15 minutes, at least 20 minutes at least 25 minutes, at least 30 minutes, or more). In some embodiments, mixing occurs at a particular speed or range of speeds, for example, at least 10 rpm, at least 25 rpm, at least 50 rpm, at least 75 rpm, at least 100 rpm, at least 125 rpm, at least 150 rpm, at least 175 rpm, at least 200 rpm, at least 250 rpm, at least 300 rpm, at least 350 rpm, at least 400 rpm, at least 450 rpm, at least 500 rpm or more).
  • a purified LNP preparation can be adjusted with a formulation buffer described herein such that nucelic acid (e.g., RNA) concentration is 0.1-1 mg/mL, or 0.2-0.8 mg/mL, or 0.3-0.7 mg/mL, or 0.4-0.6 mg/mL.
  • nucelic acid e.g., RNA
  • a bulk LNP product may be stored and/or maintained at an appropriate temperature for a period of time before transportation and/or aseptic filling.
  • a bulk LNP product described herein may be stored and/or maintained as a frozen or liquid composition.
  • a bulk LNP product described herein may be stored as a frozen composition at a subzero temperature, e.g., -10°C or lower, including, e.g., -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, - 80°C or -90°C.
  • a frozen composition comprising a bulk LNP product may be stored for at least 2 weeks, at least 4 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, or longer.
  • a bulk LNP product described herein may be stored as a liquid composition at a refrigerated temperature, e.g., 2-10°C or 2-8°C.
  • a liquid composition comprising a bulk LNP product may be stored for at least 5 days, at least 10 days, at least 20 days, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or longer.
  • a liquid composition comprising a bulk LNP product may be stored for about 1 week.
  • a bulk LNP product described herein may be stored as a liquid composition at room temperature or lower (e.g., 10-25°C).
  • a liquid composition comprising a bulk LNP product may be stored for at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, or longer.
  • one or more product attributes including, e.g., but not limited to LNP size/polydispersity, lipid/nucleic acid content (e.g., concentration), nucleic acid encapsulation, nucleic acid integrity, pH, osmolality, and combinations thereof, can be assessed and/or monitored during and/or after LNP formulation and/or storage.
  • a container may have a volume within a range of less than 30 mL, less than 25 mL, less than 20 mL, less than 15 mL, less than 10 mL, less than 5 mL, less than 4 mL, less than 3 mL, less than 2 mL, less than 1.5 mL, less than 1 mL, or smaller. In some embodiments, a container may have a volume within a range of 4-26 mL.
  • a single-dose amount or a multi-dose amount of a bulk RNA-LNP product described herein is aseptically filled in a container (e.g., described herein).
  • about 0.1-1 mL e.g., 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mL
  • 0.2-0.7 mL or 0.4-0.5 mL of a bulk LNP product described herein is aseptically filled in a container (e.g., described herein).
  • a drug product is provided as a concentrate for suspension; in some such embodiments, about 0.1, about 0.2, or about 0.3 mg of concentrate (e.g., about 0.21, 0.22, 0.23, 0.24, or 0.25 mg, such as about 0.225 mg).
  • Aseptic filling can be manual or automated. In some embodiments, aseptic filling can be operated at a throughput of at least 1000 vials/day, at least 2000 vials/day, at least 3000 vials/day, at least 4000 vials/day, at least 5000 vials, or more.
  • aseptic filling can be operated at a throughput of at least 5000 vials or more, including, e.g., at least 7500 vials/day, at least 10,000 vials/day, at least 20,000 vials/day, at least 30,000 vials/day, at least 40,000 vials/day, at least 50,000 vials/day, at least 60,000 vials/day, at least 70,000 vials/day or more.
  • a lot number is labeled (e.g., printed) on a container and/or a lid.
  • vials prior to storage, vials are visually inspected for visible particles and/or vial weight is assessed (e.g., before and/or after filling).
  • a processes of sterile filtration, aseptic filing, and/or capping are performed under constant environmental monitoring.
  • all personnel involved in clean room activities are microbially monitored.
  • particle monitoring and microbial air monitoring is performed.
  • a bulk LNP product described herein can be sterile filtered, e.g. , through a sterilization grade filter with a pore size of 0.1-0.3 pm. In some embodiments, a sterilization grade filter with a pore size of 0.2 pm can be used.
  • a sterile filter may have a filter surface area of at least 200 cm 2 , at least 300 cm 2 , at least 400 cm 2 , at least 500 cm 2 , at least 600 cm 2 , at least 700 cm 2 , at least 800 cm 2 , at least 900 cm 2 , at least 1000 cm 2 , at least 1250 cm 2 , at least 1500 cm 2 , at least 1750 cm 2 , at least 2000 cm 2 , at least 5000 cm 2 , at least 10,000 cm 2 , at least 15,000 cm 2 , at least 20,000 cm 2 or larger.
  • a sterile filtration is performed directly before filling a bulk RNA-LNP product described into containers described herein.
  • bioburden of a bulk LNP product described herein can be assessed prior to sterile filtration.
  • filter integrity can be assessed prior to and/or after sterile filtration.
  • one or more product attributes including, e.g., but not limited to LNP size/polydispersity, nucleic acid content (e.g., concentration), nucleic acid encapsulation, nucleic acid integrity, nucleic acid identity, pH, osmolality, and combinations thereof, can be assessed and/or monitored at the beginning and/or during the filling.
  • sterility e.g. , bioburden, endotoxin, etc.
  • a bulk LNP product described herein can be transported to a different location for filling and/or labeling.
  • a bulk LNP product may be transferred to a container, e.g., with flexible wall(s), which, e.g., may be a flexible bag.
  • a container may have a volume of between 2 L and 200 L, in some embodiments between 5 and 50 L.
  • a bulk LNP product may be transported, e.g., in a disposable bioprocessing polymer bag, e.g.
  • such period of time may be less than 90 days, less than 60 days, less than 30 days, less than 14 days, less than 10 days, less than 7 days, less than 6 days, less than 5 days, less than 4 days, less than 3 days, less than 2 days, less than 1 day or shorter.
  • a bulk LNP product may be transported at a refrigerated temperature (e.g., 2 to 10 °C or 2 to 8°C) for less than 14 days, less than 20 days, less than 7 days, less than 6 days, or shorter.
  • a bulk LNP product may be transported at a frozen temperature (e.g., -90 to -60°C or -60 to -35°C) for at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months or longer.
  • one or more product attributes including, e.g., but not limited to LNP size/polydispersity, nucleic acid content (e.g., concentration), RNA encapsulation, nucleic acid integrity, nucleic acid identity, pH, osmolality, and combinations thereof, can be assessed. Additionally or alternatively, sterility (e.g., bioburden, endotoxin, etc.) of a defined number of vials, can be assessed after transport to a different location for aseptic filling and/or labeling and prior to aseptic filling.
  • filling is completed using pumps (e.g., piston pumps or rotary piston pumps).
  • multiple containers e.g., multiple vials such as single use or multi-use vials
  • LNP product in which LNP product is disposed are positioned in a common tray or rack, and multiple such trays or racks are stacked in a carton that is surrounded by a temperature adjusting material (e.g., dry ice) in a thermal (e.g., insulated) shipper (packaging designed to maintain crucial conditions).
  • a temperature adjusting material e.g., dry ice
  • thermal shipper e.g., insulated
  • a thermal shipper comprises a thermal sensor.
  • a thermal shipper comprises a global positioning satellite (GPS) monitor.
  • GPS global positioning satellite
  • a thermal shipper comprises a system for communicating location and/or temperature via GPS to another site and/or device (e.g., tower).
  • a thermal shipper comprises a GPS-enabled thermal sensor, for example, with a control site and/or device (e.g., tower) that will track the location and/or temperature of each product shipment across their pre-set routes.
  • a thermal shipper (e.g., as described herein) is utilized to maintain crucial conditions (e.g., temperature) throughout a distribution process and/or during storage.
  • a thermal shipper (e.g., as described herein) is used to ship product from a manufacturing site to a distribution center and/or point of care, e.g., by air and/or ground transportation.
  • a thermal shipper (e.g., as described herein) is useful for long-distance shipping(e.g., at least 100 kilometers, 200 kilometers, 300 kilometers, 400 kilometers, 500 kilometers, 1,000 kilometers, 2,000 kilometers, 3,000 kilometers, 4,000 kilometers, 5,000 kilometers, 6,000 kilometers, 7,000 kilometers, 8,000 kilometers, 9,000 kilometers, 10,000 kilometers or more).
  • filled products can be stored stable at a refrigerated temperature (e.g., about 2°C to about 10°C or about 2°C to about 8°C) for at least 3 days, at least 5 days, at least 10 days, at least 20 days, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or longer.
  • filled products can be stored stable at a temperature of about 2°C to about 8°C for at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, or longer.
  • filled products can be maintained at ultra-low temperature (e.g., as described herein) in a thermal shipper (e.g., as described herein) as a temporary storage, for example, for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days or longer when the thermal shipper is maintained at 15°C to 25°C.
  • product is shipped and/or stored in a thermal shipper for a period of time less than about 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 day.
  • duration of time a thermal shipper that keeps product at ultra-low temperature can be extended, for example, by at least several days, by opening the thermal shipper and adding and/or replacing ice or dry ice (e.g., re-icing).
  • temperature and/or location can be monitored during storage.
  • one or more quality control parameters may be assessed to determine whether LNPs in a preparation or a bulk drug product described herein meet or exceed acceptance criteria (e.g., for subsequent formulation and/or release for distribution).
  • quality control parameters may include, but are not limited to appearance (e.g., color, dryness, presence and/or size, color, type, etc. of visible particles), lipid identity, lipid content (e.g.
  • a batch of a preparation or a bulk drug product described herein that satisfy assessment results can be utilized for one or more further steps of manufacturing and/or formulation and/or distribution.
  • manufacturing methods described herein may further comprise assessing and/or monitoring (e.g. , assessing at one or more time points) one or more features of an LNP preparation or a bulk drug product described herein including, e.g., appearance (e.g., color, dryness, presence and/or size, color, type, etc. of visible particles), lipid identity, lipid content (e.g.
  • nucleic acid e.g., RNA
  • nucleic acid identity e.g., sequence and/or other structure
  • nucleic acid integrity e.g., nucleic acid content (e.g., presence and/or absolute or relative amount)
  • nucleic acid encapsulation LNP size (e.g., average size, size distribution, etc.), LNP polydispersity, pH, osmolality, subvisible particles, presence and/or amount of one or more endotoxins, sterility, etc.
  • at least one or more features e.g.
  • At least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve at least thirteen, at least fourteen) described herein can be characterized and/or monitored for quality control.
  • an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, visual inspection is utilized to monitor appearance. In some embodiments, an LNP preparation or bulk product described herein is a white to off-white suspension.
  • visible particles present in an LNP preparation or bulk product described herein are assessed and/or monitored (e.g., determined at one or more points over time).
  • visible particle testing is performed according to Ph. Eur. 2.9.20.
  • visible particle testing is performed according to Ph. Eur. 2.9.20 with minor adaptions.
  • LNPs are free or essentially free from observable particles (e.g., visible to unaided eye).
  • lipid identity and/or lipid content of lipids, lipid stock solutions, and/or LNPs is assessed and/or monitored (e.g., determined at one or more points over time).
  • an HPLC-CAD assay determines the identity and concentration of lipids in the tested sample (e.g. LNPs).
  • individual lipid identities and/or content is determined by comparison of retention times with those of the reference standards.
  • lipid identities and content determined comprise monitoring or particular lipids.
  • particular lipids comprise cationic lipid, PEG-lipid, helper lipid (e.g., DSPC, and/or cholesterol).
  • concentration of each individual lipid is determined by sample area response against the respective five-point calibration curve generated from the reference standards, with peak detection performed use a CAD.
  • results for lipid identity and lipid content are reported as relative retention time compared to reference standard and as mg/mL, respectively.
  • a predetermined acceptance criterion is met for release for lipids, lipid stock solutions, and/or LNPs.
  • RNA identity is verified by comparing with the reference standard.
  • RNA identity is determined by reverse transcribing said RNA into cDNA and amplifying said cDNA (e.g., by PCR) with a target specific probe and/or primers.
  • sequence of anRNA is determined by reverse transcribing said RNA into cDNA, amplifying (e.g., by PCR), and sequencing the amplified product.
  • nucleic acid integrity is determined use agarose gel electrophoresis. In some embodiments, nucleic acid integrity is determined by capillary electrophoresis. In some embodiments, nucleic acid integrity can be quantitatively determined using capillary electrophoresis. In some embodiments, determination of nucleic acid integrity comprises one or more of LNP treatment with nonionic surfactant, application of nonionic surfactant treated LNP to a gel matrix contained in a capillary, separating nucleic acid and its derivatives, degradants, and impurities according to their sizes, detection of intact nucleic acid and its derivatives, degradants, and impurities, and/or determining the integrity of the RNA.
  • quantification of a main nucleic acid (e.g., RNA) peak is calculated in relation to signal intensities in the electropherogram where degradation products are detectable.
  • > 30.0, 40.0 50.0, 60.0, 70.0, 80.0 or 90.0 % in the peak corresponds to intact nucleic acid (e.g., RNA).
  • nucleic acid (e.g., RNA) encapsulation is assessed and/or monitored (e.g., determined at one or more points over time).
  • encapsulation is monitored using a nucleic acid-binding (e.g., an RNA-binding) dye.
  • an RNA-binding dye is Ribogreen (Invitrogen, Eugene, OR, USA).
  • nucleic acid encapsulation is calculated by comparing signals (e.g., fluorescent signals) of LNP samples in the absence (free nucleic acid) and presence (total nucleic acid) of detergent.
  • the detergent is TritonX-100.
  • > 60, 70, 80, or 90% of nucleic acid (e.g., RNA) is encapsulated.
  • nucleic acid (.e.g, RNA) content is assessed and/or monitored (e.g., determined at one or more points over time).
  • nucleic acid (.e.g, RNA) content is determined using UV absorption spectrophotometry.
  • nucleic acid (.e.g, RNA) content is measured using a nucleic acid-binding (e.., an RNA-binding) dye.
  • an RNA- binding dye is Ribogreen (Invitrogen, Eugene, OR, USA).
  • nucleic acid (.e.g, RNA) content is determined by disrupting LNPs with detergent and measuring the total nucleic acid (.e.g, RNA) content based on a signal.
  • the detergent is Triton X-100.
  • the total nucleic acid (.e.g, RNA) content signal is measured using a spectrofluorophotometer.
  • nucleic acid (.e.g, RNA) content is 0.1-1 mg/mL or 0.3- 0.7 mg/mL, or 0.4-0.6 mg/mL.
  • LNP size and/or polydispersity is assessed and/or monitored (e.g., determined at one or more points over time).
  • mean particle size and size distribution of LNP in a sample In some embodiments, mean particle size and size distribution of LNP in a sample. In some embodiments, evaluation of mean particle size and size distribution of LNP in a sample involves use of dynamic light scattering. In some embodiments, results are reported as the Z-average size of the particles and the polydispersity index. In some embodiments, polydispersity values are used to describe the width of fitted log-normal distribution around the measured Z-average size and are generated using proprietary mathematical calculations within a particle sizing software. In some embodiments, dynamic light scattering methods comprise use of a particle sizer that uses back-scatter at 173°. In some embodiments, LNP size is ⁇ 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, or 250 nm. In some embodiments, LNP polydispersity is ⁇ 0.1, 0.2, 0.3, 0.4, or 0.5.
  • osmolality of an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, osmolality of LNPs is determined according to regional pharmacopeia (e.g., Ph. Eur. 2.2.35, USP ⁇ 785>). In some embodiments, osmolality of LNPs is 400-650 mOsmol/kg, 425-625 mOsmol/kg, or 450-600 mOsmol/kg, or 475-550 mOsmol/kg.
  • subvisible particles of an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, detection of subvisible particles is determined according to Ph. Eur. 2.9.19 / USP ⁇ 787> (method 2, microscopic particle count).
  • an LNP preparation or bulk product described herein can comprise particles with a size of > 25 pm is no more than 600 particles/container. In some embodiments, an LNP preparation or bulk product described herein can comprise particles with a size of > 10 pm is no more than 6000 particles/container.
  • presence and/or level of bacterial endotoxins in an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time), for example, using an analytical kinetic turbidimetric limulus amebocyte lysate (LAL) procedure.
  • LAL analytical kinetic turbidimetric limulus amebocyte lysate
  • Gram-negative bacterial endotoxins are assessed and/or monitored (e.g., determined at one or more points over time).
  • Gram-negative bacterial endotoxins are determined to have an acceptable level if the acceptance criteria in regional pharmacopoeia (e.g., Ph. Eur.
  • LNPs have ⁇ 12.5 EU/mL of bacterial endotoxins. In some embodiments, for example, prior to fdtration, LNPs may have ⁇ 46 EU/mL.
  • bioburden is assessed and/or monitored (e.g., determined at one or more points over time) using a membrane filtration method.
  • bioburden is determined to have an acceptable level if the acceptance criteria in regional pharmacopoeia (e.g., Ph. Eur. 2.6.12, USP ⁇ 61>, JP 4.05) are met when the bioburden is determined according to the method described therein (e.g., less than or equal 10 1 CFU per 10 mL). In some embodiments, for example, prior to filtration, bioburden may be less than or equal to 20 CFU per 20 mL.
  • sterility of an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, sterility testing is performed according to regional pharmacopoeia (e.g., Ph. Eur. 2.6.1, USP ⁇ 71 >, JP 4.06). In some embodiments, LNPs are sterile. In some embodiments, sterility is assessed and/or monitored by determining the presence or absence of detectable growth. In some embodiments, sterility is assessed and/or monitored, for example, by subjecting LNP samples to luciferase which catalyzes a reaction with microbial ATP. Light emitted during the reaction can be measured, for example, using a luminometer.
  • luciferase which catalyzes a reaction with microbial ATP. Light emitted during the reaction can be measured, for example, using a luminometer.
  • additional characterization may be carried out in addition to, or in combination with, any other characterization and/or quality control method.
  • protein expression from nucleic acids encapsulated in LNPs can be assessed.
  • protein expression is measured using a process comprising one or more of the following steps: adding LNPs to mammalian cells and/or measuring protein expression.
  • mammalian cells are HEK-293T cells.
  • n LNP dose is added to mammalian cells.
  • protein expression is measured using an antibody directed against an expressed protein or a portion thereof.
  • cells are labeled with a live/dead dye.
  • live/dead dye labeled cells are separated by flow cytometry.
  • the percent of live cells expressing relevant protein is enumerated.
  • nucleic acid (e.g., RNA) substance is transfected as a control to confirm protein expression.
  • a control substance transfection comprises use of electroporation.
  • a control transfection comprises use of calcium carbonate transfection.
  • expression is measured by quantifying the number of cells that have positive signal for bound antibody directed against the expressed protein or portion thereof. In some embodiments, expression is measured by quantifying the number of cells that have positive signal for bound antibody directed to a target protein.
  • protein expression of is measured using a process comprising one or more of the following steps: adding LNPs to mammalian cells, e.g., HEK-293T cells, at a pre-determined dose level, labeling cells with a live/dead dye and separating by flow cytometry, enumerating the percent of live cells expressing relevant protein, transfecting a control compositon with lipofectamine to confirm protein expression, and/or measuring expression by quantifying the number of cells that have positive signal for bound antibody directed to a target protein.
  • mammalian cells e.g., HEK-293T cells
  • characterization of LNPs is performed. In some embodiments, characterization comprises use of one or more of electron microscopy, CD spectroscopy, small angel X-ray scattering (SAXS), in vitro expression, and/ or mouse immunogenicity and comparing to a reference standard and/or control LNPs.
  • SAXS small angel X-ray scattering
  • excipients present in an LNP preparation or bulk product are assessed and/or monitored (e.g., determined at one or more points over time).
  • excipients that may be assessed and/or monitored include, but are not limited to cholesterol, cryoprotectant, solvent (e.g., water and/or organic solvent), and/or salts.
  • excipients are tested according to a quality standard set forth in Ph. Eur.
  • the impurity profile of LNPs is based primarily on the impurity profile of the materials used for its manufacture.
  • possible process-related impurities include residual solvent (e.g., ethanol), buffer components (e.g., citrate, HEPES), and/or chelating agent (e.g., EDTA).
  • residual solvent (e.g., ethanol) content present in an LNP preparation or a bulk product described herein is less than 10,000 ppm, 7,500 ppm, 5,000 ppm, 2,500 ppm, 1,000 ppm, or lower.
  • all buffers and solutions held at least 24 hours are assessed and/or monitored for microbial content.
  • the container and/or closure of the container is assessed and/or monitored.
  • the closure system comprises, for example, a vial and/or a vial stopper.
  • container closure integrity is assessed when exposed to low temperatures (e.g., less than - 50°C, less than -60°C, less than -70°C, less than -80°C, less than -90°C) and/or to assess and/or monitor the impact of crimping force on container closure integrity.
  • vial quality testing is performed according to regional pharmacopoeia (e.g., Ph. Eur. 3.2.1, USP ⁇ 660>, JP 7.01).
  • vial stopper quality testing is performed according to regional pharmacopoeia (e.g., Ph.
  • closure of the container is assessed and/or monitored by incursion of a dye.
  • container closure integrity e.g., before and/or after exposure to low temperature
  • HSA headspace carbon dioxide and oxygen detection analysis
  • headspace measurements are conducted using headspace analyzers (e.g., Lighthouse Instruments Oxygen and FMS-Carbon dioxide headspace analyzers).
  • analyzers are calibrated using traceable standards (e.g., NIST-traceable standards).
  • traceable standards e.g., NIST-traceable standards.
  • an increase in the percent of oxygen measured of about 0.5%, 1%, 1.5% or 2% is considered to be a failure and/or loss of container closure integrity.
  • RSF residual seal force
  • a container closure system is assessed and/or monitored.
  • RSF is stress an elastomeric closure will continue to exert against the glass vial finish and the overseal after capping is complete.
  • RSF is measured prior to and/or after sample exposure to low temperature.
  • samples are warmed to room temperature and RSF is measured.
  • an initial RSF alert limit of no less than 10 Ibf, 9 Ibf, 8 Ibf, 7 Ibf, 6 Ibf, 5 Ibf, 4 Ibf, or 3 Ibf is utilized for monitoring RSF.
  • physiochemical properties e.g., density, viscosity, size distribution and shape, surface charge, and/or surface PEG
  • thermal transitions of LNPs are assessed and/or monitored, for example, using differential scanning calorimetry.
  • provided technologies include one or more quality assessment steps.
  • one or more of aqueous (e.g., nucleic acid, e.g., RNA) solution, lipid solution, and/or LNP preparation is subjected to one or more quality control steps, assessments, and/or characterizations during and/or after its production and/or use as described herein.
  • an assessed material is subjected to repeat or alternative assessment. In some embodiments, if an assessment indicates a defect or failure, an assessed material is discarded.
  • a reference standard for a particular quality control assessment can be any quality control standard, including, e.g., a historical reference, a set specification. As will be understood by a skilled artisan, in some embodiments, a direct comparison is not required. In some embodiments, a reference standard is an acceptance criterion based on, for example, assessment and/or characterization of features described herein, including, e.g.
  • nucleic acid e.g., RNA
  • nucleic acid e.g., RNA
  • nucleic acid e.g., RNA
  • length e.g., nucleic acid (e.g., RNA) identity (e.g., as RNA)
  • integrity e.g., integrity, sequence, and/or concentration, pH, osmolality, potency, bacterial endotoxins, bioburden, residual organic solvent, osmolality, pH, and combinations thereof.
  • a quality control assessment involves an assessment of presence of air and/or of one or more manifestations (e.g., loss of polydispersity, disruption of nanoparticle structure and/or of colloidal structure of an LNP composition, etc.) of air having been present.
  • one or more manifestations e.g., loss of polydispersity, disruption of nanoparticle structure and/or of colloidal structure of an LNP composition, etc.
  • Example 1 Overview of exemplary manufacturing process for a pharmaceutical-grade composition comprising RNA
  • the present Example depicts an exemplary manufacturing process for pharmaceutical-grade RNA comprising an in vitro RNA transcription followed by removal of components utilized or formed in the course of production by a purification process, and filtration to reduce bioburden (e.g., as illustrated in Figure 4).
  • Optional in-process controls may also be completed depending on whether a hold step is performed.
  • Example 2 Overview of exemplary manufacturing process for pharmaceutical-grade RNA-LNPs
  • the present Example demonstrates an exemplary manufacturing process for pharmaceutical-grade RNA- LNPs comprising six steps and one optional step (Figure 5).
  • a lipid and RNA stock is prepared (the lipid stock corresponds to the second liquid mentioned further above, the RNA stock corresponds to the first liquid mentioned above).
  • LNPs are formulated and stabilized by dilution followed by concentration, buffer exchange, and filtration. Subsequently, the concentration is adjusted and cryoprotectant is added.
  • RNA-LNPs are transported to an external fill and finish site.
  • RNA-LNPs undergo sterile filtration and aseptic filling and storage.
  • Example 3 Overview of exemplary DNA template manufacture via a PCR-based process.
  • the present Example describes an exemplary manufacturing process of a DNA template via a PCR-based process ( Figure 6). Initially, a master mix preparation was made. Subsequently, forward primer and vector were added. The PCR-mix is transferred into a reagent reservoir and a PCR plate was filled. A PCR is completed comprising an initial denaturation, a denaturation step, an annealing step, a final extension step for 20-30 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) cycles and a hold step. The PCR products can be pooled and purified. Subsequently, the purified, pooled PCR product was filtered and quality control tested.
  • Example 4 Exemplary characterization of pharmaceutical-grade RNA
  • the present Example describes exemplary characterization of pharmaceutical-grade RNA compositions.
  • degree of coloration was tested based on Ph. Eur. 2.2.2. In some embodiments, degree of opalescence was determined based on Ph. Eur. 2.2.1. Results were reported as the clarity and color of the product solution.
  • Gram-negative bacterial endotoxins were detected with a chromogenic-kinetic method according to regional pharmacopeia (e.g. Ph. Eur. 2.6.14, USP ⁇ 85>, JP 4.01). Results were reported as EU/mL of product solution.
  • bioburden tests determined the total aerobic microbial count (TAMC) and the total combined yeast/molds counts (TYMC) using a membrane filtration method according to regional pharmacopeia (e.g., Ph. Eur. 2.6.12, USP ⁇ 61>, JP4.05).
  • the test solution was filtered and the membrane filter was transferred to the surface of a suitable nutrient agar medium. Results were reported as CFU/mL of composition comprising RNA.
  • RNA concentration was determined photometrically according to Eur. 2.2.25 at a wavelength of 260 nm utilizing an extinction coefficient of 0.025 *pg-l*cm-l. Results were reported as mg/mL of product solution.
  • RNA samples were incubated for a defined time period with RNase A, certified to be free of DNases and proteases and then separated by gel-electrophoresis on a precast and pre-stained agarose gel and compared to an RNA sample that had been incubated under identical conditions except for the addition of RNase A.
  • disappearance of the RNA band upon incubation with RNase A verified the identity as RNA. Results were reported as the presence or absence of an RNA band by gel electrophoresis.
  • RNA samples were separated by denaturing gel electrophoresis on precast and buffered agarose gel pre-stained with a nucleic acid specific dye.
  • the gel was photographed using a gel documentation system and the length of the RNA band was compared to an RNA of known size (length standard [RNA ladder]).
  • RNAs were separated by capillary electrophoresis using a system which gives an electropherogram as a result and a quantitative evaluation was performed.
  • the conformance of lengths of RNA (and thus indirectly the molar masses) with theoretical values were verified by denaturing gel electrophoresis in comparison to a standard ladder with RNAs of known lengths.
  • sizes obtained were consistent with the theoretically expected lengths and with reference RNAs, i.e., transcripts from the respective DNA template used.
  • capillary electrophoresis was applied for quantitative analysis of RNA integrity.
  • RNAs gave rise to a single peak at the expected retention time consistent with expected lengths as compared to the retention times of a standard ladder.
  • quantification of the main RNA peak was calculated in relation to the signal intensities in regions of the electropherogram, where degradation products were detectable.
  • residual DNA template content derived from the respective linear DNA template was determined using a real-time quantitative PCR test method. For example, in some embodiments, for the PCR a pre -mixed Sybr Green master mix was used according to manufacturer’s recommendations. In some embodiments, amplification and detection of DNA was performed in a real-time thermocycler. In some embodiments, residual DNA template in the sample was quantified in comparison to a standard (serial dilution of plasmid DNA). The results were reported in ng DNA/mg RNA.
  • residual dsRNA level was determined using a limit test.
  • RNA samples and a dsRNA reference 2000 pg dsRNA/pg RNA, 1500 pg dsRN A/ijg RNA, 1000 pg dsRNA/pg RNA, 500 pg dsRNA/pg RNA, or lower representing the upper limit of accepted residual dsRNA content
  • a dsRNA-specific monoclonal antibody mouse IgG (immuno globulin G), clone J2
  • ECL Enhanced chemiluminescence
  • signal intensities were quantified by densitometry, and the values of the RNA samples compared to the signal intensity of the dsRNA reference. Results were reported as complies with the specified upper limit.
  • RNA sequence was deduced from sequencing the DNA template, which served as template for in vitro transcription and defines the primary structure of each RNA.
  • identity of the starting material and thus identity of the transcribed RNA was controlled by automated sequencing of the RNA encoding region of the template.
  • results were reported as compliments to the target sequence.
  • a cap-analog was included in the in vitro transcription reaction mixture, which, upon incorporation at the 5’ end during transcription led to RNA with a so-called capl structure.
  • the percentage of capped RNA for the exemplary batches were characterized by an RNase H based assay.
  • RNA samples were annealed to a customized biotinylated nucleic acid probe binding close to the 5’ end of the RNA, and RNase H was used to digest the mRNA-probe complex, generating a short fragment corresponding to the 5’ part of the RNA.
  • streptavidin-coated spin columns or magnetic beads were used for sample clean-up.
  • capped and non-capped species were identified by the observed mass values and their MS signals were used to calculate the percentage of capped RNA. Multiple such batches displayed a percentage of capped RNA between 40-70%.
  • percentage of polyadenylation (Poly A) attached to the 3’ end of the RNA construct was measured for exemplary batches using droplet digital PCR (ddPCR).
  • ddPCR droplet digital PCR
  • cDNA was generated using a reverse transcription primer that spanned the PolyA and 3’ sequences of the RNA construct and required both for binding.
  • positive signals indicated polyadenylated RNA and were detected using primers and probes located close to the 3’ end of the RNA construct.
  • quantitation was based on normalization to the theoretical input of the test sample (UV AJSO nm concentration).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Dispersion Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Methods, systems, and uses for providing a lipid nanoparticle composition with advantageous nanoparticle properties are provided.

Description

Title
Methods and uses associated with liquid compositions
Background
The present disclosure relates to improvements associated with liquid compositions, in particular lipid nanoparticle compositions and their manufacture.
Nucleic acids represent an important therapeutic modality. Lipid nanoparticle technologies have proven to be particularly useful for the delivery of nucleic acid therapeutics, specifically including RNA therapeutics or DNA therapeutics, such as mRNA therapeutics (RNA = ribonucleic acid, mRNA = messenger RNA, DNA = deoxyribonucleic acid).
Hence, providing lipid nanoparticle compositions comprising or consisting of lipid nanoparticles (LNPs) is a key aspect for nucleic acid therapeutics. Properties of the LNPs which are provided may influence the stability or quality of the therapeutic or intermediate products and/or have decisive influences on the yield during the production process.
It is an aim of the present disclosure to provide improvements associated with liquid compositions, particularly associated with lipid nanoparticle technology, e.g. associated with the method of forming, providing, or producing lipid nanoparticle compositions. The improvements may relate to the method of providing or producing liquid compositions, e.g. lipid nanoparticle compositions, as such, to components, e.g. components configured to be used in the method or configured to be used in the method, to uses associated with the method and/or preparations, e.g. comprising lipid nanoparticles, such as lipid nanoparticle compositions obtainable or obtained with the method.
These and/or other aims are achieved by subject-matter disclosed herein and/or by subject-matter set forth in the appended independent claims as will become apparent from the following description.
Advantageous embodiments and refinements, inter alia, are subject to dependent claims.
Summary
One aspect of the present disclosure relates to a method of forming, providing or producing a liquid composition, e.g. by mixing a first liquid and a second liquid. Another aspect of the present disclosure relates to a use of a mixing component for forming, providing or producing a liquid composition, e.g. by mixing a first liquid and a second liquid and/or with the method(s) described herein. Yet another aspect of the present disclosure relates to a preparation comprising lipid nanoparticles, e.g. particles of the liquid composition obtainable or obtained with the method and/or with the use of the mixing component. The preparation may be the liquid composition or be obtained or obtainable from the liquid composition.
It is noted that features which are disclosed herein in connection with the method also apply for the use and features which are disclosed herein for the use also apply for the method. In general, features disclosed in connection with different aspects, examples or embodiments can be combined with one another, even if such a combination is not explicitly described herein. Unless expressly stated otherwise, features disclosed herein above and below apply for all aspects, examples or embodiments of the disclosure, e.g. for the method and the use. Features relating to the liquid composition or the components, methods or uses associated therewith also apply for the preparation and vice versa.
In an embodiment, the method and/or the use comprises:
- guiding a first flow of a first liquid along a first flow path into a mixing chamber, e.g. a region in the mixing component,
- guiding a second flow of a second liquid along a second flow path into the mixing chamber;
- mixing the first liquid and the second liquid in the mixing chamber for the liquid composition, e.g. to form or provide the liquid composition.
In an embodiment, the liquid composition is a lipid nanoparticle (LNP) composition. The composition expediently comprises lipid nanoparticles, e.g. within a carrier liquid, such as a liquid comprising water and/or ethanol.
In an embodiment, the liquid composition is a nucleic acid-LNP composition, e.g. an RNA-LNP composition or a DNA-LNP composition.
In an embodiment, the mixing chamber is provided in a mixing component, the mixing component having a first inlet in fluid communication with the mixing chamber and a second inlet in fluid communication with the mixing chamber. The first and second inlets may be fluidically separated from one another. Thus, the first and second liquid may be separated from one another until they meet in the mixing chamber. The mixing chamber may be that region of the mixing component where the two liquids meet.
In an embodiment, the mixing chamber and/or the mixing component has an outlet. The outlet of the mixing chamber may be a passage where the liquid composition flow, after mixing, enters a section of a flow path or conduit with constant cross sectional area or diameter. The cross sectional area (or cross section) may be less than or equal to the (maximum, minimum and/or average) cross sectional area or diameter of the mixing chamber. The outlet of the mixing component may be the passage to a region of the flow path of the liquid composition downstream of the mixing chamber where the cross section or diameter of the flow path increases (e.g. as compared to the outlet of the mixing chamber). Alternatively or additionally the outlet of the mixing component may be located at an interface between the mixing component and another component, e.g. a tubing. The cross section or diameter of the outlet of the mixing component may be equal to the cross section of the outlet of the mixing chamber. The flow path from the mixing chamber outlet to the mixing component outlet may have a constant cross section or diameter.
In an embodiment, the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of less than or equal to 10000 and/or greater than or equal to 800.
In an embodiment, the mixing component is used to provide a liquid composition, e.g. a lipid nanoparticle (LNP) composition, by mixing a first liquid and a second liquid in a mixing chamber of the mixing component. The mixing component may be used to provide a liquid flow, e.g. away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component, with a Reynolds number of greater than or equal to 800 and/or less than or equal to 10000 at an outlet of the mixing chamber or of the mixing component. The liquid flow may be a flow of the liquid composition.
Reynolds numbers are used to classify a liquid flow. The Reynolds number R of a liquid flow can be calculated by using the following formula:
R = V * D / Vis _kin, where V is the velocity of the liquid flow in m/s (meters per second), D is a characteristic distance (e.g. the diameter of the flow path guiding the liquid flow, e.g. the inner diameter of a conduit) in m (meter) and Vis_kin is the kinematic viscosity in m2/s. The kinematic viscosity results from the (dynamic) viscosity (Vis_dyn) of the liquid in Pascal seconds, Pa s, divided by the density D_L of the liquid, e.g. in kg/m3. The velocity V can be derived from the flow rate (e.g. specified in ml/min, i.e. milliliters per minute) by dividing the flow rate by the cross-sectional area of the flow path guiding the liquid flow. The cross section is taken perpendicular to the flow direction. For a circular cross-section the cross-sectional area is (ID/2)2 * n, with ID being the inner diameter of the flow path, e.g. of an outlet, conduit or tubing.
For determining the Reynolds number of the liquid composition flow away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component characteristic values of the first and second liquids can be used (if applicable weighted with a factor determining the contribution of the flow rate of the first and second liquid into the mixing chamber to the total flow rate of the first and second liquids). Thus, the respective Reynolds number for the liquid composition flow discussed herein may relate to Reynolds numbers based on values for the relevant quantities which are calculated as set forth below or based on values for the relevant quantities which have been measured.
For the liquid composition, i.e. after the liquids have been mixed, the Reynolds number may be calculated by using:
V = (F_l + F_2) / ((D/2)2 * it), with
D being the inner diameter of the flow path at the relevant location, e.g. at the outlet of the mixing chamber or of the mixing component,
F_1 being the flow rate of the first liquid into the mixing chamber, and
F_2 being the flow rate of the second liquid into the mixing chamber (the sum of F_1 and F_2_being the flow rate of the liquid composition at the outlet of the mixing chamber).
Vis_dyn = F_1 / (F_l + F_2) * Vis_l + F_21 (F_l + F_2) * Vis_2, with
Vis_l being the (dynamic) viscosity of the first liquid, Vis_2 being the dynamic viscosity of the second liquid.
D_L = F_1 / (F_l + F_2) * D_1 + F_2 / (F_l + F_2) * D_2, with
D_1 being the density of the first liquid
D_2 being the density of the second liquid
Vis_kin = Vis_dyn / D_L
The Reynolds number then results from:
R = V * D / Vis_kin Reynolds numbers are dimensionless quantities. The Reynolds number can be used to qualify a liquid flow without having to specify dimensions of the conduit or other values which are characteristic for the flow like the flow rate, viscosity, density, etc..
When investigating the formation of LNPs, particularly nucleic acid-LNPs, by mixing two liquids it has been found that having a flow of the liquid composition after the liquids have been mixed with a Reynolds number of less than or equal to 10000 (which is a flow which is turbulent but not yet too turbulent to form advantageous lipid nanoparticles) and/or of greater than or equal to 800 (which is a laminar flow) results in nanoparticles with advantageous properties. For example, nanoparticles in the LNP composition with particular low average diameters (e.g. lower than particles formed under equivalent conditions with a flow having higher Reynolds numbers) and/or with low polydispersity index can be provided when staying below 10000.
The inventors attribute the positive effects for the nanoparticles to the liquid composition flow having Reynolds numbers less than 10000 and/or greater than 800 (e.g. right after the mixing of the first and second liquids, such as in the mixing chamber, at the outlet of the mixing chamber or at the outlet of the mixing component and/or before another substance is being added to the composition) when the mixture is in a state in which the nanoparticles are being formed from ingredients of the first liquid and the second liquid or the formation is being initiated. Having the liquid flow during the (initial) formation stage of the nanoparticles in the specified Reynolds number range resulted in the formation of advantageous nanoparticles.
Reynolds numbers of 2000 and above or 2500 and above, e.g. up to 4000, 5000, 6000 or 6500, 7000, 8000 or 8500, may characterize liquid flow in a transitional regime between laminar flow and turbulent flow or mildly turbulent flow (usually the transition region between laminar and turbulent flow is around 2500). A Reynolds number of 800 characterizes a laminar flow. 10000 characterizes a turbulent but not yet very turbulent flow. Hence, the range of 800 to 10000 covers laminar flow as well as its transition to turbulent and mild turbulent flow. In some embodiments, the liquid flow after mixing is maintained in the relevant Reynolds number range or the Reynolds number is changed after the outlet, e.g. due to an increase in diameter.
In an embodiment, the method and/or the use is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of less than or equal to any one of the following: 9950, 9900, 9850, 9800, 9750, 9700, 9650, 9600, 9550, 9500, 9450, 9400, 9350, 9300, 9250, 9200, 9150, 9100, 9050, 9000, 8950, 8900, 8850, 8800, 8750, 8700, 8650, 8600, 8550, 8500, 8450, 8400, 8350, 8300, 8250, 8200, 8150, 8100, 8050, 8000, 7950, 7900, 7850, 7800, 7750, 7700, 7650, 7600, 7550, 7500, 7450, 7400, 7350, 7300, 7250, 7200,
7150, 7100, 7050, 7000, 6950, 6900, 6850, 6800, 6750, 6700, 6650, 6600, 6550, 6500, 6450, 6400, 6350,
6300, 6250, 6200, 6150, 6100, 6050, 6000, 5950, 5900, 5850, 5800, 5750, 5700, 5650, 5600, 5550, 5500,
5450, 5400, 5350, 5300, 5250, 5200, 5150, 5100, 5050, 5000, 4950, 4900, 4850, 4800, 4750, 4700, 4650,
4600, 4550, 4500, 4450, 4400, 4350, 4300, 4250, 4200, 4150, 4100, 4050, 4000, 3950, 3900, 3850, 3800,
3750, 3700, 3650, 3600, 3550, 3500, 3450, 3400, 3350, 3300, 3250, 3200, 3150, 3100, 3050, 3000, 2950,
2900, 2850, 2800, 2750, 2700, 2650, 2600, 2550, 2500, 2450, 2400, 2350, 2300, 2250, 2200, 2150, 2100,
2050, 2000, 1950, 1900, 1850, 1800, 1750, 1700, 1650, 1600, 1550, 1500, 1450, 1400, 1350, 1300, 1250,
1200, 1150, 1100, 1050, 1000, 950, 900, 850.
In an embodiment, the method and/or the use is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of greater than or equal to any one of the following: 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900,
1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750,
2800, 2850, 2900, 2950, 3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600,
3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450,
4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300,
5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150,
6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000,
7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850,
7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700,
8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550,
9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950.
As noted above, Reynolds numbers below 10000 and/or above 800 (or any other sub-range thereof between 800 to 10000 formed from the disclosed values) can yield advantageous lipid nanoparticles.
In an embodiment, the method and/or the use is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between any one of the following Reynolds number pairs: 800 and 8500, 800 and 6500, 800 and 5000, 1000 and 8500, 1000 and 6500, 1000 and 5000, 2000 and 8500, 2000 and 6500, 2000 and 5000, 3000 and 8500, 3000 and 6500, 3000 and 5000, 4000 and 8500, 4000 and 6500, 4000 and 5000.
In an embodiment, the first liquid and/or the second liquid is guided into the mixing chamber and/or into the mixing component with a flow rate of greater than or equal to any one of the following: 10 ml/min, 20 ml/min, 30 ml/min, 40 ml/min, 50 ml/min, 60 ml/min, 70 ml/min, 80 ml/min, 90 ml/min, 100 ml/min, 110 ml/min, 120 ml/min, 130 ml/min, 140 ml/min, 150 ml/min, 160 ml/min, 170 ml/min, 180 ml/min, 190 ml/min, 200 ml/min, 210 ml/min, 220 ml/min.
In an embodiment, the first liquid and/or the second liquid is guided into the mixing chamber and/or into the mixing component with a flow rate of less than or equal to any one of the following: 660 ml/min, 650 ml/min, 640 ml/min, 630 ml/min, 620 ml/min, 610 ml/min, 600 ml/min, 590 ml/min, 580 ml/min, 570 ml/min, 560 ml/min, 550 ml/min, 540 ml/min, 530 ml/min, 520 ml/min, 510 ml/min, 500 ml/min, 490 ml/min, 480 ml/min, 470 ml/min, 460 ml/min, 450 ml/min, 440 ml/min, 430 ml/min, 420 ml/min, 410 ml/min, 400 ml/min, 390 ml/min, 380 ml/min, 370 ml/min, 360 ml/min, 350 ml/min, 340 ml/min, 330 ml/min, 320 ml/min, 310 ml/min, 300 ml/min, 290 ml/min, 280 ml/min, 270 ml/min, 260 ml/min, 250 ml/min, 240 ml/min, 230 ml/min, 220 ml/min, 210 ml/min, 200 ml/min, 190 ml/min, 180 ml/min, 170 ml/min, 160 ml/min, 150 ml/min, 140 ml/min, 130 ml/min, 120 ml/min, 110 ml/min, 100 ml/min, 90 ml/min, 80 ml/min, 70 ml/min, 60 ml/min, 50 ml/min, 40 ml/min, 30 ml/min, 20 ml/min, 10 ml/min.
Thus, the flow rate of the first liquid and/or the flow rate of the second liquid may be between 10 and 660 ml/min. Arbitrary sub-ranges may be formed by the disclosed values.
In an embodiment, the flow may be driven by an associated flow driver, e.g. a pump. One flow driver may be assigned to each liquid, i.e. the first liquid or the second liquid. The liquid composition may be driven by the flow drivers in combination.
In an embodiment, the flow rate with which the first liquid is guided or driven into the mixing chamber is different from, e.g. greater than, the flow rate with which the second liquid is guided or driven into the mixing chamber. The ratio between the flow rate of the first liquid and the flow rate of the second liquid may be less than or equal to any one of the following: 5, 4, 3. The ratio may be greater than 1 or greater than 2, e.g. 3.
In an embodiment, the liquid composition is guided or driven away from the mixing chamber and/or leaves the mixing chamber or the mixing component via the respective outlet with a flow rate of greater than or equal to any one of the following: 10 ml/min, 20 ml/min, 30 ml/min, 40 ml/min, 50 ml/min, 60 ml/min, 70 ml/min, 80 ml/min, 90 ml/min, 100 ml/min, 110 ml/min, 120 ml/min, 130 ml/min, 140 ml/min, 150 ml/min, 160 ml/min, 170 ml/min, 180 ml/min, 190 ml/min, 200 ml/min, 210 ml/min, 220 ml/min, 230 ml/min, 240 ml/min, 250 ml/min, 260 ml/min, 270 ml/min, 280 ml/min, 290 ml/min, 300 ml/min, 310 ml/min, 320 ml/min, 330 ml/min, 340 ml/min, 350 ml/min, 360 ml/min, 370 ml/min, 380 ml/min, 390 ml/min, 400 ml/min, 410 ml/min, 420 ml/min, 430 ml/min, 440 ml/min, 450 ml/min, 460 ml/min, 470 ml/min, 480 ml/min, 490 ml/min, 500 ml/min, 510 ml/min, 520 ml/min, 530 ml/min, 540 ml/min, 550 ml/min, 560 ml/min, 570 ml/min, 580 ml/min, 590 ml/min, 600 ml/min, 610 ml/min, 620 ml/min, 630 ml/min, 640 ml/min, 650 ml/min, 660 ml/min, 670 ml/min, 680 ml/min, 690 ml/min, 700 ml/min, 710 ml/min, 720 ml/min, 730 ml/min, 740 ml/min, 750 ml/min, 760 ml/min, 770 ml/min, 780 ml/min, 790 ml/min, 800 ml/min, 810 ml/min, 820 ml/min, 830 ml/min, 840 ml/min, 850 ml/min, 860 ml/min, 870 ml/min, 880 ml/min, 890 ml/min, 900 ml/min, 950 ml/min, 1000 ml/min.
As noted, the flow rate of the liquid composition away from the mixing chamber or at its outlet may be defined by, e.g. equal to, the sum of the flow rates with which the first liquid and the second liquid enter the mixing chamber. Thus, the same flow drivers may be used to drive the first and second liquid flow and also the liquid composition flow.
In an embodiment, the liquid composition is guided or driven away from the mixing chamber and/or leaves the mixing chamber or the mixing component via the outlet with a flow rate of less than or equal to any one of the following: 1000 ml/min, 950 ml/min, 900 ml/ min, 890 ml/min, 880 ml/min, 870 ml/min, 860 ml/min, 850 ml/min, 840 ml/min, 830 ml/min, 820 ml/min, 810 ml/min, 800 ml/min, 790 ml/min,
780 ml/min, 770 ml/min, 760 ml/min, 750 ml/min, 740 ml/min, 730 ml/min, 720 ml/min, 710 ml/min,
700 ml/min, 690 ml/min, 680 ml/min, 670 ml/min, 660 ml/min, 650 ml/min, 640 ml/min, 630 ml/min,
620 ml/min, 610 ml/min, 600 ml/min, 590 ml/min, 580 ml/min, 570 ml/min, 560 ml/min, 550 ml/min,
540 ml/min, 530 ml/min, 520 ml/min, 510 ml/min, 500 ml/min, 490 ml/min, 480 ml/min, 470 ml/min,
460 ml/min, 450 ml/min, 440 ml/min, 430 ml/min, 420 ml/min, 410 ml/min, 400 ml/min, 390 ml/min,
380 ml/min, 370 ml/min, 360 ml/min, 350 ml/min, 340 ml/min, 330 ml/min, 320 ml/min, 310 ml/min,
300 ml/min, 290 ml/min, 280 ml/min, 270 ml/min, 260 ml/min, 250 ml/min, 240 ml/min, 230 ml/min,
220 ml/min, 210 ml/min, 200 ml/min, 190 ml/min, 180 ml/min, 170 ml/min, 160 ml/min, 150 ml/min,
140 ml/min, 130 ml/min, 120 ml/min, 110 ml/min, 100 ml/min, 90 ml/min, 80 ml/min, 70 ml/min, 60 ml/min, 50 ml/min, 40 ml/min, 30 ml/min, 20 ml/min, 10 ml/min.
Thus, the flow rate of the liquid composition may be between 10 ml/min and 1000 ml/min or be in any sub-range derived from the values stated above.
In an embodiment, the nanoparticles of the lipid nanoparticle composition have a size of less than or equal to any one of the following: 195 nm, 190 nm, 185 nm, 180 nm, 175 nm, 170 nm, 165 nm, 160 nm, 155 nm, 150 nm, 145 nm, 140 nm, 135 nm, 130 nm, 125 nm, 120 nm, 115 nm, 110 nm, 105 nm, 100 nm, 95 nm, 90 nm, 85 nm, 80 nm, 75 nm, 70 nm, 65 nm, 60 nm, 55 nm, 50 nm, 45 nm, 40 nm.
In an embodiment, the nanoparticles of the lipid nanoparticle composition have a size of greater than or equal to any one of the following: 20 nm, 25 nm, 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, 155 nm, 160 nm, 165 nm, 170 nm, 175 nm, 180 nm, 185 nm,
190 nm, 195 nm
In an embodiment, the nanoparticles of the lipid nanoparticle composition have a size, e.g. an average size, of greater than or equal to any one of the following: 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, 50 nm (nm: nanometers).
In an embodiment, the nanoparticles of the lipid nanoparticle composition have a size, e.g. an average size, of less than or equal to any one of the following: 100 nm, 99 nm, 98 nm, 97 nm, 96 nm, 95 nm, 94 nm, 93 nm, 92 nm, 91 nm, 90 nm, 89 nm, 88 nm, 87 nm, 86 nm, 85 nm, 84 nm, 83 nm, 82 nm, 81 nm, 80 nm, 79 nm, 78 nm, 77 nm, 76 nm, 75 nm, 74 nm, 73 nm, 72 nm, 71 nm, 70 nm, 69 nm, 68 nm, 67 nm, 66 nm, 65 nm, 64 nm, 63 nm, 62 nm, 61 nm, 60 nm, 59 nm, 58 nm, 57 nm, 56 nm, 55 nm, 54 nm, 53 nm, 52 nm, 51 nm, 50 nm.
The size may be defined by the diameter of the nanoparticles, e.g. based on the maximum, minimum or average diameter of the particles.
The size of the nanoparticles may be between 20 nm and 195 nm or be in any sub-range derived from the values stated above, e.g. between 40 nm and 100 nm.
We note that the size depends on whether and what substance the nanoparticles encapsulate. The greater the substance, the greater the nanoparticles, of course.
In an embodiment, the outlet of the mixing chamber or of the mixing component has a diameter of greater than or equal to any one of the following: 0.1 mm, 0.15 mm, 0.2 mm, 0.25 mm, 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm (mm: millimeters).
The respective diameters for inlets, openings or flow paths specified herein are expediently inner diameters. In case the diameter of the flow path or conduit varies, e.g. azimuthally or circumferentially, the diameter at a certain position of the flow path may be the maximum, minimum or average diameter at the certain position.
In an embodiment, the outlet of the mixing chamber or of the mixing component has a diameter of less than or equal to any one of the following: 4 mm, 3.5 mm, 3 mm, 2.5 mm, 2 mm, 1.5 mm, 1 mm, 0.95 mm, 0.9 mm, 0.85 mm, 0.8 mm, 0.75 mm, 0.7 mm, 0.65 mm, 0.6 mm, 0.55 mm, 0.5 mm. The outlet of the mixing chamber or of the mixing component may have a diameter of between 0.1 mm and 4 mm or be in any sub-range derived from the values stated above.
In an embodiment, the first inlet and/or the second inlet of the mixing chamber or of the mixing component has a diameter of greater than or equal to any one of the following: 0.1 mm, 0.15 mm, 0.2 mm, 0.25 mm, 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm.
In an embodiment, the first inlet and/or the second inlet of the mixing chamber or of the mixing component has a diameter of less than or equal to any one of the following: 4 mm, 3.5 mm, 3 mm, 2.5 mm, 2 mm, 1.5 mm, 1 mm, 0.95 mm, 0.9 mm, 0.85 mm, 0.8 mm, 0.75 mm, 0.7 mm, 0.65 mm, 0.6 mm, 0.55 mm, 0.5 mm.
The first inlet of the mixing chamber or of the mixing component may have a diameter of between 0.1 mm and 4 mm or be in any sub-range derived from the values stated above.
The second inlet of the mixing chamber or of the mixing component may have a diameter of between 0.1 mm and 4 mm or be in any sub-range derived from the values stated above.
The first inlet and the second inlet may have the same or different diameters.
The outlet may have the same diameter as one of or both of the inlets. The outlet may have a diameter which is different from the diameter of the first and the second inlets.
In an embodiment, a viscosity of the first liquid and/or of the second liquid is greater than or equal to any one of the following values: 0.5 cP, 0.6 cP, 0.7 cP, 0.8 cP, 0.9 cP, 1.0 cP, 1.1 cP (cP: centi-Poise = mPa s, milliPascal seconds).
In an embodiment, a viscosity of the first liquid and/or or the second liquid is less than or equal to any one of the following values: 1.8 cP, 1.7 cP, 1.6 cP, 1.5cP, 1.4 cp, 1.3 cP, 1.2 cP, 1.1 cP, 1.0 cP, 0.9 cP.
The viscosity of the first liquid and/or the second liquid may be between 0.5 cP and 1.8 cP or be in any sub-range derived from the values stated above.
In an embodiment a viscosity of the liquid composition is less than or equal to any one of the following values: 1.8 cP, 1.7 cP, 1.6 cP, 1.5cP, 1.4 cp, 1.3 cP, 1.2 cP, 1.1 cP, 1.0 cP. In an embodiment a viscosity of the liquid composition is greater than or equal to any one of the following values: 0.5 cP, 0.6 cP, 0.7 cP, 0.8 cP, 0.9 cP.
The viscosity of the liquid composition may be between 0.5 cP and 1.8 cP or be in any sub-range derived from the values stated above.
In an embodiment, the viscosity of the first liquid is lower than the one of the second liquid.
In case of doubt, measurements of quantities mentioned herein may be performed according to what is specified in an associated standard, e.g. a DIN standard or EN standard, or documents having standard character. Taking the viscosity as an example, standards which are related to the determination of viscosities are: DIN 1319, DIN 1342, DIN 53019-1 or DIN 53019-2.
In an embodiment, a density of the first liquid and/or of the second liquid is less than or equal to any one of the following values: 1200 kg/m3, 1190 kg/m3, 1180 kg/m3, 1170 kg/m3, 1160 kg/m3, 1150 kg/m3, 1140 kg/m3, 1130 kg/m3, 1120 kg/m3, 1110 kg/m3, 1100 kg/m3, 1090 kg/m3, 1080 kg/m3, 1070 kg/m3, 1060 kg/m3, 1050 kg/m3, 1040 kg/m3, 1030 kg/m3, 1020 kg/m3, 1010 kg/m3, 1000 kg/m3, 990 kg/m3, 980 kg/m3, 970 kg/m3, 960 kg/m3, 950 kg/m3, 940 kg/m3, 930 kg/m3, 920 kg/m3, 910 kg/m3, 900 kg/m3, 890 kg/m3, 880 kg/m3, 870 kg/m3, 860 kg/m3, 850 kg/m3, 840 kg/m3, 830 kg/m3, 820 kg/m3, 810 kg/m3, 800 kg/m3, 790 kg/m3.
In an embodiment, a density of the first liquid and/or of the second liquid is greater than or equal to any one of the following values: 500 kg/m3, 510 kg/m3, 520 kg/m3, 530 kg/m3, 540 kg/m3, 550 kg/m3, 560 kg/m3, 570 kg/m3, 580 kg/m3, 590 kg/m3, 600 kg/m3, 610 kg/m3, 620 kg/m3, 630 kg/m3, 640 kg/m3, 650 kg/m3, 660 kg/m3, 670 kg/m3, 680 kg/m3, 690 kg/m3, 700 kg/m3, 710 kg/m3, 720 kg/m3, 730 kg/m3, 740 kg/m3, 750 kg/m3, 760 kg/m3, 770 kg/m3, 780 kg/m3, 790 kg/m3, 800 kg/m3, 810 kg/m3, 820 kg/m3, 830 kg/m3, 840 kg/m3, 850 kg/m3, 860 kg/m3, 870 kg/m3, 880 kg/m3, 890 kg/m3, 900 kg/m3, 910 kg/m3, 920 kg/m3, 930 kg/m3, 940 kg/m3, 950 kg/m3.
The density of the first liquid may be greater than the one of the second liquid.
The density of the first liquid may be between 500 kg/m3 and 1200 kg/m3 or be in any sub-range derived from the values stated above.
The density of the second liquid may be between 500 kg/m3 and 1200 kg/m3 or be in any sub-range derived from the values stated above. The specified densities and/or viscosities are typical for liquids suitable for LNP formation when mixing the liquids.
In an embodiment, the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of less than or equal to any one of the following: 0.3, 0.29, 0.28, 0.27, 0.26, 0.25, 0.24, 0.23, 0.22, 0.21, 0.2, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06.
In an embodiment, the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of greater than or equal to any one of the following: 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22.
The polydispersity index (PDI) is a heterogeneity index. The smaller the PDI, the less the variations in particle size in the nanoparticles in the LNP composition. An associated industry standard may be: ISO 22412:2017 (relating to the particle size analysis and dynamic light scattering). In case of doubt, the system available as Malvern Zetasizer Ultra can be used to determine the size and/or the PDI of the LNPs.
The polydispersity index of the liquid composition may be between 0.008 and 0.3 or be in any sub-range derived from the values stated above.
In some embodiments, lipid nanoparticles, e.g. nucleic acid-LNPs, may be formed in the liquid composition with a flow rate of the composition after mixing or at the outlet of the mixing chamber or mixing component of greater than or equal to 50 ml/min, 60 ml/min, 70 ml/min, 80 ml/min, 90 ml/min, 100 ml/min, e.g. of 200 ml/min or more. The PDI of the nanoparticles may be 0.13 or less, 0.12 or less, or 0.11 or less. The size of the nanoparticles may be 65 nm or less, or 60 nm or less.
In an embodiment, the first inlet is used for the first liquid or the second liquid. The second inlet may be used for the other liquid not being guided through the first inlet into the mixing chamber. It has been noted that particles with advantageous properties can be provided regardless of which inlet is used for the first liquid and which inlet is used for the second liquid.
In an embodiment, the mixing component is an impingement jet mixer. The impinging jets in the mixer may provide for some turbulence or agitation in the mixing chamber to enhance or promote mixing of the first and second liquids.
In an embodiment, the mixing component is a T-mixer. The T-mixer may be used for impingement jet mixing. Alternatively, a dedicated impingement jet mixing unit may be used. The T-mixer may have its mixing chamber at the location where the three flow path sections (as defined by the "T") meet. The first and second liquid may enter the T-mixer through the opposite inlets. The flows of the first and second liquid may be oppositely directed in the T-mixer, may meet one another in the mixing chamber where the liquids can be mixed. The liquid composition leaves the mixing chamber and/or the T-mixer with a flow direction at an angle, e.g. about 90° or 90°, with respect to the flow direction of the first and/or second liquid into the mixing chamber.
In an embodiment, the mixing component is configured to provide a linear flow and/or spatially nonoscillating flow at the outlet of the mixing component.
In an embodiment, the mixing component is a static mixer. Static mixers, such as T-mixers, do not require, and preferably do not use, additional energy, e.g. mechanical energy, for the mixing process in addition to the energy provided by the flow of the first liquid and the second liquid into the mixing chamber. For example, shaking or stirring is not required.
In an embodiment, the first liquid comprises RNA or DNA.
In an embodiment, the first liquid is an aqueous phase or an aqueous solution.
In an embodiment, the first liquid has a pH-value below 7 and/or greater than or equal to 2. The first liquid may have a pH-value of 4 or more, e.g. between 4 and 6. The first liquid may be an acidic liquid. The pH-value may be adjusted to the proper range by adding citric acid and/or citrate or acetic acid and/or acetate.
In an embodiment, the second liquid comprises one or more lipids.
In an embodiment, the second liquid comprises one or more or all of: a cationic lipid, a non-cationic lipid or helper lipid, a PEG-lipid (sometimes also termed: PEGylated lipid or PEG-conjugated lipid) or a non- PEG-lipid, and cholesterol. A second liquid with such a configuration is particularly suitable for lipid nanoparticle formation, and, especially, for RNA-LNPs. The second liquid, in this case, may also be referred to as a four-component system e.g. it may consist of the components mentioned.
In an embodiment, the second liquid comprises one or more or all of: a cationic lipid, a non-cationic lipid or helper lipid, an anionic lipid (e.g. dimyristoylglycerolhemisuccinate (DMGS)), and cholesterol. A second liquid with such a configuration is particularly suitable for lipid nanoparticle formation, and, especially, for RNA-LNPs. The second liquid, in this case, may also be referred to as a four-component system e.g. it may consist of the components mentioned. LNPs obtained with such a second liquid may be referred to as aLNPs, where "a" hints to the anionic lipid in the second liquid. In an embodiment, the second liquid comprises one or more or all of: a cationic lipid, a non-cationic lipid or helper lipid, and cholesterol. The second liquid, in this case, may also be referred to as a three- component system, e.g. it may consist of the components mentioned. The second liquid, in this case may be free or substantially free of anionic lipids and/or free of PEG-lipids. A second liquid with such a configuration is particularly suitable for lipid nanoparticle formation, and, especially, for RNA-LNPs.
In an embodiment, the second liquid comprises one or more or all of: a cationic lipid, a non-cationic lipid, a stealth lipid, and cholesterol. The stealth lipid may be a PEG lipid, a pSAR lipid or a pAEEA lipid. A second liquid with such a configuration is particularly suitable for lipid nanoparticle formation, and, especially, for RNA-LNPs.
In an embodiment, the second liquid comprises a cationic lipid, a non-cationic lipid and cholesterol. The second liquid may further comprise a stealth lipid, an anionic lipid, and/or a PEG-lipid. Alternatively or additionally, the second liquid may be free or substantially free of PEG-lipids.
In an embodiment, the second liquid is an organic phase.
In an embodiment, the second liquid comprises an organic solvent.
In an embodiment, the organic solvent is selected from the group of ethanol, propanol, isopropanol and acetone.
In an embodiment, the first liquid comprises
- RNA, the second liquid comprises
- a cationic lipid, a non-cationic lipid or helper lipid, a PEG-lipid, and cholesterol, wherein the first liquid and the second liquid are mixed in the mixing chamber to provide the liquid composition, the liquid composition having a flow rate of greater than or equal to 65 ml/min and optionally less than or equal to 300 ml/min at an outlet of the mixing chamber or of a mixing component comprising the mixing chamber, wherein a diameter of the flow path at the outlet is greater than or equal to 0.15 mm and, optionally, less than or equal to 1 mm or less than or equal to 0.85 mm.
In an embodiment, the liquid composition comprises lipid nanoparticles, the respective lipid nanoparticle encapsulating nucleic acid, e.g. RNA or DNA. In an embodiment, the liquid composition is a dispersion. The liquid composition may be a homogeneous dispersion. That is to say, the dispersed phase (e.g. the nanoparticles) is homogeneous, e.g. with a low PDI, such as below 0.13, or below 0.12 or below 0.11.
In an embodiment, the first liquid is a solution and/or the second liquid is a solution.
Another aspect of the disclosure relates to a method of processing a liquid composition obtainable or obtained with the method of providing or forming the liquid composition described further above. The processed liquid composition still comprises the LNPs. The processed liquid composition may be the preparation set forth below. The processed liquid composition may be a drug product and/or a pharmaceutical product.
In an embodiment, a third liquid is added to the liquid composition downstream of the mixing chamber.
In an embodiment, a further mixing chamber, e.g. in a further mixing component, e.g. a T-mixer, is used for mixing the liquid composition and the third liquid.
In an embodiment, the length of a flow path fluidly connecting the outlet of the mixing chamber or the mixing component and an inlet of the further mixing chamber or of the further mixing component, the inlet being provided for the liquid composition, is greater than or equal to one of the following: 5 cm, 6 cm, 7 cm, 8 cm, 9 cm, 10 cm, 11 cm, 12 cm, 13 cm, 14 cm, 15 cm, 16 cm, 17 cm, 18 cm, 19 cm, 20 cm (cm: centimeters). The liquid composition may enter the further mixing chamber or mixing component through the inlet.
In an embodiment, the length of a flow path fluidly connecting the outlet of the mixing chamber or the mixing component and an inlet of the further mixing chamber or of the further mixing component, the inlet being provided for the liquid composition, is less than or equal to one of the following: 40 cm, 39 cm, 38 cm, 37 cm, 36 cm, 35 cm, 34 cm, 33 cm, 32 cm, 31 cm, 30 cm, 29 cm, 28 cm, 27 cm, 26 cm, 25 cm, 24 cm, 23 cm, 22 cm, 21 cm, 20 cm.
Thus, the length of the flow path may be between 5 cm and 40 cm. Arbitrary sub-ranges may be formed by the disclosed values.
In an embodiment, the third liquid is a buffer and/or provided to provide quenching for the liquid composition. The third liquid may be a buffer, e.g. a citrate buffer, sodium triphosphate pentabasic (also termed "3P" herein) or Tris buffer. 3P may be particularly suitable for a second liquid which is a three- component system as set forth further above. Tris buffer may be used for systems using non-PEG lipids in the second liquid and/or for aLNPs, for example. The citrate buffer may be used for four component systems, e.g. with a PEG lipid.
In an embodiment, the liquid composition, e.g. the processed or unprocessed liquid composition, is filtered through a filter. The filter may be a 0.2 pm filter, i.e. a filter which is designed to allow particles with a size or diameter below 200 nm to pass through the filter. In other words, the pore size may be 0.2 pm.
In an embodiment, a filter area of the filter is less than or equal to A cm2 per gram of RNA in the lipid nanoparticles, where A is any one of the following values: 180, 170, 160, 150, 140, 130, 120. In this case, the first liquid comprises RNA, of course.
In an embodiment, a filter area of the filter is greater than or equal to A cm2 per gram of RNA in the lipid nanoparticles, where A is any one of the following values: 80, 90, 100, 110, 120.
Thus, A may be between 80 and 180. Arbitrary sub-ranges may be formed by the disclosed values.
In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition deviates from the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition by less than or equal to any one of: 25 %, 24%, 23 %, 22 %, 21 %, 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0.5 %.
In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition is equal to or lower than the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition.
In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and/or the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of the following: 0.2, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06. Hence, particles with advantageously low PDI can be obtained and maintained at low PDI throughout different process steps.
In an embodiment, an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of: 0.030, 0.025, 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005. In an embodiment, the liquid composition, e.g. the filtered or unfiltered liquid composition, is frozen to a predetermined temperature, e.g. to - 20 °C or - 70 °C. The frozen liquid composition may be thawed, e.g. until the thawed liquid composition has reached room temperature. The frozen liquid may be thawed after a predetermined time. That is to say, the liquid composition is kept frozen for the predetermined time. After that time, the frozen composition may be allowed to thaw at room temperature, e.g. without applying additional heat.
In an embodiment, the predetermined time is greater than or equal to any one of: one week, two weeks, three weeks, four weeks, five weeks, six weeks, one month, two months, three months, six months, twelve months, 24 months.
In an embodiment, the predetermined time is less than or equal to any one of: one week, two weeks, four weeks, five weeks, six weeks, one month, two months, three months, six months, twelve months, 24 months, 36 months.
In an embodiment, multiple freeze and thaw cycles, e.g. more than 2 such as 5, are conducted with the liquid composition, e.g. in the predetermined time. When having thawed at the end of one freeze and thaw cycle (e.g. up to room temperature), the liquid composition may be frozen again until a predetermined number of cycles has been completed, e.g. frozen x times and thawed x times; x may be 3, 4, or 5, for example. The freeze and thaw cycles may be performed between - 20° C and room temperature or between - 70°C and room temperature, for example. For one set of multiple freeze and thaw cycles the temperature to which the liquid composition is frozen is kept constant between different cycles of the same set.
In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which has been thawed after the predetermined time or after the last thawing process of the multiple freeze and thaw cycles has been completed, deviates from the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition by less than or equal to any one of: 25 %, 24%, 23 %, 22 %, 21%, 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0.5 %.
In an embodiment, an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which has been thawed after the predetermined time or after the last thawing process of the multiple freeze and thaw cycles has been completed, and the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition is less than or equal to any one of: 0.030, 0.025, 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005. In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, is equal to or lower than the poly dispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition.
In an embodiment, the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, and/or the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition, e.g. directly before the (first) freeze cycle or in a fully processed liquid composition, is less than or equal to any one of the following: 0.2, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06. Hence, particles with advantageously low PDI can be obtained and maintained at low PDI throughout different process steps.
In an embodiment, the polydispersity index of the nanoparticles in the thawed liquid composition, which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, is less than or equal to any one of the following: 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06, 0.55, 0.05, 0.45, 0.04, 0.35, 0.03.
The respective deviation or difference mentioned above may be greater than zero or zero.
The respective deviation in percentage shown above may be determined by (PDI_1 - PDI_2) / PDI_1 x 100 %. If the value is negative, the absolute value is used to yield a positive result.
Thus, processing steps like filtering, freezing and/or thawing may not change the PDI significantly or lower the PDI, when the processes, uses and/or components proposed herein are applied. This suggests very homogenously configured lipid nanoparticles in the composition before it is filtered already or advantageous characteristics of the lipid nanoparticles which favors a particularly low PDI. The composition may be the one with or without addition of the third liquid or a further processed composition.
In an embodiment, the liquid composition, e.g. before filtering, may be purified and/or the organic solvent may be reduced or removed.
Another aspect of the present disclosure relates to a preparation, e.g. a pharmaceutical preparation, the preparation comprising lipid nanoparticles, the lipid nanoparticles or the preparation being obtainable or obtained with any one of the methods described herein above or below or with the use as described herein above or below. Hence, features described for any one of the methods above or below or the use also apply to the preparation and vice versa. The preparation may be the (unprocessed or processed) liquid composition. Hence, features described for the composition or its nanoparticles also apply for the preparation and its nanoparticles.
In an embodiment, the mixing component used herein does not introduce spatial oscillations in the fluid flow.
Certain Definitions
About or Approximately: The term “about” or “approximately”, when used herein in reference to a value, refers to a value that is similar, in context to a stated reference value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” or “approximately” in that context. For example, in some embodiments, the term “about” or “approximately” may encompass a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.
Administration: As used herein, the term “administration” typically refers to the administration of a composition to a subject or system. Those of ordinary skill in the art will be aware of a variety of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, intradermal, transdermal, etc.), enteral, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e. g. intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreal, etc. In some embodiments, administration may be intramuscular. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and/or periodic (e.g. , individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.
Agent: In general, the term “agent”, as used herein, is used to refer to an entity (e.g. , for example, a lipid, metal, nucleic acid, polypeptide, polysaccharide, small molecule, etc., or complex, combination, mixture or system [e.g., cell, tissue, organism] thereof), or phenomenon (e.g., heat, electric current or field, magnetic force or field, etc.). In appropriate circumstances, as will be clear from context to those skilled in the art, the term may be utilized to refer to an entity that is or comprises a cell or organism, or a fraction, extract, or component thereof. Alternatively or additionally, as context will make clear, the term may be used to refer to a natural product in that it is found in and/or is obtained from nature. In some instances, again as will be clear from context, the term may be used to refer to one or more entities that is man-made in that it is designed, engineered, and/or produced through action of the hand of man and/or is not found in nature. In some embodiments, an agent may be utilized in isolated or pure form; in some embodiments, an agent may be utilized in crude form. In some embodiments, potential agents may be provided as collections or libraries, for example that may be screened to identify or characterize active agents within them. In some cases, the term “agent” may refer to a compound or entity that is or comprises a polymer; in some cases, the term may refer to a compound or entity that comprises one or more polymeric moieties. In some embodiments, the term “agent” may refer to a compound or entity that is not a polymer and/or is substantially free of any polymer and/or of one or more particular polymeric moieties. In some embodiments, the term may refer to a compound or entity that lacks or is substantially free of any polymeric moiety.
Analog: As used herein, the term “analog” refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an “analog” shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, an analog is a substance that can be generated from the reference substance, e.g.. by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance. In some embodiments, an analog is or can be generated through performance of a synthetic process different from that used to generate the reference substance.
Antibody agent: As used herein, the term "antibody agent" refers to an agent that specifically binds to a particular antigen. In some embodiments, the term encompasses any polypeptide or polypeptide complex that includes immunoglobulin structural elements sufficient to confer specific binding. Exemplary antibody agents include, but are not limited to monoclonal antibodies or polyclonal antibodies. In some embodiments, an antibody agent may include one or more constant region sequences that are characteristic of mouse, rabbit, primate, or human antibodies. In some embodiments, an antibody agent may include one or more sequence elements are humanized, primatized, chimeric, etc., as is known in the art. In many embodiments, the term "antibody agent" is used to refer to one or more of the art-known or developed constructs or formats for utilizing antibody structural and functional features in alternative presentation. For example, embodiments, an antibody agent utilized in accordance with the present disclosure is in a format selected from, but not limited to, intact IgA, IgG, IgE or IgM antibodies; bi- or multi- specific antibodies (e.g., Zybodies®, etc.); antibody fragments such as Fab fragments, Fab' fragments, F(ab')2 fragments, Fd' fragments, Fd fragments, and isolated complementarity determining regions (CDRs) or sets thereof; single chain Fvs; polypeptide -Fc fusions; single domain antibodies (e.g., shark single domain antibodies such as IgNAR or fragments thereof); cameloid antibodies; masked antibodies (e.g., Probodies®); Small Modular ImmunoPharmaceuticals ("SMIPsTM"); single chain or Tandem diabodies (TandAb®); VHHs; Anticalins®; Nanobodies® minibodies; BiTE®s; ankyrin repeat proteins or DARPINs®; Avimers®; DARTs; TCR-like antibodies; Adnectins®; Affilins®; Transbodies®; Affibodies®; TrimerX®; MicroProteins; Fynomers®, Centyrins®; and KALBITOR®s. In some embodiments, an antibody may lack a covalent modification (e.g., attachment of a glycan) that it would have if produced naturally. In some embodiments, an antibody may contain a covalent modification (e.g. , attachment of a glycan, a payload [e.g., a detectable moiety, a therapeutic moiety, a catalytic moiety, etc.}, or other pendant group [e.g., poly-ethylene glycol, etc.}. In many embodiments, an antibody agent is or comprises a polypeptide whose amino acid sequence includes one or more structural elements recognized by those skilled in the art as a complementarity determining region (CDR); in some embodiments an antibody agent is or comprises a polypeptide whose amino acid sequence includes at least one CDR (e.g., at least one heavy chain CDR and/or at least one light chain CDR) that is substantially identical to one found in a reference antibody. In some embodiments an included CDR is substantially identical to a reference CDR in that it is either identical in sequence or contains between 1-5 amino acid substitutions as compared with the reference CDR. In some embodiments an included CDR is substantially identical to a reference CDR in that it shows at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDR. In some embodiments, an included CDR is substantially identical to a reference CDR in that it shows at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDR. In some embodiments an included CDR is substantially identical to a reference CDR in that at least one amino acid within the included CDR is deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical with that of the reference CDR. In some embodiments an included CDR is substantially identical to a reference CDR in that 1-5 amino acids within the included CDR are deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical to the reference CDR. In some embodiments, an included CDR is substantially identical to a reference CDR in that at least one amino acid within the included CDR is substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical with that of the reference CDR. In some embodiments, an included CDR is substantially identical to a reference CDR in that 1-5 amino acids within the included CDR are deleted, added, or substituted as compared with the reference CDR but the included CDR has an amino acid sequence that is otherwise identical to the reference CDR. In some embodiments, an antibody agent is or comprises a polypeptide whose amino acid sequence includes structural elements recognized by those skilled in the art as an immunoglobulin variable domain. In some embodiments, an antibody agent is a polypeptide protein having a binding domain which is homologous or largely homologous to an immunoglobulin-binding domain. Antibody agents can be made by the skilled person using methods and commercially available services and kits known in the art. For example, methods of preparation of monoclonal antibodies are well known in the art and include hybridoma technology and phage display technology. Further antibodies suitable for use in the present disclosure are described, for example, in the following publications: Antibodies A Laboratory Manual, Second edition. Edward A. Greenfield. Cold Spring Harbor Laboratory Press (September 30, 2013); Making and Using Antibodies: A Practical Handbook, Second Edition. Eds. Gary C. Howard and Matthew R. Kaser. CRC Press (July 29, 2013); Antibody Engineering: Methods and Protocols, Second Edition (Methods in Molecular Biology). Patrick Chames. Humana Press (August 21,
2012); Monoclonal Antibodies: Methods and Protocols (Methods in Molecular Biology). Eds. Vincent Ossipow and Nicolas Fischer. Humana Press (February 12, 2014); and Human Monoclonal Antibodies: Methods and Protocols (Methods in Molecular Biology). Michael Steinitz. Humana Press (September 30,
2013)).
Antibodies may be produced by standard techniques, for example by immunization with the appropriate polypeptide or portion(s) thereof, or by using a phage display library. If polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc.) is immunized with an immunogenic polypeptide bearing a desired epitope(s), optionally haptenized to another polypeptide. Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface-active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Serum from the immunized animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to the desired epitope contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography or any other method known in the art. Techniques for producing and processing polyclonal antisera are well known in the art.
Antigen-. The term “antigen”, as used herein, refers to an agent that elicits an immune response; and/or (ii) an agent that binds to a T cell receptor (e.g., when presented by an MHC molecule) or to an antibody. In some embodiments, an antigen elicits a humoral response (e.g., including production of antigenspecific antibodies); in some embodiments, an antigen elicits a cellular response (e.g., involving T-cells whose receptors specifically interact with the antigen). In some embodiments, an antigen binds to an antibody and may or may not induce a particular physiological response in an organism. In general, an antigen may be or include any chemical entity such as, for example, a small molecule, a nucleic acid, a polypeptide, a carbohydrate, a lipid, a polymer (in some embodiments other than a biologic polymer [e.g., other than a nucleic acid or amino acid polymer) etc. In some embodiments, an antigen is or comprises a polypeptide. In some embodiments, an antigen is or comprises a glycan. Those of ordinary skill in the art will appreciate that, in general, an antigen may be provided in isolated or pure form, or alternatively may be provided in crude form (e.g., together with other materials, for example in an extract such as a cellular extract or other relatively crude preparation of an antigen-containing source). In some embodiments, antigens utilized in accordance with the present disclosure are provided in a crude form. In some embodiments, an antigen is a recombinant antigen.
Binding'. It will be understood that the term “binding”, as used herein, typically refers to a non-covalent association between or among two or more entities. “Direct” binding involves physical contact between entities or moieties; indirect binding involves physical interaction by way of physical contact with one or more intermediate entities. Binding between two or more entities can typically be assessed in any of a variety of contexts - including where interacting entities or moieties are studied in isolation or in the context of more complex systems (e.g., while covalently or otherwise associated with a carrier entity and/or in a biological system or cell).
Bioreactor'. The term “bioreactor” as used herein refers to a vessel used for in vitro transcription described herein. A bioreactor can be of any size so long as it is useful for in vitro transcription. For example, in some embodiments, a bioreactor can be at least 0.5 liter, including 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 liters or more, or any volume in between. The internal conditions of the bioreactor, including, but not limited to pH and temperature, are typically controlled during in vitro transcription. The bioreactor can be composed of any material that is suitable for in vitro transcription under the conditions as described herein, including glass, plastic or metal. One of ordinary skill in the art will be aware of and will be able to choose suitable bioreactor volume for use in practicing in vitro transcription.
Cap: As used herein, the term “cap” refers to a structure comprising or essentially consisting of a nucleoside-5 '-triphosphate that is typically joined to a 5'-end of an uncapped RNA (e.g., an uncapped RNA having a 5'- diphosphate). In some embodiments, a cap is or comprises a guanine nucleotide. In some embodiments, a cap is or comprises a naturally-occurring RNA 5’ cap, including, e.g., but not limited to a N7-methylguanosine cap, which has a structure designated as "m7G." In some embodiments, a cap is or comprises a synthetic cap analog that resembles an RNA cap structure and possesses the ability to stabilize RNA if attached thereto, including, e.g., but not limited to anti-reverse cap analogs (ARCAs) known in the art). Those skilled in the art will appreciate that methods for joining a cap to a 5’ end of an RNA are known in the art. For example, in some embodiments, a capped RNA may be obtained by in vitro capping of RNA that has a 5' triphosphate group or RNA that has a 5' diphosphate group with a capping enzyme system (including, e.g., but not limited to vaccinia capping enzyme system or Saccharomyces cerevisiae capping enzyme system). Alternatively, a capped RNA can be obtained by in vitro transcription (IVT) of a DNA template, wherein, in addition to the GTP, an IVT system also contains a cap analog, e.g., as known in the art. Non-limiting examples of a cap analog include a m7GpppG cap analog or an N7-methyl-, 2’-O- methyl -GpppG ARCA cap analog or an N7-methyl-, 3'- O-methyl-GpppG ARCA cap analog, or any commercially available cap analogs, including, e.g., CleanCap (Trilink), EZ Cap, etc.. In some embodiments, a cap analog is or comprises a trinucleotide cap analog.
Comparable: As used herein, the term “comparable” refers to two or more agents, entities, situations, sets of conditions, etc., that may not be identical to one another but that are sufficiently similar to permit comparison there between so that one skilled in the art will appreciate that conclusions may reasonably be drawn based on differences or similarities observed. In some embodiments, comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc. to be considered comparable. For example, those of ordinary skill in the art will appreciate that sets of circumstances, individuals, or populations are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by or indicative of the variation in those features that are varied.
Complementary: As used herein, the term “complementary” is used in reference to oligonucleotide hybridization related by base -pairing rules. For example, the sequence “C-A-G-T” is complementary to the sequence “G-T-C-A.” Complementarity can be partial or total. Thus, any degree of partial complementarity is intended to be included within the scope of the term “complementary” provided that the partial complementarity permits oligonucleotide hybridization. Partial complementarity is where one or more nucleic acid bases is not matched according to the base pairing rules. Total or complete complementarity between nucleic acids is where each and every nucleic acid base is matched with another base under the base pairing rules.
Detecting: The term “detecting” is used broadly herein to include appropriate means of determining the presence or absence of an entity of interest or any form of measurement of an entity of interest in a sample. Thus, “detecting” may include determining, measuring, assessing, or assaying the presence or absence, level, amount, and/or location of an entity of interest. Quantitative and qualitative determinations, measurements or assessments are included, including semi-quantitative. Such determinations, measurements or assessments may be relative, for example when an entity of interest is being detected relative to a control reference, or absolute. As such, the term “quantifying” when used in the context of quantifying an entity of interest can refer to absolute or to relative quantification. Absolute quantification may be accomplished by correlating a detected level of an entity of interest to known control standards (e.g., through generation of a standard curve). Alternatively, relative quantification can be accomplished by comparison of detected levels or amounts between two or more different entities of interest to provide a relative quantification of each of the two or more different entities of interest, i.e.. relative to each other.
Determine: Those of ordinary skill in the art, reading the present specification, will appreciate that a step of “determining” can utilize or be accomplished through use of any of a variety of techniques available to those skilled in the art, including for example specific techniques explicitly referred to herein. In some embodiments, determining involves manipulation of a physical sample. In some embodiments, determining involves consideration and/or manipulation of data or information, for example utilizing a computer or other processing unit adapted to perform a relevant analysis. In some embodiments, determining involves receiving relevant information and/or materials from a source. In some embodiments, determining involves comparing one or more features of a sample or entity to a comparable reference.
Dosage form or unit dosage form: Those skilled in the art will appreciate that the term “dosage form” may be used to refer to a physically discrete unit of an active agent (e.g. , a therapeutic or diagnostic agent) for administration to a subject. Typically, each such unit contains a predetermined quantity of active agent. In some embodiments, such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen). Those of ordinary skill in the art appreciate that the total amount of a therapeutic composition or agent administered to a particular subject is determined by one or more attending physicians and may involve administration of multiple dosage forms.
Encapsulate: The term “encapsulate” or “encapsulation” is used herein to refer to at least a portion of a component is enclosed or surrounded by another material or another component in a composition. In some embodiments, a component can be fully enclosed or surrounded by another material or another component in a composition.
Excipient: As used herein, the term “excipient” refers to a non-therapeutic agent that may be included in a pharmaceutical composition, for example to provide or contribute to a desired property or effect (e.g. , desired consistency, delivery, and/or stabilizing effect, etc.). In some embodiments, suitable pharmaceutical excipients to be added to a LNP composition may include, for example, salts, starch, glucose, lactose, sucrose, gelatin, sodium chloride, glycerol, propylene, glycol, water, ethanol and the like. Encode: As used herein, the term “encode” or “encoding” refers to sequence information of a first molecule that guides production of a second molecule having a defined sequence of nucleotides (e.g., mRNA) or a defined sequence of amino acids. For example, a DNA molecule can encode an RNA molecule (e.g., by a transcription process that includes a DNA-dependent RNA polymerase enzyme). An RNA molecule can encode a polypeptide (e.g., by a translation process). Thus, a gene, a cDNA, or a single-stranded RNA (e.g., an mRNA) encodes a polypeptide if transcription and translation of mRNA corresponding to that gene produces the polypeptide in a cell or other biological system. In some embodiments, a coding region of a single-stranded RNA encoding a target polypeptide agent refers to a coding strand, the nucleotide sequence of which is identical to the mRNA sequence of such a target polypeptide agent. In some embodiments, a coding region of a single-stranded RNA encoding a target polypeptide agent refers to a non-coding strand of such a target polypeptide agent, which may be used as a template for transcription of a gene or cDNA.
Expression: As used herein, “expression” of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5’ cap formation, and/or 3’ end formation); (3) translation of an RNA into a polypeptide or protein; and/or (4) post-translational modification of a polypeptide or protein.
Fed-batch process: The term “fed-batch process” as used herein refers to a process in which one or more components are introduced into a vessel, e.g., a bioreactor, at some time subsequent to the beginning of a reaction. In some embodiments, one or more components are introduced by a fed-batch process to maintain its concentration low during a reaction. In some embodiments, one or more components are introduced by a fed-batch process to replenish what is depleted during a reaction.
Five prime untranslated region: As used herein, the terms "five prime untranslated region" or "5' UTR" refer to a sequence of an mRNA molecule that begins at the transcription start site and ends one nucleotide (nt) before the start codon (usually AUG) of the coding region of an RNA.
Functional: As used herein, a “functional” biological molecule is a biological molecule in a form in which it exhibits a property and/or activity by which it is characterized. In some embodiments, a biological molecule may have two functions (i.e., bifunctional) or many functions (i.e., multifunctional).
Gene: As used herein, the term “gene” refers to a DNA sequence in a chromosome that codes for a product (e.g., an RNA product and/or a polypeptide product). In some embodiments, a gene includes coding sequence (i.e., sequence that encodes a particular product); in some embodiments, a gene includes non-coding sequence. In some particular embodiments, a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequences. In some embodiments, a gene may include one or more regulatory elements that, for example, may control or impact one or more aspects of gene expression (e.g., cell-type -specific expression, inducible expression, etc.).
Gene product or expression product: As used herein, the term “gene product” or “expression product” generally refers to an RNA transcribed from the gene (pre-and/or post-processing) or a polypeptide (pre- and/or post-modification) encoded by an RNA transcribed from the gene.
Homology: As used herein, the term “homology” or “homolog” refers to the overall relatedness between polynucleotide molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polynucleotide molecules (e.g., DNA molecules and/or RNA molecules) and/or polypeptide molecules are considered to be “homologous” to one another if their sequences are at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polynucleotide molecules (e.g., DNA molecules and/or RNA molecules) and/or polypeptide molecules are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar (e.g., containing residues with related chemical properties at corresponding positions). For example, as is well known by those of ordinary skill in the art, certain amino acids are typically classified as similar to one another as "hydrophobic" or “hydrophilic” amino acids, and/or as having “polar” or “non-polar” side chains. Substitution of one amino acid for another of the same type may often be considered a “homologous” substitution.
Host cell'. As used herein, refers to a cell into which exogenous material (e.g., DNA such as recombinant or otherwise) has been introduced. Persons of skill upon reading this disclosure will understand that such terms refer not only to the particular subject cell, but also to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. In some embodiments, host cells include prokaryotic and eukaryotic cells selected from any of the Kingdoms of life that are suitable for expressing an exogenous DNA (e.g., a recombinant nucleic acid sequence). Exemplary cells include those of prokaryotes and eukaryotes (single-cell or multiple-cell), bacterial cells (e.g., strains of E. coli, Bacillus spp., Streptomyces spp., etc.), mycobacteria cells, fungal cells, yeast cells (e.g., 5. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions such as, for example, hybridomas or quadromas. In some embodiments, a host cell is a human, monkey, ape, hamster, rat, or mouse cell. In some embodiments, a host cell is eukaryotic. For example, an eukaryotic host cell may be CHO (e.g., CHO KI, DXB-1 1 CHO, Veggie -CHO), COS (e.g., COS-7), retinal cell, Vero, CV1, kidney (e.g., HEK293, 293 EBNA, MSR 293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC 5, Colo205, HB 8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cell, C127 cell, SP2/0, NS-0, MMT 060562, Sertoli cell, BRL 3 A cell, HT1080 cell, myeloma cell, tumor cell, or a cell line derived from an aforementioned cell.
Identity. As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CAB IOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
Improved, increased or reduced: As used herein, these terms, or grammatically comparable comparative terms, indicate values that are relative to a comparable reference measurement. For example, in some embodiments, an assessed value achieved with an agent of interest may be “improved” relative to that obtained with a comparable reference agent. Alternatively or additionally, in some embodiments, an assessed value achieved in a subject or system of interest may be “improved” relative to that obtained in the same subject or system under different conditions (e.g., prior to or after an event such as administration of an agent of interest), or in a different, comparable subject (e.g., in a comparable subject or system that differs from the subject or system of interest in presence of one or more indicators of a particular disease, disorder or condition of interest, or in prior exposure to a condition or agent, etc.). In some embodiments, comparative terms refer to statistically relevant differences (e.g., that are of a prevalence and/or magnitude sufficient to achieve statistical relevance). Those skilled in the art will be aware, or will readily be able to determine, in a given context, a degree and/or prevalence of difference that is required or sufficient to achieve such statistical significance.
In vitro: The term “in vitro” as used herein refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel (e.g., a bioreactor), in cell culture, etc., rather than within a multi-cellular organism.
In vitro transcription: As used herein, the term "in vitro transcription" or "IVT" refers to the process whereby transcription occurs in vitro in a non-cellular system to produce a synthetic RNA product for use in various applications, including, e.g., production of protein or polypeptides. Such synthetic RNA products can be translated in vitro or introduced directly into cells, where they can be translated. Such synthetic RNA products include, e.g., but not limited to mRNAs, antisense RNA molecules, shRNA molecules, long non-coding RNA molecules, ribozymes, aptamers, guide RNAs (e.g., for CRISPR), ribosomal RNAs, small nuclear RNAs, small nucleolar RNAs, and the like. An IVT reaction typically utilizes a DNA template (e.g., a linear DNA template) as described and/or utilized herein, ribonucleotides (e.g., non-modified ribonucleotide triphosphates or modified ribonucleotide triphosphates), and an appropriate RNA polymerase.
In vitro transcription RNA composition: As used herein, the term “in vitro transcription RNA composition” refers to a composition comprising target RNA synthesized by in vitro transcription. In some embodiments, such a composition can comprise excess in vitro transcription reagents (including, e.g., ribonucleotides and/or capping agents), nucleic acids or fragments thereof such as DNA templates or fragments thereof, polypeptides or fragments thereof such as recombinant enzymes or host cell proteins or fragments thereof, and/or other impurities. In some embodiments, an in vitro transcription RNA composition may have been treated and/or processed prior to a purification processes that ultimately produces an RNA transcript preparation comprising RNA transcript at a desired concentration in an appropriate buffer for formulation and/or further manufacturing and/or processing. For example, in some embodiments, an in vitro transcription RNA composition may have been treated to remove or digest DNA template (e.g., using a DNase). In some embodiments, an in vitro transcription RNA composition may have been treated to remove or digest polypeptides (e.g. , enzymes such as RNA polymerases, RNase inhibitors, etc.) present in an in vitro transcription reaction (e.g., using a protease).
In vivo: As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. Nanoparticle: As used herein, the term “nanoparticle” refers to a particle having a diameter of less than 1000 nanometers (nm). In some embodiments, a nanoparticle has a diameter of less than 300 nm, as defined by the National Science Foundation. In some embodiments, a nanoparticle has a diameter of less than 100 nm as defined by the National Institutes of Health. In some embodiments, a nanoparticle has a diameter of less than 80 nm as defined by the National Institutes of Health. In some embodiments, a nanoparticle comprises one or more enclosed compartments, separated from the bulk solution by a membrane, which surrounds and encloses a space or compartment.
Nucleic acid/ Polynucleotide: As used herein, the term “nucleic acid” refers to a polymer of at least 2 nucleotides or more, including, e.g., at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, or more . In some embodiments, a nucleic acid is or comprises DNA. In some embodiments, a nucleic acid is or comprises RNA. In some embodiments, a nucleic acid is or comprises peptide nucleic acid (PNA). In some embodiments, a nucleic acid is or comprises a single stranded nucleic acid. In some embodiments, a nucleic acid is or comprises a double-stranded nucleic acid. In some embodiments, a nucleic acid comprises both single and double-stranded portions. In some embodiments, a nucleic acid comprises a backbone that comprises one or more phosphodiester linkages. In some embodiments, a nucleic acid comprises a backbone that comprises both phosphodiester and non-phosphodiester linkages. For example, in some embodiments, a nucleic acid may comprise a backbone that comprises one or more phosphorothioate or 5'-N-phosphoramidite linkages and/or one or more peptide bonds, e.g., as in a “peptide nucleic acid”. In some embodiments, a nucleic acid comprises one or more, or all, natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxy thymidine, guanine, thymine, uracil). In some embodiments, a nucleic acid comprises on or more, or all, non-natural residues. In some embodiments, a non-natural residue comprises a nucleoside analog (e.g., 2- aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5 -methylcytidine, C- 5 propynyl-cytidine, 1-methyl-pseudouridine, C-5 propynyl -uridine, 2-aminoadenosine, C5- bromouridine, C5 -fluorouridine, C5 -iodouridine, C5-propynyl-uridine, C5 -propynyl-cytidine, C5- methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8- oxoguanosine, 6-O-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a non-natural residue comprises one or more modified sugars (e.g., 2'- fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared to those in natural residues. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or polypeptide. In some embodiments, a nucleic acid has a nucleotide sequence that comprises one or more introns. In some embodiments, a nucleic acid may be prepared by isolation from a natural source, enzymatic synthesis (e.g., by polymerization based on a complementary template, e.g., in vivo or in vitro, reproduction in a recombinant cell or system, or chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, or 20,000 or more residues or nucleotides long.
Pharmaceutical grade: The term “pharmaceutical grade” as used herein refers to standards for chemical and biological drug substances, drug products, dosage forms, compounded preparations, excipients, medical devices, and dietary supplements, established by a recognized national or regional pharmacopeia (e.g., The United States Pharmacopeia and The Formulary (USP-NF)).
Polypeptide: The term “polypeptide”, as used herein, typically has its art-recognized meaning of a polymer of at least three amino acids or more. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional, biologically active, or characteristic fragments, portions or domains (e.g., fragments, portions, or domains retaining at least one activity) of such complete polypeptides. In some embodiments, polypeptides may contain L-amino acids, D-amino acids, or both and/or may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, polypeptides may comprise natural amino acids, nonnatural amino acids, synthetic amino acids, and combinations thereof (e.g., may be or comprise peptidomimetics). In some embodiments, a polypeptide may be or comprise an enzyme. In some embodiments, a polypeptide may be or comprise a polypeptide antigen. In some embodiments, a polypeptide may be or comprise an antibody agent. In some embodiments a polypeptide may be or comprise a cytokine.
Pure or Purified: As used herein, an agent or entity is “pure” or “purified” if it is substantially free of other components. For example, a preparation that contains more than about 90% of a particular agent or entity is typically considered to be a pure preparation. In some embodiments, an agent or entity is at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% pure in a preparation.
Ribonucleotide: As used herein, the term “ribonucleotide” encompasses unmodified ribonucleotides and modified ribonucleotides. For example, unmodified ribonucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). Modified ribonucleotides may include one or more modifications including, but not limited to, for example, (a) end modifications, e.g., 5' end modifications (e.g., phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (e.g., conjugation, inverted linkages, etc.), (b) base modifications, e.g. , replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, and (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. The term “ribonucleotide” also encompasses ribonucleotide triphosphates including modified and non-modified ribonucleotide triphosphates.
Ribonucleic acid (RNA): As used herein, the term “RNA” refers to a polymer of ribonucleotides. In some embodiments, an RNA is single stranded. In some embodiments, an RNA is double stranded. In some embodiments, an RNA comprises both single and double stranded portions. In some embodiments, an RNA can comprise a backbone structure as described in the definition of “Nucleic acid / Polynucleotide” above. An RNA can be a regulatory RNA (e.g., siRNA, microRNA, etc.), or a messenger RNA (mRNA). In some embodiments, an RNA is a mRNA. In some embodiments, where an RNA is a mRNA, a RNA typically comprises at its 3’ end a poly(A) region. In some embodiments where an RNA is a mRNA, an RNA typically comprises at its 5’ end, an art-recognized cap structure, e.g., for recognizing and attachment of a mRNA to a ribosome to initiate translation. In some embodiments, an RNA is a synthetic RNA. Synthetic RNAs include RNAs that are synthesized in vitro (e.g., by enzymatic synthesis methods and/or by chemical synthesis methods). In some embodiments, an RNA is a singlestranded RNA. In some embodiments, a single-stranded RNA may comprise self-complementary elements and/or may establish a secondary and/or tertiary structure. One of ordinary skill in the art will understand that when a single -stranded RNA is referred to as “encoding,” it can mean that it comprises a nucleic acid sequence that itself encodes or that it comprises a complement of the nucleic acid sequence that encodes. In some embodiments, a single-stranded RNA can be a self-amplifying RNA (also known as self-replicating RNA).
Recombinant', as used herein, is intended to refer to polypeptides that are designed, engineered, prepared, expressed, created, manufactured, and/or or isolated by recombinant means, such as polypeptides expressed using a recombinant expression vector transfected into a host cell; polypeptides isolated from a recombinant, combinatorial human polypeptide library; polypeptides isolated from an animal (e.g., a mouse, rabbit, sheep, fish, etc.) that is transgenic for or otherwise has been manipulated to express a gene or genes, or gene components that encode and/or direct expression of the polypeptide or one or more component(s), portion/ s), element(s), or domain(s) thereof; and/or polypeptides prepared, expressed, created or isolated by any other means that involves splicing or ligating selected nucleic acid sequence elements to one another, chemically synthesizing selected sequence elements, and/or otherwise generating a nucleic acid that encodes and/or directs expression of the polypeptide or one or more component/ s), portion/s), element/s), or domain/s) thereof. In some embodiments, one or more of such selected sequence elements is found in nature. In some embodiments, one or more of such selected sequence elements is designed in silico. In some embodiments, one or more such selected sequence elements results from mutagenesis (e.g., in vivo or in vitro) of a known sequence element, e.g., from a natural or synthetic source such as, for example, in the germline of a source organism of interest (e.g., of a human, a mouse, etc.).
Reference: As used herein, the term “reference” describes a standard or control relative to which a comparison is performed. For example, in some embodiments, an agent, animal, individual, population, sample, sequence or value of interest is compared with a reference or control agent, animal, individual, population, sample, sequence or value. In some embodiments, a reference or control is tested and/or determined substantially simultaneously with the testing or determination of interest. In some embodiments, a reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as would be understood by those skilled in the art, a reference or control is determined or characterized under comparable conditions or circumstances to those under assessment. Those skilled in the art will appreciate when sufficient similarities are present to justify reliance on and/or comparison to a particular possible reference or control.
RNA polymerase: As used herein, the term “RNA polymerase” refers to an enzyme that catalyzes polyribonucleotide synthesis by addition of ribonucleotide units to a nucleotide chain using DNA or RNA as a template. The term refers to either a complete enzyme as it occurs in nature, or an isolated, active catalytic or functional domain, or fragment thereof. In some embodiments, an RNA polymerase enzyme initiates synthesis at the 3'-end of a primer or a nucleic acid strand, or at a promoter sequence, and proceeds in the 5'-direction along the target nucleic acid to synthesize a strand complementary to the target nucleic acid until synthesis terminates.
RNA transcript preparation -. The term “RNA transcript preparation” as used herein refers to a preparation comprising RNA transcript that is purified from an in vitro transcription RNA composition described herein. In some embodiments, an RNA transcript preparation is a preparation comprising pharmaceutical-grade RNA transcript. In some embodiments, an RNA transcript preparation is a preparation comprising RNA transcript, which its one or more product quality attributes are characterized and determined to meet a release and/or acceptance criteria (e.g., as described herein). Examples of such product quality attributes include, but are not limited to appearance, RNA length, identity of drug substance as RNA, RNA integrity, RNA sequence, RNA concentration, pH, osmolality, residual DNA template, residual double stranded RNA, bacterial endotoxins, bioburden, and combinations thereof. Room temperature: As used herein, the term “room temperature” refers to an ambient temperature. In some embodiments, a room temperature is about 18°C-30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C.
Sample: As used herein, the term “sample” typically refers to an aliquot of material obtained or derived from a source of interest, e.g. , as described herein. In some embodiments, a source of interest is a biological or environmental source. In some embodiments, a source of interest may be or comprise a cell or an organism, such as a microbe, a plant, or an animal (e.g., a mouse). In some embodiments, a source of interest is or comprises biological tissue or fluid. In some embodiments, a biological fluid may be or comprise an intracellular fluid, an extracellular fluid, an intravascular fluid (blood plasma), an interstitial fluid, a lymphatic fluid, and/or a transcellular fluid. In some embodiments, a biological tissue or sample may be obtained, for example, by aspirate, biopsy (e.g., fine needle or tissue biopsy), swab (e.g., oral, nasal, skin, or vaginal swab), scraping, surgery, washing or lavage (e.g., brocheoalvealar, ductal, nasal, ocular, oral, uterine, vaginal, or other washing or lavage). In some embodiments, a sample is or comprises cells obtained from a subject. In some embodiments, a sample is a “primary sample” obtained directly from a source of interest by any appropriate means. In some embodiments, as will be clear from context, the term “sample” refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, a “processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to one or more techniques such as amplification or reverse transcription of nucleic acid, isolation and/or purification of certain components, etc.
Stable: The term “stable,” when applied to nucleic acids and/or compositions comprising nucleic acids, e.g., encapsulated in lipid nanoparticles, means that such nucleic acids and/or compositions maintain one or more aspects of their characteristics (e.g., physical and/or structural characteristics, function, and/or activity) over a period of time under a designated set of conditions (e.g., pH, temperature, light, relative humidity, etc.). In some embodiments, such stability is maintained over a period of time of at least about one hour; in some embodiments, such stability is maintained over a period of time of about 5 hours, about 10 hours, about one (1) day, about one (1) week, about two (2) weeks, about one (1) month, about two (2) months, about three (3) months, about four (4) months, about five (5) months, about six (6) months, about eight (8) months, about ten (10) months, about twelve (12) months, about twenty-four (24) months, about thirty-six (36) months, or longer. In some embodiments, such stability is maintained over a period of time within the range of about one (1) day to about twenty-four (24) months, about two (2) weeks to about twelve (12) months, about two (2) months to about five (5) months, etc. In some embodiments, such stability is maintained under an ambient condition (e.g., at room temperature and ambient pressure). In some embodiments, such stability is maintained under a physiological condition (e.g., in vivo or at about 37 °C for example in serum or in phosphate buffered saline). In some embodiments, such stability is maintained under cold storage (e.g., at or below about 4 °C, including, e.g., -20 °C, or -70 °C). In some embodiments, such stability is maintained when nucleic acids and/or compositions comprising the same are protected from light (e.g., maintaining in the dark).
As an example, in some embodiments, the term “stable” is used in reference to a nanoparticle composition (e.g., a lipid nanoparticle composition). In such embodiments, a stable nanoparticle composition (e.g., a stable nanoparticle composition) and/or component(s) thereof maintain one or more aspects of its characteristics (e.g., physical and/or structural characteristics, function(s), and/or activity) over a period of time under a designated set of conditions. For example, in some embodiments, a stable nanoparticle composition (e.g. , a lipid nanoparticle composition) is characterized in that average particle size, particle size distribution, and/or polydispersity of nanoparticles is substantially maintained (e.g., within 10% or less, as compared to the initial characteristic(s)) over a period of time (e.g., as described herein) under a designated set of conditions (e.g., as described herein). In some embodiments, a stable nanoparticle composition (e.g. , a lipid nanoparticle composition) is characterized in that no detectable amount of degradation products (e.g., associated with hydrolysis and/or enzymatic digestion) is present after it is maintained under a designated set of conditions (e.g., as described herein) over a period of time.
Stealth moiety or stealth agent: As used herein, the terms "stealth moiety" or “stealth agent” describe a chemical moiety or an agent that prevents that the moiety itself or the agent itself, or that a compound bound to the moiety or the agent or that a particle, such as a particle described herein (e.g. an LNP), bound to the moiety or the agent is detected and then sequestered and/or degraded, or is hardly detected and then sequestered and/or degraded, and/or is detected and then sequestered and/or degraded late, by the immune system of the host to which they are administered. Macrophages constitute one of the most important components of the immune system and play a predominant role in eliminating foreign particles, including liposomes and other colloidal particles, from the blood circulation. At the molecular level, the clearance of particles takes place in two steps: opsonization by the depositing of serum proteins (or "opsonins") at the surface of the particles followed by recognition and capture of the opsonized particles by macrophages. The stealth moiety or the stealth agent may be a polymer (“stealth polymer”), such as a polyethylene glycol (PEG), a polysarcosine (pSAR) or a poly-(2-(2-(2-aminoethoxy)ethoxy)acetic acid) (pAEEA).
Stealth lipid: As used herein, the term “stealth lipid” is a lipid covalently bonded to a stealth moiety or a stealth agent. In one embodiment, a stealth lipid comprises a lipid bound to PEG (PEGylated lipid or PEG lipid), a lipid bound to pSAR (pSarcosylated lipid or pSAR lipid) or a lipid bound to pAEEA (pAEEA lipid). When an LNP comprises a stealth lipid, the stealth lipid can provide stealth properties to the LNP. Synthetic: As used herein, the term “synthetic” refers to an entity that is artificial, or that is made with human intervention, or that results from synthesis rather than naturally occurring. For example, in some embodiments, a synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule that is chemically synthesized, e.g., in some embodiments by solid-phase synthesis. In some embodiments, the term “synthetic” refers to an entity that is made outside of biological cells. For example, in some embodiments, a synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule (e.g., an RNA) that is produced by in vitro transcription using a template.
Three prime untranslated region: As used herein, the terms "three prime untranslated region" or "3' UTR" refer to the sequence of an mRNA molecule that begins following the stop codon of the coding region of an open reading frame sequence. In some embodiments, the 3' UTR begins immediately after the stop codon of the coding region of an open reading frame sequence. In other embodiments, the 3' UTR does not begin immediately after stop codon of the coding region of an open reading frame sequence
Threshold level (e.g., acceptance criteria) : As used herein, the term “threshold level” refers to a level that are used as a reference to attain information on and/or classify the results of a measurement, for example, the results of a measurement attained in an assay. For example, in some embodiments, a threshold level means a value measured in an assay that defines the dividing line between two subsets of a population (e.g. a batch that satisfy quality control criteria vs. a batch that does not satisfy quality control criteria). Thus, a value that is equal to or higher than the threshold level defines one subset of the population, and a value that is lower than the threshold level defines the other subset of the population. A threshold level can be determined based on one or more control samples or across a population of control samples. A threshold level can be determined prior to, concurrently with, or after the measurement of interest is taken. In some embodiments, a threshold level can be a range of values.
Vector : As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA into which additional DNA segments may be ligated. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g. , non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors.” Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g.. electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), which is incorporated herein by reference for any purpose.
Brief description of the drawings
Figure 1 illustrates a system for and a method of forming or providing a liquid composition comprising lipid nanoparticles.
Figure 2 illustrates a system for and a method of forming or providing a liquid composition comprising lipid nanoparticles using a T-mixer as mixing component.
Figures 3A and 3B depict results obtained for the setting shown in figure 2 for different flow rates and two different first liquids.
Figure 4 depicts an exemplary process flow charts of manufacturing an RNA (e.g., for encapsulation in LNPs).
Figure 5 depicts an overview of an exemplary LNP drug product manufacturing process.
Figure 6 depicts an overview of an exemplary process of DNA template manufacture via a PCR-based process.
Figure 7 depicts an exemplary LNP manufacturing process.
Figure 8 depicts an exemplary process by which a drug product composition can be filled/finished.
Figure 9 depicts a Pareto effects chart illustrating relative influences of various factors on LNP particle size and stability.
Figure 10 depicts an exemplary process for LNP manufacturing (e.g., of RNA-LNPs), according to aspects of the present embodiments. Figure 11 depicts an exemplary system for LNP manufacturing (e.g., of RNA-LNPs), according to aspects of the present embodiments.
Figures 12 A to 12 C depict images of LNP samples, the images being obtained by transmission electron microscopy (TEM), particularly Cryo-TEM.
Figure 13 illustrates results obtained for compositions during LNP manufacturing, i.e. PDI and Vmax.
Detailed description
Advantageous Reynolds number regime for the lipid nanoparticle composition
Figure 1 schematically illustrates an embodiment of a system 300 for forming or providing a liquid composition comprising lipid nanoparticles. The system is expediently provided for conducting the methods described herein above and below. The system 300 comprises a mixing chamber 302. The mixing chamber has a first inlet 304 and a second inlet 306. The inlets 304 and 306 are provided to permit entry of a first liquid 308 and a second liquid 310 into the mixing chamber. The liquids may be provided in associated reservoirs which are in fluid communication with the associated inlet, e.g. via associated flow paths or the system may be connectable to such reservoirs. A first reservoir 312 in the depicted embodiment holds the first liquid 308 and a second reservoir 314 holds the second liquid 310. A first flow path 309 guides the first liquid 308 and a second flow path 311 guides the second liquid 310 towards the respective inlet. The respective flow path may be defined by one or more conduits, tubings and/or other structures limiting the flow path laterally with respect to the flow direction (e.g. by the mixing component mentioned below).
The mixing chamber 302 is part of a mixing component, device or unit 316. The respective inlet (first or second inlet) of the mixing chamber 302 may coincide with the inlet of the mixing component or an associated inlet of the mixing component (e.g. first inlet 318 or second inlet 320) may be arranged upstream of the mixing chamber (i.e. closer to the associated reservoir as seen along the flow path counter to the flow direction). Thus, the first liquid 308 can enter the mixing chamber or component via the first inlet (304, 318) and the second liquid (310) can enter the mixing chamber or component via the second inlet (306, 320). A first flow driver 322 may be provided to move the first liquid 308 into the mixing chamber 302 or the component 316. A second flow driver 324 may be provided to move the second liquid 310 into the mixing chamber 302 or the component 316. The respective flow driver may be a pump. The flow of the first liquid 308 towards and into the mixing chamber 302 or the mixing component 316 is highlighted by arrow 326, the flow of the second liquid 310 towards and into the mixing chamber 302 or the mixing component 316 is highlighted by arrow 328. The flow of the first and second liquids may be continuously driven into the mixing chamber. In the mixing chamber 302, the first and second liquids can mix for the liquid composition 330. The liquid composition 330 leaves the mixing chamber 302 via an outlet 332 of the mixing chamber. The outlet of the mixing component 316 may coincide with the outlet of the mixing chamber or be arranged downstream of the outlet 332 of the mixing chamber 302 (see outlet 334, for example).
The flow rate of the liquid composition 330 at the respective outlet may be defined by the flow rates of the first liquid and the second liquid into the mixing chamber 302, e.g. be equal to the sum of these flow rates.
After having left the mixing chamber and/or the mixing component, the liquid composition as indicated by arrow 336 continues its flow and can be further processed, e.g. buffered, purified, filtered and/or diluted. As an example, a further liquid 338 (third liquid) may be added to the flow of the liquid composition downstream of the mixing component or mixing chamber, e.g. a buffer, such as a quench buffer. The third liquid may be a citrate buffer. The third liquid 338 can be added to the liquid composition flow 336 at an angle to the liquid composition flow 336, e.g. less than 160°, such as about 90°. The liquid flow of the third liquid 338 is illustrated by arrow 340. The third liquid can be continuously guided into the liquid flow. The flow rate of the third liquid may be less than the one for the first liquid and/or the second liquid or less than the sum of these flow rates. The processed lipid nanoparticle composition flow 342 may be guided towards a further processing step or unit and/or leave the system 300 via a system outlet (not explicitly shown).
The first and second liquids entering the mixing chamber 302 are chosen so as to, when mixed, provide a lipid nanoparticle composition comprising lipid nanoparticles, expediently lipid nanoparticles encapsulating a pharmaceutically active substance, e.g. comprising RNA, such as mRNA. The respective liquids (first, second and/or third liquid) may be solutions. The lipid nanoparticle composition expediently is a dispersed phase or, in other words, a dispersion with lipid nanoparticles being the dispersed phase in a liquid. Both, the nanoparticles and the liquid expediently result from mixing the first liquid and the second liquid with one another in the mixing chamber. A preparation may comprise the processed lipid nanoparticle composition or the unprocessed lipid nanoparticle composition.
The first liquid 308 comprises the entity to be encapsulated by the nanoparticles, e.g. RNA, such as mRNA. The first liquid expediently has a pH of between 2 and 7, e.g. between 4 and 7 or between 4 and 6 (e.g. adjusted via citric acid or acetic acid). The first liquid may be an aqueous phase or solution. More detailed examples on the first liquid are given further below.
The second liquid 310 expediently comprises further ingredients for the nanoparticle formation. For example, the second liquid comprises one of, more of, or all of: a cationic lipid, a non-cationic or second cationic lipid or helper lipid, a PEG-lipid (sometimes also termed: PEGylated lipid), and cholesterol. More detailed examples on the second liquid are given further below. The second liquid 310 may be an organic phase and/or comprise an organic solvent, e.g. ethanol, propanol, isopropanol or acetone.
Surprisingly, it has been found that, when performing the mixing process such that at the outlet 334 or 332 the flow of the liquid composition is in a range of Reynolds numbers less than 10000 and optionally greater than 800, lipid nanoparticles encapsulating RNA, i.e. RNA-LNPs, with advantageous properties were formed. For example, the (average) size of the nanoparticles could be decreased (as compared to regimes with higher Reynolds numbers) and/or homogeneity of the dispersion with the nanoparticles could be increased (e.g. as the nanoparticles are more uniform in size which entails a smaller PDI). Having smaller particles and/or a more homogeneous particle size distribution facilitates further processing of any preparation comprising the nanoparticles formed. For example, less particles are lost during a filtration step or finer filters can be used.
In connection with the following figures this is explained in more detail.
Figure 2 shows a setting which is very similar to the one shown in figure 1 but with more details on the flow paths and some associated data. Hence, features described in conjunction with figure lalso apply for figure 2 and vice versa. Features from figure 1 are not repeated here.
In figure 2, a T-mixer (also referenced as "A" in the figure) is used as mixing component 316 for obtaining the liquid composition. "V" and "D" specify the viscosity (V) and density (D) of the respective liquid or the liquid composition. For the addition of the third liquid another T-mixer is used (designated as B). Also, the inner diameters of the flow path sections (e.g. provided by tube sections or the respective T-mixer) are specified as well as their lengths.
The flow rate of the first liquid may be greater than the flow rate of the second liquid. A ratio of the flow rate of the first liquid to the one of the second liquid may be less than or equal to one of the following: 7, 6, 5, 4, 3. For example, the flow rate of the first liquid is about or equal to 3 times the flow rate of the second liquid. The combined flow rate of the first and second liquids into the mixing chamber may then determine the flow rate of the liquid composition away from the mixing chamber 302. In the setting shown in figure 2, the first and second liquids are mixed using a T-mixer in an impingement liquid setting. The flow directions of the liquid flows are diametrically opposite and the liquids hit one another (frontally) in the mixing chamber. The two impinging liquid streams may create some turbulences which may enhance the mixing in the chamber. However laminar flow in the mixing chamber may also be possible. The liquid composition leaves the mixing component 316 at its outlet 334 in a flow direction which is at an angle of 90° or about 90° relative to the flow directions of the first and second liquid into the mixing chamber. The densities (denoted "D" in kg/m3) and viscosities (denoted "V" in centipoise) specified in figure 2 are typical values occurring when forming lipid nanoparticle compositions from mixing two liquids. The diameters of the inlets and the outlet of the mixing chamber or the mixing component are equal. However, it is also conceivable that the inlets have different diameters. For example, the inlet for the first liquid may have a greater diameter than the inlet for the second liquid. The outlet may have a greater or smaller diameter than at least one of the inlets, e.g. greater than the first inlet and/or the second inlet. Instead of the T-mixer "A" it is also conceivable to use a dedicated impingement jet mixing unit for mixing the first and second liquid as is described further below.
Figures 3A and 3B show results obtained for the setting shown in figure 2 for different flow rates and two different first liquids (with RNA). The first liquids employed differed only in the additives or buffers used, i.e. for Liquid 1 citric acid and/or citrate (e.g. natrium citrate) was used (the liquid comprises citrate, indicated by (Ci)) and for Liquid 2 acetic acid and/or acetate (e.g. natrium acetate) was used (the liquid comprises acetate, indicated by (Ac)). The flow rate of the liquid composition with the nanoparticles encapsulating RNA at the outlet of the mixing chamber or of the mixing component was varied between 100 ml/min (via adjusting the flow rates for the first and second liquid appropriately while keeping their ratio at 3:1) and 300 ml/min.
Measurements were made to determine the (average) size of the nanoparticles in the liquid composition and their polydispersity index (PDI). As is apparent, for Reynolds numbers at the outlet 334 of the mixing component 316 below about 10000, the PDI is consistently below about 0.13 and the size is below about 70 nm, 65 nm and/or 60 nm for flow rates greater than 100 ml/min. As noted above, the flow rate in combination with the cross-sectional area of the (inner bore of the) outlet of the mixing component determines the velocity required for the Reynolds number calculation.
The measurements for the PDI and the average particle size were made using dynamic light scattering, e.g. using a Zetasizer available from Malvern. The Zetasizer calculates the PDI and the average particle size.
As noted, the data relating to PDI and size were obtained using a Malvern Zetasizer Ultra, which is a system designed to measure and calculate particle properties, such as by using dynamic light scattering. The (colloidal) parameters size and polydispersity (descriptive of the width of the size distribution) of LNPs produced were analyzed by dynamic light scattering (DLS) in the Malvern Panalytical Zetasizer Ultra. Samples were diluted to 2 pg/mL in phosphate-buffered saline (PBS) and were measured in PMMA cuvettes by back-scattering (173°) at 25 °C. The cuvette was set as ZEN0040, material was set as protein (refractive index RI 1.45, absorption 0.001) and RI and viscosity for PBS were 1.34 and 0.91 cP, respectively. Choice of all other measurement parameters was set to "automatic". Measurement of each sample was repeated three times. Cumulants fit with the model “General Purpose” was used for data evaluation. The “general purpose model” is a model which needs to be selected as a pre-setting for measurement of a “standard, non-deviating, known and expected” sample of nanoparticles and uses a certain cumulant fit for calculation of size and distribution in the Zetasizer defined by the software of the Zetasizer. The investigations were performed using the following versions of the firmware and the software of the Malvern Panalytical Zetasizer Ultra: Firmware 1.02.042 and Software 2.2.0.147. In case of doubt, these can be used in the Malvern Zetasizer Ultra for determining PDI and/or size of nanoparticles described herein.
The results depicted in figure 3A result from the data points shown in the following table:
The data point at 240 ml/min with the Reynolds number of 9949 was qualified as likely resulting from an irregularity during the measurement.
The results depicted in figure 3B resulted from the data points shown in the following table: The results shown in Figures 3A and 3B give a clear indication that staying in the Reynolds number regime of below 10000 has advantageous effects on particle size (which was below 60 nm for both first liquids) and/or on the PDI. This was achieved at comparatively high flow rates of the liquid composition after mixing which indicates a suitability of the proposed process for mass production.
The advantageous effects for the formed nanoparticles were achieved independent from the buffer used for the first liquid (citrate and acetate were used for Liquids 1 and 2, respectively) and also independent from the flow drivers which were used. For Liquid 1 a syringe pump system or SPS was used (e.g. available from Cetoni), whereas for Liquid 2 a piston pump system (e.g. available from Knauer) was used.
Further examples for LNP compositions and associated processes, for which the proposed concepts having a Reynolds number of the liquid composition flow (particularly after the initial mixing of the first and second liquids and/or before the liquid composition is further processed, e.g. before the third liquid is added) of 10000 and below are advantageous are set forth below.
Further processing of the liquid composition, e.g. the unprocessed composition or the one to which the third liquid has been added or an even further processed liquid composition, with nanoparticles, may include filtering using a 0.2 pm filter, e.g. a Sartopore 2 filter. A filter area of the filter can be less than or equal to A m2 per gram of lipid nanoparticles in the liquid composition, where A is 120, for example.
LNP production and related processes
Nucleic acid therapeutics, and particularly RNA therapeutics represent a particularly promising class of therapies for treatment and prevention of various diseases such as cancer, infectious diseases, and/or diseases or disorders associated with overabundance or deficiency in certain proteins.
RNA therapeutics in particular have proven remarkably effective as vaccines to address the COVID 19 pandemic. Particularly given the promise of this technology, and its adaptability to a wide variety of clinical contexts, including massively large scale (e.g., vaccination and/or treatment on a global scale such as is under development for SARS-CoV-2), improvements to manufacturing technologies, especially those applicable to large-scale production, are especially valuable.
Development of effective delivery technologies has been central to the success of nucleic acid therapeutics, and lipid nanoparticle technologies have proven to be particularly effective (reviewed in, for example, Cullis et al. Molecular Therapy 25:1467, July 5, 2017; See also, US Patent 8058069), specifically including for RNA therapeutics (reviewed in, for example, Hou et al., Nat. Rev. Mater doi.org/10.1038/s41578-021-00358-0, August 10, 2021).
Technologies provided herein are useful, among other things, to achieve particularly effective and/or efficient production, e.g., on commercial scale and/or under commercial conditions, of pharmaceutical grade LNP preparations and/or compositions (e.g., nucleic acid-LNP preparations, and specifically RNA- LNP preparations). For example, in various embodiments, provided technologies permit and/or facilitate achievement of requirements unique to pharmaceutical-grade (and/or scale) production such as, for example, batch size and/or rate of production, pre -determined in-process controls and/or lot release specifications (e.g., high purity, integrity, potency, and/or stability, etc.), etc..
The present disclosure provides technologies for manufacturing LNP compositions (e.g., including RNA, e.g., therapeutic RNA such as therapeutic mRNA). In some embodiments, provided technologies are useful for manufacturing pharmaceutical-grade RNA-LNP therapeutics.
In some embodiments, provided technologies are useful for large scale manufacturing of LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) therapeutics, e.g., pharmaceutical-grade therapeutics. For example, in some such embodiments, technologies provided herein can be used to produce a pharmaceutical-grade batch throughput of at least 10,000 vials of LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) therapeutics (including, e.g., at least 20,000 vials, at least 30,000 vials, at least 40,000 vials, at least 50,000 vials, at least 60,000 vials, at least 70,000 vials, at least 80,000 vials, at least 90,000 vials, at least 100,000 vials, at least 200,000 vials, at least 300,000 vials, at least 400,000 vials, at least 500,000 vials, or more). For example, in some such embodiments, technologies provided herein can be used to produce a pharmaceutical-grade batch throughput of at least 50 L of LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) therapeutics (including e.g., at least 50L, at least 60L, at least 70L, at least 80L, at least 100L, at least 110 L, at least 120 L, at least 130 L, at least 140 L, at least 150 L or more. In some embodiments, each vial can comprise an RNA drug product in an amount of 0.01 mg to 0.5 mg (e.g., 0.01 mg, 0.02 mg, 0.03 mg, 0.04 mg, 0.05 mg, 0.06 mg, 0.07 mg, 0.08 mg, 0.09 mg, 0.1 mg, 0.15 mg, 0.2 mg, 0.25 mg, 0.3 mg, 0.35 mg, 0.4 mg, 0.45 mg, 0.5 mg).
Technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA- LNP) compositions for treatment and/or prevention of a disease, disorder, or condition (e.g., cancer, infectious diseases, diseases associated with protein deficiency, etc.). In some embodiments, technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions that comprise or deliver (e.g., by comprising and/or delivering a nucleic acid, such as an RNA, that encodes it) a polypeptide. In some particular embodiments, technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions for inducing an immune response to an antigen. In some embodiments, technologies described herein can be useful for manufacturing LNP (e.g., nucleic acid-LNP, e.g., RNA-LNP) compositions for treatment and/or prevention of coronavirus infection, e.g., SARS-CoV-2 infection, as described in Walsh et al. “RNA-based COVID-19 vaccine BNT162b2 selected for a pivotal efficacy study” medRxiv preprint (2020), which is online accessible at: https://doi.org/10. ] 101/2020.08.17.20176651; and Milligan et al. “Phase I/II study of COVID-19 RNA vaccine BNT162bl in adults” Nature (2020 August), which is online accessible at: https://doi.org/10. l()38/s41586-02()-2639-4, the contents of each of which are incorporated by reference in their entirety.
Lipid Nanoparticles
Those skilled in the art are aware that lipid nanoparticles have achieved successful clinical delivery of a wide range of therapeutic agents including, for example, small molecules, and various nucleic acids - e.g., oligonucleotides, siRNAs, and mRNAs (reviewed, for example, in Hu et al., Nat. Rev. Mater. https://doi.org/10. 1038/s41578-021-()0358-0, August 10, 2021).
Various routes of administration for lipid nanoparticle compositions have been proposed and/or tested; those skilled in the art will be aware of appropriate routes for particular compositions (e.g., depending on agent being delivered). To give but a few examples, in some embodiments, LNPs are parenterally administered; most clinical studies have utilized parenteral administration, and particularly intravenous, subcutaneous, intradermal, intravitreal, intratumoral, or intramuscular injection. Intrautero injection has also been described. In some embodiments, topical administration is utilized. In some embodiments, intranasal administration is utilized.
In some embodiments, administered LNPs are delivered to or accumulate in the liver. Given that the liver is naturally effective at producing and secreting proteins, liver delivery can prove useful for achieving delivery of an LNP-encapsulated agent (and/or, in the case of a nucleic acid agent such as an RNA agent, a polypeptide encoded thereby) into the bloodstream. Such liver delivery has been proposed to be particularly useful, for example, for expression of proteins that are missing in certain metabolic or hematological disorders, or that are effective in provoking immune responses (e.g., particularly antibody responses), for example against infectious agents or cancer cells.
In some embodiments, administered LNPs are delivered to and/or taken up by antigen-presenting cells (e.g., as may be present in skin, muscle, mucosal tissues, etc. f, such administration may be particularly useful or effective for induction of T cell immunity (e.g., for treatment of infectious diseases and/or cancers).
In various embodiments, lipid nanoparticles can have an average size (e.g., mean diameter) of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 50 nm to about 130 nm, about 50 nm to about 110 nm, about 50 nm to about 100 nm, about 50 to about 90 nm, or about 60 nm to about 80 nm, or about 60 nm to about 70 nm. In some embodiments, lipid nanoparticles that may be useful in accordance with the present disclosure can have an average size (e.g., mean diameter) of about 50 nm to about 100 nm. In some embodiments, lipid nanoparticles may have an average size (e.g. , mean diameter) of less than 80 nm, less than 75 nm, less than 70 nm, less than 65 nm, less than 60 nm, less than 55 nm, less than 50 nm, or less than 45 nm. In some embodiments, lipid nanoparticles that may be useful in accordance with the present disclosure can have an average size (e.g., mean diameter) of about 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm.
In some embodiments, lipids that form lipid nanoparticles described herein comprise: a polymer - conjugated lipid; a cationic lipid; and a helper neutral lipid. In some such embodiments, total polymer- conjugated lipid may be present in about 0.5-5 mol%, about 0.7-3.5 mol%, about 1-2.5 mol%, about 1.5-2 mol%, or about 1.5-1.8 mol% of the total lipids. In some embodiments, total polymer-conjugated lipid may be present in about 1-2.5 mol% of the total lipids. In some embodiments, the molar ratio of total cationic lipid to total polymer-conjugated lipid (e.g., PEG-conjugated lipid) may be about 100:1 to about 20:1, or about 50:1 to about 20:1, or about 40:1 to about 20:1, or about 35:1 to about 25:1. In some embodiments, the molar ratio of total cationic lipid to total polymer-conjugated lipid may be about 35:1 to about 25:1.
In some embodiments involving a polymer-conjugated lipid, a cationic lipid, and a helper neutral lipid in lipid nanoparticles described herein, total cationic lipid is present in about 35-65 mol%, about 40-60 mol%, about 41-49 mol%, about 41-48 mol%, about 42-48 mol%, about 43-48 mol%, about 44-48 mol%, about 45-48 mol%, or about 46-49 mol% of the total lipids. In certain embodiments, total cationic lipid is present in about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9 or 48.0 mol% of the total lipids.
In some embodiments involving a polymer-conjugated lipid, a cationic lipid, and a helper neutral lipid in lipid nanoparticles described herein, total neutral lipid is present in about 35-65 mol%, about 40-60 mol%, about 45-55 mol%, or about 47-52 mol% of the total lipids. In some embodiments, total neutral lipid is present in 35-65 mol% of the total lipids. In some embodiments, total non-steroid neutral lipid (e.g., DPSC) is present in about 5-15 mol%, about 7-13 mol%, or 9-11 mol% of the total lipids. In some embodiments, total non-steroid neutral lipid is present in about 9.5, 10 or 10.5 mol% of the total lipids. In some embodiments, the molar ratio of the total cationic lipid to the non-steroid neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0, from about 4.5: 1.0 to about 4.8: 1.0, or from about 4.7: 1.0 to 4.8: 1.0. In some embodiments, total steroid neutral lipid (e.g., cholesterol) is present in about 35- 50 mol%, about 39-49 mol%, about 39-46 mol%, about 39- 44 mol%, or about 39-42 mol% of the total lipids. In certain embodiments, total steroid neutral lipid (e.g., cholesterol) is present in about 39, 40, 41, 42, 43, 44, 45, or 46 mol% of the total lipids. In certain embodiments, the molar ratio of total cationic lipid to total steroid neutral lipid is about 1.5:1 to 1: 1.2, or about 1.2: 1 to 1: 1.2.
In some embodiments, a lipid composition comprising a cationic lipid, a polymer-conjugated lipid, and a neutral lipid can have individual lipids present in certain molar percents of the total lipids, or in certain molar ratios (relative to each other) as described in WO 2018/081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein.
In some embodiments, lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2.5 mol% of the total lipids; the cationic lipid is present in 35-65 mol% of the total lipids; and the neutral lipid is present in 35-65 mol% of the total lipids. In some embodiments, lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2 mol% of the total lipids; the cationic lipid is present in 45-48.5 mol% of the total lipids; and the neutral lipid is present in 45-55 mol% of the total lipids. In some embodiments, lipids that form the lipid nanoparticles comprise: a polymer-conjugated lipid (e.g., PEG-conjugated lipid); a cationic lipid; and a neutral lipid comprising a non-steroid neutral lipid and a steroid neutral lipid, wherein the polymer-conjugated lipid is present in about 1-2 mol% of the total lipids; the cationic lipid is present in 45-48.5 mol% of the total lipids; the non-steroid neutral lipid is present in 9-11 mol% of the total lipids; and the steroid neutral lipid is present in about 36-44 mol% of the total lipids. In many of such embodiments, a PEG-conjugated lipid is or comprises a structure as described in WO
2017/075531 (also described above), or a derivative thereof. In some embodiments, a PEG-conjugated lipid is or comprises 2- [(polyethylene glycol )-2000|-JV, A'-ditctradccylacctamidc. In many of such embodiments, a cationic lipid is or comprises a chemical structure selected from 1-1 to I- 10 of Table 1 herein or a derivative thereof. In some embodiments, a cationic lipid is or comprises ((4- hydroxybutyl)azanediyl)bis(hexane-6,l-diyl)bis(2-hexyldecanoate). In many of such embodiments, a neutral lipid comprises DSPC (l,2-distearoyl-sn-glycero-3-phosphocholine) and cholesterol, wherein DSPC is a non-steroid neutral lipid and cholesterol is a steroid neutral lipid.
In some embodiments, lipid nanoparticles include one or more cationic lipids (e.g., ones described herein). In some embodiments, cationic lipid nanoparticles may comprise at least one cationic lipid, at least one polymer -conjugated lipid, and at least one helper lipid (e.g., at least one neutral lipid).
1. Helper lipids
In some embodiments, a lipid nanoparticle described herein comprises at least one helper lipid, which may be a neutral lipid, a positively charged lipid, or a negatively charged lipid. In some embodiments, a helper lipid is a lipid that are useful for increasing the effectiveness of delivery of lipid-based particles such as cationic lipid-based particles to a target cell. In some embodiments, a helper lipid may be or comprise a structural lipid with its concentration chosen to optimize LNP particle size, stability, and/or encapsulation.
In some embodiments, a lipid nanoparticle described herein comprises a neutral helper lipid. Examples of such neutral helper lipids include, but are not limited to phosphotidylcholines such as 1 ,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), l,2-Dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), 1,2- Dimyristoyl-sn-glycero-3-phosphocholine (DMPC), l-palmitoyl-2-oleoyl-sn-glycero-3 -phosphocholine (POPC), 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phophatidylethanolamines such as 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), sphingomyelins (SM), ceramides, cholesterol, steroids such as sterols and their derivatives. Neutral lipids may be synthetic or naturally derived. Other neutral helper lipids that are known in the art, e.g., as described in WO 2017/075531 and WO 2018/081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein, can also be used in lipid nanoparticles described herein. In some embodiments, a lipid nanoparticle for delivery of RNA(s) described herein comprises DSPC and/or cholesterol.
In some embodiments, a lipid nanoparticle described herein comprises at least two helper lipids (e.g., ones described herein). In some such embodiments, a lipid nanoparticle may comprise DSPC and cholesterol.
2. Cationic lipids
In some embodiments, a lipid nanoparticle described herein comprises a cationic lipid. A cationic lipid is typically a lipid having a net positive charge. In some embodiments, a cationic lipid may comprise one or more amine group(s) which bear a positive charge. In some embodiments, a cationic lipid may comprise a cationic, meaning positively charged, headgroup. In some embodiments, a cationic lipid may have a hydrophobic domain (e.g., one or more domains of a neutral lipid or an anionic lipid) provided that the cationic lipid has a net positive charge. In some embodiments, a cationic lipid comprises a polar headgroup, which in some embodiments may comprise one or more amine derivatives such as primary, secondary, and/or tertiary amines, quaternary ammonium, various combinations of amines, amidinium salts, or guanidine and/or imidazole groups as well as pyridinium, piperizine and amino acid headgroups such as lysine, arginine, ornithine and/or tryptophan. In some embodiments, a polar headgroup of a cationic lipid comprises one or more amine derivatives. In some embodiments, a polar headgroup of a cationic lipid comprises a quaternary ammonium. In some embodiments, a headgroup of a cationic lipid may comprise multiple cationic charges. In some embodiments, a headgroup of a cationic lipid comprises one cationic charge. Examples of monocationic lipids include, but are not limited to 1,2-dimyristoyl-sn- glycero-3-ethylphosphocholine (DMEPC), 1 ,2-di-O-octadecenyl- 3 -trimethylammonium propane (DOTMA) and/or 1 ,2-dioleoyl-3 -trimethylammonium propane (DOTAP), l,2-dimyristoyl-3- trimethylammonium propane (DMTAP), 2,3- di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium bromide (DMRIE), didodecyl(dimethyl)azanium bromide (DDAB), 1 ,2-dioleyloxypropyl-3 -dimethyl - hydroxyethyl ammonium bromide (DORIE), 3P-[N-(N\N'-dimethylamino- ethane)carbamoyl] cholesterol (DC-Choi) and/or dioleyl ether phosphatidylcholine (DOEPC).
In some embodiments, a positively charged lipid structure described herein may also include one or more other components that may be typically used in the formation of vesicles (e.g. for stabilization). Examples of such other components includes, without being limited thereto, fatty alcohols, fatty acids, and/or cholesterol esters or any other pharmaceutically acceptable excipients which may affect the surface charge, the membrane fluidity and assist in the incorporation of the lipid into the lipid assembly. Examples of sterols include cholesterol, cholesteryl hemisuccinate, cholesteryl sulfate, or any other derivatives of cholesterol. Preferably, the at least one cationic lipid comprises DMEPC and/or DOTMA.
In some embodiments, a cationic lipid is ionizable such that it can exist in a positively charged form or neutral form depending on pH. Such ionization of a cationic lipid can affect the surface charge of the lipid particle under different pH conditions, which in some embodiments may influence plasma protein absorption, blood clearance, and/or tissue distribution as well as the ability to form endosomolytic non- bilayer structures. Accordingly, in some embodiments, a cationic lipid may be or comprise a pH responsive lipid. In some embodiments a pH responsive lipid is a fatty acid derivative or other amphiphilic compound which is capable of forming a lyotropic lipid phase, and which has a pKa value between pH 5 and pH 7.5. This means that the lipid is uncharged at a pH above the pKa value and positively charged below the pKa value. In some embodiments, a pH responsive lipid may be used in addition to or instead of a cationic lipid for example by binding one or more RNAs to a lipid or lipid mixture at low pH. pH responsive lipids include, but are not limited to, 1,2- dioieyioxy-3 -dimethylamino- propane (DODMA).
In some embodiments, a lipid nanoparticle may comprise one or more cationic lipids as described in WO 2016/176330, WO 2017/075531 (e.g., as presented in Tables 1 and 3 therein) and WO 2018/081480 (e.g., as presented in Tables 1-4 therein), the entire contents of each of which are incorporated herein by reference for the purposes described herein.
In some embodiments, a cationic lipid that may be useful in accordance with the present disclosure is an amino lipid comprising a titratable tertiary amino head group linked via ester bonds to at least two saturated alkyl chains, which ester bonds can be hydrolyzed easily to facilitate fast degradation and/or excretion via renal pathways. In some embodiments, such an amino lipid has an apparent pKa of about 5.5-6.5 (e.g., in one embodiment with an apparent pKa of approximately 6.1), resulting in an essentially fully positively charged molecule at an acidic pH (e.g., pH 5). In some embodiments, such an amino lipid, when incorporated in LNP, can confer distinct physicochemical properties that regulate particle formation, cellular uptake, fusogenicity and/or endosomal release of RNA(s). In some embodiments, introduction of an aqueous RNA solution to a lipid mixture comprising such an amino lipid at pH 4.0 can lead to an electrostatic interaction between the negatively charged RNA backbone and the positively charged cationic lipid. Without wishing to be bound by any particular theory, such electrostatic interaction leads to particle formation coincident with efficient encapsulation of RNA drug substance. After RNA encapsulation, adjustment of the pH of the medium surrounding the resulting LNP to a more neutral pH (e.g. , pH 7.4) results in neutralization of the surface charge of the LNP. When all other variables are held constant, such charge-neutral particles display longer in vivo circulation lifetimes and better delivery to hepatocytes compared to charged particles, which are rapidly cleared by the reticuloendothelial system. Upon endosomal uptake, the low pH of the endosome renders LNP comprising such an amino lipid fusogenic and allows the release of the RNA into the cytosol of the target cell.
In some embodiments, a cationic lipid that may be useful in accordance with the present disclosure has one of the structures disclosed in WO 2017/075531, some of which are set forth in Table 1 below:
Table 1: Exemplary cationic lipids
In certain embodiments, a cationic lipid that may be useful in accordance with the present disclosure is or comprises a chemical structure selected from 1-1 to I- 10 as shown in Table 1 above. In some embodiments, a cationic lipid is or comprises a chemical structure of 1-3 shown in Table 1 above. In some embodiments, a cationic lipid is or comprises ((4-hydroxybutyl)azanediyl)bis(hexane-6,l-diyl)bis(2- hexy Idee ano ate) . In certain embodiments, a cationic lipid that may be useful in accordance with the present disclosure is or comprises a chemical structure selected from A-F as shown in Table 2 below. In some embodiments, a cationic lipid is or comprises a chemical structure of B shown in Table 2 above. In some embodiments, a cationic lipid is or comprises a chemical structure of D shown in Table 2 above.
In certain embodiments, a cationic lipid that may be useful in accordance with the present disclosure is an ionizable lipid-like material (lipidoid). In some embodiments, such a lipidoid is C12-200, which has the following structure:
Cationic lipids may be used alone or in combination with neutral lipids, e.g., cholesterol and/or neutral phospholipids, or in combination with other known lipid assembly components.
3. Polymer-conjugated lipids
In some embodiments, a lipid nanoparticle may comprise at least one polymer-conjugated lipid. A polymer-conjugated lipid is typically a molecule comprising a lipid portion and a polymer portion conjugated thereto.
In some embodiments, a polymer-conjugated lipid is a PEG-conjugated lipid. In some embodiments, a PEG-conjugated lipid is designed to sterically stabilize a lipid particle by forming a protective hydrophilic layer that shields the hydrophobic lipid layer. In some embodiments, a PEG-conjugated lipid can reduce its association with serum proteins and/or the resulting uptake by the reticuloendothelial system when such lipid particles are administered in vivo.
Various PEG-conjugated lipids are known in the art and include, but are not limited to pegylated diacylglycerol (PEG-DAG) such as l-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG- DMG), a pegylated phosphatidylethanoloamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S- DAG) such as 4-O-(2' ,3 ’-di(tetradecanoyloxy)propyl-l-O-(a>-methoxy(polyethoxy)ethyl) butanedioate (PEG-S-DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as ro- methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N- (a> methoxy(polyethoxy)ethyl)carbamate, and the like.
Certain PEG-conjugated lipids (also known as PEGylated lipids) were clinically approved with safety demonstrated in clinical trials. PEG-conjugated lipids are known to affect cellular uptake, a prerequisite to endosomal localization and payload delivery. The present disclosure, among other things, provides an insight that the pharmacology of encapsulated nucleic acid can be controlled in a predictable manner by modulating the alkyl chain length of a PEG-lipid anchor. In some embodiments, the present disclosure, among other things, provides an insight that such PEG-conjugated lipids may be selected for an RNA/LNP drug product formulation to provide optimum delivery of RNAs to the liver. In some embodiments, such PEG-conjugated lipids may be designed and/or selected based on reasonable solubility characteristics and/or its molecular weight to effectively perform the function of a steric barrier. For example, in some embodiments, such a PEGylated lipid does not show appreciable surfactant or permeability enhancing or disturbing effects on biological membranes. In some embodiments, PEG in such a PEG-conjugated lipid can be linked to diacyl lipid anchors with a biodegradable amide bond, thereby facilitating fast degradation and/or excretion. In some embodiments, a LNP comprising a PEG- conjugated lipid retain a full complement of a PEGylated lipid. In the blood compartment, such a PEGylated lipid dissociates from the particle over time, revealing a more fusogenic particle that is more readily taken up by cells, ultimately leading to release of the RNA payload.
In some embodiments, a lipid nanoparticle may comprise one or more PEG-conjugated lipids or pegylated lipids as described in WO 2015/199952, WO 2017/075531 and WO 2018/081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein. For example, in some embodiments, a PEG-conjugated lipid that may be useful in accordance with the present disclosure can have a structure as described in WO 2017/075531, or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein: Rs and R9 are each independently a straight or branched, saturated or unsaturated alkyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60. In some embodiments, R8 and R9 are each independently straight, saturated alkyl chains containing from 12 to 16 carbon atoms. In some embodiments, w has a mean value ranging from 43 to 53. In other embodiments, the average w is about 45. In some embodiments, a PEG-conjugated lipid is or comprises 2- [(polyethylene glycol) -2000] -N,N- ditetradecylacetamide.
Nucleic Acids
Those skilled in the art are aware that LNP technologies are useful for formulating (e.g., encapsulating) and/or otherwise assisting delivery of a variety of nucleic acid agents. In some embodiments, a nucleic acid agent may be single stranded; in some embodiments, a nucleic acid agent may be double stranded. In some embodiments, a nucleic acid agent may be or comprise DNA; in some embodiments, a nucleic acid agent may be or comprise RNA. As those skilled in the art are aware, in some embodiments, nucleic acids may include one or more non-natural features (e.g., residues, modifications, intra-nucleoside linkages, etc.). In some embodiments, a nucleic acid is a non-coding in that its nucleotide sequence does not include an open reading frame (or complement thereof). In some embodiments, a nucleic acid has a nucleotide sequence that is or includes a sequence that encodes (or is the complement of a sequence that encodes) a polypeptide as described herein. In some embodiments, a nucleic acid (e.g., and RNA) is or comprises a coding strand for at least one open reading frame (“ORF”); in some embodiments, a nucleic acid is or comprises an antisense strand (or portion thereof).
In some embodiments, a relevant nucleic acid includes a polypeptide -encoding portion. In some particular embodiments, such a portion may encode a polypeptide that is or comprises an antigen (or an epitope thereof), a cytokine, an enzyme, etc. In some embodiments, an encoded polypeptide may be or include one or more neoantigens or neoepitopes associated with a tumor. In some embodiments, an encoded polypeptide may be or include an antigen (or epitope thereof) of an infectious agent (e.g., a bacterium, fungus, virus, etc.). In certain embodiments, an encoded polypeptide may be a variant of a wild type polypeptide
In some embodiments, technologies described herein may utilize a nucleic acid having a length of at least 500 residues (such as, e.g., at least 600 residues, at least 700 residues, at least 800 residues, at least 900 residues, at least 1000 residues, at least 1250 residues, at least 1500 residues, at least 1750 residues, at least 2000 residues, at least 2500 residues, at least 3000 residues, at least 3500 residues, at least 4000 residues, at least 4500 residues, at least 5000 residues, or longer). In some embodiments, technologies described herein may utilize a nucleic acidhaving a length of about 1000 residues to 5000 residues.
In certain embodiments, nucleic acids (e.g., RNAs), when present in provided lipid nanoparticles, are resistant in aqueous solution to degradation with a nuclease.
RNAs
In some particular embodiments, the present disclosure relates to production and/or use (e.g., handling, processing, transporting, etc.) of LNP compositions that include RNA.
In some embodiments, an RNA amenable to technologies described herein is a single-stranded RNA. In some embodiments, an RNA as disclosed herein is a linear RNA. In some embodiments, a singlestranded RNA is a non-coding RNA in that its nucleotide sequence does not include an open reading frame (or complement thereof). In some embodiments, a single-stranded RNA has a nucleotide sequence that encodes (or is the complement of a sequence that encodes) a polypeptide or a plurality of polypeptides (e.g., epitopes) of the present disclosure. In many embodiments, a relevant RNA is an mRNA.
In some embodiments, an RNA includes unmodified uridine residues; an RNA that includes only unmodified uridine residues may be referred to as a “uRNA”. In some embodiments, an RNA includes one or more modified uridine residues; in some embodiments, such an RNA (e.g., an RNA including entirely modified uridine residues) is referred to as a “modRNA”. In some embodiments, an RNA may be a self-amplifying RNA (saRNA). In some embodiments, an RNA may be a trans-amplifying RNA (see, for example, WO2017/162461).
In some embodiments, technologies described herein may be particularly useful for production of an RNA (e.g., a single stranded RNA) having a length of at least 500 ribonucleotides (such as, e.g., at least 600 ribonucleotides, at least 700 ribonucleotides, at least 800 ribonucleotides, at least 900 ribonucleotides, at least 1000 ribonucleotides, at least 1250 ribonucleotides, at least 1500 ribonucleotides, at least 1750 ribonucleotides, at least 2000 ribonucleotides, at least 2500 ribonucleotides, at least 3000 ribonucleotides, at least 3500 ribonucleotides, at least 4000 ribonucleotides, at least 4500 ribonucleotides, at least 5000 ribonucleotides, or longer). In some embodiments, technologies described herein may be particularly useful for synthesizing a single-stranded RNA having a length of about 800 ribonucleotides to 5000 ribonucleotides.
In some embodiments, a relevant RNA includes a polypeptide -encoding portion or a plurality of polypeptide -encoding portions. In some particular embodiments, such a portion or portions may encode a polypeptide or polypeptides that is or comprises an antigen (or an epitope thereof), a cytokine, an enzyme, etc. In some embodiments, an encoded polypeptide or polypeptides may be or include one or more neoantigens or neoepitopes associated with a tumor. In some embodiments, an encoded polypeptide or polypeptides may be or include one or more antigens (or epitopes thereof) of an infectious agent (e.g., a bacterium, fungus, virus, etc.). In certain embodiments, an encoded polypeptide may be a variant of a wild type polypeptide.
In some embodiments, a single-stranded RNA (e.g., mRNA) may comprise a secretion signal-encoding region (e.g., a secretion signal-encoding region that allows an encoded target entity or entities to be secreted upon translation by cells). In some embodiments, such a secretion signal-encoding region may be or comprise a non-human secretion signal. In some embodiments, such a secretion signal-encoding region may be or comprise a human secretion signal.
In some embodiments, a single-stranded RNA (e.g., mRNA) may comprise at least one non-coding sequence element (e.g., to enhance RNA stability and/or translation efficiency). Examples of non-coding sequence elements include but are not limited to a 3’ untranslated region (UTR), a 5’ UTR, a cap structure for co-transcriptional capping of mRNA, a poly adenine (poly A) tail, and any combinations thereof.
Formats
At least four formats useful for RNA pharmaceutical compositions (e.g., immunogenic compositions or vaccines) have been developed, namely non-modified uridine containing mRNA (uRNA), nucleosidemodified mRNA (modRNA), self-amplifying mRNA (saRNA), and trans-amplifying RNAs.
Features of a non-modified uridine platform may include, for example, one or more of intrinsic adjuvant effect, good tolerability and safety, and strong antibody and T cell responses.
Features of modified uridine (e.g., pseudouridine) platform may include reduced adjuvant effect, blunted immune innate immune sensor activating capacity and thus augmented antigen expression, good tolerability and safety, and strong antibody and CD4-T cell responses. As noted herein, the present disclosure provides an insight that such strong antibody and CD4 T cell responses may be particularly useful for vaccination.
Features of self-amplifying platform may include, for example, long duration of polypeptide (e.g., protein) expression, good tolerability and safety, higher likelihood for efficacy with very low vaccine dose.
In some embodiments, a self-amplifying platform (e.g., RNA) comprises two nucleic acid molecules, wherein one nucleic acid molecule encodes a replicase (e.g., a viral replicase) and the other nucleic acid molecule is capable of being replicated (e.g., a rep I icon) by said replicase in trans (trans- re plication system). In some embodiments, a self-amplifying platform (e.g., RNA) comprises a plurality of nucleic acid molecules, wherein said nucleic acids encode a plurality of replicases and/or replicons.
In some embodiments, a trans-replication system comprises the presence of both nucleic acid molecules in a single host cell.
In some such embodiments, a nucleic acid encoding a replicase (e.g., a viral replicase) is not capable of self-replication in a target cell and/or target organism. In some such embodiments, a nucleic acid encoding a replicase (e.g., a viral replicase) lacks at least one conserved sequence element important for (- ) strand synthesis based on a (+) strand template and/or for (+) strand synthesis based on a (-) strand template. In some embodiments, a self-amplifying RNA comprises a 5’-cap. Without wishing to be bound by any one theory, it has been found that a 5’ -cap is important for high level expression of a gene of interest in trans. In some embodiments, a 5’ -cap drives expression of a replicase.
In some embodiments, a self-amplifying RNA does not comprise an Internal Ribosomal Entry Site (IRES) element. In some such embodiments, translation of a gene of interest and/or replicase is not driven by an IRES element. In some embodiments, an IRES element is substituted by a 5 ’-cap. In some such embodiments, substitution by a 5 ’-cap does not affect the sequence of a polypeptide encoded by an RNA.
In some embodiments, a self-amplifying platform does not require propagation of virus particles (e.g., is not associated with undesired virus-particle formation). In some embodiments, a self-amplifying platform is not capable of forming virus particles.
5’-Cap
In some embodiments, a polynucleotide (e.g., RNA) utilized in accordance with the present disclosure comprises a 5 ’-cap. RNA capping is well researched and is described, e.g., in Decroly E et al. (2012) Nature Reviews 10: 51-65; and in Ramanathan A. et al., (2016) Nucleic Acids Res; 44(16): 7511-7526, the entire contents of each of which is hereby incorporated by reference. In some embodiments, a 5 ’-cap structure which may be suitable in the context of the present disclosure is a capO (methylation of the first nucleobase, e.g. m7GpppN), capl (additional methylation of the ribose of the adjacent nucleotide of m7GpppN), cap2 (additional methylation of the ribose of the 2nd nucleotide downstream of the m7GpppN), cap3 (additional methylation of the ribose of the 3rd nucleotide downstream of the m7GpppN), cap4 (additional methylation of the ribose of the 4th nucleotide downstream of the m7GpppN), ARCA (anti-reverse cap analogue), modified ARCA (e.g. phosphothioate modified ARCA, e.g., beta-S-ARCA), inosine, N1 -methyl-guanosine, 2’ -fluoro-guanosine, 7-deaza-guanosine, 8-oxo- guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
In some embodiments, a utilized 5’ caps is a Cap-0 (also referred herein as “CapO”), a Cap-1 (also referred herein as “Capl”), or Cap-2 (also referred herein as “Cap2”). See, e.g., Figure 1 of Ramanathan A et al., and Figure 1 of Decroly E et al.
The term "5'-cap" as used herein refers to a structure found on the 5'-end of an RNA, e.g., mRNA, and generally includes a guanosine nucleotide connected to an RNA, e.g., mRNA, via a 5'- to 5'-triphosphate linkage (also referred to as Gppp or G(5')ppp(5')). In some embodiments, a guanosine nucleoside included in a 5’ cap may be modified, for example, by methylation at one or more positions (e.g., at the 7- position) on a base (guanine), and/or by methylation at one or more positions of a ribose. In some embodiments, a guanosine nucleoside included in a 5’ cap comprises a 3’0 methylation at a ribose (3’0MeG). In some embodiments, a guanosine nucleoside included in a 5’ cap comprises methylation at the 7-position of guanine (m7G). In some embodiments, a guanosine nucleoside included in a 5’ cap comprises methylation at the 7-position of guanine and a 3’ O methylation at a ribose (m7(3’OMeG)).
In some embodiments, providing an RNA with a 5'-cap disclosed herein or a 5'-cap analog may be achieved by in vitro transcription, in which a 5'-cap is co-transcriptionally expressed into an RNA strand, or may be attached to an RNA post-transcriptionally using capping enzymes. In some embodiments, co- transcriptional capping with a cap disclosed herein, e.g., with a capl or a capl analog, improves the capping efficiency of an RNA compared to co-transcriptional capping with an appropriate reference comparator. In some embodiments, improving capping efficiency can increase a translation efficiency and/or translation rate of an RNA, and/or increase expression of an encoded polypeptide.
In some embodiments, an RNA described herein comprises a 5’-cap or a 5’ cap analog, e.g. , a CapO, a Capl or a Cap2. In some embodiments, a provided RNA does not have uncapped 5'-triphosphates. In some embodiments, an RNA may be capped with a 5'- cap analog. In some embodiments, an RNA described herein comprises a CapO. In some embodiments, an RNA described herein comprises a Capl, e.g., as described herein. In some embodiments, an RNA described herein comprises a Cap2. In some embodiments, alterations to polynucleotides generates a non-hydrolyzable cap structure which can, for example, prevent decapping and increase RNA half-life.
In some embodiments, a CapO structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G). In some embodiments, a CapO structure is connected to an RNA via a 5'- to 5'- triphosphate linkage and is also referred to herein as m7Gppp or m7G(5')ppp(5').
In some embodiments, a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G or 7mG) and a 2'0 methylated first nucleotide in an RNA (2'0MeNi or Nj2'0Me or Ni20Me). In some embodiments, a Capl structure is connected to an RNA via a 5'- to 5 '-triphosphate linkage; in some embodiments, a Capl structure may be represented as m7Gppp(Ni2OMe) or m7G(5')ppp(5')(Ni2OMe) or 7mG(5')ppp(5')Ni2 0Me). In some embodiments, Ni is chosen from A, C, G, or U. In some embodiments, Nj is A. In some embodiments, Ni is C. In some embodiments, Ni is G. In some embodiments, Ni is U.
Those skilled in the art will appreciate that methylation of one or more positions in a cap structure may impact or reflect mode of incorporation (e.g., co-transcriptional vs post-transcriptional), as presence of a methyl group (e.g., a 2'OMe group) at certain positions (e.g., Ni) may interfere with elongation, e.g., by a particular polymerase (e.g., T7), as underlies the ARCA technology. In some embodiments, a m7G(5')ppp(5')(Ni2OMe) Capl structure comprises a second nucleotide, Nz which is a cap proximal A, G, C, or U at position +2. In some embodiments, such Capl structures are represented as (m7G(5')ppp(5')(Ni2OMe)pNz). In some embodiments, Nzis A. In some embodiments, Nzis C. In some embodiments, Nzis G. In some embodiments, Nzis U.
In some embodiments, a Capl structure is or comprises m7G(5')ppp(5')(A i20Me)pGz wherein Ai is a cap proximal A at position +1 and Gz is a cap proximal G at position +2. and has the following structure:
In some embodiments, a Capl structure is or comprises m7G(5')ppp(5')(Ai2OMe)pUz wherein Ai is a cap proximal A at position +1 and Uz is a cap proximal U at position +2, and has the following structure:
In some embodiments, a Capl structure is or comprises m7G(5')ppp(5')(Gi2OMe)pGz wherein Gi is a cap proximal G at position +1 and Gz is a cap proximal G at position +2, and has the following structure:
In some embodiments, a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G) and one or more additional modifications, e.g., methylation on a ribose, and a 2'0 methylated first nucleotide in an RNA. In some embodiments, a Capl structure comprises a guanosine nucleoside methylated at the 7-position of guanine and a 3'0 methylation at a ribose (m7G3'OMe) or 7mG3'OMe); anj a 2'Q methylated first nucleotide in an RNA (Ni20Me). In some embodiments, a Capl structure is connected to an RNA via a 5'- to 5 '-triphosphate linkage and is also referred to herein as (m7G3'OMe)ppp(2'OMeNi) or (m7G3 OMi:)(5')ppp(5')(2'OMeNi). In some embodiments, Ni is chosen from A, C, G, or U. In some embodiments, Ni is A. In some embodiments, Ni is C. In some embodiments, Ni is G. In some embodiments, Ni is U.
In some embodiments, a (m7G3 OMc)(5')ppp(5')(Nj2OMe) Capl structure comprises a second nucleotide, Ni which is a cap proximal nucleotide at position 2 and is chosen from A, G, C, or U (m7G3 OMe)(5')ppp(5')(Ni2OMe)pN2). In some embodiments, Niis A. In some embodiments, N?is C. In some embodiments, N, is G. In some embodiments, Ni is U.
In some embodiments, a Capl structure is or comprises (m7G3 OMe)(5')ppp(5')(Ai2OMe)pG2 wherein Ai is a cap proximal A at position +1 and G2 is a cap proximal G at position +2. and has the following structure:
In some embodiments, a Capl structure is or comprises (m7G3 OMe)(5,)ppp(5')(Gi2OMe)pG2 wherein Gi is a cap proximal G at position +1 and G2 is a cap proximal G at position +2. and has the following structure:
In some embodiments, a second nucleotide in a Capl structure can comprise one or more modifications, e.g., methylation. In some embodiments, a Capl structure comprising a second nucleotide comprising a 2'0 methylation is a Cap2 structure.
In some embodiments, an RNA polynucleotide comprising a Capl structure has increased translation efficiency, increased translation rate and/or increased expression of an encoded payload relative to an appropriate reference comparator. In some embodiments, an RNA polynucleotide comprising a Capl structure having (m7G3 OMe)(5')ppp(5')(Ai2OMe)pG2 wherein Ai is a cap proximal nucleotide at position +1 and G2 is a cap proximal nucleotide at position +2. has increased translation efficiency relative to an RNA polynucleotide comprising a Capl structure having (m7G3OMe)(5')ppp(5')(Gi2OMe)pG2 wherein Gi is a cap proximal nucleotide at position 1 and G2 is a cap proximal nucleotide at position 2. In some embodiments, increased translation efficiency is assessed upon administration of an RNA polynucleotide to a cell or an organism. In some embodiments, a cap analog used in an RNA polynucleotide is m7G3'OMeGppp(m12’-OMe)ApG (also sometimes referred to as m27,3'-OMeG(5’)ppp(5’)m2’-OMeApG or (m7G3'OMe)(5')ppp(5')(A2'OMe)pG), which has the following structure: . Below is an exemplary Cap1 RNA, which comprises RNA and m27,3`OMeG(5’)ppp(5’)m2’-OMeApG: . Below is another exemplary Cap1 RNA:
5’-UTR and Proximal Sequences
In some embodiments, a nucleic acid (e.g., DNA, RNA) utilized in accordance with the present disclosure comprises a 5'-UTR. In some embodiments, 5’-UTR may comprise a plurality of distinct sequence elements; in some embodiments, such plurality may be or comprise multiple copies of one or more particular sequence elements (e.g., as may be from a particular source or otherwise known as a functional or characteristic sequence element). In some embodiments, a 5’ UTR comprises multiple different sequence elements. The term "untranslated region" or "UTR" is commonly used in the art to a region in a DNA molecule which is transcribed but is not translated into an amino acid sequence, or to the corresponding region in an RNA polynucleotide, such as an mRNA molecule. An untranslated region (UTR) can be present 5' (upstream) of an open reading frame (5'-UTR) and/or 3' (downstream) of an open reading frame (3'- UTR). A 5'-UTR, if present, is located at the 5' end, upstream of the start codon of a polypeptide- (e.g., protein)-encoding region. A 5'-UTR is downstream of the 5'-cap (if present), e.g., directly adjacent to the 5'-cap.
In some embodiments of the disclosure, a 5' UTR is a heterologous 5’ UTR, i.e., is a 5’ UTR found in nature associated with a different ORF. In another embodiment, a 5' UTR is a synthetic 5’ UTR, i.e., does not occur in nature. In some embodiments, aynthetic 5’ UTR may be utilized, such as a 5’ UTR whose sequence has been altered relative to a parental reference 5’ UTR. Those skilled in the art will be aware of various 5’ UTR sequence alterations that, for example, may have been reported to increase expression of an ORF with which the variant 5’ UTR is associated.
To give but a few examples, in some embodiments, a utilized 5' UTRs may be or comprise a 5’ UTR from a gene such as: a-globin or p- globin, such as Xenopus or human a-globin, p- globin, or oc-globin (e.g., as described, for example, in US Patent 8278063 and/or US Patent 9012219) genes, human cytochrome b- 245 a polypeptide, hydroxysteroid (17b) dehydrogenase, Tobacco etch virus (e.g., as described, for example, in US Patent 8278063and/or US Patent 9012219). CMV immediate -early 1 (IE 1 ) gene (e.g., as described, for example, in US2014/0206753, W02013/185069); HSD17B4, RPL32, ASAHI , ATP5A1, MP68, NDUFA4, NOSIP, RPL31 , SLC7A3, TUBB4B, UBQLN2, PSMB3, RPS9, CASP1, COX6B1, NDUFA1, Rpl31, GNAS, ALB7. In some embodiments, a 5’ UTR is or comprises a 5’ UTR from an a- globin gene, or a variant thereof.
In some embodiments, embodiment utilized 5' UTR is a 5’ UTR of a TOP gene, for example a 5' UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract) (e.g., as described, for example, in WO/2015/101414, W02015/101415, WO/2015/062738, WO2015/024667, WO2015/024667); a 5' UTR element of a ribosomal protein Large 32 (L32) gene (e.g., as described, for example, in WO/2015/101414, W02015/101415, WO/2015/062738), a 5' UTR element of an hydroxysteroid (17-P) dehydrogenase 4 gene (HSD17B4) (e.g., as described, for example, in WO2015/024667), or a 5' UTR element of ATP5A1 (e.g., as described, for example, in WO2015/024667) can be used.
In some embodiments, an internal ribosome entry site (IRES) is used instead of or in addition to a 5' UTR. In some embodiments, a 5’ UTR utilized in accordance with the present disclosure is or comprises a sequence: gggaaauaag agagaaaaga agaguaagaa gaaauauaag accccggcgc cgccacc. In some embodiments, a 5’ UTR utilized in accordance with the present disclosure is or comprises a sequence: gggaaauaag agagaaaaga agaguaagaa gaaauauaag agccacc. In some embodiments, a 5’ UTR may be or comprise a sequence GGGAUCCUACC (see, e.g., WO2014/144196). In some embodiments, a 5’ UTR may be or comprise a sequence as set forth in one of SEQ ID NOs: 231-252, or 22848-22875 of WO2021/156267, or a fragment or a variant of any of the foregoing. In some embodiments, a 5’ UTR may be or comprise a sequence as set forth in claim 9 of and/or of one or more of SEQ ID NOs: 1 -20 of W02019/077001 Al, or a fragment or variant of any of the foregoing. In some embodiments, a 5’ UTR may be or comprise one set forth in W02013/143700, for example one or more of SEQ ID NOs: 1 -1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 of W02013/143700, or a fragment or variant of any of the foregoing. In some embodiments, a 5’-UTR is or comprises a 5’ UTR as described in WO2016/107877, for example in SEQ ID NOs: 25-30 or 319-382 of WO2016/107877, or fragments or variants of any of the foregoing. In some embodiments, a 5 ’-UTR is or comprises a 5’ UTR as described in W02017/036580 for example in SEQ ID NOs: 1 -151 of W02017/036580, or fragments or variants of any of the foregoing. In some embodiments, a 5’ UTR is or comprises a 5’-UTR as described in WO2016/022914, for example in SEQ ID NOs: 3-19 of WO2016/022914, or fragments or variants of any of the foregoing In some embodiments, a 5' UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the source and/or from different sources (see, for example, the 5' UTRs described in US Patent Application Publication No.2010/0293625 and PCT/US2014/069155). In some embodiments, a 5’ UTR utilized in accordance with the present disclosure comprises a cap proximal sequence, e.g., as disclosed herein. In some embodiments, a cap proximal sequence comprises a sequence adjacent to a 5’ cap. In some embodiments, a cap proximal sequence comprises nucleotides in positions +1, +2, +3, +4, and/or +5 of an RNA polynucleotide.
In some embodiments, a Cap structure comprises one or more polynucleotides of a cap proximal sequence. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +1 (Nl) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotides +1 and +2 (Nl and N2) of an RNA polynucleotide.
Those skilled in the art, reading the present disclosure, will appreciate that, in some embodiments, one or more residues of a cap proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and/or +5) may be included in an RNA by virtue of having been included in a cap entity that (e.g., a Capl structure, etc.); alternatively, in some embodiments, at least some of the residues in a cap proximal sequence may be enzymatically added (e.g., by a polymerase such as a T7 polymerase). For example, in certain exemplified embodiments where a m27,3 °Gppp(ml2 °)ApG cap is utilized, +1 and +2 are the (ml2 °)A and G residues of the cap, and +3, +4, and +5 are added by polymerase (e.g., T7 polymerase).
In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, wherein Nl and N2 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A. In some embodiments, Nl is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
In some embodiments, N1 is A and N2 is A. In some embodiments, Nl is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, Nl is A and N2 is U.
In some embodiments, N1 is C and N2 is A. In some embodiments, Nl is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, Nl is C and N2 is U.
In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.
In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.
In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure and N3, N4 and N5, wherein Nl to N5 correspond to positions +1, +2, +3, +4, and/or +5 of an RNA polynucleotide.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is A. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is C. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is A. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is C. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is G. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is A. In some embodiments, N4 is U. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is G. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is A. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is C. In some embodiments, N5 is U. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is G. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is C. In some embodiments, N4 is U. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is G. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is A. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is C. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is G. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is G. In some embodiments, N4 is U. In some embodiments, N5 is U. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is A.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is G.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is C. In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is C.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is C. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is G. In some embodiments, N5 is U.
In some embodiments, Nl, N2, N3, N4, or N5 are any nucleotide, e.g., A, C, G or U. In some embodiments, Nl is A and N2 is G. In some embodiments, N3 is U. In some embodiments, N4 is U. In some embodiments, N5 is U.
In some embodiments, a 5’ UTR disclosed herein comprises a cap proximal sequence, e.g., as disclosed herein. In some embodiments, a cap proximal sequence comprises a sequence adjacent to a 5’ cap. In some embodiments, a cap proximal sequence comprises nucleotides in positions +1, +2, +3, +4, and/or +5 of an RNA polynucleotide.
In some embodiments, a Cap structure comprises one or more polynucleotides of a cap proximal sequence. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +1 (Nl) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotides +1 and +2 (N1 and N2) of an RNA polynucleotide.
In some embodiments, N1 and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
In some embodiments, N1 and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
In some embodiments, N1 is A and N2 is A. In some embodiments, N1 is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, N1 is A and N2 is U.
In some embodiments, N1 is C and N2 is A. In some embodiments, N1 is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, N1 is C and N2 is U.
In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.
In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.
In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: A3A4X5. In some embodiments, N1 and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is chosen from A, C, G or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.
In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: C3A4X5. In some embodiments, N1 and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is chosen from A, C, G or U.
In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U. In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, and a sequence comprising X3Y4X5. In some embodiments, Nl and N2 are each independently chosen from: A, C, G, or U. In some embodiments, Nl is A and N2 is G. In some embodiments, X3 and X5 is each independently chosen from A, C, G or U. In some embodiments, X3 and/or X5 is A. In some embodiments, X3 and/or X5 is C. In some embodiments, X3 and/or X5 is G. In some embodiments, X3 and/or X5 is U. In some embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In some embodiments, Y4 is U.
In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, and a sequence comprising X3Y4X5. In some embodiments, Nl and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 is each independently chosen from A, C, G or U. In some embodiments, X3 and/or X5 is A. In some embodiments, X3 and/or X5 is C. In some embodiments, X3 and/or X5 is G. In some embodiments, X3 and/or X5 is U. In some embodiments, Y4 is not G. In some embodiments, Y4 is A. In some embodiments, Y4 is C. In some embodiments, Y4 is U.
In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, and a sequence comprising A3C4A5. In some embodiments, Nl and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G.
In some embodiments, a cap proximal sequence comprises Nl and N2 of a Cap structure, and a sequence comprising A3U4G5. In some embodiments, Nl and N2 are each independently chosen from: A, C, G, or U. In some embodiments, N1 is A and N2 is G.
In some embodiments, a Cap structure comprises one or more polynucleotides of a cap proximal sequence. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +1 (Nl) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, a Cap structure comprises an m7 Guanosine cap and nucleotides +1 and +2 (Nl and N2) of an RNA polynucleotide.
In some embodiments, Nl and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, Nl is A. In some embodiments, Nl is C. In some embodiments, Nl is G. In some embodiments, Nl is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
In some embodiments, Nl and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, Nl is A. In some embodiments, Nl is C. In some embodiments, Nl is G. In some embodiments, Nl is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.
In some embodiments, N1 is A and N2 is A. In some embodiments, N1 is A and N2 is C. In some embodiments, N1 is A and N2 is G. In some embodiments, N1 is A and N2 is U.
In some embodiments, N1 is C and N2 is A. In some embodiments, N1 is C and N2 is C. In some embodiments, N1 is C and N2 is G. In some embodiments, N1 is C and N2 is U.
In some embodiments, N1 is G and N2 is A. In some embodiments, N1 is G and N2 is C. In some embodiments, N1 is G and N2 is G. In some embodiments, N1 is G and N2 is U.
In some embodiments, N1 is U and N2 is A. In some embodiments, N1 is U and N2 is C. In some embodiments, N1 is U and N2 is G. In some embodiments, N1 is U and N2 is U.
In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: A3A4X5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is chosen from A, C, G or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.
In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising: C3A4X5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is any nucleotide, e.g., A, C, G or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.
In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising X3Y4X5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 is any nucleotide, e.g., A, C, G or U. In some embodiments, X3 and/or X5 is A. In some embodiments, X3 and/or X5 is C. In some embodiments, X3 and/or X5 is G. In some embodiments, X3 and/or X5 is U. In some embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In some embodiments, Y4 is U.
In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising X3Y4X5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 is any nucleotide, e.g., A, C, G or U. In some embodiments, X3 and/or X5 is A. In some embodiments, X3 and/or X5 is C. In some embodiments, X3 and/or X5 is G. In some embodiments, X3 and/or X5 is U. In some embodiments, Y4 is not G. In some embodiments, Y4 is A. In some embodiments, Y4 is C. In some embodiments, Y4 is U.
In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising A3C4A5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G.
In some embodiments, a cap proximal sequence comprises N1 and N2 of a Cap structure, and a sequence comprising A3U4G5. In some embodiments, N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A and N2 is G.
Exemplary 5’ UTRs include a human alpha globin (hAg) 5’UTR or a fragment thereof, a TEV 5’ UTR or a fragment thereof, a HSP70 5’ UTR or a fragment thereof, or a c-Jun 5’ UTR or a fragment thereof.
In some embodiments, an RNA disclosed herein comprises a hAg 5’ UTR or a fragment thereof.
3’ UTR
In some embodiments, an RNA as described herein comprises a 3'-UTR. A “3 ’-untranslated region” or “3’-UTR” or “3’-UTR element” will be recognized and understood by the person of ordinary skill in the art. As is known in the art, a 3’ UTR typically is a part of a nucleic acid molecule that is located 3’ (i.e. downstream) of a coding sequence and is not translated into protein. In some embodiments, a 3 ’-UTR may located between a coding sequence and an (optional) terminal poly(A) sequence. In some embodiments, a 3’-UTR may comprise elements for controlling gene expression, such a what may be referred to as regulatory elements. Such regulatory elements may be or comprise, e.g., ribosomal binding sites, miRNA binding sites etc..
A 3'-UTR, if present, is located at the 3' end, downstream of the termination codon of a polypeptide- (e.g., protein-) encoding region, but the term "3'-UTR" does preferably not include the poly(A) sequence. Thus, the 3'-UTR is upstream of the poly(A) sequence (if present), e.g. directly adjacent to the poly(A) sequence.
In some embodiments, an RNA disclosed herein comprises a 3’ UTR comprising an F element and/or an I element. In some embodiments, a 3’ UTR or a proximal sequence thereto comprises a restriction site. In some embodiments, a restriction site is a BamHI site. In some embodiments, a restriction site is a Xhol site. In some embodiments, an RNA construct comprises an F element. In some embodiments, a F element sequence is a 3’-UTR of amino-terminal enhancer of split (AES).
In some embodiments, an RNA disclosed herein comprises a 3’ UTR having 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to a 3’ UTR with the sequence comprising: CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUC CCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUA GUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACC CCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUA CUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC (SEQ ID NO: 15). In some embodiments, an RNA disclosed herein comprises a 3’ UTR provided in SEQ ID NO: 15.
In some embodiments, a 3’UTR is an FI element as described in W02017/060314.
To give but a few examples, in some embodiments, a utilized 3’UTR may be or comprise a 3’UTR from a gene such as globin UTRs, including Xenopus 0-globin UTRs and human 0-globin UTRs are known in the art (see, for example, 8278063, 9012219, US2011/0086907). In some embodiments, a modified 0- globin construct with enhanced stability in some cell types may be utilized; such a construct has been reported as having been made by cloning two sequential human 0-globin 3'UTRs head to tail (US2012/0195936, W02014/071963). In addition cc2-globin, od-globin, UTRs and variants thereof are also known in the art (W02015/101415, W02015/024667). Exemplary 3' UTRs described in the mRNA constructs in the non-patent literature include those from CYBA (Ferizi et al., 2015) and albumin (Thess et al., 2015). In some embodiments, exemplary 3' UTRs include that of bovine or human growth hormone (wild type or modified) (W02013/185069, US2014/0206753, W02014152774), rabbit 0 globin and hepatitis B virus (HBV), a-globin 3' UTR and Viral VEEV 3' UTR sequences are also known in the art. In some embodiments, the sequence UUUGAAUU (W02014/144196) is used. In some embodiments, 3' UTRs of human and/or mouse ribosomal protein are used. In some embodiments, examples include rps9 3’UTR (W02015/101414), FIG4 (W02015/101415), and human albumin 7 (W02015/101415). In some embodiments, a nucleic acid comprises at least one heterologous 3’-UTR, wherein the at least one heterologous 3 ’-UTR comprises a nucleic acid sequence derived from a 3 ’-UTR of a gene selected from PSMB3, ALB7, alpha-globin (referred to as “muag”), CASP1 , COX6B1 , GNAS, NDUFA1 and RPS9, or from a homolog, a fragment or variant of any one of these genes.
In some embodiments, a utilized 3’UTR may be as exemplified, for example, in published PCT application W02019/077001 Al , in particular, claim 9 of W02019/077001 Al . In some embodiments, a 3’ UTR may be or comprise one of SEQ ID NOs: 23-34 of W02019/077001 Al , or a fragment or variant thereof). In some embodiments, a 3’ UTR utilized in accordance with the present disclosure comprises a sequence: ugauaauagg cuggagccuc gguggccuag cuucuugccc cuugggccuc cccccagccc cuccuccccu uccugcaccc guacccccgu ggucuuugaa uaaagucuga gugggcggc. In some embodiments, a 3’ UTR of the present disclosure comprises a sequence: ugauaauagg cuggagccuc gguggccaug cuucuugccc cuugggccuc cccccagccc cuccuccccu uccugcaccc guacccccgu ggucuuugaa uaaagucuga gugggcggc. In some embodiments, a nucleic acid may comprise a 3’-UTR as described in WO2016/107877In some embodiments, suitable 3’-UTRs are SEQ ID NOs: 1-24 and SEQ ID NOs: 49-318 of WO2016/107877, or fragments or variants of these sequences. In some embodiments, a 3 ’-UTR as described in W02017/036580 may be utilized. In some embodiments, suitable 3’-UTRs are SEQ ID NOs: 152-204 of W02017/036580, or fragments or variants of these sequences. In some embodiments a 3’ -UTR as described in WO2016/022914 is utilized. In some embodiments, a 3’-UTRs is or comprises a sequence according to SEQ ID NOs: 20-36 of WO2016/022914, or fragments or variants of these sequences.
PolyA
In some embodiments, a polynucleotide (e.g., DNA, RNA) disclosed herein comprises a polyadenylate (PolyA) sequence, e.g., as described herein. In some embodiments, a PolyA sequence is situated downstream of a 3'-UTR, e.g., adjacent to a 3'-UTR.
As used herein, the term "poly(A) sequence" or "poly-A tail" refers to an uninterrupted or interrupted sequence of adenylate residues which is typically located at the 3'-end of an RNA polynucleotide. Poly(A) sequences are known to those of skill in the art and may follow the 3 ’-UTR in the RNAs described herein. An uninterrupted poly(A) sequence is characterized by consecutive adenylate residues. In nature, an uninterrupted poly(A) sequence is typical. In some embodiments, polynucleotides disclosed herein comprise an uninterrupted Poly(A) sequence. In some embodiments, polynucleotides disclosed herein comprise interrupted Poly(A) sequence. In some embodiments, RNAs disclosed herein can have a poly(A) sequence attached to the free 3'-end of the RNA by a template-independent RNA polymerase after transcription or a poly(A) sequence encoded by DNA and transcribed by a template -dependent RNA polymerase.
It has been demonstrated that a poly (A) sequence of about 120 A nucleotides has a beneficial influence on the levels of RNA in transfected eukaryotic cells, as well as on the levels of polypeptide (e.g., protein) that is translated from an open reading frame that is present upstream (5’) of the poly(A) sequence (Holtkamp et al., 2006, Blood, vol. 108, pp. 4009-4017).
In some embodiments, a poly (A) sequence in accordance with the present disclosure is not limited to a particular length; in some embodiments, a poly(A) sequence is any length. In some embodiments, a poly(A) sequence comprises, essentially consists of, or consists of at least 10, at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 1000, up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, and, in particular, about 120 A nucleotides. In this context, "essentially consists of' means that most nucleotides in the poly(A) sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly(A) sequence are A nucleotides, but permits that remaining nucleotides are nucleotides other than A nucleotides, such as U nucleotides (uridylate), G nucleotides (guanylate), or C nucleotides (cytidylate). In this context, "consists of" means that all nucleotides in the poly(A) sequence, i.e., 100% by number of nucleotides in the poly(A) sequence, are A nucleotides. The term "A nucleotide" or "A" refers to adenylate.
In some embodiments, a poly(A) sequence is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand. The DNA sequence encoding a poly(A) sequence (coding strand) is referred to as poly(A) cassette.
In some embodiments, the poly(A) cassette present in the coding strand of DNA essentially consists of dA nucleotides, but is interrupted by a random sequence of the four nucleotides (dA, dC, dG, and dT). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length. Such a cassette is disclosed in WO 2016/005324 Al, hereby incorporated by reference. Any poly(A) cassette disclosed in WO 2016/005324 Al may be used in accordance with the present disclosure. A poly(A) cassette that essentially consists of dA nucleotides, but is interrupted by a random sequence having an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of e.g., 5 to 50 nucleotides shows, on DNA level, constant propagation of plasmid DNA in E. coli and is still associated, on RNA level, with the beneficial properties with respect to supporting RNA stability and translational efficiency is encompassed. In some embodiments, the poly(A) sequence contained in an RNA polynucleotide described herein essentially consists of A nucleotides, but is interrupted by a random sequence of the four nucleotides (A, C, G, U). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.
In some embodiments, no nucleotides other than A nucleotides flank a poly(A) sequence at its 3'-end, i.e., the poly(A) sequence is not masked or followed at its 3'-end by a nucleotide other than A.
In some embodiments, the poly(A) sequence may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may essentially consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 150 nucleotides. In some embodiments, the poly(A) sequence comprises about 120 nucleotides.
In some embodiments, a poly A tail comprises a specific number of Adenosines, such as about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 120, or about 150 or about 200. In some embodiments a poly A tail of a string construct may comprise 200 A residues or less. In some embodiments, a poly A tail of a string construct may comprise about 200 A residues. In some embodiments, a poly A tail of a string construct may comprise 180 A residues or less. In some embodiments, a poly A tail of a string construct may comprise about 180 A residues. In some embodiments, a poly A tail may comprise 150 residues or less.
In some embodiments, the poly(A) sequence may comprise about 10 to about 500 adenosine nucleotides, about 10 to about 200 adenosine nucleotides, about 40 to about 200 adenosine nucleotides, or about 40 to about 150 adenosine nucleotides. In some embodiments, the length of the poly(A) sequence may be at least about or even more than about 10, 50, 64, 75, 100, 200, 300, 400, or 500 adenosine nucleotides.
In some embodiments, the nucleic acid comprises at least one poly(A) sequence comprising about 30 to about 200 adenosine nucleotides. In some embodiments, the poly(A) sequence comprises about 64 adenosine nucleotides (A64). In some embodiments, the poly(A) sequence comprises about 100 adenosine nucleotides (A100). In some embodiments, the poly(A) sequence comprises about 150 adenosine nucleotides.
In some embodiments, the nucleic acid comprises at least one poly (A) sequence comprising about 100 adenosine nucleotides, wherein the poly(A) sequence is interrupted by non-adenosine nucleotides, preferably by 10 non adenosine nucleotides (A30-N10-A70).
Open Reading Frames
In some embodiments, an RNA produced in accordance with technologies provided herein comprises an Open Reading Frame (ORF), e.g., encoding a polypeptide of interest or encoding a plurality of polypeptides of interest. In some embodiments, an RNA produced in accordance with technologies provided herein comprises a plurality of ORFs (e.g., encoding a plurality of polypeptides). In some embodiments, an RNA produced in accordance with technologies herein comprises a single ORF that encodes a plurality of polypeptides. In some such embodiments, polypeptides are or comprise antigens or epitopes thereof (e.g., relevant antigens).
To give but some examples, in some embodiments, an encoded polypeptide may be or comprise an antigen or epitope thereof, so that, when expressed in a subject to which a provided RNA is administered, an immune response (e.g., characterized by antibodies and/or T cells specifically directed to the antigen or one or more epitopes thereof); in some such embodiments, an encoded polypeptide may be polyepitopic, for example including multiple polypeptide elements, each of which includes at least one epitope, linked to one another and optionally separated by linkers. As is understood in the art, in some embodiments, a polyepitopic construct may include individual epitopes found in different portions of the same protein in nature. Alternatively or additionally, in some embodiments, a polyepitopic construct may include individual epitopes found in different proteins in nature. Those skilled in the art will be aware of a variety of considerations relevant to selection of desirable polyepitopic constructs, and/or antigens and/or epitopes for inclusion therein, useful in accordance with the present disclosure (see, for example, WO2014082729, WO2012159754, WO2017173321, WO2014180659, WO20161283762, W02017194610, WO2011143656, WO2015103037, Nielsen JS, et al. J Immunol Methods. 2010 Aug 31 ;360(l-2): 149-56. , “Polyepitope Vaccine Technology.” Polyepitope Vaccine Technology - Creative Biolabs, www.creative-biolabs.com/vaccine/polyepitope-vaccine-technology.htm., Li, L. et al. Genome Med 13, 56 (2021)., Cafri G. et al. Journal of Clinical Investigation 130, 5976-5988 (2020), Khairkhah N. et al. (2020) PLOS ONE 15(10): e0240577.).
In some embodiments, a relevant antigen may be or comprise comprise an infectious antigen (i.e., an antigen associated with an infectious agent such as an infectious virus, a bacterium, a fungus, etc.) and/or a cancer antigen (e.g., an antigen associated with a class of tumors or a specific tumor; in some embodiments, a cancer-associated antigen may be or comprise a neoantigen or neoepitope), or epitope thereof.
Alternatively or additionally, in some embodiments, an ORF may encode, for example, an antibody or portion (e.g., antigen-binding portion) thereof, an enzyme, a cytokine, a therapeutic protein, etc. (see, for example, 02017186928, WO2017191274, US10669322, Dammes et al Trens Pharmacol Sci 4:755, 2020-10-01, Wang et al Nature Reviews Drug Discovery 19, 441-442 (2020), Damase et al Front. Bioeng. Biotechnol., 18 March 2021).
In some embodiments, an ORF for use in accordance with the present disclosure encodes a polypeptide that includes a signal sequence, e.g., that is functional in mammalian cells. In some embodiments, a utilized signal sequence is “intrinsic” in that it is , in nature, it is associated with (e.g., linked to) the encoded polypeptide.
In some embodiments, a utilized signal sequence is heterologous to the encoded polypeptide - e.g., is not naturally part of a polypeptide (e.g., protein) whose sequences are included in the encoded polypeptide.
In some embodiments, signal peptides are sequences, which are typically characterized by a length of about 15 to 30 amino acids.
In many embodiments, signal peptides are positioned at the N-terminus of an encoded polypeptide as described herein, without being limited thereto. In some embodiments, signal peptides preferably allow the transport of the polypeptide encoded by RNAs of the present disclosure with which they are associated into a defined cellular compartment, preferably the cell surface, the endoplasmic reticulum (ER) or the endosomal-lysosomal compartment.
In some embodiments, a signal sequence is selected from an S1S2 signal peptide (aa 1-19), an immunoglobulin secretory signal peptide (aa 1-22), an HSV-1 gD signal peptide (MGGAAARLGAVILFVVIVGLHGVRSKY), an HSV-2 gD signal peptide (MGRLTSGVGTAALLVVAVGLRVVCA); a human SPARC signal peptide, a human insulin isoform 1 signal peptide, a human albumin signal peptide, etc. Those skilled in the art will be aware of other secretory signal peptides such as, for example, as disclosed in W02017/081082 (e.g., SEQ ID NOs: 1- 1115 and 1728, or fragments variants thereof) and W02019008001.
In some embodiments, an RNAsequence encodes an epitope that may comprise or otherwise be linked to a signal sequence (e.g., secretory sequence), such as those listed in Table 1, or at least a sequence having 1, 2, 3, 4, or 5 amino acid differences relative thereto. In some embodiments, a signal sequence such as MFVFLVLLPLVSSQCVNLT, or at least a sequence having 1, 2, 3, 4, or at the most 5 amino acid differences relative thereto is utilized. In some embodiments, a sequence such as MFVFLVLLPLVSSQCVNLT, or a sequence having 1, 2, 3, 4, or at the most 5 amino acid differences relative thereto, is utilized.
In some embodiments, a signal sequence is selected from those included in the Table 1 below and/or those encoded by the sequences in Table 2 below:
Table 1: Exemplary signal sequences
Table 2: Exemplary nucleotide sequences encoding signal sequences
In some embodiments, an RNAutilized as described herein encodes a multimerization element (e.g., a heterologous multimerization element). In some embodiments, a heterologous multimerization element comprises a dimerization, trimerization or tetramerization element.
In some embodiments, a multimerization element is one described in W02017/081082 (e.g., SEQ ID NOs: 1116-1167, or fragments or variants thereof).
Exemplary trimerization and tetramerization elements include, but are not limited to, engineered leucine zippers, fibritin foldon domain from enterobacteria phage T4, GCN4pll, GCN4-pll, and p53.
In some embodiments, a provided encoded polypeptide(s) is able to form a trimeric complex. For example, a utilized encoded polypeptide(s) may comprise a domain allowing formation of a multimeric complex, such as for example particular a trimeric complex of an amino acid sequence comprising an encoded polypeptide(s) as described herein. In some embodiments, a domain allowing formation of a multimeric complex comprises a trimerization domain, for example, a trimerization domain as described herein.
In some embodiments, an encoded polypeptide(s) can be modified by addition of a T4-fibri tin-derived “foldon” trimerization domain, for example, to increase its immunogenicity.
In some embodiments, an RNAas described herein encodes a membrane association element (e.g., a heterologous membrane association element), such as a transmembrane domain. A transmembrane domain can be N-terminal, C-terminal, or internal to an encoded polypeptide. A coding sequence of a transmembrane element is typically placed in frame (i.e., in the same reading frame), 5', 3', or internal to coding sequences of sequences (e.g., sequences encoding polypeptide(s)) with which it is to be linked.
In some embodiments, a transmembrane domain comprises or is a transmembrane domain of Hemagglutinin (HA) of Influenza virus, Env of HIV- 1, equine infectious anaemia virus (EIAV), murine leukaemia virus (MLV), mouse mammary tumor virus, G protein of vesicular stomatitis virus (VSV), Rabies virus, or a seven transmembrane domain receptor.
In some embodiments, an ORF encoding polypeptide of the disclosure is codon optimized. Various codon optimization methods are known in the art. For example, an ORF of any one or more of the sequences provided herein may be codon optimized. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove polypeptide trafficking sequences; remove/add post translation modification sites in encoded polypeptide (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the polypeptide to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - non limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms.
In some embodiments, a codon optimized sequence shares less than 95% sequence identity to a naturally - occurring or wild-type sequence ORF (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 90% sequence identity to a naturally-occurring or wild- type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 85% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wildtype mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 80% sequence identity to a naturally -occurring or wild-type sequence (e.g., a naturally- occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares less than 75% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85% or between about 67% and about 80%) sequence identity to a naturally-occurring or wild- type sequence (e.g., a naturally -occurring or wild-type mRNA sequence encoding a polypeptide). In some embodiments, a codon optimized sequence shares between 65% and 75% or about 80% sequence identity to a naturally -occurring or wild-type sequence (e.g. , a naturally-occurring or wild-type mRNA sequence encoding a polypeptide).
In some embodiments, a codon-optimized sequence encodes polypeptide (e.g., an antigen) that is as immunogenic as, or more immunogenic than (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% more), than a polypeptide encoded by a non-codon- optimized sequence.
In some embodiments, when transfected into mammalian host cells, the modified mRNAs have a stability of between 12-18 hours, or greater than 18 hours, e.g., 24, 36, 48, 60, 72, or greater than 72 hours and are capable of being expressed by the mammalian host cells.
In some embodiments, a codon optimized RNA may be one in which the levels of G/C are enhanced and/or A/U are enhanced. In some embodiments, the G/C-content of nucleic acid molecules (e.g., mRNA) may influence the stability of the RNA. RNA having an increased amount of guanine (G) and/or cytosine (C) residues may be functionally more stable than RNA containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02/098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translated region. In some embodiments, due to the degeneracy of the genetic code, the modifications work by substituting existing codons for those that promote, for example greater RNA stability, without changing the resulting amino acid. In some embodiments, the approach is limited to coding regions of the RNA.
The present disclosure specifically exemplifies use of RNAs encoding viral antigen(s) (and/or epitope(s) thereof), for example coronavirus antigen(s) and/or epitope(s). For example, in some embodiments, the present disclosure exemplifies use of a single-stranded RNA whose nucleotide sequence encodes a coronavirus polypeptide or a variant thereof. In some embodiments, a single-stranded RNA comprises a nucleotide sequence that encodes a prefusion coronavirus spike protein, e.g., as described in WO 2018081318, the entire contents of which are incorporated herein by reference for purposes described herein. In some embodiments, an RNA for use in accordance with the present disclosure encodes a SARS-CoV-2 spike protein with K986P and V978P mutations.
In some embodiments, a single-stranded RNA comprises a nucleotide sequence that encodes a SARS- CoV-2 polypeptide (including, e.g., a spike (S) protein, a nucleocapsid (N) protein, envelope (E) protein, and a membrane (M) protein) or an immunogenic fragment thereof. In some embodiments, a singlestranded RNA comprises a nucleotide sequence that encodes a SARS-CoV-2 S polypeptide or an immunogenic fragment thereof (e.g., a receptor binding domain of a S protein). In some embodiments, such a SARS-CoV-2 S polypeptide or an immunogenic fragment thereof may be a mutant protein. In some embodiments, such a SARS-CoV-2 S protein or an immunogenic fragment thereof may be one as described in Walsh et al. “RNA-based COVID-19 vaccine BNT162b2 selected for a pivotal efficacy study” medRxiv preprint (2020), which is online accessible at: https://doi.org/10.1 101/2020.08.17.20176651 ; and Milligan et al. “Phase I/II study of COVID-19 RNA vaccine BNT162bl in adults” Nature (2020 August), which is online accessible at: https://doi.org/10.1038/s41586-020-2639-4, the contents of each of which are incorporated by reference in their entirety.
In some embodiments, a single-stranded RNA comprises a nucleotide sequence that encodes a SARS- CoV-2 polypeptide as shown in Example 10.
In some embodiments, a single-stranded RNA (e.g., mRNA as described herein) may comprise a secretion signal-encoding region (e.g., a secretion signal-encoding region that allows an encoded target entity to be secreted upon translation by cells). In some embodiments, such a secretion signal-encoding region may be or comprise a non-human secretion signal. In some embodiments, such a secretion signalencoding region may be or comprise a human secretion signal.
In some embodiments, a single-stranded RNA (e.g., mRNA as described herein) may comprise at least one non-coding sequence element (e.g., to enhance RNA stability and/or translation efficiency). Examples of non-coding sequence elements include but are not limited to a 3’ untranslated region (UTR), a 5’ UTR, a cap structure for co-transcriptional capping of mRNA, a poly adenine (poly A) tail, and any combinations thereof.
UTRs (S’ UTRs and/or 3’UTRs): In some embodiments, a single-stranded RNA can comprise a nucleotide sequence that encodes a 5 ’UTR of interest and/or a 3’ UTR of interest. One of skill in the art will appreciate that untranslated regions (e.g., 3’ UTR and/or 5’ UTR) of a mRNA sequence can contribute to mRNA stability, mRNA localization, and/or translational efficiency.
In some embodiments, a single-stranded RNA can comprise a 5’ UTR nucleotide sequence and/or a 3’ UTR nucleotide sequence. In some embodiments, such a 5’ UTR sequence can be operably linked to a 3’ of a coding sequence (e.g. , encompassing one or more coding regions). Additionally or alternatively, in some embodiments, a 3’ UTR sequence can be operably linked to 5’ of a coding sequence (e.g., encompassing one or more coding regions). In some embodiments, 5' and 3' UTR sequences included in a single-stranded RNA can consist of or comprise naturally occurring or endogenous 5' and 3' UTR sequences for an open reading frame of a gene of interest. Alternatively, in some embodiments, 5’ and/or 3’ UTR sequences included in a singlestranded RNA are not endogenous to a coding sequence (e.g., encompassing one or more coding regions); in some such embodiments, such 5’ and/or 3’ UTR sequences can be useful for modifying the stability and/or translation efficiency of an RNA sequence transcribed. For example, a skilled artisan will appreciate that AU-rich elements in 3' UTR sequences can decrease the stability of mRNA. Therefore, as will be understood by a skilled artisan, 3' and/or 5’ UTRs can be selected or designed to increase the stability of the transcribed RNA based on properties of UTRs that are well known in the art.
For example, one skilled in the art will appreciate that, in some embodiments, a nucleotide sequence consisting of or comprising a Kozak sequence of an open reading frame sequence of a gene or nucleotide sequence of interest can be selected and used as a nucleotide sequence encoding a 5’ UTR. As will be understood by a skilled artisan, Kozak sequences are known to increase the efficiency of translation of some RNA transcripts, but are not necessarily required for all RNAs to enable efficient translation. In some embodiments, a single-stranded RNA can comprise a nucleotide sequence that encodes a 5' UTR derived from an RNA virus whose RNA genome is stable in cells. In some embodiments, various modified ribonucleotides (e.g., as described herein) can be used in the 3' and/or 5' UTRs, for example, to impede exonuclease degradation of the transcribed RNA sequence.
In some embodiments, a 5’ UTR included in a single-stranded RNA may be derived from human a- globin mRNA combined with Kozak region. In some embodiments, a 5’ UTR comprises the nucleotide sequence of SEQ ID NO: 12 as shown in Example 10.
In some embodiments, a single-stranded RNA may comprise one or more 3 ’UTRs. For example, in some embodiments, a single-stranded RNA may comprise two copies of 3'-UTRs derived from a globin mRNA, such as, e.g., alpha2-globin, alpha 1 -globin, beta-globin (e.g., a human beta-globin) mRNA. In some embodiments, two copies of 3’ UTR derived from a human beta-globin mRNA may be used, e.g. , in some embodiments which may be placed between a coding sequence of a single-stranded RNA and a poly(A)-tail, to improve protein expression levels and/or prolonged persistence of an mRNA. In some embodiments, a 3’ UTR included in a single-stranded RNA may be or comprise one or more (e.g., 1, 2, 3, or more) of the 3 ’UTR sequences disclosed in WO 2017/060314, the entire content of which is incorporated herein by reference for the purposes described herein. In some embodiments, a 3‘-UTR may be a combination of at least two sequence elements (FI element) derived from the "amino terminal enhancer of split" (AES) mRNA (called F) and the mitochondrial encoded 12S ribosomal RNA (called I). These were identified by an ex vivo selection process for sequences that confer RNA stability and augment total protein expression (see WO 2017/060314, herein incorporated by reference). In some embodiments, an FI element comprises the nucleotide sequence of SEQ ID NO: 13 as shown in Example 10.
PolyA tail'. In some embodiments, a single-stranded RNA can comprise a polyA tail. A polyA tail is a nucleotide sequence comprising a series of adenosine nucleotides, which can vary in length (e.g., at least 5 adenine nucleotides) and can be up to several hundred adenosine nucleotides. In some embodiments, a polyA tail is a nucleotide sequence comprising at least 30 adenosine nucleotides or more, including, e.g., at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, or more adenosine nucleotides. In some embodiments, a polyA tail is or comprises a polyA homopolymeric tail. In some embodiments, a polyA tail may comprise one or more modified adenosine nucleosides, including, but not limited to, cordycepin and 8-azaadenosine. In some embodiments, a polyA tail may comprise one or more non-adenosine nucleotides. In some embodiments, a polyA tail may be or comprise a disrupted or modified polyA tail as described in WO 2016/005324, the entire content of which is incorporated herein by reference for the purpose described herein. For example, in some embodiments, a polyA tail included in a single-stranded RNA described herein may be or comprise a modified polyA sequence comprising: a linker sequence; a first sequence of at least 20 consecutive A nucleotides, which is 5’ of the linker sequence; and a second sequence of at least 20 consecutive A nucleotides, which is 3’ of the linker sequence. In some embodiments, a modified polyA sequence may comprise: a linker sequence comprising at least ten nucleotides (e.g., U, G, and/or C nucleotides); a first sequence of at least 30 consecutive A nucleotides, which is 5’ of the linker sequence; and a second sequence of at least 70 consecutive A nucleotides, which is 3’ of the linker sequence. In some embodiments, a polyA tail comprises the nucleotide sequence of SEQ ID NO: 14 as shown in Example 10.
5’ cap: In some embodiments, a single-stranded RNA described herein may comprise a 5’ cap, which may be incorporated into such a single-stranded RNA during transcription, or joined to such a singlestranded RNA post-transcription. In some embodiments, a single-stranded RNA may comprise a 5’ cap structure for co-transcriptional capping of mRNA. Examples of a cap structure for co-transcriptional capping are known in the art, including, e.g., as described in WO 2017/053297, the entire content of which is incorporated herein by reference for the purposes described herein. In some embodiments, a 5’ cap included in a single-stranded RNA described herein is or comprises a capl structure. For example, in some embodiments, a capl structure may be or comprise m7G(5')ppp(5')(2'OMeA)pG, also known asm 27 ’ °G pppOn i 2’ °) A pG .
In some embodiments, a single-stranded RNA described herein may comprise at least one modified ribonucleotide, for example, in some embodiments to increase the stability of such a single-stranded RNA and/or to decrease cytotoxicity of such a single -stranded RNA. For example, in some embodiments, at least one of A, U, C, and G ribonucleotide of a single-stranded RNA may be replaced by a modified ribonucleotide. For example, in some embodiments, some or all of cytidine residues present in a singlestranded RNA may be replaced by a modified cytidine, which in some embodiments may be, e.g. , 5- methylcytidine. Alternatively or additionally, in some embodiments, some or all of uridine residues present in a single-stranded RNA may be replaced by a modified uridine, which in some embodiments may be, e.g., pseudouridine, such as, e.g., 1 -methylpseudouridine. In some embodiments, all uridine residues present in a single-stranded RNA is replaced by pseudouridine, e.g., 1 -methylpseudouridine.
In vitro Transcription
In some embodiments, technologies provided by the present disclosure achieve production of RNA preparations (e.g., pharmaceutical-grade RNA preparations, including large batch preparations) that include, for example (i) synthesizing RNA by in vitro transcription e.g., in a bioreactor, to produce an in vitro transcription RNA composition; and (ii) removing one or more components (e.g., undesired components) from the in vitro transcription RNA composition, thereby producing an RNA transcript preparation; in some embodiments, such the RNA transcript is present in such RNA transcript preparation at a concentration (i.e., an adjusted concentration, in light of the removing) of at least 1 mg/mL (including, e.g., at least 1.5 mg/mL, at least 2 mg/mL, at least 2.5 mg/mL, at least 3 mg/mL, at least 3.5 mg/mL, at least 4 mg/mL, at least 4.5 mg/mL, at least 5 mg/mL, at least 6 mg/mL, or higher). In some embodiments, the RNA may be present at a concentration of 1.5 mg/mL to 5 mg/mL or 2 mg/mL to 4 mg/mL. In some embodiments, all unit operations described herein are performed at room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C), unless specified otherwise.
(I) Synthesis
In some embodiments, RNA (e.g., single-stranded RNA as described herein) can be synthesized from a DNA template by in vitro RNA transcription, e.g., in the presence of appropriate reagents comprising, e.g., at least one RNA-polymerase and appropriate ribonucleotide triphosphates or variants thereof (e.g., modified ribonucleotide triphosphates), e.g., in a bioreactor. In some embodiments, a bioreactor that is useful for in vitro transcription is large enough for an in vitro transcription reaction volume of at least 1 liter, including, e.g., at least 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50 liters or more. In some embodiments, a bioreactor that is particularly useful for commercial-scale in vitro transcription is large enough for an in vitro transcription reaction volume of at least 20 liters, including, e.g., at least 25, 30, 35, 40, 45, 50 liters, or more. Exemplary starting materials
DNA template
One of ordinary skill in the art will understand that a DNA template is used to direct synthesis of RNA (e.g., single-stranded RNA). In some embodiments, a DNA template is a linear DNA molecule. In some embodiments, a DNA template is a circular DNA molecule. DNA can be obtained or generated using methods known in the art, including, e.g., gene synthesis, recombinant DNA technology, or a combination thereof. In some embodiments, a DNA template comprises a nucleotide sequence coding for a transcribed region of interest (e.g. , coding for a RNA described herein) and a promoter sequence that is recognized by an RNA polymerase selected for use in in vitro transcription. Various RNA polymerases are known in the art, including, e.g., DNA dependent RNA polymerases (e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, a N4 virion RNA polymerase, or a variant or functional domain thereof). A skilled artisan will readily understand that an RNA polymerase utilized herein may be a recombinant RNA polymerase, and/or a purified RNA polymerase, i.e.. not as part of a cell extract, which contains other components in addition to the RNA polymerases. One skilled in the art will recognize an appropriate promoter sequence for the selected RNA polymerase. In some embodiments, a DNA template can comprise a promoter sequence for a T7 RNA polymerase.
In some embodiments, a DNA template comprises a nucleotide sequence coding for an RNA described herein (e.g. , comprising a nucleotide sequence coding for an antigen of interest and optionally comprising one or more nucleotide sequences coding for characteristic elements of an RNA described herein, including, e.g., polyA tail, 3’ UTR, and/or 5’ UTR, etc.). In some embodiments, such a coding sequence may be generated by gene synthesis. In some embodiments, such a coding sequence may be inserted into a vector by cold fusion cloning.
In some embodiments, a DNA template may further comprise one or more of a recognition sequence for an appropriate restriction endonuclease (e.g., utilized for linearization), an appropriate resistance gene, and/or an appropriate origin of replication. In some embodiments, a DNA template may further comprise a recognition sequence for an appropriate restriction endonuclease (e.g., utilized for linearization such as, e.g., but not limited to a Class II restriction endonuclease), an appropriate resistance gene (e.g., but not limited to a kanamycin resistance gene), and an appropriate origin of replication.
In some embodiments, a DNA template may be amplified via polymerase chain reaction (PCR) from a plasmid DNA. In some embodiments, a plasmid DNA may be obtained, e.g., from bacterial cells (e.g., Escherichia coli (E. coli)) followed by an endotoxin- and animal product-free plasmid isolation procedure. In some embodiments, a DNA template may be a linearized plasmid DNA (pDNA) template in the absence of PCR-based amplification. In some such embodiments, a cell bank or a cell stock for a pDNA of interest (e.g., as described herein) may be established. For example, in some embodiments, such a cell bank or a cell stock may comprise a frozen stock of bacterial cells (e.g., E. coli cells, such as DH10B E. coli cells) that are genetically engineered to comprise a pDNA template of interest (e.g., as described herein) with pre -determined specifications. In some embodiments, a pDNA contains a promoter sequence (e.g. T7 RNA polymerase). In some embodiments, a pDNA contains a recognition sequence for an endonuclease (e.g., for linearization). In some embodiments, a pDNA contains a resistance gene. In some embodiments, a pDNA contains an origin of replication. In some embodiments, a pDNA contains one or more of a promoter sequence, a recognition sequence for an endonuclease, a resistance gene, and/or an origin of replication.
In some embodiments, a master cell bank or a master cell stock may be established. A cell bank or cell stock may be established, for example, by transforming a stock of competent bacterial cells (e.g., E. coli cells) with a pDNA of interest. A pure culture of transformed cells may be produced, for example, by growth on selective medium. Subsequently, a single colony isolate may be selected and grown in liquid culture and, in some embodiments, used to inoculate larger cultures volumes. In some embodiments, culture growth is stopped at a predetermined threshold (e.g., optical density (OD) threshold). In some embodiments, cryoprotectant (e.g., glycerol) is added to the culture. In some embodiments, the cell suspension is aliquoted into a container (e.g., tubes, vials, cryovials, etc.) and frozen using a controlled rate freezer. In some embodiments, cell bank aliquots are stored at least at -100°C, -125°C, -150°C, or colder (e.g., in the vapor phase of a liquid nitrogen freezer or dewar).
In some embodiments, quality control testing is performed on a master cell bank or cell stock, for example, by evaluating one or more of culture purity, presence of lytic bacteriophage, presence of lysogenic bacteriophage, host cell identity, viability, plasmid retention, restriction map analysis, plasmid copy number, and/or DNA sequencing. In some embodiments, a vial from a master cell bank or cell stock may be thawed to inoculate a culture (e.g., a working cell bank). In some embodiments, working cell bank culture growth may be stopped at a particular predetermined threshold. In some embodiments, a cryoprotectant is added. In some embodiments, a working cell bank is aliquoted, stored, and/or evaluated for quality (e.g., as described for a master cell bank). In some embodiments, master cell bank and working cell banks are monitored for quality over time (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 years or more after release) until the cell bank is depleted and/or no longer used.
A pDNA can be amplified by first thawing and subsequent fermentation of the genetically engineered bacterial cells (e.g., E. coli cells from a cell bank), followed by purification of the pDNA (e.g., by filtration, chromatography, etc.), linearization (e.g., by an endonuclease), and optionally a polishing step as appropriate, thereby generating a linearized pDNA. In some embodiments, a resulting linearized pDNA is assessed for a set of relevant specifications, including, for example, DNA concentration, purity, appearance, residual host cell DNA and/or RNA, residual selection drug, residual protein, pH, PolyA tail integrity and/or identity, linearization efficiency (e.g., least 75%, 80%, 85%, 90%, 95%, or more), identity of transcribed region, bioburden, and/or endotoxins. In some embodiments, linear DNA template is stored in water (e.g., high purity water). In some embodiments, linear DNA template is stored in buffer (e.g., HEPES, pH 7-9).
Ribonucleotides
Ribonucleotides for use in in vitro transcription may include at least two or more (e.g., at least three or more, at least four or more, at least five or more, at least six or more) different types of ribonucleotides, each type having a different nucleoside. Ribonucleotides for use in in vitro transcription can include unmodified and/or modified ribonucleotides. Unmodified ribonucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). In some embodiments, all four types of unmodified ribonucleotides may be used for in vitro transcription.
In some embodiments, at least one type of ribonucleotide included in in vitro transcription is a modified ribonucleotide. Modified ribonucleotides may include one or more modifications including, but not limited to, for example, (a) end modifications, e.g., 5' end modifications (e.g., phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (e.g., conjugation, inverted linkages, etc.), (b) base modifications, e.g. , replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, and (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. To the extent that such modifications interfere with translation (e.g., results in a reduction of 50% or more in translation relative to the absence of the modification - e.g., as characterized using a rabbit reticulocyte in vitro translation assay), such modified ribonucleotides, in some embodiments, are not desirable for use in systems and methods described herein.
In some embodiments, a modified ribonucleotide may have at least one nucleoside ("base") modification or substitution. Various nucleoside modifications or substitutions are known in the art; one of skill in the art will appreciate that modified nucleosides include, for example, but not limited to synthetic and natural nucleobases such as inosine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine, 2- (halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2- (amino)adenine, 2-(aminoalkyll)adenine, 2- (aminopropyl)adenine, 2-(methylthio)-N6-(isopentenyl)adenine, 6-(alkyl)adenine, 6- (methyl) adenine, 7- (deaza)adenine, 8-(alkenyl)adenine, 8-(alkyl)adenine, 8-(alkynyl)adenine, 8-(amino)adenine, 8- (halo)adenine, 8-(hydroxyl)adenine, 8-(thioalkyl)adenine, 8-(thiol)adenine, N6-(isopentyl)adenine, N6- (methyl) adenine, N6, N6-(dimethyl)adenine, 2-(alkyl)guanine, 2- (propyl)guanine, 6-(alkyl)guanine, 6- (methyl)guanine, 7-(alkyl)guanine, 7-(methyl)guanine, 7-(deaza)guanine, 8-(alkyl)guanine, 8- (alkenyl)guanine, 8-(alkynyl)guanine, 8-(amino)guanine, 8-(halo)guanine, 8-(hydroxyl)guanine, 8- (thioalkyl)guanine, 8-(thiol)guanine, N-(methyl)guanine, 2-(thio)cytosine, 3-(deaza)-5- (aza)cytosine, 3- (alkyl)cytosine, 3-(methyl)cytosine, 5-(alkyl)cytosine, 5-(alkynyl)cytosine, 5-(halo)cytosine, 5- (methyl)cytosine, 5-(propynyl)cytosine, 5-(propynyl)cytosine, 5-(trifluoromethyl)cytosine, 6- (azo)cytosine, N4-(acetyl)cytosine, 3-(3 amino-3 carboxypropyl)uracil, 2-(thio)uracil, 5-(methyl)-2- (thio)uracil, 5- (methylaminomethyl)-2 (thio)uracil, 4-(thio)uracil, 5-(methyl)-4 (thio)uracil, 5- (methylaminomethyl)-4 (thio)uracil, S-(methyl) -2,4-(dithio)uracil, 5-(methylaminomethyl)-2,4 (dithio)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5- (aminoallyl)uracil, 5-(aminoalkyl)uracil, 5-(guanidiniumalkyl)uracil, 5-(l,3-diazole-l-alkyl)uracil, 5- (cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5 -(dimethylaminoalky l)uracil, 5-(halo)uracil, 5- (methoxy)uracil, uracil-5-oxyacetic acid, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5- (methoxycarbonyl-methyl)uracil, 5-(propynyl)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 6- (azo)uracil, dihydrouracil, N3- (methyl)uracil, 5-uracil (7.e.. pseudouracil), 2- (thio)pseudouracil,4- (thio)pseudouracil, 2,4-(dithio)psuedouracil,5-(alkyl)pseudouracil, 5-(methyl)pseudouracil, 5-(alkyl)- 2- (thio)pseudouracil, 5-(methyl)-2-(thio)pseudouracil, 5-(alkyl)-4 (thio)pseudouracil, 5-(methyl)-4 (thio)pseudouracil, 5-(alkyl)-2,4 (dithio)pseudouracil, 5-(methyl)-2,4 (dithio)pseudouracil, 1 -substituted pseudouracil (e.g., 1-methyl-pseudouridine), C-5 propynyl-uridine, 2-aminoadenosine, C5 -bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, l-substituted-2(thio)-pseudouracil, 1-substituted 4 (thio)pseudouracil, 1-substituted 2, 4-(dithio)pseudouracil, l-(aminocarbonylethylenyl)-pseudouracil, 1- (aminocarbonylethylenyl)-2(thio)-pseudouracil, 1 (aminocarbonylethylenyl)-4 (thio)pseudouracil, 1- (aminocarbonylethylenyl)-2,4-(dithio)pseudouracil, 1 - (arninoalkylaminocarbonylethylenyl)- pseudouracil, 1 (aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouracil, 1- (arninoalkylaminocarbonylethylenyl)-4 (thio)pseudouracil, l-(arninoalkylaminocarbonylethylenyl)- 2,4- (dithio)pseudouracil, l,3-(diaza)-2-(oxo)-phenoxazin-l-yl, l-(aza)-2-(thio)-3-(aza)-phenoxazin-l- yl, 1,3- (diaza)-2-(oxo)-phenthiazin-l-yl, l-(aza)-2-(thio)-3-(aza)-phenthiazin-l-yl, 7-substituted 1,3- (diaza)-2- (oxo)-phenoxazin-l-yl, 7-substituted l-(aza)-2-(thio)-3-(aza)-phenoxazin-l-yl, 7-substituted l,3-(diaza)-2- (oxo)-phenthiazin-l-yl, 7-substituted l-(aza)-2-(thio)-3-(aza)-phenthiazin-l-yl, 7- (aminoalkylhydroxy)-l,3- (diaza)-2-(oxo)-phenoxazin-l-yl, 7-(aminoalkylhydroxy)-l-(aza)-2-(thio)-3- (aza)-phenoxazin-l-yl, 7- (aminoalkylhydroxy)-l,3-(diaza)-2-(oxo)-phenthiazin-l-yl, 7- (aminoalkylhydroxy)-l-(aza)-2-(thio)-3- (aza)-phenthiazin-l-yl, 7-(guanidiniumalkylhydroxy)-l,3- (diaza)-2-(oxo)-phenoxazin-l-yl, 7- (guanidiniumalkylhydroxy)-l-(aza)-2-(thio)-3-(aza)-phenoxazin-l-yl, 7-(guanidiniumalkyl -hydroxy)- 1,3- (diaza)-2-(oxo)-phenthiazin-l -yl, 7- (guanidiniumalkylhydroxy)-l -(aza)-2-(thio)-3-(aza)-phenthiazin-l - yl, 1 ,3,5-(triaza)-2,6-(dioxa)- naphthalene, inosine, xanthine, hypoxanthine, nubularine, tubercidine, isoguanisine, inosinyl, 2-aza- inosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, 3-(methyl)isocarbostyrilyl, 5- (methyl)isocarbostyrilyl, 3-(methyl)- 7-(propynyl)isocarbostyrilyl, 7-(aza)indolyl, 6-(methyl)-7- (aza)indolyl, imidizopyridinyl, 9-(methyl)- imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl, 7- (propynyl)isocarbostyrilyl, propynyl-7- (aza)indolyl, 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4,6- (dimethyl)indolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, difluoro tolyl, 4-(fluoro)-6- (methyl)benzimidazole, 4-(methyl)benzimidazole, 6- (azo)thymine, 2-pyridinone, 5 nitroindole, 3 nitropyrrole, 6-(aza)pyrimidine, 2 (amino)purine, 2,6- (diamino)purine, 5 substituted pyrimidines, N2- substituted purines, N6-substituted purines, 06- substituted purines, substituted 1,2,4-triazoles, pyrrolo-pyrimidin-2-on-3-yl, 6-phenyl-pyrrolo-pyrimidin- 2-on-3-yl, para-substituted-6-phenyl- pyrrolo-pyrimidin-2-on-3-yl, ortho-substituted-6-phenyl-pyrrolo- pyrimidin-2-on-3-yl, bis-ortho- substituted-6-phenyl-pyrrolo-pyrimidin-2-on-3-yl, para- (aminoalkylhydroxy)- 6-phenyl-pyrrolo- pyrimidin-2-on-3-yl, ortho-(aminoalkylhydroxy)- 6-phenyl- pyrrolo-pyrimidin-2-on-3-yl, bis-ortho — (aminoalkylhydroxy)- 6-phenyl-pyrrolo-pyrimidin-2-on-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino- pyridopyrimidin-3-yl, 2-oxo-pyridopyrimidine-3-yl, or any Ci- alkylated or N-alkylated derivatives thereof.
In some embodiments, a modified nucleotide utilized in IVT systems and/or methods described herein may disrupt binding of an RNA to one or more mammalian (e.g. , human) endogenous RNA sensors (e.g. , innate immune RNA sensors), including, e.g., but not limited to toll-like receptor (TLR)3, TLR7, TLR8, retinoic acid-inducible gene I (RIG-I), melanoma differentiation-associated gene 5 (MDA5), protein kinase R (PKR), 2’ -5’ oligoadenylate synthetase (OAS), and laboratory of genetics and physiology 2 (LGP2), and combinations thereof. In some embodiments, such modified ribonucleotides may include modifications as described in US 9,334,328, the contents of which are incorporated herein by reference in their entireties for the purposes described herein. Modified nucleosides are typically desirable to be translatable in a host cell (e.g., presence of a modified nucleoside does not prevent translation of an RNA sequence into a respective protein sequence). Effects of modified nucleotides on translation can be assayed, by one of ordinary skill in the art using, for example, a rabbit reticulocyte lysate translation assay.
In some embodiments, a modified ribonucleotide may include a modified internucleoside linkage. Various such modified internucleoside linkages are known in the art; one of skill in the art will appreciate that non-limiting examples of modified intemucleoside linkages that may be used in technologies provided herein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalky Iphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Modified internucleoside linkages that do not include a phosphorus atom therein may have internucleoside linkages that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
In some embodiments, a modified ribonucleotide may include one or more substituted sugar moieties. Various such modified sugar moieties are known in the art; one of skill in the art will appreciate that, in some embodiments, a sugar moiety of a ribonucleotide may include one of the following at the 2' position: H (deoxyribose); OH (ribose); F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted. In some embodiments, a sugar moiety of a ribonucleotide may include a 2' methoxyethoxy (2'-O- CH2CH2OCH3, also known as 2'-O-(2 -methoxyethyl) or 2-MOE), 2'- dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMA0E, and 2'- dimethylaminoethoxyethoxy (also known in the art as 2'0-dimethylaminoethoxyethyl or 2'- DMAEOE), i.e. , 2'-O-CH2-O-CH2-N(CH2)2; 2'- methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions, for example, at the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked nucleotides and the 5' position of 5' terminal nucleotide.
In some embodiments, a mixture of ribonucleotides that are useful for an in vitro transcription reaction may comprise ATP, CTP, GTP, and Nl-methylpseudouridine-5’ triphosphate (ml TTP). In some embodiments, the ratio of ATP, CTP, GTP, and ml TTP for an in vitro transcription reaction is 1:1:1: 1. In some embodiments, the ratio of ATP, CTP, GTP, and ml TTP for an in vitro transcription is optimized such that relative proportions of nucleotides correspond to fractions of the respective nucleotides in an mRNA molecule, e.g., as described in the International Patent Publication No. WO 2015188933.
Exemplary in vitro transcription reaction mixture
One of ordinary skill in the art will understand materials and reagents for a typical in vitro transcription. In some embodiments, an individual reaction component or components are thawed prior to their addition to an in vitro transcription reaction mixture. For example, an in vitro transcription reaction mixture typically includes a DNA template (e.g. , as described herein), ribonucleotides (e.g. , as described herein), a RNA polymerase (e.g., DNA dependent RNA polymerases), and an appropriate reaction buffer for a selected RNA polymerase. In some embodiments, an in vitro transcription reaction mixture may further comprise an RNase inhibitor. In some embodiments, an in vitro transcription reaction mixture may further comprise a pyrophosphatase (e.g., an inorganic pyrophosphatase). In some embodiments, an in vitro transcription reaction mixture may further comprise one or more salts (e.g. , monovalent salts and/or divalent salts), a reducing agent (e.g., dithithreitol, 2-mercaptoethanol, etc.), spermidine, or combinations thereof. In some embodiments, certain reaction components are added in a specific order (e.g., pyrophosphatase and polymerase added last). In some embodiments, agitation rate is increased following the addition of specific reaction components (e.g., pyrophosphatase, polymerase).
Various RNA polymerases that are suitable for in vitro transcription are known in the art, including, e.g., but not limited to DNA dependent RNA polymerases (e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, a N4 virion RNA polymerase, or a variant or functional domain thereof). A skilled artisan will understand that an RNA polymerase utilized herein may be a recombinant RNA polymerase, and/or a purified RNA polymerase, i.e., not as part of a cell extract, which contains other components in addition to the RNA polymerases. In some embodiments, an RNA polymerase that is useful for commercial-scale in vitro transcription is a T7 RNA polymerase. In some embodiments, an inorganic pyrphosphatase may be added to improve the yield of in vitro transcription reaction (e.g., in some embodiments catalyzed by T7 RNA polymerase).
Transcription buffer is typically optimized for a selected RNA polymerase. For example, in some embodiments, a transcription buffer may comprise Tris-HCl, HEPES, or other appropriate buffer. In some embodiments, a transcription buffer can comprise 20-60 mM HEPES, 20-60 mM divalent salt (e.g., magnesium salts, such as magnesium chloride, magnesium acetate, etc.), 5-15 mM reducing agent (e.g., dithiothreitol, 2-mercaptoethanol, etc.) and 0.5 - 3 mM spermidine. In some embodiments, a transcription buffer has a pH of 7-9 (e.g., about 7.1, 7.2, 7.3, 7.4, 7.5, 7.6 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0).
5’ cap
In some embodiments, an RNA produced by technologies described herein may comprise a cap at its 5’ end. Those skilled in the art will appreciate that addition of a 5' cap to an RNA (e.g., mRNA) can facilitate recognition and attachment of the RNA to a ribosome to initiate translation and enhances translation efficiency. Those skilled in the art will also appreciate that a 5' cap can also protect an RNA product from 5' exonuclease mediated degradation and thus increases half-life. Methods for capping are known in the art; one of ordinary skill in the art will appreciate that in some embodiments, capping may be performed after in vitro transcription in the presence of a capping system (e.g., an enzyme -based capping system such as, e.g., capping enzymes of vaccinia virus). In some embodiments, a capped RNA may be obtained by in vitro capping of RNA that has a 5' triphosphate group or RNA that has a 5' diphosphate group with a capping enzyme system (including, e.g., but not limited to vaccinia capping enzyme system or Saccharomyces cerevisiae capping enzyme system). In some embodiments, a capping agent may be introduced into an in vitro transcription reaction mixture (e.g., ones as described herein), along with a plurality of ribonucleotides such that a cap is incorporated into an RNA during transcription (also known as co-transcriptional capping). While it may be desirable to include, in some embodiments, a 5' cap in an RNA, an RNA, in some embodiments, may not have a 5’ cap.
In some embodiments, a 5’ capping agent can be added to an in vitro transcription reaction mixture. In some embodiments, a 5’ capping agent may comprise a modified nucleotide, for example, a modified guanine nucleotide. In some embodiments, a 5’ capping agent may comprise, for example, a methyl group or groups, glyceryl, inverted deoxy abasic moiety, 4’5’ methylene nucleotide, l-(beta-D-erythrofuranosyl) nucleotide, 4’ thio nucleotide, carbocyclic nucleotide, 1 ,5-anhydrohexitol nucleotide, L-nucleotides, alpha-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5 dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety, 3'-3'-inverted abasic moiety, 3'-2'-inverted nucleotide moiety, 3 '-2 '-inverted abasic moiety, 1 ,4- butanediol phosphate, 3'-phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 3'phosphorothioate, phosphorodi thioate, or bridging or non-bridging methylphosphonate moiety, inosine, Nl-methyl-guanosine, 2’-fluoro-guanosine, 7’deaza-guanosine, 8 -oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine. In some embodiments, a 5’ capping agent may be or comprise a dinucleotide cap analog (including, e.g., a m7GpppG cap analog or an N7-methyl, 2’-O- methyl -GpppG anti-reverse cap analog (ARCA) cap analog or an N7-methyl, 3'-O-methyl-GpppG ARCA cap analog). In some embodiments, a 5’ capping agent comprises a 5' N7-Methyl-3'-O-Methylguanosine structure, e.g., CleanCap® Reagents (Trilink BioTechnologies). In some embodiments, a 5’-capping agent is added in excess to a particular ribonucleotide or ribonucleotides (e.g., GTP, ATP, UTP, CTP, or modified version thereof) to enable incorporation of the 5’ -cap as the first addition to the RNA transcript.
In vitro transcription reaction conditions
In some embodiments, an in vitro transcription reaction is conducted, e.g., in a bioreactor described herein (selected for a certain in vitro transcription reaction volume, e.g., as described herein) for a period of time. In some embodiments, the period of time is at least 20 minutes, including, e.g., at least 25 minutes, at least 30 minutes, at least 40 minutes, at least 55 minutes, at least 60 minutes, at least 75 minutes, at least 90 minutes, at least 105 minutes, at least 120 minutes, at least 135 minutes, at least 150 minutes, at least 165 minutes, or at least 180 minutes. In some embodiments, the period of time is 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, or 180 minutes. In some embodiments, the period of time is about 1.5-3 hours. In some embodiments, the period of time is about 25-35 minutes.
In some embodiments, an in vitro transcription reaction is conducted, e.g., in a bioreactor described herein for a period of time (e.g., as described herein) at a temperature at which a selected RNA polymerase is functionally active. While typical phage RNA polymerases (e.g., T7 polymerases) that carry out in vitro transcription reactions are usually not active at elevated temperatures (e.g., above 45°C), thermostable RNA polymerases (e.g., thermostable variants of T7 RNA polymerases such as ones as described in US10519431, the contents of which are incorporated by reference for purposes described herein) can show increased stability at elevated temperatures. In some embodiments, in vitro transcription is performed at a temperature of approximately 25°C or higher, including, e.g., 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, or 45°C. In some embodiments, in vitro transcription is performed at a temperature of approximately 45°C or higher, including, e.g., 46°C, 47°C, 48°C , 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C or higher.
In some embodiments, an in vitro transcription is conducted e.g., in a bioreactor described herein at a pH of about 6, 6.5, 7, 7.5, 8, or 9. In some embodiments, a suitable pH for an in vitro transcription may be approximately 7.5 -8.5.
In some embodiments, in vitro transcription reactions performed in accordance with the present disclosure (e.g., in a bioreactor as described herein) may be performed as continuous feed reactions; in some embodiments, they may be performed as batch-fed reactions. In some embodiments, one or more nucleotides may be added to an in vitro transcription reaction in a step-wise manner (e.g. at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more bolus feeds). In some embodiments, an agitation rate is selected such that a particular blend time to enable rapid mixing of bolus additions to ensure optimal availability of modified nucleotide solution and one or more other nucleotide solutions during RNA synthesis is achieved.
UTP limitation and/or supplementation: In some embodiments, an in vitro transcription reaction comprises UTP or a functional thereof at a limiting concentration in combination with at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof. In some embodiments, a functional analog of UTP is or comprises Nl- methylpseudouridine-5 ’ triphosphate (ml TTP). Without wishing to be bound by any particular theory, maintaining a low concentration of UTP or functional analog thereof can be useful for reducing generation of double-stranded RNA. In some embodiments, UTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that limits the rate of transcription. In some embodiments, UTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that is lower than the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof. In some embodiments, the starting concentration of UTP or a functional analog thereof is at least 30% lower (including, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof. In some embodiments, the ratio of the starting concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof is about 1:1.3 or lower, including, e.g., 1:1.4; 1:1.5; 1:2, 1:2.5; 1:3; 1:3.5; 1:4; 1:4.5; 1:5; 1:6; 1:7; 1:8, 1:9; 1:10; 1:11; 1:12; 1:13; 1:14; 1:15; 1:16; 1:17; 1:18; 1:19; 1:20, or lower. In some embodiments, the ratio of the starting concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof is about 1:1.3 to about 1:20, or about 1:1.5 to about 1:15, or about 1:5 to about 1:15, or about 1:8 to about 1:12. In some such embodiments, the starting concentration of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof may be the same.
In some embodiments, an in vitro transcription reaction is supplemented at least once with UTP or a functional analog thereof over the course of the reaction. In some embodiments, an in vitro transcription reaction is supplemented multiple times (e.g., at least 2 or more, including, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) with UTP or a functional analog thereof over the course of the transcription reaction. In some embodiments, supplementation of UTP or a functional analog thereof is performed when its concentration in the reaction mixture is near depletion. In some embodiments, supplementation of UTP or a functional analog thereof is performed when its concentration in the reaction mixture is less than 100 uM, 90 uM, 80 uM, 70 uM, 60 uM, 50 uM, 40 uM, 30 uM, 20 uM, 10 uM, 5 uM, 3 uM, 2, uM, 1 uM, 500 nM, 250 nM, 200 nM, 100 nM, 50 nM, 25 nM, or lower.
In some embodiments, UTP (or a functional analog thereof) supplementation may be performed continuously during the course of the transcription reaction. For example, in some embodiments, UTP (or a functional analog thereof) supplementation may be performed in a continuous manner at a rate that is comparable to (e.g., within 10% or lower) of its consumption rate. In some embodiments, UTP (or a functional analog thereof) supplementation may be performed at a rate such that after such supplementation, UTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, GTP or functional analog thereof, and/or CTP or functional analog thereof.
In some embodiments, UTP (or a functional analog thereof) supplementation may be performed periodically during the course of the transcription reaction. In some embodiments, UTP (or a functional analog thereof) supplementation may be performed in a periodic manner such that after each addition, UTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, GTP or functional analog thereof, and/or CTP or functional analog thereof. In some embodiments, such periodic supplementation may be performed as one or more bolus or batch addition(s), including, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more bolus or batch addition(s). In some embodiments, such periodic supplementation may be performed by a fed-batch process.
In some embodiments, the concentration of UTP or a functional analog thereof added during supplementation is same as the starting concentration of UTP or a functional analog thereof. In some embodiments, the concentration of UTP or a functional analog thereof added during supplementation is lower than the starting concentration of UTP or a functional analog thereof, e.g., at least 10% lower (including, e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of UTP or a functional analog thereof.
In some embodiments, UTP (or a functional analog thereof) supplementation is performed at a concentration and/or at a rate or manner such that the ratio of the concentration of UTP or a functional analog thereof to the concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof (during the course of the reaction) is maintained substantially the same (e.g., within 10% or less) as the initial ratio of the concentration of UTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof, CTP or a functional analog thereof, and optionally GTP or a functional analog thereof (at the beginning of the reaction).
In some embodiments, UTP or a functional analog thereof is supplemented until the end of the transcription reaction.
In some embodiments, UTP or a functional analog thereof is present in an initial transcription reaction at a starting concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 rnM. In some embodiments, UTP or a functional analog thereof is maintained during the course of an in vitro transcription reaction at a concentration of 0.1 to 2 mM or 0.1 to 1.5 rnM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM. Optional additional non-UTP limitation and/or supplementation'. In some embodiments, at least one of non-UTP (or functional analog thereof) is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription reaction (e.g., the beginning of the in vitro transcription reaction). For example, in some embodiments, at least one of ATP or a functional analog thereof, CTP or a functional analog thereof, or GTP or a functional analog thereof is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription reaction (e.g., the beginning of the in vitro transcription reaction). In some embodiments, GTP or a functional analog thereof is provided at a limiting concentration (in addition to limited UTP or a functional analog thereof) at the initial in vitro transcription (e.g., the beginning of the in vitro transcription reaction).
In some embodiments, GTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that limits the rate of transcription. In some embodiments, GTP or a functional analog thereof is present in an in vitro transcription reaction at a starting concentration that is lower than the starting concentration of at least one or all of ATP or a functional analog thereof and/or CTP or a functional analog thereof. In some embodiments, the starting concentration of GTP or a functional analog thereof is at least 30% lower (including, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of at least one or all of ATP or a functional analog thereof and/or CTP or a functional analog thereof. In some embodiments, the ratio of the starting concentration of GTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof and/or CTP or a functional analog thereof is about 1:1.3 or lower, including, e.g., 1:1.4; 1:1.5; 1:2, 1:2.5; 1:3; 1:3.5; 1:4; 1:4.5; 1:5; 1:6; 1:7; 1:8, 1:9; 1:10; 1:11; 1:12; 1:13; 1:14; 1:15; 1:16; 1:17; 1:18; 1:19; 1:20, or lower. In some embodiments, the ratio of the starting concentration of GTP or a functional analog thereof to the starting concentration of at least one or all of ATP or a functional analog thereof and/or CTP or a functional analog thereof is about 1:1.3 to about 1:20, or about 1:1.5 to about 1:15, or about 1:5 to about 1:15, or about 1:8 to about 1:12. In some such embodiments, the starting concentration of ATP or a functional analog thereof and/or CTP or a functional analog thereof.
In some embodiments, an in vitro transcription reaction is supplemented at least once with GTP or a functional analog thereof over the course of the reaction. In some embodiments, an in vitro transcription reaction is supplemented multiple times (e.g., at least 2 or more, including, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) with GTP or a functional analog thereof over the course of the transcription reaction. In some embodiments, supplementation of GTP or a functional analog thereof is performed when its concentration in the reaction mixture is near depletion. In some embodiments, supplementation of GTP or a functional analog thereof is performed when its concentration in the reaction mixture is less than 100 uM, 90 uM, 80 uM, 70 uM, 60 uM, 50 uM, 40 uM, 30 uM, 20 uM, 10 uM, 5 uM, 3 uM, 2, uM, 1 uM, 500 nM, 250 nM, 200 nM, 100 nM, 50 nM, 25 nM, or lower.
In some embodiments, GTP (or a functional analog thereof) supplementation may be performed continuously during the course of the transcription reaction. For example, in some embodiments, GTP (or a functional analog thereof) supplementation may be performed in a continuous manner at a rate that is comparable to (e.g., within 10% or lower) of its consumption rate. In some embodiments, GTP (or a functional analog thereof) supplementation may be performed at a rate such that after such supplementation, GTP or functional analog thereof is present in the reaction at a concentration lower than that of ATP or functional analog thereof and/or CTP or functional analog thereof.
In some embodiments, GTP (or a functional analog thereof) supplementation may be performed periodically during the course of the transcription reaction. In some embodiments, GTP (or a functional analog thereof) supplementation may be performed in a periodic manner such that after each addition, GTP or functional analog thereof is present in the reaction at a concentration lower than that of one or more, and in some embodiments, all of ATP or functional analog thereof, and/or CTP or functional analog thereof. In some embodiments, such periodic supplementation may be performed as one or more bolus or batch addition(s), including, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more bolus or batch addition(s). In some embodiments, such periodic supplementation may be performed by a fed-batch process.
In some embodiments, the concentration of GTP or a functional analog thereof added during supplementation is same as the starting concentration of GTP or a functional analog thereof. In some embodiments, the concentration of GTP or a functional analog thereof added during supplementation is lower than the starting concentration of GTP or a functional analog thereof, e.g., at least 10% lower (including, e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% lower) than the starting concentration of GTP or a functional analog thereof.
In some embodiments, GTP (or a functional analog thereof) supplementation is performed at a concentration and/or at a rate or manner such that the ratio of the concentration of GTP or a functional analog thereof to the concentration of ATP or a functional analog thereof, and/or CTP or a functional analog thereof (during the course of the reaction) is maintained substantially the same (e.g., within 10% or less) as the initial ratio of the concentration of GTP or a functional analog thereof to the starting concentration of ATP or a functional analog thereof and/or CTP or a functional analog thereof (at the beginning of the reaction). In some embodiments, GTP or a functional analog thereof is supplemented until the end of the transcription reaction.
In some embodiments, GTP or a functional analog thereof is present in an initial transcription reaction at a starting concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM. In some embodiments, GTP or a functional analog thereof is maintained during the course of an in vitro transcription reaction at a concentration of 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM.
In some embodiments, non-UTP supplementation does not include supplementation of CTP or functional analog thereof or ATP or functional analog thereof.
In some embodiments where non-UTP supplementation is performed, such non-UTP supplementation can be performed concurrently with UTP supplementation over the course of the reaction. In some embodiments, non-UTP or functional analog thereof and UTP or functional analog thereof can be added to a reaction mixture as a single composition. In some embodiments, non-UTP or functional analog thereof and UTP or functional analog thereof can be added to a reaction mixture as separate compositions, for example, each at the same or different concentrations and/or each introduced at the same or different flow rates to a reaction mixture). In some embodiments, such non-UTP supplementation and UTP supplementation can be performed by different methods, e.g., one is performed continuously (e.g., as described herein) while another is performed periodically (e.g., as described herein).
In some embodiments, in vitro transcription in accordance with the present disclosure is carried out, e.g., in a bioreactor as described herein, using a fed-batch process and the present disclosure teaches that such fed-batch process may have certain advantages including, for example, ability to maintain one or more reagents or components within a particular concentration range. For example, in some embodiments, a fed-batch process may involve multiple additions of a nucleotide that competes with a cap analog (a “competing nucleotide”) such as, e.g., a GTP, in the course of an in vitro transcription reaction, for example to maintain a low concentration of GTP (e.g., 0.1 to 2 mM or 0.1 to 1.5 mM, or 0.1 to 1 mM, or 0.5 to 2 mM, or 1 to 2 mM) in order to effectively cap a synthesized RNA. In some embodiments, a fed- batch process may involve supplementation of an in vitro transcription reaction with a competing nucleotide at a ratio between about 1 : 1 and about 1 :50 relative to the concentration of a cap analog in the reaction, e.g., as described in the International Patent Publication No. WO 2006004648. In some embodiments, the concentration of a competing nucleotide in an in vitro transcription reaction is maintained at a level that is less than the concentration of a cap analog throughout the reaction but is not a limiting component. In some embodiments, a programmable pump may be used. In some embodiments, a programmable syringe pump may be used, for example, to automatically perform step-wise addition of one or more reaction components. Alternatively or additionally, in some embodiments, a monitor (e.g., a sensor) may be utilized to detect level(s) of one or more components; in some such embodiments, a monitor may communicate automatically with a pump, for example so that additional feeds may be released upon detection of a reduced amount of such component(s). In some embodiments, an in vitro transcription reaction is optimized such that relative proportions of nucleotides correspond to fractions of the respective nucleotides in an mRNA molecule, e.g., as described in the International Patent Publication No. WO 2015188933.
In some embodiments, following RNA transcription, a DNA template can be removed or separated from an in vitro transcription RNA composition, for example using methods known in the art, e.g., DNA hydrolysis. For example, in some embodiments, DNase (e.g., DNase I) may be added to remove or digest or fragment DNA template under appropriate conditions (e.g., in the presence of divalent salt such as a calcium salt and/or incubation at an optimum temperature for DNase). In some embodiments, DNA removal is performed for a period of 15-20 minutes, 15-25 minutes, 20-25 minutes, 20-30 minutes, 25-30 minutes, 25-35 minutes, 30-35 minutes, 30-40 minutes, 35-40 minutes, 35-45 minutes, 45-50 minutes, SO- 55 minutes, or 55-60 minutes. In some embodiments, DNA removal is performed at a temperature of approximately 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31 °C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, or 45°C. In some embodiments, DNA removal is performed at a temperature of 30-40 °C. In some embodiments, agitation rate is maintained during DNA removal (e.g., DNA hydrolysis) from the previous IVT step.
In some embodiments, an RNase inhibitor may be added during DNA removal or digestion to protect RNA from potential degradation. In some embodiments, a chelating agent may be added to a DNase- treated transcription mixtures to complex with divalent ions that may be added during in vitro transcription reaction. An exemplary chelating agent may be or comprise ethylenediaminetetraacetic acid (EDTA). In some embodiments, upon addition of chelating agent, the temperature may be shifted at least 1°C (including e.g., at least 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C or more).
In some embodiments, following RNA transcription, an in vitro transcription RNA composition (e.g., in some embodiments after DNA removal and/or digestion) can be subjected to a protein digestion or fragmentation process. In some embodiments, an exemplary protein digestion or fragmentation may comprise use of a proteinase (e.g., but not limited to proteinase K). In some embodiments, protein digestion utilizes a relative amount of enzyme (e.g., proteinase) to starting IVT volume, for example, at least 0.5 mL/L, at least 0.75 mL/L, at least 1 mL/L, at least 1.25 mL/L, or more. In some embodiments, protein digestion is conducted at a particular temperature (e.g., at least 30°C, at least 31 °C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, or higher) for a particular duration of time (e.g., at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, or longer). In some embodiments, RNA concentration, bioburden, and/or endotoxins are assessed and/or monitored after protein digestion.
In some embodiments, an in vitro transcription RNA composition following in vitro transcription and optional pre-purification processing (e.g., DNA and/or protein removal and/or digestion) may be maintained at 2-8°C for a period of time before further processing (e.g. , removal of impurities). In some embodiments, the maintained period of time may be at least 6 hours or longer, including, e.g., at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or longer.
In some embodiments, a RNA preparation may be held in a container, for example, a bag, tube, vial, etc. In some embodiments, the container is a polymer-based container (e.g., polyethylene, ethylene vinyl acetate).
In some embodiments, in process-controls and/or monitoring of an in vitro transcription can be conducted. For example, RNA concentration and/or integrity may be monitored during or after in vitro transcription. In some embodiments, RNA concentration may be assessed following purification of an aliquot of a transcription mixture with a commercial kit after in vitro transcription. In some embodiments, RNA concentration and/or integrity of a produced RNA solution after in vitro transcription may be assessed before maintaining at 2-8°C for a period of time (e.g., as described herein).
(II) Exemplary methods for removing one or more impurities
After an in vitro transcription RNA composition is produced by in vitro transcription, one or more components (e.g., added reagents, reaction by products, and/or impurities) can be removed by one or more purification and/or separation processes known in the art. For example, without limitation, an in vitro transcription RNA composition can be purified using phenol-chloroform extraction, enzymatic digestions of undesired components (e.g., protein components), precipitation, chromatography, spin column purification, membrane filtration, and/or affinity-based purification (e.g., in the form of a solid substrate, e.g., but not limited to magnetic beads or particles). In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by an affinity-based purification method, chromatography-based purification methods (e.g., size exclusion chromatography (SEC), high-performance liquid chromatography (HPLC), ion exchange chromatography (EC)), and/or filtration methods (e.g., centrifugal ultrafiltration, membrane filtration, etc.').
In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by an affinity-based purification method. In some embodiments, such an affinity -based purification method may be performed with a solid substrate known in the art. It will be apparent to one skilled in the art that a variety of solid substrates may be used, including, without limitation, membranes; beads; tubes; wells; microtiter plates or wells; slides; discs; columns; beads (including, e.g., polymeric beads, magnetic beads); membranes; films; chips; and composites thereof. For example, in some embodiments, a solid substrate (e.g., magnetic beads or particles) coated with a substance or composition that has a high binding affinity for high-molecular weight nucleic acids can be useful in accordance with the present disclosure such that RNA will bind to the solid substrate, while any other undesirable components present in an RNA transcription mixture, including, e.g., short hydrolyzed DNA fragments, free nucleotide triphosphates (NTPs), 5’ capping agent, proteins, divalent ions complexed with a chelating agent, will remain in solution. In some such embodiments, a silicate -coated solid substrate (e.g. , particles or magnetic beads) may be used. In some such embodiments, a carboxylate-coated solid substrate (e.g., particles or magnetic beads) may be used. In some embodiments, an RNA transcription mixture may be divided into a plurality of (e.g., at least two, at least three, at least four, or more) portions such that they can be purified in parallel (e.g., in batch mode).
In some embodiments, magnetic bead- or particle-based purification (e.g., as described herein) is carried out at room temperature (e.g. , about 18°C-3O°C, e.g. , about 18°C-25°C, or about 20°C-25°C, or about 20- 30°C, or about 23-27°C or about 25°C). In some embodiments, magnetic bead- or particle-based purification is performed under a suitable binding condition (e.g., in the presence of salt and organic solvent (e.g., ethanol)). In some embodiments, magnetic beads or particles (e.g., ones described herein) may be added to an RNA transcription mixture with a magnetic bead or particle -to-RNA ratio of approximately 1:1 to 1:5, or 1:1 to 1:3 under a suitable binding condition.
In some embodiments, after RNA binding to a solid substrate (e.g., coated magnetic beads or particles as described herein), the solid substrate can be separated from supernatant. For example, a magnet can be used to retain RNA-bound magnetic beads in a batch reaction vessel, while supernatant is subsequently removed. The RNA is then eluted from the magnetic beads under a suitable eluting condition (e.g., in the presence of a buffer and/or a chelating agent at a suitable pH). In some embodiments, such bind-and-elute process may be performed for a number of cycles (e.g. , at least two, at least three, at least four or more cycles).
In some embodiments, an in vitro transcription RNA composition is divided into aliquots. In some embodiments, such RNA aliquots are purified in parallel in batch mode with wash steps prior to the elution of purified RNA. In some embodiments one, two, three, four, five, or six wash steps are carried out. In some embodiments, different buffers are utilized in different wash steps. In some embodiments, the same solution is utilized in initial wash step or steps and a different solution is utilized in a final wash step. In some embodiments, RNA bound magnetic beads can be washed in multiple steps (e.g., three consecutive steps) with a first wash buffer comprising an organic solvent (e.g., ethanol) and a salt (e.g., sodium salt). In some embodiments, such a first wash buffer may comprise a 20-40% (v/v) ethanol/O.lM- 1M NaCl. In some embodiments, RNA bound magnetic beads can be further subjected to a final wash with an organic solvent (e.g., 80% ethanol).
In some embodiments, RNA that is bound on magnetic beads is subsequently eluted (e.g., after wash steps) by addition of an elution buffer. In some embodiments, an elution buffer comprises a chelating agent to complex and thus remove residual divalent ions (e.g., magnesium and/or calcium ions) that may be added during RNA synthesis process. In some embodiments, an elution buffer may comprise EDTA. While a skilled artisan will be able to select an appropriate buffer for elution, in some embodiments, an elution buffer may comprise HEPES buffer. In some embodiments, an elution buffer is a buffer selected for use in a pharmaceutical-grade composition comprising RNA.
In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by a chromatography method. In some embodiments, such a chromatography purification method may be performed with a chromatographic method known in the art (e.g. HPLC, SEC, IEC, etc.), wherein components of a mixture travel through a stationary phase at different speeds, resulting in separation from one another. It will be apparent to one skilled in the art that a variety of solid substrates (e.g., beads, particles, microspheres, resins, etc.) may be used, comprising, without limitation and/or in combination, silica, dextran polymers, agarose, polyacrylamide, etc. For example, in some embodiments, a solid substrate has properties such that, in accordance with the present disclosure, permits a different retention time for RNA relative to any other undesirable components present in an RNA transcription mixture, including, e.g., short hydrolyzed DNA fragments, free nucleotide triphosphates (NTPs), 5’ capping agent, proteins, divalent ions complexed with a chelating agent.
In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by high performance liquid chromatography (HPLC). In some embodiments, RNA is purified by HPLC using a column matrix of alkylated non- porous polystyrene -divinvylbenzene copolymer microspheres, e.g., in triethylammonium acetate (TEAA) buffers, e.g., as described in Kariko et al. “Generating the optimal mRNA for therapy: HPLC purification eliminates immune activation and improves translation of nucleoside-modified, protein-encoding mRNA” Nucleic Acids Res. 2011 ;39(21):el42. doi: 10.1093/nar/gkr695. In some embodiments, a TEAA buffer is supplemented with acetonitrile. In some embodiments, RNA content from desired fractions is concentrated and/or desalted (e.g., in some embodiments, using centrifugal filtration). In some embodiments, RNA is recovered by precipitation. In some embodiments, RNA is purified by HPLC using a diethylaminoethyl anion exchange column, e.g., as described in Anderson et al. “HPLC purification of RNA for crystallography and NMR” RNA. 1996;2(2): 110-117. In some embodiments, buffer comprising salt and sodium acetate is used for RNA elution. In some embodiments, RNA from RNA containing fractions is precipitated (e.g., by ethanol precipitation) and dried to a powder. In some embodiments, a dried powder comprising RNA is re-suspended, for example, in water.
In some embodiments, HPLC is not used to purify an in vitro transcription RNA composition. In some embodiments, precipitation is not used to purify an in vitro transcription RNA composition.
In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by size exclusion chromatography (SEC). In some embodiments, RNA is purified by using a gel filtration matrix, e.g., as described in Lukavsky and Puglisi. “Large-scale preparation and purification of polyacrylamide-free RNA oligonucleotides” RNA. 2004;10(5):889-893. doi:10.1261/rna.5264804. In some embodiments, fractions are collected and/or analyzed by denaturing polyacrylamide gel electrophoresis. In some embodiments, RNA-containing fractions are combined. In some embodiments, RNA-containing fractions are concentrated, for example, using centrifugal filtration. In some embodiments, filtered RNA is washed twice with buffer (e.g. , 10 mM sodium phosphate, pH 6.4). In some embodiments, RNA is concentrated a second time. In some embodiments, following a second RNA concentration process (e.g., centrifugal filtration), RNA is washed again (e.g., 1 additional wash, 2 additional washes, 3 additional washes, etc.) with buffer (e.g., 10 mM sodium phosphate, pH 6.4). In some embodiments, a final concentration step is conducted using centrifugal filtration.
In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by ion-exchange chromatography (IEC). In some embodiments, RNA is purified by applying a transcription reaction mixture to a pre-equilibrated column and eluted using a linear salt gradient (e.g., using sodium chloride), e.g., as described in Koubek et al. “Strong anion-exchange fast performance liquid chromatography as a versatile tool for preparation and purification of RNA produced by in vitro transcription” RNA. 2013; 19(10): 1449-1459. doi:10.1261/rna.038117.113) . In some embodiments, fractions are collected. In some embodiments, RNA is purified by directly applying a transcription reaction mixture to a Sepharose column (e.g. , a diethylaminoethanol (DEAE) Sepharose column).
In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by membrane filtration. Membrane filtration is a separation technique widely used in the life science separation/purification. Depending on membrane porosity, it can be classified as a microfiltration or ultrafiltration process. Microfiltration membranes, with pore sizes typically between 0.1 pm and 10 pm, are generally used for clarification, sterilization, and/or removal of microparticulates, while ultrafiltration membranes, with much smaller pore sizes between 0.001 and 0.1 pm, can be useful for removing, concentrating and/or desalting dissolved molecules (proteins, peptides, nucleic acids, carbohydrates, and other biomolecules), exchanging buffers, and gross fractionation. In some embodiments, ultrafiltration membranes are typically classified by molecular weight cutoff (MWCO) rather than pore size. A skilled artisan will understand that filtration membranes can be of different suitable materials, including, e.g., polymeric, cellulose, ceramic, etc., depending upon the application. In some embodiments, membrane filtration may be more desirable for large-volume purification process.
One of ordinary skill in the art will be aware of available membrane filtration modes, for example which can use either microfiltration or ultrafiltration membranes: (1) Direct Flow Filtration (DFF), also known as “dead-end” filtration, applies a feed stream perpendicular to the membrane face and attempts to pass 100% of the fluid through the membrane, and (2) Tangential Flow Filtration (TFF), also known as crossflow filtration, where a feed stream passes parallel to the membrane face as one portion passes through the membrane (permeate) while the remainder (retentate) is retained and/or recirculated back to the feed reservoir. In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA removal) can be purified by membrane filtration may be purified by a process comprising direct flow filtration.
In some embodiments, an in vitro transcription RNA composition (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be purified by a process comprising tangential flow filtration (TFF). In some embodiments, a filtration membrane with an appropriate molecular weight cut-off (MWCO) may be selected for TFF. The MWCO of a TFF membrane determines which solutes can pass through the membrane (i.e. into the filtrate) and which are retained (i.e. in the retentate). The MWCO of a TFF membrane used in accordance with the present disclosure is selected such that substantially all of the solutes of interest (e.g. , desired synthesized RNA species) remains in the retentate, whereas undesired components (e.g., excess ribonucleotides, small nucleic acid fragments such as digested or hydrolyzed DNA template, peptide fragments such as digested proteins and/or other impurities) pass into the filtrate. In some embodiments, the retentate comprising desired synthesized RNA species may be re-circulated to a feed reservoir to be re-filtered in additional cycles. In some embodiments, a TFF membrane may have a MWCO of at least 30 kDa (including, e.g., at least 40 kDa, at least 50 kDa, at least 60 kDa, at least 70 kDa, at least 80 kDa, at least 90 kDa, or more). In some embodiments, a TFF membrane may have a MWCO of at least 100 kDa (including, e.g., at least 150 kDa, at least 200 kDa, at least 250 kDa, at least 300 kDa, at least 350 kDa, at least 400 kDa, or more). In some embodiments, a TFF membrane may have a MWCO of about 250-350 kDa. In some embodiments, a TFF membrane (e.g., a cellulose-based membrane) may have a MWCO of about 30-300 kDa; in some embodiments about 50-300 kDa, about 100-300 kDa, or about 200-300 kDa.
While a skilled artisan may select an appropriate filtration material for a filtration membrane, in some embodiments, a filtration membrane that is particularly useful for TFF purification in accordance with the present disclosure is or comprises a cellulose -based membrane. In some embodiments, a filtration membrane is not a thermoplastic membrane (e.g., polysulfone or poly ether sulfone). In some embodiments, a filtration membrane is a filter cassette.
In some embodiments, TFF is performed at a transmembrane pressure that is less than, for example, 2 bar (including, e.g., less than 2 bar, less than 1.9 bar, less than 1.8 bar, less than 1.7 bar, less than 1.6 bar, less than 1.5 bar, less than 1.4 bar, less than 1.3 bar, less than 1.2 bar, less than 1.1 bar, less than 1.0 bar, less than 0.9 bar, less than 0.8 bar, less than 0.7 bar, less than 0.6 bar, or lower). In some embodiments, TFF is performed at a transmembrane pressure in a range of about 0.5 bar to 2 bar. In some embodiments, TFF is performed at a transmembrane pressure of about 1 bar. In some embodiments, TFF is performed with a feed flow rate of less than, for example, 400 liters/m2/hour (LMH) (including, e.g., less than 400 LMH, less than 350 LMH, less than 300 LMH, less than 250 LMH, less than 200 LMH, less than 150 LMH, less than 100 LMH, or less). In some embodiments, TFF is performed with a feed flow rate of about 75 LMH to about 500 LMH, or about 50 LMH to about 400 LMH.
In some embodiments, an in vitro transcription RNA composition following RNA transcription that is subject to TFF purification has not be treated with a protein denaturing agent such as, e.g. , urea, guanidinium chloride thiocyanate, salts of alkali metals (e.g., potassium chloride), sodium dodecyl sulfate, sarcosyl, and combinations thereof.
A purification buffer may be fed into a TFF process in addition to an RNA preparation comprising an RNA transcription mixture. The choice and composition of the purification buffer may influence the efficiency of RNA purification, levels of protein aggregation, RNA-protein separation, and/or RNA stability. Typical buffers may include Tris buffer and citrate buffers. In some embodiments, a purification buffer that may be particularly useful for TFF purification in accordance with the present disclosure may be or comprise HEPES buffer. In some embodiments, a purification buffer (e.g., HEPES buffer) may further comprise a chelating agent (e.g., as described herein) and/or a salt(s) (e.g., ammonium acetate, ammonium sulfate, potassium acetate, potassium chloride, potassium sulfate, sodium acetate, sodium chloride, and/or sodium sulfate). In some embodiments, TFF purification may be performed without a buffer change. For example, in some embodiments, TFF purification is performed in a buffer that has been utilized for in vitro transcription; in some such embodiments, TFF purification may be performed in a HEPES buffer.
In some embodiments, a TFF purification process may comprise at least two separate steps of tangential flow filtration. For example, in some embodiments, a first step of tangential flow filtration and a second step of tangential flow filtration may utilize different buffers. In some embodiments, a first buffer used in a first step of tangential flow filtration may comprise salt(s) (e.g., ammonium acetate, ammonium sulfate, potassium acetate, potassium chloride, potassium sulfate, sodium acetate, sodium chloride, and/or sodium sulfate), while a second buffer used in a second step of tangential flow filtration may not comprise the same salt(s) as used in the first step (e.g., ammonium acetate, ammonium sulfate, potassium acetate, potassium chloride, potassium sulfate, sodium acetate, sodium chloride, and/or sodium sulfate). In some embodiments, a second buffer used in a second step of tangential flow filtration may not comprise a salt.
In some embodiments, a first step of tangential flow filtration (e.g., for diafiltration) may be performed with a defined number of volume exchanges (e.g., at least one, at least two, at least three, at least four at least five, at least six, at least seven, or more volume exchanges). In some embodiments, a second step of tangential flow filtration (e.g., for diafiltration) may be performed with a defined number of volume exchanges (e.g., at least one, at least two, at least three, at least four at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least or more volume exchanges). In some embodiments, a first step of tangential flow filtration may be performed with a minimum of 5 volume exchanges and a second step of tangential flow filtration may be performed with a minimum of 10 volume exchanges.
In some embodiments, an in vitro transcription RNA composition described herein (e.g., in some embodiments after DNA and/or protein removal and/or digestion) can be subjected to a suitable purification method known to one of ordinary skill in the art. In some embodiments, an in vitro transcription RNA composition described herein can be subjected to precipitation followed by membrane filtration (e.g., as described in WO2015164773). In some embodiments, an in vitro transcription RNA composition described herein can be subjected to one or more steps of TFF, wherein at least one or more steps of TFF comprises use of a TFF membrane cassette (e.g., as described in WO2016193206). In some embodiments, an in vitro transcription RNA composition described herein can be subjected to a high salt condition chromatography (e.g., by hydrophobic interaction chromatography). In some embodiments, an in vitro transcription RNA composition described herein can be a crude RNA reaction IVT mixture or high performance liquid chromatography purified RNA which is subsequently subjected to a high salt condition chromatography (e.g., as described in WO2018096179). In some embodiments, an in vitro transcription RNA composition described herein can be subjected to filtering centrifugation. In some embodiments, an RNA is precipitated prior to centrifugation (e.g., as described in WO2018157141). In some embodiments, an in vitro transcription RNA composition described herein can be subjected to a stirred cell or agitated Nutsche filtration device. In some embodiments, a high concentration of salt is added to a RNA composition to denature and solubilize contaminating proteins prior to subjection to a stirred cell or agitated Nutsche filtration device (e.g., as described in WO2018157133). In some embodiments, an in vitro transcription RNA composition described herein can be subjected to standard flow filtration (e.g., a filtration process in which the material to be purified flows in a direction normal, i.e. perpendicular, to the surface of the filter). In some embodiments, RNA is precipitated prior to standard flow filtration (e.g., as described in W02020041793). In some embodiments, an in vitro transcription RNA composition described herein can be subjected to precipitation in a buffer comprising high concentration of salts (e.g., guanidinium salts) and a detergent (e.g., as described in W02020097509).
In some embodiments, an in vitro transcription RNA composition described herein (e.g., in some embodiments after DNA removal and/or digestion) can be subjected to a protein digestion or fragmentation process prior to one or more additional purification methods known in the art (including, e.g., precipitation, affinity-based purification, ion exchange chromatography methods, high performance liquid chromatography, hydrophobic interaction chromatography, size exclusion-based methods such as size exclusion chromatography, filtration methods such as, e.g., centrifugal ultrafiltration and/or membrane filtration (e.g., direct flow filtration or tangential flow filtration), etc., or combinations thereof). For example, in some embodiments, an exemplary protein digestion or fragmentation may comprise use of a proteinase (e.g., but not limited to proteinase K).
In some embodiments, an in vitro transcription RNA composition described herein (e.g., in some embodiments after DNA removal and/or digestion and/or removal of impurities) can be subjected to a method of removing or reducing bioburden (e.g., microbial contamination). In some embodiments, an exemplary method for bioburden removal or reduction may be or comprise filtration. In some embodiments, filtration may be or comprise gravity filtration. In some embodiments, gravity filtration may be performed using a filter with pore size that is small enough to capture bioburden (e.g., a filter with 0.45 pm pore size or smaller, a filter with 0.2 pm pore size or smaller). In some embodiments, filtration may be performed using a 0.45 pm pore filter. In some embodiments, filtration may be performed using a 0.2 pm pore filter. In some embodiments, filtration may be performed first using a 0.45 pm pore filter and subsequently using a 0.2 pm pore filter. In some embodiments, filtration may be performed first using a 0.2 pm pore filter and subsequently using a 0.45 pm pore filter.
In some embodiments, an in vitro transcription RNA composition described herein (e.g., in some embodiments after DNA removal and/or digestion) can be subjected to at least one or more of purification methods described herein, including, e.g., bind-and elute process (e.g., utilizing solid substrate with high RNA affinity such as magnetic bead-based purification, membrane filtration (e.g., tangential flow filtration), and/or filtration (e.g., gravity filtration). In some embodiments, an in vitro transcription RNA composition described herein may be purified by magnetic -bead-based purification (e.g., as described herein) followed by bioburden filtration (e.g., as described herein), to produce an RNA transcript preparation. In some embodiments, an in vitro transcription RNA composition described herein may be purified by a TFF process that may comprise one or a plurality of (e.g., at least two) TFF steps (e.g., as described herein) followed by bioburden filtration (e.g., as described herein), to produce an in vitro transcription RNA composition.
In some embodiments, purification methods described herein (including, e.g., magnetic bead-based purification and/or tangential flow filtration process) can be sufficient to remove or reduce residual host cell proteins by a factor of at least 100, 200, 250, 300, 350, 400, 450, 500, 550, or 600. By way of example only, when a starting RNA in vitro transcription mixture contains an amount of host cell proteins of approximately 400 ng/mg RNA, subsequent purification of the RNA by a reduction factor of 400 decreases this amount theoretically to 1 ng/mg RNA. Residual host cell proteins (e.g., residual bacterial host cell proteins such as E. coli proteins) may be present in an in vitro transcription RNA composition as impurity from a DNA template or as a recombinant protein expressed in host cells. In some embodiments, recombinant proteins may include recombinant enzymes added during in vitro transcription, including, e.g., RNA polymerase, pyrophosphatase, DNases, and/or RNase inhibitors.
In some embodiments, an in vitro transcription RNA composition described herein (e.g., in some embodiments after DNA removal and/or digestion) after one or more purification methods described herein can be maintained at 2-8 °C for a period of time before further purification/processing. In some embodiments, the maintained period of time may be at least 6 hours or longer, including, e.g., at least 12 hours, at least 18 hours, at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or longer.
In some embodiments, in process-controls and/or monitoring of each purification method described herein can be conducted. For example, RNA concentration and/or integrity of an in vitro transcription RNA composition may be monitored during or after each purification method described herein. In some embodiments, RNA concentration and/or integrity of an in vitro transcription RNA composition may be assessed before or after maintaining at 2-8°C for a period of time (e.g., as described herein). In some embodiments where magnetic beads are used, impurities such as Fe2+ can be derived from magnetic beads. In some such embodiments, residual Fe2+ ions in an in vitro transcription RNA composition can be analyzed. In some embodiments, filter integrity after gravity filtration may be assessed. Filter integrity may be assessed, for example, for extractables and/or leachables. In some embodiments, weight of RNA produced after purification may be assessed. In some embodiments, an RNA transcript preparation {e.g., as described herein) may comprise RNA at a concentration of at least 1 mg/mL (including, e.g.. at least 1.5 mg/mL, at least 2 mg/mL, at least 2.5 mg/mL, at least 3 mg/mL, at least 3.5 mg/mL, at least 4 mg/mL, at least 4.5 mg/mL, at least 5 mg/mL, at least 6 mg/mL, or higher). In some embodiments, an RNA transcript preparation may comprise RNA at a concentration of 1.5 mg/mL to 5 mg/mL or 2 mg/mL to 4 mg/mL.
In some embodiments, an RNA transcript preparation {e.g., as described herein) may comprise an aqueous buffer. An exemplary aqueous buffer may comprise HEPES {e.g., at a concentration of 5 mM- 15 mM) at an RNA-compatible pH {e.g., pH 7.0). In some embodiments, an RNA transcript preparation may comprise a chelating agent, e.g., EDTA.
In some embodiments, an RNA transcript preparation {e.g., as described herein) may be characterized to determine one or more {e.g., at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or more) product quality attributes of RNA drug substance. Examples of such product quality attributes include, but are not limited to appearance, RNA length, identity of drug substance as RNA, RNA integrity, RNA sequence, RNA concentration, pH, osmolality, residual DNA template, residual double stranded RNA, bacterial endotoxins, bioburden, degree of capping, presence and composition of poly(A)-tail, nucleotide composition, secondary and tertiary structure, residual salt contaminants, protein contamination, residual solvent contamination, residual bacterial DNA contamination, and combinations thereof. A skilled artisan will understand that various methods known in the art can be used to characterize such product quality attributes, certain examples of which are described below with exemplary release and/or acceptance criteria.
In some embodiments, an RNA transcript preparation {e.g., as described herein) that has been determined to meet a set of pre-determined acceptance criteria can be maintained for further steps of manufacturing, and/or formulation and/or distribution. In some embodiments, a qualified RNA transcript preparation can be dispensed in a bioprocessing bag {e.g., with a bag chamber volume of at least 5 L, including, e.g., at least 6 L, at least 7 L, at least 8 L, at least 9 L, at least 10 L, at least 15 L, at least 20 L, at least 25 L, or more). In some embodiments, a RNA preparation can be dispensed in a bioprocessing processing polymer bag, e.g., comprising ethylene vinyl acetate copolymer, polyethylene copolymer.
In some embodiments, predetermined specifications are not met {e.g., post-integrity filter testing, integrity of holding vessel post-sterile filtration) and refiltration may be utilized. In some embodiments, wherein predetermined specifications are not met, a RNA preparation may be refiltered {e.g., through a filter). In some embodiments, refiltration is performed in the same manner as the initial final filtration. In some embodiments, re filtration is performed in a different manner than the initial final filtration. In some embodiments, each RNA transcript preparation can be manufactured, filled, and stored as an independent batch, e.g. RNA from one production run forms one batch of composition comprising RNA. In some embodiments, each batch can be identified by a unique batch number. In some embodiments, an RNA transcript preparation can be transported from its manufacturing facility for further characterization and/or processing. In some embodiments, RNA preparation(s) are transported from its manufacturing facility in a container, for example, a bag, tube, vial, etc. In some embodiments, a RNA preparation may be transported in a bioprocessing polymer bag, e.g., comprising ethylene vinyl acetate copolymer. In some embodiments, a RNA preparation is held in a container with a volume of at least 4 L, at least 5 L, at least 10 L, at least 15 L, or larger. In some embodiments, a RNA preparation may be transported at a refrigerated or frozen temperature, e.g., at least less than or equal to 15°C, 10°C, 5°C, 0°C, -5°C, -10°C, - 15°C, -20°C or less for a period of time (e.g., up to 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 hours or more). In some embodiments, a freezing process may utilize controlled freeze equipment and/or temperature controlled freezers. In some embodiments, monitoring one or more of the parameters described herein may improve product output and/or provide increased reproducibility of composition comprising RNA between batches.
In some embodiments, different batch scales can be used. In some embodiments, an exemplary process to produce an RNA transcript preparation involves a three step process comprising cell-free in vitro transcription from a DNA template, purification of in vitro transcription product, and concentration adjustment and filtration as outlined in Figure 4.
(Ill) Characterization
In some embodiments, RNA quality control may be performed and/or monitored at any time during production process of RNAs and/or compositions comprising the same. For example, in some embodiments, RNA quality control parameters, including one or more of RNA identity (e.g., sequence, length, and/or RNA natures), RNA integrity, RNA concentration, residual DNA template, and residual dsRNA, may be assessed and/or monitored after each or certain steps of an RNA manufacturing process, e.g., after in vitro transcription, and/or each purification step.
In some embodiments, the stability of RNAs (e.g., produced by in vitro transcription) and/or compositions comprising RNAs can be assessed under various test storage conditions, for example, at room temperatures vs. refrigerated or sub-zero temperatures over a period of time (e.g., at least 3 months, at least 6 months, at least 9 months, at least 12 months, or longer). In some embodiments, RNAs (e.g., ones described herein) and/or compositions thereof may be stored stable at a fridge temperature (e.g. , about 2°C to about 8°C, or in some embodiments about 2 °C to about 10°C, or about 4°C to about 10°C or about 2°C to about 8°C) for at least 1 month or longer including, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months or longer. In some embodiments, RNAs (e.g., ones described herein) and/or compositions thereof may be stored stable at a sub-zero temperature (e.g., - 15°C or below) for at least 1 month or longer including, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months or longer. In some embodiments, RNAs (e.g., ones described herein) and/or compositions thereof may be stored stable at room temperature (about 18°C- 30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C) for at least 1 month or longer.
In some embodiments, one or more assessments as described in Example 4 may be utilized during manufacture, or other preparation or use of RNAs (e.g., as a release test).
In some embodiments, one or more quality control parameters may be assessed to determine whether linear DNA templates described herein meet or exceed acceptance criteria (e.g., for subsequent IVT). In some embodiments, such quality control parameters may include, but are not limited to, DNA concentration, DNA identity, identity of transcribed region, identity of PolyA tail, plasmid topology, residual host cell RNA, residual host cell DNA, residual selection drug, appearance, coloration, pH, polyA tail integrity, linearization efficiency, residual protein, bioburden, and/or endotoxins. Certain methods for assessing linear DNA template quality are known in the art; for example, one of skill in the art will recognize that in some embodiments, one or more analytical tests can be used for DNA quality assessment. Examples of such analytical tests may include, but are not limited to, gel electrophoresis, sequencing, and/or UV absorption.
In some embodiments, one or more quality control parameters may be assessed to determine whether RNAs described herein meet or exceed acceptance criteria (e.g., for subsequent formulation and/or release for distribution). In some embodiments, such quality control parameters may include, but are not limited to RNA integrity, RNA concentration, residual DNA template and/or residual dsRNA. Certain methods for assessing RNA quality are known in the art; for example, one of skill in the art will recognize that in some embodiments, one or more analytical tests can be used for RNA quality assessment. Examples of such certain analytical tests may include but are not limited to gel electrophoresis, UV absorption, and/or PCR assay.
In some embodiments, a batch of RNAs may be assessed for one or more features as described herein to determine next action step(s). For example, a batch of RNAs can be designated for one or more further steps of manufacturing and/or formulation and/or distribution if RNA quality assessment indicates that such a batch of RNAs meet or exceed the relevant acceptance criteria. Otherwise, an alternative action can be taken (e.g., discarding the batch) if such a batch of single stranded RNAs does not meet or exceed the acceptance criteria.
In some embodiments, a batch of RNAs that satisfy assessment results can be utilized for one or more further steps of manufacturing and/or formulation and/or distribution.
In some embodiments, manufacturing methods described herein may further comprise monitoring one or more features of a RNA preparation including, e.g., appearance, identity (RNA length), identity (as RNA), RNA integrity, RNA sequence, content (RNA concentration), pH, osmolality, residual DNA template, residual double-stranded RNA (dsRNA), bacterial endotoxins, bioburden, degree of capping, presence and composition of poly(A)-tail, nucleotide composition, secondary and tertiary structure, residual salt contamination, protein contamination, bacterial DNA contamination and/or residual solvent contamination. In some embodiments, at least one or more features (e.g. at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve at least thirteen, at least fourteen, at least fifteen, at least sixteen, at least seventeen, at least eighteen) described herein can be characterized and/or monitored for quality control.
In some embodiments, appearance of RNA substance is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, visual inspection is utilized to monitor appearance. In some embodiments, an RNA substance is clear (< 6 NTU, < 5 NTU, < 4 NTU, or < 3 NTU). In some embodiments, an RNA substance is a colorless liquid. In some embodiments, an RNA substance is a clear (< 6 NTU) and colorless liquid.
In some embodiments, conformance of RNA length (and thus indirectly molar mass) with the theoretical values is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, RNA length is determined by denaturing agarose gel electrophoresis in comparison to a standard ladder with RNAs of known lengths. In some embodiments, sizes obtained must be consistent with theoretically expected lengths, e.g., transcripts from the respective DNA template used, and with reference RNAs. In some embodiments, the electrophoresis gel is a precast and buffered agarose gel prestained with a nucleic-acid specific dye.
In some embodiments, RNA identity is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, RNA identity is determined by incubating an RNA sample for a defined period of time with an RNase, separating by gel-electrophoresis, and comparing to an RNA sample that has been incubated under identical conditions except for the addition of RNase. In some embodiments, disappearance of the RNA band upon incubation with RNase verifies the identity as RNA. In some embodiments, gel-electrophoresis is completed on a precast and pre-stained agarose gel. In some embodiments, the RNase is RNase A. In some embodiments, RNA identity is determined by reverse transcribing (RT) said RNA into cDNA and amplifying said cDNA (e.g., by PCR) using primers and/or a probe specific to the cDNA sequence. In some embodiments, RT-PCR is conducted in a single-step.
In some embodiments, RNA integrity is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, RNA integrity can be assessed and/or monitored by agarose gel electrophoresis. In some embodiments, RNA integrity can be assessed and/or monitored by capillary gel electrophoresis. In some embodiments, RNA integrity can be quantitatively determined using capillary electrophoresis. In some embodiments, RNA solution must give rise to a single peak at the expected retention time consistent with the expected lengths as compared to the retention times of a standard ladder. In some embodiments, RNA integrity is above 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, quantification of the main RNA peak is calculated in relation to signal intensities in the electropherogram where degradation products are detectable.
In some embodiments, the sequence of RNA is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, the RNA sequence can be deduced from sequencing the DNA template which serves as a template for in vitro transcription and defines the primary structure of each RNA. In some embodiments, identity of the starting material, and thus the identity of the transcribed RNA, is controlled by automated sequencing of the RNA encoding region of the template. In some embodiments, RNA sequence is determined by reverse transcribing said RNA into cDNA, amplifying (e.g., by PCR), and sequencing the amplified product. In some embodiments, RT-PCR is conducted in a single-step. In some embodiments, the sequencing method is Sanger sequencing. In some embodiments, the sequencing method is next generation sequencing. In some embodiments, the sequence of an RNA has 100% identity to the corresponding DNA from which it was generated. In some embodiments, RNA sequence is determined by RNA sequencing using Next Generation Sequencing technology (e.g., Illumina MiSeq).
In some embodiments, the sequence of RNA can be determined by liquid chromatography tandem mass spectrometry (LC/MS/MS)-oligonucleotide mapping. For example, in some embodiments, an RNA preparation is fragmented (e.g., by RNase) and separated (e.g., by liquid chromatography). In some embodiments, major and minor peaks in the oligonucleotide map can be identified, for example, by MS/MS. Observed masses and MS/MS fragmentation patterns of oligonucleotides in each peak can be mapped to expected RNA fragments. In some embodiments, due to the possibility of sequence isomers after fragmentation, oligonucleotide maps can be assigned via software using decoy sequences to confirm correct peak assignments. In some embodiments, protein size after expression of a RNA preparation or RNA preparation(s) are evaluated using Western blot. In some embodiments, expressed protein size is compared to that of a known protein standard.
In some embodiments, RNA concentration is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, RNA concentration is determined using UV absorption spectrophotometry. In some embodiments, RNA concentration is determined according to the method described within Ph. Eur. 2.2.25. In some embodiments, a desirable RNA concentration can vary with the batch scale. For example, a high RNA concentration may be desirable for a large-scale manufacturing process. Accordingly, in some embodiments, an RNA concentration may be at least 1 mg/mL (including, e.g., at least 1.5 mg/mL, at least 2 mg/mL, at least 2.5 mg/mL, at least 3 mg/mL, at least 3.5 mg/mL, at least 4 mg/mL, at least 4.5 mg/mL, at least 5 mg/mL, at least 6 mg/mL, or higher). In some embodiments, an RNA concentration may be 1.5 mg/mL to 5 mg/mL or 2 mg/mL to 4 mg/mL.
In some embodiments, pH value of the RNA solution is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, the pH value is determined according to the method described within Ph. Eur. 2.2.3. In some embodiments, pH value of the RNA solution is 6-8.
In some embodiments, osmolality of an RNA solution is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, osmolality of an RNA solution is determined according to the method described within Ph. Eur. 2.2.35. In some embodiments, osmolality of an RNA solution is less than 500 mOsmol/kg, 400 mOsmol/kg, 300 mOsmol/kg, 200 mOsmol/kg, 100 mOsmol/kg, or lower. In some embodiments, osmolality of an RNA solution may be less than 200 mOsmol/kg.
In some embodiments, residual DNA template is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, residual DNA template content is assessed and/or monitored (e.g., determined at one or more points over time) using, for example, PCR, absorbance, fluorescent dyes, and/or or gel electrophoresis. In some embodiments, residual DNA template content is determined using a real-time quantitative PCR (qPCR) test method. In some embodiments, qPCR is completed using a pre -mixed Sybr Green master mix according to the manufacturer’s recommendations. In some embodiments, the amplification and detection of DNA is performed in a real-time thermocycler. In some embodiments, residual DNA template in a sample is quantified in comparison to a standard or reference. In some embodiments, a standard is a serial dilution of pDNA. In some embodiments, results are reported in ng DNA/mg RNA. In some embodiments, the qPCR method comprises one or more of using a pre-mixed Sybr Green master mix according to the manufacturer’s recommendations, amplifying and detecting DNA in a real-time thermocycler, and quantifying residual DNA template in comparison to a standard (serial dilution of plasmid DNA).
In some embodiments, residual dsRNA can be assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, residual dsRNA level is determined using a test limit. For example, RNA samples and a dsRNA reference (2000 pg dsRNA/pg RNA, 1500 pg dsRNA/pg RNA, 1000 pg dsRNA/pg RNA, 500 pg dsRNA/pg RNA, or lower) representing the upper limit of accepted residual dsRNA content) are immobilized on a positively charged nylon membrane and incubated with a dsRNA-specific monoclonal antibody. After incubation with horseradish peroxidase (HRP) -conjugated secondary, enhanced chemiluminescence (ECL) substrate is added to the membrane and chemiluminescence is detected by a bioimager system. Signal intensities are quantified by densitometry and values of the RNA samples are compared to the signal intensity of the dsRNA reference. Results are reported as complies with the specified upper limit. In some embodiments, the dsRNA-specific monoclonal antibody is mouse IgG clone J2. In some embodiments, HRP-conjugated secondary is an anti-mouse IgG secondary.
In some embodiments, bacterial endotoxins are assessed and/or monitored (e.g., determined at one or more points over time), for example, using an analytical kinetic turbidimetric limulus amebocyte lysate (LAL) procedure. In some embodiments, Gram-negative bacterial endotoxins are assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, Gram-negative bacterial endotoxins are determined to have an acceptable level if the acceptance criteria in regional pharmacopoeia (e.g., Ph. Eur. 2.6.14, USP <85>, JP 4.01) are met when the level of Gram-negative bacterial endotoxins is determined according to the method described therein. In some embodiments, RNA solutions have < 12.5 EU/mL (including, e.g., < 10 EU/mL, < 7.5 EU/mL, or < 5.0 EU/mL) of bacterial endotoxins.
In some embodiments, bioburden is assessed and/or monitored (e.g., determined at one or more points over time) using a membrane filtration method. In some embodiments, bioburden is determined to have an acceptable level if the acceptance criteria in regional pharmacopoeia (e.g., Ph. Eur. 2.6.12, USP <61>, JP 4.05) are met when the bioburden is determined according to the method described therein. In some embodiments, bioburden of an RNA solution is < 1 CFU per 10 mL. In some embodiments, bioburden of an RNA solution is < 100 CFU per 10 mL when assessed prior to, or during, the process of removing impurities.
In some embodiments, capping of in vitro transcribed RNA is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, capping of in vitro transcribed RNA can be verified, for example by assessing translation (which typically requires presence of a functional cap). In some embodiments, a biological activity test, for example that may be performed during process characterization of animal trial materials, is confirmatory that the RNA is translated into a protein of correct size. Alternatively or additionally, in some embodiments, nonclinical studies are performed to demonstrate capping of various different mRNA batches.
In some embodiments, percentage of capped RNA can be assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, characterization of percentage of capped RNA is conducted by an RNase based assay. In some embodiments, characterization of percentage of capped RNA comprises one or more of the following steps: annealing RNA samples to a probe or probes binding close to the 5’ end of the RNA, digesting the RNA-probe complex with RNase generating a short fragment corresponding to the 5’ part of the RNA, purifying for sample clean-up, subjecting the purified samples with the 5’ part of the RNA to mass spectrometry (MS), capped and non-capped species are identified, and/or the percentage of capped RNA is calculated. In some embodiments, percentage of capped RNA is characterized by an RNase H based assay. In some embodiments, characterization of percentage of capped RNA comprises one or more of the following steps: annealing RNA samples to customized biotinylated nucleic acid probe binding close to the 5’ end of the RNA, digesting the RNA- probe complex with RNase H generating a short fragment corresponding to the 5’ part of the RNA, purifying the sample for sample clean-up with streptavidin-coated spin columns or magnetic beads, subjecting the purified samples with the 5’ part of the RNA to LC-MS, identifying capped and noncapped species by the observed mass values, and calculating the percentage of capped RNA using MS signals. In some embodiments, an RNase is RNase H. In some embodiments, a probe is a customizable biotinylated nucleic acid probe. In some embodiments, a purification step comprises use of streptavidin coated spin columns. In some embodiments, purification comprises use of magnetic beads. In some embodiments, the 5’ part of an RNA is subjected to LC-MS. In some embodiments, capped and/or noncapped species can be identified by the observed mass values. In some embodiments, MS signals are used to calculate percentage of capped RNA.
In some embodiments, percentage of capped RNA can be assessed and/or monitored by cleaving RNA molecules with a catalytic nucleic acid molecule into a 5’ terminal RNA fragment and at least one 3’ RNA fragment, wherein RNA molecules have a cleavage site for a catalytic nucleic acid molecule, separating RNA fragments, determining a measure for the amount of capped and non-capped 5’ terminal RNA fragments (e.g., by a spectroscopic method, quantitative mass spectrometry, or sequencing), and comparing the measures of capped and non-capped 5’ terminal RNA fragments determined (e.g., as described in EP3090060).
In some embodiments, percentage of capped RNA can be assessed and/or monitored by contacting a RNA preparation with a DNA oligonucleotide complementary to a sequence in the 5’ untranslated region of a RNA adjacent to the cap or the uncapped penultimate base of RNA under conditions that permit annealing of the DNA oligonucleotide to the sequence, providing one or more nucleases that selectively degrade DNA/RNA hybrid and/or unannealed RNA, resulting in capped and uncapped fragments, separating capped and uncapped fragments by chromatography, and determining relative amount of capped and uncapped fragments (e.g., as described in EP2971102).
In some embodiments, percentage of polyadenylation (Poly A) attached to the 3’ end of an RNA construct is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, measurement of percentage of polyadenylation attached to the 3’ end of the RNA construct uses PCR and comprises one or more of: generating cDNA using a reverse transcription and/or quantitating based on normalization to the theoretical input of the test sample. In some embodiments, measurement of the percentage of polyadenylation attached to the 3’ end of the RNA construct uses droplet digital PCR (ddPCR) and comprises one or more of the following steps: generating cDNA using a reverse transcription primer that spans the polyA and 3’ sequence of the RNA construct and requires both for binding, and/or quantitating based on normalization to the theoretical input of the test sample as measured by UV absorption at 260 nm. In some embodiments, polyadenylation is characterized by liquid chromatography-spectrometry (LC-MS). In some embodiments, LC-MS utilizes a particular detector (e.g., an ultraviolet detector). In some embodiments, prior to LC-MS, a polyA tail of a RNA is cleaved off (e.g., by a ribonucleases) and isolated, for example, by affinity purification.
In some embodiments, the higher order structure of an RNA preparation is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, higher order structure is evaluated using circular dichroism (CD) spectroscopy. A CD spectrum is a measure of differential absorption of the left- and right-circularly polarized light by the test article (e.g., RNA preparation). The ordered structure of RNA yields a CD spectrum that may contain positive and/or negative signals, while absence of CD signal is indicative of a lack of ordered structure. In some embodiments, a CD spectrum for a RNA preparation exhibits an expected profile for an RNA molecule (e.g., contains both negative and positive signals between approximately 200 and 300 nm), indicating quality of folding.
In some embodiments, residual salt contaminants are assessed and/or monitored. In some embodiments, high performance liquid chromatography is utilized to assess and/or monitor residual salt contaminants. In some embodiments, an RNA preparation comprises 5% or less, 4% or less, 3% or less, 2% or less, 1% or less, or is substantially free of salt contaminants.
In some embodiments, protein contamination is assessed and/or monitored. In some embodiments, protein content in an RNA preparation is determined using one or more of UV absorbance at 280 nm (due to presence of aromatic amino acids), a Lowry assay, a Bradford assay and/or a Bichinonic Acid assay. In some embodiments, an RNA preparation comprises less than a predetermined threshold of protein contamination.
In some embodiments, residual solvent contamination is assessed and/or monitored. In some embodiments, residual solvents are analyzed according to regional pharmacopeia (e.g., Ph. Eur. 2.2.28).
In some embodiments, bacterial DNA contamination is assessed and/or monitored. In some embodiments, residual bacterial DNA may be detected by PCR or quantitative PCR using primers and/or probes specific for bacterial genomic sequences.
LNP Manufacture
In some embodiments, the present disclosure, among other things, provides technologies for (large-scale) manufacturing a pharmaceutical-grade composition or preparation comprising LNPs, for example, at a mass batch throughput of at least 5 g (including, e.g., at least 10 g, at least 15 g, at least 20 g, at least 25 g, at least 30 g, at least 35 g, at least 40 g, at least 45 g, at least 50 g, at least 55 g, at least 60 g, at least 70 g, at least 80 g, at least 90 g, at least 100 g, or more). In some embodiments, methods described herein are particularly useful for a mass batch throughput of at least 30 g, at least 40 g, at least 50 g, at least 60 g, at least 70 g, at least 80 g, or more.
In some embodiments, technologies provided by the present disclosure achieve production of LNP preparations (e.g., pharmaceutical-grade LNP preparations, including large batch preparations), in particular including nucleic acids, e.g., RNA. In some embodiments, the present disclosure, among other things, includes technologies for manufacturing a pharmaceutical-grade LNP that include, for example, (i) generating a preparation (e.g. , a stable, dispersion preparation) comprising LNPs at a mass batch throughput of about 5 g to 100 g; and (ii) processing the preparation (which in some embodiments may include, e.g., but not limited to purification, concentration adjustment, formulation for storage, aseptic filling, labelling, storage, or combinations thereof).
In some embodiments, an LNP preparation (e.g., comprising an agent, such as a pharmaceutical agent, for delivery, and particularly comprising a nucleic acid agent such as an RNA agent) is manufactured by controlled mixing of a relevant agent (e.g., a nucleic acid agent, and particularly an RNA agent, often as an aqueous solution) and lipids (e.g. , as described herein) in a solvent environment conducive to formation of agent-encapsulating-LNPs (e.g., as described herein). In some embodiments, one or more in- process hold (e.g., storage) steps are conducted at 15-25°C unless otherwise specified.
Exemplary starting materials Lipid preparations (e.g.for or as the second liquid mentioned further above)
In some embodiments, lipid(s) to be included in lipid nanoparticles are selected based on at least one or more factors including, but not limited to, minimum encapsulation of RNA, apparent pKa, size, and/or polydispersity of resulting lipid nanoparticles. In some embodiments, lipids to be included in lipid nanoparticles comprise at least one helper lipid described herein, at least one cationic lipid described herein, and at least one PEG-conjugated lipid described herein. In some embodiments, lipids are selected to a lipid particle composition described herein.
In some embodiments, frozen lipids are thawed using a temperature-controlled thawing unit. In some embodiments, frozen lipids are thawed at controlled room temperature (e.g., about 18°C-30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C). In some embodiments, periodic monitoring is conducted throughout the duration of thawing. In some embodiments, a thawed lipid preparation is transferred to a manufacturing vessel. In some embodiments, one or more lipid components (e.g., cationic lipids, neutral lipids (e.g., DSPC, and/or cholesterol) and polymer-conjugated lipids) can be dissolved in ethanol (e.g., 100% ethanol) at a pre-determined molar ratio (e.g., ones described herein).
In some embodiments, lipids are combined (e.g., at relevant molar ratios) at a concentration above that at which they are combined with an agent to be encapsulated (e.g., a nucleic acid agent such as an RNA), and may be diluted prior to combination with such agent. In some embodiments, lipids are combined at an appropriate concentration for combination with a relevant agent without further dilution.
In some embodiments, a lipid solution (e.g., a stock or final concentration solution) can be prepared either by directly weighing lipid components in target proportions (e.g., as described herein) to a single container and dissolving in an appropriate solvent, or by volumetrically combining high concentration (e.g., 10-40 mg/mL) solutions of individual lipid components to achieve the same target proportions (e.g., as described herein) and final total lipid concentrations. In some embodiments, a lipid solution for combination with an RNA solution may comprise at least one helper lipid described herein, at least one cationic lipid described herein, and at least one PEG-conjugated lipid described herein. In some embodiments, a lipid solution for combination with an aqueous solution (e.g., of an agent such as a nucleic acid agent, e.g., an RNA) can have a total lipid concentration of at least 10 mg/mL (including, e.g., at least 15 mg/mL, at least 20 mg/mL, at least 25 mg/mL, at least 30 mg/mL, at least 35 mg/mL, at least 40 mg/mL, or higher). In some embodiments, a lipid solution for combination with an aqueous solution can have a total lipid concentration of about 10-50 mg/mL, or about 10-40 mg/mL, or about 15 to 35 mg/mL/. In some embodiments, a solvent is selected such that it can support dissolution of all lipid components in a selected combination and has a minimal toxicity risk for any residual solvent remaining after completion of manufacturing. For example, in some embodiments, such a solvent can be or comprise ethanol.
In some embodiments, a lipid solution is warmed, for example to improve or achieve lipid dissolution. In some embodiments, a lipid solution may be warmed for a period of time, for example within a range of minutes to hours; in some embodiments, such period may be within a range of 10 mins to 6 hours, 30 mins to 4 hours, or 1 to 3 hours. In some embodiments, a lipid solution may be warmed for 10 minutes to 2 hours, 1 to 3 hours, 2 to 4 hours, or 3 to 5 hours.
In some embodiments, a lipid solution is warmed to and/or maintained at a temperature above approximately 25°C; in some embodiments, a lipid solution can be warmed to and/or maintained at a temperature of about 26°C, 27°C, 28°C, 29°C, 30°C, 31 °C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C. In some embodiments, a lipid solution can be warmed to and/or maintained at a temperature of about 30-40°C, or about 33-37°C.
In some embodiments, a lipid solution is subsequently allowed to cool, e.g.. to a reduced temperature, e.g., at or near room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
In some embodiments, a lipid solution is purified (e.g., before, during, and/or after warming and/or cooling) by methods known in the art. In some embodiments, a prepared lipid solution can be purified by gravity filtration (e.g. , filtration by passage through a filter with a pore size within a range of about 0.1 to 0.3 |im). In some embodiments, a prepared lipid solution can be filtered by passage through a filter with a pore size of about 0.2 pm or smaller.
In some embodiments, a lipid solution (e.g., before and/or after purification) is stored and/or maintained at an appropriate temperature for a period time. In some embodiments, a lipid solution is stored and/or maintained at a temperature of about -25°C to about 40°C or about -10°C to about 40°C or about 0°C to about 30°C, or about 10°C to about 25°C, or about 20°C to about 25°C. In some embodiments, a lipid solution is stored and/or maintained at room temperature (e.g., about 18°C-30°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C). In some embodiments, a monitor (e.g., a sensor) may be utilized to maintain lipid temperature within a particular range (e.g., as described herein); in some such embodiments, a monitor may communicate automatically with a temperature controller, for example so that appropriate warming or cooling may be provided upon detection of a temperature that falls outside of the particular range. In some embodiments, a lipid solution (e.g., before and/or after purification) is stored and/or maintained at a selected temperature (e.g. , as described herein) for a period of hours, days or weeks. In some embodiments, such period of time may be at least 1 hour, at least 3 hours, at least 6 hours, at least 12 hours, at least 24 hours, at least 48 hours, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, at least 3 weeks or longer. In some embodiments, such period of time may be within a range of 1 hours to 48 hours or 12 hours to 24 hours. In some embodiments, a lipid solution (e.g. , before and/or after purification) is stored at room temperature (e.g. , about 18°C-3O°C, e.g. , about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C) for up to 24 hours.
In some embodiments, a lipid solution prepared for combination with an RNA transcript as described herein is referred to as a lipid stock solution.
Nucleic acid preparations (e.g. for or as the first liquid mentioned further above)
In many embodiments, technologies provided herein are particularly useful for preparation and/or use of LNP preparations that encapsulate nucleic acids, though those skilled in the art will appreciate that various teachings are not limited thereto.
In some embodiments, a preparation of a therapeutic nucleic acid (e.g., of an RNA such as an RNA transcript preparation or a dilution thereof) is combined with a lipid preparation described herein (e.g., a lipid stock solution) to provide a nucleic acid-LNP preparation. In some embodiments, LNP manufacture begins with a frozen nucleic acid preparation. In some embodiments, such a frozen preparation is thawed, for example using a temperature-controlled thawing unit. In some embodiments, a frozen preparation is thawed at controlled room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C- 25°C, or about 20-30°C, or about 23-27°C or about 25°C). In some embodiments, periodic monitoring is conducted throughout the duration of thawing. In some embodiments, a thawed preparation is transferred to a manufacturing vessel.
In some embodiments, a nucleic acid preparation may comprise nucleic acid (e.g., RNA) in an aqueous buffer at an appropriate pH (e.g., pH 2 to pH 8, or pH 4 to pH 7). Examples of such aqueous buffer may include, but are not limited to Tris buffers, phosphate buffers (e.g., PBS), HEPES, citrate buffers, acetate buffers, etc., or combinations thereof.
In some embodiments, a nucleic acid preparation for combination with a lipid preparation can be prepared by weighing a desired amount of nucleic acid (e.g. , by volume or weight if liquid or weight if solid or powder). In some embodiments, relevant nucleic acid can be dissolved or diluted in an appropriate aqueous buffer (e.g. , as described herein). In some embodiments, an aqueous buffer can be or comprise an acidic buffer, e.g., a buffer below pH 7 (e.g., pH 2-pH 6), such as, e.g., in some embodiments, a buffer at pH 4. In some embodiments, an aqueous buffer can be or comprise an acidic buffer at a concentration of 10-100 mM, or 25-75 mM, or 30-60 mM, or 40-60 mM. In some embodiments, an aqueous buffer can be or comprise an acidic buffer at a concentration of 40-60 mM. In some embodiments, an acidic buffer can be or comprise a citrate buffer at pH 4.
In some embodiments, a nucleic acidpreparation for combination with a lipid preparation is prepared by diluting with an aqueous buffer described above at an appropriate pH (e.g. , pH 2 to pH 8, or pH 4 to pH 7). In particular embodiments, such an aqueous buffer is or comprise a citrate buffer at pH 4. In some embodiments, such an aqueous buffer is or comprises a citrate buffer at a concentration of 10-100 mM, or 25-75 mM, or 30-60 mM, or 40-60 mM, or 30-50 mM; in particular embodiments, such an aqueous buffer is or comprises a citrate buffer at a concentration of 30-60 mM or 30-50 mM. In some embodiments, mixing speed is controlled during dilution of RNA preparation. In some embodiments, mixing speed is, for example, at least 10 rpm, 25 rpm, 50 rpm, 75 rpm, 100 rpm, 125 rpm, 150 rpm, 175 rpm, 200 rpm, 250 rpm, 300 rpm, 350 rpm, 400 rpm, 450 rpm, 500 rpm or more. In some embodiments, RNA is diluted to a particular concentration prior to mixing (e.g., 0.1 mg/mL-1 mg/mL).
In some embodiments, preparation of a nucleic acid preparation for combination with a lipid preparation (including, e.g. , nucleic acid weighing and/or dilution described herein) can be performed at about 2- 25°C. In some embodiments, preparation of a nucleic acid preparation for combination with a lipid preparation (including, e.g. , nucleic acid weighing and/or dilution described herein) can be performed at room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C). In some embodiments, preparation of a nucleic acid preparation for combination with a lipid preparation (including, e.g., nucleic acid weighing and/or dilution described herein) can be performed at a temperature that is below room temperature, including, e.g. , at a temperature of about 2- 8 °C.
In some embodiments, a nucleic acid preparation has been stored prior to combination with a lipid preparation. In some embodiments, a nucleic acid preparation has been stored and/or maintained as a frozen preparation. In some embodiments, a nucleic acid preparation has been stored and/or maintained as a liquid preparation. For example, in some embodiments, a nucleic acid preparation has been stored and/or maintained at an appropriate temperature for a period time. In some embodiments, a nucleic acid preparation has been stored and/or maintained at zero or subzero temperatures (e.g., a temperature of about -80°C to 0 °C, or about -80°C to -60°C, or about -80°C to -25°C). In some embodiments, a nucleic acid preparation has been stored and/or maintained at a fridge temperature (e.g., above 0°C, or about 2- 10°C, about 2-8°C or about 4-6°C). In some embodiments, a nucleic acid preparation has been stored and/or maintained at a temperature of about 10 °C to 25°C. In some embodiments, an a nucleic acid preparation has been stored and/or maintained at room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C). In some embodiments, a monitor (e.g., a sensor) may be utilized to maintain temperature within a particular range (e.g., as described herein); in some such embodiments, a monitor may communicate automatically with a temperature controller, for example so that appropriate cooling may be provided upon detection of a temperature that falls outside of the particular range.
In some embodiments, a nucleic acid has been stored and/or maintained at a selected temperature (e.g., as described herein) for a period of time, which may vary from hours to days to weeks to months, depending on the selected temperature. A skilled artisan will understand that a frozen nucleic acid preparation may be stored and/or maintained (e.g., at zero or subzero temperatures) for days to weeks to months or longer, while a liquid nucleic acid preparation may be stored and/or maintained (e.g., at 4°C or above, including room temperature) for a shorter period of time. In some embodiments, a frozen nucleic acid preparation may be stored (e.g., at zero or subzero temperatures) for at least 2 weeks, including, e.g., at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or longer. In some embodiments, a liquid nucleic acid preparation may be stored and/or maintained (e.g. , at 4°C or above, including room temperature) for at least 30 mins, including, e.g., at least 60 mins, at least 90 mins, at least 120 mins, at least 150 mins, at least 180 mins, at least 6 hours, at least 12 hours, at least 24 hours, at least 48 hours, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 2 weeks, or longer. In some embodiments, a liquid nucleic acid preparation may be stored and/or maintained at 4-6°C for a period of 30 mins to 3 hours. In some embodiments, a liquid nucleic acid preparation may be stored and/or maintained at room temperature for a period of 30 mins to 3 hours.
Without wishing to be bound by any particular theory, the present disclosure proposes that a charge -based interaction between the phosphate backbone of the nucleic acid and the amine moiety of a cationic lipid can facilitate efficient encapsulation of nucleic acid payload upon mixing. In some embodiments, such columbic interaction may be achieved and/or supported, for example, by controlling pH of a mixing solution (e.g. , a solution comprising a nucleic acid, such as an RNA, as described herein and lipid components) for example with an appropriate buffer, within a range or otherwise at a pH that maintains ionization of both a nucleic acid backbone and a cationic lipid. For example, in some embodiments, a desired pH may be between the pKa of a nucleic acid backbone (which is approximately 2 in some embodiments) and the pKa of a selected cation lipid (e.g., with a pKa of approximately 6 in some embodiments can be found at pH 4).
Accordingly, in some such embodiments, lipid components may be prepared in an organic solvent, and nucleic acid may be prepared in a buffer (e.g. , an aqueous buffer, such as for example a citrate buffer) at an appropriate pH (e.g., at a pH between about 2 and about 6, for example at a pH of about 4.0). In some embodiments, an aqueous buffer e.g., such as may be used to dissolve nucleic acid may have a buffer strength of at least 10 mM, including, e.g., at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, or higher, provided that excess buffering capacity does not significantly impact the size and/or polydispersity of resulting nucleic acid-lipid nanoparticles after mixing and/or encapsulation efficiency. In some embodiments, an aqueous buffer that may be useful to prepare a nucleic acid stock solution may have a buffer strength of 10 mM-50 mM.
In some embodiments, nucleic acid is maintained at acidic pH for only a minimal time prior to combination with a lipid preparation as described herein. For example, in some embodiments, a nucleic acid solution is prepared at an pH between about 2 and about 6, for example at a pH of about 4.0, (e.g., in a citrate buffer), and is promptly combined with a lipid preparation (e.g., in an organic solvent). In some embodiments, a nucleic acid solution is combined within a time period of not more than several hours of exposure to such acidic pH. In some embodiments, such time period is not more than 4, 3, 2, or 1 hour(s); in some embodiments, such time period is less than 60, 50, 40, 30, 20, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 minute(s). In some embodiments, such time period is less than about 5 hours, preferably less than about 4 hours or about 3 hours. In some embodiments, such time period is as short as is reasonably feasible.
Stock solution concentrations
In some embodiments, concentrations of stock solutions for mixing can be determined based on a target ratio of cationic lipid to nucleic acid (e.g., RNA), a target ratio of organic to aqueous component in a mixing output, and/or a target output lipid concentration. In some embodiments, the lipid concentration is controlled in terms of the mole ratio of cationic lipid (N) to nucleotide groups (P) in the nucleic acid RNA (e.g., RNA); with the other lipid components calculated according the target molar lipid proportions (e.g., as described herein) relative to the cationic lipid.
In some embodiments, a target ratio of cationic lipid to nucleic acid (e.g., RNA) can be represented by an N/P ratio where N represents an ionized or ionizable amine in a cationic lipid and P represents a phosphate associated with each nucleotide in a nucleic acid (e.g., RNA). Without wishing to be bound by a particular theory, in some embodiments, efficient encapsulation can be achieved when there is sufficient cationic lipid (N) to interact with the entire phosphodiester backbone (P) and/or there is a molar excess of cationic lipid relative to the nucleotides. In some embodiments, such a target N/P ratio can be selected by determining effects of various N/P ratios on size and/or polydispersity of resulting LNP preparations and/or encapsulation efficiency (EE). For example, in some embodiments, a target N/P ratio is selected that such that size of LNPs is less than 80 nm, polydispersity of LNPs is less than or equal to 0.3, and encapsulation is at least 80%. In some embodiments, a target N/P ratio may be in a range of approximately 3 to 35, approximately 3 to 30, approximately 4 to 25, approximately 4 to 20, approximately 4 to 15, approximately 3 to 10. In some embodiments, a target N/P ratio may be approximately 4 to 7.
In some embodiments, a nucleic acid preparation for combination with a lipid preparation can comprise nucleic acid described herein at a concentration of 0.1 -0.6 mg/mL, 0.1 -0.5 mg/mL, 0.2-0.4 mg/mL, or 0.3-0.5 mg/mL. In some embodiments, a lipid preparation for combination with a nucleic acid preparation can comprise lipids at a total concentration of about 10-50 mg/mL, or about 10-40 mg/mL, or about 15 to 35 mg/mL. In some embodiments, a nucleic acid (e.g., RNA) preparation for combination with a lipid preparation can comprise nucleic acid (e.g., RNA) described herein at a concentration of 0.1-0.6 mg/mL, and the lipid preparation can comprise lipids at a total concentration of about 10-40 mg/mL.
Forming LNPs
In some embodiments, LNP preparations can be produced by rapid mixing of an aqueous solution described herein (e.g. , comprising a nucleic acid, e.g., an RNA and/or in an acidic buffer) and a lipid preparation described herein (comprising, e.g., at least one cationic lipid and optionally one or more other lipid components, in an organic solvent) under conditions such that a sudden change in solubility of lipid component(s) is triggered, which drives the lipids towards self-assembly in form of LNPs. In some embodiments, properties of a cationic lipid are chosen such that nascent formation of particles occurs by association with an oppositely charged backbone of a nucleic acid (e.g., RNA). In this way, particles are formed around the nucleic acid, which, for example in some embodiments can result in much higher encapsulation efficiency (EE) than it is achieved in the absence of interactions between nucleic acids and at least one of the lipid components.
In some embodiments, nucleic acid preparation for producing an LNP preparation encapsulating the nucleic acid can be combined with an acidic buffer. An exemplary such buffer is or comprises a citrate buffer. In some embodiments, flow rate ratio of an acidic buffer (e.g., a citrate buffer) to transcript nucleic acid preparation (e.g., an RNA preparation) can be 2:1, 3:1, 4:1, or 5:1.
In some embodiments, a ratio of organic to aqueous component can be controlled such that LNPs effectively form as a precipitation of lipid components upon rapid change of the solubility characteristics of the lipids in a solution when the aqueous component is introduced. Without wishing to be bound by a particular theory, in some embodiments, proportion of organic component in a combined solution (comprising lipid components and nucleic acid) is sufficiently low to induce precipitation with kinetics that are fast enough to support nanoscale particles. In some embodiments, a combining volumetric ratio of a lipid preparation and a nucleic acid (e.g., RNA) preparation is about 1:5, 1:4, 1:3, 1:2, or 1:1. In some embodiments, a combining volumetric ratio of a lipid preparation and a nucleic acid (e.g., RNA) preparation is about 1:3. In some such embodiments, the final concentration of organic solvent in a combined solution (comprising lipid components and nucleic acid) may be approximately 25% (v/v).
In some embodiments, a lipid preparation described herein and a nucleic acid (e.g., RNA) preparation described herein can be introduced into a mixing unit or assembly. In some embodiments, a mixing unit or assembly may comprise one or more fluidic components or devices. For example, in some embodiments, a mixing unit or assembly may comprise one or more components/parts of a high- performance liquid chromatography (HPLC) and/or other fluidic devices. In some embodiments, a mixing unit or assembly may comprise a T mixer comprising an inner diameter suitable for selected flow rate. In some embodiments, mixing dynamics, for example, are controlled by orifices at the outlet of each stream and by the internal diameters of the tubing. In some embodiments, lipid and aqueous (e.g., nucleic acid, e.g., RNA) preparations can be mixed at room temperature by pumping each solution independently at controlled flow rates into a mixing unit or assembly, for example, using piston pumps. In some embodiments, the volumetric flow rates of a lipid preparation and an aqueous (e.g., nucleic acid, e.g., RNA) preparation into a mixing unit or assembly are maintained at a ratio of 1:5, 1:4, 1:3, 1:2, or 1:1. In some embodiments, the volumetric flow rates of a lipid preparation and an aqueous (e.g., nucleic acid, e.g., RNA) preparation into a mixing unit or assembly are maintained at a ratio of 1 :3. In some embodiments, volumetric flow rate of a combined preparation is 100-800, 200-800, 200-700, 200-600, 200-500, 100-600, 100-500, or 150-500 mL/min, which in some embodiments may be particularly useful for large-scale production. In some embodiments, volumetric flow rate of a combined preparation is 300- 600 mL/min.
In some embodiments, an aqueous (e.g., nucleic acid, e.g., RNA) preparation is introduced into a mixing unit or assembly such that a mass flow rate is 10-200, 20-180, 20-160, 20-150, 30-160, 40-160, 50-200, 70-200, or 100-200 mg/min. In some embodiments, an aqueous (e.g., nucleic acid, e.g., RNA) preparation is introduced into a mixing unit or assembly such that a mass flow rate is 100-300 mg/min.
In some embodiments, volumetric flow rate of a lipid preparation (e.g., in an organic phase) is 15-50, 25- 75, 50-100, 75-125, 100-150, 100-200, 50-200, or 15-200 mL/min. In some embodiments, volumetric flow rate of a lipid preparation (e.g., in an organic phases) is about 80-160 mL/min.
In some embodiments, volumetric flow rate of an aqueous (e.g., nucleic acid, e.g., RNA) preparation (e.g., in an aqueous phase) is 15-500, 30-500, 30-400, 50-500, 40-500, 100-400, 100-500, or 200-500 mL/min, which in some embodiments may be particularly useful for large-scale production. In some embodiments, volumetric flow rate of an aqueous (e.g., nucleic acid, e.g., RNA) preparation is 240-480 mL/min. In some embodiments, a flow rate of 360:120 mL/min (total 480 mL/min) is utilized. In some embodiments, a flow rate (aqueous preparation: lipid preparation) of 360:120 mL/min (total 480 mL/min) is utilized.
In some embodiments, an aqueous (e.g., nucleic acid, e.g., RNA) preparation and/or a lipid preparation may be introduced into a mixing unit or assembly (e.g. , as described herein) at room temperature. In some embodiments, an aqueous (e.g., nucleic acid, e.g., RNA) preparation and/or a lipid preparation may be introduced into a mixing unit or assembly (e.g., as described herein) at a temperature of about 13-28°C, or 15-26°C, or 15-25°C, or 16-26°C.
In some embodiments, homogenous LNP formation with appropriate sizes may require fast and efficient mixing of aqueous and organic components. Without being bound to any one theory, in some embodiments, the present disclosure recognizes that at lower flow rates particles have larger sizes and higher polydispersity characteristics with variable encapsulation efficiency (EE). In some embodiments, flow rates of organic and aqueous components are controlled independently by two pumps. In some embodiments, the two pumps are two separate pumps. In some embodiments, the pump speeds are related to each other. In some embodiments, the pump speeds are related to each other, for example, by the target final organic component concentration (e.g., described herein) and by the same ratio as the stock solution volumes (e.g., described herein) to continuously provide the same dilution at the mixing interface throughout the mixing process. In some embodiments, total output flow rates (combining volumetric flow rates of aqueous and lipid preparations) of 10 to 30, 15-35, 18-40, 25-45, or 30-50 mL/minute are utilized. In some embodiments, total output flow rates (combining volumetric flow rates of aqueous and lipid preparations) of 65-700, 130-550, 130-400, 130-275, 250-400, 200-700, 260-700, or 260-550 mL/min are utilized, which in some embodiments may be particularly useful for large-scale production.
In some embodiments, nucleic acid (e.g., RNA) concentration post-mixing is 0.05-0.5, 0.1-0.4, 0.1-0.35, or 0.15-0.30 mg/mL. In some embodiments, lipid concentration post-mixing is 2-10, 2-8, or 3-9 mg/mL. In some such embodiments, the concentration of organic solvent in a combined solution (comprising lipid components and nucleic acid) may be approximately 25% (v/v).
In some embodiments, after or immediately after LNP formation (e.g., at an acidic pH), a preparation comprising nucleic acid (e.g., RNA)-LNPs is diluted with an aqueous buffer at an appropriate pH (e.g., pH 2 to pH 6, or pH 4 to pH 6), for example, to decrease the concentration of organic solvent present in the lipid preparation and/or to maintain physiochemical stability of LNPs. Examples of such aqueous buffer may include, but are not limited to, citrate buffers, acetate buffers, etc., or combinations thereof.
In some embodiments, an aqueous buffer for dilution of such a preparation can be or comprise an acidic buffer, e.g., a buffer below pH 7 (e.g., pH 2-pH 6), such as, e.g., in some embodiments, a buffer at pH 4. In some embodiments, such an aqueous buffer can be or comprise an acidic buffer at a concentration of 10-100 mM, or 25-75 mM, or 30-60 mM, or 40-60 mM, or 10-50 mM. In some embodiments, such an aqueous buffer can be or comprise an acidic buffer at a concentration of 40-60 mM; in some embodiments, such an aqueous buffer can be or comprise an acidic buffer (e.g., a citrate buffer) at a concentration of 50 mM. In some embodiments, an acidic buffer can be or comprise a citrate buffer at pH 4.
In some embodiments, dilution of an LNP preparation with an aqueous buffer described herein can be performed in-line immediately after LNP formation in a mixing unit or assembly, e.g., as a continuous process. In some such embodiments, flow rate ratio of a preparation comprising LNPs to an acidic buffer (e.g. , as described herein) can be 1:1 or 3:2 or 2: 1.
In some embodiments, dilution of a preparation comprising LNPs with an aqueous buffer (e.g., an acidic buffer described herein) can be performed at room temperature (e.g. , about 18°C-3O°C, e.g. , about 18°C- 25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25°C).
In some embodiments, following dilution, an LNP preparation contains approximately 15-20% ethanol. In some embodiments, flow rate of such an aqueous buffer described herein can be 50-300, 60-275, 70- 250, 80-240, or 150-400 mL/minute. In some embodiments, nucleic acid concentration of an LNP preparation after such dilution can be 0.01-1, 0.05-0.5, 0.075-0.03, 0.05-0.25, or 0.09-0.21 mg/mL. In some embodiments, lipid concentration of an LNP preparation after such dilution can be 1-10, 1-7, 2-6, or 2.5-5.5 mg/mL. In some embodiments, the concentration of organic solvent, if present, can be further reduced to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24% after dilution.
In some embodiments, an LNP suspension is collected in a vessel which is cooled to approximately 2- 8°C. In some embodiments, an LNP preparation may be collected at a higher temperature, e.g., at a temperature of above 8°C, including, e.g., 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, or higher. In some embodiments, an LNP preparation may be collected at room temperature (e.g., as described herein). In some embodiments, an LNP preparation may be collected at a temperature of 2-28°C, 2-25°C, 5-28°C, 10-28°C, 15-28°C, or 16-26°C.
In some embodiments, in process-controls and/or monitoring of one or more of preparation of lipid and/or nucleic acid preparations and LNP formation can be conducted. For example, in some embodiments, filter integrity after lipid stock filtration and/or dilution of a nucleic acid preparation with an acidic buffer can be assessed. In some embodiments, LNP size and/or polydispersity, lipid and/or nucleic acid (e.g., RNA) content (e.g., concentration), and/or encapsulation can be assessed and/or monitored during and/or after LNP formation. Exemplary LNP processing
In some embodiments, an LNP preparation (e.g. , a dispersion preparation) described herein can be processed by one or more of buffer exchange, concentration adjustment, purification, formulation for storage, aseptic filling, labelling, storage, or combinations thereof.
Ultrafiltration and/or diafiltration'. In some embodiments, an LNP preparation (e.g., a dispersion preparation), in some embodiments after dilution with an acidic buffer described herein, can be subjected to one or more steps of ultrafiltration and/or diafiltration processes, or combinations thereof. For example, in some embodiments, an LNP preparation (e.g., a dispersion preparation), in some embodiments after dilution with an acidic buffer described herein, can be subjected to at least two, three, four, five, six, seven, or eight steps of ultrafiltration and/or diafiltration processes, or combinations thereof. In some embodiments, 3-5 steps of ultrafiltration and/or diafiltration processes, or combinations thereof can be performed. In some embodiments, an LNP preparation (e.g., a dispersion preparation) can be subjected to alternating ultrafiltration and diafiltration processes.
Ultrafiltration is a membrane filtration process during which external forces, e.g., pressure or concentration gradients lead to a separation through a semipermeable membrane. Suspended solids and solutes of high molecular weight are retained in the so-called retentate, while water and low molecular weight solutes pass through the membrane in the permeate. Ultrafiltration membranes typically have pore sizes between 0.001 and 0.1 pm and/or MWCO between 10-300 kDa, and can be applied in cross-flow or dead-end mode.
Diafiltration can be performed either discontinuously or alternatively, continuously. For example, in continuous diafiltration, a diafiltration solution can be added to a sample feed reservoir at the same rate as filtrate is generated. In this way, the volume in the sample reservoir remains constant but small molecules (e.g. salts, solvents, etc.,) that can freely permeate through a membrane are removed. Using solvent removal as an example, each additional diafiltration volume (DV) reduces the solvent concentration further. In discontinuous diafiltration, a solution is first diluted and then concentrated back to the starting volume. This process is then repeated until the desired concentration of small molecules (e.g. salts, solvents, etc.) remaining in the reservoir is reached. Each additional diafiltration volume (DV) reduces the small molecule (e.g., solvent) concentration further. Continuous diafiltration typically requires a minimum volume for a given reduction of molecules to be filtered. Discontinuous diafiltration, on the other hand, permits fast changes of the retentate condition, such as pH, salt content and the Eke. In some embodiments, an LNP preparation is subjected to a diafiltration process. In some embodiments, a diafiltration process with a defined number of volume exchanges (e.g. , at least one, at least two, at least three, or more volume exchanges) using an aqueous buffer described herein (e.g., a dilution buffer described herein used in dilution of an LNP preparation such as, e.g., an acidic buffer at pH 4) is performed.
In some embodiments, a diafiltration process comprises multiple volume exchanges (e.g., 1-10 volume exchanges, 3-10 volume exchanges, 5-9 volume exchanges, 6-10 volume exchanges) to perform buffer exchange, e.g., in some embodiments replacing the supernatant in a first aqueous buffer with a different aqueous buffer described herein (e.g., a formulation buffer). In some embodiments, a formulation may have a pH 6-8 (e.g., pH 7.4). In some embodiments, a formulation buffer may comprise one or more salts (e.g., sodium salts, potassium salts, phosphate salts, etc.). In some embodiments, a formulation buffer may be or comprise phosphate ions. Without being bound by any one theory, multivalent anions (e.g., from buffer components such as, e.g., citrate, and/or chelating agents (e.g., EDTA) added during processing) can be captured within LNP due to ion binding to lipid head groups. In some embodiments, there is a possibility for retention of multivalent anions (e.g., citrate, EDTA) on lipid. In some embodiments, displacement of such multivalent anions by phosphate may further reduce the amount of bound ions in a bulk LNP product.
In some embodiments, a formulation buffer may be or comprise PBS. In certain embodiments, a first combination of diafiltration and ultrafiltration is employed using a first buffer, wherein said first buffer is identical to the LNP preparation, so that this first combination of diafiltration and ultrafiltration is removing the solvent and concentrating the LNP preparation and this first combination is followed by a second combination of diafiltration and ultrafiltration steps using a second buffer so that the buffer type and pH are adjusted. In some embodiments, between 1 and 4 volumes of the first buffer are employed for the first diafiltration, the first ultrafiltration is concentrating the LNP preparation to a concentration of between 0.1 and 2mg/mL, preferably between 0.2 and Img/mL and/or the second diafiltration is using phosphate buffer in an amount to change the pH of the LNP preparation to pH7.0 or higher and the second ultrafiltration is concentrating the LNP preparation to a concentration of between 0.5 and 4mg/mL, preferably between 0.66 and 2mg/mL. The required amount of phosphate buffer of the second diafiltration depends on the buffering capacity of the same. Without wishing to be bound to a certain theory, the second buffer may needto overcompensate (i) the buffering capacity of the cationic lipid making up the LNP phase and/or (ii) a certain portion of the buffering capacity of the first buffer. In specific embodiments, between 5 and 15 volumes of a phosphate buffer having a strength of about lOmM phosphate are used for the second diafiltration and the second ultrafiltration is not started before the pH of the LNP preparation is 6.5 or higher. In some embodiments, an LNP preparation can be subjected to an ultrafiltration process. In some embodiments, an ultrafiltration process can be performed after a diafiltration, e.g., for concentration. In some embodiments, an LNP preparation can be concentrated by ultrafiltration by a factor of at least 2 (including, e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or more). In some embodiments, an LNP preparation can be concentrated by ultrafiltration by a factor within a range of about 2 to about 6-fold.
In some embodiments, an LNP preparation can be subject to a process comprising at least two cycles (including, e.g., at least three, at least four, or more) of diafiltration followed by ultrafiltration. Each cycle can comprise diafiltration using a different diafiltration volume and/or buffer and ultrafiltration with a different concentration factor.
In some embodiments, the concentration of an LNP preparation following a process comprising diafiltration and/or ultrafiltration can be in the range of 0.1-1, 0.2-0.8, or 0.4-0.6 mg/mL. In some embodiments, such concentration can be 0.5 mg RNA-LNPs/mL.
In some embodiments, diafiltration and/or ultrafiltration can be performed at room temperature (e.g., about 18°C-3O°C, e.g., about 18°C-25°C, or about 20°C-25°C, or about 20-30°C, or about 23-27°C or about 25 °C).
In some embodiments, diafiltration and/or ultrafiltration described herein can be performed in a tangential flow filtration (TFF) set-up. In some embodiments, a TFF system comprises hollow fiber membranes, which can be polymeric, ceramic, or cellulose. In some embodiments, a TFF system used for diafiltration and/or ultrafiltration comprises hollow fiber polymeric membranes, e.g., thermoplastic membranes (e.g., polysulfone or polyethersulfone). In other embodiments, planar membranes are used. In some embodiments, membranes can be stacked. TFF membranes can be several square meters in size depending on the actual scale of the preparation and in some embodiments, a TFF membrane has a filter area requirement of below Im2 per gram nucleic acid (e.g., RNA). In some embodiments, a TFF membrane has a filter area requirement of between 0.1 and 0.8 m2/g or between 0.25 and 0.5m2/g.
In some embodiments, transmembrane pressure is less than, for example, 500 mbar (including, e.g., less than 450 mbar, less than 400 mbar, less than 350 mbar, less than 300 mbar, less than 250 mbar, less than 200 mbar, less than 150 mbar, less than 100 mbar, less than 50 mbar, or less). In some embodiments, shear rate is less than 10,000/s, less than 9,000/s, less than 8,000 per second, less than 7,000 per second, less than 6,000/s, less than 5,000/s, less than 4,000/s, less than 3,000/s, less than 2,000/s, less than 1,000/s or lower. Gravity filtration: In some embodiments, an LNP preparatoin (e.g., after ultrafiltration/diafiltration described herein) can be subjected to gravity filtration. In some embodiments, gravity filtration (e.g., filtration by passage through a filter with a pore size within a range of about 0.1 to 0.3 pm) can be performed. In some embodiments, an LNP preparation (e.g., after ultrafiltration/diafiltration described herein) can be filtered by passage through a filter with a pore size of about 0.2 pm or smaller. In some embodiments, filtration is completed over a period of less than 5 hours (including, e.g., less than 4 hours, less than 3 hours, less than 2 hours, or less than 1 hour). In some embodiments, filtration is conducted at a particular pressure. In some embodiments, filtration pressure is less than 30 psig, less than 25 psig, less than 20 psig, less than 15 psig, less than 10 psig, or less than 5 psig.
Concentration adjustment and/or formulation: In some embodiments, after diafiltration and/or ultrafiltration and optionally gravity filtration described herein, a purified LNP preparation can be adjusted with a formulation buffer to a desired concentration (e.g., nucleic acid concentration). In some embodiments, a formulation buffer may have a pH 6-8 (e.g., pH 7). In some embodiments, a formulation buffer may comprise one or more salts (e.g., sodium salts, potassium salts, phosphate salts, etc.). In some embodiments, a formulation buffer may be or comprise PBS. In some embodiments, a formulation buffer may comprise a cryoprotectant. In some embodiments a cryoprotectant may be present in a formulation buffer at a concentration of about 100-500 mM, or 200-400 mM, or 250-350 mM. Non-limiting examples of cryoprotectants include a sugar (e.g., sucrose, trehalose), glycerin, ethylene glycol, or combinations thereof. In some embodiments, a cryoprotectant included in a formulation buffer includes a sugar (e.g., sucrose, trehalose, etc.). In some embodiments, cryoprotected is added with mixing. In some embodiments, mixing occurs for a particular duration of time, for example, at least 10 minutes (including e.g., at least 15 minutes, at least 20 minutes at least 25 minutes, at least 30 minutes, or more). In some embodiments, mixing occurs at a particular speed or range of speeds, for example, at least 10 rpm, at least 25 rpm, at least 50 rpm, at least 75 rpm, at least 100 rpm, at least 125 rpm, at least 150 rpm, at least 175 rpm, at least 200 rpm, at least 250 rpm, at least 300 rpm, at least 350 rpm, at least 400 rpm, at least 450 rpm, at least 500 rpm or more).
In some embodiments, a purified LNP preparation can be adjusted with a formulation buffer described herein such that nucelic acid (e.g., RNA) concentration is 0.1-1 mg/mL, or 0.2-0.8 mg/mL, or 0.3-0.7 mg/mL, or 0.4-0.6 mg/mL.
In some embodiments where LNPs are present a formulation buffer described herein, such composition (referred to as a “bulk LNP product”) may be stored and/or maintained at an appropriate temperature for a period of time before transportation and/or aseptic filling. In some embodiments, a bulk LNP product described herein may be stored and/or maintained as a frozen or liquid composition. In some embodiments, a bulk LNP product described herein may be stored as a frozen composition at a subzero temperature, e.g., -10°C or lower, including, e.g., -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, - 80°C or -90°C. In some such embodiments, a frozen composition comprising a bulk LNP product may be stored for at least 2 weeks, at least 4 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, or longer.
In some embodiments, a bulk LNP product described herein may be stored as a liquid composition at a refrigerated temperature, e.g., 2-10°C or 2-8°C. In some such embodiments, a liquid composition comprising a bulk LNP product may be stored for at least 5 days, at least 10 days, at least 20 days, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or longer. In some embodiments, a liquid composition comprising a bulk LNP product may be stored for about 1 week. In some embodiments, a bulk LNP product described herein may be stored as a liquid composition at room temperature or lower (e.g., 10-25°C). In some such embodiments, a liquid composition comprising a bulk LNP product may be stored for at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, or longer.
In some embodiments, in process-controls and/or monitoring of LNP formulation can be conducted. For example, in some embodiments, one or more product attributes including, e.g., but not limited to LNP size/polydispersity, lipid/nucleic acid content (e.g., concentration), nucleic acid encapsulation, nucleic acid integrity, pH, osmolality, and combinations thereof, can be assessed and/or monitored during and/or after LNP formulation and/or storage.
Aseptic filling and/or labeling'. In some embodiments, a bulk LNP product described herein is aseptically filled into a sterile container, which in some embodiments may be a plastic or glass vessel. In some embodiments, a container may be suitable for a single-dose administration. In some embodiments, a container may be suitable for a multi-dose administration (e.g., at least 2 doses, at least 3 doses, at least 4 doses, at least 5 doses, at least 6 doses, at least 7 doses, at least 8 doses, at least 9 doses, at least 10 doses, or more). Examples of a container include, but are not limited to a bag, a pouch, a vial, etc. In some embodiments, a container may have a volume within a range of less than 30 mL, less than 25 mL, less than 20 mL, less than 15 mL, less than 10 mL, less than 5 mL, less than 4 mL, less than 3 mL, less than 2 mL, less than 1.5 mL, less than 1 mL, or smaller. In some embodiments, a container may have a volume within a range of 4-26 mL.
In some embodiments, a container may be or comprise glass. In some embodiments a container may be or comprise borosilicate glass, which in some embodiments may be or comprise type I borosilicate glass that meets requirements of applicable ISO standards and pharmacopeias (USP and Ph.Eur.). In some embodiments, a container may be a Schott glass vial. In some embodiments, a container may be a Gerresheimer glass vial. In some embodiments, a container may include a closure, which can be, e.g., but not limited to, a cap, a stopper, or a lid, etc. In some embodiments, a closure may be or comprise a flip off cap. In some embodiments, a closure may be or comprise a rubber stopper (e.g., a latex-free bromobutyl rubber stopper). In some embodiments, a closure may be or comprise a Datwyler stopper (e.g., Datwyler FM457 V9471, Datwyler FM547 V9145, etc.). In some embodiments, a container includes an overseal (e.g. an aluminum overseal). In some embodiments, crimping speed may occur at, for example, at least 100 units/minute, at least 200 units/minute, at least 300 units/minute, at least 400 units/minute, at least 500 units/minute, at least 600 units/minute, at least 700 units/minute, or more. In some embodiments, crimping pressure occurs at, for example, at least 100 N, at least 200 N, at least 300 N, at least 400 N, at least 500 N or more.
In some embodiments, a single-dose amount or a multi-dose amount of a bulk RNA-LNP product described herein is aseptically filled in a container (e.g., described herein). In some embodiments, about 0.1-1 mL (e.g., 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 mL) of a bulk LNP product described herein is aseptically filled in a container (e.g., described herein). In some embodiments, 0.2-0.7 mL or 0.4-0.5 mL of a bulk LNP product described herein is aseptically filled in a container (e.g., described herein). In some embodiments, a drug product is provided as a concentrate for suspension; in some such embodiments, about 0.1, about 0.2, or about 0.3 mg of concentrate (e.g., about 0.21, 0.22, 0.23, 0.24, or 0.25 mg, such as about 0.225 mg).
Aseptic filling can be manual or automated. In some embodiments, aseptic filling can be operated at a throughput of at least 1000 vials/day, at least 2000 vials/day, at least 3000 vials/day, at least 4000 vials/day, at least 5000 vials, or more. In some embodiments, aseptic filling can be operated at a throughput of at least 5000 vials or more, including, e.g., at least 7500 vials/day, at least 10,000 vials/day, at least 20,000 vials/day, at least 30,000 vials/day, at least 40,000 vials/day, at least 50,000 vials/day, at least 60,000 vials/day, at least 70,000 vials/day or more.
In some embodiments, a lot number is labeled (e.g., printed) on a container and/or a lid. In some embodiments, prior to storage, vials are visually inspected for visible particles and/or vial weight is assessed (e.g., before and/or after filling). In some embodiments, a processes of sterile filtration, aseptic filing, and/or capping (e.g., crimping) are performed under constant environmental monitoring. In some embodiments, all personnel involved in clean room activities are microbially monitored. In some embodiments, e.g., in clean room classes A and B, particle monitoring and microbial air monitoring is performed.
In some embodiments, prior to aseptic filling and/or prior to transferring to a container for transport, a bulk LNP product described herein can be sterile filtered, e.g. , through a sterilization grade filter with a pore size of 0.1-0.3 pm. In some embodiments, a sterilization grade filter with a pore size of 0.2 pm can be used. In some embodiments, a sterile filter may have a filter surface area of at least 200 cm2, at least 300 cm2, at least 400 cm2, at least 500 cm2, at least 600 cm2, at least 700 cm2, at least 800 cm2, at least 900 cm2, at least 1000 cm2, at least 1250 cm2, at least 1500 cm2, at least 1750 cm2, at least 2000 cm2, at least 5000 cm2, at least 10,000 cm2, at least 15,000 cm2, at least 20,000 cm2 or larger. In some embodiments, a sterile filtration is performed directly before filling a bulk RNA-LNP product described into containers described herein. In some embodiments, bioburden of a bulk LNP product described herein can be assessed prior to sterile filtration. In some embodiments, filter integrity can be assessed prior to and/or after sterile filtration.
In some embodiments, in process-controls and/or monitoring of aseptic filling and/or labeling. For example, in some embodiments, one or more product attributes including, e.g., but not limited to LNP size/polydispersity, nucleic acid content (e.g., concentration), nucleic acid encapsulation, nucleic acid integrity, nucleic acid identity, pH, osmolality, and combinations thereof, can be assessed and/or monitored at the beginning and/or during the filling. Additionally or alternatively, sterility (e.g. , bioburden, endotoxin, etc.) of a defined number of vials, can be assessed and/or monitored before, during, and/or after filling and/or labeling.
Optional transport for filling and/or labeling: In some embodiments, a bulk LNP product described herein can be transported to a different location for filling and/or labeling. In some such embodiments, a bulk LNP product may be transferred to a container, e.g., with flexible wall(s), which, e.g., may be a flexible bag. In some embodiments, a container may have a volume of between 2 L and 200 L, in some embodiments between 5 and 50 L. In some embodiments, a bulk LNP product may be transported, e.g., in a disposable bioprocessing polymer bag, e.g. ethylene vinyl acetate copolymer at a refrigerated or frozen temperature, e.g., -90 to -60°C, -60 to -35°C, 2 to 10°C or 2 to 8°C for a period of time. In some embodiments, such period of time may be less than 90 days, less than 60 days, less than 30 days, less than 14 days, less than 10 days, less than 7 days, less than 6 days, less than 5 days, less than 4 days, less than 3 days, less than 2 days, less than 1 day or shorter. In some embodiments, a bulk LNP product may be transported at a refrigerated temperature (e.g., 2 to 10 °C or 2 to 8°C) for less than 14 days, less than 20 days, less than 7 days, less than 6 days, or shorter. In some embodiments, a bulk LNP product may be transported at a frozen temperature (e.g., -90 to -60°C or -60 to -35°C) for at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months or longer.
In some embodiments, after transport to a different location for aseptic filling and/or labeling and prior to aseptic filling, one or more product attributes including, e.g., but not limited to LNP size/polydispersity, nucleic acid content (e.g., concentration), RNA encapsulation, nucleic acid integrity, nucleic acid identity, pH, osmolality, and combinations thereof, can be assessed. Additionally or alternatively, sterility (e.g., bioburden, endotoxin, etc.) of a defined number of vials, can be assessed after transport to a different location for aseptic filling and/or labeling and prior to aseptic filling. In some embodiments, filling is completed using pumps (e.g., piston pumps or rotary piston pumps).
Packaging'. In some embodiments, multiple containers (e.g., multiple vials such as single use or multi-use vials) in which LNP product is disposed are positioned in a common tray or rack, and multiple such trays or racks are stacked in a carton that is surrounded by a temperature adjusting material (e.g., dry ice) in a thermal (e.g., insulated) shipper (packaging designed to maintain crucial conditions). In some embodiments, a thermal shipper keeps product at ultra-low temperature (e.g., less than -60°C, less than - 70°C, less than -80°C, less than -90°C or lower) for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days or longer, e.g., if the thermal shipper is maintained at 15°C to 25°C. In some embodiments, product is shipped and/or stored in a thermal shipper for a period of time less than about 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 day. In some embodiments, dry ice added during the period. In some embodiments, duration of time a thermal shipper that keeps product at ultra-low temperature (e.g., as described herein) can be extended, for example, by several days, by opening said thermal shipper and adding and/or replacing ice or dry ice (e.g., re -icing). In some embodiments, temperature and/or location is monitored during storage. In some embodiments, a thermal shipper comprises a thermal sensor. In some embodiments, a thermal shipper comprises a global positioning satellite (GPS) monitor. In some embodiments, a thermal shipper comprises a system for communicating location and/or temperature via GPS to another site and/or device (e.g., tower). In some embodiments, a thermal shipper comprises a GPS-enabled thermal sensor, for example, with a control site and/or device (e.g., tower) that will track the location and/or temperature of each product shipment across their pre-set routes.
In some embodiments, a thermal shipper (e.g., as described herein) is utilized to maintain crucial conditions (e.g., temperature) throughout a distribution process and/or during storage. In some embodiments, a thermal shipper (e.g., as described herein) is used to ship product from a manufacturing site to a distribution center and/or point of care, e.g., by air and/or ground transportation. In some embodiments, a thermal shipper (e.g., as described herein) is useful for long-distance shipping(e.g., at least 100 kilometers, 200 kilometers, 300 kilometers, 400 kilometers, 500 kilometers, 1,000 kilometers, 2,000 kilometers, 3,000 kilometers, 4,000 kilometers, 5,000 kilometers, 6,000 kilometers, 7,000 kilometers, 8,000 kilometers, 9,000 kilometers, 10,000 kilometers or more).
Storage (e.g., at manufacturing and/or distribution sites, and/or point-of-care facilities): In some embodiments, filled products can be stored stable at sub-zero temperatures (e.g., less than -20°C, less than -30°C, less than -40°C, less than -50°C, less than -60°C, less than -70°C, less than -80°C, or lower) over a period of time (e.g. , at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months, at least 12 months, or longer). In some embodiments, filled products can be stored stable as a frozen liquid at a temperature of -60°C to -80°C or lower for a period of at least 6 months. In some embodiments, a freezing process may utilize controlled freeze equipment and/or temperature controlled freezers.
In some embodiments, filled products can be stored stable at a refrigerated temperature (e.g., about 2°C to about 10°C or about 2°C to about 8°C) for at least 3 days, at least 5 days, at least 10 days, at least 20 days, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or longer. In some embodiments, filled products can be stored stable at a temperature of about 2°C to about 8°C for at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, or longer. In some embodiments, filled products can be stored stable at room temperature or lower (e.g., 10-25 °C) for at least 12 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, or longer.
In some embodiments, filled products can be maintained at ultra-low temperature (e.g., as described herein) in a thermal shipper (e.g., as described herein) as a temporary storage, for example, for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days or longer when the thermal shipper is maintained at 15°C to 25°C. In some embodiments, product is shipped and/or stored in a thermal shipper for a period of time less than about 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 day. In some embodiments, duration of time a thermal shipper that keeps product at ultra-low temperature (e.g., as described herein) can be extended, for example, by at least several days, by opening the thermal shipper and adding and/or replacing ice or dry ice (e.g., re-icing). In some embodiments, temperature and/or location can be monitored during storage.
Characterization
In some embodiments, one or more quality control parameters may be assessed to determine whether LNPs in a preparation or a bulk drug product described herein meet or exceed acceptance criteria (e.g., for subsequent formulation and/or release for distribution). In some embodiments, such quality control parameters may include, but are not limited to appearance (e.g., color, dryness, presence and/or size, color, type, etc. of visible particles), lipid identity, lipid content (e.g. , absolute and/or relative amount of any lipid), nucleic acid (e.g., RNA) identity (e.g., sequence and/or other structure), nucleic acid integrity, nucleic acid content (e.g., presence and/or absolute or relative amount), nucleic acid encapsulation, LNP size (e.g., average size, size distribution, etc.), LNP polydispersity, pH, osmolality, subvisible particles (e.g., too small to be visible to unaided eye, e.g., particles in the size range of 0.1 pm to 100 pm), presence and/or amount of one or more endotoxins, sterility, etc., may be assessed. Certain methods for assessing quality of an LNP preparation or a bulk drug product are known in the art; for example, one of skill in the art will recognize that in some embodiments, one or more analytical tests (e.g., as described herein) can be used for quality assessment.
In some embodiments, a batch of an LNP preparation or a bulk drug product described herein may be assessed for one or more features as described herein to determine next action step(s). For example, a batch of a preparation or a bulk drug product described herein can be designated for one or more further steps of manufacturing and/or formulation and/or distribution if quality assessment indicates that such a batch of a preparation or a bulk drug product described herein meets or exceeds the relevant acceptance criteria. Otherwise, an alternative action can be taken (e.g., discarding the batch) if such a batch of a preparation or a bulk drug product described herein does not meet or exceed the acceptance criteria.
In some embodiments, a batch of a preparation or a bulk drug product described herein that satisfy assessment results can be utilized for one or more further steps of manufacturing and/or formulation and/or distribution.
In some embodiments, manufacturing methods described herein may further comprise assessing and/or monitoring (e.g. , assessing at one or more time points) one or more features of an LNP preparation or a bulk drug product described herein including, e.g., appearance (e.g., color, dryness, presence and/or size, color, type, etc. of visible particles), lipid identity, lipid content (e.g. , absolute and/or relative amount of any lipid), nucleic acid (e.g., RNA) identity (e.g., sequence and/or other structure), nucleic acid integrity, nucleic acid content (e.g., presence and/or absolute or relative amount), nucleic acid encapsulation, LNP size (e.g., average size, size distribution, etc.), LNP polydispersity, pH, osmolality, subvisible particles, presence and/or amount of one or more endotoxins, sterility, etc. In some embodiments, at least one or more features (e.g. at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve at least thirteen, at least fourteen) described herein can be characterized and/or monitored for quality control.
In some embodiments, appearance of an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, visual inspection is utilized to monitor appearance. In some embodiments, an LNP preparation or bulk product described herein is a white to off-white suspension.
In some embodiments, visible particles present in an LNP preparation or bulk product described herein are assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, visible particle testing is performed according to Ph. Eur. 2.9.20. In some embodiments, visible particle testing is performed according to Ph. Eur. 2.9.20 with minor adaptions. In some embodiments, LNPs are free or essentially free from observable particles (e.g., visible to unaided eye). In some embodiments, lipid identity and/or lipid content of lipids, lipid stock solutions, and/or LNPs is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, an HPLC-CAD assay determines the identity and concentration of lipids in the tested sample (e.g. LNPs). In some embodiments, individual lipid identities and/or content is determined by comparison of retention times with those of the reference standards. In some embodiments, lipid identities and content determined comprise monitoring or particular lipids. In some embodiments, particular lipids comprise cationic lipid, PEG-lipid, helper lipid (e.g., DSPC, and/or cholesterol). In some embodiments, concentration of each individual lipid is determined by sample area response against the respective five-point calibration curve generated from the reference standards, with peak detection performed use a CAD. In some embodiments, results for lipid identity and lipid content are reported as relative retention time compared to reference standard and as mg/mL, respectively. In some embodiments, a predetermined acceptance criterion is met for release for lipids, lipid stock solutions, and/or LNPs.
In some embodiments, nucleic acid (e.g., RNA) identity is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, nucleic acid identity is determined by capillary electrophoresis. In some embodiments, LNPs are treated with Tween20 are applied to a gel matrix contained in a capillary. In some embodiments, nucleic acid (e.g., RNA) and its derivatives, degradants, and impurities are separated according to their sizes. In some embodiments, the gel matrix contains a fluorescence dye which binds specifically to nucleic acid (e.g., in some embodiments specifically to RNA) components which allows detection by a laser-induced fluorescence (LIF) detector. In some embodiments, the excitation wavelength is 495 nm. In some embodiments, the emission wavelength is 537 nm.
In some embodiments, the identity of a nucleic acid (e.g., RNA) is verified by comparing with the reference standard. In some embodiments, RNA identity is determined by reverse transcribing said RNA into cDNA and amplifying said cDNA (e.g., by PCR) with a target specific probe and/or primers. In some embodiments, the sequence of anRNA is determined by reverse transcribing said RNA into cDNA, amplifying (e.g., by PCR), and sequencing the amplified product.
In some embodiments, conformance of nucleic acid length (and thus indirectly molar mass) with the theoretical values is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, nucleic acid length is determined by denaturing agarose gel electrophoresis in comparison to a standard ladder with nucleic acid s of known lengths. In some embodiments, sizes obtained must be consistent with theoretically expected lengths. In some embodiments, the electrophoresis gel is a precast and buffered agarose gel pre-stained with a nucleic-acid specific dye. In some embodiments, nucleic acid (e.g., RNA) integrity is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, nucleic acid integrity is determined use agarose gel electrophoresis. In some embodiments, nucleic acid integrity is determined by capillary electrophoresis. In some embodiments, nucleic acid integrity can be quantitatively determined using capillary electrophoresis. In some embodiments, determination of nucleic acid integrity comprises one or more of LNP treatment with nonionic surfactant, application of nonionic surfactant treated LNP to a gel matrix contained in a capillary, separating nucleic acid and its derivatives, degradants, and impurities according to their sizes, detection of intact nucleic acid and its derivatives, degradants, and impurities, and/or determining the integrity of the RNA. In some embodiments, a non-ionic surfactant is Tween20. In some embodiments, a gel matrix comprises a fluorescent dye which binds specifically to nucleic acid (e.g., in some embodiments specifically to RNA) components. In some embodiments, detection is conducted using a laser-induced fluorescent (LIF) detector. In some embodiments, an excitation wavelength is 495 nm. In some embodiments, an emission wavelength is 537 nm. In some embodiments, a nucleic acid (e.g., RNA) solution must give rise to a single peak at the expected retention time consistent with the expected lengths as compared to the retention times of a standard ladder. In some embodiments, quantification of a main nucleic acid (e.g., RNA) peak is calculated in relation to signal intensities in the electropherogram where degradation products are detectable. In some embodiments, > 30.0, 40.0 50.0, 60.0, 70.0, 80.0 or 90.0 % in the peak corresponds to intact nucleic acid (e.g., RNA).
In some embodiments, nucleic acid (e.g., RNA) encapsulation is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, encapsulation is monitored using a nucleic acid-binding (e.g., an RNA-binding) dye. In some embodiments, an RNA-binding dye is Ribogreen (Invitrogen, Eugene, OR, USA). In some embodiments, nucleic acid encapsulation is calculated by comparing signals (e.g., fluorescent signals) of LNP samples in the absence (free nucleic acid) and presence (total nucleic acid) of detergent. In some embodiments, the detergent is TritonX-100. In some embodiments, > 60, 70, 80, or 90% of nucleic acid (e.g., RNA) is encapsulated.
In some embodiments, nucleic acid (.e.g, RNA) content is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, nucleic acid (.e.g, RNA) content is determined using UV absorption spectrophotometry. In some embodiments, nucleic acid (.e.g, RNA) content is measured using a nucleic acid-binding (e.., an RNA-binding) dye. In some embodiments, an RNA- binding dye is Ribogreen (Invitrogen, Eugene, OR, USA). In some embodiments, nucleic acid (.e.g, RNA) content is determined by disrupting LNPs with detergent and measuring the total nucleic acid (.e.g, RNA) content based on a signal. In some embodiments, the detergent is Triton X-100. In some embodiments, the total nucleic acid (.e.g, RNA) content signal is measured using a spectrofluorophotometer. In some embodiments, nucleic acid (.e.g, RNA) content is 0.1-1 mg/mL or 0.3- 0.7 mg/mL, or 0.4-0.6 mg/mL. In some embodiments, LNP size and/or polydispersity is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, mean particle size and size distribution of LNP in a sample. In some embodiments, evaluation of mean particle size and size distribution of LNP in a sample involves use of dynamic light scattering. In some embodiments, results are reported as the Z-average size of the particles and the polydispersity index. In some embodiments, polydispersity values are used to describe the width of fitted log-normal distribution around the measured Z-average size and are generated using proprietary mathematical calculations within a particle sizing software. In some embodiments, dynamic light scattering methods comprise use of a particle sizer that uses back-scatter at 173°. In some embodiments, LNP size is < 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, or 250 nm. In some embodiments, LNP polydispersity is < 0.1, 0.2, 0.3, 0.4, or 0.5.
In some embodiments, pH value of an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, the pH value is determined according to regional pharmacopeia (e.g., Ph. Eur. 2.2.3, USP<791>). In some embodiments, pH value is 6-8, or 7-8, or 6.8-7.9.
In some embodiments, osmolality of an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, osmolality of LNPs is determined according to regional pharmacopeia (e.g., Ph. Eur. 2.2.35, USP<785>). In some embodiments, osmolality of LNPs is 400-650 mOsmol/kg, 425-625 mOsmol/kg, or 450-600 mOsmol/kg, or 475-550 mOsmol/kg.
In some embodiments, subvisible particles of an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, detection of subvisible particles is determined according to Ph. Eur. 2.9.19 / USP <787> (method 2, microscopic particle count). In some embodiments, an LNP preparation or bulk product described herein can comprise particles with a size of > 25 pm is no more than 600 particles/container. In some embodiments, an LNP preparation or bulk product described herein can comprise particles with a size of > 10 pm is no more than 6000 particles/container.
In some embodiments, presence and/or level of bacterial endotoxins in an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time), for example, using an analytical kinetic turbidimetric limulus amebocyte lysate (LAL) procedure. In some embodiments, Gram-negative bacterial endotoxins are assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, Gram-negative bacterial endotoxins are determined to have an acceptable level if the acceptance criteria in regional pharmacopoeia (e.g., Ph. Eur. 2.6.14, USP <85>, JP 4.01) are met when the level of Gram-negative bacterial endotoxins is determined according to the method described therein. In some embodiments, LNPs have < 12.5 EU/mL of bacterial endotoxins. In some embodiments, for example, prior to fdtration, LNPs may have < 46 EU/mL.
In some embodiments, bioburden is assessed and/or monitored (e.g., determined at one or more points over time) using a membrane filtration method. In some embodiments, bioburden is determined to have an acceptable level if the acceptance criteria in regional pharmacopoeia (e.g., Ph. Eur. 2.6.12, USP <61>, JP 4.05) are met when the bioburden is determined according to the method described therein (e.g., less than or equal 10 1 CFU per 10 mL). In some embodiments, for example, prior to filtration, bioburden may be less than or equal to 20 CFU per 20 mL.
In some embodiments, sterility of an LNP preparation or bulk product described herein is assessed and/or monitored (e.g., determined at one or more points over time). In some embodiments, sterility testing is performed according to regional pharmacopoeia (e.g., Ph. Eur. 2.6.1, USP <71 >, JP 4.06). In some embodiments, LNPs are sterile. In some embodiments, sterility is assessed and/or monitored by determining the presence or absence of detectable growth. In some embodiments, sterility is assessed and/or monitored, for example, by subjecting LNP samples to luciferase which catalyzes a reaction with microbial ATP. Light emitted during the reaction can be measured, for example, using a luminometer.
In some embodiments, additional characterization may be carried out in addition to, or in combination with, any other characterization and/or quality control method.
In some embodiments, protein expression from nucleic acids encapsulated in LNPs can be assessed. In some embodiments, protein expression is measured using a process comprising one or more of the following steps: adding LNPs to mammalian cells and/or measuring protein expression. In some embodiments, mammalian cells are HEK-293T cells. In some embodiments, n LNP dose is added to mammalian cells. In some embodiments, protein expression is measured using an antibody directed against an expressed protein or a portion thereof. In some embodiments, cells are labeled with a live/dead dye. In some embodiments, live/dead dye labeled cells are separated by flow cytometry. In some embodiments, the percent of live cells expressing relevant protein is enumerated. In some embodiments, nucleic acid (e.g., RNA) substance is transfected as a control to confirm protein expression. In some embodiments, a control substance transfection comprises use of electroporation. In some embodiments, a control transfection comprises use of calcium carbonate transfection. In some embodiments, expression is measured by quantifying the number of cells that have positive signal for bound antibody directed against the expressed protein or portion thereof. In some embodiments, expression is measured by quantifying the number of cells that have positive signal for bound antibody directed to a target protein. In some embodiments, protein expression of is measured using a process comprising one or more of the following steps: adding LNPs to mammalian cells, e.g., HEK-293T cells, at a pre-determined dose level, labeling cells with a live/dead dye and separating by flow cytometry, enumerating the percent of live cells expressing relevant protein, transfecting a control compositon with lipofectamine to confirm protein expression, and/or measuring expression by quantifying the number of cells that have positive signal for bound antibody directed to a target protein.
In some embodiments, characterization of LNPs is performed. In some embodiments, characterization comprises use of one or more of electron microscopy, CD spectroscopy, small angel X-ray scattering (SAXS), in vitro expression, and/ or mouse immunogenicity and comparing to a reference standard and/or control LNPs.
In some embodiments, excipients present in an LNP preparation or bulk product are assessed and/or monitored (e.g., determined at one or more points over time). Examples of excipients that may be assessed and/or monitored include, but are not limited to cholesterol, cryoprotectant, solvent (e.g., water and/or organic solvent), and/or salts. In some embodiments, excipients are tested according to a quality standard set forth in Ph. Eur.
In some embodiments, the impurity profile of LNPs is based primarily on the impurity profile of the materials used for its manufacture. In some embodiments, possible process-related impurities include residual solvent (e.g., ethanol), buffer components (e.g., citrate, HEPES), and/or chelating agent (e.g., EDTA). In some embodiments, residual solvent (e.g., ethanol) content present in an LNP preparation or a bulk product described herein is less than 10,000 ppm, 7,500 ppm, 5,000 ppm, 2,500 ppm, 1,000 ppm, or lower.
In some embodiments, all buffers and solutions held at least 24 hours are assessed and/or monitored for microbial content.
In some embodiments, the container and/or closure of the container is assessed and/or monitored. In some embodiments, the closure system comprises, for example, a vial and/or a vial stopper. In some embodiments, container closure integrity is assessed when exposed to low temperatures (e.g., less than - 50°C, less than -60°C, less than -70°C, less than -80°C, less than -90°C) and/or to assess and/or monitor the impact of crimping force on container closure integrity. In some embodiments, vial quality testing is performed according to regional pharmacopoeia (e.g., Ph. Eur. 3.2.1, USP<660>, JP 7.01). In some embodiments, vial stopper quality testing is performed according to regional pharmacopoeia (e.g., Ph.
Eur. 3.2.9, USP<381>, JP 7.03) and, in some embodiments, is sterilized by steam. In some embodiments, closure of the container is assessed and/or monitored by incursion of a dye. In some embodiments, container closure integrity (e.g., before and/or after exposure to low temperature) can be assessed and/or monitored using laser -based headspace carbon dioxide and oxygen detection analysis (HSA). Without being bound by any one theory, HSA’s principle of operation is based on the initial headspace of the container closure system containers air and atmospheric pressure levels and after exposing the samples to an environment container nitrogen or carbon dioxide at low temperatures, vials without integrity will reveal loss of oxygen or an increase in carbon dioxide in the vial headspace. In some embodiments, headspace measurements are conducted using headspace analyzers (e.g., Lighthouse Instruments Oxygen and FMS-Carbon dioxide headspace analyzers). In some embodiments, analyzers are calibrated using traceable standards (e.g., NIST-traceable standards). In some embodiments, an increase in the percent of oxygen measured of about 0.5%, 1%, 1.5% or 2% is considered to be a failure and/or loss of container closure integrity.
In some embodiments, residual seal force (RSF) of a container closure system is assessed and/or monitored. RSF is stress an elastomeric closure will continue to exert against the glass vial finish and the overseal after capping is complete. In some embodiments, RSF is measured prior to and/or after sample exposure to low temperature. In some embodiments, after sample exposure to low temperature, samples are warmed to room temperature and RSF is measured. In some embodiments, an initial RSF alert limit of no less than 10 Ibf, 9 Ibf, 8 Ibf, 7 Ibf, 6 Ibf, 5 Ibf, 4 Ibf, or 3 Ibf is utilized for monitoring RSF.
In some embodiments, physiochemical properties (e.g., density, viscosity, size distribution and shape, surface charge, and/or surface PEG) of LNPs are assessed and/or monitored. In some embodiments, thermal transitions of LNPs are assessed and/or monitored, for example, using differential scanning calorimetry.
Quality control
In some embodiments, provided technologies include one or more quality assessment steps. In some embodiments, one or more of aqueous (e.g., nucleic acid, e.g., RNA) solution, lipid solution, and/or LNP preparation is subjected to one or more quality control steps, assessments, and/or characterizations during and/or after its production and/or use as described herein.
In some embodiments, if a particular quality control assessment indicates a defect or failure, an assessed material is subjected to repeat or alternative assessment. In some embodiments, if an assessment indicates a defect or failure, an assessed material is discarded.
In some embodiments, if a particular quality control assessment is successfully passed, an assessed material continues along a predetermined workflow. In some embodiments, a reference standard for a particular quality control assessment can be any quality control standard, including, e.g., a historical reference, a set specification. As will be understood by a skilled artisan, in some embodiments, a direct comparison is not required. In some embodiments, a reference standard is an acceptance criterion based on, for example, assessment and/or characterization of features described herein, including, e.g. , physical appearance, lipid identity and/or content, LNP size, LNP polydispersity, nucleic acid (e.g., RNA) encapsulation, nucleic acid (e.g., RNA) length, nucleic acid (e.g., RNA) identity (e.g., as RNA), integrity, sequence, and/or concentration, pH, osmolality, potency, bacterial endotoxins, bioburden, residual organic solvent, osmolality, pH, and combinations thereof.
In some embodiments, a quality control assessment involves an assessment of presence of air and/or of one or more manifestations (e.g., loss of polydispersity, disruption of nanoparticle structure and/or of colloidal structure of an LNP composition, etc.) of air having been present.
Exemplification
Example 1: Overview of exemplary manufacturing process for a pharmaceutical-grade composition comprising RNA
The present Example depicts an exemplary manufacturing process for pharmaceutical-grade RNA comprising an in vitro RNA transcription followed by removal of components utilized or formed in the course of production by a purification process, and filtration to reduce bioburden (e.g., as illustrated in Figure 4). Optional in-process controls may also be completed depending on whether a hold step is performed.
Example 2: Overview of exemplary manufacturing process for pharmaceutical-grade RNA-LNPs
The present Example demonstrates an exemplary manufacturing process for pharmaceutical-grade RNA- LNPs comprising six steps and one optional step (Figure 5). First, a lipid and RNA stock is prepared (the lipid stock corresponds to the second liquid mentioned further above, the RNA stock corresponds to the first liquid mentioned above). Next, LNPs are formulated and stabilized by dilution followed by concentration, buffer exchange, and filtration. Subsequently, the concentration is adjusted and cryoprotectant is added. Optionally, RNA-LNPs are transported to an external fill and finish site. Finally, RNA-LNPs undergo sterile filtration and aseptic filling and storage.
Example 3: Overview of exemplary DNA template manufacture via a PCR-based process. The present Example describes an exemplary manufacturing process of a DNA template via a PCR-based process (Figure 6). Initially, a master mix preparation was made. Subsequently, forward primer and vector were added. The PCR-mix is transferred into a reagent reservoir and a PCR plate was filled. A PCR is completed comprising an initial denaturation, a denaturation step, an annealing step, a final extension step for 20-30 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) cycles and a hold step. The PCR products can be pooled and purified. Subsequently, the purified, pooled PCR product was filtered and quality control tested.
Example 4: Exemplary characterization of pharmaceutical-grade RNA
The present Example describes exemplary characterization of pharmaceutical-grade RNA compositions.
Appearance
In some embodiments, degree of coloration was tested based on Ph. Eur. 2.2.2. In some embodiments, degree of opalescence was determined based on Ph. Eur. 2.2.1. Results were reported as the clarity and color of the product solution.
Bacterial endotoxins
In some embodiments, Gram-negative bacterial endotoxins were detected with a chromogenic-kinetic method according to regional pharmacopeia (e.g. Ph. Eur. 2.6.14, USP<85>, JP 4.01). Results were reported as EU/mL of product solution.
Bioburden
In some embodiments, bioburden tests determined the total aerobic microbial count (TAMC) and the total combined yeast/molds counts (TYMC) using a membrane filtration method according to regional pharmacopeia (e.g., Ph. Eur. 2.6.12, USP<61>, JP4.05). In some embodiments, the test solution was filtered and the membrane filter was transferred to the surface of a suitable nutrient agar medium. Results were reported as CFU/mL of composition comprising RNA.
Content In some embodiments, RNA concentration was determined photometrically according to Eur. 2.2.25 at a wavelength of 260 nm utilizing an extinction coefficient of 0.025 *pg-l*cm-l. Results were reported as mg/mL of product solution.
Identity as RNA
In some embodiments, RNA samples were incubated for a defined time period with RNase A, certified to be free of DNases and proteases and then separated by gel-electrophoresis on a precast and pre-stained agarose gel and compared to an RNA sample that had been incubated under identical conditions except for the addition of RNase A. In some embodiments, disappearance of the RNA band upon incubation with RNase A verified the identity as RNA. Results were reported as the presence or absence of an RNA band by gel electrophoresis.
Identity (as RNA) and Integrity.
In some embodiments, denatured RNA samples were separated by denaturing gel electrophoresis on precast and buffered agarose gel pre-stained with a nucleic acid specific dye. In some embodiments, the gel was photographed using a gel documentation system and the length of the RNA band was compared to an RNA of known size (length standard [RNA ladder]). In some embodiments, RNAs were separated by capillary electrophoresis using a system which gives an electropherogram as a result and a quantitative evaluation was performed.
In some embodiments, the conformance of lengths of RNA (and thus indirectly the molar masses) with theoretical values were verified by denaturing gel electrophoresis in comparison to a standard ladder with RNAs of known lengths. In some embodiments, sizes obtained were consistent with the theoretically expected lengths and with reference RNAs, i.e., transcripts from the respective DNA template used. In some embodiments, capillary electrophoresis was applied for quantitative analysis of RNA integrity. In some embodiments, RNAs gave rise to a single peak at the expected retention time consistent with expected lengths as compared to the retention times of a standard ladder. In some embodiments, quantification of the main RNA peak was calculated in relation to the signal intensities in regions of the electropherogram, where degradation products were detectable.
Osmolality
In some embodiments, osmolality of a RNA solution was determined according to regional pharmacopeia (e.g., Ph. Eur. 2.2.35, USP<785>). Results were reported as mOsmol/kg of water. PH
In some embodiments, a pH value was potentiometrically determined according to regional pharmacopeia (e.g., Ph. Eur. 2.2.3, USP<791>) using a microelectrode with an embedded temperature sensor for automatic correction of the measured values.
Residual DNA template
In some embodiments, residual DNA template content derived from the respective linear DNA template was determined using a real-time quantitative PCR test method. For example, in some embodiments, for the PCR a pre -mixed Sybr Green master mix was used according to manufacturer’s recommendations. In some embodiments, amplification and detection of DNA was performed in a real-time thermocycler. In some embodiments, residual DNA template in the sample was quantified in comparison to a standard (serial dilution of plasmid DNA). The results were reported in ng DNA/mg RNA.
Residual dsRNA
In some embodiments, residual dsRNA level was determined using a limit test. In some embodiments, RNA samples and a dsRNA reference (2000 pg dsRNA/pg RNA, 1500 pg dsRN A/ijg RNA, 1000 pg dsRNA/pg RNA, 500 pg dsRNA/pg RNA, or lower representing the upper limit of accepted residual dsRNA content) were immobilized on a positively charged nylon membrane and incubated with a dsRNA-specific monoclonal antibody (mouse IgG (immuno globulin G), clone J2). In some embodiments, after incubation with HRP-conjugated (horseradish peroxidase) anti-mouse-IgG, ECL (Enhanced chemiluminescence) substrate was added to the membrane and chemiluminescence is detected by a bioimager system. In some embodiments, signal intensities were quantified by densitometry, and the values of the RNA samples compared to the signal intensity of the dsRNA reference. Results were reported as complies with the specified upper limit.
RNA sequence (testing of DNA starting material)
In some embodiments, a RNA sequence was deduced from sequencing the DNA template, which served as template for in vitro transcription and defines the primary structure of each RNA. In some embodiments, identity of the starting material and thus identity of the transcribed RNA was controlled by automated sequencing of the RNA encoding region of the template. In some embodiments, results were reported as compliments to the target sequence.
Capping and polyadenylation In some embodiments, a cap-analog was included in the in vitro transcription reaction mixture, which, upon incorporation at the 5’ end during transcription led to RNA with a so-called capl structure. In some embodiments, the percentage of capped RNA for the exemplary batches were characterized by an RNase H based assay. In some embodiments, RNA samples were annealed to a customized biotinylated nucleic acid probe binding close to the 5’ end of the RNA, and RNase H was used to digest the mRNA-probe complex, generating a short fragment corresponding to the 5’ part of the RNA. In some embodiments, streptavidin-coated spin columns or magnetic beads were used for sample clean-up. In some embodiments, purified samples with the 5’ part of the RNA were subjected to liquid chromatographymass spectrometry (LS-MS). In some embodiments, capped and non-capped species were identified by the observed mass values and their MS signals were used to calculate the percentage of capped RNA. Multiple such batches displayed a percentage of capped RNA between 40-70%.
In some embodiments, percentage of polyadenylation (Poly A) attached to the 3’ end of the RNA construct was measured for exemplary batches using droplet digital PCR (ddPCR). For example, in some embodiments, cDNA was generated using a reverse transcription primer that spanned the PolyA and 3’ sequences of the RNA construct and required both for binding. Thus, positive signals indicated polyadenylated RNA and were detected using primers and probes located close to the 3’ end of the RNA construct. In some embodiments, quantitation was based on normalization to the theoretical input of the test sample (UV AJSO nm concentration). Multiple such batches displayed a percentage of polyadenylation of at least 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
Multiple batches of relevant RNAs (e.g., of BNT162b2 RNA) have been produced, including multiple batches that produced at least 5 g. Multiple such batches displayed identity (RNA length) as a single, distinct band migrating at the expected location as compared to a length standard (RNA ladder). Multiple such batches displayed RNA integrity above 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. Multiple such batches displayed content (RNA concentration) of 1.53-1.87 mg/mL.
Multiple such batches displayed pH between 6.0-8.0. Multiple batches displayed osmolality of 25-400 mOsmol/kg, 50-400 mOsmol/kg, wherein osmolality is preferably less than or equal to 200 mOsmol/kg. Multiple such batches displayed residual DNA template levels between 50-1,000 ng DNA per mg RNA, 50-950 ng DNA per mg RNA, 50-900 ng DNA per mg RNA, 50-850 ng DNA per mg RNA, wherein residual DNA template level is preferably less than or equal to 500 ng DNA per mg RNA, 480 ng DNA per mg RNA, 450 ng DNA per mg RNA, 420 ng DNA per mg RNA, 390 ng DNA per mg RNA, 360 ng DNA per mg RNA, 330 ng DNA per mg RNA 300 ng DNA per mg RNA, 270 ng DNA per mg RNA, 240 ng DNA per mg RNA, 210 ng DNA per mg RNA, or lower. Multiple such batches displayed residual dsRNA less than or equal to 2000 pg dsRNA/pg RNA, 1500 pg dsRNA/ug RNA, 1000 pg dsRNA/pg RNA, 500 pg dsRNA/pg RNA, or lower. Multiple such batches displayed bacterial endotoxins at levels less than or equal to 5 EU/mL, 4 EU/mL, 3 EU/mL, 2 EU/mL, 1 EU/mL, or 0.5 EU/mL. Multiple such batches displayed bioburden levels less than or equal to 1 CFU per 1 mL. Multiple such batches displayed potency via detection of a translated protein of expected size compared to a protein ladder.
Multiple batches have been produced, including multiple batches that produced at least 30 g. Multiple such batches displayed an appearance which was a clear (less than or equal to 6 NTU), colorless liquid. Multiple such batches displayed identity (RNA length) as a single, distinct band migrating at the expected location as compared to a length standard (RNA ladder). Multiple such batches displayed RNA identity as RNA by lack of an RNase-resistant band detectable by gel electrophoresis. Multiple such batches displayed RNA integrity above 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. Multiple such batches displayed a desired RNA sequence based on testing (e.g.. sequencing) of DNA starting material. Multiple such batches displayed content (RNA concentration) of 1.53-1.87 mg/mL. Multiple such batches displayed pH between 6.0-8.0. Multiple batches displayed osmolality of 10-100 mOsmol/kg, 20-90 mOsmol/kg, or 30-80 mOsmol/kg, wherein osmolality is preferably less than or equal to 200 mOsmol/kg. Multiple such batches displayed residual DNA template levels between 0.1-100 ng DNA per mg RNA, wherein residual DNA template level is preferably less than or equal 500 ng DNA per mg RNA, 480 ng DNA per mg RNA, 450 ng DNA per mg RNA, 420 ng DNA per mg RNA, 390 ng DNA per mg RNA, 360 ng DNA per mg RNA, 330 ng DNA per mg RNA 300 ng DNA per mg RNA, 270 ng DNA per mg RNA, 240 ng DNA per mg RNA, 210 ng DNA per mg RNA, or lower. Multiple such batches displayed residual dsRNA less than or equal to 2000 pg dsRNA/pg RNA, 1500 pg dsRNA/pg RNA, 1000 pg dsRNA/pg RNA, 500 pg dsRNA/pg RNA, or lower. Multiple such batches displayed bacterial endotoxins at levels less than or equal to 0.5 EU/mL. Multiple such batches displayed bioburden levels less than or equal to 1 CFU per 1 mL.
Example 5: Certain characteristics of exemplary RNA solutions and/or RNA-LNP compositions
The present Example describes certain assessments that may be performed of RNA-LNP compositions.
In some embodiments, RNA length is assessed and, for example, is determined to be a single, distinct band migrating at the expected location as compared to a length standard (RNA ladder). In some embodiments, RNA integrity is assessed to be above 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, RNA content (RNA concentration) is assessed to be within a range of about 1.53-1.87 mg/mL. In some embodiments, an RNA solution for use in accordance with the present disclosure is characterized by a pH between 6.0-8.0. In some embodiments, an RNA solution is characterized by osmolality of 25- 400 mOsmol/kg, 50-400 mOsmol/kg, wherein osmolality is preferably less than or equal to 200 mOsmol/kg. In some embodiments, an RNA solution is characterized by residual DNA template levels between 1-850 ng DNA/mg RNA, wherein residual DNA template level is preferably less than or equal 500 ng DNA per mg RNA, 480 ng DNA per mg RNA, 450 ng DNA per mg RNA, 420 ng DNA per mg RNA, 390 ng DNA per mg RNA, 360 ng DNA per mg RNA, 330 ng DNA per mg RNA 300 ng DNA per mg RNA, 270 ng DNA per mg RNA, 240 ng DNA per mg RNA, 210 ng DNA per mg RNA, or lower. In some embodiments, an RNA solution is characterized by residual dsDNA levels between 75-125 ng dsRNA/pg RNA. In some embodiments, residual dsDNA levels are preferably less than or equal to 2000 pg dsRNA/pg RNA, 1500 pg dsRNA/pg RNA, 1000 pg dsRNA/ug RNA, 500 pg dsRNA/pg RNA, or lower. In some embodiments, an RNA solution is characterized by bacterial endotoxins at levels less than or equal to 0.5 EU/mL. In some embodiments, an RNA solution is characterized by bioburden levels less than or equal to 1 CFU per 10 mL.
In some embodiments, an RNA-LNP preparation is characterized by RNA-LNP size of 60-90 nm. Multiple such batches displayed a polydispersity index (PDI) of 0.05-1. In some embodiments, an RNA- LNP preparation is characterized by RNA integrity above 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, an RNA-LNP preparation is characterized by RNA content between 0.4-1 mg/mL. In some embodiments, an RNA-LNP preparation is characterized by percent encapsulation efficiency above 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, and specifically above, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 92.0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%,
93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%,
94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, or 96.0%. In some embodiments, an RNA-LNP preparation is characterized by cationic lipid levels between 5-7 mg/mL. In some embodiments, an RNA-LNP preparation is characterized by polyethylene glycol (PEG)- lipid levels between 0.5-1 mg/mL. In some embodiments, an RNA-LNP preparation is characterized by phospholipid levels between 1-2 mg/mL. In some embodiments, an RNA-LNP preparation is characterized by sterol levels between 2-3 mg/mL.
In some embodiments, an RNA-LNP preparation is characterized by pH between 6.0-8.0. In some embodiments, an RNA-LNP preparation is characterized by osmolality between 400-600 mOsmol/kg, 450-575 mOsmol/kg, 500-575 mOsmol/kg, or 525-575 mOsmol/kg. In some embodiments, an RNA-LNP preparation is characterized by N/P ratio between 4.5-5.5. In some embodiments, physiochemical properties (e.g., size distribution and shape, and/or surface charge) of RNA-LNPs are assessed and/or monitored. Size distribution and particle shape may be assessed, for example, using asymmetrical flow field-flow fractionation (AF4). In some embodiments, an RNA-LNP preparation is characterized by a size distribution, as measured by AF4 between 20-55 nm. In some embodiments, an RNA-LNP preparation is characterized by a particle shape between 0.6 and 0.8 Rz/Rh. In some embodiments, an RNA-LNP preparation is characterized by a surface charge, as assessed by electrophoretic light scattering, between -3.5 and -1.5 mV.
Example 6: Exemplary characterization of RNA-LNPs
The present Example describes additional characterization of (e.g., expression of encoded protein from) exemplary RNA-LNP preparations (e.g., drug product batches). In some embodiments, to determine protein expression, RNA-LNPs were added to mammalian cells (e.g., HEK-293T cells) at an RNA dose (.e.g., a dose of 60 ng or 100 ng). In some embodiments, protein expression is measured (e.g., by flow cytometry) using an antibody directed against the expressed protein. In some embodiments, (e.g., prior to analysis by flow cytometry), cells ae labeled with a Live/Dead dye and the percent of live cells (to eliminate background signal) expressing protein (e.g., spike protein) is enumerated. In some embodiments, a positive control is utilized (e.g., RNA drug substance transfected with lipofectamine) to confirm protein expression. In some embodiments, expression is measured by quantifying the number of cells that had a positive signal for bound antibody. In some embodiments, percent positive cells range from 5-60%. In some embodiments, percent positive cells is at least 30% or higher.
In some embodiments, protein expression of an exemplary RNA-LNP product is measured on different days. In some embodiments, it is recommended that degree of cell viability be considered when evaluating assay results, and particularly when comparing different sets of assay results. For example, in some embodiments, it may be desirable to compare results achieved with populations of cells whose percent viability is comparable, e.g., does not differ by more than about 5%, 4%, 3%, 2%, 1% or less.
In some embodiments, protein expression is characterized for exemplary RNA-LNPs, with various doses of RNA. In some embodiments, expression within range of 20-70% positive cells is observed. In some embodiments, for a 60 ng dose, at least20-40% positive cells are observed, for a 100 ng dose, expression between 25-60% positive cells is observed, and/or for a 150 ng dose, expression between 40-70% positive cells is observed. Often, observed expression is above 35% positive cells for multiple (e.g., all) doses.
In some embodiments, percentage of capped RNA and/or polyadenylated RNA is measured. In some embodiments, percentage of capped RNA is characterized by an RNase H based assay. In some embodiments, capped and non-capped species are identified by the observed mass value and their MS signals are used to calculate the percentage of capped RNA. In some embodiments, a percentage of capped RNA is between 40-70%.
In some embodiments, percentage of polyadenylation (Poly A) attached to the 3’ end of an RNA is measured, for example using droplet digital PCR (ddPCR). In some embodiments, quantitation is based on normalization to the theoretical input of test sample (UV A260 nm concentration). In some embodiments, a percentage of polyadenylation of at least 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% is observed.
Example 7 : Exemplary manufacturing increased batch sizes of RNA-LNPs
The present example demonstrates Exemplary manufacturing of RNA-LNPs at a larger batch size.
In brief, an exemplary composition comprising RNA with a concentration with 2.25 mg/mL can be conditioned with citrate pH 4.0 to arrive at 0.2 or 0.4 mg/mL of composition comprising RNA in 40 mM citrate. In some embodiments, lipids are dissolved in absolute ethanol at 35°C and filtered through a 0.2pm PES filter before use. In some embodiments, lipid stocks are prepared at a 15 or 30 mg/mL. In some embodiments, three volumes of the conditioned RNA drug substance phase is mixed with one volume of the lipid stock in a continuous flow process. In some embodiments, shortly after the initial mixing step, another two volumes of citrate pH 4.0 are added continuously to the LNP stream. In some embodiments, resulting material constitutes the primary LNP from which in-process control post-mixing is taken.
In some embodiments, primary LNP (e.g. the liquid composition discussed further above) are connected to a TFF device and (i) diafiltered with two volumes of citrate pH 4, (ii) concentrated to 0.5 mg/mL, (iii) diafiltered with eight volumes of PBS, and (iv) concentrated to about 1.2 mg/mL. In some embodiments, in-process control post-TFF is taken. In some embodiments, material is harvested from the TFF device and filtered through a 0.2 pm PES filter. In some embodiments, in-process control post 0.2pm filtration is taken. In some embodiments, PBS and 1.2M sucrose are added to arrive at 0.5 mg/mL LNP (expressed as RNA drug substance concentration) in 300 mM sucrose and 0.8x PBS. In some embodiments, this product constituted RNA-LNPs, and in-process control post bulk compounding is taken. In some embodiments, RNA-LNPs are filtered a further time through a 0.2 pm PES filter. In some embodiments, in-process data and characterization are highly similar between an upscale and a reference manufacturing processes scales. In some embodiments produced RNA-LNP are characterized by particle size of 50-80 nm. In some embodiments produced RNA-LNP are characterized by a polydispersity index (PDI) of 0.05-0.2. Without wishing to be bound by any particular theory, it is proposed that technologies described herein for avoiding, reducing, and/or removing air in RNA-LNP compositions may protect particle size and/or polydispersity characteristics, for example over time and/or under conditions of storage and/or transport.
In some embodiments produced RNA-LNP are characterized by RNA integrity above 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments produced RNA-LNP are characterized byRNA content between 500-600 pg. In some embodiments produced RNA-LNP are characterized bypercent encapsulation efficiency above 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, and specifically above, 91.0%, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91.6%, 91.7%,
91.8%, 91.9%, 92.0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%,
93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3%,
94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%,
95.7%, 95.8%, 95.9%, or 96.0%. In some embodiments produced RNA-LNP are characterized bypH between 6.0-8.0. In some embodiments produced RNA-LNP are characterized byosmolality of 400-600 mOsmol/kg, 475-575 mOsmol/kg, or 525-575 mOsmol/kg. In some embodiments produced RNA-LNP are characterized by N/P ratio between 4-6.
In some embodiments, RNA-LNPs may be characterized for lipid content, for example compared to theoretical values, at one or more steps throughout manufacturing. In some embodiments produced RNA- LNP are characterized by lipid composition of cationic lipid between 95-105% of the theoretical value and/or 4,000 to 9,500 pg/mL and/or by relative mole percent, 45-55%. In some embodiments produced RNA-LNP are characterized bylipid composition of polyethylene glycol (PEG-lipid) between 90-105% of the theoretical value and/or 500-1,200 pg/mL and/or by relative mole percent, 1-3%. In some embodiments produced RNA-LNP are characterized bylipid composition of phospholipid between 90- 105% of the theoretical value and/or 900-2,100 pg/mL and/or by relative mole percent, 8-12%. Without being bound by any one theory, it is possible phospholipid may reach as high as 135% of the theoretical value due to assay noise. In some embodiments produced RNA-LNP are characterized bylipid composition of sterol between 90-105% of the theoretical value and/or 1,700-4,000 pg/mL and/or by relative mole percent, 37-43%.
In some embodiments, produced RNA-LNP are characterized by using electron microscopy, CD spectroscopy, small angle X-ray scattering (SAXS), in vitro expression (IVE), and/or animal expression and/or immunogenicity studies. In some embodiments, an RNA-LNP preparation is exposed to certain storage and/or transport condtions. For example, in some embodiments, an RNA-LNP preparation is transported, e.g. at 5 °C, from a LNP manufacturing site to a different location; in some such embodiments, it may be transported in aliquots which may then be pooled. In some embodiments, a preparation may be maintained for a period of time (e.g., several days), for example at 5°C. In some embodiments, optionally after such transport and/or storage, a preparation may be filled into vials (e.g., into 2R vials), for example using an automated fill line.
In some embodiments, RNA-LNP material (e.g., vialed material) is frozen and/or stored and/or transported in a frozen state (e.g., at -20°C or below, such as at -70°C)
In some embodiments, potency of RNA-LNP materials (e.g., after storage and/or transport) is measured, for example using an IVE assay described herein.
In some embodiments, different doses (e.g., 100 ng, 200 ng, 250 ng) of an RNA-LNP preparation are prepared and/or tested (e.g., to exclude saturation effects). In some embodiments, RNA-LNPs administered at 100 ng display percent cell expression between 25-75% and a Mean Fluorescence Intensity (MFI) between 200-350; in some embodiments, RNA-LNPs administered at 200 ng display percent cell expression between 60-90% and a MFI of 250-450; in some embodiments, RNA-LNPs administered at 250 ng display percent cell expression between 50-95% and a MFI of 200-500.
In some embodiments, biological activity of produced materials are assessed in an appropriate animal model. For example, in some embodiments, immunogenicity of RNA-LNP vaccine preparations (e.g., BNT162b2) are assessed in a mouse immunogenicity model. In some embodiments, BALB/c mice are immunized once (on day 0) with formulated RNA-LNPs at a 1 ug dose level, or with buffer alone (control group). Immunizations are given intramuscularly (i.m.) in a dose volume of 20 pL. Blood is collected once weekly for three weeks (days 7, 14, and 21) to measure the antibody immune response by ELISA and pseudovirus-based neutralization assay (pVNT). At day 28, blood is collected and animals are euthanized for spleen collection and additional analysis of the T-cell response in splenocytes by ELISpot and intracellular cytokine staining (ICS).
Example 8: Exemplary characterization of impurities
The present example demonstrates Exemplary characterization and removal of impurities from a composition comprising RNA.
In some embodiments, impurities from the starting and raw materials as well as early process steps are significantly removed during purification of a composition comprising RNA. Multiple such batches display less than the limit of quantification (e.g., 1 pg/mL, 0.8 pg/mL, 0.6 pg/mL, 0.4 pg/mL, 0.2 pg/mL) residual NTP/cap. Multiple such batches display less than the limit of quantification (e.g., 1 pg/mL, 0.8 pg/mL, 0.6 pg/mL, 0.4 pg/mL, 0.2 pg/mL) of residual spermidine. Multiple such batches display less than the limit of quantification (e.g., 1 pg/mL, 0.8 pg/mL, 0.6 pg/mL, 0.4 pg/mL, 0.2 pg/mL) residual dithiothreitol. Multiple such batches display less than 5%, 4%, 3%, 2%, 1% ethanol or lower (e.g., 0.1- 0.3%, 0.1-0.25%, or 0.12-0.25%). Multiple such batches display less than 1 U/mL, 0.75 U/mL, 0. 5 U/mL, 0.25 U/mL, 0.10 U/mL, 0.05 U/mL, 0.01 U/mL or lower of residual DNase I. Multiple such batches display less than the limit of quantification (e.g., 1 mg/kg, 0.8 mg/kg, 0.6 mg/kg, 0.4 mg/kg, 0.2 mg/kg, or lower) of residual magnesium. Multiple such batches display less than the limit of quantification (e.g., 1 mg/kg, 0.8 mg/kg, 0.6 mg/kg, 0.4 mg/kg, 0.2 mg/kg, or lower) of residual calcium. Multiple such batches display less than or equal to 1000 ng/mg, 750 ng/mg, 500 ng/mg, 250 ng/mg, 100 ng/mg, 50 ng/mg, 10 mg/ng, or lower RNA of residual host cell DNA (e.g., 1-30 ng/mg). Multiple such batches display less than 1000 ng/mg, 750 ng/mg, 500 ng/mg, 250 ng/mg, 100 ng/mg, 50 ng/mg, or lower RNA of residual host cell protein (e.g. , less than 50 ng/mg RNA, less than 45 ng/mg RNA, less than 40 ng/mg RNA, or less than 30 ng/mg RNA).
In some embodiments, residual E. coli proteins may be present in the composition comprising RNA as a left-over impurity from the DNA template or recombinant enzymes (e.g., T7 RNA polymerase, inorganic pyrophosphatase, DNase I, and RNase inhibitor), which were all recombinantly expressed in E. coli. In some embodiments, the purification process with magnetic beads comprised multiple binding, elution, and washing steps. For example, in some embodiments, with the limit of detection, this corresponded to a reduction factor of about 400 (e.g., 300-500, 350-500, 400-500, 300-450, 300-400, 350-450). However, in some embodiments, an even higher removal could be calculated based on the efficacy of individual binding and washing steps used in the course of the magnetic bead purification. In some embodiments, the calculated maximum amount of host cell proteins introduced by the four exemplary enzymes equaled approximately 400 ng/mg RNA. In some embodiments, subsequent purification of the RNA by a reduction factor of 400 decreases this amount, and/or to a purity of at least 0.7, at least 0.75, at least 0.80, at least 0.85, at least 0.9, or at least 0.95. In some embodiments, calculated values were in agreement with the measured results for residual host cell proteins for compositions comprising RNA described in previous and ongoing clinical studies.
In some embodiments, to assess potential further impurities residing from the magnetic beads itself, residual Fe2+ions in composition comprising RNA were measured. In some embodiments, residual magnetic beads are removed from the composition comprising RNA via filtration steps throughout the manufacturing process. In some embodiments, filter cassettes consisting of filters with pore sizes of 0.22 pm were used. Example 9: Exemplary container closure integrity assessment and/or monitoring
The present Example demonstrates exemplary assessment and/or monitoring of container closure integrity of a vial, stopper, and/or overseal container closure system. In some embodiments, container closure integrity was assessed on representative container closure system samples when exposed to sub-zero temperatures (e.g., less than -70°C, less than -80°C, or lower). In some embodiments, laser-based headspace carbon dioxide and oxygen detection analysis (HSA) was used to detect loss of container closure integrity in a 2 mL clear glass tubing vial configuration having a 1 atm air headspace following storage. Without being bound by any one theory, HSA’s principle of operation is based on the initial headspace of a container closure system’s air and atmospheric pressure levels. After exposing samples to an environment containing nitrogen or carbon dioxide at low temperatures (e.g., liquid nitrogen, dry ice, etc.), vials without integrity will reveal loss of oxygen and/or an increase in carbon dioxide in the vial headspace. In some embodiments, HSA measurements were conducted using Lighthouse Instruments Oxygen and FMS-Carbon Dioxide Headspace Analyzers. In some embodiments, analyzers were calibrated using NIST-traceable standards (Lighthouse Instruments). In some embodiments, empty vials (no solution fill) were purged with nitrogen to produce headspace with low oxygen.
In some embodiments, for samples stored at -70°C, headspace oxygen analysis testing was performed over a 96 hour period with measurements taken at time (T) 0, T24, and T96 hours. In some embodiments, samples were prepared on two separate filling lines and underwent crimping at three different crimping forces (low, medium, or high). In some embodiments, for each crimp setting sample set, five samples were analyzed at TO at room temperature. In some embodiments, following testing, the five samples were returned to the freezer. In some embodiments, five samples were analyzed at T24 at room temperature (e.g., samples underwent one freeze-thaw cycle). In some embodiments, following testing, the five samples were returned to the freezer. In some embodiments, five samples were analyzed at T96 at room temperature (e.g., samples underwent two freeze-thaw cycles). Multiple such samples demonstrated essentially no change in percent oxygen (e.g., -1 to 1%, -0.75 to 0.75%, -0.5 to 0.5%) when samples were stored at -70°C throughout the 96 hour time course after each of the three different crimping forces tested (low, medium or high).
In some embodiments, for samples stored at -84°C, headspace oxygen analysis testing was performed over a 72 hour period with measurements taken at time TO, T24, T48, and T72 hours. In some embodiments, samples were prepared on two separate filling lines and underwent crimping at three different crimping forces (low, medium, or high). In some embodiments, for each crimp setting sample set, thirty samples were analyzed at TO at room temperature. In some embodiments, following testing, the samples were returned to the freezer. In some embodiments, five samples were analyzed at T24 at room temperature (e.g., samples underwent one freeze-thaw cycle). In some embodiments, following testing, the five samples were returned to the freezer. In some embodiments, the five T24 samples, plus five additional samples, were removed from the freezer and headspace oxygen analysis was completed at T48 (e.g., five of the ten samples underwent two freeze -thaw cycles). In some embodiments, following testing, all ten samples were returned to the freezer. In some embodiments, the ten T48 samples plus ten additional samples were removed from the freezer and headspace oxygen analysis was completed at T72 (e.g., five of the twenty samples underwent a third freeze -thaw cycle). In some embodiments, for example, a total of 140 samples were tested after freezing at -84°C. In some embodiments, all samples were tested after one freeze-thaw cycle, 70 were tested after two freeze -thaw cycles, and 35 samples were tested after three freeze-thaw cycles. Multiple such samples demonstrated essentially no change in percent oxygen (e.g., -1 to 1%, -0.75 to 0.75%, -0.5 to 0.5%) when samples were stored at -84°C throughout the 72 hour time course after each of the three different crimping forces tested (low, medium or high). A single, low crimp force sample was determined to have elevated oxygen content following storage and freeze -thaw.
In some embodiments, integrity of the vial can be assessed for residual seal force (RSF). In some embodiments, RSF is the stress an elastomeric closure will continue to exert against the glass vial finish and the overseal after capping is complete. In some embodiments, RSF can be utilized to assess and/or monitor container closure integrity.
In some embodiments, representative container closure system components were assembled (Gerresheimer 2 mL Vial with Datwyler FM457 V9481 stopper combination) and crimped with four crimping forces (low, -5 Ibf, mid low, ~8.7 Ibf, mid high, -11.7 lb, and high, -21.4 Ibf). In some embodiments, representative container closure system components were assembled (Schott 2 mL Vial with Datwyler FM457 V9145 stopper combination) and crimped with four crimping forces (low, -3.5 Ibf, mid low, -7.3 Ibf, mid high, -12.5 lb, and high, -18.2 Ibf). In some embodiments, RSF values were measured at the initial crimping time (TO) and at T72 for twelve representative samples for each group. In some embodiments, thirty samples from each group were tested for RSF prior to freezing. In some embodiments, vials were subjected to a room temperature container closure test to confirm the absence of leakage prior to subjecting the samples to freezing at -80°C. In some embodiments, vials determined to be integral were frozen and held in a -80°C standard freezer for one week. In some embodiments, freezer temperature was approximately -78 °C to maintain an appropriate level of carbon dioxide for the test environment. In some embodiments, a carbon dioxide rich environment was created in the freezer using dry ice. In some embodiments, vials were warmed to room temperature and RSF was measured or each vial that was frozen. Multiple such samples utilizing a Gerresheimer 2 mL Vial with Datwyler FM457 V9481 stopper combination displayed RSF between 3-6 Ibf at low crimping force, 8-11 Ibf at mid low crimping force, 11-18 Ibf at mid high crimping force, and 20-30 Ibf at high crimping force. Multiple such samples utilizing Schott 2 mL Vial with Datwyler FM457 V9145 stopper combination displayed RSF between 3-6 Ibf at low crimping force, 6-9 at mid low crimping force, 11-15 Ibf at mid high crimping force, and 17-23 Ibf at high crimping force.
Example 10: Exemplary RNAs utilized in accordance with the present disclosure
The present Example describes certain mRNAs (e.g., nucleoside-modified mRNAs) useful in accordance with the present disclosure. For example, in some embodiments, an mRNA comprises a nucleic acid sequence encoding a coronavirus antigen. Exemplary sequences of such coronavirus antigen are shown in Table 3 below.
In some embodiments, an mRNA encoding a coronavirus antigen can comprise one or more structural elements optimized for maximal efficacy of the RNA, including, e.g., but not limited to 5'-cap, 5'-UTR, 3'-UTR, poly(A)-tail, and combinations thereof. In some embodiments, such an mRNA can comprise a modified nucleotide, e.g., a modified uridine such as 1-methyl-pseudouridine, instead of uridine. In some embodiments, such an mRNA can comprise a 5’ cap structure of m27’3 °Gppp(mi2 °)ApG. In some embodiments, such an mRNA can comprise 5'-UTR and 3'-UTR, which comprise the nucleotide sequence of hAg-Kozak set forth in SEQ ID NO: 12 (AACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC) and the nucleotide sequence of a FI element set forth in SEQ ID NO: 13 (CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUC CCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUA GUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACC CCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUA CUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC), respectively. In some embodiments, such an mRNA can comprise a poly(A)-tail comprising the sequence of A30L70 set forth in SEQ ID NO: 14 (AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA).
In some embodiments, an mRNA encoding a coronavirus antigen is represented as follows:
BNT162b2; RBP020.1 (SEQ ID NO: 10; SEQ ID NO: 7)
Structure m27’3 °Gppp(mi2 °)ApG)-hAg-Kozak-SlS2-PP-FI-A30L70
Encoded antigen Viral spike protein (S1S2 protein) of the SARS-CoV-2 (S1S2 full-length protein, sequence variant) Nucleotide Sequence of RBP020.1 (SEO ID NO: 10)
Nucleotide sequence is shown with individual sequence elements as indicated in bold letters. In addition, the sequence of the translated protein is shown in italic letters below the coding nucleotide sequence (* = stop codon).
102030405053
AGAAUAAACU AGUAUUCUUC UGGUCCCCAC AGACUCAGAG AGAACCCGCC ACC hAg-Kozak
63738393103113
AUGUUUGUGU UUCUUGUGCU GCUGCCUCUU GUGUCUUCUC AGUGUGUGAA UUUGACAACA
M F V F L V L L P L V S S Q C V N L T T
S protein
123133143153163173
AGAACACAGC UGCCACCAGC UUAUACAAAU UCUUUUACCA GAGGAGUGUA UUAUCCUGAU
R T Q L P P A Y TN S F T R G V Y YP D
S protein
183193203213223233
AAAGUGUUUA GAUCUUCUGU GCUGCACAGC ACACAGGACC UGUUUCUGCC AUUUUUUAGC
K V F R S S V L H S T Q D L F L P F F S
S protein
243253263273283293
AAUGUGACAU GGUUUCAUGC AAUUCAUGUG UCUGGAACAA AUGGAACAAA AAGAUUUGAU
N V T W F H A I H V S G T N G T K R F D
S protein
303313323333343353
AAUCCUGUGC UGCCUUUUAA UGAUGGAGUG UAUUUUGCUU CAACAGAAAA GUCAAAUAUU
NP V L P F ND G V Y F A S T E K S N I
S protein
363373383393403413 AUUAGAGGAU GGAUUUUUGG AACAACACUG GAUUCUAAAA CACAGUCUCU GCUGAUUGUG
I R G W I F G T T L D S K T Q S L L I V
S protein
423433443453463473
AAUAAUGCAA CAAAUGUGGU GAUUAAAGUG UGUGAAUUUC AGUUUUGUAA UGAUCCUUUU
N N A T N V V I K V C E F Q F C N D P F
S protein
483493503513523533
CUGGGAGUGU AUUAUCACAA AAAUAAUAAA UCUUGGAUGG AAUCUGAAUU UAGAGUGUAU
L G V Y Y H K N N K S W M E S E F R V Y
S protein
543553563573583593
UCCUCUGCAA AUAAUUGUAC AUUUGAAUAU GUGUCUCAGC CUUUUCUGAU GGAUCUGGAA
.8 .8 A N N C T F E Y V S Q P F L M D L E
S protein
603613622633643653
GGAAAACAGG GCAAUUUUAA AAAUCUGAGA GAAUUUGUGU UUAAAAAUAU UGAUGGAUAU
GKQ G N F K N L R E F V F KN I D G Y
S protein
663673683693703713
UUUAAAAUUU AUUCUAAACA CACACCAAUU AAUUUAGUGA GAGAUCUGCC UCAGGGAUUU
F K I Y S K H TP I N L V R D L P Q G F
S protein
723733743753763773
UCUGCUCUGG AACCUCUGGU GGAUCUGCCA AUUGGCAUUA AUAUUACAAG AUUUCAGACA
SA L E P L V D L P I G I N I T R F Q T
S protein
783793803813823833 CUGCUGGCUC UGCACAGAUC UUAUCUGACA CCUGGAGAUU CUUCUUCUGG AUGGACAGCC
L L A L H R S Y L T P G D S S S G W T A
S protein
843 853 863 873 883 893
GGAGCUGCAG CUUAUUAUGU GGGCUAUCUG CAGCCAAGAA CAUUUCUGCU GAAAUAUAAU
G A A A Y Y V G Y L Q P R T F L L K Y N
S protein
903 913 923 933 943 953
GAAAAUGGAA CAAUUACAGA UGCUGUGGAU UGUGCUCUGG AUCCUCUGUC UGAAACAAAA
E N G T I T D A V D C A L D P L S E T K
S protein
963 973 983 993 1003 1013
UGUACAUUAA AAUCUUUUAC AGUGGAAAAA GGCAUUUAUC AGACAUCUAA UUUUAGAGUG
C T L K S F T V E K G I Y Q T S N F R V
S protein
1023 1033 1043 1053 1063 1073
CAGCCAACAG AAUCUAUUGU GAGAUUUCCA AAUAUUACAA AUCUGUGUCC AUUUGGAGAA
Q P T E S I V R F P N I T N L C P F G E
S protein
1083 1093 1103 1113 1123 1133
GUGUUUAAUG CAACAAGAUU UGCAUCUGUG UAUGCAUGGA AUAGAAAAAG AAUUUCUAAU
V F N A T R F A S V Y A W N R K R I S N
S protein
1143 1153 1163 1173 1183 1193
UGUGUGGCUG AUUAUUCUGU GCUGUAUAAU AGUGCUUCUU UUUCCACAUU UAAAUGUUAU
C V A D Y S V L Y N S A S F S T F K C Y
S protein
1203 1213 1223 1233 1243 1253 GGAGUGUCUC CAACAAAAUU AAAUGAUUUA UGUUUUACAA AUGUGUAUGC UGAUUCUUUU
G V S P T K L N D L C F T N V Y A D S F
S protein
126312731283129313031313
GUGAUCAGAG GUGAUGAAGU GAGACAGAUU GCCCCCGGAC AGACAGGAAA AAUUGCUGAU
V I R G D E V R Q I A P G Q T G KI A D
S protein
132313331343135313631373
UACAAUUACA AACUGCCUGA UGAUUUUACA GGAUGUGUGA UUGCUUGGAA UUCUAAUAAU
Y N Y K L P D D F T G C V IA W N S NN
S protein
138313931403141314231433
UUAGAUUCUA AAGUGGGAGG AAAUUACAAU UAUCUGUACA GACUGUUUAG AAAAUCAAAU
L D S K V G G N Y N YL Y R L F R KS N
S protein
144314531463147314831493
CUGAAACCUU UUGAAAGAGA UAUUUCAACA GAAAUUUAUC AGGCUGGAUC AACACCUUGU
L K P F E R D I S T E I Y Q A G S T P C
S protein
150315131523153315431553
AAUGGAGUGG AAGGAUUUAA UUGUUAUUUU CCAUUACAGA GCUAUGGAUU UCAGCCAACC
N G V E G F N C YF P L Q S Y G F Q P T
S protein
156315731583159316031613
AAUGGUGUGG GAUAUCAGCC AUAUAGAGUG GUGGUGCUGU CUUUUGAACU GCUGCAUGCA
N G V G Y Q P Y R V V V L S F E L L H A
S protein
162316331643165316631673 CCUGCAACAG UGUGUGGACC UAAAAAAUCU ACAAAUUUAG UGAAAAAUAA AUGUGUGAAU
P A T V C G P K K S T N L V K N K C V N
S protein
168316931703171317231733
UUUAAUUUUA AUGGAUUAAC AGGAACAGGA GUGCUGACAG AAUCUAAUAA AAAAUUUCUG
F N F N G L T G T G V L T E S N K K F L
S protein
174317531763177317831793
CCUUUUCAGC AGUUUGGCAG AGAUAUUGCA GAUACCACAG AUGCAGUGAG AGAUCCUCAG
P F Q Q F G R D I A D T T D A V R D P Q
S protein
180318131823183318431853
ACAUUAGAAA UUCUGGAUAU UACACCUUGU UCUUUUGGGG GUGUGUCUGU GAUUACACCU
T L E I L D I T P C S F G G V S V I T P
S protein
186318731883189319031913
GGAACAAAUA CAUCUAAUCA GGUGGCUGUG CUGUAUCAGG AUGUGAAUUG UACAGAAGUG
G T N T S N Q V A V L Y Q D V N C T E V
S protein
192319331943195319631973
CCAGUGGCAA UUCAUGCAGA UCAGCUGACA CCAACAUGGA GAGUGUAUUC UACAGGAUCU
P V A I H A D Q L T P T W R V Y S T G S
S protein
198319932003201320232033
AAUGUGUUUC AGACAAGAGC AGGAUGUCUG AUUGGAGCAG AACAUGUGAA UAAUUCUUAU
N V F Q T R A G C L I G A E H V N N S Y
S protein
204320532063207320832093 GAAUGUGAUA UUCCAAUUGG AGCAGGCAUU UGUGCAUCUU AUCAGACACA GACAAAUUCC
E C D I P I GA G ! CA S Y Q T Q T N S
S protein
210321132123213321432153
CCAAGGAGAG CAAGAUCUGU GGCAUCUCAG UCUAUUAUUG CAUACACCAU GUCUCUGGGA
P R R A R S V A S Q S I I A Y T M S L G
S protein
216321732183219322032213
GCAGAAAAUU CUGUGGCAUA UUCUAAUAAU UCUAUUGCUA UUCCAACAAA UUUUACCAUU
A E N S V A Y S N N S I A I P T N F T I
S protein
222322332243225322632273
UCUGUGACAA CAGAAAUUUU ACCUGUGUCU AUGACAAAAA CAUCUGUGGA UUGUACCAUG
S V T T E I L P V S M T K T S V D C T M
S protein
228322932303231323232333
UACAUUUGUG GAGAUUCUAC AGAAUGUUCU AAUCUGCUGC UGCAGUAUGG AUCUUUUUGU
Y I C G D S T E C S N L L L Q Y G S F C
S protein
234323532363237323832393
ACACAGCUGA AUAGAGCUUU AACAGGAAUU GCUGUGGAAC AGGAUAAAAA UACACAGGAA
T Q L N R A L T G I A V E Q D K N T Q E
S protein
240324132423243324432453
GUGUUUGCUC AGGUGAAACA GAUUUACAAA ACACCACCAA UUAAAGAUUU UGGAGGAUUU
V F A Q V K Q I Y K T P P I K D F G G F
S protein
246324732483249325032513 AAUUUUAGCC AGAUUCUGCC UGAUCCUUCU AAACCUUCUA AAAGAUCUUU UAUUGAAGAU
NF S Q I L P D F S K P S K R S F I E D
S protein
252325332543255325632573
CUGCUGUUUA AUAAAGUGAC ACUGGCAGAU GCAGGAUUUA UUAAACAGUA UGGAGAUUGC
L L F N K V TLA D A G F I K Q Y G D C
S protein
258325932603261326232633
CUGGGUGAUA UUGCUGCAAG AGAUCUGAUU UGUGCUCAGA AAUUUAAUGG ACUGACAGUG
L G D I A A R D L I C A Q K F N G L T V
S protein
264326532663267326832693
CUGCCUCCUC UGCUGACAGA UGAAAUGAUU GCUCAGUACA CAUCUGCUUU ACUGGCUGGA
L P P L L T D EM I A Q Y T S A L L A G
S protein
270327132723273327432753
ACAAUUACAA GCGGAUGGAC AUUUGGAGCU GGAGCUGCUC UGCAGAUUCC UUUUGCAAUG
TI T S G W TF G A G A A L Q I P F A M
S protein
276327732783279328032813
CAGAUGGCUU ACAGAUUUAA UGGAAUUGGA GUGACACAGA AUGUGUUAUA UGAAAAUCAG
Q M A Y R F N G I G V T Q N V L Y E N Q
S protein
282328332843285328632873
AAACUGAUUG CAAAUCAGUU UAAUUCUGCA AUUGGCAAAA UUCAGGAUUC UCUGUCUUCU
K L I A N Q F N S A I G K I Q D S L S S
S protein
288328932903291329232933 ACAGCUUCUG CUCUGGGAAA ACUGCAGGAU GUGGUGAAUC AGAAUGCACA GGCACUGAAU
T A S A L G K L Q D V V N Q N A Q A L N
S protein
2943 2953 2963 2973 2983 2993
ACUCUGGUGA AACAGCUGUC UAGCAAUUUU GGGGCAAUUU CUUCUGUGCU GAAUGAUAUU
T L V K Q L S S N F G A I S S V L N D I
S protein
3003 3013 3023 3033 3043 3053
CUGUCUAGAC UGGAUCCUCC UGAAGCUGAA GUGCAGAUUG AUAGACUGAU CACAGGAAGA
L S R L D P P E A E V Q I D R L I T G R
S protein
3063 3073 3083 3093 3103 3113
CUGCAGUCUC UGCAGACUUA UGUGACACAG CAGCUGAUUA GAGCUGCUGA AAUUAGAGCU
L Q S L Q T Y V T Q Q L I R A A E I R A
S protein
3123 3133 3143 3153 3163 3173
UCUGCUAAUC UGGCUGCUAC AAAAAUGUCU GAAUGUGUGC UGGGACAGUC AAAAAGAGUG
S A N L A A T K M S E C V L G Q S K R V
S protein
3183 3193 3203 3213 3223 3233
GAUUUUUGUG GAAAAGGAUA UCAUCUGAUG UCUUUUCCAC AGUCUGCUCC ACAUGGAGUG
D F C G K G Y H L M S F P Q S A P H G V
S protein
3243 3253 3263 3273 3283 3293
GUGUUUUUAC AUGUGACAUA UGUGCCAGCA CAGGAAAAGA AUUUUACCAC AGCACCAGCA
V F L H V T Y V P A Q E K N F T T A P A
S protein
3303 3313 3323 3333 3343 3353 AUUUGUCAUG AUGGAAAAGC ACAUUUUCCA AGAGAAGGAG UGUUUGUGUC UAAUGGAACA
I C H D G K A H F P R E G V F V S N G T
S protein
336333733383339334033413
CAUUGGUUUG UGACACAGAG AAAUUUUUAU GAACCUCAGA UUAUUACAAC AGAUAAUACA
H W F V T Q R N F Y E P Q I I T T D N T
S protein
342334333443345334633473
UUUGUGUCAG GAAAUUGUGA UGUGGUGAUU GGAAUUGUGA AUAAUACAGU GUAUGAUCCA
F V S G N C D V V I G I V N N T V Y D P
S protein
348334933503351335233533
CUGCAGCCAG AACUGGAUUC UUUUAAAGAA GAACUGGAUA AAUAUUUUAA AAAUCACACA
L Q P E L D S F K E E L D K Y F K N H T
S protein
354335533563357335833593
UCUCCUGAUG UGGAUUUAGG AGAUAUUUCU GGAAUCAAUG CAUCUGUGGU GAAUAUUCAG
S P D V D L G D I S G I N A S V V N I Q
S protein
360336133623363336433653
AAAGAAAUUG AUAGACUGAA UGAAGUGGCC AAAAAUCUGA AUGAAUCUCU GAUUGAUCUG
K E I D R L N E VA K N L N E S L I D L
S protein
366336733683369337033713
CAGGAACUUG GAAAAUAUGA ACAGUACAUU AAAUGGCCUU GGUACAUUUG GCUUGGAUUU
Q E L G K Y E Q Y I K W P W Y I WL G F
S protein
372337333743375337633773 AUUGCAGGAU UAAUUGCAAU UGUGAUGGUG ACAAUUAUGU UAUGUUGUAU GACAUCAUGU
I A G L I A I V M V T I M L C C M T S C
S protein
3783 3793 3803 3813 3823 3833
UGUUCUUGUU UAAAAGGAUG UUGUUCUUGU GGAAGCUGUU GUAAAUUUGA UGAAGAUGAU
C S C L K G C C S C G S C C K F D E D D
S protein
3843 3853 3863 3873 3878
UCUGAACCUG UGUUAAAAGG AGUGAAAUUG CAUUACACAU GAUGA
S E P V L K G V K L H Y T * *
S protein
3888 3898 3908 3918 3928 3938
CUCGAGCUGG UACUGCAUGC ACGCAAUGCU AGCUGCCCCU UUCCCGUCCU GGGUACCCCG
FI element
3948 3958 3968 3978 3988 3998
AGUCUCCCCC GACCUCGGGU CCCAGGUAUG CUCCCACCUC CACCUGCCCC ACUCACCACC
FI element
4008 4018 4028 4038 4048 4058
UCUGCUAGUU CCAGACACCU CCCAAGCACG CAGCAAUGCA GCUCAAAACG CUUAGCCUAG
FI element
4068 4078 4088 4098 4108 4118
CCACACCCCC ACGGGAAACA GCAGUGAUUA ACCUUUAGCA AUAAACGAAA GUUUAACUAA
FI element
4128 4138 4148 4158 4168 4173
GCUAUACUAA CCCCAGGGUU GGUCAAUUUC GUGCCAGCCA CACCCUGGAG CUAGC
FI element
4183 4193 4203 4213 4223 4233
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA GCAUAUGACU AAAAAAAAAA AAAAAAAAAA Poly(A)
42434253426342734283
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
Poly(A)
In some embodiments, an mRNA encoding a coronavirus antigen is represented as follows:
BNT162b2; RBP020.2 (SEQ ID NO: 11; SEQ ID NO: 7)
Structure rm73 °Gppp(mi2 °)ApG)-hAg-Kozak-SlS2-PP-FI-A30L70
Encoded antigen Viral spike protein (S1S2 protein) of the SARS-CoV-2 (S1S2 full-length protein, sequence variant)
Nucleotide Sequence of RBP020.2 (SEQ ID NO: 11)
Nucleotide sequence is shown with individual sequence elements as indicated in bold letters. In addition, the sequence of the translated protein is shown in italic letters below the coding nucleotide sequence (* = stop codon).
102030405053
AGAAUAAACU AGUAUUCUUC UGGUCCCCAC AGACUCAGAG AGAACCCGCC ACC hAg-Kozak
63738393103113
AUGUUCGUGU UCCUGGUGCU GCUGCCUCUG GUGUCCAGCC AGUGUGUGAA CCUGACCACC
M F V F L V L L P L V S S Q C V N L T T
S protein
123133143153163173
AGAACACAGC UGCCUCCAGC CUACACCAAC AGCUUUACCA GAGGCGUGUA CUACCCCGAC
R T Q L P P A Y T N S F T R G V Y Y P D
S protein
183193203213223233
AAGGUGUUCA GAUCCAGCGU GCUGCACUCU ACCCAGGACC UGUUCCUGCC UUUCUUCAGC
K VF R S S V L H S TQ D L F L P F F S
S protein
243253263273283293 AACGUGACCU GGUUCCACGC CAUCCACGUG UCCGGCACCA AUGGCACCAA GAGAUUCGAC
N VT W F H A I H V S G T N G T K R F D
S protein
303313323333343353
AACCCCGUGC UGCCCUUCAA CGACGGGGUG UACUUUGCCA GCACCGAGAA GUCCAACAUC
N P V L P F N D G V Y F A S T E K S N I
S protein
363373383393403413
AUCAGAGGCU GGAUCUUCGG CACCACACUG GACAGCAAGA CCCAGAGCCU GCUGAUCGUG
I R G W I F G T T L D S K T Q S L L I V
S protein
423433443453463473
AACAACGCCA CCAACGUGGU CAUCAAAGUG UGCGAGUUCC AGUUCUGCAA CGACCCCUUC
N N A T N V V I K V C E F Q F C N D P F
S protein
483493503513523533
CUGGGCGUCU ACUACCACAA GAACAACAAG AGCUGGAUGG AAAGCGAGUU CCGGGUGUAC
L G V Y Y H K N N K S W M E S E F R V Y
S protein
543553563573583593
AGCAGCGCCA ACAACUGCAC CUUCGAGUAC GUGUCCCAGC CUUUCCUGAU GGACCUGGAA
S S A N N C T F E Y V S Q P F L M D L E
S protein
603613623633643653
GGCAAGCAGG GCAACUUCAA GAACCUGCGC GAGUUCGUGU UUAAGAACAU CGACGGCUAC
G K Q G N F K N L R E F V F K N I D G Y
S protein
663673683693703713 UUCAAGAUCU ACAGCAAGCA CACCCCUAUC AACCUCGUGC GGGAUCUGCC UCAGGGCUUC
F K I Y S K H T P I N L V R D L P Q G F
S protein
723 733 743 753 763 773
UCUGCUCUGG AACCCCUGGU GGAUCUGCCC AUCGGCAUCA ACAUCACCCG GUUUCAGACA
S A L E P L V D L P I G I N I T R F Q T
S protein
783 793 803 813 823 833
CUGCUGGCCC UGCACAGAAG CUACCUGACA CCUGGCGAUA GCAGCAGCGG AUGGACAGCU
L L A L H R S Y L T P G D S S S G W T A
S protein
843 853 863 873 883 893
GGUGCCGCCG CUUACUAUGU GGGCUACCUG CAGCCUAGAA CCUUCCUGCU GAAGUACAAC
G A A A Y Y V G Y L Q P R T F L L K Y N
S protein
903 913 923 933 943 953
GAGAACGGCA CCAUCACCGA CGCCGUGGAU UGUGCUCUGG AUCCUCUGAG CGAGACAAAG
E N G T I T D A V D C A L D P L S E T K
S protein
963 973 983 993 1003 1013
UGCACCCUGA AGUCCUUCAC CGUGGAAAAG GGCAUCUACC AGACCAGCAA CUUCCGGGUG
C T L K S F T V E K G I Y Q T S N F R V
S protein
1023 1033 1043 1053 1063 1073
CAGCCCACCG AAUCCAUCGU GCGGUUCCCC AAUAUCACCA AUCUGUGCCC CUUCGGCGAG
Q P T E S I V R F P N I T N L C P F G E
S protein
1083 1093 1103 1113 1123 1133 GUGUUCAAUG CCACCAGAUU CGCCUCUGUG UACGCCUGGA ACCGGAAGCG GAUCAGCAAU
V F N A T R F A S V YA W NR K R I S N
S protein
114311531163117311831193
UGCGUGGCCG ACUACUCCGU GCUGUACAAC UCCGCCAGCU UCAGCACCUU CAAGUGCUAC
C V A D Y S V L Y N S A S F S T F K C Y
S protein
120312131223123312431253
GGCGUGUCCC CUACCAAGCU GAACGACCUG UGCUUCACAA ACGUGUACGC CGACAGCUUC
G V S P T K L N D L C F T N V Y A D S F
S protein
126312731283129313031313
GUGAUCCGGG GAGAUGAAGU GCGGCAGAUU GCCCCUGGAC AGACAGGCAA GAUCGCCGAC
V I R G D E V R Q I A P G Q T G K I A D
S protein
132313331343135313631373
UACAACUACA AGCUGCCCGA CGACUUCACC GGCUGUGUGA UUGCCUGGAA CAGCAACAAC
V N Y K L P D D F T G C V IA W N S NN
S protein
138313931403141314231433
CUGGACUCCA AAGUCGGCGG CAACUACAAU UACCUGUACC GGCUGUUCCG GAAGUCCAAU
L D S K V G G N Y N YL Y R L F R K S N
S protein
144314531463147314831493
CUGAAGCCCU UCGAGCGGGA CAUCUCCACC GAGAUCUAUC AGGCCGGCAG CACCCCUUGU
L K P F E R D I S T E I Y Q A G S T P C
S protein
150315131523153315431553 AACGGCGUGG AAGGCUUCAA CUGCUACUUC CCACUGCAGU CCUACGGCUU UCAGCCCACA
N G V E G F N C YF P L Q S Y G FQP T
S protein
156315731583159316031613
AAUGGCGUGG GCUAUCAGCC CUACAGAGUG GUGGUGCUGA GCUUCGAACU GCUGCAUGCC
N G V G Y Q P Y R V V V L S F E L L H A
S protein
162316331643165316631673
CCUGCCACAG UGUGCGGCCC UAAGAAAAGC ACCAAUCUCG UGAAGAACAA AUGCGUGAAC
P A T V C G P K K S T N L V K N K C V N
S protein
168316931703171317231733
UUCAACUUCA ACGGCCUGAC CGGCACCGGC GUGCUGACAG AGAGCAACAA GAAGUUCCUG
F N F N G L T G T G VL T E S N KKF L
S protein
174317531763177317831793
CCAUUCCAGC AGUUUGGCCG GGAUAUCGCC GAUACCACAG ACGCCGUUAG AGAUCCCCAG
P F Q Q F G R D I A D T T D A V R D P Q
S protein
180318131823183318431853
ACACUGGAAA UCCUGGACAU CACCCCUUGC AGCUUCGGCG GAGUGUCUGU GAUCACCCCU
TL E I L D I T P C S F G G V S V I T P
S protein
186318731883189319031913
GGCACCAACA CCAGCAAUCA GGUGGCAGUG CUGUACCAGG ACGUGAACUG UACCGAAGUG
G T N T S N Q V A V L Y Q D V N C T E V
S protein
192319331943195319631973 CCCGUGGCCA UUCACGCCGA UCAGCUGACA CCUACAUGGC GGGUGUACUC CACCGGCAGC
P V A I H A D Q L T P T W R V Y S T G S
S protein
198319932003201320232033
AAUGUGUUUC AGACCAGAGC CGGCUGUCUG AUCGGAGCCG AGCACGUGAA CAAUAGCUAC
N V F Q T R A G C L I G A E H V N N S Y
S protein
204320532063207320832093
GAGUGCGACA UCCCCAUCGG CGCUGGAAUC UGCGCCAGCU ACCAGACACA GACAAACAGC
E C D I P I G A G I C A S Y Q T Q T N S
S protein
210321132123213321432153
CCUCGGAGAG CCAGAAGCGU GGCCAGCCAG AGCAUCAUUG CCUACACAAU GUCUCUGGGC
P R R A R S V A S Q S I I A Y T M S L G
S protein
216321732183219322032213
GCCGAGAACA GCGUGGCCUA CUCCAACAAC UCUAUCGCUA UCCCCACCAA CUUCACCAUC
A E N S V A Y S N N S I A I P T N F T I
S protein
222322332243225322632273
AGCGUGACCA CAGAGAUCCU GCCUGUGUCC AUGACCAAGA CCAGCGUGGA CUGCACCAUG
S V T T E I L P V S M T K T S V D C T M
S protein
228322932303231323232333
UACAUCUGCG GCGAUUCCAC CGAGUGCUCC AACCUGCUGC UGCAGUACGG CAGCUUCUGC
Y I C G D S T E C S N L L L Q Y G S F C
S protein
234323532363237323832393 ACCCAGCUGA AUAGAGCCCU GACAGGGAUC GCCGUGGAAC AGGACAAGAA CACCCAAGAG
T Q L N R A L T G I A V E Q D K N T Q E
S protein
240324132423243324432453
GUGUUCGCCC AAGUGAAGCA GAUCUACAAG ACCCCUCCUA UCAAGGACUU CGGCGGCUUC
V F A Q VK Q I Y K T P P I K D F G G F
S protein
246324732483249325032513
AAUUUCAGCC AGAUUCUGCC CGAUCCUAGC AAGCCCAGCA AGCGGAGCUU CAUCGAGGAC
NF S Q I L P D F S K P S K R S F I E D
S protein
252325332543255325632573
CUGCUGUUCA ACAAAGUGAC ACUGGCCGAC GCCGGCUUCA UCAAGCAGUA UGGCGAUUGU
L L F N K V TLA D A G F I K Q Y G D C
S protein
258325932603261326232633
CUGGGCGACA UUGCCGCCAG GGAUCUGAUU UGCGCCCAGA AGUUUAACGG ACUGACAGUG
L G D I A A R D L I C A Q K F N G L T V
S protein
264326532663267326832693
CUGCCUCCUC UGCUGACCGA UGAGAUGAUC GCCCAGUACA CAUCUGCCCU GCUGGCCGGC
E P P L L T D EM I A Q Y T S A L L A G
S protein
270327132723273327432753
ACAAUCACAA GCGGCUGGAC AUUUGGAGCA GGCGCCGCUC UGCAGAUCCC CUUUGCUAUG
TI T S G W TF G A G A A L Q I P F A M
S protein
276327732783279328032813 CAGAUGGCCU ACCGGUUCAA CGGCAUCGGA GUGACCCAGA AUGUGCUGUA CGAGAACCAG
Q M A Y R F N G I G V T Q N V L Y E N Q
S protein
2823 2833 2843 2853 2863 2873
AAGCUGAUCG CCAACCAGUU CAACAGCGCC AUCGGCAAGA UCCAGGACAG CCUGAGCAGC
K L I A N Q F N S A I G K I Q D S L S S
S protein
2883 2893 2903 2913 2923 2933
ACAGCAAGCG CCCUGGGAAA GCUGCAGGAC GUGGUCAACC AGAAUGCCCA GGCACUGAAC
T A S A L G K L Q D V V N Q N A Q A L N
S protein
2943 2953 2963 2973 2983 2993
ACCCUGGUCA AGCAGCUGUC CUCCAACUUC GGCGCCAUCA GCUCUGUGCU GAACGAUAUC
T L V K Q L S S N F G A I S S V L N D I
S protein
3003 3013 3023 3033 3043 3053
CUGAGCAGAC UGGACCCUCC UGAGGCCGAG GUGCAGAUCG ACAGACUGAU CACAGGCAGA
L S R L D P P E A E V Q I D R E I T G R
S protein
3063 3073 3083 3093 3103 3113
CUGCAGAGCC UCCAGACAUA CGUGACCCAG CAGCUGAUCA GAGCCGCCGA GAUUAGAGCC
E Q S L Q T Y V T Q Q L I R A A E I R A
S protein
3123 3133 3143 3153 3163 3173
UCUGCCAAUC UGGCCGCCAC CAAGAUGUCU GAGUGUGUGC UGGGCCAGAG CAAGAGAGUG
S A N L A A T K M S E C V L G Q S K R V
S protein
3183 3193 3203 3213 3223 3233 GACUUUUGCG GCAAGGGCUA CCACCUGAUG AGCUUCCCUC AGUCUGCCCC UCACGGCGUG
D F C G K G Y H L M S F P Q S A P H G V
S protein
3243 3253 3263 3273 3283 3293
GUGUUUCUGC ACGUGACAUA UGUGCCCGCU CAAGAGAAGA AUUUCACCAC CGCUCCAGCC
V F L H V T Y V P A Q E K N F T T A P A
S protein
3303 3313 3323 3333 3343 3353
AUCUGCCACG ACGGCAAAGC CCACUUUCCU AGAGAAGGCG UGUUCGUGUC CAACGGCACC
I C H D G K A H F P R E G V F V S N G T
S protein
3363 3373 3383 3393 3403 3413
CAUUGGUUCG UGACACAGCG GAACUUCUAC GAGCCCCAGA UCAUCACCAC CGACAACACC
H W F V T Q R N F Y E P Q I I T T D N T
S protein
3423 3433 3443 3453 3463 3473
UUCGUGUCUG GCAACUGCGA CGUCGUGAUC GGCAUUGUGA ACAAUACCGU GUACGACCCU
F V S G N C D V V I G I V N N T V Y D P
S protein
3483 3493 3503 3513 3523 3533
CUGCAGCCCG AGCUGGACAG CUUCAAAGAG GAACUGGACA AGUACUUUAA GAACCACACA
L Q P E L D S F K E E L D K Y F K N H T
S protein
3543 3553 3563 3573 3583 3593
AGCCCCGACG UGGACCUGGG CGAUAUCAGC GGAAUCAAUG CCAGCGUCGU GAACAUCCAG
S P D V D L G D I S G I N A S V V N I Q
S protein
3603 3613 3623 3633 3643 3653 AAAGAGAUCG ACCGGCUGAA CGAGGUGGCC AAGAAUCUGA ACGAGAGCCU GAUCGACCUG
K E I D R L N E VA K N L N E S L I D L
S protein
366336733683369337033713
CAAGAACUGG GGAAGUACGA GCAGUACAUC AAGUGGCCCU GGUACAUCUG GCUGGGCUUU
Q E L G K Y E Q Y I K W P W Y I WL G F
S protein
372337333743375337633773
AUCGCCGGAC UGAUUGCCAU CGUGAUGGUC ACAAUCAUGC UGUGUUGCAU GACCAGCUGC
I A G L I A I V M V T I M L C C M T S C
S protein
378337933803381338233833
UGUAGCUGCC UGAAGGGCUG UUGUAGCUGU GGCAGCUGCU GCAAGUUCGA CGAGGACGAU
C S C L K G C C S C G S C C K F D E D D
S protein
38433853386338733878
UCUGAGCCCG UGCUGAAGGG CGUGAAACUG CACUACACAU GAUGA
S E P V L K G V K L H Y T * *
S protein
388838983908391839283938
CUCGAGCUGG UACUGCAUGC ACGCAAUGCU AGCUGCCCCU UUCCCGUCCU GGGUACCCCG
FI element
394839583968397839883998
AGUCUCCCCC GACCUCGGGU CCCAGGUAUG CUCCCACCUC CACCUGCCCC ACUCACCACC
FI element
400840184028403840484058
UCUGCUAGUU CCAGACACCU CCCAAGCACG CAGCAAUGCA GCUCAAAACG CUUAGCCUAG
FI element 4068 4078 4088 4098 4108 4118
CCACACCCCC ACGGGAAACA GCAGUGAUUA ACCUUUAGCA AUAAACGAAA GUUUAACUAA
FI element
4128 4138 4148 4158 4168 4173
GCUAUACUAA CCCCAGGGUU GGUCAAUUUC GUGCCAGCCA CACCCUGGAG CUAGC
FI element
4183 4193 4203 4213 4223 4233
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA GCAUAUGACU AAAAAAAAAA AAAAAAAAAA
Poly(A)
4243 4253 4263 4273 4283
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
Poly(A)
Example 11 : RNA batch size
In some embodiments, the present disclosure, among other things, utilizes RNA manufactured, for example, at a mass batch throughput of at least 10 g RNA (including, e.g., at least 15 g RNA, at least 20 g RNA, at least 25 g RNA, at least 30 g RNA, at least 35 g RNA, at least 40 g RNA, at least 45 g RNA, at least 50 g RNA, at least 55 g RNA, at least 60 g RNA, at least 70 g RNA, at least 80 g RNA, at least 90 g RNA, at least 100 g RNA, at least 150 g RNA, at least 200 g RNA, or more). In some embodiments, such a method described herein can be used to produce a mass batch throughput of about 10 g to about 300 g RNA, about 10 g to about 200 g RNA, about 10 g to about 100 g RNA, about 30 g to about 60 g RNA, or about 50 g RNA to 300 g RNA. In some embodiments, such a method described herein is useful for large scale manufacturing that produces a mass batch throughput of at least 1.5 g RNA per hour (including, e.g., at least 2 g RNA per hour, at least 2.5 g RNA per hour, at least 3 g RNA per hour, at least 3.5 g RNA per hour, at least 4 g RNA per hour, at least 4.5 g RNA per hour, at least 5 g RNA per hour, at least 5.5 g RNA per hour, at least 6 g RNA per hour, at least 6.5 g RNA per hour, at least 7 g RNA per hour, at least 7.5 g RNA per hour, at least 8 g RNA per hour, at least 8.5 g RNA per hour, at least 9 g RNA per hour, at least 10 g RNA per hour or higher). In some embodiments, large scale manufacture methods described herein can reach a capacity of 15 g RNA per hour to 20 g RNA per hour (e.g., about 17g per hour).
In some particular embodiments, provided technologies may utilize nucleic acid (e.g., RNA) preparations manufactured in a batch size of at least 0.01 g, 0.02 g, 0.03 g, 0.04 g, 0.05 g, 0.06 g, 0.07g, 0.08 g, 0.09 g, 0.1 g, 0.5 g, 1 g, 2 g, 3 g, 4 g, 5 g, 6 g, 7 g, 8 g, 9 g, 10 g nucleic acid (including, e.g., at least 15 g RNA, at least 20 g RNA, at least 25 g RNA, at least 30 g RNA, at least 35 g RNA, at least 40 g RNA, at least 45 g RNA, at least 50 g RNA, at least 55 g RNA, at least 60 g RNA, at least 70 g RNA, at least 80 g RNA, at least 90 g RNA, at least 100 g RNA, at least 150 g RNA, at least 200 g RNA, at least 300 g RNA, at least 400 g RNA, at least 500 g RNA, at least 750 g, at least 1 kg, at least 1.1 kg, at least 1.2 kg, at least 1.3 kg, at least 1.4 kg, at least 1.5 kg or more). In some embodiments, technologies provided herein can be used to produce batch sizes within a range of about 10 g to about 300 g RNA, about 10 g to about 200 g RNA, about 10 g to about 100 g RNA or about 30 g to about 60 g RNA.
Example 12: Exemplary utilized RNA manufacturing
The present Example describes certain features of exemplary in vitro transcription technologies that may be utilized to prepare RNA for use as described herein.
In some embodiments, the present disclosure, among other things, utilizes technologies (e.g., compositions, systems, and/or methods) for large-scale and/or high yield in vitro transcription. In some embodiments, such technologies generate significantly more RNA (e.g., mRNA) than certain prior or alternative methods. In some embodiments, such technologies generate significantly more capped RNA (e.g., capped mRNA) than certain prior or alternative methods.
In some embodiments, GTP may be added to an in vitro transcription reaction by a fed-batch process. In some embodiments, GTP may be added to an in vitro transcription reaction by a continuous flow process. In some embodiments, GTP may be added to an in vitro transcription reaction in a step-wise manner (e.g. at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more bolus feeds). In some embodiments, an agitation rate is selected such that a particular blend time to enable rapid mixing of bolus additions to ensure optimal availability of GTP during RNA synthesis is achieved.
Example 13: Exemplary specifications for an RNA drug substance
The present Example describes exemplary specifications for an RNA drug substance for use as described herein.
Table 13.1: Exemplary specifications for an RNA drug substance
Thus, in some embodiments, and/or testing assessments establish that a utilized RNA is characterized by one or more of: a) a percentage of capped RNA within a range of about 40-70%. b) RNA integrity above about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. c) residual dsRNA level below about 2000 pg dsRNA/pg RNA, about 1500 pg dsRNA/pg RNA, about 1000 pg dsRNA/ug RNA, about 500 pg dsRNA/pg RNA, or lower. d) residual DNA levels within about 0.1-100 ng DNA per mg RNA, about 50-1,000 ng DNA per mg RNA, about 50-950 ng DNA per mg RNA, about 50-900 ng DNA per mg RNA, about 50-850 ng DNA per mg RNA, or in some embodiments less than or equal to about 500 ng DNA per mg RNA, about 480 ng DNA per mg RNA, about 450 ng DNA per mg RNA, about 420 ng DNA per mg RNA, about 390 ng DNA per mg RNA, about 360 ng DNA per mg RNA, about 330 ng DNA per mg RNA, about 300 ng DNA per mg RNA, about 270 ng DNA per mg RNA, about 240 ng DNA per mg RNA, about 210 ng DNA per mg RNA, or lower. Example 14: Exemplary RNA/LNP product manufacturing process
The present Example depicts an exemplary manufacturing process (Figure 7) that can be used in accordance with the present disclosure, and herein is exemplified for BNT162b2.
In some embodiments, critical quality attributes related to LNP formation and payload delivery may be or include, for example: LNP size, encapsulation efficiency, and in vivo potency (RNA integrity). In some embodiments, surface area may be considered critical, for example to avoid aggregation both during storage and with serum components in vivo. In some embodiments, ratio of cationic lipid to RNA (N/P) may be considered critical for formation of LN; in many embodiments an excess of cationic lipid is utilized, for example at a ratio of about 6.
Table 14.1: Exemplary process parameters for drug substance thaw. a- For controlled drug substance thaw. b - For controlled room temperature drug substance thaw.
Table 14.2: Exemplary process parameters for dilution of drug substance
Table 14.3: Exemplary process parameters for formation and stabilization of LNPs.
Table 14.4: Exemplary process parameters for buffer exchange and concentration.
Table 14.5: Exemplary process parameter and in-process test criteria.
Table 14.6: Exemplary process controls for formation and stabilization of LNPs. a. Target set-point during LNP formation
Abbreviation: LNP = lipid nanoparticle: CPP = critical process parameter
Table 14.7: Exemplary LNP fabrication and bulk drug product formulation process hold times.
Example 15: Exemplary Fill/Finish process
The present Example provides an exemplary Fill/Finish process. In some embodiments, the drug product composition can be filled/finished according to a process as illustrated in Figure 8.
Example 16: Exemplary drug product specifications The present Example provides exemplary drug product specifications for an RNA-LNP drug product. In some embodiments, one or more, or all, of the following are assessed:
Thus, in some embodiments, as described elsewhere herein, release and/or testing assessments establish that a utilized RNA composition is characterized by RNA integrity above about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
Example 17: Exemplary analytical procedures for assessing an RNA/LNP drug product in accordance with the present disclosure The present Example provides exemplary analytical procedures for assessing an RNA/LNP drug product in accordance with the present disclosure. Table 17.1 : Exemplary analytical procedures for assessing RNA/LNP drug product.
Abbreviations: RT-PCR = reverse transcription polymerase chain reaction
Tablel7.2: Exemplary analytical procedures for assessing RNA/LNP drug product.
Abbreviations: HPLC-CAD = high performance liquid chromatography-charged aerosol detection, LNP = lipid nanoparticle
Example 18: Exemplary Commercial stability protocol for RNA/LNP product in accordance with the present disclosure
The present example provides exemplary commercial stability protocols for an exemplary RNA/LNP product in accordance with the present disclosure. Table 18.1 : Exemplary commercial stability protocol for an RNA/LNP product including noted lipids a. Additional test intervals may be included for the purpose of extending expiry.
Abbreviations: LNP = Lipid Nanoparticle
The present Example describes a shipping process that has been used for BNT162b2 RNA-LNP vaccines.
Drug substance is and dispensed, e.g., as 0.225 mg of concentrate for suspension or other batch product concentration. In some specific embodiments, product is dispensed into flexible containers (e.g., ethylene vinyl acetate flexible containers) of appropriate volume to permit resuspension. For example, 34.8 g may be dispensed into 16.6 L EVA FCs; depending on the batch product concentration, expect a minimum fill volume of about 4.2 L and a maximum fill volume of about 16.6 L.
FCs may be frozen and stored, for example, at -20 ± 5 °C. FCs can be shipped for formulation and filling.
In some embodiments, FCs are shipped with passive temperature control. Temperature control of drug substance during shipment can use a qualified passive pallet shipper packed with dry ice and phase change material to support the shipment of the FCs. The passive pallet shipper can be qualified to maintain a temperature of < -15 °C for a transit time of up to, for example, 4-5 days (e.g., 106 hours). Routine shipments can be temperature monitored to record the product temperature throughout the duration of each shipment. Temperature monitors can be placed above the payload bags. Example 20: Certain characteristics of an exemplary RNA/LNP drug product
In some embodiments, a frozen drug product (e.g., a BNT162b2 drug product) is characterized by two glass transition events observed by differential scanning calorimetry, e.g., as is characteristic of saccharide-containing formulations with onset temperatures at -51.8 °C ± 0.8 °C and -38.8 °C ± 0.1 °C. The higher temperature event, Tg’, is identified as the glass transition of the maximally freeze- concentrated solution. Molecular mobility decreases below the glass transition which prevents instability over time.
Alternatively or additionally, in some embodiments, a drug product (e.g., a BNT162b2 drug product) is characterized by a measured density of about 1.04 g/mL at 20 °C.
Alternatively or additionally, in some embodiments, a drug product (e.g., a BNT162b2 drug product) is characterized by a viscosity of about 1.42 cP measured at 20 °C, 0.5 mg/mL.
Alternatively or additionally, in some embodiments, a drug product (e.g., a BNT162b2 drug product) is characterized by a narrow hydrodynamic radius (Rh) distribution predominantly between 30 and 41 nm. The overall ratio between root mean square radius and hydrodynamic radius (Rz/Rh) describes the shape of the particle. Thus, for a product (e.g., a BNT162b2 product) with an average Rz/Rh ratio of 0.71, the value is very close to that (0.77) for a solid spherical particle. The distribution of Rz/Rh ratio across the main peak also suggests that LNP with different sizes are still in similar spherical shape (Rz/Rh range of 0.60-.70 for Rh slices between 30-51 nm). The AF4-MALS-QELS results indicate that BNT162b2 drug product has a relatively homogeneous size distribution and is largely spherical as expected.
Alternatively or additionally, in some embodiments, a drug product (e.g., a BNT162b2 drug product) is characterized by a zeta potential distribution that is narrow and monomodal. The average apparent zeta potential for BNT162b2 drug product is around -3.13 mV, indicating the surface of the LNP is slightly negatively charged. The nearly neutral LNP surface supports the mechanism that BNT162b2 drug product avoids non-specific binding events in the blood compartment.
Alternatively or additionally, in some embodiments, a drug product (e.g., a BNT162b2 drug product) is characterized by an ultra-high filed (800 MHz) NMR spectrum (after dialysis into 0.2 x PBS with 10% DjO to remove sucrose that detects protons associated with the PEG moiety of ALC-0159 at the surface of LNP due to the flexibility of PEG chains. A major peak at 3.71 ppm is associated with the multiple methylene protons of PEG repeating unit (n=45-50) and a smaller but distinctive peak at 3.39 ppm is from PEG terminal methyl group. The NMR peak assignments and intensity data confirms that PEG moiety from the functional ALC-0159 lipid is present at LNP surface in the BNT162b2 drug product samples. ID proton NMR analysis also detected the presence of ALC-0315, the other functional lipid, near the surface from the methylene groups of the hydroxylbutyl group at 3.50 ppm and 2.29 ppm, respectively. In addition, the alkyl chains that are common to both ALC-0159 and ALC-0315 lipids are also detected near the surface. The signals for the alkyl chains are strong due to the large number of protons for each alkyl chain. ID proton NMR signals from DSPC and cholesterol are not observed, suggesting that they are much less mobile and more tightly associated with the LNP as structural lipids. The ID proton NMR results are consistent with the proposed LNP architecture and structure, particularly with the presence of surface PEG being supportive of the in vivo fate of BNT162b2 drug product in terms of ApoE-dependent cellular uptake. The detection of hydrophilic head of ALC-0315 at the LNP surface is also consistent with the proposed dual roles of this functional lipid, which allows LNP becoming positively charged in low pH environment to favorably interact with endosomal membrane during endosome escape.
Example 21: Providing the LNP composition (e.g. by minimizing Air in LNP Compositions)
The present Example documents certain negative impacts of air in LNP compositions, and provides technologies for avoiding and/or removing it.
Figure 9 illustrates a Pareto chart 700 summarizing results of a study that assessed the impact of certain factors on features of RNA-LNP compositions. In particular, the study included impact on features such as particle size and/or composition stability (e.g., of colloidal characteristic(s)) during shipping. Examined factors included: (i) number of vibration cycles, A, that each study sample underwent (“cycles”); (ii) concentration, B, of drug product (i.e., RNA-LNP) within each sample (“cone”); (iii) presence (or lack thereof) of air bubbles, C, within each sample (“bubble”); and (iv) frequency of vibration, D, to which each sample was exposed (“vibration”). As is illustrated in Fig. 6, the presence of air bubbles had a very strong effect (i.e., it was the “primary effect”) on RNA-LNP particle size and stability. Concentration of drug product had a secondary effect on RNA-LNP particle size and stabi lity. Vibration intensity had almost no effect on RNA-LNP particle size and stability. Finally, number of vibration cycles had basically no effect on RNA-LNP particle size and stability. This study therefore confirms that, as described herein, presence of air bubbles can significantly impact features (e.g., particle size and/or stability) of LNP compositions, and specifically RNA-LNP compositions. Moreover, in this study, presence of air bubbles played a far greater role in RNA-LNP particle size and stability than many of the other factors that were examined. We note that having the LNP composition flow in the advantageous Reynolds number regime of below 10000 and, optionally, above 800 provides advantageous characteristics for the LNPs when they are being formed. Hence, the proposed Reynolds number regime is suitable to positively influence the properties of the nanoparticles along the entire process chain as starting with particles of particularly small PDI and/or comparatively small sizes can influence the entire process positively. The positive effect of the Reynolds number regime on the primary LNPs described further above was observed even when no air was present. Thus, the Reynolds number regime provides advantages in addition to and independently of having no air in the system.
Figure 10 illustrates an exemplary process 800 for manufacturing LNP compositions. As can be seen, the produced compositions are prepared by combining lipids 810 (e.g. the second liquid mentioned above) with an aqueous preparation (e.g. the first liquid mentioned above) which carries an agent of interest (e.g., an active agent). In many embodiments, the agent of interest is a nucleic acid (e.g., a nucleic acid therapeutic). As depicted in Figure 10, the nucleic acid is an RNA (e.g., a therapeutic RNA); in many embodiments of this depicted process, a utilized RNA includes at least one open reading frame (ORF) which may, for example, encode a vaccine antigen, a replacement protein, an antibody agent, a cytokine, etc). In some embodiments a vaccine antigen may be a cancer vaccine antigen or a infectious disease (e.g., viral) antigen. In some embodiments, an RNA encodes a polypeptide that is or comprises a viral antigen such as a coronaviral antigen, such as a spike protein or portion thereof, or relevant variant of the foregoing (e.g., a SARS-CoV-2 spike protein or receptor binding domain thereof, for example, a prefusion stabilized variant thereof), e.g., as is utilized in one or more of mRNA-BNT162al, mRNA- BNT162M, mRNA-BNT162b2, mRNA-BNT-162cl, mRNA-1273, CVnCov, CVnCoV2, etc.). In certain embodiments exemplified herein, utilized was an RNA of BNT162b2.
In some embodiments of the process depicted in Figure 10, the RNA is prepared by in vitro transcription (e.g., of a DNA template which may, for example be a linear template such as a linearized plasmid or an amplicaon).
Among other things, as described herein, the present disclosure identifies the source of a problem associated with certain LNP compositions and/or their preparation, for example appreciating that presence of air can have undesirable impact(s). Without wishing to be bound by any particular theory, it is proposed that excess air, particularly in preparations or systems exposed to transport conditions, can adversely affect LNP compositions, for example resulting in aggregation or other loss of colloidal stability, and/or one or more other negative impacts of polydispersity. In some embodiments, the present disclosure provides an insight that such negative effects may be particularly likely and/or particularly deleterious in large scale preparations. Alternatively or additionally, the present disclosure provides an insight that such negative effects may be particularly problematic for preparations intended for filtration, e.g., before, during and/or after fill/finish steps such as are indicated in Figure 10.
Referring to Figure 10 and the exemplary process that it depicts, at step 808, the process 800 may include LNP formation by adding lipids 810 to an RNA solution 806, as well as high impact mixing (for example, via impingement jet mixing), and stabilization. Typically, the RNA solution is an aqueous solution. In many embodiments, the lipids 810 may include one or more of a cationically ionizable (sometimes referred to as “cationic” for simplicity) lipid, a phospholipid, a PEG-lipid, a sterol (e.g., a cholesterol) and an appropriate solvent (e.g., ethanol).
In some embodiments, LNP formation may be performed in presence of a buffer (e.g., a citrate buffer) 812. In some embodiments, the buffer (e.g., a citrate buffer) 812 may be present in the RNA solution 806 prior to mixing with the lipids 810 (for example, via in-line dilution of the water-diluted RNA with the buffer (e.g., citrate buffer) 812 to form the aqueous solution of RNA 806). Stated otherwise, buffer (e.g., citrate buffer) 812 may be added to the RNA solution prior to mixing with the lipid solution 810. In some embodiments, the buffer (e.g., citrate buffer) 812 may also or alternatively be added to the mixture resulting from combining the lipid solution with the aqueous solution 806 (which, as depicted in Figure 10, is an RNA solution but could, in some embodiments, carry a different agent). In some embodiments, the buffer (e.g., citrate buffer) 812 may include citric acid (monohydrate sodium citrate) and/or sodium hydroxide.
According to embodiments described herein, step 808 (LNP formation) may include introducing substantially no air into the process and/or various solutions thereof, thereby forming a first RNA-LNP preparation that includes LNP-encapsulated RNA. LNP formation 808 may include the adjusting of one or more process temperatures, process flow rates, and/or ratios of the buffers, solutions and/or suspensions. LNP formation may include independently flowing each of the aqueous solution and lipids 810 (for example, in a lipid solution) into a mixing unit (for example, impingement jet mixing unit 902 shown in Figure 11 and/or a T-mixer). Each of the aqueous RNA solution 806 (the first liquid discussed further above) and lipid solution 810 (the second liquid discussed further above) may flow into the mixing unit under laminar flow conditions (to avoid the entrapment of air bubbles within the flow) or under non-laminar conditions. In some embodiments, the combined first RNA-LNP preparation flows out of the mixing unit 902 at laminar-turbulent transition flow conditions (i.e., transitional flow conditions, for example, at Reynolds numbers (Re) in a range from about 800 to about 10000, or from about 2000 to about 5000). In some embodiments, the combined first RNA-LNP preparation (i.e. the liquid composition described above) flows out of the mixing unit at low Re turbulent flow conditions (for example, at Reynolds numbers in a range from about 2900 to about 5000, or 6000, and/or about 7000). In some embodiments, the combined first RNA-LNP preparation flows out of the mixing unit at laminar- turbulent transition flow conditions and/or at low Re turbulent flow conditions (for example, at Reynolds numbers in a range from about 2000 to about 5000, or 6000, and/or 7000). According to aspects of the present embodiments, achieving flow conditions within the Reynolds numbers ranges disclosed herein may result in favorable RNA-LNP characteristics (for example, with polydispersities (PDI) in a range from about 0.05 to about 0.2, as disclosed herein). In some embodiments, the combined first RNA-LNP preparation flows out of the mixing unit 902 at laminar-turbulent transition flow conditions (i.e., transitional flow conditions). In some embodiments, the combined first RNA-LNP preparation flows out of the mixing unit 902 at turbulent flow conditions (for example, at low turbulent flow conditions within the turbulent regime). In some embodiments, the combined first RNA-LNP preparation flows out of the mixing unit 902 at transitional flow conditions and/or at turbulent flow conditions (for example, at low turbulent flow conditions within the turbulent regime). In some embodiments, highly turbulent flow conditions (i.e., conditions with high shear) should be avoided. According to aspects of the present embodiments, achieving flow conditions as disclosed herein may result in favorable RNA-LNP characteristics (for example, with polydispersities (PDI) in a range from about 0.05 to about 0.2, as disclosed herein).
Still referring to Figure 10, at step 814, the process 800 may include buffer exchange and concentration of the first RNA-LNP preparation to form a second RNA-LNP preparation. The buffer exchange and concentration step 814 may be conducted with process parameters including, for example, a feed flow rate, for example within a range of of 18 to 50 liter/min (LPM), a trans-membrane pressure (TMP), for example lower than 1200 mbar, a retentate pressure, for example within a range of 130 to 230 mbar, and a permeate pressure, for example within a range of 10 to 70 mbar.
In some embodiments, buffer exchange 814 of the first RNA-LNP preparation and concentrating the first RNA-LNP preparation are performed in alternating steps. In some embodiments, the buffer exchange 814 is conducted via diafiltration and the concentration is conducted via ultrafiltration. In some embodiments, the diafiltration and/or the ultrafiltration are conducted via tangential flow filtration (TFF) (for example, in a tangential flow filtration unit and/or TFF skid). In some embodiments, the tangential flow filtration is conducted using one or more jejunostomy tubes and/or one or more dip tubes configured to avoid introducing air into the second RNA-LNP preparation. During the tangential flow filtration, a retentate may be recirculated to a feed tank using a dip tube comprising a first end submerged into filtration feed liquid in the feed tank to avoid introducing air into the filtration feed liquid. Prior to the buffer exchange and concentration steps, a filtration system for tangential flow filtration may be filled with a buffer to prevent introducing air into the second RNA-LNP preparation.
Referring still to Figure 10, the buffer exchange and concentration step 814 may include at least two buffer exchanges conducted via diafiltration alternating with at least two concentrations conducted via ultrafiltration. During buffer exchange and concentration 814, process temperatures may be maintained within a desired temperature range (for example, at or below about 25 degrees C, or from about 2 degrees C to about 25 degrees C, or from about 15 degrees C to about 25 degrees C). During buffer exchange and concentration 814, pH may be continuously monitored (and may be maintained in a target range (for example, from about 7.0 to about 7.5, or from about 7.1 to about 7.3)) and shear may be maintained, for example in a range from about 2000 sA-l to about 6000 sA-l, or from about 3000 sA-l to about 5000 sA-l, or at about 4000 sA-l (+/- 1%, 5%, and/or 10%). Following buffer exchange and concentration 814, a recovery flush may be performed, during which time shear may be reduced to under about 2000 sA-l (for example, under about 1500 sA-l, or under about 1000 sA-l). In some embodiments, following buffer exchange 814, the pH may be maintained within a range from about 7.3 to about 7.5, for example following ultrafiltration and/or diafiltration.
In some embodiments, during buffer exchange and/or concentration 814, the pH of the first RNA-LNP preparation may be maintained at a pH that is higher than that of the cationic lipid (i.e., the cationic lipid in the lipid solution). Without wishing to be bound by any particular theory, it is proposed that doing so may reduce foaming of the liquid nanoparticles.
In some embodiments, the first and/or second RNA-LNP preparation(s) may be sterilized while introducing substantially no air into the produced formulation. In some embodiments, a relevant produced formulation may be a product for further manipulation, processing, packaging, and/or shipping. In some embodiments, a produced formulation may be or comprise a drug product formulation, e.g., for administration to humans.
In some embodiments, one or more sterilization steps may be performed by sterile filtration; in some embodiments, sterile (or other) filtration may be conducted at a target pressure with substantially no pressure building up during the filtration process, for example at about 1.03 bar (or from about 1.02 bar to about 1.04 bar, from about 1.01 bar to about 1.05 bar, or from about 1.00 bar to about 1.1 bar).
In some embodiments, a utilized mixing unit may include one or more impingement jet mixing skids (and/or T-mixers). Prior to mixing, the impingement jet mixing skids may be vented and/or flooded to remove air from tubing of the impingement jet mixing skids. Mixing of the aqueous and lipid solutions may be performed within boundaries of the mixing unit and/or one or more impingement jet mixing skids. In some embodiments, prior to mixing, the aqueous solution does not contact the lipid solution. In some embodiments, the flow rate ratio into the mixing unit of the aqueous solution to the lipid solution is about 3:1. In some embodiments, the mixing speed may be adapted to avoid entrapping air in the first RNA- LNP preparation. For example, in order to avoid the introduction of air (and/or other impurities), one or more mixing processes may include increasing the mixing speed gradually until a slight vortex has formed (for example, the mixing speed at or slightly above the point at which a visible vortex has formed), but below the mixing speed at which foam begins to form.
Still referring to Figure 10, the system (for example, the impingement jet mixing skids, the TFF system (i.e., the tangential flow filtration unit), and/or components thereof) may be assessed at one or more time points (e.g., monitored over time, e.g., periodically or continuously) for presence of air bubbles. In the event that air is detected in the aqueous solution, the lipid solution, the first RNA-LNP preparation, the second RNA-LNP preparation, the mixing unit, and/or tubing providing the aqueous solution of RNA, the lipid solution, the first RNA-LNP preparation, and/or the second RNA-LNP preparation, an alert or notification may be sent indicating that air has been detected somewhere in the system. In some embodiments, air detection may be performed via one or more flowmeters (for example, via one or more Coriolis flowmeters), and/or by visual assessment (e.g., via the human eye and/or various types of cameras), viand/or other detection means.
In some embodiments, the aqueous solution and/or the lipid solution may be flowed into the mixing unit through one or more inlets disposed at a bottom portion of the mixing unit, and the resulting first RNA- LNP preparation may be released from the mixing unit through one or more outlets disposed at a top portion of the mixing unit. In some embodiments, the mixing may be performed with a submerged mixer. In some embodiments, foam may be generated during and/or after formation of the LNP-encapsulated RNA, and may be subsequently removed from the RNA-LNP preparation (for example, the foam may be removed from the first and/or second RNA-LNP preparation).
Referring still to Figure 10, following buffer exchange 814 and concentration, the process 800 may include 0.2 pm filtration and/or the addition of sucrose and PBS for compounding. Following compounding, the process 800 may include bioburden reduction filtration (BBR) 816 following the buffer exchange and concentration 814. Bioburden reduction filtration 816 may include filtering with 0.2 pm pore size (or for example, about a 0.22 pm pore size) or smaller filter. Bioburden reduction filtration 816 may also include using other pore sizes (for example, 0.45 pm pore size) as described herein. According to the present embodiments, 0.2 pm pore size filtering may also occur on each of the lipid solution and the aqueous RNA solution prior to mixing, on the first RNA-LNP preparation, and/or on the second RNA-LNP preparation. Bioburden reduction filtration 816 may also include filtering the post TFF-LNP suspension through a particulate reduction filter prior to filtering the suspension through (for example) the 0.2 pm pore size and/or 0.22 pm pore size bioburden reduction filter. In some embodiments, bioburden reduction filtration 816 may also include performing a filter recovery flush.
Still referring to Figure 10, following bioburden reduction filtration 816, the process 800 may include filling transport bags (for example, Hexsafe ® bags) with the filtered second RNA-LNP preparation, and performing a visual inspection 818 of the transport bags for air bubbles. In some embodiments, transport bags may be, for example 12L bags, 50 L bags, 100 L bags, and/or other suitable bag sizes (e.g., depending on the batch size of the relevant RNA-LNP preparation), including bags that include a volume between 12L and SOL, and/or bags that include a volume between SOL and 100L. As noted herein, the present disclosure appreciates that negative impact(s) of introduced air may be particularly problematic when LNP compositions (e.g., RNA-LNP preparations as exemplified herein) are manufactured on relatively large scale and/or need to be transported.
In some embodiments, filling transport bags may include filling the bags to a volume in a range from about 30% to about 95%, or from about 40% to about 90%, or from about 50% to about 85%, or from about 60% to about 85% or from about 70% to about 85%, and/or other subranges therebetween of the total bag volume. In some embodiments, prior to filling, the bags may be evacuated, unfilled, and/or otherwise uninflated, in order to avoid the introduction of air bubbles.
In some embodiments, after filling the bags to the desired volume, air bubbles may be removed (e.g., may be manually removed from the bags via syringe), and the bags may be sealed. In some embodiments, care is taken to ensure no air bubbles are or become entrapped therewithin during sealing. After the bags are filled and sealed, visual inspection 818 may be performed and may include visual inspection 818 using the human eye, and/or camera. In some embodiments, if air bubbles are discovered in bags, efforts may be made to remove the air bubbles (e.g., manually via syringe); alternatively or additionally, in some embodiments, bags with bubbles (e.g., bags with visibly observable bubbles) may be discarded.
Filled bags may be stored and/or shipped at a temperature in a range from about 1 degree C to about 15 degrees C (for example, at about 2 degrees C to about 10 degrees C, or from about 2 degrees C to about 8 degrees C), or alternatively may be frozen to a temperature of about -70 degrees C (for example, in a range from about -60 degrees C to about -80 degrees C). Prior to shipment, (e.g., once any air bubbles have been removed), the bags may be secured in or on racks and/or within or on any other suitable shelving or storage system so as to minimize movement, rupturing, and/or disruption of the bags during the transport to a fill and finish site. For example, transport bags may be stacked in a specific manner using a stacking system on pallets that include shock absorbers. During transport 820 and/or in preparation for transport 820, as well as following transport, nitrogen with a positive pressure (for example, from about 1-2 bars) may be maintained in and around the environment in which the bags are kept and/or transported, in order to prevent air from entering the bags. After transport 820, the bags may be assessed for air content (e.g., visually inspected) 822 a second time. In some embodiments, air bubbles that are discovered during such second assessment 822 may be removed (e.g., may be manually removed), or alternatively, the bag or bags that include air bubbles may be selectively discarded (for example, if the volume of air within a given bag has exceeded a threshold).
Referring still to Figure 10, after arriving at a fill and finish site (and, in some embodiments, after having been assessed for air a second time), sterile filtration 824 may be performed (i.e., the second RNA-LNP preparation). In some embodiments, such sterile filtration 824 may be performed after the preparation has been removed from the transport bags, but prior to being disposed within a collection vessel, reservoir, and/or fill tank. In some embodiments, the material (i.e., the filtered preparation) may then be dispersed from the collection vessel, reservoir, and/or fill tank during aseptic fill and finish 826 (for example, to aseptically fill glass vessels with the drug product).
A third air assessment (e.g., by visual inspection) 828 may be performed on the filled glass vessels, again to ensure no air bubbles have been introduced. The inspected and filled glass vessels, at step 830 of the process 800, may then be frozen, stored, warehoused and/or distributed, for example, to health care administration sites. Alternatively, in some embodiments, filled glass vessels may be subjected to lyophilization or other drying process, so that drug product is transported and/or stored in a dry state (e.g., for subsequent resuspension).
In many embodiments, aseptic fill and finish 826 at the fill and finish site as depicted in Figure 10 will be performed such that substantially no air is introduced to the product.
Still referring to Figure 10, in some embodiments, the fill and finish facility may be located in the same location as the LNP production facility, in which case fill and finish may be performed directly using Point of Fill filtration equipment (in which case the transport 820, bag filling and sealing, and one or more of the visual inspection steps 818, 822, 828 may not be required. In yet other embodiments, the process 800 may include multiple transport steps 820, as well as additional visual inspection steps 818, 822, 828 if the various steps of the process 800 are performed at additional and/or other facilities (or alternatively, if transport is required within a single facility).
Figure 11 illustrates a system 900 for producing a formulation comprising lipid nanoparticle (LNP)- encapsulated RNA, according to aspects of embodiments exemplified herein. The particular system 900 depicted in Figure 11 includes an impingement jet mixing unit 902 configured to mix an aqueous solution including RNA 904 (for example, RNA stock) and a lipid solution 906 (for example, lipid stock) to produce a first RNA-LNP preparation including LNP-encapsulated RNA. The system 900 may also include one or more tangential flow filtration units 908 configured to exchange solvent and/or concentrate the first RNA-LNP preparation to produce a second RNA-LNP preparation. The system 900 may also include one or more jejunostomy tubes 910 in fluid communication with the impingement jet mixing unit 902 and/or the one or more tangential flow filtration units 908, configured to transport liquid in the system while introducing substantially no air into the liquid. In the embodiment of Figure 11, lipids 906 (for example, lipid stock in a lipid solution 906) and the aqueous RNA solution 904 flow into the impingement jet mixing unit 902 and, after mixing together, flow out (i.e., through the one or more jejunostomy tubes 910) as the first RNA-LNP preparation (i.e., including LNP-encapsulated RNA). Each of the one or more jejunostomy tubes 910 may include one or more deaerating ports 912 which may include one or more pressure -relief valves and/or spring-loaded values for releasing air out of the system (thereby ensuring that any entrapped air during mixing is removed from the system and first RNA-LNP preparation). In some embodiments, deaerating ports 912 may be manually controlled, passively controlled, and/or automatically controlled by a control system 914. In some embodiments, the mixing unit 902 may be configured to mix the aqueous solution 904 (i.e., RNA stock) and the lipid solution 906 with a submerged mixer (for example, the mixing unit 902 may include one or more mixers capable of being submerged while mixing). In some embodiments, the impingement jet mixing unit 902 may include one or more inlets 936 for receiving the aqueous solution 904 and/or lipid solution 906, the one or more inlets 936 being disposed at a bottom portion of the impingement jet mixing unit 902. The impingement jet mixing unit 902 may also include and one or more outlets 938 for releasing the first RNA-LNP preparation, the one or more outlets 938 being disposed at a top portion of the impingement jet mixing unit 902.
Referring still to Figure 11 , the one or more tangential flow filtration units 908 may include two or more diafiltration modules 916 configured for buffer exchange and/or two or more ultrafiltration modules 918 configured for concentration of the first RNA-LNP preparation. Each of the two or more ultrafiltration modules 918 may be fluidly coupled downstream of the respective diafiltration modules 916. The system 900 may include one or more return lines (not shown) for taking the outlet flows of the two or more ultrafiltration modules 918 and feeding them back into the two or more diafiltration modules 916 such that multiple buffer exchange and concentration cycles may be performed. The system 900 may include one or more flowmeters 920, pressure sensors 922, and other instrumentation (for example, temperature sensors, differential pressure transducers, pH sensors, and other types of instrumentation) positioned throughout the system, for example, upstream and/or downstream of each of the impingement jet mixing unit 902, the tangential flow filtration units 908, the two or more diafiltration modules 916, the two or more ultrafiltration modules 918, as well as other components of the system 900. Each of the flowmeters 920 may be used only for monitoring the flow, and/or in some embodiments or installations, also for controlling the flow (in which case, they may include one or more embedded flow control valves and/or other flow control means). Each of the flowmeters 920 may include one or more turbine flowmeters, differential pressure flowmeters (for example, including an orifice plate or venturi tube), Coriolis flowmeters, ultrasonic flowmeters, as well as other suitable types of flowmeters. In some embodiments, one or more of the flowmeters 920 attached to various tubing of the system 900 may be configured to detect air in the tubing and/or send an alert signal in response to detection of air in the tubing (for example, via the control system 914). The system 900 may also include various types of valving (not shown) and bypass lines (not shown) in order to allow the operators and/or control system 914 to selectively direct the various flows to desired locations, and at the desired flow rates. The system 900 may also include one or more pumps 924 (for example, one or more Levitronix pumps, as well as other suitable pumps). In some embodiments, at least one of the pumps may be positioned upstream of one or more diafiltration modules 916, immediately upstream of one of the pressure sensors 922, and upstream and/or downstream of the deaerating port 920.
Still referring to Figure 11, the system 900 may include a sterilization filtration unit 926 configured to sterilize the second RNA-LNP preparation to produce a RNA-LNP product formulation. The second RNA-LNP preparation includes the output flowing from the TFF skid 908 (or tangential flow filtration units 908), for example, after one or more buffer exchange and/or concentration cycles have been performed (i.e., within the diafiltration and ultrafiltration modules 916, 918). The system may also include one or more dip tubes 928, each having a first end 930 submerged into a feed tank 932 of the one or more tangential flow filtration units 908, and a second end in fluid communication with a retentate outlet 934 of the one or more tangential flow filtration units 908. The one or more dip tubes 928 may be configured to transport a retentate to the feed tank 932 while introducing substantially no air into the feed tank 932 (i.e., because first end 930 of the one or more dip tubes 928 (i.e., the outlet of each dip tube 928) is submerged rather than being position so as to drop the solution into the feed tank 932). The feed tank 932 may be fluidly coupled via one or more return lines 946 such that flow (for example, the first and/or second RNA-LNP preparation and/or retentate) can be directed back into the diafiltration and/or ultrafiltration modules 916, 918 from the feed tank 932. In some embodiments, the second end(s) of the dip tubes 928 may be coupled to the retentate outlet(s) 934 of the one or more diafiltration modules 916. In some embodiments, the dip tubes 928 may be coupled to the retentate outlet(s) 934 of the one or more ultrafiltration modules 918. In some embodiments, the dip tubes 928 may be coupled to the retentate outlet(s) 934 of both of the diafiltration and ultrafiltration modules 916, 918.
In order to ensure that the first end 930 of each of the dip tubes 928 remains submerged in the feed tank 932, the feed tank 932 may include a level indicator and/or a level monitoring system. For example, in connection with the control system 914, a level monitoring system may send a signal or alert to the control system 914 indicating that the fluid level within the feed tank 932 is getting close to dropping below the level of the bottom of the first end 930 of the dip tube 928. In some embodiments, the first end 930 of the dip tube 928 may partially float at the surface of the fluid in the feed tank 932 with a bottom portion protruding downwardly into the fluid such that as a fluid level in the feed tank 932 moves up or down, the dip tube 928 moves or down as well, thereby ensuring that the bottom portion of the first end 930 is always submerged. In some embodiments, the dip tube 928 may be disposed in a fixed position, in which case fluid level within the feed tank 932 may be maintained such that the first end 930 always remains submerged. In some embodiments, an RFID tag and/or proximity sensor may be embedded in the first end 930 of the dip tube 928 such that the position of the dip tube 928 can be tracked relative to the fluid level within the feed tank 932 (and mitigating actions can be taken by the control system 914 (for example, adding additional fluid to the feed tank 932) as needed to ensure the first end 930 of the dip tube 928 always remains submerged). In some embodiments, as the first and/or second RNA-LNP preparation is circulated through each of the diafiltration and ultrafiltration modules 916, 918 and back into the feed tank 932, sufficient mixing is required. However, because turbulent flow (which may enhance mixing) often encourages the development, entrainment, and/or absorption of air bubbles, care should be taken to avoid creating turbulent flow within the feed tank 932. In some embodiments, the first end 930 of each dip tube 928 may be directed away from (or at least not near) any internal wall of the feed tank 932. In addition, in some embodiments, the first end 930 of each dip tube 928 may be directed away from a longitudinal centerline of the feed tank 932 to avoid the first and/or second RNA-LNP preparation from simply passing through the feed tank 932 (and to encourage some level of mixing). In some embodiments, the feed tank 932 may include one or more impellers (for example, that is or comprises a double magnetic stirring rod and/or an eccentrically seated impeller (to avoid the development of “dead spots” within the feed tank 932)). In some embodiments, the one or more impellers may operate at a rotational speed of 10 rpm, 20, rpm, 35 rpm, 50 rpm, 75 rpm, 100 rpm, 150 rpm, 200 rpm, other suitable speeds, and various sub-ranges therebetween.
Referring still to Figure 11, the control system 914 may be operatively and/or communicatively coupled to each of the major components and sensors of the system 900. The control system 914 may be configured to monitor and adjust one or more operating parameters of the system to avoid introducing air into liquid, solutions, and suspensions of the system 900. In some embodiments, the operating parameters (i.e., that are being adjusted) may include one or more of: a mixing rate of the aqueous solution of RNA 904 and the lipid solution 906, a flow rate of the aqueous solution of RNA 904, a flow rate of the lipid solution 906, a feed pressure for the diafiltration modules 916 and/or ultrafiltration modules 918, membrane filter sizes in the one or more tangential flow filtration units 908, or any combination thereof.
Still referring to Figure 11, the system 900 may include other processing facilities and/or modules (i.e., downstream systems 940) downstream of the sterilization filtration unit 926. In some embodiments, processing facilities and downstream systems 940 may include aseptic fill and finish steps, further filtration, further sterilization, manual and/or automated removal of air bubbles, transport, further concentration, dilution, storage, warehousing, freezing, distribution, inspection, labelling, and/or other downstream processes.
Referring still to Figure 11 , the system 900 may be configured to generate foam during and/or after formation of the LNP-encapsulated RNA, and the foam may be removable (for example, immediately upstream or downstream of the sterilization filtration unit and/or immediately downstream of the impingement jet mixing unit 902 (and upstream of the deaerating ports 912)). The system 900 (specifically the impingement jet mixing unit 902) may include one or more impingement jet mixing skids 942 configured to mix the aqueous solution 904 and the lipid solution 906 within boundaries of the mixing unit 902 and/or impingement jet mixing skids 942. In some embodiments, a citrate buffer 944 may be added to the aqueous RNA solution 904 and mixed therewith prior to the aqueous RNA solution 904 being mixed with the lipid solution 906. In some embodiments, after the aqueous RNA solution 904 and the lipid solution 906 have been mixed together in the impingement jet mixing unit 902 thereby creating the first RNA-LNP preparation, citrate buffer 94 may be added prior to the first RNA-LNP preparation flowing to the tangential flow filtration unit 908. Stated otherwise, citrate buffer may be added to the first RNA-LNP preparation downstream of the impingement jet mixing unit 902 and upstream of the tangential flow filtration unit 908.
Buffer 944 may be added (for example, added to and mixed with the RNA stock 904 upstream of the impingement jet mixing unit 902 and/or added to and mixed with the first RNA-LNP preparation downstream of the impingement jet mixing unit 902) via one or more T-mixers (not shown). Stated otherwise, the system 900 may include a first T-mixer for combining the RNA stock 904 and buffer 944 upstream of the impingement jet mixing unit 902, and a second T-mixer for combining the first RNA- LNP preparation and buffer downstream of the impingement jet mixing unit 902. Each T-mixer may include an inner diameter of about 0.5 mm, or for example, from about 0.4 mm to about 0.6 mm, or from about 0.3 mm to about 0.7 mm, or from about 0.1 mm to about 1 mm, and/or from about 0.5 mm to about 2 mm. Each T-mixer may include a minimum upstream and/or downstream pipe -run (i.e., separating the T-Mixer from an pipe expansion or manifold) of at least 50 mm to about 500 mm, or from about 100 mm to about 350 mm, or from about 150 mm to about 200 mm, or from about 175 mm to about 300 mm, or from about 175 mm to about 250 mm. In some embodiments, the RNA stock 902 and/or first RNA-LNP preparation is mixed with buffer 944 in the respective first and/or second T-mixer in a ratio of about 2 to 1.
Still referring to Figure 11, the buffer or buffers 944 used in connection with the present embodiments may include ALC-0315, ALC-0159, DSPC, cholesterol, ethanol, dionized water, citrate, NaOH, as well as other suitable buffers 944. Each of the T-mixers may be calibrated and/or purged prior to use. Each of the pumps and connections in the system should be checked to ensure they are sufficiently sealed. In the case of piping, valves, vessels, tanks, modules, mixers, connections, and other system components that are positively pressured, unsealed locations may be apparent via the presense of visible leaks. In the case of unpressurized (or negatively pressurized (i.e., relative to atmospheric pressure)) components (for example, suction lines on some pumps (for example, pumps used to pressurize buffer 944 prior to mixing with first RNA-LNP preparation and/or RNA stock 904)) any leaks may pull unwanted air into the system, and are thus important to identify. In some embodiments, process 800 and/or system 900 may include priming each pump within the system and running the pump with fluid via a recirculation line for a period of time (for example, 5 minutes, 10 minutes, 15 minutes, etc.) to ensure any air has worked its way out of the system. In some embodiments, recirculating lines may include one or more dearating ports. In some embodiments, the present process 800 and/or system 900 may include visually inspecting all system lines and connections for leaks, checking all fittings to ensure they are tightly connected, and/or running various system pumps (including buffer pumps (i.e., citrate pumps)) in recirculation mode for a period of time to remove air from the system.
Example 22: Air Entrapment and RNA-LNP Particle Size
The present Example describes analysis of certain factors that may have an impact on LNP (for example, RNA-LNP) compositions, and in particular that may affect particle size.
Without wishing to be bound by theory, it is proposed that entrained air can disrupt LNP formation, even if all air is subsequently removed from the system and/or suspensions, solutions, preparations, and resulting drug products. For example, in some embodiments, an LNP (i.e., RNA-LNP) formation process may result in LNP particles that range in diameter from about 30 nm to about 110 nm (or from about 20 nm to about 120 nm, or from about 20 nm to about 140 nm, and/or other sub-ranges therebetween), if there is substantially no entrained air during LNP formation. By contrast, if air is present during the LNP formation process, resulting particles may range in diameter from about 130 nm to about 180 nm, or from about 160 nm to about 200 nm, and/or other sub-ranges therebetween. In some embodiments, if the diameter range of the resulting LNP particles has noticeably (or even slightly) shifted, it may be an indication that air bubbles have been (or are becoming) introduced to the LNP formation process.
In some embodiments, a provided process 800 and/or system 900 may include one or more step(s) and/or instrumentation for directly monitoring LNP particle size downstream of the LNP formation, for example to detect if any particle size shift has occurred (e.g., to detect presence of particle(s) - e.g., a population of particles, with a different size range). In some embodiments, a disparity between a first flow measurement (for example, using a turbine flow meter) and a second flow measurement (for example, using an ultrasonic flow meter) at a location downstream (e.g., immediately downstream) of the LNP formation location may indicate that the LNP particle size has changed (and air is being introduced to the system). In some embodiments, other sensors (such as pressure sensors, temperature sensors, viscosity sensors, etc.) may be used to directly or inferentially detect a shift in the LNP particle size such that appropriate mitigating actions may be taken.
Tight process control can be maintained, in connection with the present embodiments, which in some embodiments, may include systems and methods for removing air from RNA-LNP liquids, solutions, suspensions, and/or preparations. By taking active measures to avoid the entrapment of air, by using systems to detect air, and by removing any air that has been detected, the present methods and systems allow for the large-scale and small-scale encapsulation of RNA within lipid nanoparticles, thereby resulting in efficient drug production and delivery.
General observation
Surprisingly, it has been found that RNA-LNP compositions formed under process conditions in the advantageous Reynolds number regimes discussed further above (i.e. below 10000, below 9000, or below 8500) in the examples or the summary section of this disclosure did not change the PDI of the LNPs significantly, when the liquid composition at some stages during processing (e.g. the processes described further above, such as in connection with figures 7 and 8 or, more generally, in figure 5) was filtered, e.g. using a 0.2 micron filter, e.g. a Sartopore 2 filter (e.g. with a filter area of 17.3 cm2).
Absolute differences in the PDIs between filtered and unfiltered compositions, for example, can be below 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005. Relative deviations can be below 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, or 0.5 %.
Similar positive results were observed when the RNA-LNP compositions formed under these process conditions were frozen for a predetermined time, e.g. one or more weeks, e.g. 3, 4, 5 or 6 weeks, or one or more months and thawed thereafter or made subject to 3, 4 or 5 freeze and thaw cycles. The differences in the PDIs between lipid nanoparticles from not yet once frozen LNP compositions to lipid nanoparticles from the final thawed LNP composition (after freezing for the predetermined time or after completion of all of the freeze and thaw cycles) was also in the ranges stated above with respect to absolute and relative deviations. These results suggest that the particles are very stable and will maintain the PDI (or have only comparatively small deviations in the PDI) even for one or two years.
Example 23: Exemplary Reynolds numbers and corresponding flow rates in different mixers
Table 23.1 below provides exemplary Reynolds numbers used in LNP production and corresponding flow rates in different T-mixers with different diameters at the outlet, as used in the following examples (c.f. examples 24-28) herein below.
Table 23.1 : Overview on Reynolds number and flow rate for a respective Reynolds number within a mixing unit with an outlet (see 334 in figures 1 and 2) of a given inner diameter (also "ID" or "i.d." in the following); preferred Reynolds numbers (Re#) range (2000-10,000) in bold.
Example 24: This example has different sub-examples (labelled 24.1 to 24.4) and was derived with compositions processed up to and including the quenching step using different (second) liquids with lipids.
Example 24.1: BHD-C2C2-PipZ formulation with VitE pAEEA 14 Ac LNPs were prepared using an aqueous-ethanol mixing protocol in a volume part ratio of 3: 1 :2 (Acidified mRNA : organic phase : quench buffer). For that, mRNA having a concentration of 0.4 mg/ml was provided in 50mM citrate buffer pH 4.0. The organic phase comprising 47.4 rnM of total lipids (47.5 mol% BHD-C2C2-PipZ, 10.0 mol% DSPC, 40.7 mol% cholesterol and 1.8 mol% VitE pAEEA 14 Ac) was provided in ethanol. BHD-C2C2-PipZ (di(heptadecan-9-yl) 3,3'-((2-(4-methylpiperazin-l-yl)ethyl)azanediyl)dipropionate):
VitE pAEEA 14 Ac ((R)-2,5,7,8-tetramethyl-2-((4R,8R)-4,8,12-trimethyltridecyl)chroman-6-yl
2,11,20,29,38,47,56,65,74,83,92,101,110,119-tetradecaoxo-
6, 9, 15, 18, 24, 27, 33, 36, 42, 45, 51, 54, 60, 63, 69, 72, 78, 81, 87, 90, 96, 99, 105, 108, 114, 117, 123, 126-octacosaoxa-
3, 12,21,30,39,48,51, < 66, 75, 84,93,102, 111, 120-tetradecaazaoctacosahectan-128-oate):
Quench buffer was 50mM citrate buffer pH 4.0. A raw colloid was produced by continuous mixing of the acidified mRNA with the organic phase, immediately followed by quenching. Flow rates ranged for the 0.15 mm ID mixer from 5-30 ml/min, for the 0.3 mm ID mixer from 10-130 ml/min and for the 0.5 mm ID mixer from 10-330 ml/min.
PDI and the average particle diameter size were determined by dynamic light scattering using a Zetasizer available from Malvern (as also described further above). Results are shown in Table 24.1.
Reynolds numbers in the range of from about 2000 to about 10000 generally yielded particularly advantageous PDI and/or particle sizes. Thus, this range is a particularly good candidate for choosing the Reynolds number for the flow of the liquid composition after the liquid with the RNA and the liquid with the lipids have been mixed as such a flow seems to promote the formation of uniform, e.g. PDI < 0.1, and/or small, e.g. size < 100 nm, particles. In some cases, high quality particles were also achieved with Reynolds numbers greater than 10000, e.g. up to about 14000. Table 24.1: Overview on particle attributes of the raw colloid after quenching for the BHD-C2C2-PipZ formulation with VitE pAEEA 14 Ac produced with different mixer outlet diameters along Re#.
Example 24.2: BHD-C2C2-PipZ formulation with DMG-PEG2000
LNPs were prepared using an aqueous-ethanol mixing protocol in a volume part ratio of 3: 1 :2 (Acidified mRNA : organic phase : quench buffer). For that, mRNA having a concentration of 0.4 mg/ml was provided in 50mM citrate buffer pH 4.0. The organic phase comprising 47.4 mM of total lipids (47.5 mol% BHD-C2C2-PipZ, 10.0 mol% DSPC, 40.7 mol% cholesterol and 1.8 mol% DMG-PEG2000; DMG-PEG2000: l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000) was provided in ethanol. Quench buffer was 50mM citrate buffer pH 4.0. A raw colloid was produced by continuous mixing of the acidified mRNA with the organic phase, immediately followed by quenching. Flow rates ranged for the 0.15 mm ID mixer from 10-25 ml/min, for the 0.3 mm ID mixer from 10-130 ml/min and for the 0.5 mm ID mixer from 10-600 ml/min.
PDI and the average particle diameter size were determined by dynamic light scattering using a Zetasizer available from Malvern (as also described further above). Results are shown in Table 24.2.
Reynolds numbers in the range of from about 2000 to about 10000 generally yielded particularly advantageous PDI and/or particle sizes. Thus, this range is a particularly good candidate for choosing the Reynolds number for the flow of the liquid composition after the liquid with the RNA and the liquid with the lipids have been mixed as such a flow seems to promote the formation of uniform, e.g. PDI < 0.1, and/or small, e.g. size < 100 nm, particles. In some cases, high quality particles were also achieved with Reynolds numbers greater than 10000, e.g. up to about 14000.
Table 24.2: Overview on particle attributes of the raw colloid after quenching for the BHD-C2C2-PipZ formulation with DMG-PEG2000 produced with different mixer outlet diameters along Re#.
Example 24.3: BODD-C2C2-MePyr formulation with VitE pAEEA 14 Ac
LNPs were prepared using an aqueous-ethanol mixing protocol in a volume part ratio of 3: 1 :2 (Acidified mRNA : organic phase : quench buffer). For that, mRNA having a concentration of 0.4 mg/ml was provided in 50mM citrate buffer pH 4.0. The organic phase comprising 47.4 mM of total lipids (47.5 mol% BODD-C2C2-MePyr, 10.0 mol% DSPC, 40.7 mol% cholesterol and 1.8 mol% VitE pAEEA 14 Ac) was provided in ethanol.
BODD-C2C2- 1 Me-Pyr (bis(2-octyldodecyl) 3 ,3'-((2-( 1 -methylpyrrolidin-2- yl) ethyl) azanediyl) dipropionate) :
Quench buffer was 50mM citrate buffer pH 4.0. A raw colloid was produced by continuous mixing of the acidified mRNA with the organic phase, immediately followed by quenching. Flow rates ranged for the 0.15 mm ID mixer from 5-30 ml/min, for the 0.3 mm ID mixer from 10-130 ml/min and for the 0.5 mm ID mixer from 10-330 ml/min.
PDI and the average particle diameter size were determined by dynamic light scattering using a Zetasizer available from Malvern (as also described further above). Results are shown in Table 24.3.
Reynolds numbers in the range of from about 2000 to about 10000 generally yielded particularly advantageous PDI and/or particle sizes. Thus, this range is a particularly good candidate for choosing the Reynolds number for the flow of the liquid composition after the liquid with the RNA and the liquid with the lipids have been mixed as such a flow seems to promote the formation of uniform, e.g. PDI < 0.1, and/or small, e.g. size < 100 nm, particles. In some cases, high quality particles were also achieved with Reynolds numbers greater than 10000, e.g. up to about 14000.
Table 24.3: Overview on particle attributes of the raw colloid after quenching for the BODD-C2C2- MePyr formulation with VitE pAEEA 14 Ac produced with different mixer outlet diameters along Re#.
Example 24.4: BODD-C2C2-MePyr formulation with DMG-PEG2000
LNPs were prepared using an aqueous-ethanol mixing protocol in a volume part ratio of 3: 1 :2 (Acidified mRNA : organic phase : quench buffer). For that, mRNA having a concentration of 0.4 mg/ml was provided in 50mM citrate buffer pH 4.0. The organic phase comprising 47.4 mM of total lipids (47.5 mol% BODD-C2C2-MePyr, 10.0 mol% DSPC, 40.7 mol% cholesterol and 1.8 mol% DMG-PEG2000) was provided in ethanol. Quench buffer was 50mM citrate buffer pH 4.0. A raw colloid was produced by continuous mixing of the acidified mRNA with the organic phase, immediately followed by quenching. Flow rates ranged for the 0.15 mm ID mixer from 5-30 ml/min, for the 0.3 mm ID mixer from 10-240 ml/min and for the 0.5 mm ID mixer from 10-600 ml/min. PDI and the average particle diameter size were determined by dynamic light scattering using a Zetasizer available from Malvern (as also described further above). Results are shown in Table 24.4.
Reynolds numbers in the range of from about 2000 to about 10000 generally yielded particularly advantageous PDI and/or particle sizes. Thus, this range is a particularly good candidate for choosing the Reynolds number for the flow of the liquid composition after the liquid with the RNA and the liquid with the lipids have been mixed as such a flow seems to promote the formation of uniform, e.g. PDI < 0.1, and/or small, e.g. size < 100 nm, particles. In some cases, high quality particles were also achieved with Reynolds numbers greater than 10000, e.g. up to about 14000.
Table 24.4: Overview on particle attributes of the raw colloid after quenching for the BODD-C2C2- MePyr formulation with DMG-PEG2000 produced with different mixer outlet diameters along Re#. Example 25: BHD-C2C2-PipZ formulation stabilized with 3P
LNPs were prepared using an aqueous-ethanol mixing protocol in a volume part ratio of 3: 1 :2 (Acidified mRNA : organic phase : quench buffer). For that, mRNA having a concentration of 0.4 mg/ml was provided in 50mM acetate buffer pH 5.0. The organic phase comprising 47.4 rnM of total lipids (46.7 mol% BHD-C2C2-PipZ, 20.8 mol% DSPC, 32.5 mol% cholesterol) was provided in ethanol. Quench buffer was 15 rnM sodium triphosphate pentabasic (3P) acidified with 34.97 mM acetic acid to pH 5.1. A raw colloid was produced by continuous mixing of the acidified mRNA with the organic phase, immediately followed by quenching. Flow rates ranged for the 0.15 mm ID mixer from 5-20 ml/min, for the 0.3 mm ID mixer from 10-240 ml/min and for the 0.5 mm ID mixer from 10-600 ml/min.
PDI and the average particle diameter size were determined by dynamic light scattering using a Zetasizer available from Malvern (as also described further above). Results are shown in Table 25.1.
Reynolds numbers in the range of from about 1000 to about 10000 generally yielded particularly advantageous PDI and/or particle sizes. Thus, this range is a particularly good candidate for choosing the Reynolds number for the flow of the liquid composition after the liquid with the RNA and the liquid with the lipids have been mixed as such a flow seems to promote the formation of uniform, e.g. PDI < 0.1 or PDI < 0.15, and/or small, e.g. size < 100 nm, particles. In some cases, high quality particles were also achieved with Reynolds numbers greater than 10000, e.g. up to about 14000.
Table 25.1: Overview on particle attributes of the raw colloid after quenching for the BHD-C2C2-PipZ formulation stabilized with 3P produced with different mixer outlet diameters along Re#.
Example 26: BHD-C2C2-PipZ formulation stabilized with DMGS
LNPs were prepared using an aqueous-ethanol mixing protocol in a volume part ratio of 3: 1 :2 (Acidified mRNA : organic phase : quench buffer). For that, mRNA having a concentration of 0.4 mg/mL was provided in 50mM sodium acetate pH 5.5. The organic phase comprising 47.4 mM of total lipids (47.0 mol BHD-C2C2-PipZ, 13.0 mol% DSPC, 32.0 mol% cholesterol and 8.0 mol% DMGS) was provided in ethanol. Quench buffer was 50 mM Tris pH 7.7. A raw colloid was produced by continuous mixing of the acidified mRNA with the organic phase, immediately followed by quenching. Flow rates ranged for the 0.15 mm ID mixer from 5-20 ml/min, for the 0.3 mm ID mixer from 10-240 ml/min and for the 0.5 mm ID mixer from 10-480 ml/min.
PDI and the average particle diameter size were determined by dynamic light scattering using a Zetasizer available from Malvern (as also described further above). Results are shown in Table 26.1.
Reynolds numbers in the range of from about 1000 to about 10000 generally yielded particularly advantageous PDI and/or particle sizes. Thus, this range is a particularly good candidate for choosing the Reynolds number for the flow of the liquid composition after the liquid with the RNA and the liquid with the lipids have been mixed as such a flow seems to promote the formation of uniform, e.g. PDI < 0.1 or PDI < 0.15, and/or small, e.g. size < 100 nm, particles. In some cases, high quality particles were also achieved with Reynolds numbers greater than 10000, e.g. up to about 14000. Table 26.1: Overview on particle attributes of the raw colloid after quenching for the BHD-C2C2-PipZ formulation stabilized with DMGS as anionic lipid, produced with different mixer outlet diameters along Re#.
Example 27: Freeze thaw cycle
LNPs were prepared using an aqueous-ethanol mixing protocol in a volume part ratio of 3: 1 :2 (Acidified mRNA : organic phase : quench buffer), utilizing a T-mixer with an inner diameter of 0.3 mm. For that, mRNA having a concentration of 0.4 mg/ml was provided in 50mM citrate buffer pH 4.0. The organic phase comprising 47.4 mM of total lipids (47.5 mol% BHD-C2C2-PipZ, 10.0 mol% DSPC, 40.7 mol% cholesterol and 1.8 mol% DMG-PEG2000) was provided in ethanol. Quench buffer was 50mM citrate buffer pH 4.0. A raw colloid was produced by continuous mixing of the acidified mRNA with the organic phase, immediately followed by quenching (acidic raw colloid). The acidic raw colloid was dialyzed against PBS pH 7.4 (dialyzed colloid). The dialyzed colloid were filtrated to determine Vmax, followed by manual up-concentration using a cross-flow membrane (MikroKros 20cm 100K MPES 0.5mm (C02- E100-05)). Eventually, PBS and sucrose solution were added to arrive at a final product having 0.5 mg/ml of RNA in PBS with 300mM sucrose, pH7.4 (fully processed). LNPs were once frozen to -70 °C for storage and thawed to room temperature to measure the final product. PDI and the average particle diameter size were determined by dynamic light scattering using a Zetasizer available from Malvern (as also described further above). Results are shown in Table 27.1.
Particularly advantageous PDI and particle sizes were achieved for Reynolds numbers in the range of from about 1000 to about 8000. Throughout processing, including freezing and thawing, particle attributes (size/PDI) were not changed to an extent that would be detrimental to the LNP compositions. PDI and size were maintained in the preferred range of PDI < 0.1 and size <100 nm. It is evident that compositions produced with the advantageous Reynolds numbers described herein maintain their particle attributes and are robust against influences of further processing steps and influences during storage of the compositions.
Table 27.1: Overview on particle attributes (“size” is average particle diameter size) of the processed particles up to one freeze thaw cycle at -70 °C along Re#.
PDI and the average particle diameter size of dialyzed and filtrated colloids was determined by dynamic light scattering using a Zetasizer available from Malvern (as also described further above). Results are shown in Table 27.1.
Particularly advantageous PDI and/or particle sizes were achieved for Reynolds numbers in the range of from about 1300 to about 8000 or 8300.
Vmax represents a theoretical volume applied to a given filter surface until the filter is completely clogged during filtration. Hence, high Vmax values are associated with a high filterability of a product.
Vmax determination was conducted with the dialyzed colloid, directly after samples were taken for Cryo- TEM (see below Example 28). For each filtration, a volume of 100-120 ml raw colloid was filled into a steel tank, which was subsequently pressurized with nitrogen to 1000 mbar. Sartopore 2 Sartoscale 25 (Sartorius) filters with a PES membrane and a filter surface of 4.5 cmA2 were used. After wetting the filter with PBS, the filter was attached to the outlet of the pressurized filtration vessel. The filtrate was collected within a beaker on a balance, which recorded the weight increase over time. The filtrate collection was recorded for up to 5 minutes each. Time related Flow and volume functions were created by the Zero-T software. Vmax was calculated thereof with a correlation coefficient of >= 0.99. Results are shown in Table 27.2.
Table 27.2: Particle attributes (“size” is average particle diameter size) and Vmax values upon filtration study
When comparing Vmax and the PDI of the respective formulation, a trend towards higher filterability paired with lower PDIs within the favored Reynolds number region becomes apparent (see also the graphical representation in Figure 13). All compositions prepared with a Reynolds number in the range of from about 1000 to about 10000 provided advantageous particle features (PDI and/or size) and had good filterability.
Example 28: Cryo-TEM analysis on processed samples along the range of Reynolds
Sample preparation: LNPs were produced according to Example 27. Directly after dialysis, the samples for Cryo-TEM were separated without further processing. Samples were stored at refrigerated temperature and brought to room temperature before blotting. 7JJ 1 of each sample was applied onto a gold grid covered by a holey gold film (UltrAuFoil 1.2/1.3, Quantifoil Micro Tools GmbH, Jena, Germany). Excess of liquid was blotted automatically from the backside of the grid with a strip of filter paper. Subsequently, the samples were rapidly plunge-frozen in liquid ethane (cooled to - 180 °C) in a Cryobox (Carl Zeiss NTS GmbH, Oberkochen, Germany). Excess of ethane was removed with a piece of filter paper. The samples were transferred immediately with a Gatan 626 cryo-transfer holder (Gatan, Pleasanton, USA) into the pre-cooled Cryo-electron microscope (Philips CM 120, Eindhoven, Netherlands) operated at 120 kV and viewed under low dose conditions. The images were recorded with a 2k CMOS Camera (F216, TVIPS, Gauting, Germany). In order to minimize the noise, four images were recorded and averaged to one image. The averaged images are shown in Figures 12 A, 12 B and 12 C for samples taken for the compositions processed with the different Reynolds numbers set forth above. RE# samples 2-5 predominantly showed filled spherical vesicles in a size range of 40-100 nm. Most of the vesicles show an outer bilayer and an inner regular structure. Vesicles from RE# < 1000 and > 10000 (Rel and Re6 in Figures 12 A and 12 C) showed bulges and blebs; unilamellar and oligolamellar empty liposomes can occasionally be found in the samples. Sample Rel (Re# 691) and sample Re6 (Re# 16582) also show a higher number of large particles as well as defective filled vesicles. Furthermore, sample Rel and Re6 show more irregular LNP structures (non-spherical structures, heterogenous morphologies) than particles produced using the preferred Reynolds number range from about 1000 to about 10000.
Thus, Cryo-TEM analysis on partly processed LNP samples (after dialysis) along the range of Reynolds numbers used for obtaining the LNPs shows that both, particle size distribution across the LNP composition as well as morphology of the individual particles, is particularly advantageous when, after mixing (e.g. directly after mixing), the flow has a Reynolds number in a range from about 1000 to about 10000, and even more in a range from about 2000 to about 10000, for instance as shown for samples Re2 to Re5 in Figures 12 A to 12 C. For this Reynolds number range spherical vesicles in a size range of 40- 100 nm were obtained with an outer bilayer and a regular (inner) structure and particles had a reduced size variance compared to, for instance, samples Rel and Re6.
Additional observations
As is apparent from the above, Reynolds numbers in the range of from about 1000 to about 10000 or about 2000 to about 10000 for the flow away from the mixing chamber of a mixing component or at the outlet of the mixing chamber or of the mixing component, generally yielded advantageous compositions, e.g. with advantageous particle attributes of the formed LNPs, such as with particularly advantageous PDI, particle sizes, and/or morphology. Also, filterability was advantageous. The range was advantageous for all mixers which were tested, e.g. independent of the bore size or inner diameter.
Moreover, within the mentioned Reynolds number range, there is usual a region with a local minimum in the PDI of the particles when the Reynolds numbers are varied within that range. On both sides of the local minimum, i.e. for smaller and larger Reynolds numbers than the one indicative for the minimum, the associated Reynolds numbers still yield particles with advantageous particle attributes. Thus, the mentioned range is a particularly good candidate for choosing the Reynolds number for the flow of the liquid composition after the liquid with the RNA (or potentially DNA) and the liquid with the lipids have been mixed. In other words, a flow away from the mixing chamber within the Reynolds number range of from about 1000 to about 10000 seems to promote the formation of uniform and/or small particles. While useful particle attributes may also be obtainable outside of this Reynolds number range, it is evident that mixing at a Reynolds number within the range of from about 1000 to about 10000 is a reliable range for obtaining an LNP composition with advantageous properties. We herein investigated the manufacturing of LNP using static mixers und conditions of continuous flow.
It seems that, independent of the particular type of mixer which is used, a Reynolds number range between about 1000 and about 10000 is advantageous for achieving particles with good attributes. It is noted that this Reynolds number range is expected to be advantageous for providing LNP compositions for a wide range of mixing components, such as T-mixers, Y-mixers, microfluidic mixers (e.g. mixers with a herring bone like structure defining the fluid path through the mixer), mixers with or without spatial oscillation of the liquid flow at the outlet of the mixer, chaotic mixers, and/or non-chaotic mixers.
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of any invention described herein. Therefore, the scope of the present invention is not intended to be limited to the above description.

Claims

Claims
1. A method of providing a liquid composition, comprising:
- guiding a first flow of a first liquid along a first flow path into a mixing chamber,
- guiding a second flow of a second liquid along a second flow path into the mixing chamber;
- mixing the first liquid and the second liquid in the mixing chamber for the liquid composition, wherein the liquid composition is a lipid nanoparticle (LNP) composition, wherein the mixing chamber is provided in a mixing component, the mixing component having a first inlet in fluid communication with the mixing chamber and a second inlet in fluid communication with the mixing chamber, wherein one of the first inlet and the second inlet is used for guiding the first liquid to the mixing chamber and the other one of the first inlet and the second inlet is used for guiding the second liquid to the mixing chamber, and wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at an outlet of the mixing chamber or of the mixing component has a Reynolds number of less than or equal to 10000.
2. The method of claim 1, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of greater than or equal to 800.
3. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 1000 and 10000.
4. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 1000 and 8500.
5. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 1000 and 6500.
6. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 2000 and 10000.
7. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 2000 and 8500.
8. The method of any one of the preceding claims, wherein the method is performed such that the flow of the liquid composition away from the mixing chamber and/or at the outlet of the mixing chamber or of the mixing component has a Reynolds number of between 2000 and 6500.
9. The method of any one of the preceding claims, wherein the liquid composition is guided away from the mixing chamber and/or leaves the mixing chamber or the mixing component via the outlet with a flow rate of greater than or equal to any one of the following: 10 ml/min, 20 ml/min, 30 ml/min, 40 ml/min, 50 ml/min, 60 ml/min, 70 ml/min, 80 ml/min, 90 ml/min, 100 ml/min, 110 ml/min, 120 ml/min, 130 ml/min, 140 ml/min, 150 ml/min, 160 ml/min, 170 ml/min, 180 ml/min, 190 ml/min, 200 ml/min, 210 ml/min, 220 ml/min.
10. The method of any one of the preceding claims, wherein the liquid composition is guided away from the mixing chamber and/or leaves the mixing chamber or the mixing component via the outlet with a flow rate of less than or equal to any one of the following: 600 ml/min, 590 ml/min, 580 ml/min, 570 ml/min, 560 ml/min, 550 ml/min, 540 ml/min, 530 ml/min, 520 ml/min, 510 ml/min, 500 ml/min, 490 ml/min, 480 ml/min, 470 ml/min, 460 ml/min, 450 ml/min, 440 ml/min, 430 ml/min, 420 ml/min, 410 ml/min, 400 ml/min, 390 ml/min, 380 ml/min, 370 ml/min, 360 ml/min, 350 ml/min, 340 ml/min, 330 ml/min, 320 ml/min, 310 ml/min, 300 ml/min, 290 ml/min, 280 ml/min, 270 ml/min, 260 ml/min, 250 ml/min, 240 ml/min, 230 ml/min.
11. The method of any one of the preceding claims, wherein the nanoparticles of the lipid nanoparticle composition have a size of less than or equal to: 100 nm, 95 nm, 90 nm, 85 nm, 80 nm, 75 nm, 70 nm, 65 nm, 60 nm, 55 nm, 50 nm.
12. The method of any one of the preceding claims, wherein the outlet of the mixing chamber or of the mixing component has a diameter of greater than or equal to any one of the following: 0.1 mm, 0.15 mm, 0.2 mm, 0.25 mm, 0.3 mm, 0.35 mm, 0.4 mm, 0.45 mm, 0.5 mm.
13. The method of any one of the preceding claims, wherein the outlet of the mixing chamber or of the mixing component has a diameter of less than or equal to any one of the following: 4 mm, 3.5 mm, 3 mm, 2.5 mm, 2 mm, 1.5 mm, 1 mm, 0.95 mm, 0.9 mm, 0.85 mm, 0.8 mm, 0.75 mm, 0.7 mm, 0.65 mm, 0.6 mm, 0.55 mm, 0.5 mm.
14. The method of any one of the preceding claims, wherein a viscosity of the first liquid and/or of the second liquid is greater than or equal to any one of the following values: 0.5 cP, 0.6 cP, 0.7 cP, 0.8 cP, 0.9 cP, 1.0 cP, 1.1 cP.
15. The method of any one of the preceding claims, wherein the viscosity of the first liquid and/or or the second liquid is less than or equal to any one of the following values: 1.8 cP, 1.7 cP, 1.6 cP, 1.5cP, 1.4 cp, 1.3 cP, 1.2 cP, 1.1 cP, 1.0 cP, 0.9 cP.
16. The method of any one of the preceding claims, wherein the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of less than or equal to any one of the following: 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09.
17. The method of any one of the preceding claims, wherein the lipid nanoparticle composition has a polydispersity index (PDI) of the nanoparticles of greater than or equal to any one of the following: 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22.
18. The method of any one of the preceding claims, wherein the viscosity of the first liquid is lower than the one of the second liquid.
19. The method of any one of the preceding claims, wherein the first inlet is used for the first liquid or the second liquid.
20. The method of any one of the preceding claims, wherein the mixing component is an impingement jet mixer.
21. The method of any one of the preceding claims, wherein the mixing component is a T-mixer.
22. The method of any one of the preceding claims, wherein the liquid composition is a nucleic acid-LNP composition, e.g. an RNA-LNP composition or a DNA-LNP composition.
23. The method of any one of the preceding claims, wherein the first liquid comprises RNA.
24. The method of any one of the preceding claims, wherein the first liquid is an aqueous phase.
25. The method of any one of the preceding claims, wherein the first liquid has a pH below 7 and/or greater than 4, e.g. between 4 and 6.
26. The method of any one of the preceding claims, wherein the second liquid comprises lipids.
27. The method of any one of the preceding claims, wherein the second liquid comprises a) at least a cationic lipid, a non-cationic lipid, a PEG lipid and cholesterol, b) at least a cationic lipid, a non-cationic lipid, an anionic lipid and cholesterol, or c) at least a cationic lipid, a non-cationic lipid, and cholesterol, or d) at least a cationic lipid, a non-cationic lipid, a stealth lipid, and cholesterol.
28. The method of any one of the preceding claims 1 to 26, wherein the second liquid comprises a cationic lipid, a non-cationic lipid and cholesterol.
29. The method of claim 28, wherein the second liquid further comprises a stealth lipid.
30. The method of claim 28 or 29, wherein the second liquid further comprises an anionic lipid.
31. The method of any one of claims 28 to30, wherein the second liquid further comprises a PEG-lipid.
32. The method of any one of the preceding claims, wherein the second liquid is an organic phase.
33. The method of any one of the preceding claims, wherein the second liquid comprises an organic solvent.
34. The method of any one of the preceding claims, wherein the organic solvent is selected from the group of ethanol, propanol, isopropanol and acetone.
35. The method of any one of the preceding claims, wherein the liquid composition comprises lipid nanoparticles, the respective lipid nanoparticle encapsulating nucleic acid, e.g. RNA or DNA.
36. The method of any one of the preceding claims, wherein the liquid composition is a dispersion.
37. The method of any one of the preceding claims, wherein the liquid composition is a homogeneous dispersion.
38. The method of any one of the preceding claims, wherein the first liquid and/or the second liquid is a solution.
39. A method of processing a liquid composition obtainable or obtained with the method of any one of claims 1 to 38.
40. The method of any one of the preceding claims, wherein a third liquid is added to the liquid composition downstream of the mixing chamber.
41. The method of claim 40, wherein the third liquid is a buffer and/or provided for quenching for the liquid composition.
42. The method of any one of the preceding claims, wherein the liquid composition is filtered through a filter.
43. The method of claim 42, wherein the filter is a 0.2 pm filter.
44. The method of claim 42 or 43, wherein a filter area of the filter is less than or equal to 130 cm2 per gram of RNA in the lipid nanoparticles.
45. The method of any one of claims 42 to 44, wherein the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition deviates from the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition by less than or equal to any one of: 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0.5 %.
46. The method of any one of claims 42 to 45, wherein the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition is equal to or lower than the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition.
47. The method of any one of claims 42 to 46, wherein the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of the following: 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06.
48. The method of any one of claims 42 to 47, wherein an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the filtered liquid composition and the polydispersity index (PDI_1) of the nanoparticles in the unfiltered liquid composition is less than or equal to any one of: 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005.
49. The method of any one of the preceding claims, wherein the liquid composition, e.g. the filtered or unfiltered liquid composition, is frozen to a predetermined temperature, e.g. to - 20 °C or - 70 °C.
50. The method of claim 49, wherein the frozen liquid composition is thawed after a predetermined time.
51. The method of claim 50, wherein the predetermined time is greater than or equal to: one week, two weeks, four weeks, five weeks, six weeks, one month, two months, three months, six months, twelve months, 24 months.
52. The method of any one of claims 49 to 51, wherein multiple freeze and thaw cycles are conducted with the liquid composition, e.g. between -20°C or -70°C and room temperature.
53. The method of any one of claims 49 to 52, wherein the poly dispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which is thawed after the predetermined time or thawed in the last one of the multiple freeze and thaw cycles, deviates from the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition by less than or equal to any one of: 20 %, 19 %, 18 %, 17 %, 16 %, 15 %, 14 %, 13 %, 12 %, 11 %, 10 %, 9 %, 8 %, 7 %, 6 %, 5 %, 4 %, 3 %, 2 %, 1 %, 0.5 %.
54. The method of any one of claims 49 to 53, wherein an absolute value of the difference between the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which is thawed after the predetermined time or thawed in the last one of the multiple freeze and thaw cycles, and the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition is less than or equal to any one of: 0.020, 0.015, 0.010, 0.009, 0.008, 0.007, 0.006, 0.005.
55. The method of any one of claims 49 to 54, wherein the poly dispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which is thawed after the predetermined time or is thawed in the last one of the multiple freeze and thaw cycles, is equal to or lower than the poly dispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition.
56. The method of any one of claims 49 to 55, wherein the polydispersity index (PDI_2) of the nanoparticles in the thawed liquid composition, which may be thawed after the predetermined time or may be thawed in the last one of the multiple freeze and thaw cycles, and the polydispersity index (PDI_1) of the nanoparticles in the not yet once frozen liquid composition, e.g. directly before freezing or in a fully processed liquid composition, is less than or equal to any one of the following: 0.15, 0.14, 0.13, 0.12, 0.11, 0.1, 0.09, 0.08, 0.07, 0.06.
57. The method of claim 45 or 53, wherein the deviation is determined by (PDI_1 - PDI_2) I PDI_1 x 100 %.
58. A method of providing a liquid composition, comprising:
- guiding a first flow of a first liquid along a first flow path into a mixing chamber,
- guiding a second flow of a second liquid along a second flow path into the mixing chamber;
- mixing the first liquid and the second liquid in the mixing chamber for the liquid composition, wherein the liquid composition is a lipid nanoparticle (LNP) composition, wherein the first liquid comprises
- RNA, the second liquid comprises
- a cationic lipid, a non-cationic lipid or helper lipid, and cholesterol, wherein the first liquid and the second liquid are mixed in the mixing chamber to provide the liquid composition, the liquid composition having a flow rate of greater than or equal to 65 ml/min and optionally less than or equal to 300 ml/min at an outlet of the mixing chamber or of a mixing component comprising the mixing chamber, wherein a diameter of the flow path at the outlet is greater than or equal to 0.15 mm and, optionally, less than or equal to 1 mm or less than or equal to 0.85 mm.
59. The method of claim 58, wherein the second liquid further comprises a PEG lipid, an anionic lipid, and/or a stealth lipid.
60. A use of a mixing component to provide a lipid nanoparticle (LNP) composition by mixing a first liquid and a second liquid in a mixing chamber of the mixing component, wherein the mixing component is used to provide a liquid flow with a Reynolds number of greater than or equal to 800 and less than or equal to 10000 at an outlet of the mixing chamber or of the mixing component.
61. A preparation comprising lipid nanoparticles, the lipid nanoparticles or the preparation being obtainable or obtained with the method of any one of claims 1 to 59 or with the use of claim 60.
EP23794304.8A 2022-10-21 2023-10-20 Methods and uses associated with liquid compositions Pending EP4604933A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PCT/EP2022/079475 WO2024083345A1 (en) 2022-10-21 2022-10-21 Methods and uses associated with liquid compositions
PCT/EP2023/079374 WO2024084089A1 (en) 2022-10-21 2023-10-20 Methods and uses associated with liquid compositions

Publications (1)

Publication Number Publication Date
EP4604933A1 true EP4604933A1 (en) 2025-08-27

Family

ID=84361918

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23794304.8A Pending EP4604933A1 (en) 2022-10-21 2023-10-20 Methods and uses associated with liquid compositions

Country Status (2)

Country Link
EP (1) EP4604933A1 (en)
WO (2) WO2024083345A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025228975A1 (en) * 2024-04-29 2025-11-06 BioNTech SE Particles, compositions and methods

Family Cites Families (60)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10121252A1 (en) 2001-04-30 2002-11-07 Christos C Zouboulis Acne treatment
EP1903054A3 (en) 2001-06-05 2008-07-23 CureVac GmbH Pharmaceutical compound containing a stabilised mRNA which is optimised for translation in its coded areas
US20050287539A1 (en) 2004-06-29 2005-12-29 Emmanuel Labourier Methods and compositions for preparing capped RNA
US9012219B2 (en) 2005-08-23 2015-04-21 The Trustees Of The University Of Pennsylvania RNA preparations comprising purified modified RNA for reprogramming cells
WO2009003222A1 (en) 2007-06-29 2009-01-08 Commonwealth Scientific And Industrial Research Organisation Methods for degrading toxic compounds
EP3156414B1 (en) 2007-09-26 2019-12-04 Intrexon Corporation Synthetic 5'utrs, expression vectors, and methods for increasing transgene expression
NZ588583A (en) 2008-04-15 2012-08-31 Protiva Biotherapeutics Inc Novel lipid formulations for nucleic acid delivery
EP3165234B1 (en) 2009-07-31 2019-04-03 ethris GmbH Rna with a combination of unmodified and modified nucleotides for protein expression
KR102095670B1 (en) 2010-05-14 2020-03-31 더 제너럴 하스피톨 코포레이션 Compositions and methods of identifying tumor specific neoantigens
ES3005233T3 (en) 2010-10-01 2025-03-14 Modernatx Inc Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
PL3892295T3 (en) 2011-05-24 2023-07-24 BioNTech SE Individualized vaccines for cancer
PT2717893T (en) 2011-06-08 2019-08-20 Translate Bio Inc Lipid nanoparticle compositions and methods for mrna delivery
SG11201405545XA (en) 2012-03-27 2014-11-27 Curevac Gmbh Artificial nucleic acid molecules comprising a 5'top utr
WO2013185069A1 (en) 2012-06-08 2013-12-12 Shire Human Genetic Therapies, Inc. Pulmonary delivery of mrna to non-lung target cells
WO2014071963A1 (en) 2012-11-09 2014-05-15 Biontech Ag Method for cellular rna expression
EP2925348B1 (en) 2012-11-28 2019-03-06 BioNTech RNA Pharmaceuticals GmbH Individualized vaccines for cancer
ES2882110T3 (en) 2013-03-14 2021-12-01 Translate Bio Inc Methods and Compositions for Delivering mRNA-Encoded Antibodies
ES2680595T3 (en) 2013-03-14 2018-09-10 Translate Bio, Inc. Quantitative evaluation for efficacy of messenger RNA to cover
EP4614148A3 (en) 2013-03-15 2025-12-17 Translate Bio, Inc. Synergistic enhancement of the delivery of nucleic acids via blended formulations
DE102013208320A1 (en) 2013-05-07 2014-11-13 Deere & Company Method for determining a control parameter of a power or torque distribution controller for a hybrid drive of a work machine
AU2014310933B2 (en) 2013-08-21 2020-05-14 CureVac SE Method for increasing expression of RNA-encoded proteins
ES2806575T3 (en) 2013-11-01 2021-02-18 Curevac Ag Modified RNA with decreased immunostimulatory properties
CN111304231A (en) 2013-12-30 2020-06-19 库瑞瓦格股份公司 artificial nucleic acid molecules
EP3540060A1 (en) 2013-12-30 2019-09-18 CureVac AG Methods for rna analysis
WO2015101415A1 (en) 2013-12-30 2015-07-09 Curevac Gmbh Artificial nucleic acid molecules
SG10201805674YA (en) 2014-01-02 2018-08-30 Memorial Sloan Kettering Cancer Center Determinants of cancer response to immunotherapy
JP6571679B2 (en) 2014-04-25 2019-09-04 トランスレイト バイオ, インコーポレイテッド Method for purifying messenger RNA
US10837039B2 (en) 2014-06-10 2020-11-17 Curevac Real Estate Gmbh Methods and means for enhancing RNA production
IL316479A (en) 2014-06-25 2024-12-01 Acuitas Therapeutics Inc Novel lipids and lipid nanoparticle formulations for delivery of nucleic acids
WO2016005004A1 (en) 2014-07-11 2016-01-14 Biontech Rna Pharmaceuticals Gmbh Stabilization of poly(a) sequence encoding dna sequences
EP3177732A4 (en) 2014-08-08 2018-04-25 ModernaTX, Inc. Compositions and methods for the treatment of ophthalmic diseases and conditions
JP6907116B2 (en) 2014-12-30 2021-07-21 キュアバック アーゲー Artificial nucleic acid molecule
WO2016128060A1 (en) 2015-02-12 2016-08-18 Biontech Ag Predicting t cell epitopes useful for vaccination
KR102626448B1 (en) * 2015-02-24 2024-01-19 더 유니버시티 오브 브리티시 콜롬비아 Continuous flow microfluidic systems
JP2018526321A (en) 2015-04-27 2018-09-13 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Nucleoside-modified RNA for inducing an adaptive immune response
JP2018525209A (en) * 2015-04-28 2018-09-06 ザ・ユニバーシティ・オブ・ブリティッシュ・コロンビア Disposable microfluidic cartridge
PL4108769T3 (en) 2015-05-29 2024-02-05 CureVac Manufacturing GmbH A method for producing and purifying rna, comprising at least one step of tangential flow filtration
KR102645398B1 (en) 2015-08-28 2024-03-07 큐어백 에스이 Novel artificial nucleic acid molecules
HUE064227T2 (en) 2015-09-21 2024-02-28 Trilink Biotechnologies Llc A method for synthesizing 5'-capped rns
WO2017059902A1 (en) 2015-10-07 2017-04-13 Biontech Rna Pharmaceuticals Gmbh 3' utr sequences for stabilization of rna
RS63986B1 (en) 2015-10-28 2023-03-31 Acuitas Therapeutics Inc Novel lipids and lipid nanoparticle formulations for delivery of nucleic acids
WO2017081082A2 (en) 2015-11-09 2017-05-18 Curevac Ag Optimized nucleic acid molecules
WO2017102010A1 (en) 2015-12-17 2017-06-22 Biontech Rna Pharmaceuticals Gmbh Novel cytokine fusion proteins
CN108779446B (en) 2016-01-13 2023-04-21 新英格兰生物实验室公司 Thermostable variants of T7 RNA polymerase
WO2017162265A1 (en) 2016-03-21 2017-09-28 Biontech Rna Pharmaceuticals Gmbh Trans-replicating rna
CR20180519A (en) 2016-03-31 2019-03-05 Neon Therapeutics Inc NEOANT US AND METHODS OF USE
WO2017186928A1 (en) 2016-04-29 2017-11-02 Curevac Ag Rna encoding an antibody
WO2017191274A2 (en) 2016-05-04 2017-11-09 Curevac Ag Rna encoding a therapeutic protein
WO2017194170A1 (en) 2016-05-13 2017-11-16 Biontech Rna Pharmaceuticals Gmbh Methods for predicting the usefulness of proteins or protein fragments for immunotherapy
WO2018041921A1 (en) * 2016-08-31 2018-03-08 Curevac Ag Mixing device for the production of a liquid nucleic acid composition
EP4599847A3 (en) 2016-10-25 2025-11-12 Trustees of Dartmouth College Prefusion coronavirus spike proteins and their use
EP4714454A2 (en) 2016-10-26 2026-03-25 Acuitas Therapeutics Inc. Lipid nanoparticle formulations
WO2018096179A1 (en) 2016-11-28 2018-05-31 Curevac Ag Method for purifying rna
CA3054321A1 (en) 2017-02-27 2018-08-30 Translate Bio, Inc. Methods for purification of messenger rna
ES2925083T3 (en) 2017-02-27 2022-10-13 Translate Bio Inc Messenger RNA purification methods
BR112019028280A2 (en) 2017-07-04 2020-07-14 Curevac Ag nucleic acid molecules
SG11202002186VA (en) 2017-10-19 2020-05-28 Curevac Ag Novel artificial nucleic acid molecules
CN118421617A (en) 2018-08-24 2024-08-02 川斯勒佰尔公司 Method for purifying messenger RNA
EP3877538A1 (en) 2018-11-08 2021-09-15 Translate Bio, Inc. Methods and compositions for messenger rna purification
EP3886897A1 (en) 2020-02-04 2021-10-06 CureVac AG Coronavirus vaccine

Also Published As

Publication number Publication date
WO2024084089A1 (en) 2024-04-25
WO2024083345A1 (en) 2024-04-25

Similar Documents

Publication Publication Date Title
EP3852728B1 (en) Preparation of lipid nanoparticles and methods of administration thereof
US12527742B2 (en) Methods for manufacturing a liposome encapsulated RNA
US20230157955A1 (en) Vesicle compositions for oral delivery
JP7787084B2 (en) Improved in vitro transcription process of messenger RNA
KR20210135494A (en) Method for preparing lipid nanoparticles
JP2022525540A (en) Method for producing lipid-encapsulated RNA nanoparticles
CN114901253A (en) Improved lipid nanoparticles for delivery of nucleic acids
JP2020183411A (en) Method of Encapsulating Nucleic Acid in Lipid Nanoparticle Host
JP2020532528A (en) Method of producing lipid nanoparticles
AU2022268706A1 (en) Immunogenic composition against influenza
US20240110214A1 (en) Rna manufacturing
TW202330922A (en) Compositions and methods of ribonucleic acid respiratory syncytial virus (rsv) vaccines
US20250032604A1 (en) Immunogenic compositions and their uses
CN116710074A (en) Methods of making lipid nanoparticles and compositions derived therefrom
WO2024084089A1 (en) Methods and uses associated with liquid compositions
WO2024194767A1 (en) Automated drug production system
WO2025057115A2 (en) Methods and compositions for continuous production of nucleic acids
WO2024209418A1 (en) Heating and cooling jacket for fluid vessels
WO2024151583A2 (en) Vaccines and related methods
EP4565209A1 (en) Quantitative assessment of rna encapsulation
WO2025024336A1 (en) Compositions and methods of ribonucleic acid respiratory syncytial virus (rsv) vaccines
CN122070137A (en) Method of

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250429

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20260217