EP4577647A1 - Crispr base editor - Google Patents

Crispr base editor

Info

Publication number
EP4577647A1
EP4577647A1 EP23858091.4A EP23858091A EP4577647A1 EP 4577647 A1 EP4577647 A1 EP 4577647A1 EP 23858091 A EP23858091 A EP 23858091A EP 4577647 A1 EP4577647 A1 EP 4577647A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
protein
cas
acid sequence
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23858091.4A
Other languages
German (de)
French (fr)
Inventor
Yan Zhang
David R. Liu
Xin D. GAO
Kevin T. ZHAO
Zhonggang HOU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Michigan System
Broad Institute Inc
Harvard University
Original Assignee
University of Michigan System
Broad Institute Inc
Harvard University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Michigan System, Broad Institute Inc, Harvard University filed Critical University of Michigan System
Publication of EP4577647A1 publication Critical patent/EP4577647A1/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04001—Cytosine deaminase (3.5.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04002—Adenine deaminase (3.5.4.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]

Definitions

  • a target nucleic acid sequence comprising: an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)- CRISPR associated (Cas) (CRISPR-Cas) system, and/or one or more nucleic acids encoding the engineered CRISPR-Cas system
  • the engineered CRISPR-Cas system comprises: a) a first Cas protein, wherein the first Cas protein is optionally selected from the group consisting of: Cas5, Cas6, Cas7, Cas8, or Cas11; b) an effector protein which is optionally tethered or fused to the first Cas protein, wherein the effector protein comprises: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC (apolipoprotein B mRNA editing enzyme, catalytic polypeptide) protein
  • CRISPR-Cas Clustered Regularly Interspaced
  • the one or more nucleic acids comprises one or more messenger RNAs, one or more vectors, or a combination thereof.
  • the first Cas protein, the effector protein, and the second Cas protein are encoded by a single nucleic acid.
  • the first Cas protein, the effector protein, and the second Cas protein are encoded by different nucleic acids.
  • the guide RNA is encoded by a different nucleic acid than the first Cas protein, the effector protein, and the second Cas protein.
  • the guide RNA, the first Cas protein, the effector protein, and the second Cas protein are encoded by a single nucleic acid.
  • the first Cas protein is selected from the group consisting of: Cas5, Cas6, Cas7, and Cas8 or Cas11.
  • the engineered CRISPR-Cas system is derived from a Type I CRISPR-Cas system.
  • the Type I CRISPR-Cas system is a Type I-B, a Type I-C, or a Type I-D system.
  • the at least one gRNA is encoded in a CRISPR RNA (crRNA) array.
  • the at least one gRNA comprises a non-naturally occurring gRNA.
  • the system further comprises at least one target nucleic acid.
  • the system is a cell free system.
  • compositions comprising any of the systems described above or herein.
  • provided herein is a eukaryotic cell comprising any of the systems above or herein.
  • methods of altering a target nucleic acid sequence comprising: contacting a target nucleic acid sequence with any one of the systems or compositions described above or herein.
  • altering a target nucleic acid sequence comprises changing an A/T pair to a G/C pair, or changing a G/C pair to an A/T pair, in the target nucleic acid sequence.
  • the target nucleic acid sequence encodes a gene product with a disease or condition causing single nucleotide polymorphism.
  • the target nucleic acid sequence is in a cell.
  • the cell is a eukaryotic cell (e.g., mammalian cell or human cell).
  • the target nucleic acid sequence is a genomic DNA sequence.
  • contacting a target nucleic acid sequence comprises introducing the system into the cell.
  • introducing the system into the cell comprises administering the system to a subject (e.g., human subject).
  • the administering comprises in vivo administration.
  • the administering comprises transplantation of ex vivo treated cells comprising the system.
  • FIG. 1 A schematic depicting a novel adenine base editing platform derived from the multi-subunit Cas moiety of Nla type I-C CRISPR-Cas system.
  • a single-stranded DNA specific adenine deaminase (TadA* from ABE8e [Richter et al, NBT 2020, PMID: 32433547]) is fused to a subunit of the Cascade target-recognition Attorney Docket No. UM-41218.601 complex.
  • Cascade is directed by CRISPR RNA (crRNA) to bind PAM-flanked target sequence, bringing TadA* closer to modify nearby accessible adenine residues.
  • crRNA CRISPR RNA
  • a helicase-defective but nuclease-intact Cas3 variant serves as a nickase (nCas3) that cleaves non-target strand (NTS) DNA, tricking human cells to use the opposing target strand (TS) as template in DNA repair to copy inosine intermediate thereby leading to robust TS base editing.
  • NTS non-target strand
  • TS opposing target strand
  • B In vitro DNA cleavage assay showing that in the absence of ATP, wild-type (wt) Cas3 is converted into nCas3 that nicks the NTS but not TS DNA.
  • C Schematics of plasmids used to express all Nla Type I-C components in human cells.
  • Human codon optimized cas5, cas7, cas8, cas11, and cas3 genes are driven from EF1 ⁇ promoters, each has a tethered nuclear localization signal (NLS) and HA epitope tag.
  • CRISPR RNA is expressed from a R-S-R array containing two CRISPR repeats and one spacer, driven by a U6 promoter.
  • FIG. D Schematics of all TadA* fusion configurations analyzed. TadA* is tethered to N- or C- termini of each Cascade subunit.
  • E TadA* tethering to all possible Cascade subunit termini can be tolerated to varying degree, in traditional gene deletion assay with wt CRISPR-Cas3.
  • Cascade-TadA* fusions shown in (D) were assayed in a HAP1- GFP reporter cell line, for their abilities to support large gene deletion, with wt Cas3 and a GFP-targeting crRNA. Gene targeting efficiencies were shown on the Y-axis, as the percentage of EGFP negative cells in the total population. [015] Figure 2.
  • A-C Heatmap representations of A•T to G•C edits achieved by different Cascade-TadA* fusions, in conjunction with helicase-deficient nCas3 (D392A), on various genomic sites AAVS1-EGFP in HAP1 cells (A), HIRA (B) and HPRT1 (C) in HEK293T cells. Plasmids encoding all components were transfected into HAP1-EGFP reporter cell line or HEK293T cells.
  • Nla-IC-ABE Define the base editing window for Nla-IC-ABE in human cells.
  • B Results from the 10 target sites shown in (A) were plotted together into a bar graph.
  • X-axis target site nucleotide (nt) positions; Y-axis, normalized A•T-to-G•C editing efficiencies.
  • data for each nt position were normalized relative to the position with the highest editing value, which was set to 100%.
  • Data are mean +/- standard deviation (SD)
  • Data in B was smoothened by fitting to a normal distribution.
  • D Schematic illustration of the editing window (blue box) defined for Nla Type I-ABE. Red box denotes the upstream 5’-TTC PAM. Note: Nla Type I-ABE enabled a distinct window on TS DNA downstream of CRISPR-matched sequence.
  • HBB S and HBB G are shown at the top and bottom, respectively.
  • the pathogenic variant A to be corrected is located at position 43 nt downstream of the 5’-TTC PAM (marked in red).
  • the resulting G after A-to-G conversion was shown in blue.
  • Ex vivo editing of patient hematopoietic stem and progenitor cells (HSPCs) using such a Nla Type I-ABE strategy would offer accessible cure to SCD patients.
  • HSPCs patient hematopoietic stem and progenitor cells
  • Example 2 Correcting W138X mutation in the CTNS gene, which is the underlying cause of rare disease cystinosis.
  • the targeted region of W138X and wt alleles are shown at the top and bottom, respectively.
  • the pathogenic target A at position 41 nt downstream of the 5’-TTC PAM was indicated in red.
  • Patient HSPCs that are ex vivo edited and transduced back would populate all tissue compartments, reduce cystine level and restore normal cellular functions in most diseased organs and cells.
  • the SCD HBB S and CTNS W138X alleles remained inaccessible to base editing until very recently, when the Cas9 NRCH variant was invented via phage-assisted continuous Attorney Docket No. UM-41218.601 evolution to recognize altered PAM specificity (3’-NGG to 3’-NRCH [Miller et al., NBT 2020. PMID: 32042170]).
  • FIG. 1 Tunable editing window achieved using a “guide-length variation” strategy.
  • A Schematics of the guide-length variation strategy. By shortening or elongating the length of crRNA spacer (i.e., guide) sequence in 3-nt increments, we can remodel the overall Nla Cascade architecture and thereby freely slide the editing window over the target region.
  • B Heatmap representation of base editing positions and efficiencies achieved on a GFP target site for Nla Type I-ABE, using CRISPR guides ranging from 23 to 65 nts. Experiments were performed in HAP1-EGFP reporter cells. The PAM (in red) and target sequence are shown at the bottom, with positions of adenines labeled on TS DNA.
  • the wt guide length is 35 nts, further truncations or elongations occur at its 3’ end.
  • C Northern blots showing increasing lengths of mature crRNAs for Nla Type I-ABE in human cells, as the guide/spacer encoded in the R-S-R CRISPR array construct changes from 23 to 65 nts. Note: 35 nt is the wt spacer length.
  • Total RNAs were extracted from human cells transfected with Nla Type I-ABE-encoding plasmids and subjected to 15% denaturing PAGE and northern blot analysis, probing for mature crRNA (anti-repeat probe, top) and 5S rRNA as the loading control (bottom). [019] Figure 6.
  • Nla Type I-ABE mediated base editing on targets with canonical PAM and non- canonical PAM variants.
  • Nla I-C CRISPR-Cas system i.e., Nla Cascade-Cas3 without TadA* fusion
  • Nla Cascade-Cas3 without TadA* fusion
  • Nla Cascade-Cas3 elicits robust gene targeting activity with its consensus PAM
  • 5’-CTC consensus PAM
  • non-canonical PAM variants 5’-CTC, TCC, TTG and TTT.
  • PAM specificity for Nla Type I-ABE by assaying base editing on dozens of genomic target sites flanked by canonical (A) and non-canonical (B) PAMs.
  • B-C Heatmap representations of A•T to G•C edits achieved by different Cascade-TadA* fusions without nCas3, on genomic target sites in HIRA (B) and HPRT1 (C) genes in HEK293T cells.
  • B HIRA
  • C HPRT1
  • the present invention relates to systems, compositions, and methods for altering nucleic acids, such as at a single position (e.g., A/T to G/C or G/C to A/T; in a gene with disease causing SNP).
  • nucleic acid or “nucleic acid sequence” may also encompass a chain comprising non-natural nucleotides, modified nucleotides, and/or non- nucleotide building blocks that can exhibit the same function as natural nucleotides (e.g., “nucleotide analogs”); further, the term “nucleic acid sequence” as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single or double-stranded, and represent the sense or antisense strand.
  • nucleic acid refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
  • complementary refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base-paring or other non-traditional types of pairing.
  • BSA bovine serum albumin
  • PVP polyvinylpyrrolidone
  • percent sequence identity refers to the percentage of nucleotides or nucleotide analogs in a nucleic acid sequence, or amino acids in an amino acid sequence, that is identical with the corresponding nucleotides or amino acids in a reference sequence after aligning the two sequences and introducing gaps, if necessary, to achieve the maximum percent identity.
  • additional nucleotides in the nucleic acid, that do not align with the reference sequence are not taken into account for determining sequence identity.
  • Methods and computer programs for alignment are well known in the art, including BLAST, Align 2, and FASTA.
  • a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions.
  • wild-type refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source.
  • a wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene.
  • nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
  • peptide polypeptide
  • protein protein are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • Binding interactions are generally characterized by a dissociation constant (Kd) of less than 10 –6 M, less than 10 –7 M, less than 10 –8 M, less than 10 –9 M, less than 10 –10 M, less than 10 –11 M, less than 10 –12 M, less than 10 –13 M, less than 10 –14 M, or less than 10 –15 M.
  • Kd dissociation constant
  • Affinity refers to the strength of binding, increased binding affinity being correlated with a lower Kd.
  • binding domain it is meant a protein domain that is able to bind non-covalently to another molecule.
  • a binding domain can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein binding protein).
  • a DNA-binding protein a DNA-binding protein
  • RNA-binding protein an RNA-binding protein
  • a protein molecule a protein binding protein binding protein.
  • a protein domain-binding protein it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins.
  • Recombinant means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and/or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems.
  • DNA sequences encoding polypeptides can be assembled from cDNA fragments or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system.
  • Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of Attorney Docket No. UM-41218.601 non-translated DNA may be present 5’ or 3’ from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms). Alternatively, DNA sequences encoding RNA (e.g., DNA-targeting RNA) that is not translated may also be considered recombinant.
  • the term “recombinant” nucleic acid refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention.
  • This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a codon encoding the same amino acid, a conservative amino acid, or a non- conservative amino acid. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
  • a recombinant polynucleotide encodes a polypeptide
  • the sequence of the encoded polypeptide can be naturally occurring (“wild type”) or can be a variant (e.g., a mutant) of the naturally occurring sequence.
  • the term “recombinant” polypeptide does not necessarily refer to a polypeptide whose sequence does not naturally occur.
  • a “recombinant” polypeptide is encoded by a recombinant DNA sequence, but the sequence of the polypeptide can be naturally occurring (“wild type”) or non-naturally occurring (e.g., a variant, a mutant, etc.).
  • a “recombinant” polypeptide is the result of human intervention but may be a naturally occurring amino acid sequence.
  • a “vector” or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, e.g., an “insert,” may be attached or incorporated so as to bring about the replication of the attached segment in a cell.
  • a cell has been “genetically modified,” “transformed,” or “transfected” by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change.
  • the transforming DNA may or may not be integrated (covalently linked) into the genome of the cell.
  • the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that Attorney Docket No. UM-41218.601 comprise a population of daughter cells containing the transforming DNA.
  • a “clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
  • a “subject” or “patient” may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model as described herein. Likewise, patient may include either adults, juveniles (e.g., children), or infants. Moreover, patient may mean any living organism, preferably a mammal (e.g., humans and non-humans) that may benefit from the administration of compositions contemplated herein.
  • contact refers to a state or condition of touching or of immediate or local proximity. Contacting a composition to a target destination, such as, but not limited to, an organ, tissue, cell, or tumor, may occur by any means of administration known to the skilled artisan.
  • a target destination such as, but not limited to, an organ, tissue, cell, or tumor
  • the terms “providing,” “administering,” and “introducing,” are used interchangeably herein and refer to the placement of the compositions of the disclosure into a subject by a method or route which results in at least partial localization of the composition to a desired site.
  • the compositions can be administered by any appropriate route which results in delivery to a desired location in the subject.
  • CRISPR/Cas system for altering a DNA sequence
  • crRNAs CRISPR RNAs
  • CRISPR locus Transcription of a CRISPR locus Attorney Docket No. UM-41218.601 produces a “pre-crRNA,” which is processed to yield crRNAs containing spacer-repeat fragments that guide effector nuclease complexes to cleave dsDNA sequences complementary to the spacer.
  • pre-crRNA Several different types of CRISPR systems are known, (e.g., type I, type II, or type III), and classified based on the Cas protein type and the use of a proto-spacer-adjacent motif (PAM) for selection of proto-spacers in invading DNA.
  • PAM proto-spacer-adjacent motif
  • RNA sequences necessary for CRISPR/Cas systems are referred to collectively as “guide RNA” (gRNA) or single guide RNA (sgRNA).
  • gRNA guide RNA
  • sgRNA single guide RNA
  • guide RNA single guide RNA
  • single guide RNA single guide RNA
  • synthetic guide RNA may refer to a nucleic acid sequence comprising a tracrRNA and a pre-crRNA array containing a guide sequence.
  • guide sequence guide
  • guide and “spacer,” are used interchangeably herein and refer to the nucleotide sequence within a guide RNA that specifies the target site.
  • Cascade CRISPR-Associated Complex for Anti-viral Defense
  • Cascade complex refers to a ribonucleoprotein complex comprised of multiple protein subunits (e.g., Cas proteins) used naturally in bacteria as a mechanism for nucleic acid-based immune defense.
  • the Cascade complex recognizes nucleic acid targets via direct base-pairing to guide RNA contained in the complex. Acceptance of target recognition by Cascade results in a conformational change which, in E. coli and other bacteria, recruits a protein component referred to as Cas3.
  • Cas3 may comprise a single protein unit which contains helicase and nuclease domains.
  • the engineered CRISPR-Cas system may be derived from a CRISPR-Cas system of any type or subtype.
  • the engineered CRISPR-Cas system is derived from a Type I CRISPR- Cas system.
  • Type I system is the most widespread and diversified type of CRISPR and is further classified into eight subtypes (I-A through I-F, I-Fv, and I-U) based on cas gene composition. For example, subtypes I-E and I-F lack the cas4 gene.
  • the Type I CRISPR-Cas system is a Type I-C system. Elements or sequences from any suitable Type I-C CRISPR-Cas system may be used in the context of the disclosed methods.
  • the system comprises Cas11, Cas3, Cas5, Cas7, and Cas8.
  • the Type I-C CRISPR-Cas system may be derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Neisseria species (e.g., Neisseria lactamica).
  • the genus Neisseria comprises many gram-negative ⁇ -proteobacteria that interact with eukaryotic hosts, but only two organisms, the gonococcus (Gc) and its close relative the meningococcus (Mc), are human pathogens, both of which colonize mucosal surfaces.
  • N many non-pathogenic Neisseria species also colonize the human nasopharynx, and among them N. lactamica is the most widely studied commensal bacterium.
  • the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I-C system of Neisseria lactamica (Nla), or variants thereof. [062] N.
  • lactamica Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the N. lactamica Type I-C proteins.
  • the N. lactamica Type I-C proteins may be those as disclosed in International Patent Application No. PCT/US21/034165, incorporated herein by reference in its entirety.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 99 or SEQ ID NO: 100
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 102 or SEQ ID NO: 103
  • the Cas8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 105 or SEQ ID NO: 106
  • the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 108 or SEQ ID NO: 109
  • a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 111 or SEQ ID NO: 112.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 99 or SEQ ID NO: 100
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103
  • the Cas8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 105 or SEQ ID NO: 106
  • the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 108 or SEQ ID NO: 109
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 111 or SEQ ID NO: 112.
  • the invention is not limited to these exemplary sequences. Indeed, genetic sequences Attorney Docket No.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 101
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 104
  • the Cas8 protein comprises the amino acid sequence of SEQ ID NO: 107
  • the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 110
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 113.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 101
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 104
  • the Cas8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 107
  • the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 110
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 113.
  • the Type I-C CRISPR-Cas system is derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Bacillus species (e.g., Bacillus halodurans (Bha)) system, or variants thereof.
  • Bacillus species e.g., Bacillus halodurans (Bha)
  • Bacillus Bacillus is a diverse group of spore-forming bacteria ubiquitous in the environment.
  • Bacillus anthracis the agent of anthrax, is the only obligate Bacillus pathogen in vertebrates.
  • Bacillus larvae, B lentimorbus, B popilliae, B sphaericus, and B thuringiensis are pathogens of specific groups of insects.
  • the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I-C system of Bacillus halodurans (Bha), or variants thereof.
  • Bacillus halodurans Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Bacillus halodurans Type I-C proteins.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:156
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 150
  • the Cas8 (Csd1) protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 152
  • the Cas7 (Csd2) protein is encoded by Attorney Docket No.
  • UM-41218.601 a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 148, and a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 154.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 156
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 150
  • the Cas8 (Csd1) protein is encoded by the nucleic acid sequence of SEQ ID NO: 152
  • the Cas7 (Csd2) protein is encoded by the nucleic acid sequence of SEQ ID NO: 148
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 154.
  • the invention is not limited to these exemplary sequences. Indeed, genetic sequences can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 155
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 149
  • the Cas8 (Csd1) protein comprises the amino acid sequence of SEQ ID NO: 151
  • the Cas7 (Csd2) protein comprises the amino acid sequence of SEQ ID NO: 147
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 153.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 155
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 149
  • the Cas8 (Csd1) protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 151
  • the Cas7 (Csd2) protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 147
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 153.
  • the Type I-C CRISPR-Cas system may be derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Desulfovibrio species (e.g., Desulfovibrio vulgaris (Dvu)) system, or variants thereof.
  • Desulfovibrio is a genus of Gram-negative sulfate-reducing bacteria commonly found in aquatic environments.
  • the CRISPR- Cas system used in the context of the present disclosure is derived from the Type I-C system of Desulfovibrio vulgaris (Dvu), or variants thereof.
  • Desulfovibrio vulgaris Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Desulfovibrio vulgaris Type I-C proteins.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:168
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 160
  • the Cas8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 162
  • the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 164
  • a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 166.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 168
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 160
  • the Cas8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 162
  • the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 164
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 166.
  • the invention is not limited to these exemplary sequences. Indeed, genetic sequences can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 167
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 159
  • the Cas8 protein comprises the amino acid sequence of SEQ ID NO: 161
  • the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 163
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 165.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 167
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 159
  • the Cas8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 161
  • the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 163
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 165.
  • the Type I CRISPR-Cas system is a Type I-B system.
  • the system comprises Cas11, Cas3, Cas5, Cas6, Cas7, and Cmx8.
  • the Type I CRISPR-Cas system is a Type I-D system. Elements or sequences from any suitable type I-D CRISPR-Cas system may be used in the context of the disclosed methods.
  • the system comprises Cas11, Cas3, Cas5, Cas6, Cas7, and Cas10. Attorney Docket No.
  • the Type I-B or Type I-D CRISPR-Cas system is derived from the cyanobacteria Synechocystis (Syn).
  • the primary strain of Synechocystis sp. is PCC6803.
  • the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I system of Synechocystis sp. PCC6803, or variants thereof.
  • Synechocystis Type I CRISPR/Cas system proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Synechocystis Type I CRISPR/Cas system proteins.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:130
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 126
  • the Cmx8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 122
  • the Cas6 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 120
  • the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 123
  • a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 128.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 130
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 126
  • the Cmx8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 122
  • the Cas6 protein is encoded by the nucleic acid sequence of SEQ ID NO: 120
  • the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 123
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 128.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 129
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 125
  • the Cmx8 protein comprises the amino acid sequence of SEQ ID NO: 121
  • the Cas6 protein comprises the amino acid sequence of SEQ ID NO: 119
  • the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 124
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 127.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of Attorney Docket No. UM-41218.601 SEQ ID NO: 129
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 125
  • the Cmx8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 121
  • the Cas6 protein comprises the amino acid sequence having at least 70% similarity to that of SEQ ID NO: 119
  • the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 124
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 127.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of 143
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 138
  • the Cas6 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 140
  • the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 136
  • the Cas10 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 134
  • a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 141.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 143
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 138
  • the Cas6 protein is encoded by the nucleic acid sequence of SEQ ID NO: 140
  • the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 136
  • the Cas10 protein is encoded by the nucleic acid sequence of SEQ ID NO: 134
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 141.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 144
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 137
  • the Cas6 protein comprises the amino acid sequence of SEQ ID NO: 139
  • the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 135
  • the Cas10 protein comprises the amino acid sequence of SEQ ID NO: 133
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 142.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 144
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 137
  • the Cas6 protein comprises the amino acid sequence having at least 70% similarity to that of SEQ ID NO: 139
  • the Cas7 protein comprises an amino acid sequence having at least Attorney Docket No. UM-41218.601 70% similarity to that of SEQ ID NO: 135
  • the Cas10 protein comprises the amino acid sequence of SEQ ID NO: 133
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 142.
  • Non- aromatic amino acids are broadly grouped as “aliphatic.”
  • “aliphatic” amino acids include glycine (G or Gly), alanine (A or Ala), valine (V or Val), leucine (L or Leu), isoleucine (I or He), methionine (M or Met), serine (S or Ser), threonine (T or Thr), cysteine (C or Cys), proline (P or Pro), glutamic acid (E or Glu), aspartic acid (A or Asp), asparagine (N or Asn), glutamine (Q or Gin), lysine (K or Lys), and arginine (R or Arg).
  • the amino acid replacement or substitution can be conservative, semi-conservative, or non- conservative.
  • the phrase “conservative amino acid substitution” or “conservative mutation” refers to the replacement of one amino acid by another amino acid with a common property.
  • a functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz and Schirmer, Principles of Protein Structure, Springer-Verlag, New York (1979)). According to such analyses, groups of amino acids may be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz and Schirmer, supra).
  • Non-conservative mutations involve amino acid substitutions between different groups, for example, lysine for tryptophan, or phenylalanine for serine, etc.
  • Attorney Docket No. UM-41218.601 The one or more nucleic acids encoding the engineered CRISPR-Cas system may be any nucleic acid including DNA, RNA, or combinations thereof.
  • the one or more nucleic acids comprise one or more messenger RNAs, one or more vectors, or any combination thereof.
  • Cas11 may be encoded by a vector, whereas the two or more additional Cas proteins may be encoded by one or more messenger RNA.
  • a target sequence may comprise any polynucleotide, such as DNA or RNA.
  • Suitable DNA/RNA binding conditions include physiological conditions normally present in a cell.
  • Other suitable DNA/RNA Attorney Docket No. UM-41218.601 binding conditions e.g., conditions in a cell-free system are known in the art; see, e.g., Sambrook, referenced herein and incorporated by reference.
  • the gRNA or portion thereof that hybridizes to a target nucleic acid sequence may be between any length.
  • the guide sequence of the gRNA does not need to be completely complementary to the target site.
  • the guide sequence of the gRNA is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the target site.
  • the gRNA sequence is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the 3’ end of the target site (e.g., the last 5, 6, 7, 8, 9, or 10 nucleotides of the 3’ end of the target site).
  • “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson- Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule, which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence.
  • a gRNA may also comprise a scaffold sequence (e.g., tracrRNA).
  • a scaffold sequence e.g., tracrRNA.
  • Exemplary scaffold sequences will be evident to one of skill in the art and can be found, for example, in Jinek, et al. Science (2012) 337(6096):816-821, and Ran, et al. Nature Protocols (2013) 8:2281-2308, incorporated herein by reference in their entireties.
  • At least one gRNA is within a crRNA array.
  • a crRNA array comprises multiple guide RNAs (sgRNA) derived from the fusion of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) expressed a single transcript, which after processing by a nuclease are cleaved into separate gRNAs.
  • the crRNA array may contain multiple repeats separated by unique spacers.
  • an engineered crRNA array may comprise contains two repeats and one spacer, or three repeats and two identical spacers.
  • An exemplary crRNA array-repeat amino acid sequence may comprise SEQ ID NO: 114, SEQ ID NO: 131, SEQ ID NO: 145, SEQ ID NO: 157 or SEQ ID NO: 169.
  • One or all of the at least one gRNAs may be a non-naturally occurring gRNA.
  • the system comprises two or more engineered CRISPR-Cas systems or one or more nucleic acids encoding two or more engineered (CRISPR-Cas) systems.
  • the two or more engineered CRISPR-Cas systems are derived from different subtypes of Type I CRISPR-Cas systems.
  • the two or more engineered CRISPR-Cas systems are orthogonal, which means that each CRISPR-Cas system only functions with its own cognate components (e.g., Cas proteins, PAM sequences, and crRNA (gRNA, spacer, and repeat sequences)).
  • the two or more engineered CRISPR-Cas systems comprise two Type I CRISPR-Cas systems selected from the group consisting of a Type I-B CRISPR-Cas system, a Type I-C CRISPR-Cas system, and a Type I-D CRISPR-Cas system.
  • the two or more engineered CRISPR-Cas systems may be selected from a N.
  • the system is a cell-free system.
  • Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids encoding components of the present system into cells, tissues, or a subject. Such methods can be Attorney Docket No. UM-41218.601 used to administer nucleic acids encoding components of the present system to cells in culture, or in a host organism.
  • Non-viral vector delivery systems include DNA plasmids, cosmids, RNA (e.g., a transcript of a vector described herein), a nucleic acid, and a nucleic acid complexed with a delivery vehicle.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. A variety of viral constructs may be used to deliver the present system and/or components to the cells, tissues and/or a subject. Viral vectors include, for example, retroviral, lentiviral, adenoviral, adeno-associated and herpes simplex viral vectors.
  • Nonlimiting examples of such recombinant viruses include recombinant adeno-associated virus (AAV), recombinant adenoviruses, recombinant lentiviruses, recombinant retroviruses, recombinant herpes simplex viruses, recombinant poxviruses, phages, etc.
  • AAV adeno-associated virus
  • the present disclosure provides vectors capable of integration in the host genome, such as retrovirus or lentivirus. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, M. A., et al., 2001 Nat. Medic.7(1):33-40; and Walther W.
  • Drug selection strategies may be adopted for positively selecting for cells comprising the nucleic acid sequences encoding the present system or components thereof.
  • the present disclosure also provides for DNA segments encoding the proteins and nucleic acids disclosed herein, vectors containing these segments and cells containing the vectors.
  • the vectors may be used to propagate the segment in an appropriate cell and/or to allow expression from the segment (e.g., an expression vector).
  • an expression vector The person of ordinary skill in the art would be aware of the various vectors available for propagation and expression of a nucleic acid sequence.
  • expression vectors for stable or transient expression of the present system may be constructed via conventional methods and introduced into cells.
  • nucleic acids encoding the components of the present system may be cloned into a suitable expression vector, such as a plasmid or a viral vector in operable linkage to a suitable promoter.
  • a suitable expression vector such as a plasmid or a viral vector in operable linkage to a suitable promoter.
  • the selection of expression vectors/plasmids/viral vectors should be suitable for integration and replication in eukaryotic cells.
  • vectors of the present disclosure can drive the expression of one or more sequences in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors examples include pCDM8 (Seed, Nature (1987) 329:840, incorporated herein by reference) and pMT2PC (Kaufman, et al., EMBO J. (1987) 6:187, incorporated herein by reference).
  • the expression vector's control functions are typically provided by one or more regulatory elements.
  • Attorney Docket No. UM-41218.601 For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art.
  • Vectors of the present disclosure can comprise any of a number of promoters known to the art, wherein the promoter is constitutive, regulatable or inducible, cell type specific, tissue-specific, or species specific.
  • a promoter sequence of the invention can also include sequences of other regulatory elements that are involved in modulating transcription (e.g., enhancers, Kozak sequences and introns).
  • Many promoter/regulatory sequences useful for driving constitutive expression of a gene are available in the art and include, but are not limited to, for example, CMV (cytomegalovirus promoter), EF1a (human elongation factor 1 alpha promoter), SV40 (simian vacuolating virus 40 promoter), PGK (mammalian phosphoglycerate kinase promoter), Ubc (human ubiquitin C promoter), human beta-actin promoter, rodent beta-actin promoter, CBh (chicken beta-actin promoter), CAG (hybrid promoter contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor), TRE (Tetracycline response element promoter), H1 (human polyme
  • Additional promoters that can be used for expression of the components of the present system, include, without limitation, cytomegalovirus (CMV) intermediate early promoter, a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeloproliferative sarcoma virus (MPSV) LTR, spleen focus-forming virus (SFFV) LTR, the simian virus 40 (SV40) early promoter, herpes simplex tk virus promoter, elongation factor 1-alpha (EF1- ⁇ ) promoter with or without the EF1- ⁇ intron.
  • CMV cytomegalovirus
  • a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeloproliferative sarcoma virus (MPSV) LTR
  • any regulatable promoter may be used, such that its expression can be modulated within a cell.
  • inducible expression can be accomplished by placing the nucleic acid encoding such a molecule under the control of an inducible promoter/regulatory sequence. Promoters well known in the art can be induced in response to inducing agents such as metals, glucocorticoids, tetracycline, hormones, and the like, are also contemplated for use with the invention. Thus, it will be appreciated that the present disclosure includes the use of any promoter/regulatory sequence known in the art that is capable of driving expression of the desired protein operably linked thereto. Attorney Docket No.
  • the vectors of the present disclosure may direct the expression of the nucleic acid in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements include promoters that may be tissue specific or cell specific.
  • tissue specific refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., seeds) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue.
  • cell type specific refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue.
  • the term “cell type specific” when applied to a promoter also means a promoter capable of promoting selective expression of a nucleotide sequence of interest in a region within a single tissue. Cell type specificity of a promoter may be assessed using methods well known in the art, e.g., immunohistochemical staining.
  • the vector may contain, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in host cells; enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription; transcription termination and RNA processing signals from SV40 for mRNA stability; 5’- and 3’-untranslated regions for mRNA stability and translation efficiency from highly-expressed genes like ⁇ -globin or ⁇ -globin; SV40 polyoma origins of replication and ColE1 for proper episomal replication; internal ribosome binding sites (IRESes), versatile multiple cloning sites; T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA; a “suicide switch” or “suicide gene” which when triggered causes cells carrying the vector to die (e.g., HSV thymidine kinase, an inducible caspase such as iCas
  • the vectors When introduced into a cell, the vectors may be maintained as an autonomously replicating sequence or extrachromosomal element or may be integrated into host DNA.
  • the present system or components thereof may be delivered to a cell by any suitable means. In certain embodiments, the system is delivered in vivo. In other embodiments, the system is delivered to isolated/cultured cells in vitro or ex vivo to provide modified cells useful for in vivo delivery to patients afflicted with a disease or condition.
  • Vectors according to the present disclosure can be transformed, transfected, or otherwise introduced into a wide variety of host cells. Transfection refers to the taking up of a vector by a cell whether or not any coding sequences are in fact expressed.
  • Transduction refers to entry of a virus into the cell and expression (e.g., transcription and/or translation) of sequences delivered by the viral vector genome.
  • transduction generally refers to entry of the recombinant viral vector into the cell and expression of a nucleic acid of interest delivered by the vector genome.
  • any of the vectors comprising a nucleic acid sequence that encodes the components of the present system is also within the scope of the present disclosure.
  • a vector may be delivered into cells by a suitable method.
  • Methods of delivering vectors to cells are well known in the art and may include DNA or RNA electroporation, transfection reagents such as liposomes or nanoparticles to delivery DNA or RNA; delivery of DNA, RNA, or protein by mechanical deformation (see, e.g., Sharei et al. Proc. Natl. Acad. Sci. USA (2013) 110(6): 2082-2087, incorporated herein by reference); or viral transduction.
  • the vectors are delivered to host cells by viral transduction.
  • Nucleic acids can be delivered as part of a larger construct, such as a plasmid or viral vector, or directly, e.g., by electroporation, lipid vesicles, viral transporters, microinjection, and biolistics (high-speed particle bombardment).
  • the construct or the nucleic acid encoding the components of the present system is a DNA molecule.
  • the nucleic acid encoding the components of the present system is a DNA vector and may be electroporated to cells.
  • the nucleic acid encoding the components of the present system is an RNA molecule, which may be electroporated to cells.
  • delivery vehicles such as nanoparticle- and lipid-based mRNA or protein delivery systems can be used.
  • Further examples of delivery vehicles include lentiviral vectors, ribonucleoprotein (RNP) complexes, lipid-based delivery system, gene gun, hydrodynamic, electroporation or nucleofection microinjection, and biolistics.
  • RNP ribonucleoprotein
  • lipid-based delivery system lipid-based delivery system
  • gene gun hydrodynamic, electroporation or nucleofection microinjection
  • biolistics biolistics.
  • Various gene delivery methods are discussed in detail by Nayerossadat et al. (Adv Biomed Res.2012; 1: 27) and Ibraheem et al. (Int J Pharm.2014 Jan 1;459(1-2):70-83), incorporated herein by reference.
  • RNP ribonucleoprotein
  • ribonucleoprotein complex refers to a complex of ribonucleic acid and RNA-binding protein(s).
  • an RNP complex typically comprises Cas protein(s) (e.g., Cas5, Cas7, and Cas8) in complex with a gRNA.
  • yeast cells examples include those from the genera Kluyveromyces, Pichia, Rhino-sporidium, Saccharomyces, and Schizosaccharomyces.
  • Exemplary insect cells include Sf-9 and HIS (Invitrogen, Carlsbad, Calif.) and are described in, for example, Kitts et al., Biotechniques, 14: 810-817 (1993); Lucklow, Curr. Opin. Biotechnol., 4: 564-572 (1993); and Lucklow et al., J. Virol., 67: 4566-4579 (1993), incorporated herein by reference.
  • the cell is a mammalian cell, and in some embodiments, the cell is a human cell.
  • suitable mammalian and human host cells are known in the art, and many are available from the American Type Culture Collection (ATCC, Manassas, Va.).
  • suitable mammalian cells include, but are not limited to, Chinese hamster ovary cells (CHO) (ATCC No. CCL61), CHO DHFR- cells (Urlaub et al., Proc. Natl. Acad. Sci. USA, 97: 4216-4220 (1980)), human embryonic kidney (HEK) 293 or 293T cells (ATCC No. CRL1573), and 3T3 cells (ATCC No. CCL92).
  • CHO Chinese hamster ovary cells
  • CHO DHFR- cells Urlaub et al., Proc. Natl. Acad. Sci. USA, 97: 4216-4220 (1980)
  • human embryonic kidney (HEK) 293 or 293T cells ATCC No. CRL1573)
  • 3T3 cells ATCC No. CCL92.
  • the methods comprise contacting a target nucleic acid sequence with a system disclosed herein or a composition comprising the system.
  • the contacting a target nucleic acid sequence comprises introducing the system into the cell.
  • the system may be introduced into eukaryotic or prokaryotic cells by methods known in the art.
  • the cell is a mammalian cell.
  • the cell is a human cell.
  • introducing the system into a cell comprises administering the system to a subject.
  • the subject is human.
  • the administer may comprise in vivo administration.
  • a vector is contacted with a cell in vitro or ex vivo and the treated cell, containing the system, is transplanted into a subject.
  • the target nucleic acid is a nucleic acid endogenous to a target cell.
  • the target nucleic acid is a genomic DNA sequence.
  • genomic refers to a nucleic acid sequence (e.g., a gene or locus) that is located on a chromosome in a cell.
  • the target nucleic acid encodes a gene or gene product.
  • gene product refers to any biochemical product resulting from expression of a gene. Gene products may be RNA or protein. RNA gene products include non-coding RNA, such as tRNA, rRNA, micro RNA (miRNA), and small interfering RNA (siRNA), and coding RNA, such as messenger RNA (mRNA).
  • the target nucleic acid sequence encodes a protein or polypeptide.
  • the systems and methods described herein may be used to correct one or more defects or mutations in a gene (referred to as “gene correction”).
  • the target sequence encodes a defective version of a gene (e.g. with a SNP that causes disease).
  • the target sequence is a “disease-associated” gene.
  • the term “disease-associated gene,” refers to any gene or polynucleotide whose gene products are expressed at an abnormal level or in an abnormal form in cells obtained from a disease-affected individual as compared with tissues or cells obtained from an individual not affected by the disease.
  • a disease-associated gene may be expressed at an abnormally high level or at an abnormally low level, where the altered expression correlates with the occurrence and/or progression of the disease.
  • a disease-associated gene also refers to a gene, the mutation or genetic variation of which is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of Attorney Docket No. UM-41218.601 a disease.
  • genes responsible for such “single gene” or “monogenic” diseases include, but are not limited to, adenosine deaminase, ⁇ -1 antitrypsin, cystic fibrosis transmembrane conductance regulator (CFTR), ⁇ -hemoglobin (HBB), oculocutaneous albinism II (OCA2), Huntingtin (HTT), dystrophia myotonica-protein kinase (DMPK), low-density lipoprotein receptor (LDLR), apolipoprotein B (APOB), neurofibromin 1 (NF1), polycystic kidney disease 1 (PKD1), polycystic kidney disease 2 (PKD2), coagulation factor VIII (F8), dystrophin (DMD), phosphate-regulating endopeptidase homologue, X- linked (PHEX), methyl-CpG-binding protein 2 (MECP2), and ubiquitin-specific peptidase 9Y, Y-linked (USP9Y
  • the target genomic DNA sequence can comprise a gene, the mutation of which contributes to a particular disease in combination with mutations in other genes. Diseases caused by the contribution of multiple genes which lack simple (i.e., Mendelian) inheritance patterns are referred to in the art as a “multifactorial” or “polygenic” disease.
  • multifactorial or polygenic diseases include, but are not limited to, asthma, diabetes, epilepsy, hypertension, bipolar disorder, and schizophrenia. Certain developmental abnormalities also can be inherited in a multifactorial or polygenic pattern and include, for example, cleft lip/palate, congenital heart defects, and neural tube defects.
  • kits may include CRISPR reagents (Cas proteins, guide RNAs, vectors, compositions, etc.), transfection or administration reagents, negative and positive control samples (e.g., cells, template DNA), cells, containers housing one or more components (e.g., microcentrifuge tubes, boxes), detectable labels, detection and analysis instruments, software, instructions, and the like.
  • CRISPR reagents Cas proteins, guide RNAs, vectors, compositions, etc.
  • transfection or administration reagents e.g., cells, template DNA
  • negative and positive control samples e.g., cells, template DNA
  • cells e.g., cells, template DNA
  • containers housing one or more components e.g., microcentrifuge tubes, boxes
  • detectable labels e.g., detection and analysis instruments, software, instructions, and the like.
  • Plasmid transfection CRISPR-Cas3 plasmid transfection was conducted using Lipofectamine 3000 Transfection Reagent (ThermoFisher) per manufacturer’s instructions. HAP1-EGFP reporter cells were seeded one day before transfection at 1x10 5 cells per well of a 24-well plate. For each transfection, we used 1 ⁇ L P3000 Enhancer Reagent, 1.5 ⁇ L Lipofectamine 3000 reagent, and a total of 500 ng crispr-cas plasmids.
  • Tfu I-E system we used 50, 92.5, 25, 95, 95, 92.5, 50 ng of Cas3, Cas5, Cas6, Cas7, Cas8, Cas11 and CRISPR plasmid, respectively.
  • Pae I-F system we used 50, 92.5, 50, 162.5, 95 and 50 ng of Cas2-3, Cas5, Cas6, Cas7, Cas8 and CRISPR plasmids, respectively.
  • WT subunit plasmids are substituted with the same amount of TadA*-, or APOBEC- or 2xUGI- fusion derivative plasmids.
  • Genomic DNA of the edited cells was isolated using Gentra Puregene Cell Kit (Qiagen) per manufacturer’s instructions and used as template for NGS library construction. A 200-300 bp region surrounding the target genomic site was PCR amplified. Following Illumina barcoding, PCR amplicons were pooled and purified through 2% agarose gel electrophoresis and gel extraction using a Monarch DNA Gel Extraction Attorney Docket No. UM-41218.601 Kit (New England Biolabs). Final elution is done with 30 ⁇ L H 2 O.
  • DNA concentration was quantified with a Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific) and sequenced on an Illumina MiSeq instrument (paired-end read, R1: 250–280 cycles, R2: 0 cycles) according to the manufacturer’s protocols.
  • Bioinformatic analysis of NGS sequencing datasets [0141] Sequencing reads were demultiplexed using the MiSeq Reporter (Illumina), and the FASTQ files were analyzed using CRISPResso2.
  • Base editing efficiency values were reported as the percentage of reads with A•T to G•C conversion at a specific adenine location in the total aligned reads in ABE experiments or as the percentage of reads with C•G to T•A conversion at a specific cytosine location in the total aligned reads in CBE experiments.
  • Heatmaps were generated in GraphPad Prism version 9.
  • UM-41218.601 >human codon optimized Tfu-cas5 with NLS and HA tag (SEQ ID NO: 195) ATGAGCGGCTTCCTGCTGAGACTGGCTGGCCCTATGCAGTCTTGGGGCGAGCACTCTATGTTCGGCGAGAGAGACACCCTGCCTT ATCCTAGCAGATCCGGCCTGATCGGCATGTTTGCTGCTGCCCAGGGTGTCAGAAGAGGCGACCCTCTGGACCGGTACAAAGAACT GAAGTTCACCGTGCGCGTGGACAGACCTGGCGTCAGACTGGTGGATTTCCACACCATTGGCGGCGGACTGCCCAAAGAAAGAACC GTGCCTACAGCCGCTGGCGAGAAGGGATCCTAAGAAAGCCACCATCGTGACCAGCAGAAGCTACCTGGCCGACGCCGTGTTTA CAGTGGCTGTGACAGGACCCGAGGCCGACACAATTGCTGATGCTCTGGCCGCTCCTTACTGGCAGCCTTATCTTGGCAGACGGGC CTTCGTGCCTGATCCTCTCTGCTGGTGCTT
  • UM-41218.601 >human codon optimized Pae-cas2-cas3 nickase (K426A) with NLS and HA tag (SEQ ID NO: 206) ATGAACATCCTGCTGGTGTCCCAGTGCGAGAAGAGAGCCCTGAGCGAGACAAGACGGATCCTGGATCAGTTCGCCGAGCGGAGAG GCGAGAACATGGCAGACACCTATCACACAGGCCGGACTGGACACCCTGCGGAGACTGCTGAAGAAGTCCGCCAGACGGAATAC CGCCGTGGCCTGTCACTGGATCAGAGGCAGAGATCACTCCGAGCTGCTGTGGATCGTGGGCGACGCCTCTAGATTCAATGCTCAG GGCGCCGTGCCTACCAACAGAACCTGCAGAGACATCCTGCGGAAAGAGGACGAGAACGACTGGCACAGCGCCGAGGATATCAGGC TGCTGACAGTGATGGCCGCTCTGTTCCACGATATCGGCAAAAAGCCAGCCAGGCCTTCCAGGCCAAGCTGAGAAATAGAGGCAAG

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to systems, compositions, and methods for altering nucleic acids, such as at a single position (e.g., A/T to G/C or G/C to A/T; in a gene with disease causing SNP). In particular, the present invention relates to engineered CRISPR/Cas systems comprising: a first Cas protein (e.g., Cas5-8 or Cas11) which is optionally tethered or fused to an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein; and at least one guide RNA (gRNA) configured to hybridize to a portion of a target nucleic acid sequence. In certain embodiments, the systems further comprise a second Cas protein selected from: i) Cas3, ii) a helicase-deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein).

Description

Attorney Docket No. UM-41218.601 CRISPR BASE EDITOR FIELD [001] The present invention relates to systems, compositions, and methods for altering nucleic acids, such as at a single position (e.g., A/T to G/C or G/C to A/T; in a gene with disease causing SNP). In particular, the present invention relates to engineered CRISPR/Cas systems comprising: a first Cas protein (e.g., Cas5-8 or Cas11) which is optionally tethered or fused to an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein; and at least one guide RNA (gRNA) configured to hybridize to a portion of a target nucleic acid sequence. In certain embodiments, the systems further comprise a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein). INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY [002] The text of the computer readable sequence listing filed herewith, titled “41218- 601_SEQUENCE_LISTING”, created August 24, 2023, having a file size of 417,584 bytes, is hereby incorporated by reference in its entirety. STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH [003] This invention was made with government support under contract numbers GM137833 awarded by the National Institutes of Health. The government has certain rights in the invention. BACKGROUND [004] The majority of human disease-causing mutations are point mutations, highlighting the need for developing tools to install any desired single-nucleotide changes at any target gene. Conventional Cas9 nuclease-based gene editing approach generates harmful double-strand breaks. Leading base editors (BE) are based on Types II or V CRISPR effectors, Cas9 or Cas12a, and modify bases within a 4-7 nucleotides window, which must be correctly positioned relative to an essential DNA motif termed protospacer adjacent motif (PAM). Most DNA sites in the human genome remain inaccessible for base editing, due to the lack of BE compatible DNA-binding CRISPR proteins that recognize diverse PAMs and the rigid distance requirement between the desired editing position and PAM. There is a pressing need to develop novel BE platforms with expanded targeting Attorney Docket No. UM-41218.601 SUMMARY [005] The present invention relates to systems, compositions, and methods for altering nucleic acids, such as at a single position (e.g., A/T to G/C or G/C to A/T; in a gene with disease causing SNP). In particular, the present invention relates to engineered CRISPR/Cas systems comprising: a first Cas protein (e.g., Cas5-8 or Cas11) which is optionally tethered or fused to an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein; and at least one guide RNA (gRNA) configured to hybridize to a portion of a target nucleic acid sequence. In certain embodiments, the systems further comprise a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein). [006] In some embodiments, provided herein are systems for altering a target nucleic acid sequence comprising: an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)- CRISPR associated (Cas) (CRISPR-Cas) system, and/or one or more nucleic acids encoding the engineered CRISPR-Cas system, wherein the engineered CRISPR-Cas system comprises: a) a first Cas protein, wherein the first Cas protein is optionally selected from the group consisting of: Cas5, Cas6, Cas7, Cas8, or Cas11; b) an effector protein which is optionally tethered or fused to the first Cas protein, wherein the effector protein comprises: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC (apolipoprotein B mRNA editing enzyme, catalytic polypeptide) protein; c) optionally a second Cas protein, wherein the second Cas protein comprises: i) Cas3, ii) a helicase-deficient Cas3; iii) a single-strand nicking Cas endonucleases (SSNCE), wherein the SSNCE is optionally Cas9 Nickase H840A Protein; and d) at least one guide RNA (gRNA), wherein each gRNA is configured to hybridize to a portion of a target nucleic acid sequence. [007] In certain embodiments, the one or more nucleic acids comprises one or more messenger RNAs, one or more vectors, or a combination thereof. In certain embodiments, the first Cas protein, the effector protein, and the second Cas protein are encoded by a single nucleic acid. In additional embodiments, the first Cas protein, the effector protein, and the second Cas protein are encoded by different nucleic acids. In other embodiments, the guide RNA is encoded by a different nucleic acid than the first Cas protein, the effector protein, and the second Cas protein. In additional embodiments, the guide RNA, the first Cas protein, the effector protein, and the second Cas protein, are encoded by a single nucleic acid. In further embodiments, at least one or all of the first Cas protein, the effector protein, and the second Cas protein comprise a nuclear localization sequence or a tag. Attorney Docket No. UM-41218.601 [008] In certain embodiments, the first Cas protein is selected from the group consisting of: Cas5, Cas6, Cas7, and Cas8 or Cas11. In other embodiments, the engineered CRISPR-Cas system is derived from a Type I CRISPR-Cas system. In additional embodiments, the Type I CRISPR-Cas system is a Type I-B, a Type I-C, or a Type I-D system. [009] In particular embodiments, the at least one gRNA is encoded in a CRISPR RNA (crRNA) array. In additional embodiments, the at least one gRNA comprises a non-naturally occurring gRNA. In some embodiments, the system further comprises at least one target nucleic acid. In other embodiments, the system is a cell free system. [010] In some embodiments, provided herein are compositions comprising any of the systems described above or herein. In other embodiments, provided herein is a eukaryotic cell comprising any of the systems above or herein. [011] In particular embodiments, provided herein are methods of altering a target nucleic acid sequence comprising: contacting a target nucleic acid sequence with any one of the systems or compositions described above or herein. In certain embodiments, altering a target nucleic acid sequence comprises changing an A/T pair to a G/C pair, or changing a G/C pair to an A/T pair, in the target nucleic acid sequence. In some embodiments, the target nucleic acid sequence encodes a gene product with a disease or condition causing single nucleotide polymorphism. [012] In certain embodiments, the target nucleic acid sequence is in a cell. In other embodiments, the cell is a eukaryotic cell (e.g., mammalian cell or human cell). In particular embodiments, the target nucleic acid sequence is a genomic DNA sequence. In some embodiments, contacting a target nucleic acid sequence comprises introducing the system into the cell. In further embodiments, introducing the system into the cell comprises administering the system to a subject (e.g., human subject). In further embodiments, the administering comprises in vivo administration. In some embodiments, the administering comprises transplantation of ex vivo treated cells comprising the system. [013] Other aspects and embodiments of the disclosure will be apparent in light of the following detailed description and accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS [014] Figure 1. Developing Nla type I-C CRISPR into adenine base editors in human cells. (A) Cartoon depicting a novel adenine base editing platform derived from the multi-subunit Cas moiety of Nla type I-C CRISPR-Cas system. A single-stranded DNA specific adenine deaminase (TadA* from ABE8e [Richter et al, NBT 2020, PMID: 32433547]) is fused to a subunit of the Cascade target-recognition Attorney Docket No. UM-41218.601 complex. Cascade is directed by CRISPR RNA (crRNA) to bind PAM-flanked target sequence, bringing TadA* closer to modify nearby accessible adenine residues. A helicase-defective but nuclease-intact Cas3 variant serves as a nickase (nCas3) that cleaves non-target strand (NTS) DNA, tricking human cells to use the opposing target strand (TS) as template in DNA repair to copy inosine intermediate thereby leading to robust TS base editing. (B) In vitro DNA cleavage assay showing that in the absence of ATP, wild-type (wt) Cas3 is converted into nCas3 that nicks the NTS but not TS DNA. When incubated with ATP, dsDNA target, and a cognate Cascade RNP with matching crRNA, wt Cas3 (which has both nuclease and ATP-dependent helicase activities) cleaves both the TS and NTS strands at multiple locations. (C) Schematics of plasmids used to express all Nla Type I-C components in human cells. Human codon optimized cas5, cas7, cas8, cas11, and cas3 genes are driven from EF1α promoters, each has a tethered nuclear localization signal (NLS) and HA epitope tag. CRISPR RNA is expressed from a R-S-R array containing two CRISPR repeats and one spacer, driven by a U6 promoter. (D) Schematics of all TadA* fusion configurations analyzed. TadA* is tethered to N- or C- termini of each Cascade subunit. (E) TadA* tethering to all possible Cascade subunit termini can be tolerated to varying degree, in traditional gene deletion assay with wt CRISPR-Cas3. Cascade-TadA* fusions shown in (D) were assayed in a HAP1- GFP reporter cell line, for their abilities to support large gene deletion, with wt Cas3 and a GFP-targeting crRNA. Gene targeting efficiencies were shown on the Y-axis, as the percentage of EGFP negative cells in the total population. [015] Figure 2. Analyses of different Cascade-TadA* fusions on three genomic targets in human cells revealed distinct base editing positions, compared to Cas9-BEs. (A-C) Heatmap representations of A•T to G•C edits achieved by different Cascade-TadA* fusions, in conjunction with helicase-deficient nCas3 (D392A), on various genomic sites AAVS1-EGFP in HAP1 cells (A), HIRA (B) and HPRT1 (C) in HEK293T cells. Plasmids encoding all components were transfected into HAP1-EGFP reporter cell line or HEK293T cells. Base conversion efficiencies were measured via amplicon sequencing NGS and plotted as the percentage of total reads with A•T to G•C edits at a specific location. The target regions and protospacer-adjacent-motifs (PAM) are shown at the bottom, with positions of all adenines relative to PAM labeled. TadA* tethering to Cas11 subunit elicited robust base editing at unexpected positions on TS DNA downstream of the crRNA-matched sequence. Note: these editing positions are distinct from that of Cas9-BEs. This configuration (Cas11-TadA*) was dubbed Type I-ABE and was used in all later experiments unless otherwise noted. Attorney Docket No. UM-41218.601 [016] Figure 3. Define the base editing window for Nla-IC-ABE in human cells. (A) To comprehensively define Nla-IC-ABE’s editing window, we evaluated 21 different genomic sites in HAP1-EGFP reporter or HEK293T cells and found that 15 sites exhibited >=3% A-to-G editing. For those sites (10 out of 21) with >6% editing efficiencies, heatmap representations of their A-to-G editing efficiencies were shown (mean, n=3). PAM is located at positions -3 to -1, whereas CRISPR-matched target sequence is at positions 1-35 following the PAM. (B) Results from the 10 target sites shown in (A) were plotted together into a bar graph. X-axis, target site nucleotide (nt) positions; Y-axis, normalized A•T-to-G•C editing efficiencies. For each target, data for each nt position were normalized relative to the position with the highest editing value, which was set to 100%. We used an arbitrary threshold of 40% (dotted line) to define the editing window. Data are mean +/- standard deviation (SD) (C) Data in B was smoothened by fitting to a normal distribution. (D) Schematic illustration of the editing window (blue box) defined for Nla Type I-ABE. Red box denotes the upstream 5’-TTC PAM. Note: Nla Type I-ABE enabled a distinct window on TS DNA downstream of CRISPR-matched sequence. This differs from prior Cas9-derived ABEs, which install A•T-to-G•C edits on NTS DNA within the R-loop. The editing window (blue box) of Cas9-ABE8 is illustrated in (E) for comparison. [017] Figure 4. Therapeutic potential of Nla Type I-ABE. We envision that the Nla Type I-ABE components, in DNA, RNA, or ribonucleoproteins (RNP) format, can be used in clinical settings. Shown here are two example corrections of disease-causing mutations. (A) Example 1: Converting sickle cell disease (SCD)-causing β-globin gene HBBS allele into a benign Makassar allele HBBG. The targeted regions of HBBS and HBBG are shown at the top and bottom, respectively. The pathogenic variant A to be corrected is located at position 43 nt downstream of the 5’-TTC PAM (marked in red). The resulting G after A-to-G conversion was shown in blue. Ex vivo editing of patient hematopoietic stem and progenitor cells (HSPCs) using such a Nla Type I-ABE strategy would offer accessible cure to SCD patients. (B) Example 2: Correcting W138X mutation in the CTNS gene, which is the underlying cause of rare disease cystinosis. The targeted region of W138X and wt alleles are shown at the top and bottom, respectively. The pathogenic target A at position 41 nt downstream of the 5’-TTC PAM was indicated in red. Patient HSPCs that are ex vivo edited and transduced back would populate all tissue compartments, reduce cystine level and restore normal cellular functions in most diseased organs and cells. Note: Due to the lack of a well-positioned 3’-NGG PAM, the SCD HBBS and CTNS W138X alleles remained inaccessible to base editing until very recently, when the Cas9 NRCH variant was invented via phage-assisted continuous Attorney Docket No. UM-41218.601 evolution to recognize altered PAM specificity (3’-NGG to 3’-NRCH [Miller et al., NBT 2020. PMID: 32042170]). [018] Figure 5. Tunable editing window achieved using a “guide-length variation” strategy. (A) Schematics of the guide-length variation strategy. By shortening or elongating the length of crRNA spacer (i.e., guide) sequence in 3-nt increments, we can remodel the overall Nla Cascade architecture and thereby freely slide the editing window over the target region. (B) Heatmap representation of base editing positions and efficiencies achieved on a GFP target site for Nla Type I-ABE, using CRISPR guides ranging from 23 to 65 nts. Experiments were performed in HAP1-EGFP reporter cells. The PAM (in red) and target sequence are shown at the bottom, with positions of adenines labeled on TS DNA. The wt guide length is 35 nts, further truncations or elongations occur at its 3’ end. (C) Northern blots showing increasing lengths of mature crRNAs for Nla Type I-ABE in human cells, as the guide/spacer encoded in the R-S-R CRISPR array construct changes from 23 to 65 nts. Note: 35 nt is the wt spacer length. Total RNAs were extracted from human cells transfected with Nla Type I-ABE-encoding plasmids and subjected to 15% denaturing PAGE and northern blot analysis, probing for mature crRNA (anti-repeat probe, top) and 5S rRNA as the loading control (bottom). [019] Figure 6. Nla Type I-ABE mediated base editing on targets with canonical PAM and non- canonical PAM variants. Previously we have found that wt Nla I-C CRISPR-Cas system (i.e., Nla Cascade-Cas3 without TadA* fusion) elicits robust gene targeting activity with its consensus PAM (5’- TTC), as well as several non-canonical PAM variants (5’-CTC, TCC, TTG and TTT). Here we tested PAM specificity for Nla Type I-ABE by assaying base editing on dozens of genomic target sites flanked by canonical (A) and non-canonical (B) PAMs. Experiments were conducted and analyzed as described in Figure 2A, with the highest A•T to G•C conversion efficiency at any position for each target site plotted. While most targets with canonical PAM exhibited robust base editing (>5%), the vast majority of non- canonical CTC, TCC or TTG PAMs tested failed to support base editing with >2% efficiency. Two out of the three TTT PAMs tested gave >2% base editing. (C) A schematic of target site positions with non- canonical PAMs on EGFP reporter gene tested in B. [020] Figure 7. Enabling a different editing window on NTS DNA by omitting nCas3 from Nla Type I-ABE. (A) Schematic illustration of “Cascade-TadA*” only version of Nla Type I-ABE, which lacks the nCas3 nickase. In this setup, TadA* is tethered to a subunit of Cascade and therefore brought closer to the Cascade-DNA-RNA R-loop formed at the targeted site. Because the D392A nCas3 nickase is left out in this Type I-ABE configuration, potential A•T-to-G•C edits occurring on the displaced NTS Attorney Docket No. UM-41218.601 DNA within R-loop are unmasked and retained. (B-C) Heatmap representations of A•T to G•C edits achieved by different Cascade-TadA* fusions without nCas3, on genomic target sites in HIRA (B) and HPRT1 (C) genes in HEK293T cells. Experiments were conducted by co-transfecting plasmids encoding all Cascade-TadA* components into HEK293T cells and measuring A•T to G•C edits via targeted amplicon sequencing. Base editing efficiencies were plotted as the percentage of total reads with A•T to G•C edits at a specific location. The target sequences and protospacer-adjacent-motifs (PAM, in red) are shown at the bottom, with positions (relative to PAM) of all adenines indicated. TadA* fusion to Cas11 elicited the most robust base conversions on NTS DNA inside the presumed R-loop (i.e., the CRISPR- complementary 1-35 nts region). This configuration (Cas11-TadA*, no nCas3) was used in all later experiments for NTS editing, unless noted otherwise. [021] Figure 8. Define the NTS editing window for Cascade-TadA* in human cells, in the absence of nCas3. (A) To comprehensively define the NTS editing window for the Cascade-TadA* & no nCas3 set up, we assayed 7 different genomic target sites in HEK293T or HAP1-EGFP reporter cells. Heatmap representations of their A•T to G•C conversion efficiencies were shown (mean, n=3). PAM is located at positions -3 to -1, whereas CRISPR-matched target sequence is at positions 1-35 following the PAM. (B) Results from the 7 target sites in (A) were plotted together into a bar graph. X-axis, target site nucleotide (nt) positions; Y-axis, normalized A•T-to-G•C editing efficiencies. For each target, data for each nt position were normalized relative to the position with the highest editing value, which was set to 100%. An arbitrary threshold of 40% (dotted line) was used to define the editing window. (C) Data in (B) was smoothened by fitting to a normal distribution. (D) Schematic illustration of the NTS editing window (blue box) defined for Nla Cascade-TadA* without nCas3. Red box denotes the upstream 5’-TTC PAM. The window (26-38 nts) spans the PAM-distal end of R-loop and its 3’ flank. [022] Figure 9. TS DNA nicking by H840A nickase Cas9 (nCas9) is a viable strategy to enhance base conversion efficiency of Cascade-TadA* in its NTS editing window. (A) A schematic depicting the 5’-TTC PAM (in red), CRISPR-target site (in grey), and nicking positions of the nCas9 used. Five different guides for nCas9 are cleaving at 68-, 100-, 122- nts downstream or 47-, and 83- nts upstream of the 1st nt of the Nla target, respectively. Instead of using nCas3 to nick NTS as described in Figs.2-6, here we exploited H840A nCas9 directed by its sgRNA to nick TS DNA in the close vicinity. These TS nicking events would cause human cells to use the opposing NTS as template in DNA repair to copy the inosine intermediates created by Cascade-TaA*, thereby enhancing NTS edits and diminishing TS edits. (B) Heatmap representation of A•T to G•C editing positions and efficiencies achieved by Cascade (via Attorney Docket No. UM-41218.601 Cas11)-TadA* fusion, in conjunction with H840A nCas9. Experiments were conducted on the AAVS1- EGFP-guide 1 genomic site in HAP1-GFP reporter cells. Base editing by Cascade-TadA* alone caused negligible A•T to G•C conversion on both the NTS and TS DNA. Upon stimulation by a nearby Cas9 nicking guide (e.g., G1 and G2), NTS editing efficiency can be elevated to ~ 5%. [023] Figure 10. Diverse Type I CRISPR subtypes and orthologs can be harnessed as Type I-ABEs, with broad targetable PAM repertoire. (A) Schematics of various Type I CRISPR-Cas systems utilized, including a I-B locus from cyanobacteria Synechocystis (Syn), the Bacillus halodurans (Bha) I-C, Thermobifida fusca (Tfu) I-E, Pseudomonas aeruginosa (Pae) I-F and Thioalkalivibrio sulfidiphilus (Tsu) I-G systems. Left, Cas loci; right, R-S-R CRISPR array used with the actual repeat sequence and lengths of spacers and repeats indicated. (B-F) Heatmap representations of A•T to G•C editing positions and efficiencies achieved by Syn I-B (5’-ATG PAM), Bha I-C (5’-TTC PAM), Tfu I-E (5’-AAG PAM), Pae I-F (5’-CC PAM) and Tsu I-G (5’-TTC PAM) based Type I-ABE platforms. All Cascade orthologs were assayed with TadA* tethered to the Cas11 subunit (except for Pae I-F which has TadA* fused to Cas6 and Tsu I-G which has TadA* fused to either Cas8, Cas7 or Csb2), in the absence or presence of a cognate nCas3. Experiments were performed in HAP1 reporter cells. Note: we found that distinct Type I-ABE orthologs have different TS vs. NTS editing preferences. For example, Syn I-B-ABE has minimal TS DNA editing even under nCas3 condition but showed ~5 % editing in the NTS editing window in the absence of nCas3 (B). Bha I-C-ABE exhibited similar editing efficacy and windows as Nla I-C-ABE, except that its NTS window is wider (C). The Tfu I-E-ABE and Pae I-F-ABE prefers to edit TS DNA downstream of the presumed R-loop but elicited minimal NTS editing in the R-loop (D-E). [024] Figure 11. Developing Nla type I-C CRISPR-Cas into cytosine base editors in human cells using APOBEC. (A). Schematics of the key CBE constructs used. APOBEC is tethered to the N- or C- terminus of Cas11, whereas a 2X Uracil Glycosylase Inhibitor (UGI) is fused to the C- terminus of Cas5. All other crispr-cas-encoding constructs are the same as depicted in Fig 1C. (B-C). Heatmap representations of C•G to T•A edits achieved by different Cas11-APOBEC fusions, in conjunction with nCas3 (D392A) or Cas5-2xUGI, on genomic target sites for HPRT1-guide 6 (B) or HPRT1-guide 1 (C) in HEK293T cells. Plasmids encoding all individual components were co-transfected into HEK293T cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with C•G-to-T•A edits at a specific nt location. Sequences of the target region and PAM (in red) are shown at the bottom, with positions of all cytosines relative to PAM (-1) labeled. Overall, Type IC-CBE exhibited a similar trend in terms of editing window positions, compared to Type IC-ABE. It is Attorney Docket No. UM-41218.601 important to include the 2xUGI fusion on Cas5 because this led to significant increases of the C•G-to-T•A editing efficiencies. With nCas3’ presence, APOBEC tethering through Cas11 elicited cytosine base editing on TS DNA in a window (position 42-53 nts relative to PAM) downstream of the crRNA-paired sequence. Without nCas3, TS cytosine editing is reduced whereas NTS editing on the displaced DNA in the Cascade/DNA/R-loop region is enhanced. [025] Figure 12. Developing Nla type I-C CRISPR-Cas into cytosine base editors in human cells using tadCBE. (A). Schematics of the CBE constructs used. tadCBE is tethered to the C- terminus of Cas11, whereas a 2X Uracil Glycosylase Inhibitor (UGI) is fused to the C- terminus of Cas5. All other crispr-cas-encoding constructs are the same as depicted in Fig 1C. B. Heatmap representations of C•G to T•A edits achieved by Cas11-tadCBE fusion, in conjunction with nCas3 (D392A) and Cas5-2xUGI, on genomic target sites for HPRT1-guide 7 in HEK293T cells. Plasmids encoding all individual components were co-transfected into HEK293T cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with C•G-to-T•A edits at a specific nt location. Sequences of the target region and PAM (in red) are shown at the bottom, with positions of all cytosines relative to PAM (-1) labeled. Overall, Type IC-CBE exhibited a similar trend in terms of editing window positions, compared to Type IC-ABE. It is important to include the 2xUGI fusion on Cas5 because this led to significant increases of the C•G-to-T•A editing efficiencies. With nCas3’ presence, tadCBE tethering through Cas11 elicited cytosine base editing on TS DNA in a window (position 42-53 nts relative to PAM) downstream of the crRNA-paired sequence. [026] Figure 13. Developing Nla type I-C CRISPR-Cas into C to G base editor (CGBE) in human cells using tadCBE. (A). Schematics of the CGBE constructs used. tadCBE is tethered to the C- terminus of Cas11. All other crispr-cas-encoding constructs are the same as depicted in Fig 1C. B. Heatmap representations of C•G to G•C edits achieved by Cas11-tadCBE fusion, in conjunction with nCas3 (D392A), on genomic target sites for HPRT1-guide 7 in HEK293T cells. Plasmids encoding all individual components were co-transfected into HEK293T cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with C•G-to-G•C edits at a specific nt location. Sequences of the target region and PAM (in red) are shown at the bottom, with positions of all cytosines relative to PAM (-1) labeled. Overall, Type IC-CGBE exhibited a similar trend in terms of editing window positions, compared to Type IC-ABE. [027] Figure 14. Developing Nla type I-C CRISPR-Cas into A to Y base editor (AYBE) in human cells using tadA* and MPGv3. (A). Schematics of the AYBE constructs used. tadA* is tethered Attorney Docket No. UM-41218.601 to the C- terminus of Cas11 just like regular type I-C ABE. A mutant version of human MPG (MPGv3) is fused to the C- terminus of Cas5. All other crispr-cas-encoding constructs are the same as depicted in Fig 1C. B. Heatmap representations of A•T to T•A (top panel) and A•T to C•G (bottom panel) edits achieved by type I-C AYBE, in conjunction with nCas3 (D392A), on genomic target sites for HPRT1-guide 7 in HEK293T cells. Plasmids encoding all individual components were co-transfected into HEK293T cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with A•T to T•A or A•T to C•G edits at a specific nt location. Sequences of the target region and PAM (in red) are shown at the bottom, with positions of all adenine residues relative to PAM (-1) labeled. Overall, Type IC-AYBE exhibited a similar trend in terms of editing window positions, compared to Type IC-ABE. [028] Figure 15. Experimental evidence of the therapeutic potential of Nla Type I-ABE. Exemplary Nla Type I-ABE components, in DNA, RNA, or ribonucleoproteins (RNP) format are shown. Shown here are two example generation of beneficial mutations. (A) Example 1: Knocking out PCSK9 expression in hepatocytes by mutating the splice junction site that leads to exon skipping. A recent report showed durable LDL cholesterol reductions in primates following one single treatment with PCSK9 Cas9-base editor (PMID: 34012082). Here in our Type I-ABE experiment, the targeted region and guide sequence used are shown. The ‘A’ to be mutated, which is critical for normal mRNA splicing, is located at position 44 nt downstream of the 5’-TTC PAM (marked in red). The exemplary gene therapy product is in vivo base editing of patient hepatocytes using this and other similar Nla Type I-ABE strategies to achieve PCSK9 knock down. The clinical goal is that patients with uncontrolled high cholesterol experience significant durable reduction of blood cholesterol level. (B) 15% intended PCSK9 A-to-G editing is achieved using Type I-ABE in HepG2 cells. Plasmids encoding all individual components were co-transfected into HepG2 cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with A•T to G•C edits at A44 location either with or without puromycin selection. In this experiment, Cas11-tadA* plasmid contains a puromycin resistant cassette for selection after transfection to enrich for cells with transfected plasmids. (C) Example 2: Knocking out ASGR1 expression in hepatocytes by mutating the splice junction site that leads to exon skipping. The targeted region and guide sequence used are shown. The ‘A’ to be mutated, that is critical for mRNA splicing, is located at position 45 nt downstream of the 5’-TTC PAM (marked in red). The envisioned gene therapy product is in vivo base editing of patient hepatocytes using this and other similar Nla Type I-ABE strategies to achieve ASGR1 knock down. The clinical goal is that patients exhibit Attorney Docket No. UM-41218.601 reduce low-density lipoprotein (LDL)-cholesterol and coronary artery disease risk. (D). Plasmids encoding all individual components were co-transfected into HepG2 cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with A•T to G•C edits at a A45 location either with or without puromycin selection. In this specific experiment, Cas11-tadA* plasmid contains a puromycin resistant cassette for puromycin selection after transfection to enrich for cells with transfected plasmids. [029] Figure 16. Further engineering NlaCas3 nickase to decrease its indel formation in base editing applications. A. Cartoon showing the NlaCas3 domain architecture. Important helicase motifs and potentially critical residues for the NlaCas3’s helicase activity are indicated. Data in prior figures are generated using D392A nickase NlaCas3, which exhibited residual GFP disruption in nuclease-based assays in panel B and single digit indel formation in base editing in panel C. We hypothesized that this is due to residual helicase activity and envision mutating any of the residues listed here individually, or combinatorically, to create a better version of Cas3 nickase to mitigate indel formation. B-C. An example Cas3 nickase (sextuple mutants, M6) showed reduced residue activity in GFP-targeting (B, nuclease assay) and indel formation in base editing experiments (C). In panel B, plasmids encoding all individual components of WT Nla-IC Cascade targeting either EGFP-G1 along with different versions of Cas3 were co-transfected into HAP1EGFP reporter cells. The GFP negative cell percentage was measured via flow cytometry 4 days after transfection. The 5% GFP disruption by single mutant nCas3 (M1) was likely caused by its residual helicase activity that causes smaller deletions or insertions (indels); and is further reduced to 2% in M6, reflecting further mitigation of helicase activities. C. To confirm findings from B, we directly measured indel formation by deep sequencing in a base editing experiment using a target site that gave relatively high indel formation for M1 base editing. As a proof-of-concept, indel formation is reduced from 20% of M1 to 3% of M6. We envision any other helicase domain mutations introduced into the key residues would generate similar effect. D. M6 Cas3 nickase still maintained high capacity for supporting base editing activity. Only a modest drop from ~60% to 45% was observed in base editing activity when comparing M6 to M1. For C and D, Plasmids encoding all individual components of Nla- IC-BE targeting HPRT1-G7 were co-transfected into HEK293T cells, and indel formation and base conversion efficiencies measured via amplicon sequencing NGS and calculated as the percentage of total reads with indel or A•T-to-G•C edits at a specific nt location. The highest base conversion efficiency is shown. Attorney Docket No. UM-41218.601 DETAILED DESCRIPTION OF THE INVENTION [030] The present invention relates to systems, compositions, and methods for altering nucleic acids, such as at a single position (e.g., A/T to G/C or G/C to A/T; in a gene with disease causing SNP). In particular, the present invention relates to engineered CRISPR/Cas systems comprising: a first Cas protein (e.g., Cas5-8 or Cas11) which is optionally tethered or fused to an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein; and at least one guide RNA (gRNA) configured to hybridize to a portion of a target nucleic acid sequence. In certain embodiments, the systems further comprise a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein). [031] Type I CRISPR-Cas is the most widespread and diversified type of bacteria adaptive immune system. It can be further classified into eight subtype (I-A through I-F, I-Fv, and I-U) based on their cas gene composition. Type I CRISPR system uses an RNA-guided multi-subunit complex called Cascade to find DNA target site, and then recruits a helicase-nuclease enzyme, Cas3, to travel along and degrade target DNA over a long distance with high processivity. Work conducted during development of embodiments herein established, in some embodiments, a novel BE platform by tethering TadA-8e (TadA*) deaminase to the small subunit (Cas11) of Cascade from the N. lactamica Type I-C CRISPR. We found that in the presence of a helicase-defective Cas3 nickase, TadA*-Cascade fusion enables ~20% A·T to G·C conversion on target strand DNA, at an unexpected window 41-47 nts downstream of the 5’ TTN PAM. This is in stark contrast to the traditional editing window for Cas9 nickase-BEs, which is on non- target strand DNA 14-17 nts upstream of a 3’- NGG PAM. Furthermore, we devised a “guide length variation” strategy that can successfully tune the Type I-BE editing window across a ~30-40 nt region. This is achieved by modulating the guide RNA length in 3-nt increments, leading to remodeled Cascade complexes with elongated or shortened overall architectures. This remodeling would place the TadA* deaminase to different positions along the DNA target (relative to the 5’ anchored PAM), thereby enabling editing window tunability. Lastly, we have also developed additional Type I-BEs based on other CRISPR subtypes (e.g., I-E, I-F, etc.) that offer novel PAM specificities and guide orthogonality. Taken together, our Type I-BE platform greatly expanded the targeting capacity for base editing technology. It would therefore substantially increase the number of human genetic disorders that can be potentially treated via base editing therapeutics (e.g., correction of the sickle cell disease mutation). Attorney Docket No. UM-41218.601 1. Definitions [032] To facilitate an understanding of the present technology, a number of terms and phrases are defined below. Additional definitions are set forth throughout the detailed description. [033] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not. [034] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated. [035] Unless otherwise defined herein, scientific, and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. [036] As used herein, a “nucleic acid” or a “nucleic acid sequence” refers to a polymer or oligomer of pyrimidine and/or purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub.1982)). The present technology contemplates any deoxyribonucleotide, ribonucleotide, or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated, or glycosylated forms of these bases, and the like. The polymers or oligomers may be heterogenous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states. In some embodiments, a nucleic acid or nucleic acid sequence comprises other kinds of nucleic acid structures such as, for instance, a DNA/RNA helix, peptide nucleic acid (PNA), morpholino nucleic acid (see, e.g., Braasch and Corey, Biochemistry, 41(14): 4503-4510 (2002)) Attorney Docket No. UM-41218.601 and U.S. Patent 5,034,506), locked nucleic acid (LNA; see Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 97: 5633-5638 (2000)), cyclohexenyl nucleic acids (see Wang, J. Am. Chem. Soc., 122: 8595- 8602 (2000)), and/or a ribozyme. Hence, the term “nucleic acid” or “nucleic acid sequence” may also encompass a chain comprising non-natural nucleotides, modified nucleotides, and/or non- nucleotide building blocks that can exhibit the same function as natural nucleotides (e.g., “nucleotide analogs”); further, the term “nucleic acid sequence” as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single or double-stranded, and represent the sense or antisense strand. The terms “nucleic acid,” “polynucleotide,” “nucleotide sequence,” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. [037] The terms “complementary” and “complementarity” refer to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base-paring or other non-traditional types of pairing. The degree of complementarity between two nucleic acid sequences can be indicated by the percentage of nucleotides in a nucleic acid sequence which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 50%, 60%, 70%, 80%, 90%, and 100% complementary). Two nucleic acid sequences are “perfectly complementary” if all the contiguous nucleotides of a nucleic acid sequence will hydrogen bond with the same number of contiguous nucleotides in a second nucleic acid sequence. Two nucleic acid sequences are “substantially complementary” if the degree of complementarity between the two nucleic acid sequences is at least 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%.97%, 98%, 99%, or 100%) over a region of at least 8 nucleotides (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides), or if the two nucleic acid sequences hybridize under at least moderate, preferably high, stringency conditions. Exemplary moderate stringency conditions include overnight incubation at 37° C in a solution comprising 20% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5×Denhardt’s solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1×SSC at about 37-50° C, or substantially similar conditions, e.g., the moderately stringent conditions described in Sambrook et al., infra. High stringency conditions are conditions that use, for example (1) low ionic strength and high temperature for washing, such as 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate (SDS) at 50° C, (2) employ a denaturing agent during hybridization, such as formamide, for example, 50% (v/v) Attorney Docket No. UM-41218.601 formamide with 0.1% bovine serum albumin (BSA)/0.1% Ficoll/0.1% polyvinylpyrrolidone (PVP)/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride and 75 mM sodium citrate at 42° C, or (3) employ 50% formamide, 5×SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5×Denhardt’s solution, sonicated salmon sperm DNA (50 μg/ml), 0.1% SDS, and 10% dextran sulfate at 42° C, with washes at (i) 42° C in 0.2×SSC, (ii) 55° C in 50% formamide, and (iii) 55° C in 0.1×SSC (preferably in combination with EDTA). Additional details and an explanation of stringency of hybridization reactions are provided in, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2001); and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, New York (1994). [038] As used herein, the term “percent sequence identity” refers to the percentage of nucleotides or nucleotide analogs in a nucleic acid sequence, or amino acids in an amino acid sequence, that is identical with the corresponding nucleotides or amino acids in a reference sequence after aligning the two sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Hence, in case a nucleic acid according to the technology is longer than a reference sequence, additional nucleotides in the nucleic acid, that do not align with the reference sequence, are not taken into account for determining sequence identity. Methods and computer programs for alignment are well known in the art, including BLAST, Align 2, and FASTA. [039] The term “homology” and “homologous” refers to a degree of identity. There may be partial homology or complete homology. A partially homologous sequence is one that is less than 100% identical to another sequence. [040] As used herein, the term “hybridization” is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (e.g., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the Tm of the formed hybrid. Hybridization methods involve the annealing of one nucleic acid to another, complementary nucleic acid, e.g., a nucleic acid having a complementary nucleotide sequence. The ability of two polymers of nucleic acid containing complementary sequences to find each other and “anneal” or “hybridize” through base pairing interaction is a well-recognized phenomenon. The initial observations of the “hybridization” process by Marmur and Lane, Proc. Natl. Acad. Sci. USA, 46: 453 (1960) and Doty et al., Proc. Natl. Acad. Sci. USA, 46: 461 (1960), have been followed by the refinement of this process into an essential tool of modern biology. For Attorney Docket No. UM-41218.601 example, hybridization and washing conditions are now well known and exemplified in Sambrook et al., supra. The conditions of temperature and ionic strength determine the “stringency” of the hybridization. [041] As used herein, a “double-stranded nucleic acid” may be a portion of a nucleic acid, a region of a longer nucleic acid, or an entire nucleic acid. A “double-stranded nucleic acid” may be, e.g., without limitation, a double-stranded DNA, a double-stranded RNA, a double-stranded DNA/RNA hybrid, etc. A single-stranded nucleic acid having secondary structure (e.g., base-paired secondary structure) and/or higher order structure (e.g., a stem-loop structure) may also be considered a “double-stranded nucleic acid.” For example, triplex structures are considered to be “double-stranded.” In some embodiments, any base-paired nucleic acid is a “double-stranded nucleic acid.” [042] The term “gene” refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA having a non-coding function (e.g., a ribosomal or transfer RNA), a polypeptide, or a precursor of any of the foregoing. The RNA or polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained. Thus, a “gene” refers to a DNA or RNA, or portion thereof, that encodes a polypeptide or an RNA chain that has functional role to play in an organism. For the purpose of this disclosure, it may be considered that genes include regions that regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions. [043] The term “wild-type” refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene. In contrast, the term “modified,” “mutant,” or “polymorphic” refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild- type gene or gene product. [044] As used herein, the term “variant” refers to the exhibition of qualities that have a pattern that deviates from what occurs in nature. In some embodiments, a variant may also be a mutant. Attorney Docket No. UM-41218.601 [045] The terms “non-naturally occurring,” “engineered,” and “synthetic” are used interchangeably and indicate the involvement of the hand of man. The terms, when referring to nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature. [046] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. [047] “Binding” as used herein (e.g., with reference to an RNA-binding domain of a polypeptide) refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). While in a state of non-covalent interaction, the macromolecules are said to be “associated” or “interacting” or “binding” (e.g., when a molecule X is said to interact with a molecule Y, it is meant the molecule X binds to molecule Y in a non-covalent manner). Not all components of a binding interaction need be sequence- specific (e.g., contacts with phosphate residues in a DNA backbone), but some portions of a binding interaction may be sequence specific. Binding interactions are generally characterized by a dissociation constant (Kd) of less than 10–6 M, less than 10–7 M, less than 10–8 M, less than 10–9 M, less than 10–10 M, less than 10–11 M, less than 10–12 M, less than 10–13 M, less than 10–14 M, or less than 10–15 M. “Affinity” refers to the strength of binding, increased binding affinity being correlated with a lower Kd. [048] By “binding domain” it is meant a protein domain that is able to bind non-covalently to another molecule. A binding domain can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein binding protein). In the case of a protein domain-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins. [049] “Recombinant,” as used herein, means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and/or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems. DNA sequences encoding polypeptides can be assembled from cDNA fragments or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system. Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of Attorney Docket No. UM-41218.601 non-translated DNA may be present 5’ or 3’ from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms). Alternatively, DNA sequences encoding RNA (e.g., DNA-targeting RNA) that is not translated may also be considered recombinant. Thus, the term “recombinant” nucleic acid refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a codon encoding the same amino acid, a conservative amino acid, or a non- conservative amino acid. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. When a recombinant polynucleotide encodes a polypeptide, the sequence of the encoded polypeptide can be naturally occurring (“wild type”) or can be a variant (e.g., a mutant) of the naturally occurring sequence. Thus, the term “recombinant” polypeptide does not necessarily refer to a polypeptide whose sequence does not naturally occur. Instead, a “recombinant” polypeptide is encoded by a recombinant DNA sequence, but the sequence of the polypeptide can be naturally occurring (“wild type”) or non-naturally occurring (e.g., a variant, a mutant, etc.). Thus, a “recombinant” polypeptide is the result of human intervention but may be a naturally occurring amino acid sequence. [050] A “vector” or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, e.g., an “insert,” may be attached or incorporated so as to bring about the replication of the attached segment in a cell. [051] A cell has been “genetically modified,” “transformed,” or “transfected” by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that Attorney Docket No. UM-41218.601 comprise a population of daughter cells containing the transforming DNA. A “clone” is a population of cells derived from a single cell or common ancestor by mitosis. A “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations. [052] A “subject” or “patient” may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model as described herein. Likewise, patient may include either adults, juveniles (e.g., children), or infants. Moreover, patient may mean any living organism, preferably a mammal (e.g., humans and non-humans) that may benefit from the administration of compositions contemplated herein. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non-mammals include, but are not limited to, birds, fish, and the like. In one embodiment, the mammal is a human. [053] The term “contacting” as used herein refers to bring or put in contact, to be in or come into contact. The term “contact” as used herein refers to a state or condition of touching or of immediate or local proximity. Contacting a composition to a target destination, such as, but not limited to, an organ, tissue, cell, or tumor, may occur by any means of administration known to the skilled artisan. [054] As used herein, the terms “providing,” “administering,” and “introducing,” are used interchangeably herein and refer to the placement of the compositions of the disclosure into a subject by a method or route which results in at least partial localization of the composition to a desired site. The compositions can be administered by any appropriate route which results in delivery to a desired location in the subject. [055] Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting. 2. CRISPR/Cas system for altering a DNA sequence [056] In bacteria and archaea, CRISPR/Cas systems provide immunity by incorporating fragments of invading phage, virus, and plasmid DNA into CRISPR loci and using corresponding CRISPR RNAs (“crRNAs”) to guide the degradation of homologous sequences. Transcription of a CRISPR locus Attorney Docket No. UM-41218.601 produces a “pre-crRNA,” which is processed to yield crRNAs containing spacer-repeat fragments that guide effector nuclease complexes to cleave dsDNA sequences complementary to the spacer. Several different types of CRISPR systems are known, (e.g., type I, type II, or type III), and classified based on the Cas protein type and the use of a proto-spacer-adjacent motif (PAM) for selection of proto-spacers in invading DNA. [057] Engineering CRISPR/Cas systems for use in eukaryotic cells typically involves reconstitution of the CRISPR/Cas complex. Typically, the RNA sequences necessary for CRISPR/Cas systems are referred to collectively as “guide RNA” (gRNA) or single guide RNA (sgRNA). Thus, the terms “guide RNA,” “single guide RNA,” and “synthetic guide RNA,” are used interchangeably herein and may refer to a nucleic acid sequence comprising a tracrRNA and a pre-crRNA array containing a guide sequence. The terms “guide sequence,” “guide,” and “spacer,” are used interchangeably herein and refer to the nucleotide sequence within a guide RNA that specifies the target site. [058] The terms “Cascade (CRISPR-Associated Complex for Anti-viral Defense)” or “Cascade complex” as used herein, refer to a ribonucleoprotein complex comprised of multiple protein subunits (e.g., Cas proteins) used naturally in bacteria as a mechanism for nucleic acid-based immune defense. The Cascade complex recognizes nucleic acid targets via direct base-pairing to guide RNA contained in the complex. Acceptance of target recognition by Cascade results in a conformational change which, in E. coli and other bacteria, recruits a protein component referred to as Cas3. Cas3 may comprise a single protein unit which contains helicase and nuclease domains. After target validation by Cascade, Cas3 nicks the strand of DNA that is looped out by the R-loop formed by Cascade approximately 9-12 nucleotides inward from the PAM site. Cas3 then uses its helicase/nuclease activity to processively degrade substrate nucleic acids, moving in a 3’ to 5’ direction. In some embodiments, the two or more additional Cas proteins from the Cascade complex are selected from the group consisting of Cas5, Cas7, Cas6, and Cas8 or Cmx8. [059] The engineered CRISPR-Cas system may be derived from a CRISPR-Cas system of any type or subtype. In some embodiments, the engineered CRISPR-Cas system is derived from a Type I CRISPR- Cas system. Type I system is the most widespread and diversified type of CRISPR and is further classified into eight subtypes (I-A through I-F, I-Fv, and I-U) based on cas gene composition. For example, subtypes I-E and I-F lack the cas4 gene. Attorney Docket No. UM-41218.601 [060] In some embodiments, the Type I CRISPR-Cas system is a Type I-C system. Elements or sequences from any suitable Type I-C CRISPR-Cas system may be used in the context of the disclosed methods. In some embodiments, the system comprises Cas11, Cas3, Cas5, Cas7, and Cas8. [061] In some embodiments, the Type I-C CRISPR-Cas system may be derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Neisseria species (e.g., Neisseria lactamica). The genus Neisseria comprises many gram-negative β-proteobacteria that interact with eukaryotic hosts, but only two organisms, the gonococcus (Gc) and its close relative the meningococcus (Mc), are human pathogens, both of which colonize mucosal surfaces. Many non-pathogenic Neisseria species also colonize the human nasopharynx, and among them N. lactamica is the most widely studied commensal bacterium. In some embodiments, the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I-C system of Neisseria lactamica (Nla), or variants thereof. [062] N. lactamica Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the N. lactamica Type I-C proteins. The N. lactamica Type I-C proteins may be those as disclosed in International Patent Application No. PCT/US21/034165, incorporated herein by reference in its entirety. [063] In certain embodiments, the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 99 or SEQ ID NO: 100, the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 102 or SEQ ID NO: 103, the Cas8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 105 or SEQ ID NO: 106, the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 108 or SEQ ID NO: 109, and a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 111 or SEQ ID NO: 112. [064] In certain embodiments, the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 99 or SEQ ID NO: 100, the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103, the Cas8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 105 or SEQ ID NO: 106, the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 108 or SEQ ID NO: 109, and the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 111 or SEQ ID NO: 112. However, the invention is not limited to these exemplary sequences. Indeed, genetic sequences Attorney Docket No. UM-41218.601 can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention. [065] In certain embodiments, the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 101, the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 104, the Cas8 protein comprises the amino acid sequence of SEQ ID NO: 107, the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 110, and the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 113. However, the invention is not limited to these exemplary sequences. For example, in certain embodiments, the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 101, the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 104, the Cas8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 107, the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 110, and the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 113. [066] In some embodiments, the Type I-C CRISPR-Cas system is derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Bacillus species (e.g., Bacillus halodurans (Bha)) system, or variants thereof. The genus Bacillus is a diverse group of spore-forming bacteria ubiquitous in the environment. Bacillus anthracis, the agent of anthrax, is the only obligate Bacillus pathogen in vertebrates. Bacillus larvae, B lentimorbus, B popilliae, B sphaericus, and B thuringiensis are pathogens of specific groups of insects. A number of other species, in particular B cereus, are occasional pathogens of humans and livestock, but the large majority of Bacillus species are harmless saprophytes. Thus, the vast majority of Bacillus are nonpathogenic, environmental organisms found in soil, air, dust, and debris. In some embodiments, the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I-C system of Bacillus halodurans (Bha), or variants thereof. [067] Bacillus halodurans Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Bacillus halodurans Type I-C proteins. [068] In certain embodiments, the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:156, the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 150, the Cas8 (Csd1) protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 152 the Cas7 (Csd2) protein is encoded by Attorney Docket No. UM-41218.601 a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 148, and a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 154. [069] In certain embodiments, the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 156, the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 150, the Cas8 (Csd1) protein is encoded by the nucleic acid sequence of SEQ ID NO: 152, the Cas7 (Csd2) protein is encoded by the nucleic acid sequence of SEQ ID NO: 148, and the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 154. However, the invention is not limited to these exemplary sequences. Indeed, genetic sequences can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention. [070] In certain embodiments, the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 155, the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 149, the Cas8 (Csd1) protein comprises the amino acid sequence of SEQ ID NO: 151, the Cas7 (Csd2) protein comprises the amino acid sequence of SEQ ID NO: 147, and the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 153. However, the invention is not limited to these exemplary sequences. For example, in certain embodiments, the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 155, the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 149, the Cas8 (Csd1) protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 151, the Cas7 (Csd2) protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 147, and the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 153. [071] In some embodiments, the Type I-C CRISPR-Cas system may be derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Desulfovibrio species (e.g., Desulfovibrio vulgaris (Dvu)) system, or variants thereof. Desulfovibrio is a genus of Gram-negative sulfate-reducing bacteria commonly found in aquatic environments. In some embodiments, the CRISPR- Cas system used in the context of the present disclosure is derived from the Type I-C system of Desulfovibrio vulgaris (Dvu), or variants thereof. [072] Desulfovibrio vulgaris Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Desulfovibrio vulgaris Type I-C proteins. Attorney Docket No. UM-41218.601 [073] In certain embodiments, the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:168, the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 160, the Cas8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 162, the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 164, and a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 166. [074] In certain embodiments, the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 168, the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 160, the Cas8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 162, the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 164, and the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 166. However, the invention is not limited to these exemplary sequences. Indeed, genetic sequences can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention. [075] In certain embodiments, the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 167, the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 159, the Cas8 protein comprises the amino acid sequence of SEQ ID NO: 161, the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 163, and the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 165. [076] However, the invention is not limited to these exemplary sequences. For example, in certain embodiments, the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 167, the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 159, the Cas8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 161, the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 163, and the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 165. [077] In some embodiments, the Type I CRISPR-Cas system is a Type I-B system. Elements or sequences from any suitable type I-B CRISPR-Cas system may be used in the context of the disclosed methods. In some embodiments, the system comprises Cas11, Cas3, Cas5, Cas6, Cas7, and Cmx8. [078] In some embodiments, the Type I CRISPR-Cas system is a Type I-D system. Elements or sequences from any suitable type I-D CRISPR-Cas system may be used in the context of the disclosed methods. In some embodiments, the system comprises Cas11, Cas3, Cas5, Cas6, Cas7, and Cas10. Attorney Docket No. UM-41218.601 [079] In some embodiments, the Type I-B or Type I-D CRISPR-Cas system is derived from the cyanobacteria Synechocystis (Syn). The primary strain of Synechocystis sp. is PCC6803. In some embodiments, the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I system of Synechocystis sp. PCC6803, or variants thereof. [080] Synechocystis Type I CRISPR/Cas system proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Synechocystis Type I CRISPR/Cas system proteins. [081] In certain embodiments, the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:130, the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 126, the Cmx8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 122, the Cas6 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 120, the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 123, and a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 128. [082] In certain embodiments, the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 130, the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 126, the Cmx8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 122, the Cas6 protein is encoded by the nucleic acid sequence of SEQ ID NO: 120, the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 123, and the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 128. However, the invention is not limited to these exemplary sequences. Indeed, genetic sequences can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention. [083] In certain embodiments, the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 129, the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 125, the Cmx8 protein comprises the amino acid sequence of SEQ ID NO: 121, the Cas6 protein comprises the amino acid sequence of SEQ ID NO: 119, the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 124, and the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 127. [084] However, the invention is not limited to these exemplary sequences. For example, in certain embodiments, the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of Attorney Docket No. UM-41218.601 SEQ ID NO: 129, the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 125, the Cmx8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 121, the Cas6 protein comprises the amino acid sequence having at least 70% similarity to that of SEQ ID NO: 119, the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 124, and the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 127. [085] In certain embodiments, the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of 143, the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 138, the Cas6 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 140, the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 136, the Cas10 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 134, and a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 141. [086] In certain embodiments, the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 143, the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 138, the Cas6 protein is encoded by the nucleic acid sequence of SEQ ID NO: 140, the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 136, the Cas10 protein is encoded by the nucleic acid sequence of SEQ ID NO: 134, and the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 141. However, the invention is not limited to these exemplary sequences. Indeed, genetic sequences can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention. [087] In certain embodiments, the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 144, the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 137, the Cas6 protein comprises the amino acid sequence of SEQ ID NO: 139, the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 135, the Cas10 protein comprises the amino acid sequence of SEQ ID NO: 133, and the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 142. [088] However, the invention is not limited to these exemplary sequences. For example, in certain embodiments, the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 144, the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 137, the Cas6 protein comprises the amino acid sequence having at least 70% similarity to that of SEQ ID NO: 139, the Cas7 protein comprises an amino acid sequence having at least Attorney Docket No. UM-41218.601 70% similarity to that of SEQ ID NO: 135, the Cas10 protein comprises the amino acid sequence of SEQ ID NO: 133, and the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 142. [089] Any of the proteins described herein may comprise one or more amino acid substitutions as compared to the corresponding wild-type protein. An amino acid “replacement” or “substitution” refers to the replacement of one amino acid at a given position or residue by another amino acid at the same position or residue within a polypeptide sequence. Amino acids are broadly grouped as “aromatic” or “aliphatic.” An aromatic amino acid includes an aromatic ring. Examples of “aromatic” amino acids include histidine (H or His), phenylalanine (F or Phe), tyrosine (Y or Tyr), and tryptophan (W or Trp). Non- aromatic amino acids are broadly grouped as “aliphatic.” Examples of “aliphatic” amino acids include glycine (G or Gly), alanine (A or Ala), valine (V or Val), leucine (L or Leu), isoleucine (I or He), methionine (M or Met), serine (S or Ser), threonine (T or Thr), cysteine (C or Cys), proline (P or Pro), glutamic acid (E or Glu), aspartic acid (A or Asp), asparagine (N or Asn), glutamine (Q or Gin), lysine (K or Lys), and arginine (R or Arg). [090] The amino acid replacement or substitution can be conservative, semi-conservative, or non- conservative. The phrase “conservative amino acid substitution” or “conservative mutation” refers to the replacement of one amino acid by another amino acid with a common property. A functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz and Schirmer, Principles of Protein Structure, Springer-Verlag, New York (1979)). According to such analyses, groups of amino acids may be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz and Schirmer, supra). Examples of conservative amino acid substitutions include substitutions of amino acids within the sub-groups described above, for example, lysine for arginine and vice versa such that a positive charge may be maintained, glutamic acid for aspartic acid and vice versa such that a negative charge may be maintained, serine for threonine such that a free -OH can be maintained, and glutamine for asparagine such that a free -NH2 can be maintained. “Semi-conservative mutations” include amino acid substitutions of amino acids within the same groups listed above, but not within the same sub-group. For example, the substitution of aspartic acid for asparagine, or asparagine for lysine, involves amino acids within the same group, but different sub-groups. “Non-conservative mutations” involve amino acid substitutions between different groups, for example, lysine for tryptophan, or phenylalanine for serine, etc. Attorney Docket No. UM-41218.601 [091] The one or more nucleic acids encoding the engineered CRISPR-Cas system may be any nucleic acid including DNA, RNA, or combinations thereof. In some embodiments, the one or more nucleic acids comprise one or more messenger RNAs, one or more vectors, or any combination thereof. For example, Cas11 may be encoded by a vector, whereas the two or more additional Cas proteins may be encoded by one or more messenger RNA. [092] In certain embodiments, engineering the system for use in eukaryotic cells may involve codon- optimization or other modification (e.g., to include an appropriate nuclear localization signal (NLS) or purification tag). It will be appreciated that changing native codons to those most frequently used in mammals allows for maximum expression of the system proteins in mammalian cells (e.g., human cells). Such modified nucleic acid sequences are commonly described in the art as “codon-optimized,” or as utilizing “mammalian-preferred” or “human-preferred” codons. In some embodiments, the nucleic acid sequence is considered codon-optimized if at least about 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) of the codons encoded therein are mammalian preferred codons. Furthermore, in some embodiments, engineering the CRISPR-Cas system involves incorporating elements of the native CRISPR array into the disclosed system. [093] The system and the nucleic acid disclosed herein may comprise at least one guide RNA (gRNA), wherein each gRNA is configured to hybridize to a target nucleic acid sequence. The gRNA may be a crRNA or a crRNA/tracrRNA (e.g., single guide RNA, sgRNA) fusion. The terms “gRNA” and “guide RNA” refer to any nucleic acid comprising a sequence that determines the binding specificity of the CRISPR-Cas complex. In instances in which the system comprises two or more guide RNAs, each guide RNA may hybridize to a different target nucleic acid sequence. [094] The terms “target DNA sequence,” “target nucleic acid,” “target sequence,” and “target site” are used interchangeably herein to refer to a polynucleotide (nucleic acid, gene, chromosome, genome, etc.) to which a guide sequence (e.g., a guide RNA) is designed to have complementarity, wherein hybridization between the target sequence and a guide sequence promotes the formation of a CRISPR/Cas complex, provided sufficient conditions for binding exist. The target sequence and guide sequence need not exhibit complete complementarity, provided that there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. In some embodiments the system further comprises at least one target nucleic acid. [095] A target sequence may comprise any polynucleotide, such as DNA or RNA. Suitable DNA/RNA binding conditions include physiological conditions normally present in a cell. Other suitable DNA/RNA Attorney Docket No. UM-41218.601 binding conditions (e.g., conditions in a cell-free system) are known in the art; see, e.g., Sambrook, referenced herein and incorporated by reference. The strand of the target DNA that is complementary to and hybridizes with the DNA-targeting RNA is referred to as the “complementary strand” and the strand of the target DNA that is complementary to the “complementary strand” (and is therefore not complementary to the DNA-targeting RNA) is referred to as the “noncomplementary strand” or “non- complementary strand.” [096] The target nucleic acid sequence may include a protospacer adjacent motif (PAM). A PAM can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides in length. In certain embodiments, a PAM is between 2-6 nucleotides in length. In some embodiments, the PAM is 3 nucleotides in length. The PAM may be “adjacent to” the target nucleic acid sequence in that it typically immediately precedes the target sequence. In some embodiments, the PAM is 5’ of the target site. [097] PAM sequences are often specific to the particular Cas endonuclease being used in the CRISPR/Cas complex and the species from which it was derived. For example, Type I-C CRISPR-Cas3 elements typically are active in a host cell genome which comprises a protospacer adjacent motif (PAM) comprising the nucleic acid sequence 5’-TTC-3’ or 5’-TTT-3’ located adjacent to the target genomic DNA sequence. PAM sequences and methods of determining PAM sequences for specific Cas proteins are known in the art. The gRNA or portion thereof that hybridizes to a target nucleic acid sequence (e.g., the guide sequence) may be between any length. [098] The guide sequence of the gRNA does not need to be completely complementary to the target site. In some embodiments, the guide sequence of the gRNA is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the target site. In some embodiments, the gRNA sequence is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the 3’ end of the target site (e.g., the last 5, 6, 7, 8, 9, or 10 nucleotides of the 3’ end of the target site). “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson- Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule, which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence. [099] To facilitate gRNA design, many computational tools have been developed (See Prykhozhij et al. (PLoS ONE, 10(3): (2015)); Zhu et al. (PLoS ONE, 9(9) (2014)); Xiao et al. (Bioinformatics. Jan 21 (2014)); Heigwer et al. (Nat Methods, 11(2): 122–123 (2014)). Methods and tools for guide RNA design Attorney Docket No. UM-41218.601 are discussed by Zhu (Frontiers in Biology, 10 (4) pp 289-296 (2015)), which is incorporated by reference herein. Additionally, there are many publicly available software tools that can be used to facilitate the design of sgRNA(s); including but not limited to, Genscript Interactive CRISPR gRNA Design Tool, WU-CRISPR, and Broad Institute GPP sgRNA Designer. [0100] In addition to the guide sequence, in some embodiments, a gRNA may also comprise a scaffold sequence (e.g., tracrRNA). Exemplary scaffold sequences will be evident to one of skill in the art and can be found, for example, in Jinek, et al. Science (2012) 337(6096):816-821, and Ran, et al. Nature Protocols (2013) 8:2281-2308, incorporated herein by reference in their entireties. [0101] In some embodiments, at least one gRNA is within a crRNA array. A crRNA array comprises multiple guide RNAs (sgRNA) derived from the fusion of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) expressed a single transcript, which after processing by a nuclease are cleaved into separate gRNAs. The crRNA array may contain multiple repeats separated by unique spacers. For example, an engineered crRNA array may comprise contains two repeats and one spacer, or three repeats and two identical spacers. An exemplary crRNA array-repeat amino acid sequence may comprise SEQ ID NO: 114, SEQ ID NO: 131, SEQ ID NO: 145, SEQ ID NO: 157 or SEQ ID NO: 169. [0102] One or all of the at least one gRNAs may be a non-naturally occurring gRNA. [0103] In some embodiments, the system comprises two or more engineered CRISPR-Cas systems or one or more nucleic acids encoding two or more engineered (CRISPR-Cas) systems. Desirably, the two or more engineered CRISPR-Cas systems are derived from different subtypes of Type I CRISPR-Cas systems. Desirably, the two or more engineered CRISPR-Cas systems are orthogonal, which means that each CRISPR-Cas system only functions with its own cognate components (e.g., Cas proteins, PAM sequences, and crRNA (gRNA, spacer, and repeat sequences)). [0104] In some embodiments, the two or more engineered CRISPR-Cas systems comprise two Type I CRISPR-Cas systems selected from the group consisting of a Type I-B CRISPR-Cas system, a Type I-C CRISPR-Cas system, and a Type I-D CRISPR-Cas system. The two or more engineered CRISPR-Cas systems may be selected from a N. lactamica Type I-C derived system, a Synechocystis Type I-D derived system, a Synechocystis Type I-B system, a Bacillus Type I-C derived system and a Desulfovibrio, Type I-C derived system. [0105] In some embodiments, the system is a cell-free system. [0106] Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids encoding components of the present system into cells, tissues, or a subject. Such methods can be Attorney Docket No. UM-41218.601 used to administer nucleic acids encoding components of the present system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, cosmids, RNA (e.g., a transcript of a vector described herein), a nucleic acid, and a nucleic acid complexed with a delivery vehicle. [0107] Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. A variety of viral constructs may be used to deliver the present system and/or components to the cells, tissues and/or a subject. Viral vectors include, for example, retroviral, lentiviral, adenoviral, adeno-associated and herpes simplex viral vectors. Nonlimiting examples of such recombinant viruses include recombinant adeno-associated virus (AAV), recombinant adenoviruses, recombinant lentiviruses, recombinant retroviruses, recombinant herpes simplex viruses, recombinant poxviruses, phages, etc. The present disclosure provides vectors capable of integration in the host genome, such as retrovirus or lentivirus. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, M. A., et al., 2001 Nat. Medic.7(1):33-40; and Walther W. and Stein U., 2000 Drugs, 60(2): 249-71. [0108] Drug selection strategies may be adopted for positively selecting for cells comprising the nucleic acid sequences encoding the present system or components thereof. [0109] The present disclosure also provides for DNA segments encoding the proteins and nucleic acids disclosed herein, vectors containing these segments and cells containing the vectors. The vectors may be used to propagate the segment in an appropriate cell and/or to allow expression from the segment (e.g., an expression vector). The person of ordinary skill in the art would be aware of the various vectors available for propagation and expression of a nucleic acid sequence. [0110] To construct cells that express the present system, expression vectors for stable or transient expression of the present system may be constructed via conventional methods and introduced into cells. For example, nucleic acids encoding the components of the present system may be cloned into a suitable expression vector, such as a plasmid or a viral vector in operable linkage to a suitable promoter. The selection of expression vectors/plasmids/viral vectors should be suitable for integration and replication in eukaryotic cells. [0111] In certain embodiments, vectors of the present disclosure can drive the expression of one or more sequences in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, Nature (1987) 329:840, incorporated herein by reference) and pMT2PC (Kaufman, et al., EMBO J. (1987) 6:187, incorporated herein by reference). When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. Attorney Docket No. UM-41218.601 For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells see, e.g., Chapters 16 and 17 of Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., incorporated herein by reference. [0112] Vectors of the present disclosure can comprise any of a number of promoters known to the art, wherein the promoter is constitutive, regulatable or inducible, cell type specific, tissue-specific, or species specific. In addition to the sequence sufficient to direct transcription, a promoter sequence of the invention can also include sequences of other regulatory elements that are involved in modulating transcription (e.g., enhancers, Kozak sequences and introns). Many promoter/regulatory sequences useful for driving constitutive expression of a gene are available in the art and include, but are not limited to, for example, CMV (cytomegalovirus promoter), EF1a (human elongation factor 1 alpha promoter), SV40 (simian vacuolating virus 40 promoter), PGK (mammalian phosphoglycerate kinase promoter), Ubc (human ubiquitin C promoter), human beta-actin promoter, rodent beta-actin promoter, CBh (chicken beta-actin promoter), CAG (hybrid promoter contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor), TRE (Tetracycline response element promoter), H1 (human polymerase III RNA promoter), U6 (human U6 small nuclear promoter), and the like. Additional promoters that can be used for expression of the components of the present system, include, without limitation, cytomegalovirus (CMV) intermediate early promoter, a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeloproliferative sarcoma virus (MPSV) LTR, spleen focus-forming virus (SFFV) LTR, the simian virus 40 (SV40) early promoter, herpes simplex tk virus promoter, elongation factor 1-alpha (EF1-α) promoter with or without the EF1-α intron. Additional promoters include any constitutively active promoter. Alternatively, any regulatable promoter may be used, such that its expression can be modulated within a cell. [0113] Moreover, inducible expression can be accomplished by placing the nucleic acid encoding such a molecule under the control of an inducible promoter/regulatory sequence. Promoters well known in the art can be induced in response to inducing agents such as metals, glucocorticoids, tetracycline, hormones, and the like, are also contemplated for use with the invention. Thus, it will be appreciated that the present disclosure includes the use of any promoter/regulatory sequence known in the art that is capable of driving expression of the desired protein operably linked thereto. Attorney Docket No. UM-41218.601 [0114] The vectors of the present disclosure may direct the expression of the nucleic acid in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Such regulatory elements include promoters that may be tissue specific or cell specific. The term “tissue specific” as it applies to a promoter refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., seeds) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue. The term “cell type specific” as applied to a promoter refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue. The term “cell type specific” when applied to a promoter also means a promoter capable of promoting selective expression of a nucleotide sequence of interest in a region within a single tissue. Cell type specificity of a promoter may be assessed using methods well known in the art, e.g., immunohistochemical staining. [0115] Additionally, the vector may contain, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in host cells; enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription; transcription termination and RNA processing signals from SV40 for mRNA stability; 5’- and 3’-untranslated regions for mRNA stability and translation efficiency from highly-expressed genes like α-globin or β-globin; SV40 polyoma origins of replication and ColE1 for proper episomal replication; internal ribosome binding sites (IRESes), versatile multiple cloning sites; T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA; a “suicide switch” or “suicide gene” which when triggered causes cells carrying the vector to die (e.g., HSV thymidine kinase, an inducible caspase such as iCasp9), and reporter gene for assessing expression. [0116] When introduced into a cell, the vectors may be maintained as an autonomously replicating sequence or extrachromosomal element or may be integrated into host DNA. [0117] The present system or components thereof may be delivered to a cell by any suitable means. In certain embodiments, the system is delivered in vivo. In other embodiments, the system is delivered to isolated/cultured cells in vitro or ex vivo to provide modified cells useful for in vivo delivery to patients afflicted with a disease or condition. [0118] Vectors according to the present disclosure can be transformed, transfected, or otherwise introduced into a wide variety of host cells. Transfection refers to the taking up of a vector by a cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known Attorney Docket No. UM-41218.601 to the ordinarily skilled artisan, for example, lipofectamine, calcium phosphate co-precipitation, electroporation, DEAE-dextran treatment, microinjection, viral infection, and other methods known in the art. Transduction refers to entry of a virus into the cell and expression (e.g., transcription and/or translation) of sequences delivered by the viral vector genome. In the case of a recombinant vector, “transduction” generally refers to entry of the recombinant viral vector into the cell and expression of a nucleic acid of interest delivered by the vector genome. [0119] Any of the vectors comprising a nucleic acid sequence that encodes the components of the present system is also within the scope of the present disclosure. Such a vector may be delivered into cells by a suitable method. Methods of delivering vectors to cells are well known in the art and may include DNA or RNA electroporation, transfection reagents such as liposomes or nanoparticles to delivery DNA or RNA; delivery of DNA, RNA, or protein by mechanical deformation (see, e.g., Sharei et al. Proc. Natl. Acad. Sci. USA (2013) 110(6): 2082-2087, incorporated herein by reference); or viral transduction. In some embodiments, the vectors are delivered to host cells by viral transduction. Nucleic acids can be delivered as part of a larger construct, such as a plasmid or viral vector, or directly, e.g., by electroporation, lipid vesicles, viral transporters, microinjection, and biolistics (high-speed particle bombardment). In some embodiments, the construct or the nucleic acid encoding the components of the present system is a DNA molecule. In some embodiments, the nucleic acid encoding the components of the present system is a DNA vector and may be electroporated to cells. In some embodiments, the nucleic acid encoding the components of the present system is an RNA molecule, which may be electroporated to cells. [0120] Additionally, delivery vehicles such as nanoparticle- and lipid-based mRNA or protein delivery systems can be used. Further examples of delivery vehicles include lentiviral vectors, ribonucleoprotein (RNP) complexes, lipid-based delivery system, gene gun, hydrodynamic, electroporation or nucleofection microinjection, and biolistics. Various gene delivery methods are discussed in detail by Nayerossadat et al. (Adv Biomed Res.2012; 1: 27) and Ibraheem et al. (Int J Pharm.2014 Jan 1;459(1-2):70-83), incorporated herein by reference. [0121] In other embodiments, various components of the system may be introduced into a host cell as a ribonucleoprotein (RNP) complex. The term “ribonucleoprotein complex,” as used herein, refers to a complex of ribonucleic acid and RNA-binding protein(s). In the context of CRISPR-Cas systems, an RNP complex typically comprises Cas protein(s) (e.g., Cas5, Cas7, and Cas8) in complex with a gRNA. RNPs may be assembled in vitro and can be delivered directly to cells using standard electroporation, cationic lipids, gold nanoparticles, or other transfection techniques (see, e.g., Kim et al., Genome Res., 24: 1012- Attorney Docket No. UM-41218.601 1019 (2014); Zuris et al., Nat. Biotechnol., 33: 73-80 (2015); and Mout et al., ACS Nano., 11: 2452-2458 (2017)). [0122] As such, the disclosure provides an isolated cell comprising the system, the vector(s), nucleic acid(s), or system disclosed herein. The disclosure also provides populations of cells comprising the present systems. [0123] Preferred cells are those that can be easily and reliably grown, have reasonably fast growth rates, have well characterized expression systems, and can be transformed or transfected easily and efficiently, including both eukaryotic and prokaryotic cells. Examples of suitable prokaryotic cells include, but are not limited to, cells from the genera Bacillus (such as Bacillus subtilis and Bacillus brevis), Escherichia (such as E. coli), Pseudomonas, Streptomyces, Salmonella, and Envinia. Suitable eukaryotic cells are known in the art and include, for example, yeast cells, insect cells, and mammalian cells. Examples of suitable yeast cells include those from the genera Kluyveromyces, Pichia, Rhino-sporidium, Saccharomyces, and Schizosaccharomyces. Exemplary insect cells include Sf-9 and HIS (Invitrogen, Carlsbad, Calif.) and are described in, for example, Kitts et al., Biotechniques, 14: 810-817 (1993); Lucklow, Curr. Opin. Biotechnol., 4: 564-572 (1993); and Lucklow et al., J. Virol., 67: 4566-4579 (1993), incorporated herein by reference. [0124] Desirably, the cell is a mammalian cell, and in some embodiments, the cell is a human cell. A number of suitable mammalian and human host cells are known in the art, and many are available from the American Type Culture Collection (ATCC, Manassas, Va.). Examples of suitable mammalian cells include, but are not limited to, Chinese hamster ovary cells (CHO) (ATCC No. CCL61), CHO DHFR- cells (Urlaub et al., Proc. Natl. Acad. Sci. USA, 97: 4216-4220 (1980)), human embryonic kidney (HEK) 293 or 293T cells (ATCC No. CRL1573), and 3T3 cells (ATCC No. CCL92). Other suitable mammalian cell lines are the monkey COS-1 (ATCC No. CRL1650) and COS-7 cell lines (ATCC No. CRL1651), as well as the CV-1 cell line (ATCC No. CCL70). Further exemplary mammalian host cells include primate, rodent, and human cell lines, including transformed cell lines. Normal diploid cells, cell strains derived from in vitro culture of primary tissue, as well as primary explants, are also suitable. Other suitable mammalian cell lines include, but are not limited to, mouse neuroblastoma N2A cells, HeLa, HEK, A549, HepG2, mouse L-929 cells, and BHK or HaK hamster cell lines. [0125] Methods for selecting suitable mammalian cells and methods for transformation, culture, amplification, screening, and purification of cells are known in the art. Attorney Docket No. UM-41218.601 [0126] The system may further comprise components in addition to those listed, including, but not limited to: sequence tags, protein markers or marker proteins, spacers, capture sequences, and the like. 3. Methods of Altering a Target Nucleic Acid [0127] The methods comprise contacting a target nucleic acid sequence with a system disclosed herein or a composition comprising the system. [0128] In some embodiments, the contacting a target nucleic acid sequence comprises introducing the system into the cell. As described above the system may be introduced into eukaryotic or prokaryotic cells by methods known in the art. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. [0129] In some embodiments, introducing the system into a cell comprises administering the system to a subject. In some embodiments, the subject is human. The administer may comprise in vivo administration. In alternative embodiments, a vector is contacted with a cell in vitro or ex vivo and the treated cell, containing the system, is transplanted into a subject. [0130] In some embodiments, the target nucleic acid is a nucleic acid endogenous to a target cell. In some embodiments, the target nucleic acid is a genomic DNA sequence. The term “genomic,” as used herein, refers to a nucleic acid sequence (e.g., a gene or locus) that is located on a chromosome in a cell. [0131] In some embodiments, the target nucleic acid encodes a gene or gene product. The term “gene product,” as used herein, refers to any biochemical product resulting from expression of a gene. Gene products may be RNA or protein. RNA gene products include non-coding RNA, such as tRNA, rRNA, micro RNA (miRNA), and small interfering RNA (siRNA), and coding RNA, such as messenger RNA (mRNA). In some embodiments, the target nucleic acid sequence encodes a protein or polypeptide. [0132] In some embodiments, the systems and methods described herein may be used to correct one or more defects or mutations in a gene (referred to as “gene correction”). In such cases, the target sequence encodes a defective version of a gene (e.g. with a SNP that causes disease). Thus, in other words, the target sequence is a “disease-associated” gene. The term “disease-associated gene,” refers to any gene or polynucleotide whose gene products are expressed at an abnormal level or in an abnormal form in cells obtained from a disease-affected individual as compared with tissues or cells obtained from an individual not affected by the disease. A disease-associated gene may be expressed at an abnormally high level or at an abnormally low level, where the altered expression correlates with the occurrence and/or progression of the disease. A disease-associated gene also refers to a gene, the mutation or genetic variation of which is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of Attorney Docket No. UM-41218.601 a disease. Examples of genes responsible for such “single gene” or “monogenic” diseases include, but are not limited to, adenosine deaminase, α-1 antitrypsin, cystic fibrosis transmembrane conductance regulator (CFTR), β-hemoglobin (HBB), oculocutaneous albinism II (OCA2), Huntingtin (HTT), dystrophia myotonica-protein kinase (DMPK), low-density lipoprotein receptor (LDLR), apolipoprotein B (APOB), neurofibromin 1 (NF1), polycystic kidney disease 1 (PKD1), polycystic kidney disease 2 (PKD2), coagulation factor VIII (F8), dystrophin (DMD), phosphate-regulating endopeptidase homologue, X- linked (PHEX), methyl-CpG-binding protein 2 (MECP2), and ubiquitin-specific peptidase 9Y, Y-linked (USP9Y). Other single gene or monogenic diseases are known in the art and described in, e.g., Chial, H. Rare Genetic Disorders: Learning About Genetic Disease Through Gene Mapping, SNPs, and Microarray Data, Nature Education 1(1):192 (2008); Online Mendelian Inheritance in Man (OMIM); and the Human Gene Mutation Database (HGMD). In another embodiment, the target genomic DNA sequence can comprise a gene, the mutation of which contributes to a particular disease in combination with mutations in other genes. Diseases caused by the contribution of multiple genes which lack simple (i.e., Mendelian) inheritance patterns are referred to in the art as a “multifactorial” or “polygenic” disease. Examples of multifactorial or polygenic diseases include, but are not limited to, asthma, diabetes, epilepsy, hypertension, bipolar disorder, and schizophrenia. Certain developmental abnormalities also can be inherited in a multifactorial or polygenic pattern and include, for example, cleft lip/palate, congenital heart defects, and neural tube defects. [0133] The disclosure further provides kits containing one or more reagents or other components useful, necessary, or sufficient for practicing any of the methods described herein. For example, kits may include CRISPR reagents (Cas proteins, guide RNAs, vectors, compositions, etc.), transfection or administration reagents, negative and positive control samples (e.g., cells, template DNA), cells, containers housing one or more components (e.g., microcentrifuge tubes, boxes), detectable labels, detection and analysis instruments, software, instructions, and the like. [0134] Any element of any suitable CRISPR/Cas gene editing system known in the art can be employed in the systems and methods described herein, as appropriate. CRISPR/Cas gene editing technology is described in detail in, for example, U.S. Patent Nos.8,546,553, 8,697,359; 8,771,945; 8,795,965; 8,865,406; 8,871,445; 8,889,356; 8,889,418; 8,895,308; 8,9066,616; 8,932,814; 8,945,839; 8,993,233; 8,999,641; 9,115,348; 9,149,049; 9,493,844; 9,567,603; 9,637,739; 9,663,782; 9,404,098; 9,885,026; 9,951,342; 10,087,431; 10,227,610; 10,266,850; 10,601,748; 10,604,771; and 10,760,064; and U.S. Patent Application Publication Nos. US2010/0076057; US2014/0113376; US2015/0050699; Attorney Docket No. UM-41218.601 US2015/0031134; US2014/0357530; US2014/0349400; US2014/0315985; US2014/0310830; US2014/0310828; US2014/0309487; US2014/0294773; US2014/0287938; US2014/0273230; US2014/0242699; US2014/0242664; US2014/0212869; US2014/0201857; US2014/0199767; US2014/0189896; US2014/0186919; US2014/0186843; and US2014/0179770, each incorporated herein by reference. [0135] The following examples further illustrate the invention but should not be construed as in any way limiting its scope. EXAMPLES Materials and Methods [0136] Plasmid transfection [0137] CRISPR-Cas3 plasmid transfection was conducted using Lipofectamine 3000 Transfection Reagent (ThermoFisher) per manufacturer’s instructions. HAP1-EGFP reporter cells were seeded one day before transfection at 1x105 cells per well of a 24-well plate. For each transfection, we used 1 μL P3000 Enhancer Reagent, 1.5 μL Lipofectamine 3000 reagent, and a total of 500 ng crispr-cas plasmids. To monitor genome targeting efficiency on reporter genes, cells were analyzed by flow cytometry 4-5 days post transfection. For the Nla I-C system, we used 45, 22.5, 67.5, 270, 45 and 50 ng of Cas3, Cas5, Cas7, Cas8, Cas11 and CRISPR plasmids, respectively. For Syn I-B system, we used 75 ng each of Cas3, Cas5, Cas6, Cas7, Cas8, Cas11 and 50 ng of CRISPR plasmids, respectively. For Bha I-C system, we used 45, 22.5, 67.5, 270, 45 and 50 ng of Cas3, Cas5, Cas7, Cas8, Cas11 and CRISPR plasmids, respectively. For Tfu I-E system, we used 50, 92.5, 25, 95, 95, 92.5, 50 ng of Cas3, Cas5, Cas6, Cas7, Cas8, Cas11 and CRISPR plasmid, respectively. For Pae I-F system, we used 50, 92.5, 50, 162.5, 95 and 50 ng of Cas2-3, Cas5, Cas6, Cas7, Cas8 and CRISPR plasmids, respectively. For base editing experiments, WT subunit plasmids are substituted with the same amount of TadA*-, or APOBEC- or 2xUGI- fusion derivative plasmids. [0138] High-throughput sequencing of genomic DNA samples [0139] For base editing experiments, cells were harvested 4 days after plasmid transfection. Genomic DNA of the edited cells was isolated using Gentra Puregene Cell Kit (Qiagen) per manufacturer’s instructions and used as template for NGS library construction. A 200-300 bp region surrounding the target genomic site was PCR amplified. Following Illumina barcoding, PCR amplicons were pooled and purified through 2% agarose gel electrophoresis and gel extraction using a Monarch DNA Gel Extraction Attorney Docket No. UM-41218.601 Kit (New England Biolabs). Final elution is done with 30 μL H2O. DNA concentration was quantified with a Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific) and sequenced on an Illumina MiSeq instrument (paired-end read, R1: 250–280 cycles, R2: 0 cycles) according to the manufacturer’s protocols. [0140] Bioinformatic analysis of NGS sequencing datasets [0141] Sequencing reads were demultiplexed using the MiSeq Reporter (Illumina), and the FASTQ files were analyzed using CRISPResso2. Base editing efficiency values were reported as the percentage of reads with A•T to G•C conversion at a specific adenine location in the total aligned reads in ABE experiments or as the percentage of reads with C•G to T•A conversion at a specific cytosine location in the total aligned reads in CBE experiments. Heatmaps were generated in GraphPad Prism version 9. [0142] Sequences: >human codon optimized Nla-cas3 with NLS and HA tag (SEQ ID NO: 171) ATGAACTTCGACTATATCGCCCACGCCAGACAGGACAGCAGCAAGAACTGGCACTCTCACCCTCTGCAGAAACATCTGCAGAAGG TGGCCCAGCTGGCCAAGAGATTTGCCGGCAGATACGGCAGCCTGTTCGCCGAATATGCCGGCCTGCTGCACGATCTGGGCAAGTT CCAAGAGAGCTTCCAGAAGTACATCCGGAACGCCAGCGGCTTCGAGAAAGAGAATGCCCACCTGGAAGATGTGGAAAGCACCAAG CTGCGGAAGATCCCTCACTCTACAGCCGGCGCTAAGTACGCCGTGGAAAGACTGAACCCCTTCTTCGGCCATCTGCTGGCCTATC TGATTGCCGGACATCATGCCGGACTGGCCGATTGGTACGATAAGGGCAGCCTGAAGCGGAGACTGCAGCAAGCCGATGATGAACT GGCCGCCTCTCTGTCCGGCTTCGTGGAATCTTCTCTGCCCGAGGACTTCTTCCCTCTGTCCGACGACGACCTGATGAGAGACTTC TTCGCCTTCTGGGAGGACGGCGCCAAGCTGGAAGAACTGCACATCTGGATGCGGTTTCTGTTCAGCTGCCTGGTGGACGCCGACT TCCTGGATACCGAGGCCTTCATGAACGGCTACGCCGATGCCGATACAGCCCAAGCTGCTGGACTGAGGCCTAAGTTCCCTGGCCT GGATGAGCTGCATCGGAGATACGAGCAGTACATGGCTCAGCTGTCCGAGAAGGCCGACAAGAACAGCTCCCTGAATCAAGAGCGG CACGCCATCCTGCAGCAGTGCTTTTCTGCCGCCGAGACAGACAGAACCCTGTTCAGCCTGACAGTGCCTACAGGCGGCGGAAAAA CTCTGGCCTCTCTGGGCTTTGCCCTGAAGCACGCCCTGAAGTTCGGCAAGAAGCGGATCATCTACGCCATTCCTTTCACCAGCAT CATCGAGCAGAACGCCAACGTGTTCAGAAACGCCCTGGGCGACGATGTGGTGCTGGAACACCACAGCAACCTGGAAGTGAAAGAG GACAAAGAGACAGCCAAGACCAGACTGGCCACCGAGAATTGGGATGCCCCTCTGATCGTGACCACCAACGTGCAGCTGTTCGAGA GCCTGTTTGCCGCCAAGACCTCCAGATGCAGAAAGATCCACAATATCGCCGACAGCGTGGTCATCCTGGACGAAGCTCAGCAGCT GCCCCGGGACTTCCAGAAACCTATCACCGATATGATGCGCGTGCTGGCCAGAGACTACGGCGTGACCTTTGTGCTGTGTACCGCC ACACAGCCTGAGCTGGGCAAGAACATCGATGCCTTCGGCCGGACCATCCTGGAAGGATTGCCTGACGTGCGGGAAATCGTGGCCG ATAAGATCGCCCTGAGCGAGAAGCTGAGAAGAGTGCGGATCAAGATGCCTCCTCCAAACGGCGAGACACAGAGCTGGCAGAAGAT CGCCGACGAGATCGCCGCTAGACCATGTGTGCTGGCCGTGGTCAACACCAGAAAACACGCCCAGAAGCTGTTCGCTGCCCTGCCT AGCAATGGCATCAAGCTGCACCTGAGCGCCAACATGTGCGCCACACACTGCTCTGAAGTGATCGCCCTCGTGCGGAGATATCTGG CCCTGTACAGAGCCGGAAGCCTGCACAAACCTCTGTGGCTGGTGTCTACCCAGCTGATTGAAGCTGGCGTGGACCTGGACTTCCC CTGTGTGTATAGAGCCATGGCCGGCCTGGATTCTATTGCCCAAGCAGCCGGACGGTGCAACAGAGAGGGAAAACTGCCTCAGCTG Attorney Docket No. UM-41218.601 GGCGAAGTGGTGGTGTTCAGAGCTGAAGAAGGCGCCCCTAGCGGCTCTCTGAAGCAAGGCCAGGATATCACCGAGGAAATGCTGA AGGCCGGACTGCTGGACGACCCTTTGTCTCCTCTGGCCTTCGCCGAGTACTTCAGACGGTTCAATGGCAAGGGCGACGTGGACAA GCACGGCATCACAACACTGCTGACAGCCGAGGCCAGCAACGAGAATCCACTGGCCATCAAGTTCCGGACCGCCGCTGAGAGATTC CACCTGATCGATAATCAGGGCGTCGCACTGATCGTGCCCTTCATTCCTCTGGCTCACTGGGAGAAAGACGGCAGCCCTCAGATCG TGGAAGCCAACGAGCTGGACGATTTCTTCAGGCGGCACCTGGACGGCGTGGAAGTGTCTGAGTGGCAGGACATCCTGGATAAGCA GCGGTTCCCTCAGCCTCCTGACAACAGCTTTGGCCAGACCGATCAGCCTCTGCTGCCTGAGCCTTTCGAGAGTTGGTTCGGCCTG CTCGAGAGCGACCCACTGAAGCACAAATGGGTGTACCGGAAGCTGCAGCGGTACACCATCACCGTGTATGAGCACGAGCTGAAAA AGCTGCCCGAGCACGCCGTGTTCTCTAGAGCTGGACTGCTCGTGCTGGACAAGGGCTACTATAAGGCCGTGCTGGGCGCCGATTT TGACGATGCTGCTTGGCTGCCAGAGAACTCTGTGCTGGGCTCTGTGGGCTACCCCTACGATGTGCCTGATTACGCCGGCAGCTAC CCTGAGTTCCCCAAGAAAAAGCGGAAAGTGTGA > human codon optimized Nla-cas3 D392A (cas3 nickase) with NLS and HA tag (SEQ ID NO: 172) ATGAACTTCGACTATATCGCCCACGCCAGACAGGACAGCAGCAAGAACTGGCACTCTCACCCTCTGCAGAAACATCTGCAGAAGG TGGCCCAGCTGGCCAAGAGATTTGCCGGCAGATACGGCAGCCTGTTCGCCGAATATGCCGGCCTGCTGCACGATCTGGGCAAGTT CCAAGAGAGCTTCCAGAAGTACATCCGGAACGCCAGCGGCTTCGAGAAAGAGAATGCCCACCTGGAAGATGTGGAAAGCACCAAG CTGCGGAAGATCCCTCACTCTACAGCCGGCGCTAAGTACGCCGTGGAAAGACTGAACCCCTTCTTCGGCCATCTGCTGGCCTATC TGATTGCCGGACATCATGCCGGACTGGCCGATTGGTACGATAAGGGCAGCCTGAAGCGGAGACTGCAGCAAGCCGATGATGAACT GGCCGCCTCTCTGTCCGGCTTCGTGGAATCTTCTCTGCCCGAGGACTTCTTCCCTCTGTCCGACGACGACCTGATGAGAGACTTC TTCGCCTTCTGGGAGGACGGCGCCAAGCTGGAAGAACTGCACATCTGGATGCGGTTTCTGTTCAGCTGCCTGGTGGACGCCGACT TCCTGGATACCGAGGCCTTCATGAACGGCTACGCCGATGCCGATACAGCCCAAGCTGCTGGACTGAGGCCTAAGTTCCCTGGCCT GGATGAGCTGCATCGGAGATACGAGCAGTACATGGCTCAGCTGTCCGAGAAGGCCGACAAGAACAGCTCCCTGAATCAAGAGCGG CACGCCATCCTGCAGCAGTGCTTTTCTGCCGCCGAGACAGACAGAACCCTGTTCAGCCTGACAGTGCCTACAGGCGGCGGAAAAA CTCTGGCCTCTCTGGGCTTTGCCCTGAAGCACGCCCTGAAGTTCGGCAAGAAGCGGATCATCTACGCCATTCCTTTCACCAGCAT CATCGAGCAGAACGCCAACGTGTTCAGAAACGCCCTGGGCGACGATGTGGTGCTGGAACACCACAGCAACCTGGAAGTGAAAGAG GACAAAGAGACAGCCAAGACCAGACTGGCCACCGAGAATTGGGATGCCCCTCTGATCGTGACCACCAACGTGCAGCTGTTCGAGA GCCTGTTTGCCGCCAAGACCTCCAGATGCAGAAAGATCCACAATATCGCCGACAGCGTGGTCATCCTGGcCGAAGCTCAGCAGCT GCCCCGGGACTTCCAGAAACCTATCACCGATATGATGCGCGTGCTGGCCAGAGACTACGGCGTGACCTTTGTGCTGTGTACCGCC ACACAGCCTGAGCTGGGCAAGAACATCGATGCCTTCGGCCGGACCATCCTGGAAGGATTGCCTGACGTGCGGGAAATCGTGGCCG ATAAGATCGCCCTGAGCGAGAAGCTGAGAAGAGTGCGGATCAAGATGCCTCCTCCAAACGGCGAGACACAGAGCTGGCAGAAGAT CGCCGACGAGATCGCCGCTAGACCATGTGTGCTGGCCGTGGTCAACACCAGAAAACACGCCCAGAAGCTGTTCGCTGCCCTGCCT AGCAATGGCATCAAGCTGCACCTGAGCGCCAACATGTGCGCCACACACTGCTCTGAAGTGATCGCCCTCGTGCGGAGATATCTGG CCCTGTACAGAGCCGGAAGCCTGCACAAACCTCTGTGGCTGGTGTCTACCCAGCTGATTGAAGCTGGCGTGGACCTGGACTTCCC CTGTGTGTATAGAGCCATGGCCGGCCTGGATTCTATTGCCCAAGCAGCCGGACGGTGCAACAGAGAGGGAAAACTGCCTCAGCTG GGCGAAGTGGTGGTGTTCAGAGCTGAAGAAGGCGCCCCTAGCGGCTCTCTGAAGCAAGGCCAGGATATCACCGAGGAAATGCTGA AGGCCGGACTGCTGGACGACCCTTTGTCTCCTCTGGCCTTCGCCGAGTACTTCAGACGGTTCAATGGCAAGGGCGACGTGGACAA GCACGGCATCACAACACTGCTGACAGCCGAGGCCAGCAACGAGAATCCACTGGCCATCAAGTTCCGGACCGCCGCTGAGAGATTC CACCTGATCGATAATCAGGGCGTCGCACTGATCGTGCCCTTCATTCCTCTGGCTCACTGGGAGAAAGACGGCAGCCCTCAGATCG Attorney Docket No. UM-41218.601 TGGAAGCCAACGAGCTGGACGATTTCTTCAGGCGGCACCTGGACGGCGTGGAAGTGTCTGAGTGGCAGGACATCCTGGATAAGCA GCGGTTCCCTCAGCCTCCTGACAACAGCTTTGGCCAGACCGATCAGCCTCTGCTGCCTGAGCCTTTCGAGAGTTGGTTCGGCCTG CTCGAGAGCGACCCACTGAAGCACAAATGGGTGTACCGGAAGCTGCAGCGGTACACCATCACCGTGTATGAGCACGAGCTGAAAA AGCTGCCCGAGCACGCCGTGTTCTCTAGAGCTGGACTGCTCGTGCTGGACAAGGGCTACTATAAGGCCGTGCTGGGCGCCGATTT TGACGATGCTGCTTGGCTGCCAGAGAACTCTGTGCTGGGCTCTGTGGGCTACCCCTACGATGTGCCTGATTACGCCGGCAGCTAC CCTGAGTTCCCCAAGAAAAAGCGGAAAGTGTGA >human codon optimized Nla-cas5 with NLS and HA tag (SEQ ID NO: 173) ATGCGGTTCATCCTGGAAATCAGCGGCGACCTGGCCTGCTTCACAAGAAGCGAGCTGAAGGTCGAGCGGGTGTCATACCCTGTGA TCACCCCTAGCGCCGCCAGAAACATCCTGATGGCCATTCTGTGGAAGCCCGCCATCAGATGGAAGGTGCTGAAGATCGAGATCCT GAAGCCTATCCAGTGGACCAACATCCGGCGGAACGAAGTGGGCACCAAGATGAGCGAGAGAAGCGGCAGCCTGTACATCGAGGAC AACAGACAGCAGCGGGCCTCCATGCTGCTGAAGGATGTGGCCTATAGAATCCACGCCGACTTCGACATGACAAGCGAGGCCGGCG AGAGCGACAACTACGTGAAGTTCGCCGAGATGTTCAAGCGGAGAGCCAAGAAGGGCCAGTACTTCCACCAGCCTTACCTGGGCTG CAGAGAGTTCCCCTGCGACTTCAGACTGCTGGAAAAGGCCGAGGATGGCCTGCCTCTGGAAGATATCACCCAGGACTTCGGCTTC ATGCTGTACGACATGGACTTCAGCAAGAGCGACCCCAGAGACAGCAACAACGCCGAGCCTATGTTCTACCAGTGCAAGGCCGTGA ACGGCGTGATCACTGTGCCTCCAGCCGATAGCGAGGAAGTGAAGAGAGGCAGCGTCGGCTACCCCTACGATGTGCCTGATTACGC CCCTAAGAAAAAGCGGAAAGTGTGA >human codon optimized Nla-cas8 with NLS and HA tag (SEQ ID NO: 174) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAATTCTGCACGCCCTGACAC AGTACTACCAGCGGAAGGCCGAAAGCGACGGCGGAATTGCCCAAGAGGGCTTCGAGAACAAAGAGATCCCCTTCATCATCGTGAT CGACAAGCAGGGCAACTTCATCCAGCTCGAGGACACCCGCGAGCTGAAAGTGAAGAAAAAAGTGGGCCGCACCTTCCTGGTGCCT AAAGGCCTTGGCAGAAGCGGCAGCAAGAGCTACGAGGTGTCCAACCTGCTGTGGGACCACTACGGATACGTGCTGGCCTATGCCG GCGAGAAGGGACAAGAACAGGCCGATAAGCAGCACGCCAGCTTCACCGCCAAAGTGAACGAGCTGAAGCAGGCCCTGCCTGATGA TGCTGGCGTGACAGCTGTGGCCGCCTTTCTGTCTAGCGCCGAAGAGAAGTCCAAAGTGATGCAGGCCGCCAACTGGGCCGAGTGC GCTAAAGTGAAGGGCTGCAACCTGAGCTTCCGGCTGGTGGATGAAGCCGTGGATCTCGTGTGTCAGTCTAAGGCCGTGCGCGAGT ATGTGTCCCAGGCCAATCAGACCCAGAGCGACAACGTGCAGAAAGGCATCTGTCTGGTCACCGGCAAGGCCGCTCCTATTGCCAG ACTGCACAATGCCGTGAAGGGCGTGAACGCCAAGCCTGCTCCTTTCGCCTCTGTGAACCTGAGCGCCTTTGAGAGCTACGGCAAA GAGCAGGGCTTCATCTTCCCTGTGGGAGAGCAGGCCATGTTCGAGTACACCACCGCTCTGAATACCCTGCTGGCCTCCGAGAACA GATTCCGGATCGGAGATGTGACCGCCGTGTGTTGGGGAGCCAAGAGAACACCTCTGGAAGAGTCCCTGGCCAGCATGATCAATGG CGGCGGAAAGGACAAGCCCGACGAGCACATCGACGCCGTGAAAACCCTGTACAAGAGCCTGTACAACGGCCAGTACCAGAAGCCT GACGGAAAAGAGAAGTTCTACCTGCTGGGACTGAGCCCCAACAGCGCCAGAATCGTTGTGCGGTTCTGGCACGAGACAACCGTGG CTGCCCTGTCTGAGTCTATCGCCGCTTGGTACGACGACCTGCAGATGGTTCGAGGCGAGAACAGCCCCTATCCTGAGTACATGCC CCTGCCTAGACTGCTGGGCAACCTGGTGCTGGACGGCAAGATGGAAAACCTGCCTAGCGACCTGATCGCCCAGATCACAGATGCT GCCCTGAACAACAGAGTGCTGCCTGTCAGTCTGCTGCAGGCAGCCCTGAGAAGAAACAAGGCCGAGCAGAAGATCACCTACGGCA GAGCCAGCCTGCTGAAGGCCTACATCAACCGGGCCATCAGAGCCGGACGGCTGAAGAACATGAAGGAACTGACCATGGGCCTCGA CCGGAACAGACAGGATATCGGCTATGTGCTGGGCAGACTGTTCGCCGTGCTGGAAAAGATTCAGGCCGAGGCCAATCCTGGCCTG AACGCCACAATCGCCGACAGATATTTTGGCAGCGCCAGCAGCACACCTATCGCCGTGTTTGGCACCCTGATGAGACTGCTGCCTC Attorney Docket No. UM-41218.601 ACCACCTGAACAAGCTGGAATTCGAGGGCAGAGCCGTGCAGCTCCAGTGGGAGATCAGACAGATCCTGGAACACTGCCAGCGGTT CCCCAATCACCTGAACCTGGAACAGCAGGGACTGTTTGCCATCGGCTACTACCACGAGACACAGTTTCTGTTCACCAAGGACGCC CTGAAGAACCTGTTCAACGAGGCCAAGACCGCCTGA >human codon optimized Nla-cas7 with NLS and HA tag (SEQ ID NO: 175) ATGACCATCGAGAAGCGCTACGACTTCGTGTTCCTGTTCGACGTGCAAGACGGCAACCCCAACGGCGATCCTGATGCCGGAAACC TGCCTAGAATCGACCCTCAGACAGGCGAGGGCCTCGTGACAGATGTGTGCCTGAAGCGGAAAGTGCGGAACTTCATCCAGATGAC CCAGAACGACGAGCACCACGACATCTTCATCAGAGAGAAGGGCATCCTGAACAACCTGATCGACGAGGCCCACGAGCAAGAGAAC GTGAAGGGCAAAGAGAAAGGCGAGAAAACCGAGGCCGCCAGACAGTACATGTGCAGCCGGTACTACGACATCAGAACCTTCGGCG CCGTGATGACCACCGGCAAGAATGCTGGACAAGTGCGGGGACCTGTGCAGCTGACCTTCAGCAGATCCATCGATCCCATCATGAC CCTGGAACACAGCATCACCAGAATGGCCGTGACCAATGAGAAGGACGCCAGCGAAACCGGCGACAACAGAACCATGGGCAGAAAG TTCACCGTGCCTTACGGCCTGTACCGGTGCCACGGCTTTATCAGCACCCACTTCGCCAAGCAGACCGGCTTCAGCGAGAACGACC TGGAACTGTTTTGGCAGGCCCTGGTCAACATGTTCGATCACGATCACTCTGCCGCCAGAGGCCAGATGAATGCCAGAGGACTGTA CGTGTTCGAGCACAGCAACAACCTGGGAGATGCCCCTGCCGACAGCCTGTTCAAGAGAATCCAGGTGGTCAAGAAAGACGGCGTG GAAGTCGTGCGGAGCTTCGACGATTACCTGGTGTCCGTGGACGACAAGAACCTGGAAGAGACAAAGCTGCTGCGGAAGCTCGGCG GCTCTGTGGGCTATCCTTACGACGTGCCAGACTACGCCCCTAAGAAAAAGCGCAAAGTGTGA >human codon optimized Nla-cas11 with NLS and HA tag (SEQ ID NO: 176) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAGGCCTCGACCGGAACAGAC AGGATATCGGCTATGTGCTGGGCAGACTGTTCGCCGTGCTGGAAAAGATTCAGGCCGAGGCCAATCCTGGCCTGAACGCCACAAT CGCCGACAGATATTTTGGCAGCGCCAGCAGCACACCTATCGCCGTGTTTGGCACCCTGATGAGACTGCTGCCTCACCACCTGAAC AAGCTGGAATTCGAGGGCAGAGCCGTGCAGCTCCAGTGGGAGATCAGACAGATCCTGGAACACTGCCAGCGGTTCCCCAATCACC TGAACCTGGAACAGCAGGGACTGTTTGCCATCGGCTACTACCACGAGACACAGTTTCTGTTCACCAAGGACGCCCTGAAGAACCT GTTCAACGAGGCCAAGACCGCCTGA > human codon optimized Nla-cas11-TadA* fusion with NLS and HA tag (SEQ ID NO: 177) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAGGCCTCGACCGGAACAGAC AGGATATCGGCTATGTGCTGGGCAGACTGTTCGCCGTGCTGGAAAAGATTCAGGCCGAGGCCAATCCTGGCCTGAACGCCACAAT CGCCGACAGATATTTTGGCAGCGCCAGCAGCACACCTATCGCCGTGTTTGGCACCCTGATGAGACTGCTGCCTCACCACCTGAAC AAGCTGGAATTCGAGGGCAGAGCCGTGCAGCTCCAGTGGGAGATCAGACAGATCCTGGAACACTGCCAGCGGTTCCCCAATCACC TGAACCTGGAACAGCAGGGACTGTTTGCCATCGGCTACTACCACGAGACACAGTTTCTGTTCACCAAGGACGCCCTGAAGAACCT GTTCAACGAGGCCAAGACCGCCTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACA CCTGAAAGCAGCGGGGGCAGCAGCGGcGGGTCATCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCCCTGACCCTGG CCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAG AGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGCCTGGTCATGCAGAACTACAGACTG ATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCCACTCTAGGATCGGCCGCGTGGTGT TTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCGGCATGAATCACCGCGTCGAAAT Attorney Docket No. UM-41218.601 TACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAATGCTCAGAAG AAGGCCCAGAGCTCCATCAACTGA > human codon optimized Nla-cas11-APOBEC fusion with NLS and HA tag (SEQ ID NO: 178) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAGGCCTCGACCGGAACAGAC AGGATATCGGCTATGTGCTGGGCAGACTGTTCGCCGTGCTGGAAAAGATTCAGGCCGAGGCCAATCCTGGCCTGAACGCCACAAT CGCCGACAGATATTTTGGCAGCGCCAGCAGCACACCTATCGCCGTGTTTGGCACCCTGATGAGACTGCTGCCTCACCACCTGAAC AAGCTGGAATTCGAGGGCAGAGCCGTGCAGCTCCAGTGGGAGATCAGACAGATCCTGGAACACTGCCAGCGGTTCCCCAATCACC TGAACCTGGAACAGCAGGGACTGTTTGCCATCGGCTACTACCACGAGACACAGTTTCTGTTCACCAAGGACGCCCTGAAGAACCT GTTCAACGAGGCCAAGACCGCCTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACA CCTGAAAGCAGCGGGGGCAGCAGCGGCGGGTCAAGTTCAGAGACTGGGCCTGTCGCCGTCGATCCAACCCTGCGCCGCCGGATTG AACCTCACGAGTTTGAAGTGTTCTTTGACCCCCGGGAGCTGAGAAAGGAGACATGCCTGCTGTACGAGATCAACTGGGGAGGCAG GCACTCCATCTGGAGGCACACCTCTCAGAACACAAATAAGCACGTGGAGGTGAACTTCATCGAGAAGTTTACCACAGAGCGGTAC TTCTGCCCCAATACCAGATGTAGCATCACATGGTTTCTGAGCTGGTCCCCTTGCGGAGAGTGTAGCAGGGCCATCACCGAGTTCC TGTCCAGATATCCACACGTGACACTGTTTATCTACATCGCCAGGCTGTATCACCACGCAGACCCAAGGAATAGGCAGGGCCTGCG CGATCTGATCAGCTCCGGCGTGACCATCCAGATCATGACAGAGCAGGAGTCCGGCTACTGCTGGCGGAACTTCGTGAATTATTCT CCTAGCAACGAGGCCCACTGGCCTAGGTACCCACACCTGTGGGTGCGCCTGTACGTGCTGGAGCTGTATTGCATCATCCTGGGCC TGCCCCCTTGTCTGAATATCCTGCGGAGAAAGCAGCCCCAGCTGACCTTCTTTACAATCGCCCTGCAGTCTTGTCACTATCAGAG GCTGCCACCCCACATCCTGTGGGCCACAGGCCTGAAGTGA > human codon optimized APOBEC-Nla-cas11 fusion with NLS and HA tag (SEQ ID NO: 179) ATGAAACGGACAGCCGACGGAAGCGAGTTCGAGTCACCAAAGAAGAAGCGGAAAGTCAGTTCAGAGACTGGGCCTGTCGCCGTCG ATCCAACCCTGCGCCGCCGGATTGAACCTCACGAGTTTGAAGTGTTCTTTGACCCCCGGGAGCTGAGAAAGGAGACATGCCTGCT GTACGAGATCAACTGGGGAGGCAGGCACTCCATCTGGAGGCACACCTCTCAGAACACAAATAAGCACGTGGAGGTGAACTTCATC GAGAAGTTTACCACAGAGCGGTACTTCTGCCCCAATACCAGATGTAGCATCACATGGTTTCTGAGCTGGTCCCCTTGCGGAGAGT GTAGCAGGGCCATCACCGAGTTCCTGTCCAGATATCCACACGTGACACTGTTTATCTACATCGCCAGGCTGTATCACCACGCAGA CCCAAGGAATAGGCAGGGCCTGCGCGATCTGATCAGCTCCGGCGTGACCATCCAGATCATGACAGAGCAGGAGTCCGGCTACTGC TGGCGGAACTTCGTGAATTATTCTCCTAGCAACGAGGCCCACTGGCCTAGGTACCCACACCTGTGGGTGCGCCTGTACGTGCTGG AGCTGTATTGCATCATCCTGGGCCTGCCCCCTTGTCTGAATATCCTGCGGAGAAAGCAGCCCCAGCTGACCTTCTTTACAATCGC CCTGCAGTCTTGTCACTATCAGAGGCTGCCACCCCACATCCTGTGGGCCACAGGCCTGAAGTCTGGCGGATCTAGCGGAGGATCC TCTGGCAGCGAGACACCAGGAACAAGCGAGTCAGCAACACCAGAGAGCAGTGGCGGCAGCAGCGGCGGGTCACCCAAGAAAAAGC GGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAGGCCTCGACCGGAACAGACAGGATATCGGCTATGTGCT GGGCAGACTGTTCGCCGTGCTGGAAAAGATTCAGGCCGAGGCCAATCCTGGCCTGAACGCCACAATCGCCGACAGATATTTTGGC AGCGCCAGCAGCACACCTATCGCCGTGTTTGGCACCCTGATGAGACTGCTGCCTCACCACCTGAACAAGCTGGAATTCGAGGGCA GAGCCGTGCAGCTCCAGTGGGAGATCAGACAGATCCTGGAACACTGCCAGCGGTTCCCCAATCACCTGAACCTGGAACAGCAGGG ACTGTTTGCCATCGGCTACTACCACGAGACACAGTTTCTGTTCACCAAGGACGCCCTGAAGAACCTGTTCAACGAGGCCAAGACC GCCTGA Attorney Docket No. UM-41218.601 > human codon optimized Nla-cas5-2xUGI fusion with NLS and HA tag (SEQ ID NO: 180) ATGCGGTTCATCCTGGAAATCAGCGGCGACCTGGCCTGCTTCACAAGAAGCGAGCTGAAGGTCGAGCGGGTGTCATACCCTGTGA TCACCCCTAGCGCCGCCAGAAACATCCTGATGGCCATTCTGTGGAAGCCCGCCATCAGATGGAAGGTGCTGAAGATCGAGATCCT GAAGCCTATCCAGTGGACCAACATCCGGCGGAACGAAGTGGGCACCAAGATGAGCGAGAGAAGCGGCAGCCTGTACATCGAGGAC AACAGACAGCAGCGGGCCTCCATGCTGCTGAAGGATGTGGCCTATAGAATCCACGCCGACTTCGACATGACAAGCGAGGCCGGCG AGAGCGACAACTACGTGAAGTTCGCCGAGATGTTCAAGCGGAGAGCCAAGAAGGGCCAGTACTTCCACCAGCCTTACCTGGGCTG CAGAGAGTTCCCCTGCGACTTCAGACTGCTGGAAAAGGCCGAGGATGGCCTGCCTCTGGAAGATATCACCCAGGACTTCGGCTTC ATGCTGTACGACATGGACTTCAGCAAGAGCGACCCCAGAGACAGCAACAACGCCGAGCCTATGTTCTACCAGTGCAAGGCCGTGA ACGGCGTGATCACTGTGCCTCCAGCCGATAGCGAGGAAGTGAAGAGAGGCAGCGTCGGCTACCCCTACGATGTGCCTGATTACGC CCCCAAGAAAAAGCGGAAAGTGTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACA CCTGAAAGCAGCGGGGGCAGCAGCGGCGGGTCAACTAATCTGAGCGACATCATTGAGAAGGAGACTGGGAAACAGCTGGTCATTC AGGAGTCCATCCTGATGCTGCCTGAGGAGGTGGAGGAAGTGATCGGCAACAAGCCAGAGTCTGACATCCTGGTGCACACCGCCTA CGACGAGTCCACAGATGAGAATGTGATGCTGCTGACCTCTGACGCCCCCGAGTATAAGCCTTGGGCCCTGGTCATCCAGGATTCT AACGGCGAGAATAAGATCAAGATGCTGAGCGGAGGATCCGGAGGATCTGGAGGCAGCACCAACCTGTCTGACATCATCGAGAAGG AGACAGGCAAGCAGCTGGTCATCCAGGAGAGCATCCTGATGCTGCCCGAAGAAGTCGAAGAAGTGATCGGAAACAAGCCTGAGAG CGATATCCTGGTCCATACCGCCTACGACGAGAGTACCGACGAAAATGTGATGCTGCTGACATCCGACGCCCCAGAGTATAAGCCC TGGGCTCTGGTCATCCAGGATTCCAACGGAGAGAACAAAATCAAAATGCTGTCTGGCGGCTCAAAAAGAACCGCCGACGGCAGCG AATTCGAGCCCAAGAAGAAGAGGAAAGTCTGA >Nla-CRISPR-repeat (SEQ ID NO: 181) TCAGCCGCCTCTAGGCGGCTGTGTGTTGAAAC > human codon optimized Syn-IB-cas5 with NLS and HA tag (SEQ ID NO: 182) ATGGCTCAACTGGCCCTGGCTCTGGATACCGTGACCAGATACCTGAGACTGAAGGCCCCTTTCGCCGCCTTCAGACCTTTTCAGA GCGGCAGCTTCCGGTCCACCACACCTGTGCCATCTTTCAGCGCCGTGTATGGCCTGCTGCTGAATCTGGCCGGAATCGAGCAGCG GCAAGAGGTGGAAGGCAAAGTGACCCTGATCAAGCCCAAGGCCGAGCTGCCTAAACTGGCCATTGCCATCGGCCAAGTGAAGCCC AGCAGCACCAGCCTGATCAACCAGCAGCTGCACAACTACCCCGTGGGCAACAGCGGCAAAGAGTTCGCCAGCAGAACCTTCGGCA GCAAGTACTGGATCGCCCCTGTGCGGAGAGAGGTGCTGGTCAACCTGGATCTGATCATCGGCCTGCAGAGCCCCGTGGAATTCTG GCAGAAACTGGACCAGGGCCTGAAGGGCGAGACAGTGATCAACAGATACGGCCTGCCTTTTGCCGGCGACAACAACTTCCTGTTC GACGAGATCTACCCCATCGAGAAGCCCGATCTGGCCAGCTGGTACTGCCCTCTGGAACCCGACACCAGACCTAATCAGGGCGCCT GTAGACTGACCCTGTGGATCGACAGAGAGAACAACACCCAGACCACCATCAAGGTGTTCAGCCCCAGCGACTTCCGGCTGGAACC TCCTGCTAAAGCTTGGCAGCAGCTCCCTGGAGGCAGCGTCGGCTACCCCTACGATGTGCCTGATTACGCCCCTAAGAAAAAGCGG AAAGTGTGA > human codon optimized Syn-IB-cas6 with NLS and HA tag (SEQ ID NO: 183) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAATGAACTTCATCGACCTGG CTTTCCCCGTGAAGGGCACCGTGCTGAACGCCGACCACAACTACTACCTGTACAGCGCCATTGCCAAAGAGTTCCCCATCCTGCA CGACCTGCCTGACCTGGCCGTGAATACCATCAGCGGCAAGCCTGACAGAGAGGGCAAGATCCTGCTGGTGCCTGGCAGCAAGCTG Attorney Docket No. UM-41218.601 TGGATGAGACTGCCCATCGACAACATCACCCACATCTACCAGCTGGCCGGCAAGAAGCTGAGAATCGGCCAGTACTCTATCGAGC TGGGCAACCCCTCTCTGCACCCTCTGGAACCTGTGGAAAGCCTGAAGGCCCGGATCATCACCATCAAGGGCCATACCGAGCCTAT CAGCTTCCTGGAAGCCGTGAAGAGACAGCTGTTCGCCCTGGAAATCACCGAGGGCGACGTGGGAATTCCTGCCAATCACGAGGGC ATCCCCAAGAGACTGACCCTGCAGATCAAGAAGCCCGAGCGGACCTATAGCATCGTGGGCTACTCTGTGCTGCTGAGCAATCTGA GCGCCGAGGACAGCCTGAAGATCCAGCAAGTTGGCATCGGCGGCAAGAGAAGGCTTGGCTGTGGCGTGTTCTACCCCGCCGTGAA AAAGAGCACCAACTCCGGCAACAAGAAGAACGTCGAGGCCACACTGGGCTGA > human codon optimized Syn-IB-cas7 with NLS and HA tag (SEQ ID NO: 184) ATGAGCAACCTGAACCTGTTCGCCACCATCCTGACATACCCTGCTCCAGCCAGCAACTACAGAGGCGAGAGCGAAGAGAACAGAA GCGTGATCCAGAAGATCCTGAAGGACGGCCAGAAGTACGCCATCATCAGCCCCGAGAGCATGCGGAATGCCCTGAGAGAGATGCT GATCGAGCTGGGCCAGCCTAACAACCGGACAAGACTGCACAGCGAGGATCAGCTGGCCGTGGAATTCAAAGAGTACCCCAATCCT GACAAGTTCGCCGACGACTTCCTGTTCGGCTACATGGTGGCCCAGACCAACGACGCCAAAGAGATGAAGAAGCTGAACAGACCCG CCAAGCGGGACAGCATCTTCAGATGCAATATGGCCGTGGCCGTGAATCCCTATAAGTACGACACCGTGTTCTATCAGAGCCCTCT GAACGCCGGCGATAGCGCCTGGAAGAATAGCACATCTAGCGCCCTGCTGCACCGGGAAGTGACCCATACAGCCTTTCAGTACCCC TTCGCTCTGGCCGGCAAAGACTGTGCCGCTAAGCCTGAATGGGTCAAAGCTCTGCTGCAGGCCATTGCCGAGCTGAATGGTGTTG CTGGCGGACACGCCAGAGCCTACTATGAGTTTGCCCCTAGAAGCGTGGTGGCCCGGCTGACACCTAAACTGGTGGCCGGCTATCA GACCTACGGCTTCGATGCCGAAGGCAACTGGCTGGAACTGAGCAGACTGACCGCCACCGACAGCGACAATCTGGACCTGCCTGCC AACGAGTTTTGGCTCGGCGGCGAACTCGTGCGGAAGATGGATCAAGAGCAGAAGGCCCAGCTGGAAGCCATGGGAGCCCACCTGT ATGCCAATCCAGAGAAGCTGTTCGCCGATCTGGCCGACTCTTTCCTGGGCGTGGGCAGCGTCGGCTACCCCTACGATGTGCCTGA TTACGCCCCTAAGAAAAAGCGGAAAGTGTGA > human codon optimized Syn-IB-cas8 with NLS and HA tag (SEQ ID NO: 185) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAATGCCTAAGACACAGGCCG AGATCCTGACACTGGACTTCAACCTGGCCGAGCTGCCTAGCGCTCAGCATAGAGCTGGACTGGCCGGACTGATCCTGATGATCCG CGAGCTGAAGAAGTGGCCCTGGTTCAAGATCCGGCAGAAAGAAAAGGACGTGCTGCTGAGCATCGAGAACCTGGATCAGTACGGC GCCAGCATCCAGCTGAATCTGGAAGGACTGATCGCCCTGTTCGACCTGGCCTACCTGAGCTTCACCGAGGAACGGAAGTCCAAGA GCAAGATCAAGGACTTCAAGCGCGTGGACGAGATCGAGATCGAAGAGAACGGCAAGAACAAGATCCAGAAGTACTACTTTTACGA CGTGATAACCCCTCAAGGCGGCTTCCTGGCCGGCTGGGATAAGTCTGATGGACAGATCTGGCTGCGGATCTGGCGGGACATGTTC TGGTCCATCATCAAGGGCGTGCCCGCCACCAGAAATCCCTTCAACAATAGATGCGGCCTGAACCTGAACGCCGGCGACAGCTTTA GCAAGGACGTGGAAAGCGTGTGGAAGTCCCTGCAGAACGCCGAGAAAACCACAGGACAGAGCGGCGCCTTTTACCTGGGAGCCAT GGCCGTGAATGCCGAGAACGTGTCCACCGACGACCTGATCAAGTGGCAGTTCCTGCTGCACTTCTGGGCCTTCGTGGCCCAGGTG TACTGCCCCTACATCCTGGACAAGGACGGCAAGCGGAACTTCAACGGCTACGTGATCGTGATCCCCGATATCGCCAACCTGGAAG ATTTCTGCGACATCCTGCCTGACGTGCTGAGCAACAGAAACAGCAAGGCCTTCGGCTTCAGACCCCAAGAGTCCGTGATCGATGT GCCTGAGCAAGGCGCTCTGGAACTGCTGAACCTCATCAAGCAGCGGATCGCCAAGAAGGCCGGAAGCGGACTGCTGAGCGATCTG ATCGTGGGCGTCGAAGTGATCCACGCCGAAAAGCAGGGCAACAGCATCAAGCTGCACAGCGTGTCCTACCTGCAGCCTAACGAAG AGTCTGTGGACGACTACAACGCCATCAAGAACAGCTACTACTGCCCATGGTTCCGGCGGCAGCTGCTGCTGAATCTCGTGAACCC CAAGTTCGATCTGGCCAGCCAGAGCTGGCTGAAGAGACACCCTTGGTACGGCTTCGGCGACCTGCTGTCTAGAATCCCTCAGCGG TGGCTGAAAGAGAACAACTCCTACTTCAGCCACGACGCCCGGCAGCTGTTTACCCAGAAAGGCGACTTCGACATGACCGTGGCCA Attorney Docket No. UM-41218.601 CCACCAAGACCAGAGAATACGCCGAGATCGTGTACAAGATCGCCCAGGGCTTCGTGCTGTCCAAGCTGAGCAGCAAGCACGACCT GCAGTGGTCCAAGTGCAAGGGCAACCCCAAGCTGGAAAGAGAGTACAACGACAAAAAAGAGAAGGTCGTCAACGAGGCCTTCCTG GCTATCAGAAGCCGGACAGAGAAGCAGGCCTTCATCGACTACTTCGTGTCCACACTGTACCCTCACGTGCGGCAGGACGAGTTCG TGGATTTTGCCCAGAAGCTGTTCCAGGACACCGACGAAATCAGATCTCTGACCCTGCTGGCCCTGTCCTCTCAGTACCCTATCAA GAGACAGGGCGAGACAGAGTGA > human codon optimized Syn-IB-cas3 nickase (D430A) with NLS and HA tag (SEQ ID NO: 186) ATGCTGAAACAGCTGCTGGCCAAGAGCCTGCCTACCGATCCTCAGAAGAAGCCCCTGAGCCTGGAACAGCATCTGCTGGACACAG AGACAGCCGCTCTGGTCATCTTCAAGGGCAGAATGCTGGACAACTGGTGCCGGTTCTTCAAAGTGAAGGACCCCGACGAGTTCCT GCTGCACCTGAGAGTGGCCGCTCTGTTTCACGATCTGGGCAAAGCCAACCACGAGTTCATCGAGGCCGTGACCGCCAAGGGATTC GTGCCTCAGACACTGAGACACGAGTGGATCTCTGCCCTGGTGCTGCATCTGCCTGAAGTTCGACAGTGGCTGGGCAAGAGCAACC TGAACCTGGAAGTGGTTACAGCCGCCGTGCTGAGCCACCACCTGAAAGCTTCTCCCGACGGCGACTACAAGTGGGACGAGCCTCA GAAAAGCGGCGACAAGGTGGAAACAAAGCTGTACTTCAACCACGAAGAGGTGGACCGGATCCTGAACAAGATCGCCAACCTGCTG GACGTGGACAGCAAGCTGCCTGAGCTGCCCAAGAAGTGGATCAAGGGCGACATCTTCCTGGAAAACATCTACAAGGACGCCAACC AGATCGGCCGGAAGTTCACCAGACAGGCCAAGAAGGACGACAGCCTGAAGGGACTGCTGCTGGCTGTGAAGGCCGGACTGATCGC CTCTGATTCTGTGGCCAGCGGCATCTACAGAACCCAGGACTCTGAGGCCATTGCCAACTGGGTCAACCAGACACTGCACACCAAC AGCATCACCCCTGAGGAAATCGAGGAAAAGATTCTGCACCCTCGGTACAGACAGGTGGAAAAGAGCATCAACGAGCCCTTCCAGC TGAAGCGGTTCCAAGAGAAGGCCGAGACTCTGAGCAGTCGGCTGCTGCTGATGTCTGGCTGTGGCTCTGGCAAGACCATCTTCGC CTATAAGTGGATGCAGGGCGTGCTGAACAAGCACCAGGCCGGCAGAGCCATCTTTCTGTACCCTACAAGAGGCACCGCCACCGAG GGCTTCAAGGACTATGTGTCCTGGTGTCCTGAGGCCGATGCCTCTCTGCTGACTGGCACAGCCACATACGAGCTGCAGGCTATCG CCAAGAATCCCACCGAGGCCAACGAGGGCAAAGACTACCAGGCCGACGAGAGACTGTACGCCCTCGGCTATTGGGGCAAGAGATT CTTCAGCGCTACCGTGGACCAGTTCCTGAGCTTTCTGACCCACAACTACAAGAGCATCTGTCTGCTGCCCGTGCTGGCCGATAGC GTGGTGGTTATCGcTGAGATCCACAGCTTCAGCCCCGAGATGTTCGACAGCCTCGTGTGCTTCCTGAAAACCTTCGACGTGCCAG TGCTGTGCATGACCGCTACACTGCCCCAGACCAGAATCGAGGACCTGACCATCCAGCTCGACAAGGACAAGGATGGCCTGGGCCT CGAGGTGTTCCCTACCTCTGATAGAAGCGAGCTGGCCGAGCTGGAAAAGGCCGAAGGCATGGAAAGATACCTGATCGCCCACACC AACGAGGAAGCTGCCCTGGATCTGGCCGTGAAAGCCTACCAGGATAGCAAGAGGGTGCTGTGGGTCGTGAACACCGTGGACAGAT GCAGAGAGAAAGCCCGGAAGCTGGAATGCCTGCTGAAAACCGAGGTGCTGACCTACCACAGCCGGTTCAAACTGGCCGACCGGCA GAACAGACACCGGGAAACCGTGGAAGCCTTCGCTCTGCATCAGGCCCAGGGCGAGAAAAAAGCCGCCATTGCCGTGACCACACAA GTGTGCGAGATGTCCCTGGACCTGGACGCCGATGTGCTGATCACAGAGCTGGCCCCTATCAGCAGCCTGGTGCAGAGATTCGGCA GAAGCAACCGGGGCGACAAGAACGACAAGACCGAGCCTAGCAAGATCTACGTGTACAAGCCTCCTAAGGACAAGCCCTACAAGCA GAAGGATGATCTGGACCCCGCCGAGAAGTTCATCAACGACGTTCTGGGCAGAGCCTCTCAGAAGCTCCTGGCCGAGAAGCTGAAA GAGCACAGCCCTCCAGGCAGATACTCCGATGGATCTGCCCCTTTCGTGACCCAAGGCTACTGGGCCTCTAGCGACGAGCCTTTCA GAAAGATCGACGACTTCGCCGTGAACGCAGTGCTGACAGAGGATCTGGGCGAGATCACCCAGTACCTGAACAGCAACCCTCCTAA GCCTATCGACGGCTTCATCGTGCCCGTGCCTAAGAAGTACAAGTTCCAGGGCTTCAGCCACCGGCCACCTCAGCTGCCTAAGTAC CTGGAAATCGCCGACAGCAAGTTCTACAGCAGCAAGAGAGGCTTTGGCGACGACGCCGGCAGCGTCGGCTACCCCTACGATGTGC CTGATTACGCCCCTAAGAAAAAGCGGAAAGTGTGA Attorney Docket No. UM-41218.601 > human codon optimized Syn-IB-cas11-tadA* with NLS and HA tag (SEQ ID NO: 187) ATGACCGTGGCCACCACCAAGACCAGAGAATACGCCGAGATCGTGTACAAGATCGCCCAGGGCTTCGTGCTGTCCAAGCTGAGCA GCAAGCACGACCTGCAGTGGTCCAAGTGCAAGGGCAACCCCAAGCTGGAAAGAGAGTACAACGACAAAAAAGAGAAGGTCGTCAA CGAGGCCTTCCTGGCTATCAGAAGCCGGACAGAGAAGCAGGCCTTCATCGACTACTTCGTGTCCACACTGTACCCTCACGTGCGG CAGGACGAGTTCGTGGATTTTGCCCAGAAGCTGTTCCAGGACACCGACGAAATCAGATCTCTGACCCTGCTGGCCCTGTCCTCTC AGTACCCTATCAAGAGACAGGGCGAGACAGAGTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGA GAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGcGGGTCATCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCC CTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGG GCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGCCTGGTCATGCAGAA CTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCCACTCTAGGATCGGC CGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCGGCATGAATCACC GCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAA TGCTCAGAAGAAGGCCCAGAGCTCCATCAACTGA >Syn-IB-CRISPR repeat (SEQ ID NO: 188) GTGTCCAAACCATTGATGCCGTAAGGCGTTGAGCAC >human codon optimized Bha-cas5 with NLS and HA tag (SEQ ID NO: 189) ATGAGAAACGAGGTGCAGTTCGAGCTGTTCGGCGACTACGCCCTGTTCACCGATCCTCTGACAAAGATCGGCGGCGAGAAGCTGA GCTACAGCGTGCCAACATATCAGGCCCTGAAGGGAATCGCCGAGAGCATCTACTGGAAGCCCACCATCGTGTTCGTGATCGACGA GCTGAGAGTGATGAAGCCCATCCAGATGGAAAGCAAAGGCGTGCGGCCCATCGAGTACGGCGGAGGAAATACTCTGGCCCACTAC ACCTACCTGAAGGACGTGCACTACCAAGTGAAGGCCCACTTCGAGTTCAACCTGCACAGACCCGACCTGGCCTTCGACAGAAATG AGGGCAAGCACTACAGCATCCTGCAGCGGAGTCTGAAGGCTGGCGGCAGAAGAGACATCTTCCTGGGCGCTAGAGAATGCCAGGG CTATGTGGCCCCTTGCGAGTTTGGAAGCGGCGACGGCTTTTATGACGGCCAGGGCAAGTATCACCTGGGCACAATGGTGCACGGC TTCAACTACCCCGATGAGACAGGACAGCACCAGCTGGATGTTCGGCTTTGGAGCGCCGTGATGGAAAACGGCTACATTCAGTTCC CCAGACCTGAGGACTGCCCCATTGTGCGGCCTGTGAAAGAGATGGAACCCAAGATCTTCAACCCCGACAACGTGCAGTCTGCCGA GCAGCTCCTGCATGATCTTGGCGGAGAATACCCATACGATGTTCCAGATTACGCTGTGCCTAAGAAGAAGAGAAAGGTGTAA >human codon optimized Bha-cas7 with NLS and HA tag (SEQ ID NO: 190) ATGGTGCCTAAGAAGAAGAGAAAGGTGTACCCATACGATGTTCCAGATTACGCTGGCAGCGGCACCATCCTGGACCACAAGATCG ACTTCGCCGTGATCCTGAGCGTGACCAAGGCCAATCCTAACGGCGACCCTCTGAACGGCAACAGACCCAGACAGAACTACGATGG CCACGGCGAGATCAGCGACGTGGCCATTAAGCGGAAGATCCGGAACCGGCTGCTGGACATGGAAGAACCCATCTTCGTGCAGAGC GACGACAGAAAGGCCGACAGCTTCAAGAGCCTGAGAGACAGAGCCGACAGCAACCCTGAGCTGGCCAAGATGCTGAAGGCCAAGA ATGCCAGCGTGGACGAGTTCGCCAAGATCGCCTGTCAAGAGTGGATGGACGTGCGGAGCTTTGGCCAGGTGTTCGCCTTCAAGGG CAGCAATCTGAGCGTGGGCGTTAGAGGCCCTGTGTCTATTCACACCGCCACCAGCATCGACCCCATCGACATCGTGTCTACCCAG ATCACCAAGAGCGTGAACAGCGTGACCGGCGACAAGAGAAGCAGCGACACCATGGGCATGAAGCACAGAGTGGACTTCGGCGTGT ACGTGTTCAAGGGCTCCATCAACACCCAGCTGGCCGAGAAAACCGGCTTCACCAATGAGGACGCCGAGAAGATCAAGCGGGCCCT GATCACCCTGTTCGAGAACGATAGCAGCAGCGCCAGACCTGACGGCAGCATGGAAGTGCACAAAGTGTATTGGTGGGAGCACAGC Attorney Docket No. UM-41218.601 AGCAAGCTGGGCCAGTACTCTAGCGCCAAGGTGCACAGAAGCCTGAAGATCGAGAGCAAGACCGACACACCCAAGAGCTTCGACG ACTACGCCGTGGAACTGTACGAGCTGGATGGCCTGGGCGTCGAAGTGATCGATGGACAATAA >human codon optimized Bha-cas8 with NLS and HA tag (SEQ ID NO: 191) ATGGTTCCCAAGAAGAAGCGGAAAGTCTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAAGCTGGCTGCTGCACCTGT ACGAGACATACGAGGCCAACCTGGACCAAGTGGGCAAGACCGTGAAGAAGGGCGAAGATAGAGAGTACACCCTGCTGCCTATCAG CCACACCACACAGAACGCCCACATCGAAGTGACCCTGGACGAGGACGGCGACTTCCTGAGAGCCAAGGCTCTGACCAAAGAGAGC ACACTGATCCCTTGCACCGAGGAAGCCGCCAGCAGATCTGGCTCTAAGGTGGCCCCTTATCCTCTGCACGACAAGCTGTCTTACG TGGCCGGCGATTTCGTGAAGTACGGCGGCAAGATCAAGAACCAGGACGACGCCCCTTTCGACACCTACATCAAGAATCTCGGCGA GTGGGCCAACTCTCCCTACGCCACAGAGAAAGTGAAGTGCATCTACACCTACCTGAAGAAAGGCCGGCTGATCGAGGACCTGGTG GATGCTGGTGTCCTGAAGCTGGACGAGAACCAGCAGCTGATTGAGAAGTGGGAGAAGCGCTACGAGGAACTGCTGGGAGAGAAGC CCGCCATCTTTAGCTCTGGCGCCACAGATCAGGCCAGCGCCTTCGTGCGGTTCAATGTGTTTCACCCCGAGAGCATCGACGACGT GTGGAAGGACAAAGAGATGTTCGACAGCTTCATCAGCTTCTACAACGATAAGCTGGGCGAAGAGGACATCTGCTTCGTGACCGGC AACAGACTGCCCAGCACAGAGAGACACGCCAACAAGATTAGACACGCCGCCGACAAGGCCAAGCTGATCTCCGCCAATGACAACA GCGGCTTCACCTTCCGGGGCAGATTCAAGACCAGCAGAGAAGCCGTGGGCATCAGCTACGAGGTGTCCCAGAAAGCCCACAACGC CCTGAAGTGGCTGATCCACAGACAGAGCAAGTCTATCGACGACCGGGTGTTCCTCGTGTGGTCCAACGACAATAGCCTGGTGCCT AATCCTGACGAGGATGCCGTGGACATCATGAAGCACGCCAATAGAGAGCTGGAACGGGACCCTGATACCGGCCAGATTTTTGCCG GCGAAGTGAAGAAAGCCATCGGCGGCTACAGAAGCGACCTGAACTATCAGCCCGAGGTGCACATCCTGGTGCTGGATTCTGCCAC CACCGGAAGAATGGCTGTGCTGTACTACCGCAGCCTGAACAAAGAGCTGTACCTGAACCGGCTGGAAGCCTGGCACGATTCTTGT GCCTGGGAGCACAGATACCGGCGGGACGAGAAAGAGTTCATCTCCTTCTACGGCGCTCCCGCCACCAAGGATATTGCCTTTGCCG CCTATGGACCCAGAGCCAGCGAAAAAGTGATCAAGGATCTGATGGAACGGATGCTGCCCTGCATCGTGGACGGCAGAAGAGTGCC TAAGGACATTGTGCGGAGCGCCTTCCAGAGGGCCAGCAATCCTGTGTCCATGGAAAGATGGGAGTGGGAAAAGACCCTGAGCATC ACATGCGCCCTGATCCGGAAGATGCACATCGAGCAGAAAGAGGAATGGGGCGTCCCACTGGACAAGAGCAGCACCGATAGAAGCT ACCTGTTCGGCAGACTGCTGGCCGTGGCTGACGTTTTGGAAAGAGGCGCCCTGGGCAAAGACGAGACAAGAGCCACAAACGCCAT CCGGTACATGAACAGCTACAGCAAGAACCCCGGCAGAACCTGGAAAACCATCCAAGAGAGCCTGCAGCCTTACCAGGCCAAACTG GGCACCAAGGCCACATACCTGAGCAAGCTGGTGGACGAGATCGGGGACCAGTTTGAGCCCGGCGACTTTAACAACAACCCTCTGA CCGAGCAGTACCTGCTGGGCTTCTACAGCCAGCGGCGGGAACTGTACAAGAAGAAAGAAGAGGAAACGAACCAGTAA >human codon optimized Bha-cas3 nickase (D395A) with NLS and HA tag (SEQ ID NO: 192) ATGTATATCGCCCACATCCGCGAGGTGGACAAAGTGATCCAGACACTGAAAGAACACCTGTGCGGCGTGCAGTGCCTGGCCGAAA CATTTGGAGCCAAGCTGAGACTGCAGCACGTGGCAGGACTGGCTGGACTGCTGCATGATCTGGGCAAGTACACCAACGAGTTCAA GGACTACATCTACAAGGCCGTGTTCGAGCCCGAGCTGGCCGAGAAAAAGAGAGGCCAGGTCGACCACTCTACCGCTGGTGGCAGA CTGCTGTACCAGATGCTGCACGACAGAGAGAACAGCTTCCACGAGAAGCTGCTGGCCGAAGTCGTGGGCAATGCCATCATCAGCC ACCACAGCAACCTGCAGGATTACATCAGCCCTACAATCGAGAGCAACTTCCTGACCAGAGTGCTGGAAAAAGAGCTGCCCGAGTA CGAGAGCGCCGTGGAACGGTTCTTCCAAGAAGTGATGACCGAGGCCGAACTGGCCAGATACGTGGCCAAAGCCGTGGACGAGATC AAGCAGTTCACCGACAACAGCCCTACTCAGTCATTCTTTCTGACCAAGTACATCTTCAGCTGCCTGATCGACGCCGACCGGACCA ACACCAGAATGTTCGATGAGCAGGCCAGAGAGGAAGAACCCACACAGCCTCAGCAGCTGTTCGAGCACTATCACCAGCAACTGCT GAACCACCTGGCCAGCCTGAAAGAGAGCGACAGCGCCCAGAAACCTATCAACGTGCTGAGAAGCGCCATGAGCGAGCAGTGCGAG Attorney Docket No. UM-41218.601 AGCTTTGCCATGAGGCCTAGCGGCATCTACACCCTGTCTATCCCAACAGGCGGCGGAAAGACCCTGGCTTCTCTGAGATATGCCC TGAAGCACGCCCAAGAGTACAACAAGCAGCGGATCATCTACATCGTGCCCTTCACCACCATCATCGAGCAGAACGCTCAAGAAGT GCGGAACATCCTGGGCGACGACGAGAATATCCTGGAACACCACTCCAACGTGGTGGAAGATAGCGAGAACGGCGACGAGCAAGAG GACGGCGTGATCACCAAGAAAGAGAGACTGAGACTGGCCCGGGACAACTGGGACAGACCCATCATCTTTACAACCCTGGTGCAGT TCCTGAACGTGTTCTACGCCAAGGGCAACAGAAACACCAGACGGCTGCACAACCTGAGCCACAGCGTGCTGATCTTCGCCGAGGT GCAGAAAGTGCCCACCAAATGCGTGTCCCTGTTCAACGAGGCCCTGAACTTTCTGAAAGAGTTCGCCCACTGCAGCATCCTGCTG TGCACTGCCACTCAGCCCACACTGGAAAACGTGAAGCACAGCCTGCTGAAGGACCGCGACGGCGAGATTGTGCAGAACCTGACCG AAGTGTCCGAGGCCTTCAAGAGAGTGGAAATCCTGGACAAGACCGACCAGCCTATGACCAACGAAAGACTGGCCGAGTGGGTCCG AGATGAGGCTCCTTCTTGGGGCTCTACCCTGATCATCCTGAATACCAAGAAGGTGGTCAAGGACCTGTATGAGAAGCTGGAAGGC GGCCCTCTGCCTGTGTTTCACCTGAGCACCTCTATGTGCGCCGCTCACAGAAAGGACCAGCTGGATGAGATCAGAGCCCTGCTGA AAGAGGGCACCCCTTTCATCTGCGTGACCACACAGCTGATTGAGGCCGGCGTGGACGTGTCCTTTAAGTGCGTGATCAGAAGCCT GGCCGGCCTGGATTCTATTGCCCAGGCTGCCGGAAGATGCAACAGACACGGCGAAGAACAGCTCCAGTACGTGTACGTGATCGAC CACGCCGAGGAAACCCTGAGCAAGCTGAAAGAAATCGAAGTGGGCCAAGAGATCGCCGGCAATGTGCTGGCCCGGTTCAAGAAGA AGGCCGAGAAGTACGAGGGCAACCTGCTGTCTCAGGCCGCCATGAGAGAGTACTTCCGGTACTACTACAGCAAGATGGACGCCAA CCTGAACTACTTCGTGAAAGAAGTCGACAAGGACATGACCAAGCTGCTGATGAGCCACGCCGTCGAGAACTCCTACGTGACCTAC TACCAGAAGAACACCGGCACACACTTCCCTCTGCTGCTGAACGGCAGCTACAAGACAGCCGCCGACCACTTCAGAGTGATTGACC AGAATACCACCAGCGCCATCGTGCCTTATGGCGAAGGCCAGGACATCATTGCCCAGCTGAATAGCGGCGAGTGGGTTGACGATCT GAGCAAGGTGCTGAAGAAAGCCCAGCAGTACACCGTGAACCTGTACTCCCAAGAGATTGATCAGCTGAAAAAAGAGGGCGCCATT GTGATGCACCTGGACGGCATGGTGTACGAACTCAAAGAGAGCTGGTACTCCCACCAGTATGGCGTGGACTTCAAAGGCGAAGGCG GCATGGACTTCATGAGCTTCGGCAGCGGCTGGTCCCATCCTCAGTTCGAGAAAGGCGGAGGATCTGGCGGTGGTTCTGGTGGATC TGCTTGGAGCCATCCACAATTTGAAAAAGTGCCTAAGAAGAAGAGAAAGGTGTAA >human codon optimized Bha-cas11-tadA* with NLS and HA tag (SEQ ID NO: 193) ATGCCACTGGACAAGAGCAGCACCGATAGAAGCTACCTGTTCGGCAGACTGCTGGCCGTGGCTGACGTTTTGGAAAGAGGCGCCC TGGGCAAAGACGAGACAAGAGCCACAAACGCCATCCGGTACATGAACAGCTACAGCAAGAACCCCGGCAGAACCTGGAAAACCAT CCAAGAGAGCCTGCAGCCTTACCAGGCCAAACTGGGCACCAAGGCCACATACCTGAGCAAGCTGGTGGACGAGATCGGGGACCAG TTTGAGCCCGGCGACTTTAACAACAACCCTCTGACCGAGCAGTACCTGCTGGGCTTCTACAGCCAGCGGCGGGAACTGTACAAGA AGAAAGAAGAGGAAACGAACCAGTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAAC ACCTGAAAGCAGCGGGGGCAGCAGCGGCGGGTCATCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCCCTGACCCTG GCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACA GAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGCCTGGTCATGCAGAACTACAGACT GATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCCACTCTAGGATCGGCCGCGTGGTG TTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCGGCATGAATCACCGCGTCGAAA TTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAATGCTCAGAA GAAGGCCCAGAGCTCCATCAACTGA > Bha-IC-CRISPR repeat (SEQ ID NO: 194) GTCGCACTCTTCATGGGTGCGTGGATTGAAAT Attorney Docket No. UM-41218.601 >human codon optimized Tfu-cas5 with NLS and HA tag (SEQ ID NO: 195) ATGAGCGGCTTCCTGCTGAGACTGGCTGGCCCTATGCAGTCTTGGGGCGAGCACTCTATGTTCGGCGAGAGAGACACCCTGCCTT ATCCTAGCAGATCCGGCCTGATCGGCATGTTTGCTGCTGCCCAGGGTGTCAGAAGAGGCGACCCTCTGGACCGGTACAAAGAACT GAAGTTCACCGTGCGCGTGGACAGACCTGGCGTCAGACTGGTGGATTTCCACACCATTGGCGGCGGACTGCCCAAAGAAAGAACC GTGCCTACAGCCGCTGGCGAGAGAAGGGATCCTAAGAAAGCCACCATCGTGACCAGCAGAAGCTACCTGGCCGACGCCGTGTTTA CAGTGGCTGTGACAGGACCCGAGGCCGACACAATTGCTGATGCTCTGGCCGCTCCTTACTGGCAGCCTTATCTTGGCAGACGGGC CTTCGTGCCTGATCCTCTGCTGGTGCTTCGGAGAAGAGTGGCCGATCCTGTCAGAGAACTGGTGGAAGCTGTGCCCCTGCCTCAT CGGAGAGTGGAAGAGGATGCTGCCACCGTGCTGGTGGACCTGATCTATGAGGAAGGCGAGTACCCCGACACACGGACCCTGACCG TGCTGAATGATGTGCCTCTGAGCTTCGACAGCAAGAGCAGACGGTACAGCACCCGGCAGATCAGAGTGGTGCCAACAGAAGTGCC TGCCACACTGGTTGCCGGACCTGGCAGAGACTACCAGAACAAGCTGTTCACCTACGTGAAGCAGTGCGCCGAAGAGGCCGCTGGC TCTGTGGGCTATCCTTACGATGTGCCCGACTACGCCCCTAAGAAAAAGCGGAAAGTGTGA >human codon optimized Tfu-cas6 with NLS and HA tag (SEQ ID NO: 196) ATGACCTGGCTGACCAAGATCGTGCCCGACCTGCGGTACAGACAGACCAGAGCCGATTTCAGAACCGCCGGCAACCTGCACCGGA AGCTGATCAGACTGTCTAGCGACCTGGGCGAAGAGAGAATCGCCAATCCTAGACAGCAGAGCGGCCTGCTGTTCCGGATCGAGGA AACCAGAAACGAGCTGTACCTGCTGGTGCAGAGCCACTCTCCACTGAGAGTGGATAGACTCGGCCCTGGCTATCACGGCGTGCAG ATGAGAAATCTGGACCCCTTTCTGGCCCGGCTGGACAAGGGCAGCAGAGTGCGGTATAGAATCGTGGCTAGCCCCACCAAGAGAC TGGGCAGAAGCGAGAACAACACCCAGCGGCTGGGACTGAAAGAGCCTCCTAAGAAGCCCCGCGAGTACACATGGGCTCTTAGAGG CGCTGCCGCCGAAGAATGGTGGCATTCTAGAGCCGCCGCTAACGGCCTGGAACTGCTGTCCACATATGCCCAGACACTGGACGAC GTGCGCGATCCTGGTACAGCCGACAGAAGCCGGAAGATCAGACACCCCGCCGTCAGATTTGATGGCGAGGCCGTGATCTCCGATG TGGATGCCGTTAGACACGCCGTGCTGAATGGCATCGGCAGAGGCAAGTCTTACGGCTGCGGACTGCTGTCTCTGGCCCTGATTGA AGAAGGCGAGCACGGCGGAAGCGTGGGCGACTACAAGGACGATGATGACAAAGGCGGCAGCCCCAAGAAAAAGCGGAAAGTGTGA >human codon optimized Tfu-cas7 with NLS and HA tag (SEQ ID NO: 197) ATGACCTTCGTGGACATCCACGCCATCCAGACACTGCCCTACAGCAACATCAACCGGGACGATCTGGGCAGCCCTAAGACAGTGG TGTACGGCGGCAAAGAGCGGACCAGAGTCAGCAGCCAGTCTTGGAAGAGAGCCGTGCGGCACGAAGTGGAAGCCAGACTGGGAGA TAAGGCCGTGCGCACCAGACGGATCATCAGCGAGATTGCCAAGCGGCTGAGAGAGAGAGGCTGGGACGCTGATCTTGCTGATGCT GGCGCTAGACAGGTGGTGCTGAGCGTGGGAAAGAAGTCCGGCATCAAGCTGGAAAAAGAGAAGGACAGCGAGGCCCCTGCCACCA GCGTGCTGTTTTATCTGCCTGTGCCTGCCATCGACGAGCTGGCCGCTATTGCCGATGAACACAGAGATGCCGTGGCCAAAGAGGC CGCCAAGAAAACCCCTAAGGGAATCCTGCCTGCCGACCGGATTACCGAGGTGCTGAAGTCCAGAAACGTGTCCGTGAACCTGTTC GGCAGAATGCTGGCCGAGCTGCCTAGCACTGAAGTGGATGGCGCTGTGCAGTTCGCCCACGCCTTTACAGTGCACGGCACAACCG TGGAAGTGGACTTCTTCACCGCCGTGGACGACATCCCCAAAGAGAACGATCACGGCAGCGGCCACATGAACGCCGGACAGTTTTC TGCCGGCACCTTCTACAGATACGCCAATGTGAACCTGGACCGGCTGGTGGAAAACACAGGCGACGCTCAGACAGCCAGAACAGCC GTGGCCGAATTCCTGAGAGCCTTCCTGTCTACAGTGCCCAGCGGCAAGCAGAATGCCACAGCCGCTATGACCCTGCCTGACCTGG TGCACATTGCCGTCAGATTCGACAGACCCATCAGCTTCGCCCCTGCCTTTGAGACAGCCCTGTATGGCTCTGACGGCTACACCCT GAGAGCTTGCCAAGAGCTGAACAACTACGCCGAGAGACTGCGGGAAGTGTGGCCCGATGATGCCATCAGAGGCTACGCCACCGTC Attorney Docket No. UM-41218.601 GAGAACAAGACCGATCTGGCTGCCCTGGGCGAGAGATACGATAGCTACCCCGCTCTGATCGACGCCATGGTGGCTGCTGCTTTTG AAGGCGAGCGCGAGGGCTCTGTGGGCTACCCTTATGATGTGCCCGACTACGCCCCTAAGAAAAAGCGGAAAGTGTGA >human codon optimized Tfu-cas8 with NLS and HA tag (SEQ ID NO: 198) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGATCTGTGGGACTGTCTGTGGCCCTGTGTT TTCTCGTTGGCGGCGCTATCCCATCTCCTCCTAGCTTCGACGTGACAATCGCCCCTTGGCTGATCGCCAGATCCAGAGATGTTCT GGCCGCTCCTGAGATGCTGGGCCTGAGAGATGTGCTGATCAGAAGCCACGAGCTGAGCGACGTGGAAATCCCTCTTCCTCCTGGT GCTGCCGTGCTGTGGCGAATTCTGGCCCTGATTACCGCCAGAATCACCGGCCTGGATCAGCCTCCAAACAAGAACCCCAAGCGGA AGTGGCAGGCCAGAAGAAGCCAGATCCTGAGCAAGGGCAGACTGGATCCTGAAGCCGTGGATGCCTACTTCGCCGACTACAGCGA GAGATTCGACCTGTTTCACCCCGAGAGGCCCTGGCTGCAAGACCCCAGACTGAGAGAGGAATGCCCTAAGACCAGCGGCGTGAAC AAACTGGCCTGGGGAAGAACAGCCGGCGAGAATCAAGTGTGGCTCGGAGGACACCACCACGACCTGGATCCTCATCCTCTGGATT CTGCCGAGGCCGTGTGGCATCTGCTGGCCACTCTTGGCTATGGCCCTAGCGGCATGTGTACAGCCAGAGTTGTGCGGGGCAGATC CGAGAGAAATGTGACAGCCGGACCTCTGAGAGGCACCGTGTCTTATCACCCTCTGGGCAGAACCCTGTTCGAGAGCCTGATCCTG AACATCCCCTATCCTGGAACCGGCGCTGCCGATCTGGCATTTTGGGAACAGCCCGAGCTGAACGATCCTCTGGGACTGCCTGAAG AGTCTGCCGGACTGGCCGGAATCCTGAGACTGGACCACTTTAGACACGCCGTGCTGCTGCACCCATCTCCAGATGGATCTCACGT GGTGGACGCCTGGGTTACCTGGGCTTGGAGAGAGAGAAACATCAGCCCCGAGCTGGACCCCTACCTGATCTACCAGACCAGCAAA GAGGGCAGAGTCTACCCCAGACCTGCCGAAGCCGAACGGGCCATTTGGAGAGATCTGGATGCCCTGCTGCACTACGGCGAGGACG GCAATTACAGACCCACCATCCTGGACAACTGCACCCCTCTGGCTCAGGTGCCACAAGAGGTGCTGGATAGCCTGAGGCTGAGAGC CTTCGGCTTTGACCAGGATGGCCAGGCCAGAGACAAGCAGTGGTTCACCGCTACAACACCAGCCGTGCTGAGATGGCTGGCCGAC AGAGAGACAGACGACAACGAGAACGCCCGGATCGTGCGGAGAATCACCCTGGCCAGAAAAGCTGCTGAGGCCCTCGGAAGAAGGC TGGAAAAGGCCTGTAAAGAGGCATGGAAAGAGAGCAACAGCCCCAGCTCTACCAGCAGCGGCACCAATGCCAAGACAGAGACAGG CGTTGGACCTTGGGTCCAGCACGGAATGAGCCGGTATTGGGCCAAAGCCGAGCCTGTGTTCTGGAACATCGTGTACGACAGACCC GCTCAGGGCTACACACCTGGAATGGCCGGACCTGGCAACGCCTTTAATCTGGTGGCTCTGGCCGCCTACGACGAAGTGACAGGCC CTTACTGCGAGAGGCCTAGAGTGGCTAAGGTGGTGGAACGGCACAGAAGCACCCTGTTCAGCAACTGGACCCCAAAGCAGGACAA AGAGGCCGCCTAA >human codon optimized Tfu-cas3 nickase (D451A) with NLS and HA tag (SEQ ID NO: 199) ATGCCTGAGCACGATAGCACCGATGACAAGCACGGCATCCCTCCACTGGACCTGAGATTCTGGGCCAAAGAGAGAGGCCTGCGGG GCAAGACATACCCTCTCGTGTGTCACTCTCTGGATGCCGCTGCTGCTGCTCTGGTGCTGTGGAACGAGTATCTGAGCCCTGGCCT GAGAGACACAATCGCCAGCAGCATGGAAACCGACGAGGAACACGCCGGCCACTGTATCGCTTTTTGGGCCGGACTGCACGACATC GGCAAGCTGACCAGAGAGTTCCAGCAGCAGATCGCCATCGACCTGTCTGCCTATCCTGGCGAGGAACTGTCTGGCGAGCAGAGAT CTCATGCCGCCGCTACAGGCAAGTGGCTGCCTTTTGCTCTGCCAAGCCTGGGCTATCCTAATGGCGGCCTGGTTACAGGACTGGT GGCCCAGATGCTCGGAGGACACCACGGAACCTTCCATCCTCATCCTAGCTTCCAGAGCAGAAACCCTCTGGCCGAGTTCGGCTTT AGCAGCCCTCACTGGGAGAAGCAGAGACACGCTCTGCTGCACGCCGTGTTTGATGCCACAGGCAGACCCACACCTCCAGACATGC TGGATGGACCTACAGCCTCTGTCGTGTGCGGACTGGTTATCCTGGCCGATTGGCTGGTGTCCCAAGAGGACTTCCTGCTGGAAAG ACTGACCAGCCTGCCTGCCGATGGATCTGCCTCTGCTCTGAGAGCCCACTTCGAGACAAGCCTGAGAAGAATCCCCAGCCTGCTG GATGCTGCAGGCCTGAGGCCTATTACAGTGCCTCCTGCCACCTTCACCGAGAGCTTTCCACACCTGAGCAAGCCCAATGGACTGC AGGCTTCCCTGGCCAAACATCTGCCTTGCCTGTGTACAGGCCCTGGACTGGTGCTGATCACAGCCCCTATGGGCGAGGGAAAAAC Attorney Docket No. UM-41218.601 AGAGGCCGCCTATCACGTGGCCGACCTGCTGGGAAAAGCTACCGGCAGACCTGGCAGATTTCTGGCCCTGCCTACAATGGCCACC GCCGATCAGATGCACACCCGGCTGAAAGAGTACGCCCGGTACAGAGTGGAAAACACCGACCTGCCTCGGAGCAGCACACTGGCAC TGCTGCATTCTATGGCCTGGCTGAACCCCGATTACGCCCCTGCTGATCTTCCTGGCGTGTCCAAGGTGCTGAGCAATCTGGGACA CAGAGATCCCTTCGCCGCCACCGACTGGCTGATGGGAAGAAAGAGAGGACTGCTGGCTCCTTGGGCCGTGGGCACAATTGATCAG GCTCTGATGGCCGTGCTGCGGGCCAAACACAATGCCCTGAGACTGTTTGGCCTGGCCGGAAAAGTGGTGGTGGTTGcTGAAGCCC ACGCCGTGGATCCCTACATGCAGGTTCTGCTCGAACAGCTGCTGAGATGGCTGGGCACACTGGATGTGCCTGTGGTGCTGCTGTC TGCCACACTGCACCACTCTATCGCCAACAGCCTGGTCAAGGCCTATCTGGAAGGCGCCCGTGGCAGAAGATGGAATAGAAGCGAG CCTCAGCCTGTGTCCGAGGTGTCCTATCCAGGATGGCTGCATGTGGACGCCCGGATCGGCAAAGTGACAAGATCCTCCGATGTGG ATCCCCTGCCTATCGCCACCACACCAAGAAAGCCTCTGGAAGTGCGGCTGGTGGACGTGCCAGTGAAAGAGGGCGCTCTGAACAG ATCTACCGTGCTGGCCAAAGAACTGACCCCTCTGGTTAAGCAAGGCGGCTGTGCCGCCATCATCTGTACCACAGTTGCTGAGGCA CAGGGCGTGTACGATCTGCTCTCTCAGTGGTTCGCCACACTGGGCGAAGATGCCCCTGATCTGTACCTGCTGCACAGCAGATTCC CCAACCGGCAGAGAACAGAGATCACCGCCACCATCGTGGACCTGTTCGGAAAAGAAGGCGCTCAGAGCGGCAGAAGGCCTACAAG AGGCGCTGTGCTGGTGGCTACACAGGTGGTGGAACAGAGCCTGGACCTGGATGTGGACCTGATGATCAGCGATCTGGCCCCTGTT AGCCTGCTGCTTCAGCGAGCTGGACGGTGTTGGAGACACGAGCACCTGGGCATCATCAATAGACCCCAGTGGGCCAAGCAGCCCG AACTGGTTGTTCTGACCCCTGAGCAGAATGGCGACGCCGATAGAGCCCCTTGGTTTCCCAGATCTTGGACCAGCGTGTACCCACT GGCTCTGCTCCAGAGAACCTACACACTGCTGCGGAGAAGAAATGGCGCCCCTGTGCAGATCCCTGAGGATGTGCAGCAACTGGTG GATGACGTGTACGACGACGATAGCCTGGCCGAGGACCTGGAAGCCGACATGGAACGGATGGGAGAAGAACTTGCCCAGCGCGGAC TGGCCAGAAACGCCGTTATTCCCGATCCTGACGACGCCGAGGACAACCTGAATGGCCTGACCGAGTTCAGCTTCGACGTGGACGA ACACGTGCTGGCTACCAGATTTGGCGCTGGAAGCGTCAGAGTGCTGTGCTACTATGTGGACACCGCCGGCAATCGGTGGCTGGAT CCTGAGTGCACCGTGGAATTCCCCGAGCAAGGCACCGGAAGAGAAGGCAGATTCACCATGGCCGACTGTAGAGATCTGGTGGCCA GAACAATCCCCGTGCGGATGGGACCTTGGGCCTCTCAGCTGACCGAGGATAATCACCCTCCTGAGGCTTGGAGAGAGAGCTTCTA CCTGAGGGACCTCGTGCTGATCCCTCAGCGCGTTACAGATGAAGGGGCAGTGCTGCCTACAGAGACAGGCGGTAGAGAGTGGCTG CTGGATCCATGCAAGGGCCTGATCTTTGGCAGCGTGGGCTACCCCTACGACGTGCCCGATTATGCCGGCTATCCTTACGATGTGC CAGACTACGCCGGCAGCTACCCTGAGTTCCCCAAGAAAAAGCGGAAAGTGTGA >human codon optimized tadA*-Tfu-cas11 with NLS and HA tag (SEQ ID NO: 200) ATGAAACGGACAGCCGACGGAAGCGAGTTCGAGTCACCAAAGAAGAAGCGGAAAGTCTCTGAGGTGGAGTTTTCCCACGAGTACT GGATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAG AGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGC CTGGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCC ACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCC CGGCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCT AGACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAACTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACAC CTGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGcGGGTCACCCAAGAAGAAGCGGAAAGTCTACCCCTA CGACGTGCCCGATTATGCCAACAGCGACTACATCCTGCAGCACGCCGACGCTCTGGTCAAGAGAGTGTCCAAGCTGATCGTGAAC GAGCCTGCCGCTAGAGCCGCTCTGAGAAGAGGTGTTGGACTGGCCCCTGAGGACCCCAGAATGCTGGCTGCTCATAGAGTGGTGG CCCCTTACGTGCCAGTGCCTACCGACTACGATGTGGATCGGAGAAGGGCTGCCAGCCTGTGGGATGTGCATGCTGTGGAAAGGGC CTTTTATGCCGTGGCCGCCATTATGGCCGCTCAGCCTAGAAGCGCCAGAGATCAAGAAGCCGAGGCCACCGAAGAACAGACAGGC Attorney Docket No. UM-41218.601 GAGCCTCAGGATAGCGAGGCCCTGACAGAACCTACACCAGCCGAAGAGAGCAGCGCCACCAAGGATGGCAAGCCCGATAGAAGGC CTAACCTGGGAGTGTCTCTGGCCCAGGCCGTGTTTGACAAGGGCCTGAATGCCGATAGCACCGAGCAGAGACTGCACCTGATCGC CAGACAGAATCTGGACGGCGTGCACAGACATCTGCCCAGACTGGTGCTGTACCTGAGAAGCGACCAGGTGCACATCGACTGGGGC ATCCTGATCAGAGATCTGGCTAGATGGGGCCACACACCTAGACACGTGGCCAGAGAATGGGTGCAAGACTACCACAGAACCCTGG AAACCCTGACCAGACAGGCCGAACAGAAGAACAAGAACAACACCACCGACGAGGAAGCCGAAGCCGCTTAA >Tfu-IE-CRISPR repeat (SEQ ID NO: 201) GTGAGCCCCACGCACGTGGGGATGGACCG >human codon optimized Pae-cas5 with NLS and HA tag (SEQ ID NO: 202) ATGAGCGTGACCGATCCTGAAGCTCTGCTGCTGCTCCCCAGACTGAGCATCCAGAACGCCAACGCCATCAGCAGCCCTCTGACAT GGGGATTTCCAAGTCCTGGCGCCTTCACCGGATTTGTGCACGCCCTGCAGAGAAGAGTGGGCATCAGCCTGGACATCGAGCTGGA TGGCGTGGGCATCGTGTGCCACAGATTTGAGGCCCAGATCTCTCAGCCTGCCGGCAAGAGAACAAAGGTGTTCAACCTGACCAGA AATCCCCTGAACCGCGACGGATCTACAGCCGCCATTGTGGAAGAAGGCAGAGCCCACCTGGAAGTGTCACTGCTGCTTGGAGTTC ACGGCGACGGCCTGGATGATCACCCTGCTCAAGAGATCGCCAGACAGGTGCAAGAACAGGCTGGCGCCATGAGACTTGCCGGCGG ATCTATTCTGCCCTGGTGCAACGAGAGATTCCCCGCTCCTAATGCCGAACTGCTGATGCTCGGAGGCTCCGATGAACAGCGGAGA AAGAACCAGCGGAGACTGACCCGTAGACTGCTGCCTGGATTTGCTCTGGTGTCCAGAGAAGCCCTGCTCCAGCAGCACCTGGAAA CCCTGAGAACCACACTGCCTGAGGCCACCACACTGGATGCACTGCTGGACCTGTGCCGGATCAACTTTGAGCCTCCTGCCACCAG CAGCGAGGAAGAAGCCTCTCCTCCTGACGCTGCTTGGCAAGTGCGAGATAAGCCTGGATGGCTGGTGCCTATTCCTGCCGGCTAC AATGCCCTGTCTCCTCTGTATCTGCCTGGCGAAGTGCGGAACGCCAGAGACAGAGAGACACCCCTGAGATTCGTGGAAAACCTGT TCGGCCTCGGCGAGTGGCTGTCTCCACATAGAGTTGCCGCTCTGAGCGACCTGCTGTGGTATCACCATGCCGAGCCTGACAAGGG CCTGTACAGATGGTCTACCCCACGCTTCGTGGAACACGCCATTGCCGGCTCTGTGGGCTACCCCTACGATGTGCCTGATTACGCC GGCAGCTACCCTGAGTTCCCCAAGAAAAAGCGGAAAGTGTGA >human codon optimized Pae-cas6-tadA* with NLS and HA tag (SEQ ID NO: 203) ATGGACCACTACCTGGACATCAGACTGCGGCCCGATCCTGAGTTTCCTCCAGCTCAGCTGATGAGCGTGCTGTTCGGCAAACTGC ATCAGGCCCTGGTTGCCCAAGGCGGCGATAGAATCGGAGTGTCATTCCCCGACCTGGACGAGAGCAGATCTAGACTGGGCGAGAG ACTGAGAATCCACGCCAGCGCCGATGATCTGAGAGCCCTGCTTGCTAGACCTTGGCTGGAAGGCCTGAGGGACCATCTGCAGTTT GGAGAACCTGCCGTGGTGCCCCATCCTACACCTTACAGACAGGTGTCCAGAGTGCAGGCCAAGAGCAACCCCGAAAGACTGCGGA GAAGGCTGATGCGGAGACACGACCTGTCTGAGGAAGAGGCCCGGAAGAGAATCCCCGACACAGTGGCTAGAGCCCTGGACCTGCC TTTCGTGACACTGAGAAGCCAGAGCACCGGCCAGCACTTCCGGCTGTTTATCAGACACGGCCCTCTGCAAGTGACCGCCGAAGAA GGCGGCTTTACCTGTTACGGCCTGAGCAAAGGCGGATTCGTGCCCTGGTTTGGCTCTGTGGGCTACCCCTACGATGTGCCTGATT ACGCCGGCAGCTACCCTGAGTTCCCCAAGAAAAAGCGGAAAGTGTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACC TGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGcGGGTCATCTGAGGTGGAGTTTTCCCACGAGTACTGG ATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAG TGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGCCT GGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCCAC TCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCG Attorney Docket No. UM-41218.601 GCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAG ACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAACTGA >human codon optimized Pae-cas7 with NLS and HA tag (SEQ ID NO: 204) ATGAGCAAGCCCATCCTGAGCACAGCCAGCGTGCTGGCCTTTGAGAGAAAGCTGGACCCCTCTGACGCCCTGATGTCTGCTGGTG CTTGGGCTCAGAGGGATGCCTCTCAAGAATGGCCTGCTGTGACCGTGCGGGAAAAGTCTGTGCGGGGCACCATCAGCAACCGGCT GAAAACAAAGGACAGGGACCCCGCCAAACTGGACGCCTCTATCCAGTCTCCTAACCTGCAGACCGTGGACGTGGCCAATCTGCCT TCCGATGCCGACACACTGAAAGTGCGGTTCACCCTGAGAGTGCTCGGCGGAGCTGGAACACCTAGCGCCTGTAATGATGCCGCCT ACCGGGATAAGCTGCTGCAGACAGTGGCCACCTACGTGAACGATCAGGGCTTTGCCGAGCTGGCCAGAAGATACGCCCACAACCT GGCCAACGCCAGATTCCTGTGGCGGAATAGAGTGGGAGCCGAGGCTGTGGAAGTGCGGATCAACCACATCAGACAGGGCGAAGTG GCCAGAGCTTGGAGATTTGATGCCCTGGCCATCGGCCTGAGAGACTTTAAGGCCGACGCCGAACTGGATGCTCTGGCCGAACTGA TTGCCAGCGGCCTGTCTGGATCTGGACACGTGCTGCTGGAAGTGGTGGCCTTTGCCAGAATCGGCGACGGCCAAGAAGTGTTCCC TAGCCAAGAGCTGATCCTGGACAAGGGCGACAAGAAGGGCCAGAAGTCTAAGACCCTGTACAGCGTGCGGGATGCCGCCGCTATT CACTCTCAGAAGATCGGAAACGCCCTGCGGACCATCGACACCTGGTATCCCGATGAGGATGGCCTGGGACCTATCGCCGTGGAAC CTTACGGCAGCGTGACATCTCAGGGCAAAGCCTACAGACAGCCTAAGCAGAAGCTGGACTTCTACACCCTGCTGGACAACTGGGT GCTGAGAGATGAAGCCCCTGCTGTGGAACAGCAGCACTACGTGATCGCCAACCTGATCAGAGGCGGCGTGTTCGGAGAGGCCGAG GAAAAAGGCTCTGTGGGCTACCCCTACGATGTGCCTGATTACGCCGGCAGCTACCCTGAGTTCCCCAAGAAAAAGCGGAAAGTGT GA >human codon optimized Pae-cas8 with NLS and HA tag (SEQ ID NO: 205) ATGACAAGCCCTCTGCCTACACCTACCTGGCAAGAGCTGCGGCAGTTCATCGAGAGCTTCATCCAAGAGCGGCTGCAGGGCAAGC TGGACAAGCTGCAGCCTGACGAGGACGACAAGAGACAGACACTGCTGGCCACACACAGAAGAGAAGCCTGGCTGGCCGATGCCGC TAGAAGAGTTGGACAGCTCCAGCTGGTCACCCACACACTGAAGCCTATTCACCCCGATGCCAGAGGCAGCAACCTGCATTCTCTG CCTCAAGCTCCAGGCCAGCCTGGACTGGCTGGATCTCATGAGCTGGGCGATAGACTGGTGTCCGACGTGGTGGGAAATGCCGCTG CTCTGGACGTGTTCAAGTTCCTGAGCCTGCAGTACCAGGGCAAGAACCTGCTGAACTGGCTGACCGAGGATAGCGCCGAAGCTCT GCAGGCCCTGTCTGATAATGCCGAGCAGGCTAGAGAATGGCGGCAGGCCTTTATCGGCATCACCACAGTGAAAGGCGCCCCTGCC TCTCACTCTCTGGCCAAGCAGCTGTACTTTCCCCTGCCTGGCTCTGGCTACCATCTGCTGGCTCCTCTGTTTCCCACAAGCCTGG TGCATCATGTGCACGCCCTGCTGAGAGAGGCCAGATTTGGCGACGCTGCCAAAGCCGCCAGAGAAGCCAGAAGCAGACAAGAGTC TTGGCCCCACGGCTTCAGCGAGTACCCTAATCTGGCCATCCAGAAGTTCGGCGGCACCAAGCCTCAGAACATCAGCCAGCTGAAC AACGAGCGGAGAGGCGAGAATTGGCTGCTGCCAAGCCTGCCTCCTAACTGGCAGAGACAGAACGTGAACGCCCCTATGAGACACA GCAGCGTGTTCGAGCACGACTTCGGCAGAACACCCGAGGTGTCCAGACTGACAAGAACCCTGCAGAGATTCCTGGCCAAGACCGT GCACAACAACCTGGCCATCAGACAGAGAAGGGCCCAGCTGGTGGCCCAGATTTGTGATGAGGCCCTGCAGTATGCCGCCAGACTG AGAGAATTGGAGCCAGGCTGGAGCGCCACACCTGGTTGTCAACTGCATGACGCCGAACAGCTGTGGCTGGACCCTCTGAGAGCCC AGACCGATGAGACATTCCTGCAGCGAAGGCTGAGAGGCGATTGGCCAGCCGAAGTGGGCAACAGATTTGCTAATTGGCTGAACCG GGCCGTGTCCAGCGATTCTCAGATCCTGGGATCTCCTGAGGCCGCTCAGTGGTCCCAAGAGCTGAGCAAAGAACTGACCATGTTC AAAGAGATTCTCGAGGACGAGCGGGACGGCTCTGTGGGCTACCCCTACGATGTGCCTGATTACGCCGGCAGCTACCCTGAGTTCC CCAAGAAAAAGCGGAAAGTGTGA Attorney Docket No. UM-41218.601 >human codon optimized Pae-cas2-cas3 nickase (K426A) with NLS and HA tag (SEQ ID NO: 206) ATGAACATCCTGCTGGTGTCCCAGTGCGAGAAGAGAGCCCTGAGCGAGACAAGACGGATCCTGGATCAGTTCGCCGAGCGGAGAG GCGAGAGAACATGGCAGACACCTATCACACAGGCCGGACTGGACACCCTGCGGAGACTGCTGAAGAAGTCCGCCAGACGGAATAC CGCCGTGGCCTGTCACTGGATCAGAGGCAGAGATCACTCCGAGCTGCTGTGGATCGTGGGCGACGCCTCTAGATTCAATGCTCAG GGCGCCGTGCCTACCAACAGAACCTGCAGAGACATCCTGCGGAAAGAGGACGAGAACGACTGGCACAGCGCCGAGGATATCAGGC TGCTGACAGTGATGGCCGCTCTGTTCCACGATATCGGCAAAGCCAGCCAGGCCTTCCAGGCCAAGCTGAGAAATAGAGGCAAGCC CATGGCCGACGCCTACAGACATGAATGGGTGTCCCTGAGACTGTTCGAGGCCTTTGTTGGCCCTGGCAGCTCCGATGAAGATTGG CTGAGAAGGCTGGCCGACAAGAGAGAAACAGGCGACGCTTGGCTGTCTCAGCTGGCCAGAGATGACAGACAGTCTGCCCCTCCTG GACCTTTCCAGAAGTCCAGATTGCCTCCTCTGGCTCAGGCCGTTGGCTGGCTGATTGTGTCTCACCACAGACTGCCCAACGGCGA CCATAGAGGCTCTGCTTCTCTGGCTAGACTGCCCGCTCCTATCCAGTCTCAGTGGTGCGGAGCTAGAGATGCCGACGCCAAAGAG AAAGCCGCCTGCTGGCAGTTTCCTCACGGCCTGCCTTTTGCCAGCGCTCATTGGAGAGCCAGAACAGCCCTGTGTGCCCAGAGCA TGCTGGAAAGACCTGGACTGCTGGCTAGAGGCCCTGCTCTGCTGCACGATAGCTACGTGATGCACGTGTCCCGGCTGATCCTGAT GCTGGCCGATCACCACTACTCTAGCCTGCCTGCCGATAGCAGACTGGGCGACCCTAATTTTCCCCTGCACGCCAACACCGACAGA GACAGCGGAAAGCTGAAGCAGCGGCTGGACGAACATCTGCTTGGAGTGGCCCTGCACTCCAGAAAGCTGGCTGGAACACTGCCCA GACTGGAACGCCAACTGCCTAGGCTGGCAAGACACAAGGGCTTCACCAGAAGAGTGGAACAGCCCCGGTTCCGGTGGCAGGATAA GGCCTATGATTGCGCCATGGCCTGTAGAGAACAGGCTATGGAACACGGCTTCTTCGGCCTGAATCTGGCCTCTACCGGATGCGGC gcAACCCTGGCCAATGGCAGAATCCTGTACGCCCTGGCTGACCCTCAAAGAGGCGCCAGATTTTCTATCGCCCTGGGCCTGAGAA GCCTGACACTGCAGACAGGCCAGGCCTACAGAGAGAGACTCGGCCTGGGAGATGACGACCTGGCCATTCTCGTTGGAGGATCTGC CGCCAGAGAGCTGTTTGAGAAGCAGCAAGAGAGACTGGAAAGATCCGGCAGCGAGAGCGCCCAAGAACTGCTCGCCGAAAATTCC CACGTGCACTTCGCCGGCACACTGGAAGATGGACCTCTGAGAGAGTGGCTGGGCAGAAACAGCGCCGGCAATAGACTGCTGCAGG CCCCTATTCTGGCCTGCACCATCGATCATCTGATGCCCGCCAGCGAGTCTCTGAGAGGCGGACATCAAATTGCCCCTCTGCTGCG GCTGATGACCAGCGATCTGGTGCTGGATGAGGTGGACGACTTCGACATCGACGACCTGCCTGCTCTGTCCAGACTGGTGCATTGG GCTGGCCTGTTTGGCAGCAGAGTGCTGCTGTCTAGCGCCACACTTCCTCCAGCTCTGGTGCAGGGACTGTTTGAAGCCTACAGAA GCGGCAGAGAGATCTTCCAGAGACACAGAGGCGCTCCAGGCAGAGCCACCGAGATTAGATGCGCTTGGTTTGACGAGTTCAGCAG CCAGTCTAGCGCACATGGCGCCGTGACAAGCTTTTCTGAAGCCCACGCCACCTTCGTGGCCCAGAGACTGGCTAAACTCGAGCAG CTGCCACCTCGGAGACAGGCCCAACTGTGTACAGTTCATGCCGCTGGCGAAGCCAGACCTGCACTGTGCAGAGAACTGGCCGGAC AGATGAACACCTGGATGGCCGATCTGCACAGATGCCACCACACCGAGCACCAGGGCAGAAGAATCTCTTTCGGCCTGCTGAGGCT GGCCAACATCGAGCCTCTGATTGAACTGGCCCAGGCCATCCTTGCTCAAGGCGCTCCTGAAGGACTGCATGTGCACCTGTGCGTG TACCACAGCAGACACCCTCTGCTCGTCAGAAGCGCCATCGAGAGACAGCTGGACGAGCTGCTCAAGAGAAGCGACGATGATGCCG CCGCACTGTTCGCCAGACCAACACTTGCTAAAGCCCTGCAGGCCTCCACCGAGAGGGATCACCTGTTTGTGGTGCTGGCCTCTCC TGTGGCCGAAGTGGGAAGAGATCACGACTACGACTGGGCCATTGTGGAACCCAGCAGCATGCGGAGCATCATCCAGCTGGCCGGC AGAATCAGAAGGCACAGATCTGGCTTTAGCGGCGAGGCCAACCTGTACCTGCTGAGCCGGAATATCAGATCCCTGGAAGGACAGA ACCCCGCCTTTCAGAGGCCCGGCTTTGAGACACCTGACTTCCCACTGGACTCCCACGACCTGCACGATCTGCTTGATCCAGCTCT CCTGGCCAGAATCGACGCTAGCCCCAGAATCGTCGAGCCCTTTCCACTGTTCCCTAGAAGCAGGCTGGTGGACCTGGAACACAGA CGGCTGAGAGCCCTCATGCTGGCTGACGATCCTCCATCTTCTCTGCTGGGAGTGCCACTCTGGTGGCAGACTCCAGCTTCTTTGT CTGGCGCCCTGCAGACCAGCCAGCCTTTTAGAGCTGGCGCCAAAGAACGGTGCTACGCCCTGCTGCCAGACGAGGACGATGAGGA AAGACTGCACTTCAGCAGATACGAGGAAGGCACCTGGTCCAACCAGGACAACCTGCTGCGGAACCTGGACCTGACATACGGCCCT Attorney Docket No. UM-41218.601 AGAATCCAGACCTGGGGCACCGTGAACTACCGCGAAGAACTGGTGGCCATGGCTGGCAGAGAGGACCTGGATCTGAGACAGTGCG CCATGAGATACGGGGAAGTGCGGCTGCGCGAGAATACCCAAGGCTGGTCTTATCACCCCTACCTGGGCTTCAAGAAGTACAACCT GGGCTCTGTGGGCTACCCCTACGATGTGCCTGATTACGCCGGCAGCTACCCTGAGTTCCCCAAGAAAAAGCGGAAAGTGTGA >human codon optimized Nla-cas11-tadCBE fusion with NLS and HA tag (SEQ ID NO: 207) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAGGCCTCGACCGGAACAGAC AGGATATCGGCTATGTGCTGGGCAGACTGTTCGCCGTGCTGGAAAAGATTCAGGCCGAGGCCAATCCTGGCCTGAACGCCACAAT CGCCGACAGATATTTTGGCAGCGCCAGCAGCACACCTATCGCCGTGTTTGGCACCCTGATGAGACTGCTGCCTCACCACCTGAAC AAGCTGGAATTCGAGGGCAGAGCCGTGCAGCTCCAGTGGGAGATCAGACAGATCCTGGAACACTGCCAGCGGTTCCCCAATCACC TGAACCTGGAACAGCAGGGACTGTTTGCCATCGGCTACTACCACGAGACACAGTTTCTGTTCACCAAGGACGCCCTGAAGAACCT GTTCAACGAGGCCAAGACCGCCTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACA CCTGAAAGCAGCGGGGGCAGCAGCGGCGGGTCATCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCCCTGACCCTGG CCAAGAGGGCACGGGATGAGAGGAAGGCGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAG AGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATAGCCCTGAGACAGGGCGGCCTGGTCATGCAGAACTACAGACTG ATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCAACTCTAGGATCGGCCGCGTGGTGT TTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCGGAATGAATCACCGCGTCGAAAT TACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAATGCTCAGAAG AAGGCCCAGAGCTCCATCAACTGA > human codon optimized Nla-cas5-MPGv3 fusion with NLS and HA tag (SEQ ID NO: 208) ATGCGGTTCATCCTGGAAATCAGCGGCGACCTGGCCTGCTTCACAAGAAGCGAGCTGAAGGTCGAGCGGGTGTCATACCCTGTGA TCACCCCTAGCGCCGCCAGAAACATCCTGATGGCCATTCTGTGGAAGCCCGCCATCAGATGGAAGGTGCTGAAGATCGAGATCCT GAAGCCTATCCAGTGGACCAACATCCGGCGGAACGAAGTGGGCACCAAGATGAGCGAGAGAAGCGGCAGCCTGTACATCGAGGAC AACAGACAGCAGCGGGCCTCCATGCTGCTGAAGGATGTGGCCTATAGAATCCACGCCGACTTCGACATGACAAGCGAGGCCGGCG AGAGCGACAACTACGTGAAGTTCGCCGAGATGTTCAAGCGGAGAGCCAAGAAGGGCCAGTACTTCCACCAGCCTTACCTGGGCTG CAGAGAGTTCCCCTGCGACTTCAGACTGCTGGAAAAGGCCGAGGATGGCCTGCCTCTGGAAGATATCACCCAGGACTTCGGCTTC ATGCTGTACGACATGGACTTCAGCAAGAGCGACCCCAGAGACAGCAACAACGCCGAGCCTATGTTCTACCAGTGCAAGGCCGTGA ACGGCGTGATCACTGTGCCTCCAGCCGATAGCGAGGAAGTGAAGAGAGGCAGCGTCGGCTACCCCTACGATGTGCCTGATTACGC CCCCAAGAAAAAGCGGAAAGTGTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACA CCTGAAAGCAGCGGGGGCAGCAGCGGCGGGTCAGTCACCCCCGCTTTGCAGATGAAGAAACCAAAGCAGTTTTGCCGACGGATGG GGCAAAAGAAGCAGCGACCAGCTAGAGCAGGGCAGCCACACAGCTCGTCCGACGCAGCCCAGGCACCTGCAGAGCAGCCACACAG CTCGTCCGATGCAGCCCAGGCACCTTGCCCCAGGGAGCGCTGCTTGGGACCGCCCACCACTCCGGGCCCATACCGCAGCATCTAT TTCTCAAGCCCAAAGGGCCACCTTACCCGACTGGGGTTGGAGTTCTTCGACCAGCCGGCAGTCCCCCTGGCCCGGGCATTTCTGG GACAGGTCCTAGTCCGGCGACTTCCTAATGGCACAGAACTCCGAGGCCGCATCGTGGAGACCGAGGCATACCTGGGGCCAGAGGA TGAAGCCGCCCACTCAAGGGGTGGCCGGCAGACCCCCCGCAACCGAGGCATGTTCATGAAGCCGGGGACCCTGTACGTGTACATC ATTTACAGAATGTACTTCTGCATGAGCATCTCCAGCCAGGGGGACGGGGCTTGCGTCTTGCTGCGAGCACTGGAGCCCCTGGAAG GTCTGGAGACCATGCGTCAGCTTCGCGCCACCCTCCGGGCCGCCACCGCCGCCCGTGTCCTCGCCGACCGCGAGCTCTGCAGTGG Attorney Docket No. UM-41218.601 CCCCTCCAAGCTGTGCCAGGCCCTGGCCATCAACAAGAGCTTTGACCAGAGGGACCTGGCACAGGATGAAGCTGTATGGCTGGAG CGTGGTCCCCTGGAGCCCAGTGAGCCGGCTGTAGTGGCAGCAGCCCGGGTGGGCGTCGGCCATGCAGGGGAGTGGGCCCGGAAAC CCCTCCGCTTCTATGTCCGGGGCAGCCCCTGGGTCAGTGTGGTCGACAGAGTGGCTGAGCAGGACACACAGGCCTCTGGCGGCTC AAAAAGAACCGCCGACGGCAGCGAATTCGAGCCCAAGAAGAAGAGGAAAGTCTAA >human codon optimized Tsu-cas8 with NLS and HA tag (SEQ ID NO: 209) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAGACAAGGACATGCACATCA ACGAGATCGTGCTGAGAGGCTGCGCCCCTACACCTCTGGCCGCTTATCTTAAAGCCCTGGGCGTGCTGAGGCTCGTGTGTGAACA AGTGGATGCCACCGCCAAAGGCTGGTGGCAGGATGAGTGCTTCATGCTGAGAACCCGGCTGGACGACAACGACCTGCGGAGATTC TTCATCGAGGACTACAGACCCACACCTATGCTGAGCCCTTGGAATGGCGGCAGCGGCTTCTACAGAAAGGGCAACGAAACCGCCT GGTCTACCCTGGAAAAGATCATCACCACACAGGCCGAGAGATGGCGGCCCTTTAGAGATACCGCCGAAGTGATGGCCGACGCTCT GGAACACCTGAAGCTGACAGAGAAGCCCGCCGAGCTGGATAAGAGAGCCCTGCTGGCTAGACTGAGAGCAACCCTGGACGACGAG TTCCTGCCTTGGCTGGATGCTGCTGTGCTGCTGACCGACGACAAGCCTGATTACCCTCCACTGCTCGGCACCGGCGGAAATGATG GCAGACTGGACTTCACCAGCAACTACATGCAGCGGCTGCTGGAAATGTTCGACCCCGTGACAGGCAAAGCTCAGGGCGACGTGGG AAACAAGCTGGAAAGCGCCCTGTTCGCCAGACCTGTGCCTGGAATGACAGCCCTGGCCATCGGACAGTTTTCTCCAGGTGCTGCC GGCGGACCTAATAGCAGCACCGGATTTGATTCTGGCGCCCAAGTGAACATCTGGGACTACGTGCTGATGCTGGAAGGGGCCCTGC TGTTTGCCGCCACAGCTACAAGACGGCTGGAATCCGCTGATCCCAGCGCTCTGAGCTACCCTTTTACAGTGCGACCTAGCGGCGG AGGATCTGGTGCTGTTGCTCTTGGCGACGAAAGACCTGCCAGAGCCGAGATCTGGATGCCCCTGTGGGAAAGACCAGCCTCTCTG CCTGAACTGAGAGTGCTGCTCGGAGAGGGCAGAGTGACCCTGAATGGAAGGCTGCCTAGAGATGGCCTGGATTTCGCTAGAGCCG TGGCCAAGCTGGGCACAGATAGAGGCGTTAGAGCCTTCCAGAGATACGCCTTCATGATGCGGAGCGGCAAGGCCTATCTGGCCAC ACCTCTGAACAGATTCCACGTGCACAGAAACCCCAAGGCCGACCTGATCGACCAGCTCGAAAGAGGCGACTGGCTGAGAAGATTC CGCAGAGCCGCCAGATCTACACACGCCCCTGCTAGACTGCAAGGACTGGCCCACAGACTGGATGACGCCCTGTTTGACCTCGTCA GAGTGGCCGATCCTCGGAGAGTGCAAGAGGTGCTGAAGGTGCTGGGCGAAGTGCAGTTCTACCTGGCTCTGAGCCCCAGCCTGAG AGAACAAGTTCGGCCAGTGCCTAGACTGGACGCCCACTGGGTTGAAGCCGCTAGAGATGACAGCCACGAGTTTAGAGTGGCTGCC GCTCTGGCTGGACTGGACGATGGACTTCCTATGGGAGTGCATCTGGCCCCTATCGACCCTGTGAAGAGAAACGTGTGGGCCCCTG AAAGCAGACTGGCTGTTTGGGGCCAGGGCAACCTGAGCGATAATCTGGCTCAGGTCCTGCAGCGGAGACTGCTGACAGCCAGCAG AACCGACCTGAACGATAAGCCCCTGAGCGGCAGATGTCCTGCCGATGAAGGTGCCGTGGCTGCTTTTCTTGCTGGCGACGCCGAC GAGAGAAGAATTGCCGAACTTATGGCCGGCCTGGCCTGTGCAAGACTGCCAGCTAGACTTCCCCTGAGACAGAGAGGCGCTAGCG AGGCTTCTAGCCTGCCTATGATCTACGCCCTGCTGAAGCCTCTGTTCGTGCCCGATGCACAGCTGAGAGAAGCTGGGGTGCTGAC CCCTGATGGATGTTTGCCTTTGCCTCCTGCTCTGCCCCGACTGCTTAGAGCTGGACCTGCTGGTGTTGGCAGAGCTGTGGATCTG GCTAGAAGAAGGCGGAGAGCCTCTGGCCTTGCAGATGCTGGATGGCGACTGACCCCTCCATATCCTGATGGCGGAAGGCTTCTGG CTGCCCTGATGATCCCCGTGGAAATCAGAGTGATCAAGGGCTTCATCAAGCGGCTGGCCGACCACAAGAGTGACGAACCTGCTAC ACAGGACGCCAGCTGA >human codon optimized Tsu-cas7 with NLS and HA tag(SEQ ID NO: 210) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAAAGCTGGAACCCCTGCTGA GCGACGTGCCCAGACTGCTGATGGAAGCTGATCTGGTGCCAGTGCAGGGCACAAGATTCCAGCCTACCGGCTTTCCTGATCTGGG CGCTGCCCACTATGAGGGCCCTGATGGTAGACCTATGCTGCTGGTGGAAAGCGCCCAGTCCATGGCCAACAGACTGGAAACCGTG TGCTGGGACAAAGACGCCGACGATTGGGTCGTGCCTCTGAGAGGACTGCCTGTGGTCAAGGTGCTGGATAAGGCCGGCAAGCCCC Attorney Docket No. UM-41218.601 TGACCAATTCTGTGCTGGAAGCCCACAGACTGAACAGCCCCTACATCCTGGAAGGCAAGGACAAGACCCTGTTCGACCTGCTGAA GCAAGAGCTGGCCCACATGGAAGAGGGCCCCGTGGATATCAGAAAGCTGGCCGAGACACTGCTGAAGGTGGACGCTAATGCTGTG CTGCACGGCGTGTTCCTCGCCAAGAAAGAACTTGCTGGCGGCAGACTGAGACTGCCCAGAGCACTGTCTGCCTTCATCGAGGCTG AGGATGTGCGCGTGGCATCTTCTGGCGGCGTGAAGAACGATCACGTGAACCCTAGCGGCGACACCAGCAGAGGCTTTGGCAATGT GCCCTTCGCCAGGGACGAGTACGTGTCCCCTAGAATCAAGGCCTACTTCAACCTGGACCTGGCTCAGATCAGAGCCTTCGGCCTG GGAGAACAGGTGGACAGGCTGCTGATTGCCCTGGCTCTGTACAAAGTGCGGCGGTTTCTGGTGCACGGCCTGAGACTGAGAACCG CCTGCGATCTGGATTGTCAGGCCCTGAGAGTGACCAGACCTGAAGGCTGGGAAGTGCCTGAGCTGAGCGAACTGGAAGCTGCACT GCCTGGCCTGATTGAAGCTGTGGCTGGCGAGGGCAGATTTGCTCAGCCTGCCGTGACCATCGTGACCTACGAGAAATGA >human codon optimized Tsu-csb2 with NLS and HA tag (SEQ ID NO: 211) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGACTGGCCGTGGCCTGTAGAT TCACCGCCGGCAGATTTCACGCCACACCTTGGGGCAGACACGTGAACGAAGCCGACGTTGAGTGGCCTCCTTCTCCTTGGCGGTT TCTGAGAGCCCTGATCGCCACCTGGCACAGAAAACACGATCCCGGCGAGTTCCCTGAGGCCAGACTTGAGGCTCTGGTCAATGCT CTGAGCGGAGTGGCCCCTGTGTACAGACTGCCTGATGCCGTGCACGCCCACACCAGACACTACATGCCTGTCAGAGAGGGCAGAG CCGACAAGAGCGTGCTGGTGTTCGATGCCTTCCTGAGAATCGACCCCGACGAGGAACTGATCATTGCCTGGCCTGATCTGGACCC CGATCCTGAGCTGCTGGGATCTCTGGATGCCCTGATGCGGGACCTGAACTTCTTCGGCAGAGTGGAAAGCTGGATCGAGTGCAGA AGGCTCGAAGGCTGGAACCCCGAGGACGCCAATTGCAGACCTGGCAACCTGGCCGTGAATCCTGCCACAGGCGAGACAAGCGAGC CTGTGCGACTGATCGTGCCTAGATCTGCCGCCGATTATGCCCAGTGGCAGCAGCAGACAGTGGAAGATCTGCGGCTGGAAAAGCT GGCCAAGCAGAAAAGACTGTCCGTGCTGGCCACACTGCCCGAGAGACTGATCGATGCACTGAGACTGGAAACCGGCGATATCCAG AGAGCCGGCTGGTCACTTGCTCCAGGCGCTACAGAAGTGCTGTACCAAAGACCTCAGGGCGCTCTGGGAGTTAGAAGGCGGAGAG TGCCTGAGTGGCACCGGACCAGCAGAATCACCACAGCCAGATTTGCCCTGGCCGGCAGACCTCTGCCTCGCGTGGAAGATACAGT TAGAGTGGCCGAGCGGATGAGAGCCGCTCTGATGTCTAGAGCCAAGCGGAGATTCGGCGAGAGCGACATTCCTGCTCAGCTGTCT GGACACGGCCTGCCTCCAGATAATAGACACGCCCACGCATTCTTTCTGCCCGAGGGCAACGACAAGGGCAGAATTGACCACGTGA TCGTGCATGCCGAGGCCGGCTTTCCACAAGAGATGCTGAAGGTGTTCGAGGACCTGCCAATCCTGAGAGGCCAGGATGGCTCTCA GTGGCAGGTTGCCCTGGAATCTGTTGGCGGCAGAGAGGACGAAAGACACTGGCAGGCCATCCAGTCCGCCATTCCAGCTCTGGGA CATGCCACAGTGTGGGTCACCAGAACACCCTATCTGCACCCTTGGCACGCCAAGAAAGGCTTCGGCTACGTGGAACAGATCCGCA GAGAGTGTAGAGAGCGGGGCCTGCCTATTCCTAGCCAAGTGGATCTGCTGCCTGAGATCCCTGTTGGCTCCGGCAGATCCTGTAG ACCCGTGCAGTTCCACCGGTTCCGGACCAAAAGAGGACTGCCCCAGCCTGATACACACGGCGCCTTTGTGCGGCTGACCTTTCCT CAGCCTGTGTCTGGACCTCTGGCTCTCGGCTTTGGCTGTCACTATGGCCTGGGACTGTTTGCCCCTAGCCACGATTCTGAGTGA >human codon optimized Tsu-cas3 nickase (K39A) with NLS and HA tag (SEQ ID NO: 212) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAAAGTACGCCGACTTCTTCA ATCAAGCCGCCGGATTCGAGCCCTTTCCATACCAAGCCAGACTGGCCGAAGCTCCCTGGCCTGATACACTGGATGTGCCTACAGG CCTGGGCgccACAGCTGCTGTTACACTGGCCTGGCTGTACAAGCGGCGCGAGCAGAGAGATGAGGCCACACCTAGACGGCTGATC TGGTGCCTGCCTATGAGAGTGCTGGTGGAACAGACCTGCCGGAACATCGAACACTGGCTGCAGAGACTGAACCTGCACGGATTGC CTGGCGAGGGCAAAGTGTCTGTGCATCTGCTTATGGGCGGCGAGGATGATGTGCGGGCTGCTACATGGGCCGAGCATCCCGAAGA GGACATGATCCTCGTGGGCACCCAGGACATGCTGCTGTCTAGAGCCCTGATGAGAGGCTACGGCATGAGCAGATACCAGTGGCCT ATGCACTTCGGCCTGCTGCACAATGATGCCCTGTGGGTGTTCGACGAGGTGCAGCTTATGGGACCTGGCCTGCAGACATCTGCCC Attorney Docket No. UM-41218.601 AGCTGGAAGCCCTGAGAAGAGATCTGGGCTGTGTGCGCCAGAGCAGATCACTGTGGGTTTCCGCCACACTGAACCCTGGCTGGCT GGGCACAGTTGACATGAGGCCCTGGATGGACAAGCTGGCCAGACATGCTCTGGACGCCCAAGAGTGTACCATGGACGCCGTCCGG GCTAGAAGAGAAGCCGTGAAGCACCTGGAATGCCTGCCTGTGTCTCTGGAAGGCGACAGCAAGACCTTCGTGCAGGCCTATGTGA CCGGCCTGGCCGAGAGAGTTATTCAGGCTCACGTGCCAGGCACCACCACACTGGTGGTGCTGAACACAGTGGAAAGAGCCCAGGG ACTCGCTCGGGCCCTGAAAGAAAGAACCGAGGACAGAGATCCCCTGCTGGTGCACGCTAGATTCAGAGCCAGAGAGCGGAGACTG CTGGAACAGGCTCTGGGAACACAGGTGCCACCTGAGGGAAGAATCGTGGTGGCCACACAGGCTGTGGAAGCTGGCGTGGACATGA CCAGCAGAACCCTGTTTACAGAGCTGGCCCCTTGGAGCAGCATGGTGCAGAGATTCGGCCGGTGCAACAGATACGGCGAGTACAA TGGCGACGGCGGAGCCAGAATCTACTGGATCGATCTGGACGACGCCGTGTCCGTGCCTTATGATGCTGAACAGCTGGCTCCCTCC AGAGAGAGACTGAGGGCTCTGACAAGCGCTAGCCCTGTGGATCTGCCTCCTACCAAAGAGACAGCCCCTGAGGCTATGGTGCTGC GGAGAAAGGATCTGCTGCAGCTGTTCGACACAGACCCCGATCTGAGCGGCTTTGACCTGGACGTGTCCCCTTACATCAGGGACGT GCGGGAAACCGATGTCCAGGTGTTCTGGCGGACCCTGAACCGGGATCAGAAAACCGCCAGCAGACTGGACGACATCCCCAGACCT CTGTCCAGAGAGCTGTGTAGAGCCAGCCTGAGCCAGATCAAGAGCTACCGGGACAAGAGAAAGGCCGGCAGAGTGTGGGCTTGGG ATGCCGTTATGGGAACATGGCAGAGCGTGTCCGACGCCATCAGACCTGGGATGACACTGCTGCTGGATGCTGAAGCCGGCGGATA CGATCCTGTGCTGGGATTTGATGCCGCTCACAAGGGCGACGTGGAAGTGATTCCTGTGCCTGCCGATCTGCCTGCTCCTGAGGCC TACTCTTCTGACGTTCGGAGCCTGCTGAGAAGGGCCGTGCCTCTGGATATGCACCTGAGAGATGTTGGACAGGCCGCTGGCGAAC TGTGCAGAGCACTGGAACTGGACGAGGTGTTCTCCAGAAGCGTGATCAGAGCCGCCAGATGGCACGATGTGGGAAAAGCCCACGA AGCCTTTCAGAACATGCTGAGGGCCGCCATGCAGGACCCTCAAGCTCGTAGAGCTGGACTGTGGGCCAAGTCCGATGGAATGGCC AGAGCTAGACCCGAGTACTTCGTCGAGAGAGATGGCCTGCAAGAGAAGCGGCCCCACTTCAGACATGAGCTGGCCTCTATGCTGG CTTGGCTGGAACATCACCCCGAGGAACCCGAGAGCAACCTGATCGCCTATCTGATCGCCGCACACCACGGCAAAGTTCGGATGGG ACTGAGAGCCCTGCAGCGGGAACAGCAGCCTAGAGATCCTGACCTGCTGTTTGCCAGAGGCGTGTGGGATGGGGATGCTCTGCCT CCAGTGCCTATTGATGAGGGCGAGAGCGTGCCACCTACCGTGCTGAGACTGGATCTGATGAGACTCGGCGACGGACCTCAGGGAC CTTCTTGGAGTGCCAGAACTCAGTCCCTGCTGAGCGAGCACGGACCCTTTAGACTTGCCTGGCTGGAAACACTTGTGCGGCTGGC CGATTGGAGAGCCTCCAGACTGGAACAAGCCGAAGGCGCCGAGCACACCGATGATGAGCCTAGCCAAGAGAATGGCCACGGCTGA >human codon optimized Tsu-cas8-tadA* with NLS and HA tag (SEQ ID NO: 213) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAGACAAGGACATGCACATCA ACGAGATCGTGCTGAGAGGCTGCGCCCCTACACCTCTGGCCGCTTATCTTAAAGCCCTGGGCGTGCTGAGGCTCGTGTGTGAACA AGTGGATGCCACCGCCAAAGGCTGGTGGCAGGATGAGTGCTTCATGCTGAGAACCCGGCTGGACGACAACGACCTGCGGAGATTC TTCATCGAGGACTACAGACCCACACCTATGCTGAGCCCTTGGAATGGCGGCAGCGGCTTCTACAGAAAGGGCAACGAAACCGCCT GGTCTACCCTGGAAAAGATCATCACCACACAGGCCGAGAGATGGCGGCCCTTTAGAGATACCGCCGAAGTGATGGCCGACGCTCT GGAACACCTGAAGCTGACAGAGAAGCCCGCCGAGCTGGATAAGAGAGCCCTGCTGGCTAGACTGAGAGCAACCCTGGACGACGAG TTCCTGCCTTGGCTGGATGCTGCTGTGCTGCTGACCGACGACAAGCCTGATTACCCTCCACTGCTCGGCACCGGCGGAAATGATG GCAGACTGGACTTCACCAGCAACTACATGCAGCGGCTGCTGGAAATGTTCGACCCCGTGACAGGCAAAGCTCAGGGCGACGTGGG AAACAAGCTGGAAAGCGCCCTGTTCGCCAGACCTGTGCCTGGAATGACAGCCCTGGCCATCGGACAGTTTTCTCCAGGTGCTGCC GGCGGACCTAATAGCAGCACCGGATTTGATTCTGGCGCCCAAGTGAACATCTGGGACTACGTGCTGATGCTGGAAGGGGCCCTGC TGTTTGCCGCCACAGCTACAAGACGGCTGGAATCCGCTGATCCCAGCGCTCTGAGCTACCCTTTTACAGTGCGACCTAGCGGCGG AGGATCTGGTGCTGTTGCTCTTGGCGACGAAAGACCTGCCAGAGCCGAGATCTGGATGCCCCTGTGGGAAAGACCAGCCTCTCTG CCTGAACTGAGAGTGCTGCTCGGAGAGGGCAGAGTGACCCTGAATGGAAGGCTGCCTAGAGATGGCCTGGATTTCGCTAGAGCCG Attorney Docket No. UM-41218.601 TGGCCAAGCTGGGCACAGATAGAGGCGTTAGAGCCTTCCAGAGATACGCCTTCATGATGCGGAGCGGCAAGGCCTATCTGGCCAC ACCTCTGAACAGATTCCACGTGCACAGAAACCCCAAGGCCGACCTGATCGACCAGCTCGAAAGAGGCGACTGGCTGAGAAGATTC CGCAGAGCCGCCAGATCTACACACGCCCCTGCTAGACTGCAAGGACTGGCCCACAGACTGGATGACGCCCTGTTTGACCTCGTCA GAGTGGCCGATCCTCGGAGAGTGCAAGAGGTGCTGAAGGTGCTGGGCGAAGTGCAGTTCTACCTGGCTCTGAGCCCCAGCCTGAG AGAACAAGTTCGGCCAGTGCCTAGACTGGACGCCCACTGGGTTGAAGCCGCTAGAGATGACAGCCACGAGTTTAGAGTGGCTGCC GCTCTGGCTGGACTGGACGATGGACTTCCTATGGGAGTGCATCTGGCCCCTATCGACCCTGTGAAGAGAAACGTGTGGGCCCCTG AAAGCAGACTGGCTGTTTGGGGCCAGGGCAACCTGAGCGATAATCTGGCTCAGGTCCTGCAGCGGAGACTGCTGACAGCCAGCAG AACCGACCTGAACGATAAGCCCCTGAGCGGCAGATGTCCTGCCGATGAAGGTGCCGTGGCTGCTTTTCTTGCTGGCGACGCCGAC GAGAGAAGAATTGCCGAACTTATGGCCGGCCTGGCCTGTGCAAGACTGCCAGCTAGACTTCCCCTGAGACAGAGAGGCGCTAGCG AGGCTTCTAGCCTGCCTATGATCTACGCCCTGCTGAAGCCTCTGTTCGTGCCCGATGCACAGCTGAGAGAAGCTGGGGTGCTGAC CCCTGATGGATGTTTGCCTTTGCCTCCTGCTCTGCCCCGACTGCTTAGAGCTGGACCTGCTGGTGTTGGCAGAGCTGTGGATCTG GCTAGAAGAAGGCGGAGAGCCTCTGGCCTTGCAGATGCTGGATGGCGACTGACCCCTCCATATCCTGATGGCGGAAGGCTTCTGG CTGCCCTGATGATCCCCGTGGAAATCAGAGTGATCAAGGGCTTCATCAAGCGGCTGGCCGACCACAAGAGTGACGAACCTGCTAC ACAGGACGCCAGCTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACACCTGAAAGC AGCGGGGGCAGCAGCGGcGGGTCATCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCCCTGACCCTGGCCAAGAGGG CACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAGAGCCATCGG CCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGCCTGGTCATGCAGAACTACAGACTGATTGACGCC ACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCCACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGA GGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCGGCATGAATCACCGCGTCGAAATTACCGAGGG AATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAATGCTCAGAAGAAGGCCCAG AGCTCCATCAACTGA >human codon optimized tadA*Tsu-cas8 with NLS and HA tag (SEQ ID NO: 214) ATGAAACGGACAGCCGACGGAAGCGAGTTCGAGTCACCAAAGAAGAAGCGGAAAGTCTCTGAGGTGGAGTTTTCCCACGAGTACT GGATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAG AGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGC CTGGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCC ACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCC CGGCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCT AGACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAACTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACAC CTGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGcGGGTCACCCAAGAAAAAGCGGAAGGTGTACCCCTA CGACGTGCCCGATTATGCCGGCTCTGTGGGAGACAAGGACATGCACATCAACGAGATCGTGCTGAGAGGCTGCGCCCCTACACCT CTGGCCGCTTATCTTAAAGCCCTGGGCGTGCTGAGGCTCGTGTGTGAACAAGTGGATGCCACCGCCAAAGGCTGGTGGCAGGATG AGTGCTTCATGCTGAGAACCCGGCTGGACGACAACGACCTGCGGAGATTCTTCATCGAGGACTACAGACCCACACCTATGCTGAG CCCTTGGAATGGCGGCAGCGGCTTCTACAGAAAGGGCAACGAAACCGCCTGGTCTACCCTGGAAAAGATCATCACCACACAGGCC GAGAGATGGCGGCCCTTTAGAGATACCGCCGAAGTGATGGCCGACGCTCTGGAACACCTGAAGCTGACAGAGAAGCCCGCCGAGC TGGATAAGAGAGCCCTGCTGGCTAGACTGAGAGCAACCCTGGACGACGAGTTCCTGCCTTGGCTGGATGCTGCTGTGCTGCTGAC CGACGACAAGCCTGATTACCCTCCACTGCTCGGCACCGGCGGAAATGATGGCAGACTGGACTTCACCAGCAACTACATGCAGCGG Attorney Docket No. UM-41218.601 CTGCTGGAAATGTTCGACCCCGTGACAGGCAAAGCTCAGGGCGACGTGGGAAACAAGCTGGAAAGCGCCCTGTTCGCCAGACCTG TGCCTGGAATGACAGCCCTGGCCATCGGACAGTTTTCTCCAGGTGCTGCCGGCGGACCTAATAGCAGCACCGGATTTGATTCTGG CGCCCAAGTGAACATCTGGGACTACGTGCTGATGCTGGAAGGGGCCCTGCTGTTTGCCGCCACAGCTACAAGACGGCTGGAATCC GCTGATCCCAGCGCTCTGAGCTACCCTTTTACAGTGCGACCTAGCGGCGGAGGATCTGGTGCTGTTGCTCTTGGCGACGAAAGAC CTGCCAGAGCCGAGATCTGGATGCCCCTGTGGGAAAGACCAGCCTCTCTGCCTGAACTGAGAGTGCTGCTCGGAGAGGGCAGAGT GACCCTGAATGGAAGGCTGCCTAGAGATGGCCTGGATTTCGCTAGAGCCGTGGCCAAGCTGGGCACAGATAGAGGCGTTAGAGCC TTCCAGAGATACGCCTTCATGATGCGGAGCGGCAAGGCCTATCTGGCCACACCTCTGAACAGATTCCACGTGCACAGAAACCCCA AGGCCGACCTGATCGACCAGCTCGAAAGAGGCGACTGGCTGAGAAGATTCCGCAGAGCCGCCAGATCTACACACGCCCCTGCTAG ACTGCAAGGACTGGCCCACAGACTGGATGACGCCCTGTTTGACCTCGTCAGAGTGGCCGATCCTCGGAGAGTGCAAGAGGTGCTG AAGGTGCTGGGCGAAGTGCAGTTCTACCTGGCTCTGAGCCCCAGCCTGAGAGAACAAGTTCGGCCAGTGCCTAGACTGGACGCCC ACTGGGTTGAAGCCGCTAGAGATGACAGCCACGAGTTTAGAGTGGCTGCCGCTCTGGCTGGACTGGACGATGGACTTCCTATGGG AGTGCATCTGGCCCCTATCGACCCTGTGAAGAGAAACGTGTGGGCCCCTGAAAGCAGACTGGCTGTTTGGGGCCAGGGCAACCTG AGCGATAATCTGGCTCAGGTCCTGCAGCGGAGACTGCTGACAGCCAGCAGAACCGACCTGAACGATAAGCCCCTGAGCGGCAGAT GTCCTGCCGATGAAGGTGCCGTGGCTGCTTTTCTTGCTGGCGACGCCGACGAGAGAAGAATTGCCGAACTTATGGCCGGCCTGGC CTGTGCAAGACTGCCAGCTAGACTTCCCCTGAGACAGAGAGGCGCTAGCGAGGCTTCTAGCCTGCCTATGATCTACGCCCTGCTG AAGCCTCTGTTCGTGCCCGATGCACAGCTGAGAGAAGCTGGGGTGCTGACCCCTGATGGATGTTTGCCTTTGCCTCCTGCTCTGC CCCGACTGCTTAGAGCTGGACCTGCTGGTGTTGGCAGAGCTGTGGATCTGGCTAGAAGAAGGCGGAGAGCCTCTGGCCTTGCAGA TGCTGGATGGCGACTGACCCCTCCATATCCTGATGGCGGAAGGCTTCTGGCTGCCCTGATGATCCCCGTGGAAATCAGAGTGATC AAGGGCTTCATCAAGCGGCTGGCCGACCACAAGAGTGACGAACCTGCTACACAGGACGCCAGCTGA >human codon optimized Tsu-cas7-tadA* with NLS and HA tag (SEQ ID NO: 215) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGAAAGCTGGAACCCCTGCTGA GCGACGTGCCCAGACTGCTGATGGAAGCTGATCTGGTGCCAGTGCAGGGCACAAGATTCCAGCCTACCGGCTTTCCTGATCTGGG CGCTGCCCACTATGAGGGCCCTGATGGTAGACCTATGCTGCTGGTGGAAAGCGCCCAGTCCATGGCCAACAGACTGGAAACCGTG TGCTGGGACAAAGACGCCGACGATTGGGTCGTGCCTCTGAGAGGACTGCCTGTGGTCAAGGTGCTGGATAAGGCCGGCAAGCCCC TGACCAATTCTGTGCTGGAAGCCCACAGACTGAACAGCCCCTACATCCTGGAAGGCAAGGACAAGACCCTGTTCGACCTGCTGAA GCAAGAGCTGGCCCACATGGAAGAGGGCCCCGTGGATATCAGAAAGCTGGCCGAGACACTGCTGAAGGTGGACGCTAATGCTGTG CTGCACGGCGTGTTCCTCGCCAAGAAAGAACTTGCTGGCGGCAGACTGAGACTGCCCAGAGCACTGTCTGCCTTCATCGAGGCTG AGGATGTGCGCGTGGCATCTTCTGGCGGCGTGAAGAACGATCACGTGAACCCTAGCGGCGACACCAGCAGAGGCTTTGGCAATGT GCCCTTCGCCAGGGACGAGTACGTGTCCCCTAGAATCAAGGCCTACTTCAACCTGGACCTGGCTCAGATCAGAGCCTTCGGCCTG GGAGAACAGGTGGACAGGCTGCTGATTGCCCTGGCTCTGTACAAAGTGCGGCGGTTTCTGGTGCACGGCCTGAGACTGAGAACCG CCTGCGATCTGGATTGTCAGGCCCTGAGAGTGACCAGACCTGAAGGCTGGGAAGTGCCTGAGCTGAGCGAACTGGAAGCTGCACT GCCTGGCCTGATTGAAGCTGTGGCTGGCGAGGGCAGATTTGCTCAGCCTGCCGTGACCATCGTGACCTACGAGAAATCCGGAGGA TCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGcGGGT CATCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCC TGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCAT GCCGAAATTATGGCCCTGAGACAGGGCGGCCTGGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGC CTTGCGTGATGTGCGCCGGCGCCATGATCCACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGC Attorney Docket No. UM-41218.601 AGGCTCCCTGATGAACGTGCTGAACTACCCCGGCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCC GCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAACTGA >human codon optimized tadA*-Tsu-cas7 with NLS and HA tag (SEQ ID NO: 216) ATGAAACGGACAGCCGACGGAAGCGAGTTCGAGTCACCAAAGAAGAAGCGGAAAGTCTCTGAGGTGGAGTTTTCCCACGAGTACT GGATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAG AGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGC CTGGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCC ACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCC CGGCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCT AGACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAACTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACAC CTGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGcGGGTCACCCAAGAAAAAGCGGAAGGTGTACCCCTA CGACGTGCCCGATTATGCCGGCTCTGTGGGAAAGCTGGAACCCCTGCTGAGCGACGTGCCCAGACTGCTGATGGAAGCTGATCTG GTGCCAGTGCAGGGCACAAGATTCCAGCCTACCGGCTTTCCTGATCTGGGCGCTGCCCACTATGAGGGCCCTGATGGTAGACCTA TGCTGCTGGTGGAAAGCGCCCAGTCCATGGCCAACAGACTGGAAACCGTGTGCTGGGACAAAGACGCCGACGATTGGGTCGTGCC TCTGAGAGGACTGCCTGTGGTCAAGGTGCTGGATAAGGCCGGCAAGCCCCTGACCAATTCTGTGCTGGAAGCCCACAGACTGAAC AGCCCCTACATCCTGGAAGGCAAGGACAAGACCCTGTTCGACCTGCTGAAGCAAGAGCTGGCCCACATGGAAGAGGGCCCCGTGG ATATCAGAAAGCTGGCCGAGACACTGCTGAAGGTGGACGCTAATGCTGTGCTGCACGGCGTGTTCCTCGCCAAGAAAGAACTTGC TGGCGGCAGACTGAGACTGCCCAGAGCACTGTCTGCCTTCATCGAGGCTGAGGATGTGCGCGTGGCATCTTCTGGCGGCGTGAAG AACGATCACGTGAACCCTAGCGGCGACACCAGCAGAGGCTTTGGCAATGTGCCCTTCGCCAGGGACGAGTACGTGTCCCCTAGAA TCAAGGCCTACTTCAACCTGGACCTGGCTCAGATCAGAGCCTTCGGCCTGGGAGAACAGGTGGACAGGCTGCTGATTGCCCTGGC TCTGTACAAAGTGCGGCGGTTTCTGGTGCACGGCCTGAGACTGAGAACCGCCTGCGATCTGGATTGTCAGGCCCTGAGAGTGACC AGACCTGAAGGCTGGGAAGTGCCTGAGCTGAGCGAACTGGAAGCTGCACTGCCTGGCCTGATTGAAGCTGTGGCTGGCGAGGGCA GATTTGCTCAGCCTGCCGTGACCATCGTGACCTACGAGAAATGA >human codon optimized Tsu-csb2-tadA* with NLS and HA tag (SEQ ID NO: 217) ATGGTGCCCAAGAAAAAGCGGAAGGTGTACCCCTACGACGTGCCCGATTATGCCGGCTCTGTGGGACTGGCCGTGGCCTGTAGAT TCACCGCCGGCAGATTTCACGCCACACCTTGGGGCAGACACGTGAACGAAGCCGACGTTGAGTGGCCTCCTTCTCCTTGGCGGTT TCTGAGAGCCCTGATCGCCACCTGGCACAGAAAACACGATCCCGGCGAGTTCCCTGAGGCCAGACTTGAGGCTCTGGTCAATGCT CTGAGCGGAGTGGCCCCTGTGTACAGACTGCCTGATGCCGTGCACGCCCACACCAGACACTACATGCCTGTCAGAGAGGGCAGAG CCGACAAGAGCGTGCTGGTGTTCGATGCCTTCCTGAGAATCGACCCCGACGAGGAACTGATCATTGCCTGGCCTGATCTGGACCC CGATCCTGAGCTGCTGGGATCTCTGGATGCCCTGATGCGGGACCTGAACTTCTTCGGCAGAGTGGAAAGCTGGATCGAGTGCAGA AGGCTCGAAGGCTGGAACCCCGAGGACGCCAATTGCAGACCTGGCAACCTGGCCGTGAATCCTGCCACAGGCGAGACAAGCGAGC CTGTGCGACTGATCGTGCCTAGATCTGCCGCCGATTATGCCCAGTGGCAGCAGCAGACAGTGGAAGATCTGCGGCTGGAAAAGCT GGCCAAGCAGAAAAGACTGTCCGTGCTGGCCACACTGCCCGAGAGACTGATCGATGCACTGAGACTGGAAACCGGCGATATCCAG AGAGCCGGCTGGTCACTTGCTCCAGGCGCTACAGAAGTGCTGTACCAAAGACCTCAGGGCGCTCTGGGAGTTAGAAGGCGGAGAG TGCCTGAGTGGCACCGGACCAGCAGAATCACCACAGCCAGATTTGCCCTGGCCGGCAGACCTCTGCCTCGCGTGGAAGATACAGT TAGAGTGGCCGAGCGGATGAGAGCCGCTCTGATGTCTAGAGCCAAGCGGAGATTCGGCGAGAGCGACATTCCTGCTCAGCTGTCT Attorney Docket No. UM-41218.601 GGACACGGCCTGCCTCCAGATAATAGACACGCCCACGCATTCTTTCTGCCCGAGGGCAACGACAAGGGCAGAATTGACCACGTGA TCGTGCATGCCGAGGCCGGCTTTCCACAAGAGATGCTGAAGGTGTTCGAGGACCTGCCAATCCTGAGAGGCCAGGATGGCTCTCA GTGGCAGGTTGCCCTGGAATCTGTTGGCGGCAGAGAGGACGAAAGACACTGGCAGGCCATCCAGTCCGCCATTCCAGCTCTGGGA CATGCCACAGTGTGGGTCACCAGAACACCCTATCTGCACCCTTGGCACGCCAAGAAAGGCTTCGGCTACGTGGAACAGATCCGCA GAGAGTGTAGAGAGCGGGGCCTGCCTATTCCTAGCCAAGTGGATCTGCTGCCTGAGATCCCTGTTGGCTCCGGCAGATCCTGTAG ACCCGTGCAGTTCCACCGGTTCCGGACCAAAAGAGGACTGCCCCAGCCTGATACACACGGCGCCTTTGTGCGGCTGACCTTTCCT CAGCCTGTGTCTGGACCTCTGGCTCTCGGCTTTGGCTGTCACTATGGCCTGGGACTGTTTGCCCCTAGCCACGATTCTGAGTCCG GAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACACCTGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGG cGGGTCATCTGAGGTGGAGTTTTCCCACGAGTACTGGATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAG GTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAGAGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAG CCCATGCCGAAATTATGGCCCTGAGACAGGGCGGCCTGGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATT CGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCCACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGC GCCGCAGGCTCCCTGATGAACGTGCTGAACTACCCCGGCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAAT GTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCTAGACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAACTGA >human codon optimized tadA*-Tsu-csb2 with NLS and HA tag (SEQ ID NO: 218) ATGAAACGGACAGCCGACGGAAGCGAGTTCGAGTCACCAAAGAAGAAGCGGAAAGTCTCTGAGGTGGAGTTTTCCCACGAGTACT GGATGAGACATGCCCTGACCCTGGCCAAGAGGGCACGGGATGAGAGGGAGGTGCCTGTGGGAGCCGTGCTGGTGCTGAACAATAG AGTGATCGGCGAGGGCTGGAACAGAGCCATCGGCCTGCACGACCCAACAGCCCATGCCGAAATTATGGCCCTGAGACAGGGCGGC CTGGTCATGCAGAACTACAGACTGATTGACGCCACCCTGTACGTGACATTCGAGCCTTGCGTGATGTGCGCCGGCGCCATGATCC ACTCTAGGATCGGCCGCGTGGTGTTTGGCGTGAGGAACTCAAAAAGAGGCGCCGCAGGCTCCCTGATGAACGTGCTGAACTACCC CGGCATGAATCACCGCGTCGAAATTACCGAGGGAATCCTGGCAGATGAATGTGCCGCCCTGCTGTGCGATTTCTATCGGATGCCT AGACAGGTGTTCAATGCTCAGAAGAAGGCCCAGAGCTCCATCAACTCCGGAGGATCTAGCGGAGGCTCCTCTGGCTCTGAGACAC CTGGCACAAGCGAGAGCGCAACACCTGAAAGCAGCGGGGGCAGCAGCGGcGGGTCACCCAAGAAAAAGCGGAAGGTGTACCCCTA CGACGTGCCCGATTATGCCGGCTCTGTGGGACTGGCCGTGGCCTGTAGATTCACCGCCGGCAGATTTCACGCCACACCTTGGGGC AGACACGTGAACGAAGCCGACGTTGAGTGGCCTCCTTCTCCTTGGCGGTTTCTGAGAGCCCTGATCGCCACCTGGCACAGAAAAC ACGATCCCGGCGAGTTCCCTGAGGCCAGACTTGAGGCTCTGGTCAATGCTCTGAGCGGAGTGGCCCCTGTGTACAGACTGCCTGA TGCCGTGCACGCCCACACCAGACACTACATGCCTGTCAGAGAGGGCAGAGCCGACAAGAGCGTGCTGGTGTTCGATGCCTTCCTG AGAATCGACCCCGACGAGGAACTGATCATTGCCTGGCCTGATCTGGACCCCGATCCTGAGCTGCTGGGATCTCTGGATGCCCTGA TGCGGGACCTGAACTTCTTCGGCAGAGTGGAAAGCTGGATCGAGTGCAGAAGGCTCGAAGGCTGGAACCCCGAGGACGCCAATTG CAGACCTGGCAACCTGGCCGTGAATCCTGCCACAGGCGAGACAAGCGAGCCTGTGCGACTGATCGTGCCTAGATCTGCCGCCGAT TATGCCCAGTGGCAGCAGCAGACAGTGGAAGATCTGCGGCTGGAAAAGCTGGCCAAGCAGAAAAGACTGTCCGTGCTGGCCACAC TGCCCGAGAGACTGATCGATGCACTGAGACTGGAAACCGGCGATATCCAGAGAGCCGGCTGGTCACTTGCTCCAGGCGCTACAGA AGTGCTGTACCAAAGACCTCAGGGCGCTCTGGGAGTTAGAAGGCGGAGAGTGCCTGAGTGGCACCGGACCAGCAGAATCACCACA GCCAGATTTGCCCTGGCCGGCAGACCTCTGCCTCGCGTGGAAGATACAGTTAGAGTGGCCGAGCGGATGAGAGCCGCTCTGATGT CTAGAGCCAAGCGGAGATTCGGCGAGAGCGACATTCCTGCTCAGCTGTCTGGACACGGCCTGCCTCCAGATAATAGACACGCCCA CGCATTCTTTCTGCCCGAGGGCAACGACAAGGGCAGAATTGACCACGTGATCGTGCATGCCGAGGCCGGCTTTCCACAAGAGATG CTGAAGGTGTTCGAGGACCTGCCAATCCTGAGAGGCCAGGATGGCTCTCAGTGGCAGGTTGCCCTGGAATCTGTTGGCGGCAGAG Attorney Docket No. UM-41218.601 AGGACGAAAGACACTGGCAGGCCATCCAGTCCGCCATTCCAGCTCTGGGACATGCCACAGTGTGGGTCACCAGAACACCCTATCT GCACCCTTGGCACGCCAAGAAAGGCTTCGGCTACGTGGAACAGATCCGCAGAGAGTGTAGAGAGCGGGGCCTGCCTATTCCTAGC CAAGTGGATCTGCTGCCTGAGATCCCTGTTGGCTCCGGCAGATCCTGTAGACCCGTGCAGTTCCACCGGTTCCGGACCAAAAGAG GACTGCCCCAGCCTGATACACACGGCGCCTTTGTGCGGCTGACCTTTCCTCAGCCTGTGTCTGGACCTCTGGCTCTCGGCTTTGG CTGTCACTATGGCCTGGGACTGTTTGCCCCTAGCCACGATTCTGAGTGA >Tsu-IG-CRISPR repeat (SEQ ID NO: 219) GTCATCCGCGGCATTTAGCCGCGGCCTCATTGAAGC >For Tsu-IG system (SEQ ID NO: 220) EGFP-G3: GTGACCGCCGCCGGGATCACTCTCGGCATGGACGA >Pae-IF-CRISPR repeat (SEQ ID NO: 221) GTTCACTGCCGTATAGGCAGCTAAGAAA CRISPR spacer/guide sequences used For Nla-IC system HPRT1-G1: CTGACTCTTGGCCCAGTGCTTCCCCAAACCCTTAA (SEQ ID NO: 222) HPRT1-G6: AAAACAGCCCTGTAGCAATGGTATGATTATTACCA (SEQ ID NO: 223) HPRT1-G7: ATATTAGGCATTGTAATGACTTAAGGTAAAGAGCA (SEQ ID NO: 224) HPRT1-G8: CATGCTGACCGATGCCCCAGGATATAGAAAATGAG (SEQ ID NO: 225) HPRT1-G10: TCATTTTCTATATCCTGGGGCATCGGTCAGCATGG (SEQ ID NO: 226) HPRT1-G13: CCAGTTAGACTCCGTTAATAGCACTGCTCTTTACC (SEQ ID NO: 227) HPRT1-G15: AACAAACAAGAAAAAACCAGTGAGGGTGGAGCTAA (SEQ ID NO: 228) HIRA-G1: ACTTTGCCCCTCAGCAATAAGCAATACGCTGCCTG (SEQ ID NO: 229) HIRA-G2: ATGTGGTGTCATTGGGCCAAAGGTGTCATTGGAGA (SEQ ID NO: 230) EGFP-G1: GAGGGCGACACCCTGGTGAACCGCATCGAGCTGAA (SEQ ID NO: 231) EGFP-G3: GTGACCGCCGCCGGGATCACTCTCGGCATGGACGA (SEQ ID NO: 232) For Syn-IB system IB-EGFP-G3: GACGAGCTGTACAAGTAACTCGCTGATCAGCCTCG (SEQ ID NO: 233) For Bha-IC system IC-HPRT1-G7: ATATTAGGCATTGTAATGACTTAAGGTAAAGAGCA (SEQ ID NO: 234) Attorney Docket No. UM-41218.601 For Tfu-IE system IE-EGFP-G1: GCTACGTCCAGGAGCGCACCATCTTCTTCAAG (SEQ ID NO: 235) For Pae-IF system IF-EGFP-G4: GGTGAACAGCTCCTCGCCCTTGCTCACCATGG (SEQ ID NO: 236) Cas9 nicking guide 1 GACGTAGCCTTCGGGCATGG (SEQ ID NO: 237) Cas9 nicking guide 2 GCCGTCGTCCTTGAAGAAGA (SEQ ID NO: 238) Cas9 nicking guide 3 GGTACTCCAGCTTGTGCCCC (SEQ ID NO: 239) Cas9 nicking guide 4 GGGCCATGATATAGACGTTG (SEQ ID NO: 240) Cas9 nicking guide 5 GATGCCGTTCTTCTGCTTGT (SEQ ID NO: 241) [0143] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein. [0144] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

Attorney Docket No. UM-41218.601 CLAIMS What is claimed is: 1. A system for altering a target nucleic acid sequence comprising: an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system, and/or one or more nucleic acids encoding the engineered CRISPR-Cas system, wherein the engineered CRISPR-Cas system comprises: a) a first Cas protein, wherein said first Cas protein is optionally selected from the group consisting of: Cas5, Cas6, Cas7, Cas8, or Cas11; b) an effector protein which is optionally tethered or fused to said first Cas protein, wherein said effector protein comprises: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC (apolipoprotein B mRNA editing enzyme, catalytic polypeptide) protein; c) optionally a second Cas protein, wherein said second Cas protein comprises: i) Cas3, ii) a helicase-deficient Cas3; iii) a single-strand nicking Cas endonucleases (SSNCE), wherein said SSNCE is optionally Cas9 Nickase H840A Protein; and d) at least one guide RNA (gRNA), wherein each gRNA is configured to hybridize to a portion of a target nucleic acid sequence. 2 The system of claim 1, wherein the one or more nucleic acids comprises one or more messenger RNAs, one or more vectors, or a combination thereof. 3 The system of claim 1 or claim 2, wherein said first Cas protein, said effector protein, and said second Cas protein are encoded by a single nucleic acid. 4 The system of claim 1 or claim 2, wherein said first Cas protein, said effector protein, and said second Cas protein are encoded by different nucleic acids. 5 The system of any of claims 1-4, wherein the guide RNA is encoded by a different nucleic acid than said first Cas protein, said effector protein, and said second Cas protein. Attorney Docket No. UM-41218.601 6. The system of any of claims 1-3, wherein the guide RNA, said first Cas protein, said effector protein, and said second Cas protein, are encoded by a single nucleic acid. 7. The system of any of claims 1-6, wherein at least one or all of said first Cas protein, said effector protein, and said second Cas protein comprise a nuclear localization sequence or a tag. 8 The system of any of claims 1-7, wherein said first Cas protein is selected from the group consisting of: Cas5, Cas6, Cas7, and Cas8 or Cas11. 9 The system of any of claims 1-8, wherein the engineered CRISPR-Cas system is derived from a Type I CRISPR-Cas system. 10 The system of claim 9, wherein the Type I CRISPR-Cas system is a Type I-B, a Type I-C, or a Type I-D system. 11 The system of any of claims 1-10, wherein the at least one gRNA is encoded in a CRISPR RNA (crRNA) array. 12 The system of any of claims 1-11, wherein the at least one gRNA comprises a non-naturally occurring gRNA. 13 The system of any of claims 1-11, wherein the system further comprises at least one target nucleic acid 14 The system of any of claims 1-13, wherein the system is a cell free system. 15 A composition comprising the system of any one of claims 1-14. 16 A eukaryotic cell comprising the system of any one of claims 1-14. Attorney Docket No. UM-41218.601 17. A method of altering a target nucleic acid sequence comprising: contacting a target nucleic acid sequence with the system of any one of claims 1-14 or a composition of claim 15. 18. The method of claim 17, wherein altering a target nucleic acid sequence comprises changing an A/T pair to a G/C pair, or changing a G/C pair to an A/T pair, in the target nucleic acid sequence. 20. The method of any of claims 17-18, wherein the target nucleic acid sequence encodes a gene product with a disease or condition causing single nucleotide polymorphism. 21. The method of any of claims 17-20, wherein the target nucleic acid sequence is in a cell. 22. The method of claim 21, wherein the cell is a eukaryotic cell. 23. The method of claim 21 or 22, wherein the cell is a mammalian cell. 24. The method of any of claims 21-23, wherein the cell is a human cell. 25. The method of any of claims 17-24, wherein the target nucleic acid sequence is a genomic DNA sequence. 26. The method of any of claims 17-25, wherein contacting a target nucleic acid sequence comprises introducing the system into the cell. 27. The method of claim 26, wherein introducing the system into the cell comprises administering the system to a subject. 28. The method of claim 27, wherein the subject is a human. 29. The method of claim 27 or 28, wherein the administering comprises in vivo administration. Attorney Docket No. UM-41218.601 30. The method of claims 27-29, wherein the administering comprises transplantation of ex vivo treated cells comprising the system. 31. Use of the system of any of claims 1-14 or a composition of claim 15 to alter a target nucleic acid sequence.
EP23858091.4A 2022-08-24 2023-08-24 Crispr base editor Pending EP4577647A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263373411P 2022-08-24 2022-08-24
PCT/US2023/031071 WO2024044329A1 (en) 2022-08-24 2023-08-24 Crispr base editor

Publications (1)

Publication Number Publication Date
EP4577647A1 true EP4577647A1 (en) 2025-07-02

Family

ID=90013920

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23858091.4A Pending EP4577647A1 (en) 2022-08-24 2023-08-24 Crispr base editor

Country Status (2)

Country Link
EP (1) EP4577647A1 (en)
WO (1) WO2024044329A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN121780486A (en) * 2026-03-03 2026-04-03 浙江大学金华研究院 A Cas protein, a fusion protein, its corresponding gene editing system and applications

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10227576B1 (en) * 2018-06-13 2019-03-12 Caribou Biosciences, Inc. Engineered cascade components and cascade complexes
WO2019246555A1 (en) * 2018-06-21 2019-12-26 Cornell University Type i crispr system as a tool for genome editing

Also Published As

Publication number Publication date
WO2024044329A1 (en) 2024-02-29

Similar Documents

Publication Publication Date Title
US20220186226A1 (en) RNA TARGETING OF MUTATIONS VIA SUPPESSOR tRNAs AND DEAMINASES
US12344869B2 (en) Nucleobase editors and uses thereof
KR20220004674A (en) Methods and compositions for editing RNA
CN111757937A (en) Uses of adenosine base editors
US20230265404A1 (en) Engineered mad7 directed endonuclease
CA3208612A1 (en) Recombinant rabies viruses for gene therapy
US20230091242A1 (en) Rna-guided genome recombineering at kilobase scale
EP4229195A1 (en) Compositions and methods for treating glycogen storage disease type 1a
US20240229081A1 (en) Crispr-cas3 systems for targeted genome engineering
EP4577647A1 (en) Crispr base editor
US20230287457A1 (en) Type i-c crispr system from neisseria lactamica and methods of use
EP4735590A1 (en) Modified type i crispr components with enhanced gene editing activity
US20250171810A1 (en) Compositions, systems, and methods for prime editing
WO2026036033A1 (en) Products and methods for treatment of autosomal dominant genetic diseases involving diversified disease causing mutations
WO2025259780A1 (en) Polypeptides and methods for modifying nucleic acids
HK40103008A (en) Nucleobase editors and uses thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250324

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40127585

Country of ref document: HK