EP4573193A1

EP4573193A1 - Gene therapy for the treatment of argininosuccinate lyase deficiency

Info

Publication number: EP4573193A1
Application number: EP23761975.4A
Authority: EP
Inventors: Julien BARUTEAU; Paul GISSEN; John Counsell; Loukia TOURAMANIDOU; Dany PEROCHEAU; Simon Waddington
Original assignee: UCL Business Ltd
Current assignee: UCL Business Ltd
Priority date: 2022-08-19
Filing date: 2023-08-18
Publication date: 2025-06-25
Also published as: WO2024038287A1

Abstract

In accordance with the present invention, there is provided a composition comprising an optimised human Argininosuccinate Lyase (ASL) nucleic acid sequence of SEQ ID No. 9 or a derivative sequence having at least about 94% sequence identity thereof. The present invention also relates to an integrating and/or lentiviral and/or gamma retroviral vector incorporating the optimised ASL nucleic acid sequence and its use as a therapy to treat Argininosuccinate Lyase Deficiency (ASLD) or disease or condition associated with ASLD.

Description

GENE THERAPY FOR THE TREATMENT OF ARGININOSUCCINATE LYASE DEFICIENCY

Field

The present invention relates to a gene therapy transgene cassette for the treatment of Argininosuccinate Lyase Deficiency (ASLD). In particular, the gene therapy preferably utilises a lentiviral gene therapy transgene cassette which is an integrating vector which can be used to successfully correct ASLD in neonates, children and teenagers.

Background

The urea cycle is an essential liver pathway enabling the removal of neurotoxic ammonia, produced by catabolism of amino acids. Argininosuccinate Lyase Deficiency (ASLD) is the second most common urea cycle disorder (UCD), with prevalence of 1/70,000 to 1/100,000 live births (1). This prevalence is much higher in the Middle East (e.g. Saudi Arabia) where the prevalence can be as high as 1/15,000. This is a much rarer condition in Asia (1/500,000 to 1/1 ,000,000). Based on these data, it is expected that 6-7 newborns per year in the UK will have ASLD and 40 per year in Europe and a similar number in the USA. In Saudia Arabia, it is expected that 35 new born children every year will have ASLD.

Patients with ASLD may present with hyperammonaemia neonatally (early-onset), or later in life (late-onset), and require intensive care to restore life-compatible ammonia levels. Delay in appropriate management increases the risk of neurologic sequelae and death. Patients suffer recurrent hyperammonaemic crisis causing high rates of mortality and neurodisability, with learning difficulties, behavioural problems and epilepsy. The standard of care relies on ammonia scavengers, protein-restricted diet and arginine supplementation but this does not prevent recurrent hyperammonaemic decompensations (2). Severe patients undergo liver transplantation, a curative procedure balanced by lifelong immunosuppression and procedure-related complications. The UCD lifetime cost is now estimated over £1 million (3).

The only approved therapies are pharmaceutically active ammonia scavengers approved for hyperammonaemia in urea cycle defects i.e. sodium benzoate, sodium phenylbutyrate, glycerol phenylbutyrate. Patients usually receive L-arginine supplementation and follow a protein restricted diet. However, such therapies only seek to manage ASLD rather than being corrective. Gene therapy has previously been proposed for the treatment of ASLD and AAV gene therapy for ASLD has shown a successful correction of the disease in adult treated ASLD mice but only a mild correction in neonatally treated mice (4). This is due to the rapid liver growth after neonatal injection. As the AAV are not integrating, the transgene cassette is lost during the first 4 weeks of life when the liver doubles its size 5 times (5) and therefore a suitable therapy is still needed, not least to be able to treat neonatal patients where a corrective therapy would have the greatest effect.

There is currently no curative therapy for ASLD except liver transplantation, which requires lifelong immunosuppression, has procedure-related morbidity and mortality and shortage of donors. This procedure is rarely done in neonates, and is usually performed for older children or teenagers when they develop a chronic liver disease like liver fibrosis or have repeated hyperammonaemia due to metabolic instability.

It is an object of the present invention to provide an improved ASLD therapy. It would be desirable if such a therapy would be corrective in nature and have a comparable to the liver transplant strategy but without the inherent risks associated with transplants. It would also be desirable that the improved therapy would target the neonates, children and teenagers affected by ASLD.

Summary of the Invention

In accordance with an aspect of the present invention, there is provided a composition comprising an optimised human Argininosuccinate Lyase (ASL) nucleic acid sequence of SEQ ID No. 9 or a derivative sequence having at least about 94% sequence identity thereof.

Preferably, if the ASL nucleic acid sequence is a derivative sequence, the derivative sequence may have at least about 95% sequence identity thereof, at least about 96% sequence identity thereof, at least about 97% sequence identity, at least about 98% sequence identity, or at least about 99% sequence identity thereof to SEQ ID No. 9.

In some embodiments, if the ASL nucleic acid sequence is a derivative sequence, the derivative sequence may have at least about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity thereof to SEQ ID No. 9.

For all aspects, sequence identity is determined by comparing two aligned substantially complementary sequences over their length and overall identity is expressed as a percentage. The measurement of nucleotide sequence identity is well known in the art, using specialist computer programs such as “BLAST”.

The nucleic acid sequence may be a DNA, RNA, mRNA, cDNA, genomic DNA or PNA and may be recombinant or synthetic which differs from the nucleic acid sequence found in nature. It may be single stranded or double stranded. The nucleic acid sequence will encode the optimised ASL nucleic acid sequence of SEQ ID No. 9, or derivative sequence thereof having at least about 94% sequence identity. The nucleic acid sequence may be derived by cloning, for example using standard molecular cloning techniques including restriction digestion, ligation, gel electrophoresis (for example as described in Sambrook et al; Molecular Cloning: A laboratory manual, Cold Spring Harbour laboratory Press). The nucleic acid sequence may be isolated or amplified using PCR technology. Such technology may employ primers based upon the sequence of the nucleic acid sequence to be amplified. With the sequence information provided, the skilled person can use available cloning techniques to produce a nucleic acid sequence or vector suitable for transduction into a cell. The nucleic acid sequence may alternatively have been generated de novo by DNA synthesis, which can be performed using routine procedures in the field of DNA synthesis.

The optimised ASL nucleic acid sequence may be optimised in a number of ways so as to enable enhanced expression or activity. For example, the sequence may have been codon optimised by selecting codons most common in human cells and/or reducing one or more secondary structures and hairpins which may arise in subsequently formed mRNA.

So as to further enhance expression or activity, the optimised ASL nucleic acid sequence may be under the control of a suitable promoter. It is preferred that the optimised ASL nucleic acid sequence is under the control of a Liver-specific promoter 1 (LP1) promoter. In some embodiments, it is preferred that the LP1 promoter has the sequence of SEQ ID No. 8 or a derivative sequence having at least about 90% sequence identity thereof. If a derivative sequence of the SEQ ID No. 8 is employed, the derivative sequence may have at least about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity thereof to SEQ ID No. 8.

Preferably, downstream of the optimised ASL nucleic acid sequence is a WPRE element. The WPRE element may have the sequence of SEQ ID No. 10 or a derivative sequence thereof having at least about 90% sequence identity. If a derivative sequence of the SEQ ID No. 10 is employed in the vector, the derivative sequence may have at least about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity thereof to SEQ ID No. 10.

The LP1 promoter and WPRE element assist with mRNA stability and neither have been previously utilised in a lentiviral vector.

The composition of the present invention is preferably suitable for use in vivo or in vitro, and is preferably suitable for use in a human.

The optimised human ASL nucleic acid sequence was shown by the present inventors to advantageously increase expression of ASL by 2-fold. This is particularly important for vectors such as lentiviral vectors, where lower titres of these vectors are employed due to lower levels of vectors produced during manufacturing.

The composition may be formulated into a therapy for targeting neonatal infants, young children and teenagers affected by ASLD and will act like a liver replacement strategy. Advantageously, patients will not require any further ammonia scavengers or be on a protein restricted diet and they will not be at risk of hyperammonaemic decompensation anymore for decades, with no need for re injection or immunosuppression.

In certain embodiments, the optimised ASL sequence is incorporated into an integrating and/or lentiviral vector and/or a gamma retroviral vector. Preferably, the optimised ASL sequence is incorporated into a lentiviral (LV) vector. In one embodiment, the vector comprises a pCCL backbone.

The vector will preferably comprise one or more regulatory sequences to direct expression of the optimised ASL nucleic acid sequence, or derivative sequence thereof. A regulatory sequence may include a promoter operably linked to the nucleic acid sequence, an enhancer, a transcription termination signal, a polyadenylation sequence, an origin of replication, a nucleic acid restriction site, and a homologous recombination site. A vector may also include a selectable marker, for example to determine expression of the vector in a growth system (for example a bacterial cell) or in a target neural cell.

By "operably linked" means that the nucleic acid sequence is functionally associated with the sequence to which it is operably linked, such that they are linked in a manner such that they affect the expression or function of one another. For example, a nucleic acid sequence operably linked to a promoter will have an expression pattern influenced by the promoter. The composition may be for use in the treatment of a disease or condition attributable to Argininosuccinate Lyase Deficiency (ASLD).

The composition may be for use in the preparation of a medicament for the treatment of a disease or condition attributable to ASLD.

There is also provided a method of treating an individual having a disease or condition attributable to ASLD, wherein the method comprises the steps of administering a therapeutically effective amount of the composition to said individual.

A disease or condition attributable to ASLD may selected from one or more of the following commonly associated diseases or conditions: hyperammonaemia, arterial hypertension, developmental delay and chronic liver disease.

In certain embodiments, there is provided a method of treating a neonatal individual having ASLD, or who has been identified as having a defective ASL gene, the method comprising the step of delivering an optimised human ASL nucleic acid sequence of SEQ ID No. 9 or a derivative sequence having at least about 94% sequence identity thereof to the liver of a new born individual. Neonatal treatment may be defined as the administration of the composition of the invention within 8 hours, the first 12 hours, the first 24 hours, or the first 48 hours of delivery. Neonatal delivery may be within the period of about 12 hours to about 1 week, 2 weeks, 3 weeks, or about 1 month, or after about 24 hours to about 48 hours. Due to rapid turnover of liver cells, neonatal therapy is desirably followed by readministration at about 3 months of age, about 6 months, about 9 months, or about 12 months. More than one re-administration may be desirable.

It is preferred that the composition is formulated for intravenous infusion and/or intra-arterial delivery.

The composition may be a liquid or a solid, for example a powder, gel, or paste. Preferably, a composition is a liquid, preferably an injectable liquid. Such an injectable liquid will preferably be suitable for hepatic artery infusion administration. The composition may also comprise one or more excipients and such excipients will be known to persons skilled in the art.

The composition may incorporate or be administered in conjunction (either sequentially or simultaneously) with (or co-administered with) an immunosuppressant. Such immunosuppressants may be selected from one or more of the following: tacrolimus, mycofenolate mofetil and prednisolone. The skilled addressee will understand that other immunosuppressants may also be employed.

In accordance with a further aspect of the present invention, there is provided an integrating and/or lentiviral and/or gamma retroviral vector comprising an expression cassette which comprises a Argininosuccinate Lyase (ASL) nucleic acid sequence or a derivative sequence encoding a functional human argininosuccinate lyase. An "expression cassette" refers to a nucleic acid molecule which comprises the ASL nucleic acid sequence, promoter, and may include other regulatory elements.

The expression cassette may be packaged into the capsid of a viral vector. Such an expression cassette for generating a viral vector may contain the ASL nucleic acid sequence flanked by packaging signals of the viral genome and other expression control sequences which are known in the art.

The integrating and/or lentiviral vector may comprise an optimised human Argininosuccinate Lyase (ASL) nucleic acid sequence of SEQ ID No. 9 or a derivative sequence having at least about 94% homology thereof.

In one embodiment, the vector is a lentiviral vector. In another embodiment, the vector is a gamma retroviral vector.

Preferably, if the ASL nucleic acid sequence in the vector is a derivative sequence, the derivative sequence may have at least about 95% sequence identity thereof, at least about 96% sequence identity thereof, at least about 97% sequence identity thereof, at least about 98% sequence identity thereof or at least about 99% sequence identity thereof to SEQ ID No. 9.

In some embodiments, if the ASL nucleic acid sequence in the vector is a derivative sequence, the derivative sequence may have at least about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity thereof to SEQ ID No. 9.

Preferably, the optimised ASL nucleic acid sequence in the vector is under the control of a Liver-specific promoter 1 (LP1) promoter. The LP1 promoter may have the sequence of SED ID No. 8 or a derivative sequence thereof having at least about 90% sequence identity. If a derivative sequence of the SEQ ID No. 8 is employed in the vector, the derivative sequence may have at least about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity thereof to SEQ ID No. 8.

The vector may further comprise one or more of the following elements: a cytomegalovirus (CMV) enhancer, a cytomegalovirus (CMV) promoter, a 5’ long terminal repeats (LTR), a human immunodeficiency virus type 1 packaging signal (HIV-1 ip), a Rev/Rev-responsive element (RRE), a central polypurine tract/central termination sequence (cPPT/CTS), a WPRE sequence, 3’ long terminal repeats (LTR), a Simian virus 40 PolyA (SV40 polyA) signal, Simian virus 40 (SV40) ori, a F1 origin of replication (ori), NeoR/KanR, and a Origin of replication Ori.

The vector may comprise one or more of the following elements upstream of the liver specific promoter LP1 : a cytomegalovirus (CMV) enhancer; a cytomegalovirus (CMV) promoter; a 5’ long terminal repeats (LTR); a human immunodeficiency virus type 1 packaging signal (HIV-1 ip); a Rev/Rev-responsive element (RRE); and a central polypurine tract/central termination sequence (cPPT/CTS). The vector may comprise one or more of the following elements downstream of optimised ASL gene: 3’ long terminal repeats (LTR); a Simian virus 40 PolyA (SV40 polyA) signal; Simian virus 40 (SV40) ori; a F1 origin of replication (ori); NeoR/KanR; and Origin of replication Ori.

The elements will preferably comprise:

One or more derivative sequence of any of SEQ ID Nos 2 - 7 and/or SEQ ID Nos 11 - 16 may be employed with sequence identity in the range of about 90 - 99%. Additionally, the vector may or may not have coding or non-coding intervening sequences between each and every element.

The vector may be for use in the treatment of a disease or condition attributable to Argininosuccinate Lyase Deficiency (ASLD).

The vector may be for use in the preparation of a medicament for the treatment of a disease or condition attributable to ASLD.

There is also provided a method of treating an individual having ASLD (or a disease or condition attributable to ASLD), wherein the method comprises the steps of administering a therapeutically effective amount of the vector to said individual.

The disease or condition attributable to ASLD may selected from one or more of the following commonly associated diseases or conditions: hyperammonaemia, arterial hypertension, developmental delay and chronic liver disease.

It is preferred that the vector is formulated for intravenous infusion and/or intra-arterial delivery.

Preferably, a vector is formulated in the form of a liquid, preferably an injectable liquid. Such an injectable liquid will preferably be suitable for intravenous infusion administration.

The vector may incorporate or be administered in conjunction (either sequentially or simultaneously) with (or co-administered with) an immunosuppressant. Such immunosuppressants may be selected from one or more of the following: tacrolimus, mycofenolate mofetil and prednisolone. The skilled addressee will understand that other immunosuppressants may also be employed.

In accordance with a further aspect of the present invention, there is provide a kit of parts for use in the treatment of an individual suffering from a disease or condition attributable to Argininosuccinate Lyase Deficiency (ASLD), the kit comprising: a) a composition or a vector as herein above described; and b) one or more catheters or syringes for intravenous infusion of the said composition or vector.

It is preferred, that in the kit, the composition or vector is in a buffer solution.

The kit may further comprise an immunosuppressant.

In a further aspect of the present invention, there is provided an optimised ASL nucleic acid sequence of SEQ ID No. 9 or derivative sequence having at least about 94% sequence identity thereof for use in a genome editing system, such as the Clustered Regulatory Interspaced Short Palindromic Repeats (CRISPR) system. In certain embodiments, a viral or not viral vector is used to deliver the components of the genome editing system.

In certain embodiments, the vector is capable of delivering one or more components (e.g. , the guide RNA, donor template, and endonuclease) of the genome editing system, such as CRISPR-Cas9. In another embodiment, a combination or dual vector system is provided to deliver one or more components of the CRISPR system when being co-administered to an individual. The vectors delivering donor template which are gene fragments may be configured so that the donor template is inserted upstream of the ASL gene mutation or phenotype to be corrected. Alternatively, a vector may include a full-length sequence that can replace the defective ASL with an optimised ASL nucleic acid sequence of SEQ ID No. 9 or derivative sequence having at least about 94% sequence identity thereof.

A dual vector system may be provided which comprises (a) a gene editing vector which comprises an optimised ASL nucleic acid sequence of SEQ ID No. 9 or derivative sequence having at least about 94% sequence identity thereof under control of regulatory sequences which direct its expression in a target cell (e.g., a hepatocyte) comprising a targeted defective ASL gene which has one or more mutations and (b) a targeting vector comprising a sequence specifically recognized by the editing enzyme and donor template, wherein the donor template comprises nucleic acid sequences which replaces at least one of the mutations in the targeted defective ASL gene.

Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

Detailed Description of the Invention

Figure 1 is a plasmid map of the CCL-LP1-co.hASL plasmid (8419bp) which was used in the experiments described in the examples.

Figure 2 are graphs and images showing that the systemic injection of LV.cohASL sustainably improves the macroscopic phenotype of Asl^Neo/Neo mice after neonatal injection. (A) Survival curve of LV.cohASL versus LV.GFP treated Asl^Neo/Neo mice (n=8/8) compared to untreated Asl^Neo/Neo mice (n=1/8); Log rank test p<0.0001. (B) Mean growth of LV.cohASL Asl^Neo/Neo mice compared to WT and LV.GFP Asl^Neo/Neo mice over 12 weeks (n=8 per group). (C) Liver/body weight ratio. (D) Images of WT, LV.GFP Asl^Neo/Neo (GFP) and LV.cohASL Asl^Neo/Neo _{mjce w}jth gene therapy (ASL). # 50% and ## <15% of untreated Asl^Neo/Neo mice still alive.

Figure 3 are graphs showing the correction of the urea cycle after gene therapy. (A) Plasma ammonia, (B) argininosuccinic acid, (C) L-citrulline and (D) L-arginine from dried blood spots in 3 month-old mice. (E) Urine orotate (F) Liver ASL activity. (G) Vector genome copy number in liver samples from LV.GFP and LV.cohASL treated Asl^Neo/Neo mice at harvest. One-way ANOVA with Tukey’s post test compared to WT and untreated Asl^Neo/Neo mice;* p<0.05, ** p<0.01 , *** p<0.001 , ns not significant. n=8 mice per group.

Figure 4 are images and graphs showing the correction of the urea cycle after gene therapy. (A) representative images of hASL immunostaining in liver, (B) computational calculation of hASL stained area in liver from 10 representative images for each animal, (C) liver hASL western blot and (D) western blot analysis in WT, LV.GFP and LV.cohASL treated AslNeo/Neo mice at harvest (statistical analysis of log-transformed data). One-way ANOVA (b, d) * p<0.05, ** p<0.01 , *** p<0.001 , ns not significant. n=8 mice per group.

Figure 5 are graphs showing the in vitro enhanced efficacy of codon-optimised hASL transgene versus WT hASL (A) Overexpression of cohASL and hASL plasmids compared to endogenous expression in Huh7 cells, (B) Overexpression of coASL and ASL lentiviral vectors compared to endogenous expression in Huh7 cells at different MOI at 24 hours post-transfection, (C) Overexpression of coASL and ASL lentiviral vectors compared to endogenous expression in Huh7 cells over time at MOI 20 and 70. * p<0.05, ** p<0.01.

Figure 6 shows photographs of mice who have received (A) Neonatal lentiviral gene therapy after 3 months of age (two mice are shown: Wild Type (WT) and Lentiviral Gene Therapy (GT)); and (B) Neonatal AAV gene therapy after 6 months of age (three mice are shown: AAV WT, WT and untreated).

Figure 7 are graphs showing the (A) survival and (B) growth of the following mice: WT, Untreated Asl^Neo/Neo ; neonatal LV Asl^Neo/Neo ; and neonatal AAV Asl^Neo/Neo.

Figure 8 are graphs showing the levels of (A) orotic acid (orotate), (B) arginine (citrulline) and (C) argininosuccinic acid at 3 months in the following mice: WT, Untreated Asl^Neo/Neo and neonatal LV Asl^Neo/Neo and neonatal AAV Asl^Neo/Neo (** p<0.01 , *** p<0.001 , **** p<0.0001 , ns not significant).

Figure 9 graphs showing the level of arginine at 3 months in the following mice: (A) WT, Untreated Asl^Neo/Neo , neonatal LV Asl^Neo/Neo ; and (B) WT, Untreated Asl^Neo/Neo, neonatal AAV not significant).

Figure 10 graphs showing the level of arginine as an indicator of liver ASL activity (A) at 3 months in the following mice: WT, Untreated Asl^Neo/Neo , LV Asl^Neo/Neo and (B) at 9 months in the following mice: WT, Untreated Asl^Neo/Neo, AAV Asl^Neo/Neo(* p<0.05, *** p<0.001 , **** p<0.0001 , ns not significant).

Figure 11 is a schematic diagram showing the protocol to assess the safety profile of the LV.cohASL in a murine mouse model and human hepatocytes. Figure 12 are graphs showing the safety of the LV.cohASL in vivo. (A) Mean growth of LV.cohASL- and PBS- treated CD1 mice (n=20 per group). Graphs shows mean ± SD. (B) Vector genome copy number in liver samples from LV.cohASL- and PBS-treated CD1 mice (unpaired two-tailed Student’s t test; * p<0.05, ** p<0.01 , *** p<0.001 , ns not significant). Graphs show means ± SD. (C) Biodistribution of vector copies per cell in five randomly selected LV.cohASL- treated CD1 mice.

Figure 13 are graphs showing (A) the number of integrations, and (B) the Shannon Diversity Index per sample. (C) The ratio of frequency of identification for each ISA (%) out of total ISA events.

Examples

Experiments were conducted in order to assess the use of a lentiviral gene vector as a possible therapy for the treatment of ASLD.

Materials and Methods

VCN analysis

Vector copy number was analysed on every sample via droplet digital PCR (BioRad QX200 system). The LV primers were designed over the Psi region while reference control assays were designed over the Titin gene for the murine tissues and over the SPIDR gene for the human samples. The psi copies were divided by the titin copies and divided by two to infer the average VCN/diploid cell.

Table 1: Primers utilised for droplet digital PCR for VCN analysis.

Integration site analysis.

The integration site analysis was performed via linker mediated PCR (LM-PCR) (as described in (7); (8); (9)) with minor modifications. gDNA was harvested from the murine samples 9 months after IV vector transduction. gDNA from human primary hepatocytes was extracted one week after transduction. Briefly, ca. 250 ng of gDNA were fragmented and a double-stranded linker DNA ligated using the NEB Next Ultra II FS DNA Library Prep Kit and NEB Next Ultra II Ligation Master Mix and Ligation Enhancer (New England Biolabs). Specific primers were utilized to perform the LM-PCR from the viral LTR. Table 2: Primers utilised for LM-PCR from viral LTR (s=phosphorothioate modification). The PCR reactions were purified and barcoded with NEB Next Multiplex Oligos for Illumina (New England Biolabs). AMPpure XP beads purification (Beckman Coulter) was set at O.7X volume to select fragments >180bp. The libraries were finally sequenced through the Illumina NovaSeq platform and analysed with the bioinformatic pipeline (htps://github.com/AG-Boerries/CAST-Seq) calling as true IS events reporting more than 3 reads then deduplicated and quantified based on the unique molecular signature derived by the sonic abundance method.

An in silico random IS library of 10,000 events was generated to perform a statistical comparison over the genetic features distribution and to control the clustering thresholds.

Clonal distribution

Lentiviral integrations can label every single cell in a unique manner as its landing site is semi-random with a slight preference for actively expressed genes (6). A clonal expansion burst will result in an unusual quantification of one specific integration site while an even cell duplication across the whole bulk population will return an even quantification across all the mapped integrations. The Shannon Diversity Index (EH) helps to objectively measure the diversity of species in a population. Murine liver samples were collected at 1 and 9 months after treatment to potentially address any potential genotoxic outcome.

Example 1 - Lentiviral Gene Therapy Vector (LV.cohASL)

A lentiviral gene therapy vector (LV.cohASL) was produced and assessed in a ASLD mouse model. The vector comprises a pCCL backbone, a liver-specific promoter LP1 (ApoE enhancer, human a1 antitrypsin promoter) (SEQ ID No. 8), a codon-optimised version of the human ASL gene (SEQ ID No. 9). The sequence of the vector incorporating the codon optimised human ASL gene is provided in SEQ ID No. 1. This vector was produced by triple transfection in HEK293T cells and titrated by qPCR targeting WPRE. A plasmid map of the vector is shown in Figure 1.

Upstream of the liver specific promoter LP1 , the vector also comprised a cytomegalovirus (CMV) enhancer (SEQ ID No. 2), a cytomegalovirus (CMV) promoter (SEQ ID No. 3), a 5’ long terminal repeats (LTR) (SEQ ID No. 4), a human immunodeficiency virus type 1 packaging signal (HIV-1 i ) (SEQ ID No. 5), a Rev/Rev-responsive element (RRE) (SEQ ID No. 6), a central polypurine tract/central termination sequence (cPPT/CTS) (SEQ ID No. 7). Downstream of the optimised ASL sequence comprises WPRE sequence (SEQ ID No. 10), 3’ long terminal repeats (LTR) (SEQ ID No. 11), Simian virus 40 PolyA (SV40 polyA) signal (SEQ ID No. 12), Simian virus 40 (SV40) ori (SEQ ID No. 13), a F1 origin of replication (ori) (SEQ ID No. 14), NeoR/KanR (SEQ ID No. 15) and Origin of replication Ori (SEQ ID No. 16).

Example 2 - Phenotypic Analysis after Systemic Injection of LV.cohASL and Lentiviral Vector with Reporter Gene

The phenotypical analysis of the LV.cohASL vector was conducted alongside a Lentiviral vector (LV.GFP) including a green fluorescent protein (GFP) reporter gene. A single intravenous injection of LV.cohASL or LV.GFP used as control was performed in the first 24 hours of life at a dose of 4x10¹⁰ vg/kg in Asl^Neo/Neo pups. These Asl^Neo/Neo animals were compared to wild-type littermates and were followed over 12 weeks. The successful integration and expression of GFP was confirmed during the experiments.

As shown in Figure 2A, the mice injected with LV.cohASL showed rescue of survival sustainably improves the macroscopic phenotype of Asl^Neo/Neo mice after neonatal injection and had a 100 % survival rate over 80 days, which compared to a greatly reduced (less than 15%) survival rate for those mice having being injected with the LV.GFP vector. Figure D are images of mice at week 4 which show that those mice injected with LV.GFP were much smaller than WT, whereas mice injected with LV.cohASL were comparable in size to WT and were also comparable in size to WT at week 8 and had similar fur patterns.

Figure 2B shows that mice injected with LV.cohASL had achieved normalisation of growth which was similar to that of WT, whereas mice included with LV.GFP weighed substantially less. Figure 2C shows that the liver/body weight ratio was more similar in the WT and LV.cohASL mice when compared to the mice injected with LV.GFP.

A number of biomarkers were assessed in the mice to establish whether mice injected with LV.cohASL had corrected the urea cycle. In Figure 3A, the plasma ammonia levels were shown to be normalised to WT in those mice injected with LV.cohASL, whereas those mice injected with LV.GFP had elevated ammonia levels. In Figure 3B, the level of argininosuccinic acid in dried blood spots was shown to be normalised to WT in those mice injected with LV.cohASL, whereas those mice injected with LV.GFP had elevated argininosuccinic acid levels. In Figure 3C, the level of L-citrulline in dried blood spots was found to be normalised to WT in those mice injected with LV.cohASL, whereas those mice injected with LV.GFP had elevated L-citrulline levels. In Figure 3D, the level of L-arginine in dried blood spots in 3 month-old mice was shown to be normalised to WT in those mice injected with LV.cohASL, whereas those mice injected with LV.GFP had elevated L-arginine levels. In Figure 3E, the level of Urine orotate was normalised to WT in those mice injected with LV.cohASL, whereas those mice injected with LV.GFP had elevated Urine orotate levels. In Figure 3F, the Liver ASL activity was normalised to WT in those mice injected with LV.cohASL, when compared to those mice injected with LV.GFP. Figure 3G confirmed that vector genome copy numbers in the liver had been achieved in the mice which had been injected with either LV.cohASL or LV.GFP.

These results show that all metabolites typically assessed for ASL function have been normalised in those mice injected with LV.cohASL.

Example 3 - Analysis of Liver Cells after Systemic Injection of LV.cohASL and LV.GFP

Figure 4A shows images of hASL immunostaining in liver samples and show that comparable ASL activity was found in the liver of WT mice and mice injected with LV.cohASL. In comparison, no ASL activity was found in those mice injected with LV.GFP. Figure 4B shows the computational calculation of hASL stained area in liver from 10 representative images for each animal and shows that whilst ASL activity was found in mice injected with LV.cohASL, no such activity was found in those mice injected with LV.GFP.

Figure 4C shows liver hASL western blot and Figure 4D shows western blot analysis in WT, LV.GFP and LV.cohASL treated Asl^Neo/Neo mice at harvest. Again, whilst comparative ASL activity to WT was found in mice injected with LV.cohASL, no such activity was found in those mice injected with LV.GFP.

Example 4 - Enhanced Efficacy of Codon-Optimised hASL Transgene v WT hASL

Figure 5 shows graphs illustrating the in vitro enhanced efficacy of codon-optimised hASL transgene versus WT hASL. The codon-optimised hASL has 81 .4% sequence identity with the WT hASL. Figure 5A shows that there is an overexpression of cohASL and hASL plasmids compared to endogenous expression hASL in Huh7 cells. Figure 5B also shows the overexpression of coASL and ASL lentiviral vectors compared to endogenous expression in Huh7 cells at different MOI at 24 hours post-transfection and Figure 5C also shows the overexpression of coASL and ASL lentiviral vectors compared to endogenous expression in Huh7 cells over time at MOI 20 and 70 and clearly shows that the codon optimised hASL shows a 2-fold increase in expression levels when compared to WT ASL in lentiviral vectors.

Example 5 - Comparison of Correction Between Lentiviral Vector and Adeno-Associated Virus Expressing ASL

Comparative studies of the therapeutic effect of gene therapy (GT) using a lentiviral vector (LV) alongside an adeno-associated virus vector (AAV) injected intravenously once in the first 48 hours of life were undertaken.

Figure 6A is an image of mice at 3 months of age comparing WT with LV GT and shows that the mice were of comparable size and fur pattern. Figure 6B is an image of mice at 6 months comparing AAV GT, WT and untreated Asl^Neo/Neo and show that both AAV GT and untreated mice are smaller than WT and have greatly reduced fur pattern.

Figure 7A shows that survival and Figure 7B shows that growth of WT and LV Asl^Neo/Neo mice were similar to one another, whereas the Untreated Asl^Neo/Neo and AAV Asl^Neo/Neo both had greatly reduced survival and growth trajectories.

Figures 8A - 8C show that the biomarkers orotic acid (orotate), arginine (citrulline) and argininosuccinic acid in WT and LV Asl^Neo/Neo mice were similar to one another at 3 months, whereas the Untreated Asl^Neo/Neo and AAV Asl^Neo/Neo both showed elevated levels of the biomarkers. These results show that all metabolites typically assessed for ASL function have been normalised in LV Asl^Neo/Neo mice but not in AAV Asl^Neo/Neo mice.

Figures 9A - 9B show that arginine levels in dried blood spots in WT and LV Asl^Neo/Neo mice were similar to one another at 3 months, whereas arginine levels in Untreated Asl^Neo/Neo and AAV Asl^Neo/Neo were similar to one another suggesting a complete correction in LV Asl^Neo/Neo but a reversion of phenotype in AAV Asl^Neo/Neo after 3 months of treatment.

Figures 10A - 10B show that liver ASL activity was greatly improved by 3 months of age in LV Asl^Neo/Neo mice, whereas by 9 months AAV Asl^Neo/Neo mice had reverted to similar levels of liver ASL activity as seen in untreated Asl^Neo/Neo mice.

Example 6 - Validation of the safety of the LV.cohASL in murine models and human hepatocytes.

Further investigations were undertaken to determine the safety of the LV.cohASL in murine models and human hepatocytes. Wild-type CD1 neonatal pups were injected at birth with either LV.cohASL, at a dose of 4x10¹⁰TU/kg, or a PBS control. Nine months post-injection, the livers of the mice were harvested and dissected along with the spleen, lungs, heart, muscle, bladder, bone, stomach, bone marrow, gut, brain, kidney, uterus, ovaries and testis. Human hepatocytes were also transduced with the LV.cohASL at MOI 2 for 72 hours and then sequenced.

Figure 12A shows that both groups exhibited similar growth for the whole timeframe of the experiment. There were no liver tumours detected in either the LV.cohASL- or PBS-treated group.

Figure 12B shows that the average liver vector copy number was 0.6 (range 0.1-2) for LV.cohASL-treated mice whereas the vector copy number was undetectable in controls. Figure 12C confirms the high predominance of the vector within the liver and marginal detection in lungs, heart, bone marrow and kidneys.

Figure 13A shows the average integration site (IS) per sample was close to 5x10³. Figure 13B shows that the Shannon Diversity Index (EH) did not differ across samples with the exception of one sample, where the EH was lower (EH=0.74) but still within the safe diversity range. The LV.cohASL-transduced human hepatocytes showed the highest Shannon Index (EH=0.99).

Figure 13C illustrates the ratio of the frequency of identification for each IS out of the total IS events.

Overall, the ISA analysis found no signs of clonal expansion as shown with the Shannon Diversity Index and based on the percentage of ISA scores. Therefore, this demonstrates a safe integration profile with no genotoxicity up to 9 months in the murine model.

The experiments conducted show that using the codon optimised ASL sequence in the lentiviral vector of the present invention, corrects ASLD on a permanent basis in mice and therefore represents a promising treatment for human ASLD patients. Furthermore, it is believed that the therapy of the present invention would not only be suitable for neonatal treatment of ASLD, but also late-onset ASLD due to the corrective nature of the therapy and the regenerative effect of the liver.

The optional features set out herein may be used either individually or in combination with each other where appropriate and particularly in the combinations as set out in the accompanying claims. The optional features for each aspect or exemplary embodiment of the invention as set out herein are also to be read as applicable to any other aspect or exemplary embodiments of the invention, where appropriate. In other words, the skilled person reading this specification should consider the optional features for each exemplary embodiment of the invention as interchangeable and combinable between different exemplary embodiments.

Attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

All of the features disclosed in this specification (including any accompanying claims, and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive.

Each feature disclosed in this specification (including any accompanying claims, and drawings) may be replaced by alternative features serving the same, equivalent or similar purpose, unless expressly stated otherwise. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.

The invention is not restricted to the details of the foregoing embodiment(s). The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

Sequence Listings

The sequences disclosed herein are defined below:

SEQ ID No. 1 - CCL-LP1-co.hASL plasmid ccattgcatacgttgtatccatatcataatatgtacatttatattggctcatgtccaacattaccgccatgttgacattgattattgact agttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggccc gcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcc attgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctat tgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctac gtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttcc aagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgc cccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccggtggcgcccg aacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggca agaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgag agcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatata aattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctg tagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaacc ctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaa gtaagaccaccgcacagcaagcggccgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaat tatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagaga aaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgac gctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacag catctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaa cagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctg gaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattg aagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaa cataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctat agtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccga aggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggtatcggtta acttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaa ctaaagaattacaaaaacaaattacaaaaattcaaaattttatcgatcacgagactagcctcgaggatccctaaaatgggca aacattgcaagcagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggcagaggtcagagacct ctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtggttta ggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggcagcgt aggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgaccttggttaatattcacc agcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctcagcttcaggcacca ccactgacctgggacagtgaatcaccggtgccaccatggcctctgagtctggcaaactgtggggcggcagatttgtgggagc cgtggatcccatcatggaaaagttcaacgcctctatcgcctacgaccggcacctgtgggaagttgatgtgcagggcagcaag gcctacagcagaggactggaaaaagccggcctgctgaccaaggccgagatggatcagattctgcacggcctggacaag gtggccgaagaatgggcccagggcaccttcaagctgaacagcaacgacgaggacatccacaccgccaacgagcggag actgaaagagctgattggagccacagccggcaagctgcacaccggcagatccagaaatgaccaggtggtcaccgacctg cggctgtggatgagacagacctgtagcacactgtctggcctgctgtgggagctgatcagaaccatggtggatagagccgag gccgagagggacgtgctgtttcctggctacacccatctgcagagggcccagcctattagatggtcccactggatcctgagcc acgccgtggcactgacaagagactctgagagactgctggaagtgcggaagcggatcaacgtgctgcctcttggatctggcg ctatcgccggaaatcctctgggcgttgacagagagctgctgagagccgagctgaacttcggcgccatcacactgaatagcat ggacgccaccagcgagcgggatttcgtggccgagtttctgttttgggccagcctgtgcatgacccacctgagcagaatggcc gaggacctgatcctgtactgcaccaaagaattcagcttcgtgcagctgagcgacgcctactctaccggaagctctctgatgcc ccagaagaagaaccccgacagcctggaactgatccggtctaaggccggcagagtgttcggaagatgtgccggactgctg atgaccctgaagggcctgcctagcacctacaacaaggacctgcaagaggacaaagaggccgttttcgaggtttccgacac catgtctgccgtgctgcaagtggctacaggcgtgatcagcaccctgcagatccaccaagagaacatgggccaagctctgag ccccgatatgctggccacagacctggcctattacctcgtgcggaagggcatgcctttcagacaggcccatgaggcctctggc aaggccgtgtttatggccgagacaaaaggcgtggccctgaaccagctgtctctgcaagagctgcagacaatcagccctctgt tcagcggcgacgtgatctgcgtgtgggattacggccacagcgtggaacagtatggcgcccttggaggaaccgccagatcttc cgtggactggcagatcagacaagtgcgggctctgctgcaggctcagcaggcttaagtcgacaatcaacctctggattacaa aatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattg cttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtgg cgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgcttt ccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgaca attccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttct gctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgcctt cgccctcagacgagtcggatctccctttgggccgcctccccgcctggaattcgagctcggtacctttaagaccaatgacttaca aggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatc tgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagc ctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagaccctttta gtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagag tgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcact gcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccatcccgc ccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcct ctgagctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgccctatagtgagtcgtattacgcg cgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctt tcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatgggac gcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcg cccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttc cgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacg gtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtcta ttcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaaca aaatattaacgcttacaatttaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaata tgtatccgctcatgagacaataaccctgataaatgcttcaataatagcacctagatcaagagacaggatgaggatcgtttcgc atgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacaga caatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgc cctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgtt gtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccga gaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaa catcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctc gcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctg cttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcagga catagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgct cccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattattaacgcttacaatttcctgatgcggtattttctcc ttacgcatctgtgcggtatttcacaccgcatcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaat acattcaaatatgtatccgctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatc aaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttg ccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagc cgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccag tggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgggggg gtcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgcc acgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagct tccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcagg ggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcc tgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcg cagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaat gcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattagg caccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctat gaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctgcaagcttgg

SEQ ID No. 2 - Cytomegalovirus (CMV) enhancer gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataactt acggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgc caatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcc aagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctact tggcagtacatctacgtattagtcatcgctattaccatg

SEQ ID No. 3 - Cytomegalovirus (CMV) promoter gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtca atgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggt aggcgtgtacggtgggaggtctatataagcagagct

SEQ ID No. 4 - 5’ long terminal repeats (LTR) gggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttg ccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaa atctctagca

SEQ ID No. 5 - Human immunodeficiency virus type 1 packaging signal (HIV-1 i ) ctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaa ttttgactagcggaggctagaaggagagagatgggtgcgagagcgtc

SEQ ID No. 6 - Rev/Rev-responsive element (RRE) aggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccaga caattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtct ggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcct

SEQ ID No. 7 - Central polypurine tract/central termination seguence (cPPT/CTS) ttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaact aaagaattacaaaaacaaattacaaaaattcaaaatttt

SEQ ID No. 8 - Liver-specific promoter 1 (LP1) ccctaaaatgggcaaacattgcaagcagcaaacagcaaacacacagccctccctgcctgctgaccttggagctggggca gaggtcagagacctctctgggcccatgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggtt gtcctggcgtggtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaag cgtccgggcagcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggggtgacct tggttaatattcaccagcagcctcccccgttgcccctctggatccactgcttaaatacggacgaggacagggccctgtctcctc agcttcaggcaccaccactgacctgggacagtgaatc

SEQ ID No. 9 - Codon optimised (co) hASL atggcctctgagtctggcaaactgtggggcggcagatttgtgggagccgtggatcccatcatggaaaagttcaacgcctctat cgcctacgaccggcacctgtgggaagttgatgtgcagggcagcaaggcctacagcagaggactggaaaaagccggcct gctgaccaaggccgagatggatcagattctgcacggcctggacaaggtggccgaagaatgggcccagggcaccttcaag ctgaacagcaacgacgaggacatccacaccgccaacgagcggagactgaaagagctgattggagccacagccggcaa gctgcacaccggcagatccagaaatgaccaggtggtcaccgacctgcggctgtggatgagacagacctgtagcacactgt ctggcctgctgtgggagctgatcagaaccatggtggatagagccgaggccgagagggacgtgctgtttcctggctacaccc atctgcagagggcccagcctattagatggtcccactggatcctgagccacgccgtggcactgacaagagactctgagagac tgctggaagtgcggaagcggatcaacgtgctgcctcttggatctggcgctatcgccggaaatcctctgggcgttgacagaga gctgctgagagccgagctgaacttcggcgccatcacactgaatagcatggacgccaccagcgagcgggatttcgtggccg agtttctgttttgggccagcctgtgcatgacccacctgagcagaatggccgaggacctgatcctgtactgcaccaaagaattca gcttcgtgcagctgagcgacgcctactctaccggaagctctctgatgccccagaagaagaaccccgacagcctggaactga tccggtctaaggccggcagagtgttcggaagatgtgccggactgctgatgaccctgaagggcctgcctagcacctacaaca aggacctgcaagaggacaaagaggccgttttcgaggtttccgacaccatgtctgccgtgctgcaagtggctacaggcgtgat cagcaccctgcagatccaccaagagaacatgggccaagctctgagccccgatatgctggccacagacctggcctattacct cgtgcggaagggcatgcctttcagacaggcccatgaggcctctggcaaggccgtgtttatggccgagacaaaaggcgtgg ccctgaaccagctgtctctgcaagagctgcagacaatcagccctctgttcagcggcgacgtgatctgcgtgtgggattacggc cacagcgtggaacagtatggcgcccttggaggaaccgccagatcttccgtggactggcagatcagacaagtgcgggctctg ctgcaggctcagcaggcttaa

SEQ ID No. 10 - Woodchuck Hepatitis Virus (WPRE) aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgcttta atgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggc ccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagc tcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggct cggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggatt ctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggc ctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgc

SEQ ID No. 11 - 3’ long terminal repeats (LTR) tggaagggctaattcactcccaacgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgg gagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgtt gtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagca

SEQ ID No. 12 - Simian virus 40 PolyA (SV40 polyA) signal aacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattcta gttgtggtttgtccaaactcatcaatgtatctta

SEQ ID No. 13 - Simian virus 40 (SV40) ori atcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgc ctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcc

SEQ ID No. 14 - F1 origin of replication (ori) acgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctag cgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttaggg ttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgataga cggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggt ctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaa caaaatattaacgcttacaattt

SEQ ID No. 15 - NeoR/KanR atgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacaga caatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgc cctgaatgaactgcaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgtt gtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccga gaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaa catcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctc gcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctg cttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcagga catagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgct cccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctga SEQ ID No. 16 - Origin of replication Ori

Ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaag agctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttagg ccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataa gtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgggggggtcgtgcac acagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttccc gaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggg gaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcgga gcctatggaaa

SEQ ID No. 17 - PCR forward primer (HIV-psi)

CAGGACTCGGCTTGCTGAAG

SEQ ID No. 18 - PCR reverse primer (HIV-psi)

TCCCCCGCTTAATACTGACG

SEQ ID No. 19 - PCR probe (HIV-psi)

FAM-CGCACGGCAAGAGGCGAGG

SEQ ID No. 20 - PCR forward primer (Mouse titin)

AAAACGAGCAGTGACGTGAGC

SEQ ID No. 21 - PCR reverse primer (Mouse titin)

TTCAGTCATGCTGCTAGCGC

SEQ ID No. 22 - PCR probe (Mouse titin)

H EX-TGCACGGAAGCGTCTCGTCTCAGTC SEQ ID No. 23 - LV 1PCR primer

CCCGTCTGTTGTGTGACT-s-C

(s=phosphorothioate modification)

SEQ ID No. 24 - LV Nested PCR primer

G-s-ACTGGAGTTCAGACGTGTGCTCTTCCGATTCTGGTAACTAGAGATCCCTCAGA-s- C

(s=phosphorothioate modification)

SEQ ID No. 25 - Linker IPCR:

GTAATACGACTCACTATAGGGC

SEQ ID No. 26 - Linker Nested primer:

ACACTCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGGCTCCGCTTAAGGG

AC

References

(1) Baruteau J, Diez-Fernandez C, Lerner S, Ranucci G, Gissen P, Dionisi-Vici C, et al. Argininosuccinic aciduria: Recent pathophysiological insights and therapeutic prospects. Journal of inherited metabolic disease. 2019.

(2) Baruteau J, Jameson E, Morris AA, Chakrapani A, Santra S, Vijay S, et al. Expanding the phenotype in argininosuccinic aciduria: need for new therapies. Journal of inherited metabolic disease. 2017;40(3):357-68.

(3) Li M, Dick A, Montenovo M, Horslen S, Hansen R. Cost-effectiveness of liver transplantation in methylmalonic and propionic acidemias. Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society. 2015.

(4) Baruteau J, Perocheau DP, Hanley J, Lorvellec M, Rocha-Ferreira E, Karda R, Ng J, Suff N, Diaz JA, Rahim AA, Prunty H, Hristova M, Ridout DA, Virasami A, Heales S, Howe SJ, Buckley SMK, Mills PB, Gissen P, Waddington SN (2018). Argininosuccinic aciduria fosters neuronal nitrosative stress reversed by Asl gene transfer. Nature Communications 2018; 9(1) 3505.

(5) Baruteau J, Waddington SN, Alexander IE, Gissen P. Gene therapy for monogenic liver diseases: clinical successes, current challenges and future prospects. J Inherit Metab Dis. 2017 Jul;40(4):497-517.

(6) Moiani, A.; Suerth, J.D.; Gandolfi, F.; Rizzi, E.; Severgnini, M.; De Bellis, G.; Schambach, A.; Mavilio, F. Genome-Wide Analysis of Alpharetroviral Integration in Human Hematopoietic Stem/Progenitor Cells. Genes 2014, 5, 415-429.

(7) Turchiano, G.; Latella, M.C.; Dbring, A.G.; Cattoglio, C.; Mavilio, F.; Izsvak, Z.; Ivies, Z.; Recchia, A. Correction: Genomic Analysis of Sleeping Beauty Transposon Integration in Human Somatic Cells. PLOS One 9(11): e112712 (8) Turchiano, G.; Andrieux, G.; Klermund, J.; Blattner, G.; Pennucci, V.; El Gaz, M.; Monaco, G.; Poddar, S.; Mussolino, C.; Cornu, T.I.; Boerries, M.; Cathomen, T. Quantitative evaluation of chromosomal rearrangements in gene-edited human stem cells by CAST-Seq Cell Stem Cell. 2021 Jun 3;28(6):1136-1147

(9) Cattoglio, C.; Facchini, G.; Sartori, D.; Antonelli, A.; Miccio, A.; Cassani, B.; Schmidt, M.; von Kalle, C.; Howe, S.; Thrasher, A. J.; Aiuti, A.; Ferrari, G.; Recchia, A.; Mavilio, F. Hot spots of retroviral integration in human CD34+ hematopoietic cells. Blood (2007) 110 (6): 1770-1778

Claims

1. A composition comprising an optimised human Argininosuccinate Lyase (ASL) nucleic acid sequence of SEQ ID No. 9 or a derivative sequence having at least about 94% sequence identity thereof.

2. The composition of claim 1 , wherein the sequence is a derivative sequence having at least about 95% sequence identity thereof.

3. The composition of claim 1 , wherein the sequence is a derivative sequence having at least about 98% sequence identity thereof.

4. The composition of claim 1 , wherein the sequence is a derivative sequence having at least about 99% sequence identity thereof.

5. The compostion of any preceding claim, wherein the optimised ASL nucleic acid sequence is under the control of a Liver-specific promoter 1 (LP1) promoter.

6. The composition of claim 5, wherein the LP1 promoter has the seqeunce of SEQ ID No. 8 or a derivative sequence having at least about 90% sequence identity thereof.

7. The composition of any preceding claim, wherein downstream of the optimised ASL nucleic acid sequence is a WPRE element.

8. The composition of claim 7, wherein the WPRE element has a sequence of of SE ID No. 10 or a derivative sequence having at least about 90% sequence identity thereof.

9. The composition of any preceding claim, wherein the sequence is incorporated into an integrating vector and/or a lentiviral (LV) and/or gamma retroviral vector.

10. The composition of any preceding claim, for use in the treatment of a disease or condition attributable to Argininosuccinate Lyase Deficiency (ASLD). The composition for use of claim 10, wherein the composition is formulated for intravenous infusion. The composition for use of any of claims 10 or 11 , wherein the composition is coadministered with an immunosuppressant. An integrating and/or lentiviral and/or gamma retroviral vector comprising an optimised human Argininosuccinate Lyase (ASL) nucleic acid sequence of SEQ ID No. 9 or a derivative sequence having at least about 94% sequence identity thereof.

The vector of claim 13, wherein the sequence is a derivative sequence having at least about 95% sequence identity thereof.

The vector of claim 13, wherein the sequence is a derivative sequence having at least about 98% sequence identity thereof. The vector of claim 13, wherein the sequence is a derivative sequence having at least about 99% sequence identity thereof. The vector of any of claims 13 to 16, wherein the optimised ASL nucleic acid sequence is under the control of a Liver-specific promoter 1 (LP1) promoter. The vector of claim 17, wherein the LP1 promoter has the seqeunce of SEQ No. 8 or a derivative sequence having at least about 90% sequence identity thereof. The vector of any of claims 13 to 18, wherein downstream of the optimised ASL nucleic acid sequence is a WPRE element. The vector of claim 19, wherein the WPRE element has a sequence of of SE ID No.

10 or a derivative sequence having at least about 90% sequence identity thereof. The vector of any of claims 13 to 20, wherein the vector further comprises one or more of the following elements: a cytomegalovirus (CMV) enhancer, a cytomegalovirus (CMV) promoter, a 5’ long terminal repeats (LTR), a human immunodeficiency virus type 1 packaging signal (HIV-1 i ), a Rev/Rev-responsive element (RRE), a central polypurine tract/central termination sequence (cPPT/CTS), a WPRE sequence, 3’ long terminal repeats (LTR), a Simian virus 40 PolyA (SV40 polyA) signal, Simian virus 40 (SV40) ori, a F1 origin of replication (ori), NeoR/KanR, and a Origin of replication Ori. The vectorof any of claims 13 to 21 , for use in the treatment of a disease or condition attributable to Argininosuccinate Lyase Deficiency (ASLD). The vector for use of claim 22, wherein the composition is formulated for intravenous infusion. The vector for use of claims 22 or 23, wherein the vector is co-administered with an immunosuppressant. A kit of parts for use in the treatment of an individual suffering from a disease or condition attributable to Argininosuccinate Lyase Deficiency (ASLD), the kit comprising: a) a composition as claimed in any one of claims 1 to 9 or a vector as claimed in any one of claims 13 to 21 ; and b) one or more catheters or syringes for intravenous infusion of the composition or vector. The kit of claim 25, wherein the composition or vector is in a buffer solution. The kit of either claim 25 or 26, further comprises a an immunosuppressant.