EP4565677A2 - Bovine trophoblast stem cells and uses thereof - Google Patents
Bovine trophoblast stem cells and uses thereofInfo
- Publication number
- EP4565677A2 EP4565677A2 EP23850719.8A EP23850719A EP4565677A2 EP 4565677 A2 EP4565677 A2 EP 4565677A2 EP 23850719 A EP23850719 A EP 23850719A EP 4565677 A2 EP4565677 A2 EP 4565677A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- cells
- cell
- bovine
- trophoblast
- panel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0605—Cells from extra-embryonic tissues, e.g. placenta, amnion, yolk sac, Wharton's jelly
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/01—Modulators of cAMP or cGMP, e.g. non-hydrolysable analogs, phosphodiesterase inhibitors, cholera toxin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/235—Leukemia inhibitory factor [LIF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/72—Transferases [EC 2.]
- C12N2501/727—Kinases (EC 2.7.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/73—Hydrolases (EC 3.)
- C12N2501/734—Proteases (EC 3.4.)
Definitions
- This invention is directed to bovine trophoblast stem cells and uses thereof.
- An aspect of the invention is directed to bovine trophoblast stem cells and uses thereof.
- aspects of the invention are drawn towards a method of culturing, expanding or growing a population of cells derived from a mammalian blastocyst.
- the method comprises culturing the cells derived from a mammalian blastocyst for a period of time in a culture medium, wherein the culture medium comprises human leukemia inhibitory factor (hLIF), an inhibitor of glycogen synthase kinase-3 (GSK-3), an antagonist of muscarinic M2 and histamine Hl receptors, an inhibitor of matrix metalloproteinase (MMP), or any combination thereof.
- hLIF human leukemia inhibitory factor
- GSK-3 glycogen synthase kinase-3
- MMP matrix metalloproteinase
- the cultured cells remain in an undifferentiated state.
- the cultured cells are capable of differentiation.
- the method further comprises placing a mammalian blastocyst in a vessel seeded with fibroblast cells and adding the culture medium, thereby providing a population of cells derived from a mammalian blastocyst.
- the fibroblast cells comprise mouse embryonic fibroblast cells.
- the trophoblast stem cells are cultured without fibroblast feeder cells.
- the population of cells comprises trophoblast stem cells, trophoblast stem-like cells, or derivatives thereof.
- the mammal is a bovine.
- the GSK-3 inhibitor comprises CHIR99021.
- the amount of the glycogen synthase kinase-3 inhibitor is about 3pM.
- the antagonist of muscarinic M2 and histamine Hl receptors comprises dimethinedene maleate (DiM).
- the amount of the muscarinic M2 and histamine Hl receptor antagonist is about 2pM.
- the inhibitor of matrix metalloproteinase comprises minocycline hydrochloride (MiH).
- the amount of the matrix metalloproteinase inhibitor is about 2pM.
- the amount of the human leukemia inhibitory factor is about 10 ng/ml.
- the vessel comprises a dish, a flask, a well, a tube, or a plate.
- the vessel comprises a solid surface or a porous surface.
- the cells are cultured on a surface coated with extracellular matrix or a component of extracellular matrix.
- the extracellular matrix is MatrigelTM or a MatrigelTM-like substance.
- the surface is not MatrigelTM.
- the in vitro cell culture comprises a population of cells derived from a mammalian blastocyst produced by methods as described herein.
- the cells of the in vitro cell culture comprise trophoblast stem cells, trophoblast stem cell-like cells, or derivatives.
- the cells of the in vitro cell culture comprise undifferentiated cells.
- the cells of the in vitro cell culture are capable of self-renewal.
- aspects of the invention are also drawn towards an isolated cell.
- the isolated cell is derived from a mammalian blastocyst.
- the isolated cell expresses at least one marker of pluripotency.
- the at least one marker comprises GATA3, CDX2, ELF3, TFAP2A, KLF5, KRT8, SFN, DNMT1, DNMT3A, PAG2, PAG11, PAG12, CYP17A1, HSD3B1, HAND1, or any combination thereof.
- the at least one marker comprises a marker of the Wnt signaling pathway, the LIF signaling pathway, the HIF-1 signaling pathway, the AMPK signaling pathway, or any combination thereof.
- the isolated cell comprises a trophoblast stem cell, a trophoblast stem cell-like cell, or a derivative thereof.
- the isolated cell is undifferentiated.
- the isolated cell is capable of self-renewal.
- the isolated cell is capable of differentiation into cells of the trophoblast lineage in vitro and in vivo.
- the isolated cell is a bovine cell.
- the method comprises contacting an in vitro cell culture or an isolated cell as described herein with an amount of the candidate compound and evaluating a characteristic of the in vitro cell culture or isolated cell.
- the characteristic is cell growth, cell development, differentiation, apoptosis, trophoblast development, trophoblast activity, or any combination thereof.
- aspects of the invention are draw n towards a cell culture comprising a population of bovine embryonic stem cells in a medium.
- the medium comprises one or more factors selected from the group consisting of a human leukemia inhibitory factor (hLIF), an inhibitor of glycogen synthase kinase-3 (GSK-3), an antagonist of muscarinic M2 and histamine Hl receptors, and an inhibitor of matrix metalloproteinase (MMP), or any combination thereof.
- hLIF human leukemia inhibitory factor
- GSK-3 glycogen synthase kinase-3
- MMP matrix metalloproteinase
- the amount of the human leukemia inhibitory factor is about 10 ng/ml.
- the amount of the glycogen synthase kinase-3 inhibitor is about 3pM.
- the amount of the muscarinic M2 and histamine Hl receptor antagonist is about 2pM.
- the amount of the matrix metalloproteinase inhibitor is about 2pM.
- the cell culture is in a microwell plate.
- the cell culture further comprises a population of trophoblast stem cells.
- the population of trophoblast stem cells comprises a population of bovine trophoblast stem cells.
- FIG. 1 provides a representation showing the derivation and characterization of bovine trophoblast stem cells (bTSC) in vitro.
- Panel A provides a schematic diagram representing derivation of bovine TSC from blastocyst.
- Panel B provides bright field images of the outgrowths of blastocysts and typical morphologies of bovine TSC on feeder or feeder-free.
- D5 outgrowth after 5 days culture; P15: passage 15; P60: passage 60. (Scale bar: 100 pm)
- Panel C provides a representation showing immunofluorescence staining for GATA3, KRT8, CDX2 and SOX2 in bovine Day 7 IVF blastocysts and bTSC.
- Panel D provides RT-PCR analysis of expression of CDX2, SFN, ELF5, GATA3, ASCL2, GATA2, ETS2 and GAPDHm bovine TSC.
- BEF bovine embryonic fibroblast;
- bESC bovine embryonic stem cells.
- Panel E provides a representation showing flow cytometry analysis of GATA3 in bTSC.
- FIG. 2 provides a representation showing bovine TSC in vitro developmental potential.
- Panel A provides a representation of immunofluorescent (IF) images showing binucleation in differentiated-bTSC (P27). (Scale bar: 100 pm)
- Panel B provides a representation showing IF staining images of differentiated-bTSC (P27) for PTGS2 and PL-1.
- IFNT interferon tau.
- Panel D provides a representation showing expression levels of IFNT in bTSC and during in vitro differentiation.
- Panel E provides a representation showing expression levels of binuclear trophoblast markers: BEVR-kl env, ERVE-A and PAGE
- Panel F provides a representation showing expression levels of trophoblast markers: PAG2, PAG 11 and PAG12 according to RNAseq data.
- Panel G provides a representation showing gene expression dynamics of functional trophoblast cells markers: CYP11A1, CYP17A1, FURIN, HAND1, PTGS2 and HSD3B1 during differentiation according to RNAseq data.
- Panel H provides a representation showing top 10 enriched gene ontology (GO) terms in Diff_D4 trophoblast compared with bTSC.
- GO gene ontology
- Panel I provides a representation showing gene set enrichment analysis (GSEA) of bTSC and Diff_D4 trophoblast cells. Green line shows enrichment profile. Vertical black bars show where genes from a given gene set are located. Data are presented as the mean ⁇ SD of three independent experiments. *P ⁇ 0.05, **p ⁇ 0.01, ***P ⁇ 0.001.
- GSEA gene set enrichment analysis
- FIG. 3 provides a representation showing engraftment of bTSCs into NOD-SCID mice.
- Panel A provides a representation showing NOD-SCID mice with tumor formed after bTSCs were injected.
- Left Tumors removed from mice after 9 days injection.
- Panel B provides a representation showing hematoxylin and eosin (H&E) staining in TS- derived lesion. Asterisk: necrotic area.
- Scale bar 200 pm
- Panel C Blood-filled lacunae (arrow).
- Panel D Binucleate cells.
- Panel E IF images stained for MMP2, PL-1 and PTGS2. (Scale bar: 75 pm).
- FIG. 4 provides a representation showing transcnptomic features of bovine TSC.
- Panel A provides a representation showing principal-component analysis (PCA) of global gene expression (RNA-seq) of bTSC, trophectoderm of day 7 IVF blastocyst (D7_TE), day 7 IVF blastocyst (BL), trophoblast from day 14 elongated embryos (D14 TE), bESC and bEPSC.
- Panel B provides a representation showing a PCA plot showing RNA-seq data from mouse ESC/TSC, human ESC/TSC and bovine ESC/TSC.
- Panel C provides a representation showing expression pattern of trophoblast and pluripotency marker genes in bTSC, D7_TE, BL, D14 TE, bESC and bEPSC.
- Panel D provides a representation showing a heatmap of highly expressed genes in bTSC.
- Panel E provides a representation showing KEGG pathway enriched in highly expressed genes in bTSC.
- Panel F provides a representation showing Top 5 enriched and depleted GO terms in bTSC compared with D7 TE or D14 TE.
- Panel G provides a representation showing GSEA comparison between bTSC and bESC and bEPSC ES . Genes with Hippo signaling pathway, lysosome and Tight j unction were upregulated in bTSC.
- FIG. 5 provides a representation showing ATAC-seq-based chromatin accessibility of bTSCs.
- Panel A provides a representation showing a sample Pearson correlation analysis for bTSC, D7_TE, D14_TE and Diff_D4 trophoblast cells.
- Panel B provides a representation showing the enrichment of ATAC-seq peaks at transcription start sites (TSS) in bTSC, D7 TE and D14 TE.
- Panel C provides a representation showing enriched motifs of bTSC.
- Panel D provides a representation showing genomic views of selected genes according to ATAC-seq data in bTSC, D7 TE and D14 TE.
- Panel E and Panel F show enriched and depleted KEGG in bTSC compared with D7 TE (Panel E) or D14 TE (Panel F) according to chromatin accessibility.
- FIG. 6 provides a representation showing DNA methylome profiling of bTSCs.
- Panel A provides a representation showing Pearson correlation coefficients for comparing DNA methylation levels between bTSC, D7_TE, D14_TE and bEPSC.
- Panel B provides a representation showing DNA methylation levels in bTSC, D7_TE, D14_TE and bEPSC. (bTSC, D7 TE and bEPSC: 2 replicates; D14 TE: 3 replicates).
- Panel C provides a representation showing Methylation levels at genomic features: promoter, exon, intron and intergemc in bTSC, D7_TE, D14_TE and bEPSC.
- Panel D provides a representation showing expression of DNA methylation genes in bTSC, D7 TE, D14 TE and bEPSC.
- Panel E provides a representation showing numbers of DMRs and corresponding genes between different groups.
- Panel F and Panel G provide a representation enriched KEGG of hypermethylated DMRs in D7 TE (Panel F) and D14 TE (Panel G).
- FIG. 7 provides a representation showing LCDM supports bESCs.
- Panel A provides a schematic diagram showing the transition of primed bESC into LCDM-ESC. (Scale bar: 100 pm).
- Panel B provides a representation showing IF staining images of SOX2, NANOG, CDX2 and GATA3 in LCDM-ESC, primed ESC and bTSC. (Scale bar: 75 pm).
- Panel C provides a representation showing PCA analysis of bovine inner cell mass (ICM), ESC, EPSCES, EPSCiPS and TSC.
- Panel D provides a representation showing Left: Venn diagram of upregulated genes in three groups. Right: Top 10 GO terms of upregulated genes in LCDM-ESC.
- Panel E provides a representation showing Left: Heatmap of specific genes in bESC, bEPSC ES , LCDM-ESC and bTSC respectively. Right: enriched GO terms of LCDM-ESC specific genes.
- FIG. 8 Panel A provides a representation showing a screening of basal mediums, growth factors and inhibitors required for bovine TSC in vitro and outgrowth rate for the media.
- Cl combination 1 ;
- DM Dimethinedene maleate;
- MH Minocycline hydrochloride.
- Panel B provides a representation showing the outgrowths of blastocysts after 7 days culture (top row) and Passage 3 (P3) cells (botom row) in C9, CIO and Cll mediums. (Scale bar: 100 pm.)
- FIG. 9 Panel A provides a representation showing IF analysis of GATA3, KRT8, CDX2 and SOX2 in bTSC at Passage 10 (P10) and Passage 55 (P55). (Scale bar: 50 pm.)
- Panel B provides a representation showing the karyotype for bTSC at passage 15 and 45, respectively.
- Panel C provides a representation showing bright field image of differentiated- TSC.
- Panel D provides a representation of IF images showing binucleation in differentiated-bTSC (P55).
- Panel E and Panel F provide a representation showing IF staining images of differentiated-bTSC (P55) for PL-1 and PTGS2. (Scale bar: 25 pm)
- FIG. 10 Panel A provides a representation showing PCA of global gene expression (RNA-seq) of bTSC and differentiated-TSC.
- Panel B provides a representation showing Pearson correlation analysis for bTSC and differentiated-TSC.
- Panel C provides a representation showing Pearson correlation analysis for bTSC, Day7 blastocyst (BL), D7_TE and D14_TE.
- Panel D provides a representation showing differential expression profile between bTSC and Diff_D4.
- Panel E provides a representation showing GO analysis for top 50 upregulated genes in Diff_D4.
- FIG. 11 Panel A provides a representation showing expression levels of SOX2. OCT4 and NANOG in bESC and LCDM-ESC.
- Panel B provides a representation showing relative expression levels of tight-j unction-related Claudin family genes in bESC and LCDM- ESC.
- Panel C and Panel D provide a representation showing transcriptome analysis of selected primed (Panel C) and naive (Panel D) pluripotency markers in bESC and LCDM- ESC (bESC: 2 replicates; LCDM-ESC: 3 replicates). Data are presented as the mean ⁇ SD of three independent experiments. *P ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001.
- FIG. 12 provides a representation showing the derivation and charactenzation of bovine TSCs.
- Panel A provides an illustration of the derivation of bTSCs from blastocysts.
- Panel B provides bright-field images of the outgrowths of blastocysts and typical morphologies of bTSCs on feeder or feeder free. D7, outgrowth after 7 days of culture, P15, passage 15; P60, passage 60. Scale bar: 100 pm.
- Panel C provides immunostaining for epiblast marker 80X2 and trophoblast markers (GATA3, KRT8, and CDX2) in bovine day 7 IVF blastocysts and bTSCs. Scale bar: 50 pm.
- Panel D provides flow cytometry quantification of GATA3 + cell population in bTSCs.
- Panel E provides immunostaining for bovine mature trophoblast markers (PL-1 and PTGS2) in differentiated-bTSCs (P55). Arrow: binucleate cells. Scale bar: 25 pm.
- Panel I provides H&E staining analysis of bovine TSC-derived lesion. Asterisk: necrotic area; arrow: blood-filled lacunae; arrowhead: binucleate cells. Scale bar: 200 pm.
- Panel J provides immunostaining for mature trophoblast markers (PL-1 and PTGS2) and trophoblast-endometrial regulator (MMP2) in TSC-derived lesion. Scale bar: 75 pm. (Panel F and Panel G) Data are presented as the mean ⁇ SD. *p ⁇ 0.001, **p ⁇ 0.0001, ***p ⁇ 0.00001, ****p ⁇ 0.000001.
- FIG. 13 provides a representation showing transcriptomic features of bovine TSCs.
- Panel A provides principal-component analysis (PCA) of global gene expression (RNA-seq) of bTSCs, trophectoderm of day 7 IVF blastocysts (D7 TE), day 7 IVF blastocysts (BLs), trophoblast from day 14 elongated embryos (D14 TE), bESCs, and bEPSCs.
- Panel B provides a PCA plot showing RNA-seq data from mouse ESCs/TSCs, human ESCs/TSCs, and bovine ESCs/TSCs.
- Panel C provides an expression pattern of trophoblast and pluripotency marker genes in bTSCs, D7 TE, BLs, D14 TE, bESCs, and bEPSCs.
- Panel D provides GSEA of transcriptomes between bTSCs, bESCs, and bEPSCs ES . Genes with Hippo signaling pathway and tight junction were upregulated in bTSCs.
- Panel E provides a heatmap of highly expressed genes in bTSCs (left). Enriched KEGG of bTSCs’ highly expressed genes (right).
- Panel F and Panel G provide representations showing the top 7 enriched and depleted KEGG in bTSCs compared with bEPSCs Xiang (Panel F) or bEPSCs ES (Panel G).
- FIG. 14 provides a representation showing epigenomic features of bovine TSCs.
- Panel A provides a motif enrichment analysis of ATAC-seq peaks from bTSCs.
- Panel B provides a representation showing the pathways enriched in genes with more accessible or closed chromatin in bTSC compared with D7_TE.
- Panel D provides a graph showing the expression levels of DNA methyltransferase (DNMT1, DNMT3A, and DNMT3B) in bTSCs, D7 TE, D14 TE, and bEPSCs.
- Panel E provides a representation showing the total number of identified differentially methy lated regions (DMRs) and their annotated genes between bTSCs and D7 TE or D14 TE.
- Panel F and Panel G provides representations showing enriched pathways associated with genes annotated from hypomethylated DMRs in bTSCs compared to D7 TE (Panel F) or D14 TE (Panel G).
- FIG. 15 provides a representation showing the characterization of bovine TSCs.
- Panel A provides representative images of the outgrowths of blastocysts after 7 days culture (top row) and cells after 3 passages (P3) (bottom row) in C9, CIO and Cl l medium. Scale bar: 100pm.
- Panel B provides karyotyping of bTSCs at passage 15 and 45, respectively.
- Panel C provides RT-PCR analysis of bovine trophoblast marker genes (CDX2, SFN, ELF5, GATA3, ASCL2, GATA2, and ETS2) in bovine TSCs. GAPDH serves as control.
- BEF bovine embryonic fibroblast
- bESC bovine embryonic stem cells.
- Panel D provides immunostaining for epiblast marker SOX 2. and trophoblast marker (GATA3, KRT8, CIJX2) in bTSCs at passage 10 (P10) and passage 55 (P55) (Scale bar: 50pm).
- Panel E provides a bright field image of differentiated-TSCs. Scale bar: 50pm.
- Panel F provides representative immunostaining images showing binucleation in differentiated-bTSCs (P27). Scale bar: 100 pm.
- Panel G provides representative immunostaining of mature trophoblast markers (PTGS2 and PL-1) in differentiated-bTSCs (P27). Scale bar: 75 pm.
- FIG. 16 provides a representation showing transcriptomic and epigenetic features of bovine TSCs.
- Panel A provides PCA analysis of trans criptomes of bTSC, D7 TE, D14 TE and differentiated-TSCs at day 2, 3, 4, 5, and 6.
- Panel B provides a representation showing the top 10 enriched gene ontology (GO) terms in Diff D4 trophoblast compared with bTSCs.
- Panel C provides gene set enrichment analysis (GSEA) of bTSC and Diff_D4 trophoblast cells. Green line shows enrichment profile. Vertical black bars show where genes from a given gene set are located.
- Panel D provides a representation showing the enriched GO terms of upregulated genes in Diff_D5 or Diff_D6.
- Panel E provides a representation showing NOD-SCID mice with tumor formed after bTSC were injected (Top row). Tumors removed from mice after 9 days injection (Bottom row).
- Panel F provides a representation showing the top 5 enriched and depleted GO terms in bTSC compared to D7 TE or D14 TE.
- Panel G provides a representation showing pathways enriched in genes with more accessible or closed chromatin in bTSC compared to D14 TE.
- Panel H and Panel I provide representations showing enriched pathways associated with genes annotated from hypermethylated DMRs in bTSCs compared to D7 TE (Panel H) or D14 TE (Panel I).
- FIG. 17 provides a schematic showing that bovine trophoblast stem cells (bTSCs) retain developmental potency to differentiate into mature trophoblast cells and exhibit transcriptomic and epigenetic features characteristic of trophectoderm cells from early bovine embryos.
- bTSCs bovine trophoblast stem cells
- aspects of the invention are drawn to methods of culturing, expanding, or growing a population of cells derived from a mammalian blastocyst.
- a zygote travels down the fallopian tube and mitotically divides many times to form a population of cells called a blastocyst.
- the blastocyst consists of an inner mass that develops into the embryo, while the outer layer develops into tissue that nourishes and protects the embryo.
- the blastocyst ataches onto the wall of the uterus and receives nourishment through the mother’s blood.
- the major systems structures of the calf develop during the embryonic period in a process called differentiation. During this stage, kidney, brain, spinal cord, nerve, heart, and blood cells start to develop, and the gastrointestinal tract begins to form.
- Trophoblasts are cells that form the outer layer of a blastocyst. They provide nutrients to the embryo and develop into a large part of the placenta. They form during the first stage of pregnancy and are the first cells to differentiate from the fertilized egg to become extraembryonic structures and do not directly contribute to the embryo.
- Embodiments as described herein comprise culturing cells derived from a mammalian blastocyst, for example, a bovine blastocyst.
- “Culturing” a cell or a population of cells can refer to propagating or nurturing a cell, collection of cells, tissue, or organ, by incubating for a period of time in an environment and under conditions which support cell viability or propagation.
- culturing a cell can maintain the cell under conditions in which it can proliferate, differentiate, and avoid senescence.
- the environment and conditions which support cell viability and/or propagation can include culturing a cell or a population of cells in a culture medium comprising human leukemia inhibitory factor (hLIF), an inhibitor of glycogen synthase kinase-3 (GSK-3), an antagonist of muscarinic M2 and histamine Hl receptors, an inhibitor of matrix metalloproteinase (MMP), or any combination thereof.
- hLIF human leukemia inhibitory factor
- GSK-3 glycogen synthase kinase-3
- MMP matrix metalloproteinase
- Culturing can include one or more of the steps of expanding and proliferating a cell or population of cells, and/or collecting a cell, a population of cells, a tissue, or and organ.
- “Expanding” a population of cells can refer to culturing the cells for a period of time and under conditions that not only allow the cells to grow and develop, but also proliferate, so that at the end of the expansion, more cells are obtained than before the expansion. For example, one cell can be expanded by cell division to two cells. In embodiments, expansion of a population of cells can occur spontaneously as certain cells proliferate in a culture. In other embodiments, expansion of a population of cells can require certain growth conditions, including but not limited to a minimum cell density, cell confluence on the culture vessel surface, or the addition of chemical factors such as growth factors, differentiation factors, or signaling factors.
- embodiments comprise culturing cells derived from a mammalian blastocyst.
- mammalian can refer to any mammal, non-limiting examples of which include a human, a primate, mouse, rat, dog, cat, bovine, cow, horse, pig, a fish, or a bird.
- bovine can refer to an animal from the cattle group, non-limiting examples of which include cows, buffalo, and bison.
- the method described herein comprises culturing mammalian cells in a culture medium.
- the terms “medium”, “cell culture medium”, “culture medium” can refer to a solution containing nutrients that nourish growing cells.
- the culture medium is useful for growing mammalian cells.
- a culture medium can provide essential and non-essential amino acids, vitamins, energy sources, lipids, and trace elements required by the cell for minimal growth and/or survival.
- a culture medium can also contain supplementary components (see discussion of “Supplementary components” below) that enhance growth and/or survival above the minimal rate, including, but not limited to, hormones and/or other growth factors, particular ions (such as sodium, chloride, calcium, magnesium, and phosphate), buffers, vitamins, nucleosides or nucleotides, trace elements (inorganic compounds present at very low final concentrations), amino acids, lipids, and/or glucose or other energy source.
- a medium is advantageously formulated to a pH and salt concentration optimal for cell survival and proliferation.
- the culture medium can comprise “supplementary components”, which can refer to components that enhance growth and/or survival above the minimal rate.
- supplementary components include hormones and/or other grow th factors, ions (such as sodium, chloride, calcium, magnesium, and phosphate), buffers, vitamins, nucleosides or nucleotides, trace elements (inorganic compounds present at very low' final concentrations), amino acids, lipids, and/or glucose or other energy source.
- supplementary components are added to the initial cell culture.
- supplementary components are added after the beginning of the cell culture.
- the term “defined medium” can refer to a medium in which the composition of the medium is both known and controlled. See, for example, the medium of Example 4.
- the cell culture can comprise a "nutrient source", which can refer to a composition, including the source itself, that nourishes growing mammalian cells.
- a "nutrient source” can refer to a composition, including the source itself, that nourishes growing mammalian cells.
- nutrient sources comprise DMEM, IDMEM, MEM, M199, RPMI 1640, Ham's F12, DMEM/F12, Ham's F10, McCoy's 5 A, NCTC 109, and NCTC 135.
- a “culture medium” can refer to a solution for growing, storing, handling and maintaining a cell, a population of cells, and/or cell lines.
- solutions can include factors required for or assist with cell attachment, cell growth, cell proliferation, maintenance of a cell in an undifferentiated state, and/or maintenance of the cellular environment.
- factors include salts, nutrients, minerals, vitamins, amino acids, nucleic acids, proteins such as cytokines, growth factors and hormones.
- the culture medium comprises a human leukemia inhibitory factor, an inhibitor of glycogen synthase kinase-3, an antagonist of muscarinic M2 and histamine Hl receptors, an inhibitor of matrix metalloproteinase, or any combination thereof.
- the culture medium can be a liquid solution that supports the growth of stem cells, such as trophoblast stem cells, and/or maintains them in an undifferentiated state.
- a "culture of mammalian cells” can refer to a liquid culture medium containing a plurality of mammalian cells that is maintained or proliferated under a controlled set of physical conditions.
- the culture medium can be a water-based medium.
- a “cell culture” can refer to cells growing in suspension or adhered to a variety of surfaces or substrates in a vessel, such as a roller bottle, tissue culture flask, dish, multi-well plate, and the like.
- the cell culture can refer to a population of cells, such as trophoblast stem cells, derived from a mammalian blastocyst and a culture medium comprising human leukemia inhibitory factor (hLIF), an inhibitor of glycogen synthase kinase-3 (GSK-3), an antagonist of muscarinic M2 and histamine Hl receptors, an inhibitor of matrix metalloproteinase (MMP), or any combination thereof.
- hLIF human leukemia inhibitory factor
- GSK-3 glycogen synthase kinase-3
- MMP matrix metalloproteinase
- the cell culture can comprise a plurality of cells in an undifferentiated state.
- a cell in an “undifferentiated state” can refer to a cell that does not have specialized structures or functions.
- an undifferentiated cell can refer to a cell having differentiation ability that has not entered the process of differentiating into a cell having a specific function as a tissue or organ.
- the undifferentiated cells are capable of self-renewal.
- the cell culture can comprise a plurality of cells capable of differentiation.
- “Differentiation” or “to differentiate” can refer to the process by which a less specialized cell (e.g., stem cells, embryonic cells) undergoes maturation to become more distinct in form and function, such as to acquire specialized structural and/or functional features characteristic of mature cells.
- the less specialized cell e.g., a stem cell or cell maintaining sternness
- the less specialized cell can progress from the stage of having the potential to differentiate into a cell of different cellular lineages to the stage of becoming a specialized and terminally differentiated cell.
- cellular structure alters and tissuespecific proteins appear.
- Non-limiting examples of undifferentiated cells include pluripotent stem cells, embryonic stem cells, progenitor cells, induced pluripotent stem cells, germ stem cells, and the like.
- Embodiments as described herein provide methods of culturing a population of cells derived from a mammalian blastocyst, wherein the population of cells maintain cell viability.
- Cell viability can refer to the ability of cells in culture to survive under a given set of culture conditions or experimental variations. The term can also refer to that portion of cells which are alive at a particular time in relation to the total number of cells, living and dead, in the culture at that time.
- the method as described herein can comprise placing a mammalian blastocyst in a vessel, thereby providing a vessel comprising a population of cells derived from a mammalian blastocyst.
- a vessel can refer to a type of culture ware which provides a contamination barrier to protect the cultures from the external environment while maintaining the proper internal environment.
- Non-limiting examples of a vessel comprise a flask, a tube, a Petri dish, a roller bottle, and/or a multi-well plate.
- culturing a population of cells as described herein can comprise centrifuging a culture vessel comprising the population of cells and the culture media.
- a culture vessel can be centrifuged at about 50 x g after the cell and medium is added to the plate.
- a culture vessel can be centrifuged at about 100 x g after the cell and medium is added to the plate.
- a culture vessel can be centrifuged at about 150 x g after the cell and medium is added to the plate.
- a culture vessel can be centrifuged at about 200 x g after the cell and medium is added to the plate.
- a culture vessel can be centrifuged at about 250 x g after the cell and medium is added to the plate.
- a culture vessel can be centrifuged at about 300 x g after the cell and medium is added to the plate.
- a culture vessel can be centrifuged at about 350 x g after the cell and medium is added to the plate.
- a culture vessel can be centrifuged at about 400 x g after the cell and medium is added to the plate.
- a culture vessel can be at about 450 x g after the cell and medium is added to the plate.
- the v-bottomed plate is centrifuged at about 500 x g after the cell and medium is added to the plate.
- the vessel can be seeded with fibroblast cells, such as mouse embryonic fibroblast cells.
- fibroblast cells such as mouse embryonic fibroblast cells.
- Cell seeding can refer to spreading cells into or onto a surface of a vessel.
- Fibroblast cells can refer to a cell that contributes to the formation of connective tissue and are not terminally differentiated. Fibroblasts are heterogeneous mesenchymal cells that play important roles in the production and maintenance of extracellular matrix.
- the trophoblast stem cells can be cultured with or without fibroblast feeder cells.
- a “fibroblast feeder cell” can refer to a cell of one type that can be cultured with a cell of another type to provide an environment in which the cell of the second type can grow.
- a trophoblast stem cell can be cultured with a MEF such that the trophoblast stem cell grows.
- the feeder cell can be a human feeder cell or can be a nonhuman feeder cell.
- the feeder cell can be a mouse embryonic fibroblast.
- feeder cell support refers to the ability of a feeder cell (e.g., fibroblasts) to maintain pluripotent stem cells in a proliferative and undifferentiated state when the pluripotent stem cells are co-cultured on the feeder cells or when the pluripotent stem cells are cultured on a matrix (e.g., an extracellular matrix, a synthetic matrix) in the presence of a conditioned medium generated by the feeder cells.
- a feeder cell e.g., fibroblasts
- a matrix e.g., an extracellular matrix, a synthetic matrix
- the support of the feeder cells depends on the structure of the feeder cells while in culture (e g., the three dimensional matrix formed by culturing the feeder cells in a tissue culture plate), function of the feeder cells (e.g., the secretion of growth factors, nutrients and hormones by the feeder cells, the growth rate of the feeder cells, the expansion ability of the feeder cells before senescence) and/or the attachment of the pluripotent stem cells to the feeder cell layer(s).
- the phrase “absence of feeder cell support” as used herein refers to a culture medium and/or a cell culture being devoid of feeder cells and/or a conditioned medium generated thereby.
- the vessel can comprise a “surface” to which the cell or population of cells can attach.
- the surface can be a solid substrate, a porous substrate, or another non-solid substrate.
- the solid surface can be coated with an insoluble substrate that, optionally, can in turn be coated with one or more additional surface coats of a substrate, or any other chemical or biological material that allows the cells to proliferate or be stabilized in culture.
- a substrate comprise any one or combination of polyomithine, laminin, poly-lysine, purified collagen, gelatin, fibronectin, tenascin, vitronectin, entactin, heparin sulfate proteoglycans, polyglycolytic acid (PGA), polylactic acid (PLA), and polylactic-glycolic acid (PLGA).
- a “porous surface”, for example, can refer to a surface which allows for the partitioning of cellular microenvironments in vitro, while still allowing physical and biochemical crosstalk between cells.
- the cells can be cultured on a surface coated with extracellular matrix or a component of extracellular matrix as described herein.
- aspects of the invention are drawn towards culturing a population of cells derived from a mammalian blastocyst.
- the terms “cell” and “population of cells” can refer to a plurality of cells (i.e., more than one cell).
- the population can be a pure population comprising one cell type.
- the population can include multiple cell types. Accordingly, there is no limitation on the types of cells that the population of cells can contain.
- the population of cells can comprise trophoblast stem cells or trophoblast stem-like cells.
- any suitable population of cells can be used in methods for culturing, expanding, or growing a population of cells derived from a mammalian blastocyst, such as trophoblast stem cells as described herein.
- the population of cells can comprise reproductive cells, e.g., female germline stem cells and progeny thereof.
- reproductive cells include, but are not limited to, embryos, oocytes, zygotes, blastomeres, morulae, and blastocysts.
- the population of cells can comprise somatic cells such as fibroblasts (e.g., embryonic fibroblasts or skin fibroblasts).
- Somatic cells can be obtained by well-known methods from different organs, e.g., skin, lung, pancreas, liver, stomach, intestine, heart, reproductive organs, bladder, kidney, urethra, and other urinary organs.
- somatic cells include, but are not limited to, adult stem cells, Sertoli cells, endothelial cells, granulosa epithelial, neurons, pancreatic islet cells, epidermal cells, epithelial cells, hepatocytes, hair follicle cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B lymphocytes and T lymphocytes), erythrocytes, macrophages, monocytes, mononuclear cells, fibroblasts, cardiac muscle cells, and other muscle cells.
- the suitable population of cells can be obtained from any suitable source.
- the population of cells can be obtained from a subject, for example, from tissue (e.g., embryotic tissue), bone (e.g, bone marrow), blood (e.g., peripheral blood or umbilical cord blood), bodily fluid (e.g., tear, urine, or saliva), serum, plasma, or protein, from a subject via any means known in the art.
- tissue e.g., embryotic tissue
- bone e.g, bone marrow
- blood e.g., peripheral blood or umbilical cord blood
- bodily fluid e.g., tear, urine, or saliva
- serum, plasma, or protein e.g., plasma, or protein
- a subject includes, but is not limited to, a human or a nonhuman mammal such as a rodent (e.g., a mouse or a rat), an ungulate (e.g., a horse or a pig), or bovine (e.g., cow).
- a “stem cell” can refer to an undifferentiated cell which is capable of essentially unlimited propagation in vivo or ex vivo and capable of differentiation to other cell types. This can be to certain differentiated, committed, immature, progenitor, or mature cell types present in the tissue from which it was isolated, or dramatically differentiated cell types that derive from a common precursor cell, or even to cell types at any stage in a tissue completely different from the tissue from which the stem cell is obtained.
- a stem cell can retain a constant potential for differentiation even after undergoing cell division.
- stem cells examples include embryonic stem cells (ES cells) with pluripotency derived from a fertilized egg or a clone embryo, somatic stem cells and pluripotent stem cells that are present in tissues in a live body, hepatic stem cells, dermal stem cells, and germ stem cells that serve as the bases for respective tissues, pluripotent stem cells derived from a germ stem cell, pluripotent stem cells derived from a somatic cell that are obtained by nuclear reprogramming, and the like.
- ES cells embryonic stem cells
- somatic stem cells and pluripotent stem cells that are present in tissues in a live body hepatic stem cells, dermal stem cells, and germ stem cells that serve as the bases for respective tissues
- pluripotent stem cells derived from a germ stem cell pluripotent stem cells derived from a somatic cell that are obtained by nuclear reprogramming, and the like.
- a “stem-like cell” can refer to cells that have some of the characteristics of stem cells. For example, they have some ability to self-renew.
- stem-like cells include, but are not limited to, progenitor cells, multipotent stem cells, cells undergoing process to induce pluripotency, cancer cells, cancer stem cells, hematopoietic stem cells, iPS, and some antibody producing hybridoma cells.
- a “trophoblast stem cell” can refer to the precursor of the differentiated cells of the placenta, which mediate the interactions between the fetus and the mother.
- a “pluripotent stem cell” can refer to a stem cell that permits cultivation in vitro.
- a pluripotent stem cell can differentiate into cells constituting the body.
- a “pluripotent stem cell” can be obtained from a fertilized egg, a clone embryo, a germ stem cell, or a stem cell in a tissue. Also included are cells having differentiation pluripotency similar to that of embryonic stem cells, conferred artificially by transferring several different genes to a somatic cell.
- An “embryonic stem cell” can refer to a cell which is obtained from the embryonic tissue formed after gestation (e.g., blastocyst) before implantation (i.e., a pre-implantation blastocyst), extended blastocyst cells (EBCs) which are obtained from a post- implantation/pre-gastrulation stage blastocyst, and embryonic germ (EG) cells which are obtained from the genital tissue of a fetus any time during gestation, preferably before 10 weeks of gestation.
- a “fetus” can refer to a mammal in the developmental stage after the embryonic stage and before birth, with fully differentiated but not yet fully grown organs.
- stem cells examples include mammalian embryonic stem cells or the like established by culturing a pre-implantation early embryo, embryonic stem cells established by culturing an early embryo prepared by nuclear- transplanting the nucleus of a somatic cell, trophoblast stem cells established from various species, including bovine, mouse, human, and nonhuman primates, and induced pluripotent stem cells (iPS cells) established by transferring several different genes to a somatic cell.
- mammalian embryonic stem cells or the like established by culturing a pre-implantation early embryo
- embryonic stem cells established by culturing an early embryo prepared by nuclear- transplanting the nucleus of a somatic cell
- trophoblast stem cells established from various species, including bovine, mouse, human, and nonhuman primates
- iPS cells induced pluripotent stem cells
- the cells are cultured on a surface coated with extracellular matrix or a component of extracellular matrix (ECM).
- ECM extracellular matrix
- the ECM can be composed of a variety of polysaccharides, water, elastin, and glycoproteins.
- glycoproteins can comprise collagen, entactin (nidogen), fibronectin, and laminin.
- ECM can be secreted by connective tissue cells. Different ty pes of ECM are known, each of which comprise different compositions including different types of glycoproteins and/or different combination of glycoproteins.
- ECM can be provided by culturing ECM-producing cells, for example fibroblast cells, in a vessel prior to the removal of these cells and the addition of isolated tissue fragments or isolated epithelial stem cells, such as a mammalian blastocyst.
- extracellular matrix-producing cells comprise chondrocytes, producing mainly collagen and proteoglycans; fibroblast cells, producing mainly type IV collagen; laminin; interstitial procollagens; fibronectin; colonic myofibroblasts producing mainly collagens (type I, III, and V); chondroitin sulfate proteoglycan; hyaluronic acid; fibronectin; and tenascin-C.
- ECM can be commercially provided.
- extracellular matrices comprise extracellular matrix proteins (Invitrogen) and basement membrane preparations from Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells (e.g., MATRIGELTM (BD Biosciences)).
- EHS Engelbreth-Holm-Swarm
- MATRIGELTM Manton-Holm-Swarm
- a synthetic extracellular matrix material such as ProNectin (Sigma Z378666) can be used. Mixtures of extracellular matrix materials can be used.
- an ECM for culturing stem cells can enhance the longterm survival of the stem cells and the continued presence of undifferentiated stem cells.
- Aspects of the invention can be further drawn to an in vitro cell culture comprising a population of cells derived from a mammalian blastocyst and a medium as described herein.
- the in vitro population of cells are capable of self-renewal. “Self-renewal” can refer to the process by which stem cells perpetuate themselves, such as to replenish mature cells to maintain tissue homeostasis throughout the lifespan of an organism. Selfrenewal is division with maintenance of the undifferentiated state.
- an isolated cell can refer to a cell that has been removed from its natural environment, for example, as a part of an organ, tissue, or organism.
- Markers can be used to identify and isolate different cell types.
- embodiments as described herein can comprise an isolated cell expressing at least one marker of pluripotency.
- pluripotency can refer to the ability of a cell to develop into the body or lineages of the body (i.e., embryo body).
- a pluripotent cell can develop into the three primary germ cell layers of the early embryo, and therefore into cells of the adult body.
- Pluripotent stem cells can undergo self-renewal and give rise to cells of the tissues of the body.
- Non-limiting examples of a marker of pluripotency comprise CDX2, GATA3, ELF3, TFAP2A, KLF5, KRT8, SFN, DNMT1, DNMT3A, PAG2, PAG11, PAG12, CYP17A1, HSD3B1, HAND1, or any combination thereof.
- Other exemplary markers the isolated cell can express include a marker of a signaling pathway.
- Non-limiting examples of a signaling pathway comprise Wnt signaling pathway, the LIF signaling pathway, the HIF-1 signaling pathway, the AKT signaling pathway, the AMPK signaling pathway, or any combination thereof.
- the population of cells can comprise at least one marker of a trophoblast stem cell.
- the resulting cell lines have TSC characteristics, including but not limited to trophoblast marker gene expression, self-renewal, long-term stable morphology, kary otype, and transcriptomic and epigenomic features).
- the population of cells can contribute to functional uninucleate and binuclear trophoblasts in vitro and in vivo.
- a “candidate compound” can refer to a compound or agent that is to be tested for an activity of interest.
- the method comprises contacting the cell culture or the isolated cell as described herein with an amount of the candidate compound, and evaluating a characteristic of the cell culture or isolated cell.
- characteristics that can be evaluated comprise cell growth, cell development, differentiation, apoptosis, trophoblast development, trophoblast activity, or any combination thereof.
- Assisted reproductive technology can refer to technology that assists in achieving pregnancy, including, but not limited to, in vitro fertilization (IVF), embryo transfer (e.g., transfer of embryos at any stage, including blastocysts), gamete intrafallopian transfer (GIFT), tubal embryo transfer (TET), intracytoplasmic sperm injection (ICSI) and intrauterine insemination (IUI).
- IVF in vitro fertilization
- embryo transfer e.g., transfer of embryos at any stage, including blastocysts
- GIFT gamete intrafallopian transfer
- TET tubal embryo transfer
- ICSI intracytoplasmic sperm injection
- IUI intrauterine insemination
- the trophoblast stem cells can be used for the assembly of an artificial blastoid.
- a “blastoid” can refer to stem cell-based blastocyst-like structures which resemble blastocysts in terms of morphology, size, cell number, and lineage composition and allocation.
- a “blastocyst” can refer to a thin-walled hollow structure in early embryonic development that contains a cluster of cells called the inner cell mass from which the embryo arises.
- the culture medium can comprise a human leukemia inhibitory factor, an inhibitor of glycogen synthase kinase-3, an antagonist of muscarinic M2 and histamine Hl receptors, an inhibitor of matrix metalloproteinase, or any combination thereof.
- GSK-3 inhibitor include CHIR99021, CHIR98014, CHIR98023, SB-216763 and SB-415286.
- Non-limiting examples of a muscarinic M2 and histamine Hl receptors antagonist include dimethinedene maleate (DiM).
- Non-limiting examples of an matrix metalloproteinase (MMP) inhibitor includes minocycline hydrochloride (MiH).
- the medium comprises two or more factors selected from the group consisting of a human leukemia inhibitory factor (hLIF), an inhibitor of glycogen synthase kinase-3 (GSK-3), an antagonist of muscarinic M2 and histamine Hl receptors, and an inhibitor of matrix metalloproteinase (MMP).
- hLIF human leukemia inhibitory factor
- GSK-3 glycogen synthase kinase-3
- MMP matrix metalloproteinase
- the medium comprises three or more factors selected from the group consisting of a human leukemia inhibitory factor (hLIF), an inhibitor of glycogen synthase kinase-3 (GSK-3), an antagonist of muscarinic M2 and histamine Hl receptors, and an inhibitor of matrix metalloproteinase (MMP).
- hLIF human leukemia inhibitory factor
- GSK-3 glycogen synthase kinase-3
- MMP matrix metalloproteinase
- the medium comprises a human leukemia inhibitory factor (hLIF), an inhibitor of glycogen synthase kinase-3 (GSK-3), an antagonist of muscarinic M2 and histamine Hl receptors, and an inhibitor of matrix metalloproteinase (MMP).
- hLIF human leukemia inhibitory factor
- GSK-3 glycogen synthase kinase-3
- MMP matrix metalloproteinase
- a modified chemical cocktail comprising bLCDM: hLIF, CHIR99021, Dimethinedene maleate (DiM), Minocycline hydrochloride (MiH)
- TSCs trophoblast stem cells
- long-term culture means that cells and/or aggregates of cells can be kept in viable state for durations longer than conventional methods of trophoblast stem cell culture, for example, for over 1 week to 6 weeks or longer.
- the methods as descnbed herein comprise culturing a population of cells derived from a mammalian blastocyst for a period of time in a culture medium comprising at least one human leukemia inhibitory factor, at least one inhibitor of glycogen synthase kinase-3 (GSK-3), at least one antagonist of muscarinic M2 and histamine Hl receptors, and at least one inhibitor of matrix metalloproteinase (MMP).
- the population of cells can be cultured for a period of time sufficient for the assembly of artificial blastocysts.
- the human leukemia inhibitory factor, glycogen synthase kinase-3 (GSK-3) inhibitor, muscarinic M2 and histamine Hl receptor antagonist, and/or matrix metalloproteinase (MMP) inhibitor can be provided in the culture medium in an effective amount.
- An "effective amount,” “effective dose,” or an “amount effective to,” as used herein, can refer to an amount of an agent that is effective in providing at least one characteristic of trophoblast stem cells (e.g., cell grow th, cell development, differentiation, apoptosis, trophoblast development, trophoblast activity, or any combination thereof). Such characteristics can be monitored by conventional methods or can be monitored according to methods described herein.
- An effective amount can vary depending on, for example, the human leukemia inhibitory' factor, the inhibitor of glycogen synthase kinase-3 (GSK-3), the antagonist of muscarinic M2 and histamine H l receptors, and the inhibitor of matrix metalloproteinase (MMP) used.
- GSK-3 glycogen synthase kinase-3
- MMP matrix metalloproteinase
- an effective amount of a human leukemia inhibitory factor can be between about 0.1 and about 10,000 ng/ml.
- the effective amount of the human leukemia inhibitory factor can be betw een about 1 and about 10,000 ng/ml, between about 10 and about 10,000 ng/ml, between about 100 and about 10,000 ng/ml, between about 1,000 and about 10,000 ng/ml, between about 5,000 and about 10,000 ng/ml, between about 0.1 and about 5,000 ng/ml, between about 1 and about 5,000 ng/ml, between about 10 and about 5,000 ng/ml, between about 1,000 and about 5,000 ng/ml, or between about 2,500 and about 5,000 ng/ml.
- the effective amount of the human leukemia inhibitory factor for the methods described herein can be between 0.1 and 100 pM. In some embodiments, the effective amount of the human leukemia inhibitory factor for the methods described herein can be between 0.1 and 90 pM, between 0.1 and 80 pM, between 0.1 and 70 pM, between 0. 1 and 60 pM, between 0. 1 and 50 pM, between 0.1 and 40 pM, between 0. 1 and 30 pM, between 0.1 and 20 pM, between 0.1 and 10 pM, between 0.1 and 1 pM, and between 0.1 and 0.5 pM.
- the effective amount of the human leukemia inhibitory factor for the methods described herein can be between 0.5 and 100 pM, between 1 and 100 gM, between 10 and 100 gM, between 20 and 100 gM, between 30 and 100 gM, between 40 and 100 gM, between 50 and 100 gM, between 60 and 100 gM, between 70 and 100 gM, between 80 and 100 gM, and between 90 and 100 gM.
- an effective amount of an inhibitor of glycogen synthase kinase-3 (GSK-3) for the methods described herein can be between 0.1 and 10,000 ng/ml.
- the effective amount of the inhibitor of glycogen synthase kinase-3 (GSK-3) for the methods described herein can be between 1 and 10,000 ng/ml, between 10 and 10,000 ng/ml, between 100 and 10,000 ng/ml, between 1,000 and 10,000 ng/ml, between 5,000 and 10,000 ng/ml, between 0.1 and 5,000 ng/ml, between 1 and 5,000 ng/ml, between 10 and 5,000 ng/ml, between 1,000 and 5,000 ng/ml, or between 2,500 and 5,000 ng/ml.
- the effective amount of the inhibitor of glycogen synthase kinase-3 (GSK-3) for the methods described herein can be between 0.1 and 100 gM. In some embodiments, the effective amount of the inhibitor of glycogen synthase kinase-3 (GSK-3) for the methods described herein can be between 0.1 and 90 gM, between 0.1 and 80 gM, between 0.1 and 70 gM, between 0.1 and 60 gM, between 0.1 and 50 gM, between 0.1 and 40 gM, between 0.1 and 30 gM, between 0.1 and 20 gM, between 0.1 and 10 gM, between 0.1 and 1 gM, and between 0. 1 and 0.5 gM.
- the effective amount of the inhibitor of glycogen synthase kinase-3 (GSK-3) for the methods described herein can be between 0.5 and 100 gM, between 1 and 100 gM, between 10 and 100 gM, between 20 and 100 gM, between 30 and 100 gM, between 40 and 100 gM, between 50 and 100 gM, between 60 and 100 gM, between 70 and 100 gM, between 80 and 100 gM, and between 90 and 100 gM.
- an effective amount of an antagonist of muscarinic M2 and histamine Hl receptors for the methods described herein can be between 0. 1 and 10,000 ng/ml.
- the effective amount of the antagonist of muscarinic M2 and histamine Hl receptors for the methods described herein can be between 1 and 10,000 ng/ml, between 10 and 10,000 ng/ml, between 100 and 10,000 ng/ml, between 1,000 and 10,000 ng/ml, between 5,000 and 10,000 ng/ml, between 0.1 and 5,000 ng/ml, between 1 and 5,000 ng/ml, between 10 and 5,000 ng/ml, between 1,000 and 5,000 ng/ml, or between 2,500 and 5,000 ng/ml.
- the effective amount of the antagonist of muscarinic M2 and histamine Hl receptors for the methods described herein can be between 0. 1 and 100 gM. In some embodiments, the effective amount of the antagonist of muscarinic M2 and histamine Hl receptors for the methods described herein can be between 0. 1 and 90 gM, between 0. 1 and 80 gM, between 0.1 and 70 gM, between 0.1 and 60 gM, between 0.1 and 50 gM, between 0.1 and 40 gM, between 0.1 and 30 gM, between 0.1 and 20 gM, between 0.1 and 10 gM, between 0.1 and 1 pM, and between 0.1 and 0.5 pM.
- the effective amount of the antagonist of muscarinic M2 and histamine Hl receptors for the methods described herein can be between 0.5 and 100 pM, between 1 and 100 pM, between 10 and 100 pM, between 20 and 100 pM, between 30 and 100 pM, between 40 and 100 pM, between 50 and 100 pM, between 60 and 100 pM, between 70 and 100 pM, between 80 and 100 pM, and between 90 and 100 pM.
- an effective amount of an inhibitor of matrix metalloproteinase (MMP) for the methods described herein can be between 0.1 and 10,000 ng/ml.
- the effective amount of the inhibitor of matrix metalloproteinase (MMP) for the methods described herein can be between 1 and 10,000 ng/ml, between 10 and 10,000 ng/ml, between 100 and 10,000 ng/ml, between 1,000 and 10,000 ng/ml, between 5,000 and 10,000 ng/ml, between 0.1 and 5,000 ng/ml, between 1 and 5,000 ng/ml, between 10 and 5,000 ng/ml, between 1,000 and 5,000 ng/ml, or between 2,500 and 5,000 ng/ml.
- the effective amount of the inhibitor of matrix metalloproteinase (MMP) for the methods described herein can be between 0.1 and 100 pM. In some embodiments, the effective amount of the inhibitor of matrix metalloproteinase (MMP) for the methods described herein can be between 0. 1 and 90 pM, between 0. 1 and 80 pM, between 0. 1 and 70 pM, between 0.1 and 60 pM, between 0.1 and 50 pM, between 0.1 and 40 pM, between 0. 1 and 30 pM, between 0.1 and 20 pM, between 0.1 and 10 pM, between 0.1 and 1 pM, and between 0.1 and 0.5 pM.
- MMP matrix metalloproteinase
- the effective amount of the inhibitor of matrix metalloproteinase (MMP) for the methods described herein can be between 0.5 and 100 pM, between 1 and 100 pM, between 10 and 100 pM, between 20 and 100 pM, between 30 and 100 pM, between 40 and 100 pM, between 50 and 100 pM, between 60 and 100 pM, between 70 and 100 pM, between 80 and 100 pM, and between 90 and 100 pM.
- MMP matrix metalloproteinase
- the culture medium can be changed after culturing the population of cells for a period of time.
- the contents of the culture medium can be changed after about 8 hours, about 12 hours, about 16 hours, about 24 hours, about 36 hours, or about 48 hours after culturing the population of cells.
- the medium is replaced with a medium without the human leukemia inhibitory factor.
- the medium is replaced with a medium without the GSK-3 inhibitor.
- the medium is replaced with a medium without the antagonist of muscarinic M2 and histamine Hl receptors.
- the medium is replaced with a medium without the inhibitor of matrix metalloproteinase.
- trophoblast cells as described herein can be used in methods for determining drug toxicity.
- the method can comprise (a) obtaining or providing a trophoblast cell produced by a method according to any herein described method (b) contacting the trophoblast cell as described herein with the drug; and (c) detecting signs of toxicity.
- Methods described herein encompass genetic manipulation of any of the populations of cells described herein.
- a genetic manipulation includes modifying, inserting, or deleting at least one of the genes in the cells.
- Genetic manipulation can include transduction with a vector such as a nonintegrating vector (e.g., an episomal vector) or an integrating vector (e.g., lentiviral vector).
- a vector such as a nonintegrating vector (e.g., an episomal vector) or an integrating vector (e.g., lentiviral vector).
- methods described herein involve genetically manipulating a population of cells using an episomal vector. Accordingly, in some embodiments, the population of cells involved in the methods described herein are gene-modified cells.
- a "vector,” as used herein is any nucleic acid vehicle (DNA or RNA) capable of facilitating the transfer of a nucleic acid molecule into cells.
- vectors include, but are not limited to, episomal vectors, plasmids, phagermds, viral vectors, and other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of a target nucleotide sequence.
- Viral vectors include, but are not limited to, vectors comprising nucleotide sequences derived from the genome of the following viruses: retrovirus; lentivirus; adenovirus; adeno-associated virus; SV 40-type viruses; polyomaviruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus.
- retrovirus lentivirus
- adenovirus adeno-associated virus
- SV 40-type viruses polyomaviruses
- Epstein-Barr viruses Epstein-Barr viruses
- papilloma viruses herpes virus
- vaccinia virus vaccinia virus
- polio virus polio virus
- Methods described herein encompass reprogramming the population of cells (e.g., the population of somatic cells) to a less differentiated state.
- Reprogramming refers to a process that alters or reverses the differentiation status of a cell (e.g., a somatic cell), which can be partially or terminally differentiated.
- Reprogramming includes complete reversion, as well as partial reversion, of the differentiation status of a cell.
- kits for culturing, expanding, or growing a population of cells derived from a mammalian blastocyst are provided.
- Non-limiting examples of components of the kit comprise cells, culture media, a vessel, and components as described herein, and instructions for use.
- the kit can be used to carry out the methods as described herein.
- the cells can be packaged in the kit by any suitable means for transporting and storing cells.
- the cells can be provided in frozen form, such as cryopreserved; dried form, such as lyophilized; or in liquid form, such as in a buffer.
- Cryopreserved cells for example, can be viable after thawing.
- a culture medium can be included in the kit.
- the culture medium can comprise essential and non-essential amino acids, vitamins, energy sources, lipids, and trace elements required by the cell for minimal growth and/or survival.
- the culture medium can comprise a human leukemia inhibitory factor, an inhibitor of glycogen synthase kinase-3, an antagonist of muscarinic M2 and histamine H l receptors, an inhibitor of matrix metalloproteinase, or any combination thereof.
- the culture medium can be packaged by any suitable means for transporting and storing media.
- the vessel can be a type of culture ware which provides a contamination barrier to protect the cultures from the external environment while maintaining the proper internal environment.
- a vessel can be a flask, a tube, a Petri dish, a roller bottle, and/or a multi-well plate.
- the instructions can include one or more of: a description of the cells of the kit; methods for thawing or preparing cells; culturing schedule; precautions; warnings; and/or references.
- the instructions can be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.
- a kit as described herein also includes packaging.
- the kit includes a sterile container which contains a therapeutic or prophylactic composition; such containers can be boxes, ampules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container forms known in the art.
- Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding cells or medicaments.
- Trophoblast stem cells are the precursors of the differentiated cells of the placenta, which mediate the interactions between the fetus and the mother.
- a modified chemical cocktail bLCDM: hLIF, CHIR99021, Dimethinedene maleate (DiM), Minocycline hydrochloride (MiH)
- bLCDM hLIF, CHIR99021, Dimethinedene maleate (DiM), Minocycline hydrochloride (MiH)
- the resulting cell lines have TSC characteristics (trophoblast marker gene expression, self-renewal, long-term stable morphology, karyotype, and transcriptomic and epigenomic features), and can contribute to functional uninucleate and binuclear trophoblasts in vitro and in vivo.
- the bovine TSC established here will provide a powerful tool to study placental trophoblast differentiation and function, and early pregnancy failure. Together with embryonic stem cells, the established TSCs and the bLCDM condition can be used for assembly of artificial blastocysts for varies Assisted Reproductive Technology (ART) applications.
- ART Assisted Reproductive Technology
- bovine TSC cell lines include, for example, 1) pregnancy drug screening and testing, 2) used as an in vitro model for basic and translational research on placental development (deposited into ATCC for sale), 3) assembly of artificial bovine blastocysts used for assisted reproductive technologies (in vitro breeding).
- Bovine TSCs and conditions to support bovine TSCs are not available to date.
- bovine trophoblast cells including trophoblast cell line (CT- 1 and CT-5, BT-1), and more recently an undifferentiated trophectoderm cell with the support of irradiated mouse embryonic fibroblast feeders (MEFs) have been derived from bovine blastocysts.
- trophoblast cell line CT- 1 and CT-5, BT-1
- MEFs irradiated mouse embryonic fibroblast feeders
- Placental trophoblasts play an essential role in communication between the fetus and mother.
- inadequate placental trophoblast development and subsequent dysfunction results in a range of adverse outcomes in conceptus/ offspring; for example, the abnormalities seen in IVF or somatic cell nuclear transfer embryos.
- the most significant barrier to progress in this field in the bovine is the lesser feasibility of an in vivo experimental system or the lack of manipulatable in vitro cell culture models that recapitulate placental cell differentiation.
- trophoblast stem cells TSC
- TSC trophoblast stem cells
- a culture condition containing a chemical cocktail of human leukemia inhibitory factor (hLIF), CHIR99021 (an inhibitor of glycogen synthase kinease-3 (GSK-3)), DiM (antagonist of muscarinic M2 and histamine Hl receptors), and MiH (inhibitor of matrix metalloproteinase (MMP)) allows for the long-term culture (over 55 passages) of bovine TSC without altered morphology and differentiation from bovine IVF embryos.
- hLIF human leukemia inhibitory factor
- CHIR99021 an inhibitor of glycogen synthase kinease-3 (GSK-3)
- DiM antagonist of muscarinic M2 and histamine Hl receptors
- MiH inhibitor of matrix metalloproteinase
- Placental trophoblast cells are specialized cells in the placenta that mediate the interactions between the fetus and the mother and arise from the trophectoderm (TE) of the blastocyst.
- TE trophectoderm
- TSCs trophoblast stem cells
- bovine TSC trophoblast stem cells
- the bovine TSC established here will provide a powerful tool to study placental trophoblast differentiation and function, and early pregnancy failure. Together with embryonic stem cells, TSCs can also be used for assembly of artificial blastocysts for varies Assisted Reproductive Technology (ART) applications (e.g., in vitro breeding).
- ART Assisted Reproductive Technology
- IVM-IVF embryos used in this study were produced using cumulus-oocyte complexes (COCs) and maintained with BO-Bioscience medium. Blastocysts were collected, and were removed the zona pellucida by pipetting, and were processed for TSC derivation.
- Each blastocyst was placed in a separate well of a 12-well plate that was seeded with mitomycin C-treated mouse embryonic fibroblast (MEF) cells (ATCC, Cat#: SCRC-1040).
- MEF mouse embryonic fibroblast
- each well of 6-well plate is added ImL Accutae and put back into the incubator for 4-5 minutes. Then, use the same volume of LCDM medium to inactivate Accutase.
- cells are resuspended in 1.5mL of LCDM medium per well of 6-well plate. Normally the cells are passaged at 1:6 ratio every 6 days.
- cells are cultured in 38.5°C, 5% CO2 incubator.
- bTSCs cultured on feeder cells were passaged to Matrigel (Coming, 354234)-coated plates using MEF-conditioned-bTSC-medium (MEF-bTSC).
- LCMD medium are incubated on MEF feeder for 24 hours, then are collected and stored at -20°C, call it conditioned-LCDM.
- Y-27632 is added to conditioned-LCDM, use this medium to resuspend cells and seed cells on Matrigel-coated plate. After 24 hours, remove Y-27632, and change fresh conditioned-LCDM every day.
- cryopreserved medium is 1: 1 of (1.7mL ProFreeze freezing medium + 0.3mL DMSO) and LCDM medium.
- EPS human and mouse extended pluripotent stem
- the transcriptome and epigenomics reconstruct trajectories of bovine placental trophoblast development and reveal enrichment for bovine trophoblast stem cell specific signatures.
- the LCDM condition supports long term culture of both bovine TSC and a formative ESC.
- the bovine TSC established in this study will provide a powerful model to study bovine early placental establishment and early pregnancy failure.
- Placental trophoblast cells are specialized cells in the placenta that mediate the interactions between the fetus and the mother and arise from the trophectoderm (TE) of the blastocyst.
- TE trophectoderm
- the hatched blastocysts will enter a special stage, elongation, where trophoblast cells will differentiate and rapidly proliferate for optimal attachment to maternal caruncles.
- undifferentiated trophectoderm cells, or trophoblast stem cells will differentiate to uninucleate trophoblast cells and subsequently binucleate giant cells [1, 2], which drive embryo elongation and eventually fuse with uterine epithelial cells to form feta-maternal hybrid cells to establish the interface for fetus and mother [3], Trophoblast development and function are pivotal for the success of pregnancy.
- trophoblast stem cells have been established from various species including mouse [7], human [8], and nonhuman primates [9], Accordingly, in ruminants, a number of cell lines, including CT-1 and CT-5 [10], trophoblast cell line, BT-1 [11]), and more recently a undifferentiated trophectoderm cell with the support of irradiated mouse embryonic fibroblast feeders (MEFs) [12], have been derived from bovine blastocysts. However, none of these cells meet the TSC criteria, i.e., i) are able to maintain long-term self-renewal, and 2) have in vitro and in vivo developmental capacity to the functional trophoblasts. Thus, the generation of self-renewal and stable bovine TSC lines remains unexplored.
- TSC trophoblast stem cells
- bovine TSCs we applied N2B27 basal medium supplemented with LIF, CHIR99021, Dimethinedene maleate (DM), Minocycline hydrochlonde (MH) to derive bovine TSCs.
- This medium robustly derives TSCs from bovine IVF blastocysts, and TSCs maintain long-term stable morphology, karyotype, transcriptomic and epigenomic features, and in vitro and in vivo developmental potential.
- the bovine TSCs we established in this study will provide a powerful model to study bovine early placental establishment and early pregnancy failure, and, without wishing to be bound by theory, can be useful for artificial reproductive technologies.
- FIG. 1, panel A We first tested for culture conditions that allowed for robust growth bovine TE- derived cells from blastocysts (FIG. 1, panel A). We examined fourteen small molecules (eleven culture conditions) (FIG. 8, panel A) according to the important signaling pathways enriched in the primary undifferentiated trophoblast cells [12] and the pathways involved in deriving mouse and human trophoblast stem cells and expanded potential stem cells [7, 8, 17, 18], With the support of a layer of MEF feeder cells, four conditions (8 (C8: N2B27, LIF, and inhibitors to Wnt (CHIR99021), muscarinic M2/histamine Hl (DM), and MMP (MH); 9 (C9: N2B27, 10% KSR, LIF, bFGF, and inhibitors to Wnt (CHIR99021), MEK1/MEK2 (PD0325901), TGF-p (Activin A); 10 (CIO: N2B27, 10% KSR, LIF, bFGF, and
- C9 cannot support the TE derived cells beyond five passages without differentiation.
- the other three conditions (C8, CIO, and Cl 1) have allowed for blastocysts to attach to the feeder layers at Day 2 and form colonies at Day 7, with an outgrowth ratio of 89.3 % (25/28), 66.7 % (8/12) and 53.3% (8/15) for C8, CIO, and Cl 1, respectively (FIG. 8, panel A).
- the unattached blastocysts at day 2 can be physically pressed to attach to the feeder layers and maintain outgrowth.
- bTSCs expressed bovine TE markers including CDX2, GATA3 and KRT8 but not the inner cell mass (ICM) marker SOX2, which had the same expression pattern with TE of blastocysts (FIG. 1, panel C and FIG. 9, panel A).
- ICM inner cell mass
- they expressed bovine trophectoderm associated transcriptional factors (CDX2, SFN, ELF3, GAT A3, ASCL2, GATA2 and ETS2), (FIG. 1, panel D and panel E), and displayed homogeneity (FIG. 1, panel E).
- Bovine placenta consists of two cell populations, uninuclear and binuclear trophoblast cells. Binuclear trophoblast cells account for 20% of trophoblast cells throughout gestation [2], Next, we validated whether bTSCs can differentiate into functional binuclear trophoblasts in vitro. Initial culture of bTSCs in a N2B27 basal medium cannot sustain of cell differentiation. As reported, forskolin, a cAMP agonist, can reduce lipid content and induce cell fusion [19, 20], In a culture system containing forskolin, Y27632 and 4% KSR, bTSCs underwent differentiate into binuclear cells (FIG. 2, panel A, FIG.
- the differentiated cells expressed bovine trophoblast markers, PTGS2 and placental lactogen 1 (PL-1) (FIG. 2, panel B, FIG. 9, panel E and FIG. 9, panel F).
- the abundance of PTGS2 significantly increased during Day 16 to 19 compared to Day 7 to 13, which had the same pattern as IFNT2, showing a role in maternal recognition [21], PL-1, expressed in bovine trophoblast cells, plays a vital role in placentation[22].
- Interferon tau produced by mononuclear trophoblast cells of the conceptus in ruminants, is the signal for maternal recognition of pregnancy [23], By testing IFNT activity using a Luciferase-based IFN stimulatory response element (ISRE) assay during differentiation [24], we found that daily release of IFNT significantly increased upon differentiation and peaked at Day 5 (FIG. 2, panel C). The mRNA expression level of IFNT was also significantly increased upon differentiation (FIG. 2, panel D).
- ISRE Luciferase-based IFN stimulatory response element
- MMP2 expression increased significantly during peri-implantation stage, it is a key factor for trophoblast cells and endometrial epithelia talk and remodeling of endometrial matrices [33]
- RNA-seq analysis of bTSCs TE from day 7 blastocysts (D7 TE) and day 14 elongated embryos (D14 TE) in bovine, and compared our findings with those from published RNA-seq dataset of bovine primed ESCs (bESCs) and expanded potential stem cells (bEPSCs) [34, 35], Day 7 blastocyst (BL, majority cells are trophectoderm cells) was also included.
- PCA Principal Component Analysis
- Pearson correlation analysis of transcriptomic data indicated consistent measurements between biological replicates across developmental stage (FIG. 4, panel A and FIG. 10, panel C).
- the transcriptomic data in the PCI dimension showed bTSCs clustered tightly as a group separate from both ESCs/EPSCs and TEs/BL (FIG. 4, panel A).
- the transcriptomic data in the PC2 dimension appeared to align the bTSCs between two distinct developing trophoblast groupings, namely the stages representing trophectoderm stem cells at preimplantation embryo (D7 TE) and elongation trophoblasts at periimplantation stage (D14_TE) (FIG.
- bTSCs expressed trophoblast markers including KLF5, SFN, GATA2, GATA3, TBX3, KRT7, TEAD4, CDX2, and TEAP2A, but not pluripotency markers (POU5F1, SOX2, and NANOG) with a few of exceptions (e.g., LIN28A and SALL4), while their expression had contrasting trends in ESCs and EPSCs ( Figure 4C).
- Lin28A is reported to have a functional role in regulating trophoblast differentiation and function in ruminants [36], Differences between bTSCs and TEs was also observed, with low or no expression of trophoblast transcriptional factors (KRT7, TEAD3, ELF3, CDX2, and TFAP2A) in TEs (FIG. 4, panel C), indicating the distinct sternness of bTSC in vitro and that bTSC emerge from matured TE.
- KRT7, TEAD3, ELF3, CDX2, and TFAP2A trophoblast transcriptional factors
- Hippo signaling stimulates initiating TE differentiation among human, bovine and mouse [37]
- Actin is one of prominent functional cytoskeletal proteins which maintain the dynamic state and vesicle transport during blastocoel formation, blastocyst hatching and embryo implantation [12]
- Trophoblast cells are connected by tight junctions to prevent the exchange of fluid and allow the accumulation of fluid inside of blastocyst.
- Focal adhesion are upregulated in placental development in goat and sheep [29]
- dysregulated focal adhesion proteins can affect binuclear organization and trophoblast polarity [38]
- bTSCs showed more similarity with D14_TE compared to D7_TE (FIG. 5, panel D). Furthermore, we analyzed the differential enrichment of ATAC-seq peaks between bTSCs, D7_TE and D14_TE. Genes with open chromatin accessibilities in bTSCs compared to D7_TE and D14_TE were involved in MAPK, HIF-1, TGF-beta, focal adhesion, and signaling regulating PSCs (FIG. 5, panel E and panel F), which is in agreement with our findings of transcriptome analysis.
- the genes with lower accessible chromatin in bTSCs compared to D7_TE represented the pathways including cGMP-PKG, Hippo, and calcium signaling pathways, arginine and proline metabolism and cellular senescence, while genes involved in Rapl, oxytocin, apelin, Estrogen, Wnt, and GnRH signaling pathways had more accessible chromatin in D14 TE compared to bTSCs (FIG. 5, panel E and panel F).
- This analysis identified important candidate regulators and signaling networks directing bovine trophoblast lineage specification.
- Hypermethylated DMRs in D7_TE compared to bTSCs enriched in Ras signaling, cGMP-PKG signaling, Hippo signal and mTOR signaling (FIG. 6, panel F). While hypermethylated DMRs in D14 TE mainly focused on calcium signaling, Ras signaling, cGMP-PKG signaling, Notch signaling and estrogen signaling (FIG. 6, panel G) These results are consistent with those of transcriptome and chromatin accessibility. Taken together, these signaling are vital play ers in regulating trophoblast development.
- LCDM was previously used to generate mouse EPSC [39], we next sought to test if LCDM can sustain bovine ESCs. Under the LCDM condition, bovine primed ESCs maintained stable growth kinetics and exhibited colony morphology of dome shaped nai ve- like ESCs during long-term self-renewal (FIG. 7, panel A). The LCDM-ESCs had an increased expression of SOX2 compared to primed bESCs but were negative for NANOG (FIG. 7, panel B) The mRNA expression level of SOX2 was significantly increased comparing with primed bESCs, while the expression levels of OCT4 and NANOG were significantly decreased (FIG. 11, panel A).
- the LCDM-ESCs were confirmed no expression of trophoblast markers CDX2 and GAT A3, which is distinct from of TSCs cultured in the same condition (FIG. 7, panel B)
- primed ESCs form tight junctions and express high levels of tight-j unction related genes when compared to naive ESCs [40].
- the mRNA expression levels of some tight-junction related genes (CLDN6, CLDN7 and CLDN10) in LCDM-ESCs were significantly decreased when compared with primed ESCs (FIG. 11, panel B)
- LCDM-ESCs As a separate group and placed LCDM-ESCs between ICM and bESCs, and more closed to bEPSCs (FIG. 7C), indicating LCDM-ESCs can be a specific embryonic stem cell type between primed and naive ESCs.
- FIG. 7C bEPSCs
- CDX2 expression was high (>209 TPM) in bovine TSCs but much lower in trophoblast cells, and even was undetectable in bESCs and bEPSCs (0 TPM), indicating CDX2 is a vital regulator in bovine TSCs. It’s consistent with mouse TSCs, which Cdx2 is required for self-renewal[42].
- the embryos will hold the implantation and enter elongation on day 13, morphology' of embryos finally transit into filamentous, TE length and weight increase a lot, the length of conceptus can be over 20 cm after elongation [47], Therefore, it is reasonable mouse, human and bovine require different pathways to support TSC self-renewal.
- PARP1 plays diverse roles, such as DNA damage, chromatin modification, transcription and so on [48] .
- Parp 1 is involved in extraembryonic developmental potency in mouse EPSCs [39], and PARP activity' can be detected in bovine placenta [49], but the exact functions still need more work.
- MiH is also a non-selective inhibitor of MMP.
- MMP2 and MMP9 are expressed in cohort of tissues in bovine placentome [50], their activity plays a vital role during implantation in cow's. When MMP is inhibited, bovine TSC will keep selfrenewal, rather than differentiate into binuclear or multinuclear cells. When comparing with differentiated cells, the down-regulated of MAPK signaling was observed in bovine TSCs (FIG. 2, panel I) MAPK signaling is one of the important downstream signaling of muscarinic and histamine receptor [51],
- IFNT the signal for pregnancy recognition
- PTGS2 regulated by IFNT during early pregnancy, was detected in both transcription and protein level. How ever, little is known about the molecular mechanisms controlling the balance between uninucleate and binuclear trophoblast cells, which decides the success of elongation. And more precise markers at different pregnancy stages are needed to identify to support pregnancy test.
- LCDM can support bovine ESCs growth. Under LCDM, bovine primed ESCs change into tighter and domed-hke colonies, which expression of S0X2 is significantly increased. Moreover, LCDM-ESCs have higher expression levels of naive markers and lower levels of primed markers compared to primed bESCs (FIG. 11, panel C and panel D). Our results indicate that LCDM-ESCs have several distinct cellular and molecular features with primed bESCs and bEPSCs. Recently, Smith proposed that there is a specific stage, called formative phase, existed between naive and primed pluripotency phased [52], There are some criteria for evaluating formative pluripotency.
- bovine TSCs from IVF blastocysts, which opens new avenues for studying molecular and functional mechanisms of bovine trophoblast cells. Furthermore, our bovine TSC provides new possibilities for understanding the pathogenesis of failure embryo development associated with trophoblast defects.
- IVM-IVF embryos used in this study were produced as previously described [53], Briefly, bovine cumulus-oocyte complexes (COCs) were aspirated from selected follicles of slaughterhouse ovaries. BO-IVM medium (IVF Bioscience) was used for oocyte in vitro maturation, after which IVF was performed using cryopreserved semen from a Holstein bull with proven fertility. Embryos were then washed and cultured in BO-IVC medium (IVF Bioscience) at 38.5°C with 6% CO2. Blastocysts were collected, and were removed the zona pellucida by pipetting, and were processed for TSC derivation.
- COCs bovine cumulus-oocyte complexes
- mTSCs Mouse trophoblast stem cells
- FGF4 fibroblast growth factor 4
- hTSCs human trophoblast stem cells
- Cdx2, Gata3, Eomes and Elf5 are essential to maintain the undifferentiated state of mTSCs [42]
- TP63, GAT A3 and TEAD4 are reported as important players for the undifferentiated state [8]
- Each blastocyst was placed in a separate well of a 12-well plate that was seeded with mitomycin C-treated mouse embryonic fibroblast (MEF) cells.
- the embryos were cultured in bovine TSC medium containing DMEM: F12 (Gibco) and Neurobasal medium (Gibco) (1: 1), 0.5x N2-supplement (Gibco), 0.5x B27-supplement (Gibco), lx NEAA (Gibco), lx GlutaMAX (Gibco), 0.1 mM 2-mercaptoethanol (Gibco), 0.1% BSA (MP biomedicals), 10 ng/mL LIF (Peprotech, 300-05), 3 pM CHIR99021 (Sigma, SML1046), 2 pM Dimethinedene maleate (DM) (Tocris, 1425) and 2 pM Minocycline hydrochloride (MH) (Santa cruz, sc-203339)
- the cells were incubated at 38.5 °C and 5% CO2. After 48 hours of plating, the unattached embryos were pressed against to the bottom of the plates with needles under microscope. The culture medium was changed daily. At day 7 or 8, outgrowths were dissociated by Dispase (STEMCELL Technologies) for 5-10 mins at 38.5 °C, followed by twice washes with DMEM/F12. bTSC were passaged mechanically under a microscope. For optimal survival rate, 10 pM Rho-associated protein kinase (ROCK) inhibitor Y-27632 (Tocris, 1254) was added to the culture medium for 24 hours.
- ROCK Rho-associated protein kinase
- bTSCs were passaged every 6 days at a 1 :6 split ratio using Accutase (Gibco, All 10501). Each well of bTSCs was dissociated by 1 mL Accutase for 5 mins at 38.5 °C, the same volume of bTSCs medium was used to dilute Accutase for neutralizing the reaction. bTSCs were cryopreserved by ProFreeze Freezing medium (Lonza, 12-769E) according to the manufacturer’s instructions.
- bTSCs cultured on feeder cells were passaged to Matrigel (Coming, 354234)-coated plates using MEF-conditioned-bTSC-medium (MEF- bTSC).
- Bovine TSCs were grown to 80-90% confluence in the bTSCs medium and dissociated with TrypLE (Gibco, 12605-010) for 15 min at 38.5 °C. Then, bTSCs were seeded in a 6-well plate which was coated with 2.5 pg/mL Col IV (Coming, 354233) at a density of 1 - 1.5 * 105 cells per well and cultured in 2 mL differentiation medium containing DMEM: F12 and Neurobasal medium (1 : 1), with 0.5x N2-supplement, 0.5x B27-supplement, lx NEAA, lx GlutaMAX, 0.1 mM 2-mercaptoethanol, 0.1% BSA, 2.5 pM Y27632, 2 pM Forskolin (Sigma, F3917) and 4% KSR (Invitrogen, 10828028). The medium was changed every two days.
- Bovine primed ESCs were maintained on mitomycin C-treated MEF in mTeSRl (STEMCELL Technologies, 85851) supplemented with 2.5 pM IWR1 (Sigma, 10161) and 20 ng/mL FGF2 (Perotech, 100-18B). bESCs were passaged every 4 days at a 1 :3 ratio using TrypLE (Gibco, 12605-010), fresh medium was changed every day. Cells were incubated at 37°C and 5% CO2. [00114] LCDM culture bESCs
- the primary antibodies used in this experiment include anti-SOX2 (Biogenex, an833), anti-CDX2 (Biogenex, MU392A; 1:200), anti-GATA3 (Cellsignaling, D13C9; 1:200), and anti-KRT8 (Origene, BP5075; 1 :300).
- anti-SOX2 Biogenex, an833
- anti-CDX2 Biogenex, MU392A; 1:200
- anti-GATA3 Cellsignaling, D13C9; 1:200
- anti-KRT8 Origene, BP5075; 1 :300
- DAP1 ProLong Diamond Antifade
- Paraffin sections were deparaffinized and then boiled in sodium citrate buffer (pH 6.0) for 20 min for antigen retrieval. Sections were blocked in 5% goat serum in TBST for 1 hour and incubated with primary antibodies at 4 °C overnight. Then, the sections were incubated with fluorescence-conjugated secondary antibodies for one hour at room temperature. Nuclei were stained with DAPI (Invitrogen, DI 306).
- First-strand cDNA was synthesized using the iScript cDNA Synthesis Kit (BIO-RAD).
- the qRT-PCR was performed using SYBR Green PCR Master Mix (BIO-RAD) WITH specific primers (Table SI). Data were analyzed using the BIO-RAD software provided with the instrument. The relative gene expression values were calculated using the AACT method and normalized to internal control GAPDH.
- IFNT activity was measured by a established IFN stimulatory response element-reporter assay [24], Briefly, 5 - 10 * 105 Madin-Darby bovine kidney cells (MDBK) that are stably transduced with an ISRE-Luc reporter were plated into a well of 96-well polystyrene plates with opaque walls and optically clear bottoms (Coming) and cultured in MDBK growth medium (high glucose DMEM, 10% FBS and 1% Pen/Strep) at 37°C for 4 hours. After removal of MDBK grow th medium, 50 pL of sample or standard (Recombinant human IFN-a, IFNA: Millipore, IF007) were added.
- MDBK growth medium high glucose DMEM, 10% FBS and 1% Pen/Strep
- the standard curve was generated by a 1:3 serial dilution of IFNA.
- Cells were incubated at 37°C for 16 hours, then 50 pL One-Glow Luciferase reagent (Promega Corp; E6120) were added into each well, with a final volume of 100 pL. After mixture at a shaker platform for 10 minutes, the measurement was performed in a plate reader.
- bTSCs cells were grown to about 80% confluence in the bTSCs medium and dissociated with TrypLE. 5 x 106 bovine TS cells were resuspended in 200 pL 1: 1 of bTSC medium and Matrigel, and subcutaneously injected into 6-month-old non-obese diabetic (NOD)-severe combined immunodeficiency (SCID) mice. Lesions were collected at day 7 and 9, fixed in 4% PFA overnight at 4 °C for analysis.
- NOD non-obese diabetic
- SCID severe combined immunodeficiency
- bTSCs were incubated with bTSC medium containing 1 mL KaryoMAX colcemid solution (Gibco, 15212012) at 38.5 °C for 4-5 hours. Cells were then dissociated using 1 rnL Trypsin (Gibco, 25200-056) at 38.5 °C and centrifuged at 300 * g for 5 min. The cells were resuspended in IrnL PBS solution and centrifuged at 400 * g for 2 min. The supernatant was aspirated and 500 pL 0.56% KCI was added to resuspend the cells. The cells were incubated for 15 mm, then centrifuged at 400 x g for 2 min.
- KaryoMAX colcemid solution Gibco, 15212012
- RNA of bovine TSCs and ESCs was extracted using RNeasy Micro Kit (Qiagen). Pure trophectoderm of day 7 were isolated by placing embryos in a Petri dish with phosphate-buffered saline and performing microsurgery using a microblade under a microscope.
- the RNA-seq libraries were generated by using the Smart-seq2 v4 kit with minor modification from manufacturer’s instructions. Briefly, mRNA was captured and amplified with the Smart-seq2 v4 kit (Clontech). After AMPure XP beads purification, amplified RNAs were quality checked by using Agilent High Sensitivity D5000 kit (Agilent Technologies).
- RNAs were subject to library preparation (Nextera XT DNA Library' Preparation Kit; Illumina) and multiplexed by Nextera XT Indexes (Illumina).
- concentration of sequencing libraries was determined by using Qubit dsDNA HS Assay Kit (Life Technologies).
- the size of sequencing libraries was detemiined by means of High Sensitivity D5000 Assay in at Tapestation 4200 system (Agilent). Pooled indexed libraries were then sequenced on the Illumina NovoSeq platform with 150-bp paired-end reads.
- the Salmon tool [54] was applied to quantify the gene expression profile from the raw sequencing data, by using the Ensembl bovine genome annotation (ARS-UCD1.2). Transcript per million reads (TPM) was used as the unit of gene expression.
- TMM Transcript per million reads
- the edgeR tool [55] was applied to identify differentially expressed genes.
- the TMM algorithm implemented in the edgeR package was used to perform normalization of the read counts and estimation of the effective library sizes.
- Differential expression analysis was performed by the likelihood ratio test implemented in the edgeR package.
- the conventional statistical analyses were performed based on the R platform.
- the “contest” function was used to perform Spearman’s rank correlation test.
- Principal component analysis (PCA) on the gene expression profile was performed by using the “dudi.pca” function within the package “ade4”.
- the heatmaps were plotted by the “heatmap.2” function within the package “gplots”.
- the gene ontology and pathway analysis were performed by means of the David tool [56
- the ATAC-seq libraries from fresh cells were prepared as previously described [53], Shortly, cells or embryos were lysed on ice, then incubated with the Tn5 transposase (TDE1, Illumina) and tagmentation buffer. Tagmentated DNA was purified using MinElute Reaction Cleanup Kit (Qiagen).
- the ATAC-seq libraries were amplified by Illumina TrueSeq primers and multiplexed by index primers. Finally, high quality indexed libraries were then pooled together and sequenced on Illumina NovoSeq platform with 150- bp paired-end reads.
- ATACseq analysis was followed our established analysis pipeline [53], Quality assessed ATAC-seq reads were aligned to the bovine reference genome using Bowtie 2.3 with following options: -very -sensitive -X 2000 -no-mixed -no-discordant. Alignments resulted from PCR duplicates or locations in mitochondria were excluded. Only unique alignments within each sample were retained for subsequent analysis ATAC-seq peaks were called separately for each sample by MACS2 with following options: -keep-dup all - nolambda -nomodel. The ATAC-seq bigwig files were generated using bamcoverage from deeptools.
- the ATAC-seq signals were visualised in the Integrative Genome Viewer genome browser.
- the annotations of genomic features, including transcription start sites, transcription end sites (TES), promoters, CDS, introns, 5' UTR, 3' UTR and intergenic regions were downloaded from UCSC genome browser.
- the enrichment of transcriptional factor motifs in peaks was evaluated using HOMER (http://homer.ucsd.edu/homer/motif/).
- HOMER http://homer.ucsd.edu/homer/motif/).
- CCM sequenced fragments multiplied by one million
- WGBS data analysis was followed our established analysis pipelines [58, 59], Briefly, WGBS raw data were removed first 12-bp at the 5’ end of both pairs, and reads with adapters and low-quality bases by using TrimGalore-0.4.3. The trimmed sequences were mapped to the bovine genome (ARS-UCD1 2) using Bismark. Uniquely mapped reads were then removed PCR duplicated reads and non-converted reads using deduplicate bismark and filter_non_conversion. For avoiding the sequencing bias, only reads with lOx coverage was used in the downstream analysis.
- Methylation of each CpG site was calculated and methylation DNA methylation of each sample was calculated by averaging the consecutive genomic window of 3OO-bp tiles’ methylation.
- Genomic features including promoters (lOOObp upstream of transcription start site), exons, introns, CpG islands, intergenic regions were downloaded from University of California, Santa Cruz (UCSC) genome browser.
- the gene ontology and pathway analysis were performed by means of the David tool [56], [00137] References cited in this example:
- PARPS a small but powerful family of poly-ADP-ribose polymerases. Frontiers in Bioscience-Landmark, 2008. 13(8): p. 3046-3082.
- LCDM leukemia inhibitory factor [LIF], CHIR99021, dimethinedene maleate [DiM], minocycline hydrochloride
- EPCs extended pluripotent stem cells
- TSCs bovine trophoblast stem cells
- Trophoblasts are specialized cells in the placenta that mediate maternal-fetal crosstalk and are originated from the trophectoderm (TE) of the blastocyst.
- TE trophectoderm
- Pregnancy establishment in cattle requires TE elongation, a unique process in ruminants prior to apposition, attachment, and implantation. 1
- undifferentiated TE cells or so-called trophoblast progenitor cells, will differentiate to mononucleated trophoblast cells and subsequently binucleate giant cells 2,3 to drive embryo elongation and will eventually fuse with utenne epithelial cells to establish the interface for fetus and mother.
- Embryo loss and early pregnancy failure are major causes of infertility in cattle, 5,6 where the majority of losses occur during the first few weeks of pregnancy. 7 9 Proper trophoblast development and function are pivotal for the success of pregnancy.
- trophoblast stem cells TSCs
- TSCs trophoblast stem cells
- TE cells of bovine blastocysts retain the plasticity to generate inner cell mass (ICM) cells, and vice versa, 18 19 which prompted us to test de novo derivation of bovine TSCs with different combinations of basal media, growth factors, and chemicals that were previously used for culturing pluripotent stem cells (PSCs) (Table 1).
- PSCs pluripotent stem cells
- Table 1 Culture condition screened for the derivation of bovine TSCs.
- EPC extended pluripotent stem cell
- LCDM human LIF [hLIF], CHIR99021, DiM, and MiH
- bTSC-LCs bovine TSC-like cells
- Removing each hLIF, CHIR99021, DiM, and MiH failed to maintain the morphology and self-renewal of bTSCLCs.
- bTSC-LCs can also be maintained feeder free on Matrigel in the presence of MEF-conditioned LCDM medium (FIG. 12, panel B).
- bTSC-LCs maintained stable colony morphology and a normal diploid number of chromosomes (60) after long-term in vitro culture (FIG. 12, panel B; FIG. 15, panel B); (2) bTSC-LCs highly expressed TE-related transcription factors (TFs) (CDX2, SFN, ELF5, GAT A3, ASCL2, GATA2, and ETS2) (FIG. 15, panel C); (3) similar to TE cells in bovine blastocysts, at the protein level, bTSC-LCs expressed CDX2, GAT A3, and KRT8 but not SOX2 (FIG. 12, panel C; FIG. 15, panel D); and (4) the majority of bTSC-LCs were found GATA3 + (FIG. 12, panel D).
- TFs TE-related transcription factors
- bTSC-LCs express bona fide TE-related TFs at mRNA and protein levels, and hereafter we refer to them as bTSCs.
- qRT-PCR analysis further showed that the expression of IFNT and mature trophoblast markers (BEVR-kl env, bEPVE- A, 22 and pregnancy associated glycoproteins 1 [PAG1] 23 ) were significantly upregulated following bTSC differentiation (FIG. 12, panel G).
- Differentiated trophoblasts (day 4) had an upregulation of genes enriched in Gene Ontology (GO) terms related to morphogenesis, cell migration, and locomotion (FIG. 16, panel B), indicating the presence of invasive trophoblast cells.
- differentiated trophoblast cells expressed a number of genes involved in extracellular matrix (ECM)- receptor interaction, tumor necrosis factor (TNF), interleukin- 17 (IL-17), and MAPK signaling pathways (FIG. 16, panel C), which is consistent with the increase of these signaling activities during implantation and placental development in ruminants and humans.
- ECM extracellular matrix
- TNF tumor necrosis factor
- IL-17 interleukin- 17
- MAPK signaling pathways FIG. 16, panel C
- top GO terms enriched in upregulated genes in day 6 versus day 5 during bTSC differentiation were related to cell apoptosis (FIG. 16, panel D), indicating reduced cell viability. These coincided with the drop of IFNT activity (FIG. 12, panel F) and downregulation of mature trophoblast marker gene expression (FIG. 12, panel G).
- Binucleated cells were identified in the peripheral regions of the lesions and expressed PL-1 and PTGS2, indicating trophoblast maturation (FIG. 12, panel I and panel J).
- MMP2 a key factor for trophoblast-endometrial epithelia crosstalk and remodeling of endometrial matrices 30 ) located at the peripherals of the lesions (FIG. 12, panel J)
- bTSCs were separated from D7_TE, day 7 IVF blastocysts, D14 TE, bESCs, and bEPSCs (FIG. 13, panel A).
- bTSCs were distinct from bEPSC 33 that were cultured in the LCDM condition supplemented with KSR serum and higher concentrations of DiM (2 mM), MiH (2 mM), and CHIR99021 (1 mM) (FIG. 13, panel A, panel F, and panel G), while both bEPSCs FS and bEPSCs Xiang that derived from two different conditions showed similar transcriptomic profiles (FIG. 13, panel A).
- bTSCs highly expressed two pluripotency -related genes, LIN28A and SALL4 (FIG. 13, panel C), and trophoblast-related genes KRT7, TEAD3, ELF3, CDX2, and TFAP2A, which is in contrast with TE cells of early embryos (FIG. 13, panel C).
- bTSC trans criptomes were enriched with GO terms related to intracellular transport and metabolic process (FIG.
- WGBS analysis showed that the overall methylation level of bTSCs (56.75%) was much higher than those of D7 TE (29.90%) and D14_TE (28.03%) but lower than that of bEPSCs32 (79.80%) (FIG. 14, panel C). This is in line with the higher levels of DNA methyltransferases (DNMT1, DNMT3A, and DNMT3B) in bTSCs and bEPSCs (FIG. 14, panel D). We were able to identify differentially methylated regions (DMRs) between bTSCs and D7_TE/D14_TE (FIG. 14, panel E).
- DMRs differentially methylated regions
- hypomethylated regions in bTSCs compared to D7 TE and D14 TE included genes that were involved in metabolism including Ras, cGMP-PKG, calcium signaling, and purine metabolism (FIG. 14, panel F and panel G).
- the hypermethylated regions in bTSCs compared with D7 TE were enriched in adherens junction, insulin resistance, sphingolipid, and IL-17 signaling, while MARK, oxytocin, glycosaminoglycan biosynthesis, gap junction, and chemokine signaling were enriched in the hypermethylated regions in bTSCs compared with D14_TE (FIG. 16, panel H and panel I).
- RNA-seq, ATAC-seq, and WGBS analyses provide comprehensive transcriptomic and epigenomic profiles of bTSCs and shed light on the molecular features during the earliest steps of placenta development in bovine.
- an EPSC culture condition (LCDM) 16 can support de novo derivation of stable bTSCs from blastocysts.
- LCDM-derived bTSCs showed the capacity to self-renew long term in culture while retaining the potential to differentiate into mature trophoblast cells.
- Comprehensive transcriptome and epigenome analyses of bTSCs and TEs revealed the molecular features during bovine early placenta development and predicted regulators of bovine trophoblast differentiation.
- the data presented here fill a gap and add a reliable stem cell model for research into placenta development of an ungulate species.
- the LCDM condition was originally developed for the derivation and longterm culture of mouse and human EPSCs with intra- and interspecies developmental potency, respectively, toward both embryonic and extraembryonic tissues. 16 More recently, the LCDM condition has been successfully used to generate porcine induced pluripotent stem cells (iPSCs) 38 from pericytes and embryonic fibroblasts, as well as porcine PSCs (pLCDM) from in vivo blastocysts. 39 Interestingly, unlike mouse and human EPSCs, pLCDM is prone to trophoblast differentiation, and TSC-LCs can be generated from pLCDM using the human TSC conditions. 11 The LCDM condition was also recently tested in bovine.
- porcine induced pluripotent stem cells iPSCs
- pLCDM porcine PSCs
- bovine iPSCs can be culture adapted in LCDM medium into EPSCs, as well as directly reprogramed from fetal fibroblasts that exhibit embryonic and extraembryonic potency in bovine-mouse chimeras. 33 Interestingly, however, the LCDM condition failed to support the derivation of EPSCs directly from bovine blastocysts. 33 Consistent with this, under the LCDM condition, we did not find EPSC-like colonies, but TSC-like cells can be readily observed from blastocyst outgrowth.
- MiH is known to inhibit PARP, and its family member, PARP1, that plays diverse roles, such as DNA damage, chromatin modification, transcription regulation, and histone modification. 43 PARP1 facilitates SOX2 to bind to intractable genomic loci, which drive the expressions of key pluripotency genes. 44 Inhibition of PARP1 is required for maintenance of extraembryonic developmental potency in mouse EPSCs but did not affect the self-renewal. 16 MiH is also a nonselective inhibition of MMP9 that is expressed in the trophoblast cells. MMP9 can degrade components of the ECM to provide a suitable environment for tissue remodeling and migration of binuclear trophoblast cells.
- Bovine blastocyst-derived trophectoderm and endoderm cell cultures interferon tau and transferrin expression as respective in vitro markers. Biol. Reprod. 62, 235-247.
- Bovine-blastocyst-like structures derived from stem cell cultures Cell Stem Cell 30, 611-616.
- Bovine trophoblastic cell differentiation and binucleation involves enhanced endogenous retrovirus element expression. Reprod. Biol. Endocrinol. 10, 41. https://doi.org/10 1186/1477-7827-10-41.
- RNA sequencing reveals novel gene clusters in bovine conceptuses associated with maternal recognition of pregnancy and implantation. Biol. Reprod. 85, 1143-1151. https://doi.org/10.1095/biolreprod.l l l.092643.
- Trophoblast cell differentiation in the bovine placenta differentially expressed genes between uninucleate trophoblast cells and trophoblast giant cells are involved in the composition and remodeling of the extracellular matrix and O-glycan biosynthesis.
- TNF-A regulated endometrial stroma secretome promotes trophoblast invasion.
- Connexin31 -deficient trophoblast stem cells a model to analyze the role of gap junction communication in mouse placental development. Dev. Biol. 273, 63-75. https://doi.Org/10.1016/j.ydbio.2004.04.037.
- LCDM medium supports the derivation of bovine extended pluripotent stem cells with embryonic and extraembr onic potency in bovine-mouse chimeras from iPSCs and bovine fetal fibroblasts.
- PARP-1 determine Sox2 pioneer activity at intractable genomic loci. Mol. Cell 65, 589- 603. e9.
- IVF embryos used in this study were produced as previously described. 55 Briefly, bovine cumulus-oocyte complexes (COCs) were aspirated from selected follicles of slaughterhouse ovaries. BO-IVM medium (IVF Bioscience) was used for oocyte in vitro maturation. IVF was performed using cryopreserved semen from a Holstein bull with proven fertility. Embryos were then washed and cultured in BO-IVC medium (IVF Bioscience) at 38.5°C with 6% CO2. Day 7 blastocysts were collected with the zona pellucida removed and were processed for TSC derivation.
- COCs bovine cumulus-oocyte complexes
- Each blastocy st was placed in a separate well of a 12-well plate that was seeded with mitomycin C-treated mouse embryonic fibroblast (MEF) cells.
- the embryos were cultured in bovine TSC medium containing DMEM: F12 (Gibco) and Neurobasal medium (Gibco) (1: 1), 0.5x N2-supplement (Gibco), 0.5x B27-supplement (Gibco), lx NEAA (Gibco), lx GlutaMAX (Gibco), 0.1 mM 2-mercaptoethanol (Gibco), 0.1% BSA (MP biomedicals), 10 ng/mL LIF (P eprotech, 300-05), 3 mM CHIR99021 (Sigma, SML1046), 2 mM Dimethinedene maleate (DiM) (Tocris, 1425) and 2 mM Minocycline hydrochloride (MiH) (Santa cruz
- the cells were cultured at 38.5°C and 5% CO2. After 48 hours of plating, the unattached embryos were pressed against to the bottom of the plates with needles under microscope. The culture medium was changed daily. At day 7 or 8, outgrowths were dissociated by Dispase (STEMCELL Technologies) for 5-10 mins at 38.5°C, followed by twice washes with DMEM/F12. bTSC were passaged mechanically under a microscope. For optimal survival rate, 10 mM Rho-associated protein kinase (ROCK) inhibitor Y-27632 (Tocris, 1254) was added to the culture medium for 24 hours.
- ROCK Rho-associated protein kinase
- bTSCs were passaged every 6 days at a 1 :6 split ratio using Accutase (Gibco, All 10501). Each well of bTSCs was dissociated by ImL Accutase for 5 mins at 38.5°C, the same volume of bTSCs medium was used to dilute Accutase for neutralizing the reaction. bTSCs were cryopreserved by ProFreeze Freezing medium (Lonza, 12-769E) according to the manufacturer’s instructions.
- bTSCs cultured on feeder cells were passaged to Matrigel (Coming, 354234)-coated plates using MEFconditioned-bTSC-medium (MEF- bTSC).
- Bovine TSCs were grown to 80-90% confluence in the bTSCs medium and dissociated with TrypLE (Gibco, 12605-010) for 15 min at 38.5°C. Then, bTSCs were seeded in a 6-well plate which was coated with 2.5 pg/mL Col IV (Coming, 354233) at a density of 1 - 1.5 x 10 5 cells per well and cultured in 2 mL differentiation medium containing DMEM: F12 and Neurobasal medium (1:1), with 0.5x N2-supplement, 0.5x B27-supplement, lx NEAA, lx GlutaMAX, O.lmM 2-mercaptoethanol, 0.1% BSA, 2.5 pM Y27632, 2 pM Forskolin (Sigma, F3917) and 4% KSR (Invitrogen, 10828028). The medium was changed every two days.
- the primary antibodies used in this experiment include anti-SOX2 (Biogenex, an833), anti-CDX2 (Biogenex, MU392A; 1:200), anti-GATA3 (Cellsignaling, D13C9; 1:200), and anti-KRT8 (Origene, BP5075; 1 :300).
- the cells were incubated with Fluor 488- or 555- or 633-conjugated secondary antibodies 1 hour at room temperature.
- ProLong Diamond Antifade was used to stain nuclei. The images were taken with a fluorescence confocal microscope (Leica).
- Paraffin sections were deparaffinized and then boiled in sodium citrate buffer (pH 6.0) for 20 min for antigen retrieval. Sections were blocked in 5% goat serum in TBST for 1 hour and incubated with primary antibodies at 4°C overnight.
- the primary antibodies used in this experiment including anti-MMP2 (Cellsignaling, 40994; 1:200), anti-PL-1 (Santa Cruz, sc-376436; 1:200) and anti-PTGS2 (Sigma, SAB2500267; 1:100-1:200). Then, the sections were incubated with fluorescence-conjugated secondary antibodies for one hour at room temperature. Nuclei were stained with DAPI (Invitrogen, DI 306).
- First-strand cDNA was synthesized using the iScript cDNA Synthesis Kit (BIO-RAD).
- the qRT-PCR was performed using SYBR Green PCR Master Mix (BIORAD) with specific primers (Table 2).
- Data were analyzed using the BIORAD software provided with the instrument.
- the relative gene expression values were calculated using the AACT method and normalized to internal control GAPDH.
- CDX2 AAGACAAATACCGGGTCGTG CTGCGGTTCTGAAACCAAAT
- IFNT activity was measured by an established IFN stimulatory response element-reporter assay. 21 Briefly, 5 - 10 * 10 5 Madin-Darby bovine kidney cells (MDBK) that are stably transduced with an ISRE-Luc reporter were plated into a well of 96-well polystyrene plates with opaque walls and optically clear bottoms (Coming) and cultured in MDBK growth medium (high glucose DMEM, 10% FBS andl% Pen/Strep) at 37°C for 4 hours. After removal of MDBK growth medium, 50 pL of sample or standard (Recombinant human IFN-a, IFNA: Millipore, IF007) were added.
- MDBK growth medium high glucose DMEM, 10% FBS andl% Pen/Strep
- the standard curve was generated by a 1:3 serial dilution of IFNA.
- Cells were incubated at 37°C for 16 hours, then 50 pL One-Glow Luciferase reagent (Promega Corp; E6120) were added into each well, with a final volume of 100 pL. After mixture at a shaker platform for 10 minutes, the measurement was performed in a plate reader.
- bTSCs cells were grown to about 80% confluence in the bTSCs medium and dissociated with TrypLE. 5 x 10 6 bovine TS cells were resuspended in 200 pL 1 :1 of bTSC medium and Matrigel, and subcutaneously injected into 6-month-old non-obese diabetic (NOD)-severe combined immunodeficiency (SCID) mice. Lesions were collected at day 7 and 9, fixed in 4% PF A overnight at 4°C for analysis.
- NOD non-obese diabetic
- SCID severe combined immunodeficiency
- bTSCs were incubated with bTSC medium containing 1 mL KaryoMAX colcemid solution (Gibco, 15212012) at 38.5°C for 4-5 hours. Cells were then dissociated using 1 mL Trypsin (Gibco, 25200-056) at 38 5°C and centrifuged at 300 x g for 5 min. The cells were resuspended in ImL PBS solution and centrifuged at 400 x g for 2 min. The supernatant was aspirated and 500 pL 0.56% KCI w as added to resuspend the cells. The cells were incubated for 15 min, then centrifuged at 400 x g for 2 min.
- KaryoMAX colcemid solution Gibco, 15212012
- RNA of bovine TSCs was extracted using RNeasy Micro Kit (Qiagen). Trophectoderm from day 7 blastocyst was isolated by placing embryos in a Petri dish with phosphate-buffered saline and performing microsurgery using a microblade under a microscope. The RNA-seq libraries were generated by using the Smart-seq2 v4 kit with minor modification from manufacturer’s instructions. Briefly, mRNA was captured and amplified with the Smart-seq2 v4 kit (Clontech). After AMPure XP beads purification, amplified RNAs were quality checked by using Agilent High Sensitivity D5000 kit (Agilent Technologies).
- RNAs were subject to library preparation (Nextera XT DNA Library' Preparation Kit; Illumina) and multiplexed by Nextera XT Indexes (Illumina).
- concentration of sequencing libraries was determined by using Qubit dsDNA HS Assay Kit (Life Technologies).
- the size of sequencing libraries was determined by means of High Sensitivity D5000 Assay in at Tapestation 4200 system (Agilent). Pooled indexed libraries were then sequenced on the Illumina NovaS eq platform with 150-bp paired-end reads.
- the StnngTie 48 was applied to quantify the gene expression profile from the raw sequencing data, by using the Ensembl bovine genome annotation (ARS-UCD1.2). Transcript per million reads (TPM) was used as the unit of gene expression.
- TPM Transcript per million reads
- the DESeq2 49 was applied to identify differentially expressed genes.
- the TMM algorithm implemented in the DESeq2 package was used to perform normalization of the read counts and estimation of the effective library sizes. Differential expression analysis was performed by the likelihood ratio test implemented in the DESeq2 package. The conventional statistical analyses were performed based on the R platform. The “contest” function was used to perform Spearman’s rank correlation test.
- PCA Principal component analysis
- the ATAC-seq libraries from fresh cells were prepared as previously described. 55 Shortly, cells or embryos were lysed on ice, then incubated with the Tn5 transposase (TDE1, Illumina) and tagmentation buffer. Tagmentated DNA was purified using MinElute Reaction Cleanup Kit (Qiagen). The ATAC-seq libraries were amplified by Illumina TrueSeq primers and multiplexed by index primers. Finally, high quality indexed libraries were then pooled together and sequenced on Illumina NovaSeq platform with 150- bp paired-end reads.
- TDE1 Tn5 transposase
- Tagmentated DNA was purified using MinElute Reaction Cleanup Kit (Qiagen).
- the ATAC-seq libraries were amplified by Illumina TrueSeq primers and multiplexed by index primers. Finally, high quality indexed libraries were then pooled together and sequenced on Illumina NovaSeq platform with 150- bp paired-end
- ATACseq analysis was followed our established analysis pipeline. 55 Quality assessed ATAC-seq reads were aligned to the bovine reference genome using Bowtie 2.3 with following options: -very -sensitive -X 2000 -no-mixed -no-discordant. Alignments resulted from PCR duplicates or locations in mitochondria were excluded. Only unique alignments within each sample were retained for subsequent analysis. ATAC-seq peaks were called separately for each sample by MACS2 with following options: -keep-dup all - nolambda -nomodel. The ATAC-seq bigwig files were generated using bamcoverage from deeptools.
- the ATAC-seq signals were nonnalized in the Integrative Genome Viewer genome browser.
- the annotations of genomic features, including transcription start sites, transcription end sites (TES), promoters, CDS, introns, 5’ UTR, 3’ UTR and intergenic regions were downloaded from UCSC genome browser.
- the enrichment of transcriptional factor motifs in peaks was evaluated using HOMER (http://homer.ucsd.edu/homer/motif/).
- HOMER http://homer.ucsd.edu/homer/motif/).
- CCM sequenced fragments multiplied by one million
- WGBS libraries were prepared using the TruSeq DNA Methylation Library Preparation Kit (Illumina). Briefly, genomic DNA was isolated using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s guide. Then, approximately 500 ng DNA were bisulfite treated using EZ DNA Methylation Kit (Zymo Research). Bisulfite- converted DNA was end-repaired, dA-tailed, and ligated with adapters following instructions of the TruSeq DNA Methylation Library Preparation Kit. Finally, high quality indexed libraries were then pooled and sequenced on Illumina NovaSeq platform with 150-bp paired- end reads.
- WGBS data analysis was followed our established analysis pipelines. 57,58 Briefly, WGBS raw data were removed first 12-bp at the 5’ end of both pairs, and reads with adapters and low-quality bases by using TrimGalore-0.4.3. The trimmed sequences were mapped to the bovine genome (ARS-UCDI 2) using Bismark. Uniquely mapped reads were then removed PCR duplicated reads and nonconverted reads using deduplicate bismark and filter_non_conversion. For avoiding the sequencing bias, only reads with lOx coverage was used in the downstream analysis.
- ARS-UCDI 2 bovine genome
- Methylation of each CpG site was calculated and methylation DNA methylation of each sample was calculated by averaging the consecutive genomic window of 300-bp tiles’ methylation.
- Differentially methylated regions were defined as common 3OO-bp tiles between two compared groups, which methylation levels >75% in one group, while ⁇ 25% in another, and were significantly different by Fisher’s exact test (P-value ⁇ 0.05, FDR ⁇ 0.05).
- Hyper- and hypo-methylated tiles were those with DNA methylation levels >75% and ⁇ 25%, respectively.
- the gene ontology and pathway analysis were performed by means of the David tool. 56
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Developmental Biology & Embryology (AREA)
- Gynecology & Obstetrics (AREA)
- Biochemistry (AREA)
- Reproductive Health (AREA)
- Epidemiology (AREA)
- Pregnancy & Childbirth (AREA)
- Veterinary Medicine (AREA)
- Cell Biology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263370192P | 2022-08-02 | 2022-08-02 | |
| US202263413789P | 2022-10-06 | 2022-10-06 | |
| PCT/US2023/029334 WO2024030501A2 (en) | 2022-08-02 | 2023-08-02 | Bovine trophoblast stem cells and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4565677A2 true EP4565677A2 (en) | 2025-06-11 |
Family
ID=89849693
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP23850719.8A Pending EP4565677A2 (en) | 2022-08-02 | 2023-08-02 | Bovine trophoblast stem cells and uses thereof |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP4565677A2 (en) |
| CN (1) | CN120187832A (en) |
| AU (1) | AU2023319978A1 (en) |
| CA (1) | CA3262188A1 (en) |
| MX (1) | MX2025001166A (en) |
| WO (1) | WO2024030501A2 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2026087445A1 (en) * | 2024-10-21 | 2026-04-30 | Roslin Technologies Limited | Ungulate ipsc derivation and culture |
| CN120464577A (en) * | 2025-04-28 | 2025-08-12 | 西湖大学 | Culture medium for obtaining porcine pluripotent stem cells and induction culture method for porcine pluripotent stem cells |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040082062A1 (en) * | 1998-06-19 | 2004-04-29 | Sarah Robertson | Method and medium for in vitro culture of human embryos |
| US9018010B2 (en) * | 2009-11-12 | 2015-04-28 | Technion Research & Development Foundation Limited | Culture media, cell cultures and methods of culturing pluripotent stem cells in an undifferentiated state |
| US11028369B2 (en) * | 2015-08-13 | 2021-06-08 | Beihao Stem Cell And Regenerative Medicine Research Institute Co., Ltd. | Induced extended pluripotent stem cells, method of making and using |
-
2023
- 2023-08-02 WO PCT/US2023/029334 patent/WO2024030501A2/en not_active Ceased
- 2023-08-02 AU AU2023319978A patent/AU2023319978A1/en active Pending
- 2023-08-02 CN CN202380068813.1A patent/CN120187832A/en active Pending
- 2023-08-02 CA CA3262188A patent/CA3262188A1/en active Pending
- 2023-08-02 EP EP23850719.8A patent/EP4565677A2/en active Pending
-
2025
- 2025-01-28 MX MX2025001166A patent/MX2025001166A/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| CA3262188A1 (en) | 2024-02-08 |
| CN120187832A (en) | 2025-06-20 |
| MX2025001166A (en) | 2025-05-02 |
| WO2024030501A2 (en) | 2024-02-08 |
| WO2024030501A3 (en) | 2024-03-14 |
| AU2023319978A1 (en) | 2025-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Io et al. | Capturing human trophoblast development with naive pluripotent stem cells in vitro | |
| Ealy et al. | BOARD INVITED REVIEW: Post-transfer consequences of in vitro-produced embryos in cattle | |
| Shahbazi et al. | Early human development and stem cell-based human embryo models | |
| De Paepe et al. | Totipotency and lineage segregation in the human embryo | |
| Yang et al. | Derivation of pluripotent stem cells with in vivo embryonic and extraembryonic potency | |
| Wang et al. | Establishment of bovine trophoblast stem cells | |
| Hansen et al. | Regulation of present and future development by maternal regulatory signals acting on the embryo during the morula to blastocyst transition–insights from the cow | |
| CN118652837A (en) | Efficient derivation of stable pluripotent bovine embryonic stem cells | |
| Huang et al. | Establishment of bovine trophoblast stem-like cells from in vitro-produced blastocyst-stage embryos using two inhibitors | |
| WO2024030501A2 (en) | Bovine trophoblast stem cells and uses thereof | |
| Shibata et al. | Unique features and emerging in vitro models of human placental development | |
| Ramos-Ibeas et al. | An efficient system to establish biopsy-derived trophoblastic cell lines from bovine embryos | |
| Carreiro et al. | Cell differentiation events in pre-implantation mouse and bovine embryos | |
| Liu et al. | Bilineage embryo-like structure from EPS cells can produce live mice with tetraploid trophectoderm | |
| WO2023034720A1 (en) | Compositions and methods for cell reprogramming | |
| Prather et al. | A review of early mouse embryogenesis and its applications to domestic species | |
| Huang et al. | Chromatin accessibility memory of donor cells disrupts bovine somatic cell nuclear transfer blastocysts development | |
| Han et al. | MLL1 combined with GSK3 and MAP2K inhibition improves the development of in vitro-fertilized embryos | |
| AU2023317586A1 (en) | Bovine blastocyst like structures and uses thereof | |
| Aguila et al. | Haploid androgenetic development of bovine embryos reveals imbalanced WNT signaling and impaired cell fate differentiation | |
| Kim et al. | Distinct properties of putative trophoblast stem cells established from somatic cell nuclear-transferred pig blastocysts | |
| Latham | Early cell lineage formation in mammals: complexity, species diversity, and susceptibility to disruptions impacting embryo viability | |
| Winek et al. | Zygotic activin A is dispensable for the mouse preimplantation embryo development and for the derivation and pluripotency of embryonic stem cells | |
| US20260132373A1 (en) | Bovine blastocyst like structures and uses thereof | |
| Aguila et al. | Haploid androgenetic development in bovines reveals imbalanced WNT signaling and impaired cell fate differentiation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250123 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 40127754 Country of ref document: HK |