EP4558173A1 - Dendrimer-enabled targeted intracellular crispr/cas system delivery and gene editing - Google Patents
Dendrimer-enabled targeted intracellular crispr/cas system delivery and gene editingInfo
- Publication number
- EP4558173A1 EP4558173A1 EP23755291.4A EP23755291A EP4558173A1 EP 4558173 A1 EP4558173 A1 EP 4558173A1 EP 23755291 A EP23755291 A EP 23755291A EP 4558173 A1 EP4558173 A1 EP 4558173A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- dendrimer
- cas9
- cells
- cancer
- dendrimers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
- A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
- A61K47/595—Polyamides, e.g. nylon
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
- C12N9/222—Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
- C12N9/226—Class 2 CAS enzyme complex, e.g. single CAS protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- the invention is generally in the field of genetic modification using a CRISPR-CAS-based genome editing system conjugated to dendrimer for selective targeting.
- CRISPR clustered regularly interspaced short palindromic repeat
- RNP Cas9 ribonucleoprotein
- the CRISPR/Cas9 system includes S. pyogenes Cas9 nuclease and a single guide RNA (sgRNA): a nuclease protein, Cas9, cuts the specific double-stranded DNA while the sgRNA recognizes specific target genomic regions and translocates the sgRNA/Cas9 complex to target DNA sequence inside cells (Sander, et al. Nat Biotechnol 32, 347-355, (2014); Jinek, M. et al., Science 343, 1247997, (2014)).
- sgRNA single guide RNA
- the targeting RNA is composed of -20 nt sequence (protospacer) complementary to the target DNA with the sequence requirement of a protospacer adjacent motif (PAM) (5’-NGG) (Jinek, M. et al., Science 337, 816-821, (2012); van der Oost, et al. Nat Rev Microbiol 12, 479-492, (2014)).
- PAM protospacer adjacent motif
- Cas 9 RNP The efficient delivery of Cas 9 RNP is vital for efficient genome editing (Zhang, et al., Theranostics 11, 614-648, (2021); Glass, et al., Trends in biotechnology 36, 173-185, (2016)).
- Direct delivery of Cas9 RNP can significantly minimize the off-target mutations, achieve highly efficient gene editing, and reduce off-target effects, toxicity, and immune responses.
- RNP delivery offers genome editing efficacy even in embryonic stem cells, induced pluripotent stem, and tissue stem cells (D'Astolfo, D. S. et al., Cell 161, 674-690, (2015)).
- compositions that provide safe and efficient cellular targeting and intracellular delivery of CRISPR/Cas constructs, and methods of making and using thereof.
- the dendrimer can be covalently conjugated to the gene editing system via one or more of disulfide, ester, ether, or amide bonds, and optionally a hydrocarbon or oligoethylene glycol chain.
- the dendrimer is covalently conjugated to the gene editing system via a releasable bond.
- the linker preferably includes a glutathione sensitive disulfide bond, such as a gamma-aminobutyric acid linker.
- compositions including the genome editing composition and one or more pharmaceutically acceptable excipients are also provided.
- the pharmaceutical compositions are formulated for systemic administration such as parenteral or enteral administration, or local administration.
- Exemplary parenteral administrations include intramuscular, intraperitoneal, intravenous, or subcutaneous injection administration.
- the formulation is formulated for intranasal administration.
- G2-Glucose dendrimer (GD2) Cas9 conjugation for targeted neuronal delivery of CRISPR-Cas9 ribonucleoproteins is also provided.
- the pharmaceutical compositions are formulated for systemic administration such as parenteral or enteral administration, or local administration.
- Exemplary parenteral administrations include intramuscular, intraperitoneal, intravenous, or subcutaneous injection administration.
- the formulation is formulated for intranasal administration.
- G2-Glucose dendrimer (GD2) Cas9 conjugation for targeted neuronal delivery of CRISPR-Cas9 ribonucleoproteins
- the pharmaceutical formulation is administered in an effective amount to treat monogenic diseases and polygenic diseases such as cystic fibrosis, hemophilia, globinopathies, such as sickle cell anemia and beta-thalassemia, xeroderma pigmentosum, and lysosomal storage diseases.
- the pharmaceutical formulation is administered in an effective amount to treat a genetic disorder such as ocular diseases, neurological and/or neurodegenerative diseases, neurodevelopmental diseases, and cancer.
- Exemplary neurological and/or neurodegenerative diseases suitable to be suitable with the pharmaceutical formulation include Huntington’s disease, Amyotrophic Lateral Sclerosis (ALS), Alzheimer’s disease, Parkinson’s disease, Childhood Cerebral Adrenal Leukodystrophy (ccALD), muscular dystrophy, Friedreich ataxia, the spinocerebellar ataxias,
- Duchenne s muscular dystrophy, and spinal muscular dystrophy.
- exemplary neurodevelopmental diseases include cerebral palsy, fragile X syndrome, Down syndrome, Tay-Sachs disease, Sandhoff disease, Niemann-Pick disease, and sphingolipidoses.
- Exemplary cancers to be treated include bone cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, nasopharyngeal cancer, pancreatic cancer, prostate cancer, skin cancer, stomach cancer, and uterine cancer.
- the pharmaceutical formulation is administered in an effective amount to induce from about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100% reduction in the expression, translation, or activity of one or more oncogenes in the cancer.
- the pharmaceutical formulation is administered in an effective amount to induce from about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, up to 100% reduction in the expression, translation, or activity of one or more immune regulatory factors such as PD-1 or PD-L1.
- the method includes changing, adding, and/or deleting at least one nucleotide in the genomic segment in the target cell.
- Methods can also include a step of selecting a subject who is likely to benefit from treatment with the compositions of dendrimer-gene editing agent.
- FIG. 1 is a schematic showing stepwise synthesis of generation one (Gl) glucose dendrimer.
- FIG. 2 is a schematic showing stepwise synthesis of generation two (G2) glucose dendrimer.
- FIG. 3A-3C is a schematic showing stepwise synthesis of G2- Glucose-PEG4-TCO (3A) and shows the chemical structures of the intermediates TCO-PEG4-NHS ester (3B)and Cy5 (3B)used in the syntheses shown in FIG 4 and FIG 5.
- the subscripted numbers in the formulas indicate the number of attachments per dendrimer
- FIG. 4 is a schematic showing stepwise synthesis of Cy5-G2- Glucose-Cas9(2NLS).
- FIG. 5 is a MALDI-TOF of the Cy5-GD2-Cas9 of FIG. 4.
- FIG. 6 is a schematic showing synthesis of functionalized Cy5-D- PEG4-TCO and synthetic intermediates.
- the hydroxyl PAMAM dendrimer generation 6 (PAMAM-G6-0H) was treated with Boc -protected GABA linker, and the resulted product was deprotected using TFA.
- the product was labeled with Cy5 fluorophore and the resulted intermediate was conjugated with trans-cyclooctene (TCO) to obtain functionalized Cy5-D-PEG4-TCO.
- TCO trans-cyclooctene
- FIG. 7 is a schematic showing Me-Tz attached Cas9 nuclease 2NLS (S. pyogenes) and TCO attached hydroxyl PAMAM dendrimer reacting under physiological conditions to form Cy5-D-Cas9(2NLS) conjugate, using click chemistry strategy with tans-cyclooctene-tetrazine (TCO-Tz) chemistry in making Cy5-D-Cas9(2NLS) conjugate.
- TCO-Tz tans-cyclooctene-tetrazine
- FIG. 9 is a schematic showing route of nucleus 10 entry of Cy5-D- Cas9 (2NLS) 12.
- Dendrimer Cas9 conjugate 14 effectively delivered to the cytosol 16 of the cell 18, Cy5-D-Cas9-2NLS 12 undergoes reduction by intracellular glutathione, releasing Cas9(2NLS) 20, ultimately Cas9(2NLS) 20 localized in nucleus 10 or Cy5-D-Cas9(2NLS) conjugate 14 delivered to nucleus through nuclear pore complexes 22.
- FIG. 10A is a bar graph showing % GFP positive cells in D- Cas9/sgRNA and Lipo Cas9/sgRNA RNPs treated cells compared to HEK293T cells (GFP Negative) and GFP expressing HEK 293 cells (GFP positive) based on FACS analysis.
- FIG. 10B is a bar graph showing % GFP positive cells in D-Cas9/sgRNA and Lipo Cas9/sgRNA RNPs treated cells compared to HEK293T cells (GFP Negative) and GFP expressing HEK 293 cells (GFP positive) based on GFP expression.
- FIG. 10A is a bar graph showing % GFP positive cells in D- Cas9/sgRNA and Lipo Cas9/sgRNA RNPs treated cells compared to HEK293T cells (GFP Negative) and GFP expressing HEK 293 cells (GFP positive) based on GFP expression.
- FIG. 10D is a bar graph showing percent gene-edited cells (GFP negative cells) in HEK293T cells treated with different formulations of Cas9/sgRNA and Lipo Cas9/sgRNA RNPs.
- FIG. 11 is a schematic showing the predicted cut site of GFP target sequence as denoted by a dotted line.
- FIG. 12B is an enlarged bar graph showing percent gene-edited cells (i.e., VEGF negative cells) in ARPE-19 cells treated with Cas9/sgRNA and Lipo Cas9/sgRNA RNPs.
- FIG. 12C is a bar graph showing percent gene-edited cells (i.e., VEGF negative cells) in ARPE-19 cells treated with different dosages of Cas9/sgRNA and Lipo Cas9/sgRNA RNPs as indicated.
- FIG. 13A is a bar graph showing percent VEGF positive cells in ARPE-19 cells treated with D-Cas9/sgRNA and Lipo Cas9/sgRNA RNPs (VEGFA guide RNA 2) compared to VEGF antibody treated and untreated cells using flow cytometry.
- targeted gene refers to a gene or genomic component within a recipient cell, which has been selected for modification by the dendrimer conjugated CRISPR-Cas system.
- inhibitor or “reduce” in the context of inhibition, mean to reduce or decrease in activity and quantity. This can be a complete inhibition or reduction in activity or quantity, or a partial inhibition or reduction. Inhibition or reduction can be compared to a control or to a standard level. Inhibition can be measured as a % value, e.g., from 1% up to 100%, such as 5%, 10, 25, 50, 75, 80, 85, 90, 95, 99, or 100%.
- gene repression or deletion may inhibit or reduce the activity and/or expression of one or more target genes, or the activity or quantity of one or more expressed gene products by about 10%, 20%, 30%, 40%, 50%, 75%, 85%, 90%, 95%, or 100% from the activity and/or quantity of the same gene or gene product in a control cell that is not subjected to CRISPR-Cas-base gene editing.
- the inhibition and reduction are compared according to the level of mRNAs, or proteins corresponding to the targeted genetic element within the cell.
- the terms “individual,” “subject,” and “patient” are used interchangeably, and refer to a mammal, including, but not limited to, murines, simians, humans, mammalian farm animals, mammalian sport animals, and mammalian pets.
- active agent or “biologically active agent” are used interchangeably to refer to a chemical or biological compound that induces a desired pharmacological and/or physiological effect, which may be prophylactic, therapeutic, or diagnostic. These may be a nucleic acid, a nucleic acid analog, a small molecule having a molecular weight less than 2 kD, more typically less than 1 kD, a peptidomimetic, a protein or peptide, carbohydrate or sugar, lipid, or a combination thereof.
- the terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of agents, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, and analogs.
- therapeutic agent refers to an agent that can be administered to treat one or more symptoms of a disease or disorder.
- diagnostic agent generally refers to an agent that can be administered to reveal, pinpoint, and define the localization of a pathological process.
- the diagnostic agents can label target cells that allow subsequent detection or imaging of these labeled target cells.
- diagnostic agents can, via dendrimer, selectively target neurons, particularly neurons within the site of pathology in the eye, the brain, or the CNS.
- prolactic agent generally refers to an agent that can be administered to prevent disease or to prevent certain conditions.
- terapéuticaally effective amount refers to an amount of the therapeutic agent that, when incorporated into and/or onto dendrimers, produces some desired effect at a reasonable benefit/risk ratio applicable to any medical treatment.
- the effective amount may vary depending on such factors as the disease or condition being treated, the particular targeted constructs being administered, the size of the subject, or the severity of the disease or condition.
- One of ordinary skill in the art may empirically determine the effective amount of a particular compound without necessitating undue experimentation.
- the term “effective amount” refers to an amount of a therapeutic agent or prophylactic agent to reduce or diminish the symptoms of one or more ocular or neurological diseases.
- treating mean to ameliorate, reduce or otherwise stop a disease, disorder or condition from occurring or progressing in an animal which may be predisposed to the disease, disorder and/or condition but has not yet been diagnosed as having it; inhibiting the disease, disorder or condition, e.g.. impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and/or condition.
- Treating the disease or condition includes ameliorating at least one symptom of the particular disease or condition, even if the underlying pathophysiology is not affected, such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.
- Desirable effects of treatment include decreasing the rate of disease progression, ameliorating, or palliating the disease state, and remission or improved prognosis.
- an individual is successfully “treated” if one or more symptoms associated with Alzheimer’s disease are mitigated or eliminated, including, but are not limited to, reducing the rate of neuronal loss, decreasing symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, delaying the progression of the disease, and/or prolonging survival of individuals.
- pharmaceutically acceptable refers to compositions, polymers, and other materials and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- pharmaceutically acceptable carrier refers to pharmaceutically acceptable materials, compositions, or vehicles, such as a liquid or solid filler, diluent, solvent, or encapsulating material involved in carrying or transporting any subject composition, from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of a subject composition and not injurious to the patient.
- biodegradable generally refers to a material that will degrade or erode under physiologic conditions to smaller units or chemical species that are capable of being metabolized, eliminated, or excreted in vivo.
- the degradation time is a function of composition and morphology.
- dendrimer includes, but is not limited to, a molecular architecture with an interior core, interior layers, or “generations” of repeating units regularly attached to this initiator core, and an exterior surface of terminal groups attached to the outermost generation.
- a molecule may be functionalized by the introduction of a molecule that makes the molecule a strong nucleophile or strong electrophile.
- targeting moiety refers to a moiety that localizes to or away from a specific location.
- the moiety may be, for example, a protein, nucleic acid, nucleic acid analog, carbohydrate, or small molecule.
- the entity may be, for example, a therapeutic compound such as a small molecule, or a diagnostic entity such as a detectable label.
- the location may be a tissue, a particular cell type, or a subcellular compartment.
- the targeting moiety directs the localization of an agent.
- the dendrimer composition can selectively target neurons, particularly injured/hyperactive neurons, in the absence of an additional targeting moiety.
- incorporated and “encapsulated” refer to incorporating, formulating, or otherwise including an agent into and/or onto a composition that allows for release, such as sustained release, of such agent in the desired application.
- the agent or other material can be incorporated into a dendrimer, by binding to one or more surface functional groups of such dendrimer (by covalent, ionic, or other binding interaction), by physical admixture, by enveloping the agent within the dendritic structure, and/or by encapsulating the agent inside the dendritic structure.
- a dendrimer-based genome editing system to deliver gene editing agents such as Cas9 ribonucleoproteins (RNPs) into the cytoplasm and later into the nucleus has been developed.
- Cas9 ribonucleoproteins RNPs
- Cas9-2NLS endonuclease can be covalently conjugated to hydroxyl PAMAM dendrimer (D-Cas9 (2NLS)) through a glutathione sensitive disulfide linker via highly specific inverse Diels-alder click reaction (IEDDA), and guide RNA (sgRNA) complexed to Cas9-dendrimer nanoconstruct.
- D-Cas9 RNP produces robust genomic deletion in vitro human embryonic 293 cell line (HEK 293) (-100%) and human pigmental epithelium cell line (ARPE-19) (20 %).
- compositions of dendrimers complexed or covalently conjugated with one or more gene editing agents are described.
- Exemplary dendrimers include generation 4, generation 5, generation 6, generation 7, or generation 8 PAMAN and glucose dendrimers.
- the dendrimers are glucose dendrimers.
- Glucose dendrimers include (a) a central core, (b) one or more branching units, wherein the branching units are monosaccharide glucose-based branching units, optionally with a linker conjugated thereto.
- the glucose dendrimer is a generation 1, generation 2, generation 3, generation 4, generation 5, or generation 6 dendrimer.
- the dendrimers are poly(amidoamine) (PAMAM) dendrimers, such as hydroxy 1-terminated PAMAM dendrimers, preferably generation 4, generation 5, or generation 6, hydroxyl-terminated PAMAM dendrimers.
- the dendrimers are covalently conjugated to one or more Cas9 proteins, optionally via a linker or spacer moiety. In preferred embodiments, the dendrimers are covalently conjugated to one or more Cas9 proteins with one or more nuclear localization signals (NLS), more preferably two NLS.
- NLS nuclear localization signals
- Dendrimer conjugation improves formulation characteristics, for example, improved plasma stability, shelf stability, and sustained release capabilities, compared to gene editing composition that is not associate or conjugated to a dendrimer.
- dendrimer includes, but is not limited to, a molecular architecture with an interior core (“GO”) and layers (or “generations") of repeating units which are attached to and extend from this interior core, each layer having one or more branching points, and an exterior surface of terminal groups attached to the outermost generation. Tn some embodiments, dendrimers have regular dendrimeric or “starburst” molecular structures.
- Dendrimers are useful for various biomedical applications including drug/gene delivery, targeting, imaging and diagnosis (Soliman, GM et al., Chem. Commun. 2011, 47, 9572; and Tomalia, DA et al., Biochem. Soc. Trans. 2007, 35, 61).
- PAMAM polyamidoamine
- Dendrimers have been widely explored for drug delivery applications due to their commercial availability, aqueous solubility and biocompatibility (Tomalia, DA et al., Polym J 1985, 17, 117).
- the small size and the presence of easily tunable multiple surface groups make these nanoparticles excellent carriers for the transport of drugs to CNS.
- Dendrimer surface groups have a significant impact on their biodistribution (Nance, E., et al., Biomaterials, 101, 96 (2016)). Hydroxyl terminated generation 4 PAMAM dendrimers (approximately 4nm size) without any targeting ligand cross the impaired BBB upon systemic administration in a rabbit model of cerebral palsy (CP) significantly more (> 20 fold) as compared to healthy controls, and selectively target activated microglia and astrocytes (Lesniak, W. G., et al., Mol Pharm, 10 (2013)).
- dendrimers have a diameter between about 1 nm and about 50 nm, more preferably between about 1 nm and about 20 nm, between about 1 nm and about 10 nm, or between about 1 nm and about 5 nm.
- Conjugates are generally in the same size range, although large proteins such as Cas9 protein may increase the size to about 10-20 nm or 10-15 nm.
- large proteins such as Cas9 protein are conjugated in a ratio of protein to dendrimer of between 1:1 and 4:1 for the larger generation dendrimers, i.e., four or higher.
- the dendrimers have a diameter effective to penetrate brain tissue and to be retained in target cells for intracellular delivery of the agents conjugated thereto.
- dendrimers have a molecular weight between about 500 Daltons and about 100,000 Daltons inclusive, preferably between about 500 Daltons and about 50,000 Daltons inclusive, most preferably between about 1,000 Daltons and about 20,000 Daltons inclusive.
- Suitable dendrimers scaffolds that can be used include poly(amidoamine), also known as PAMAM, or STARBURSTTM dendrimers; polypropylamine (POPAM), polyethylenimine, polylysine, polyester, iptycene, aliphatic poly(ether), and/or aromatic polyether dendrimers.
- the dendrimers can have carboxylic, amine and/or hydroxyl terminations. In preferred embodiments, the dendrimers have hydroxyl terminations.
- Each dendrimer of the dendrimer complex may be same or of similar or different chemical nature than the other dendrimers (e.g., the first dendrimer may include a PAMAM dendrimer, while the second dendrimer may be a POPAM dendrimer).
- PAMAM dendrimer means poly(amidoamine) dendrimer, which may contain different cores, with amidoamine building blocks, and can have carboxylic, amine and hydroxyl terminations of any generation including, but not limited to, generation 1 PAMAM dendrimers, generation 2 PAMAM dendrimers, generation 3 PAMAM dendrimers, generation 4 PAMAM dendrimers, generation 5 PAMAM dendrimers, generation 6 PAMAM dendrimers, generation 7 PAMAM dendrimers, generation 8 PAMAM dendrimers, generation 9 PAMAM dendrimers, or generation 10 PAMAM dendrimers.
- the dendrimers are soluble in the formulation and are generation (“G”) 4, 5 or 6 dendrimers.
- the dendrimers may have hydroxyl groups attached to their functional surface groups.
- the high-density hydroxyl groups-containing dendrimers are oligo ethylene glycol (OEG)-like dendrimers.
- OEG oligo ethylene glycol
- D2-OH-60 a generation 2 OEG dendrimer
- Highly dense polyol dendrimer at very low generation in minimum reaction steps can be achieved by using an orthogonal hypermonomer and hypercore strategy, for example, as described in WO2019094952.
- the dendrimer backbone has non-cleavable poly ether bonds throughout the structure to avoid the disintegration of dendrimer in vivo and to allow the elimination of such dendrimers as a single entity from the body (non-biodegradable) .
- the dendrimers have a plurality of hydroxyl (-OH) groups on the periphery of the dendrimers.
- the preferred surface density of hydroxyl (-OH) groups is at least 1 OH group/nm 2 (number of hydroxyl surface groups/surface area in nm 2 ).
- the surface density of hydroxyl groups is more than 2, 3, 4, 5, 6, 7, 8, 9, 10; preferably at least 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50.
- the surface density of hydroxyl (-OH) groups is between about 1 and about 50, preferably 5-20 OH group/nm 2 (number of hydroxyl surface groups/surface area in nm 2 ) while having a molecular weight of between about 500 Da and about 10 kDa.
- the dendrimers may have a fraction of the hydroxyl groups exposed on the outer surface, with the others in the interior core of the dendrimers.
- the dendrimers have a volumetric density of hydroxyl (-OH) groups of at least 1 OH group/nm 3 (number of hydroxyl groups/volume in nm 3 ).
- the volumetric density of hydroxyl groups is 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, 15, 20, 25, 30, 35, 40, 45, and 50.
- the volumetric density of hydroxyl groups is between about 4 and about 50 groups/nm 3 , preferably between about 5 and about 30 groups/nm 3 , more preferably between about 10 and about 20 groups/nm 3 .
- the dendrimer specifically targets a particular tissue region and/or cell types following administration into the body. In preferred embodiments, the dendrimer specifically targets a particular tissue region and/or cell type without a targeting moiety.
- the dendrimers have a hypercore (e.g., dipentaerythritol) and one or more monosaccharide branching units.
- the monosaccharide branching units are conjugated to the core or the prior layer of monomers via linkers such as polyethylene glycol chains.
- the hypercore is dipentaerythritol and the monosaccharide branching unit is a glucose-based branching unit.
- the dendrimers include an effective number of terminal glucose and/or hydroxyl groups for targeting to one or more neurons of the CNS, or the eye.
- the hydroxyl groups on the dendrimer surface are part of glucose molecules. There are no extra hydroxyls in addition to the glucose molecules on the surface. The number of sugar molecules on the surface is determined by the generation number. All generations are expected to target neurons.
- dendrimers are made of glucose and oligoethylene glycol building blocks. Exemplary glucose dendrimers are shown in the Examples. Some exemplary glucose dendrimers include a generation 1 glucose dendrimer having 24 hydroxyl (-OH) end groups, a generation 2 glucose dendrimer having 96 hydroxyl (-OH) end groups, a generation 3 glucose dendrimer having 396 hydroxyl (-OH) end groups, and generation 4 glucose dendrimer having 1584 hydroxyl (-OH) end groups.
- the glucose dendrimer is a generation 2 glucose- based dendrimer that has 24 glucose molecules at the periphery and 6 embedded glucose molecules in the backbone held together by PEG segments.
- the dendrimers are complexed to or covalently conjugated to one or more gene editing systems, or at least one or more components thereof.
- exemplary gene editing systems include, but are not limited to, triplexforming, pseudo-complementary oligonucleotides, CRISPR/Cas, zinc finger nucleases, and TALENs.
- the gene editing system is the CRISPR/Cas system.
- the gene editing technology is the donor oligonucleotide, which can be used be used alone to modify genes.
- Strategies include, but are not limited to, small fragment homologous replacement (e.g., polynucleotide small DNA fragments (SDFs)), single-stranded oligodeoxynucleotide-mediated gene modification (e.g., ssODN/SSOs) and other described in Sargent, Oligonucleotides, 21(2): 55-75 (2011)), and elsewhere.
- SDFs polynucleotide small DNA fragments
- ssODN/SSOs single-stranded oligodeoxynucleotide-mediated gene modification
- Other suitable gene editing technologies include, but are not limited to, intron encoded meganucleases that are engineered to change their target specificity. See, e.g., Amould, et al., Protein Eng. Des. Sei., 24(I-2):27-31 (2011)).
- the gene editing system is a protein- guided gene editing system such as a CRISPR system, zinc finger nucleases (ZFN), and transcription activator-like effector nucleases (TALEN).
- CRISPR CRISPR system
- ZFN zinc finger nucleases
- TALEN transcription activator-like effector nucleases
- the gene editing system that induces a single or a double strand break in the target cell’s genome is CRISPR/Cas, or a nucleic acid construct encoding the Cas nuclease.
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
- the prokaryotic CRISPR/Cas system has been adapted for use as gene editing (silencing, enhancing, or changing specific genes) for use in eukaryotes (see, for example, Cong, Science, 15:339(6121):819-823 (2013) and Jinek, et ah, Science, 337(6096):816-21 (2012)).
- the organism's genome can be cut and modified at any desired location.
- CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
- a tracr trans-activating CRISPR
- tracr-mate sequence encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system
- guide sequence also referred to as a “spacer” in the context of an endogenous CRISPR system
- One or more tracr mate sequences operably linked to a guide sequence can also be referred to as pre-crRNA (pre-CRISPR RNA) before processing or crRNA after processing by a nuclease.
- pre-crRNA pre-CRISPR RNA
- a tracrRNA and crRNA are linked and form a chimeric crRNA-tracrRNA hybrid where a mature crRNA is fused to a partial tracrRNA via a synthetic stem loop to mimic the natural crRNA:tracrRNA duplex as described in Cong, Science, 15 : 339(6121): 819- 823 (2013) and Jinek, et al., Science, 337(6096): 816-21 (2012)).
- a single fused crRNA-tracrRNA construct can also be referred to as a guide RNA or gRNA (or single-guide RNA (sgRNA)).
- the crRNA portion can be identified as the “target sequence” and the tracrRNA is often referred to as the “scaffold.”
- dendrimers are covalently conjugated to one or more CRISPR-Associated Enzyme (Cas) nucleases.
- Cas nucleases suitable for conjugation with dendrimers as a gene editing composition include Cas9, CasX (also referred as Casl2e), Cas7-ll, CasFx, Casl2a, and Casl3.
- dendrimers are covalently conjugated to one or more Cas nucleases, which are further complexed with one or more single guide RNA (sgRNA) to form CRISPR/Cas ribonucleoproteins (RNPs).
- dendrimers are covalently conjugated to one or more Cas nucleases via one or more linking moieties.
- the linking moieties are conjugated with one or more spacer moieties.
- the linking and/or spacer moieties can be cleavable, for example, by exposure to the intracellular compartments of target cells in vivo.
- one or more spacers/linkers between a dendrimer and a gene editing system are added to achieve desired and effective release kinetics in vivo. These may be cleavable linkages such as disulfide and ester.
- dendrimers are covalently conjugated to one or more Cas9 nucleases, preferably complexed with one or more single guide RNA (sgRNA) to form CRISPR/Cas ribonucleoproteins (RNPs).
- sgRNA single guide RNA
- dendrimers are covalently conjugated to one or more Cas9 nucleases, and/or one or more single guide RNA (sgRNA), via a releasable linkage for intracellular release from the associated dendrimers.
- dendrimers are covalently conjugated to one or more Cas9 nucleases, prior to or subsequent to complexing of Cas9 with sgRNA.
- the Cas9 nuclease is modified with one or more nuclear localization signals (NLS), preferably two NLS.
- NLS nuclear localization signals
- the Cas9 nuclease is Streptococcus pyogenes Cas9 nuclease, or variants thereof.
- the gene editing system that induces a single or a double strand break in the target cell’s genome is zinc finger nuclease (ZFN), or a nucleic acid construct encoding ZFN.
- ZFNs are typically fusion proteins that include a DNA-binding domain derived from a zinc-finger protein linked to a cleavage domain.
- Fokl catalyzes double- stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, U.S. Pat. Nos. 5,356,802; 5,436, 150 and 5,487,994; as well as Li, et al., Proc., Natl. Acad. Sci. USA 89 (1992):4275- 4279; Li, et al., Proc. Natl. Acad. Sci. USA, 90:2764-2768 (1993); Kim, et al., Proc. Natl. Acad. Sci. USA.
- the DNA-binding domain which can, in principle, be designed to target any genomic location of interest, can be a tandem array of Cys2His2 zinc fingers, each of which generally recognizes three to four nucleotides in the target DNA sequence.
- the Cys2His2 domain has a general structure: Phe (sometimes Tyr)-Cys-(2 to 4 amino acids)-Cys-(3 amino acids)- Phe(sometimes Tyr)-(5 amino acids)-Leu-(2 amino acids)-His-(3 amino acids)-His.
- Rational design includes, for example, using databases including triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, U.S. Pat. Nos. 6, 140,081; 6,453,242; 6,534,261; 6,610,512; 6,746,838; 6,866,997; 7,067,617; U.S. Published Application Nos. 2002/0165356; 2004/0197892; 2007/0154989; 2007/0213269; and International Patent Application Publication Nos. WO 98/53059 and WO 2003/016496.
- the gene editing system that induces a single or a double strand break in the target cell’s genome is a transcription activator-like effector nuclease (TALEN), or a nucleic acid construct or constructs encoding TALEN.
- TALENs have an overall architecture similar to that of ZFNs, with the main difference that the DNA-binding domain comes from TAL effector proteins, transcription factors from plant pathogenic bacteria.
- the DNA-binding domain of a TALEN is a tandem array of amino acid repeats, each about 34 residues long. The repeats are very similar to each other; typically, they differ principally at two positions (amino acids 12 and 13, called the repeat variable diresidue, or RVD).
- Each RVD specifies preferential binding to one of the four possible nucleotides, meaning that each TALEN repeat binds to a single base pair, though the NN RVD is known to bind adenines in addition to guanine.
- TAL effector DNA binding is mechanistically less well understood than that of zinc-finger proteins, but their seemingly simpler code could prove very beneficial for engineered-nuclease design.
- TALENs also cleave as dimers, have relatively long target sequences (the shortest reported so far binds 13 nucleotides per monomer) and appear to have less stringent requirements than ZFNs for the length of the spacer between binding sites.
- Monomeric and dimeric TALENs can include more than 10, more than 14, more than 20, or more than 24 repeats.
- Dendrimer conjugates can be formed of one or more gene editing systems, or one or more components thereof, conjugated or attached to a dendrimer.
- the one or more gene editing systems are conjugated to the dendrimers via one or more spacers/linkers via different linkages such as disulfide, ester, carbonate, carbamate, thioester, hydrazine, hydrazides, ether, and amide linkages.
- the one or more spacers/linkers between a dendrimer and a gene editing system can be designed to provide a releasable or non-releasable form of the dendrimer conjugate in vivo.
- the attachment occurs via an appropriate spacer that provides an ester bond between the gene editing system and the dendrimer.
- one or more spacers/linkers between a dendrimer and a gene editing system are added to achieve desired and effective release kinetics in vivo. These may be cleavable (Ester, S-S) or non-cleavable (amide, ether).
- the linking chemistry can be click chemistry, acid-amine coupling, Steglich esterification etc.
- the attachment occurs via one or more of disulfide, ester, ether, thioester, carbamate, carbonate, hydrazine, ether, or amide linkages.
- the attachment occurs via an appropriate spacer that provides an ester bond or an amide bond between the agent and the dendrimer depending on the desired release kinetics of the agent.
- spacers includes compositions used for linking an active agent (e.g., one or more components of a gene editing system such as Cas9 nuclease) to the dendrimer.
- the spacer can be either a single chemical entity or two or more chemical entities linked together.
- the spacers can include any small chemical entity, peptide or polymers having sulfhydryl, thiopyridine, succinimidyl, maleimide, vinylsulfone, and carbonate terminations.
- the spacer can be chosen from among a class of compounds terminating in sulfhydryl, thiopyridine, succinimidyl, maleimide, vinylsulfone and carbonate group.
- the spacer can include thiopyridine terminated compounds such as dithiodipyridine, N-Succinimidyl 3-(2- pyridyldithio)-propionate (SPDP), Succinimidyl 6-(3-[2-pyridyldithioJ- propionamido)hexanoate LC-SPDP or Sulfo-LC-SPDP.
- the spacer can also include peptides wherein the peptides are linear or cyclic essentially having sulfhydryl groups such as glutathione, homocysteine, cysteine and its derivatives, arg-gly-asp-cys (RGDC), cyclo(Arg-Gly-Asp-d-Phe-Cys) (c(RGDfC)), cyclo(Arg-Gly-Asp-D-Tyr-Cys), cyclo(Arg-Ala-Asp-d-Tyr- Cys).
- RGDC arg-gly-asp-cys
- c(RGDfC) cyclo(Arg-Gly-Asp-D-Tyr-Cys)
- cyclo(Arg-Ala-Asp-d-Tyr- Cys cyclo(Arg-Ala-Asp-d-Tyr- Cys
- the spacer can be a mercapto acid derivative such as 3 mercapto propionic acid, mercapto acetic acid, 4 mercapto butyric acid, thiolan-2-one, 6 mercaptohexanoic acid, 5 mercapto valeric acid and other mercapto derivatives such as 2 mercaptoethanol and 2 mercaptoethylamine.
- a mercapto acid derivative such as 3 mercapto propionic acid, mercapto acetic acid, 4 mercapto butyric acid, thiolan-2-one, 6 mercaptohexanoic acid, 5 mercapto valeric acid and other mercapto derivatives such as 2 mercaptoethanol and 2 mercaptoethylamine.
- the spacer can be thiosalicylic acid and its derivatives, (4-succinimidyloxycarbonyl- methyl-alpha-2-pyridylthio)toluene, (3-[2-pyridithio]propionyl hydrazide,
- the spacer can have maleimide terminations wherein the spacer includes polymer or small chemical entity such as bis-maleimido diethylene glycol and bis-maleimido triethylene glycol, Bis-Maleimidoethane, bismaleimidohexane.
- the spacer can include vinylsulfone such as 1,6- Hexane-bis-vinylsulfone.
- the spacer can include thioglycosides such as thioglucose.
- the spacer can be reduced proteins such as bovine serum albumin and human serum albumin, any thiol terminated compound capable of forming disulfide bonds.
- the spacer can include polyethylene glycol having maleimide, succinimidyl and thiol terminations.
- Dendrimers can include one or more gene editing agents complexed or covalently conjugated to the dendrimer.
- one or more gene editing agents are covalently attached to one or more terminal groups of the dendrimer such as hydroxyl groups.
- dendrimer conjugates include one or more one or more gene editing agents conjugated or complexed with the dendrimer via one or more linking moieties.
- the one or more spacers/linkers between a dendrimer and a gene editing system can be designed to provide a releasable or non-releasable form of the dendrimer conjugate in vivo.
- the linking moieties are conjugated with one or more spacer moieties.
- the dendrimer is preferably a generation 2, generation 3, generation 4, generation 5, generation 6, and up to generation 10.
- the dendrimer is linked to one or more gene editing agents via a spacer ending in disulfide, ester, ether, or amide bonds.
- Cas9 nuclease protein is conjugated in a ratio of protein to dendrimer of between 1:1 and 4:1 for the larger generation dendrimers, i.e., four or higher.
- dendrimer complexes retain an effective amount of surface functional groups for targeting to target cells, while conjugated to an effective amount of agents for treat, prevent, and/or image the disease or disorder.
- dendrimer conjugates have a hydrodynamic volume in the nanometer range.
- the dendrimer-Cas9 RNP complex has a diameter of between about 5 nm and about 500 nm, inclusive, or between about 10 nm and about 200 nm, inclusive, between about 15 nm and about 100 nm, inclusive, depending upon the generation of dendrimer, the number of nuclease molecules loaded.
- a dendrimer conjugate has a diameter effective to penetrate and retain in target cells for a prolonged period of time.
- the agents can be proteins or peptides, sugars or carbohydrate, nucleic acids or oligonucleotides, lipids, small molecules, or combinations thereof.
- the nucleic acid can be an oligonucleotide encoding a protein, for example, a DNA expression cassette or an mRNA.
- Representative oligonucleotides include siRNAs, microRNAs, DNA, RNA, and aptamers. In one embodiment, these are antisense oligonucleotides.
- the therapeutic, prophylactic or diagnostic agent is a therapeutic antibody.
- One or more types of therapeutic, prophylactic or diagnostic agents can be encapsulated, complexed, or conjugated to the dendrimer.
- Exemplary therapeutic agents include anti-inflammatory drugs, antiproliferatives, chemotherapeutics, vasodilators, neuroactive agents, and anti- infective agents.
- the dendrimer is linked to the targeting moiety, imaging agents, and/or therapeutic agents. In some embodiments, the dendrimer is linked to the targeting moiety or antibody for targeting specific cell types.
- One or more therapeutic agents can be complexed with, covalently attached to or intra-molecularly dispersed or encapsulated within the dendrimer.
- two or more different therapeutic agents can be associated, via covalent and/or non-covalent interactions, with the dendrimer.
- the dendrimer conjugates when administered by intravenous injection, can preferentially cross the blood brain barrier (BBB).
- BBB blood brain barrier
- the agent(s) is attached or conjugated to the dendrimers, which are capable of preferentially releasing the drug at the target site i.e., site of disease, injury, and/or subcellular location.
- some drugs can be released intracellularly under the reduced conditions found in vivo.
- the dendrimer conjugates linked to an agent can be used to perform several functions including targeting, localization at a diseased site, releasing the drug, and imaging purposes.
- the dendrimer complexes can be tagged with or without targeting moieties.
- one or more therapeutic agents targeting the underlying cause of the disease or condition and one or more therapeutic agents relieving one or more symptoms of the disease or condition.
- Preferred therapeutic or prophylactic agents include agents that reduce neuroinflammation (e.g., N-acetyl cysteine, Pioglitazone, Vitamin E) and RNA oligonucleotides that interfere with gene transcription or translation.
- the agent is N- acetylcysteine, 4-phenylbutyrate, bezafibrate, thyroid hormone (T3), sobetirome, pioglitazone, resveratrol, VBP15, Vitamin E, erucic acid, Coenzyme Q10, clemastine, galactosylceramidase (GALC), Aspartoacylase (AS PA), or Arylsulfatase A (ARSA).
- Other suitable agents include antiinflammatory, neuroactive and imaging agents.
- the dendrimer can be conjugated to more than one agent and more than one type of agent.
- compositions include one or more antiinflammatory agents.
- Anti-inflammatory agents reduce inflammation and include steroidal and non-steroidal drugs.
- a preferred anti-inflammatory is an antioxidant drug including N- acetylcysteine.
- Preferred NSAIDS include mefenamic acid, aspirin, diflunisal, salsalate, ibuprofen, naproxen, fenoprofen, ketoprofen, deacketoprofen, flurbiprofen, oxaprozin, loxoprofen, indomethacin, sulindac, etodolac, ketorolac, diclofenac, nabumetone, piroxicam, meloxicam, tenoxicam, droxicam, lornoxicam, isoxicam, meclofenamic acid, flufenamic acid, tolfenamic acid, elecoxib, rofecoxib, valdecoxib, parecoxib, lumiracoxib, etoricoxib, firocoxib, sulphonanilides, nimesulide,
- Representative small molecules include steroids such as methyl prednisone, dexamethasone, non-steroidal anti-inflammatory agents including COX-2 inhibitors, corticosteroid anti-inflammatory agents, gold compound anti-inflammatory agents, immunosuppressive, anti-inflammatory and anti- angiogenic agents, anti-excitotoxic agents such as valproic acid, D- aminophosphonovalerate, D-aminophosphonoheptanoate, inhibitors of glutamate formation/release, such as baclofen, NMDA receptor antagonists, salicylate anti-inflammatory agents, ranibizumab, anti-VEGF agents, including aflibercept, and rapamycin.
- steroids such as methyl prednisone, dexamethasone
- non-steroidal anti-inflammatory agents including COX-2 inhibitors
- corticosteroid anti-inflammatory agents include corticosteroid anti-inflammatory agents, gold compound anti-inflammatory agents, immunosuppressive, anti-inflammatory and anti- angiogenic agents, anti-excitotoxic
- immune-modulating drugs include cyclosporine, tacrolimus and rapamycin.
- anti-inflammatory agents are biologic drugs that block the action of one or more immune cell types such as T cells, or block proteins in the immune system, such as tumor necrosis factor-alpha (TNF-alpha), interleukin 17-A, interleukins 12 and 23.
- TNF-alpha tumor necrosis factor-alpha
- interleukin 17-A interleukin 17-A
- interleukins 12 and 23 interleukins
- the anti-inflammatory drug is a synthetic or natural anti-inflammatory protein. Antibodies specific to select immune components can be added to immunosuppressive therapy.
- the anti-inflammatory drug is an anti-T cell antibody (e.g., anti-thymocyte globulin or Anti-lymphocyte globulin), anti-IL-2Ra receptor antibody (e.g., basiliximab or daclizumab), or anti-CD20 antibody (e.g., rituximab).
- the one or more anti-inflammatory drugs are released from the dendrimeric conjugates after administration to a mammalian subject in an amount effective to inhibit inflammation for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, preferably at least a week, 2 weeks, or 3 weeks, more preferably at least a month, two months, three months, four months, five months, six months.
- a number of drugs have been developed to interrupt, influence, or temporarily halt the glutamate excitotoxic cascade toward neuronal injury.
- One strategy is the “upstream” decrease of glutamate release.
- This category of drugs includes riluzole, lamotrigine, and lifarizine, which are sodium channel blockers.
- the commonly used nimodipine is a voltage-dependent channel (L-type) blocker.
- Some agents affect the sites of the coupled glutamate receptor. Examples of these drugs include felbamate, ifenprodil, magnesium, memantine, and nitroglycerin.
- downstream drugs attempt to influence such intracellular events as free radical formation, nitric oxide formation, proteolysis, endonuclease activity, and ICE- like protease formation (an important component in the process leading to programmed cell death, or apoptosis).
- Agents for the treatment of neurodegenerative diseases are well known in the art and vary based on the symptoms and disease to be treated.
- conventional treatments for Parkinson’s disease include levodopa (usually combined with a dopa decarboxylase inhibitor or COMT inhibitor), a dopamine agonist, or an MAO-B inhibitor.
- Examples of treatments for Huntington’s disease include a dopamine blocker to help reduce abnormal behaviors and movements, or a drug such as amantadine and tetrabenazine to control movement.
- Other drugs that help to reduce chorea include neuroleptics and benzodiazepines. Compounds such as amantadine or remacemide have shown positive results. Hypokinesia and rigidity, especially in juvenile cases, can be treated with anti-Parkinsonian drugs, and myoclonic hyperkinesia can be treated with valproic acid. Psychiatric symptoms can be treated with medications similar to those used in the general population. Selective serotonin reuptake inhibitors and mirtazapine have been recommended for depression, while atypical antipsychotic drugs are recommended for psychosis and behavioral problems.
- Riluzole (2-amino-6-(trifluoromethoxy) benzothiazole), an anti-excitotoxin
- RILUTEK® (2-amino-6-(trifluoromethoxy) benzothiazole)
- Other medications and interventions can reduce symptoms due to ALS.
- Some treatments improve quality of life and a few appear to extend life.
- Common ALS-related therapies are reviewed in Gordon, Aging and Disease, 4(5):295-310 (2013), see, e.g., Table 1 therein.
- a number of other agents have been tested in one or more clinical trials with efficacies ranging from non-efficacious to promising.
- Exemplary agents are reviewed in Carlesi, et al., Archives yogurtnes de Biologic, 149:151-167 (2011).
- therapies may include agents that reduce excitotoxicity such as talampanel (8-methyl-7H-l,3-dioxolo(2,3)benzodiazepine), a cephalosporin such as ceftriaxone, or memantine; agenta that reduce oxidative stress such as coenzyme Q10, manganoporphyrins, KNS-760704 [(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride, RPPX], or edaravone (3-methyl-l-phenyl-2-pyrazolin-5- one, MCI- 186); agents that reduce apoptosis such as histone deacetylase (HDAC) inhibitors including valproic acid, TCH346 (Dibenzo(b,f)oxepin- lO-ylmethyl-methylprop-2-ynylamine), minocycline, or taurours
- Treatments for Alzheimer’ s Disease include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine or donepezil; NMD A receptor antagonists such as memantine; and antipsychotic drugs.
- Treatment for Dementia with Lewy Bodies can include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine or donepezil; the N-methyl d-aspartate receptor antagonist memantine; dopaminergic therapy, for example, levodopa or selegiline; antipsychotics such as olanzapine or clozapine; REM disorder therapies such as clonazepam, melatonin, or quetiapine; anti-depression and antianxiety therapies such as selective serotonin reuptake inhibitors (citalopram, escitalopram, sertraline, paroxetine, etc.) or serotonin and noradrenaline reuptake inhibitors (venlafaxine, mirtazapine, and bupropion) (see, e.g., Macijauskiene, et al., Medicina (Kaunas), 48(1): 1-8 (2012)).
- neuroprotective agents include, for example, glutamate antagonists, antioxidants, and NMD A receptor stimulants.
- Other neuroprotective agents and treatments include caspase inhibitors, trophic factors, anti -protein aggregation agents, therapeutic hypothermia, and erythropoietin.
- Anti- infective agents that can be used include antibiotics, antifungals and antivirals
- Antibiotics include beta-lactams such as penicillin and ampicillin, cephalosporins such as cefuroxime, cefaclor, cephalexin, cephydroxil, cepfodoxime and proxetil, tetracycline antibiotics such as doxycycline and minocycline, macrolide antibiotics such as azithromycin, erythromycin, rapamycin and clarithromycin, fluoroquinolones such as ciprofloxacin, enrofloxacin, ofloxacin, gatifloxacin, levofloxacin and norfloxacin, tobramycin, colistin, or aztreonam as well as antibiotics which are known to possess anti-inflammatory activity, such as erythromycin, azithromycin, or clarithromycin. In some cases these are nucleic acids that interfere with infection or replication, which are expressed to yield antibodies thereto.
- the agents delivered to the target cells or tissues via dendrimer are diagnostic agents.
- diagnostic agents that can be delivered to the brain by glucose dendrimer conjugates include paramagnetic molecules, fluorescent compounds, magnetic molecules, and radionuclides, x-ray imaging agents, and contrast media.
- Dendrimer conjugates can include agents useful for determining the location of administered compositions. Agents useful for this purpose include fluorescent tags, radionuclides, and contrast agents.
- Exemplary diagnostic agents include dyes, fluorescent dyes, near infra-red dyes, SPECT imaging agents, PET imaging agents and radioisotopes.
- Representative dyes include carbocyanine, indocarbocyanine, oxacarbocyanine, thuicarbocyanine and merocyanine, polymethine, coumarine, rhodamine, xanthene, fluorescein, boron-dipyrromethane (BODIPY), Cy5, Cy5.5, Cy7, VivoTag-680, VivoTag-S680, VivoTag-S750, AlexaFluor660, AlexaFluor680, AlexaFluor700, AlexaFluor750, AlexaFluor790, Dy677, Dy676, Dy682, Dy752, Dy780, DyLight547, Dylight647, HiLyte Fluor 647, HiLyte Fluor 680, HiLyte Fluor
- Exemplary SPECT or PET imaging agents include chelators such as di-ethylene tri-amine penta-acetic acid (DTP A), 1,4,7,10-tetra- azacyclododecane-l,4,7,10-tetraacetic acid (DOTA), di-amine dithiols, activated mercaptoacetyl-glycyl-glycyl-gylcine (MAG3), and hydrazidonicotinamide (HYNIC).
- DTP A di-ethylene tri-amine penta-acetic acid
- DOTA 1,4,7,10-tetra- azacyclododecane-l,4,7,10-tetraacetic acid
- MAG3 activated mercaptoacetyl-glycyl-glycyl-gylcine
- HYNIC hydrazidonicotinamide
- Exemplary isotopes include Tc-94m, Tc-99m, ln-1 1 1 , Ga-67, Ga-68, Gd3+, Y-86, Y-90, Lu-177, Re-186, Re-188, Cu-64, Cu-67, Co-55, Co-57, F-18, Sc-47, Ac-225, Bi-213, Bi-212, Pb-212, Sm-153, Ho-166, and Dy-166.
- the dendrimer compositions include one or more radioisotopes suitable for positron emission tomography (PET) imaging.
- positron-emitting radioisotopes include carbon-11 ( n C), copper-64 ( 64 Cu), nitrogen-13 ( 13 N), oxygen-15 ( 15 O), gallium-68 ( 68 Ga), and fluorine-18 ( 18 F), e.g., 2-deoxy-2- 18 F-fluoro-P-D-glucose ( 18 F-FDG).
- a dendrimer conjugate composition can simultaneously treat and/or diagnose a disease or a condition at one or more locations in the body.
- Dendrimers complexed with one or more gene editing systems can be prepared via a variety of chemical reaction steps. Dendrimers are usually synthesized according to methods allowing controlling their structure at every stage of construction. The dendritic structures are mostly synthesized by two main different approaches: divergent or convergent.
- dendrimers are prepared using divergent methods, in which the dendrimer is assembled from a multifunctional core, which is extended outward by a series of reactions, commonly a Michael reaction.
- the strategy involves the coupling of monomeric molecules that possesses reactive and protective groups with the multifunctional core moiety, which leads to stepwise addition of generations around the core followed by removal of protecting groups.
- PAMAM-NH2 dendrimers are first synthesized by coupling N-(2-aminoethyl) acryl amide monomers to an ammonia core.
- dendrimers are prepared using convergent methods, in which dendrimers are built from small molecules that end up at the surface of the sphere, and reactions proceed inward, building inward, and are eventually attached to a core.
- the core of the dendrimer, one or more branching units, one or more linkers/spacers, and/or one or more surface groups can be modified to allow conjugation to further functional groups (branching units, linkers/spacers, surface groups, etc.), monomers, and/or agents via click chemistry, employing one or more Copper- Assisted Azide- Alkyne Cycloaddition (CuAAC), Diels- Alder reaction, thiol-ene and thiolyne reactions, and azide-alkyne reactions (Arseneault M et al., Molecules. 2015 May 20;20(5):9263-94).
- CuAAC Copper- Assisted Azide- Alkyne Cycloaddition
- Diels- Alder reaction Diels- Alder reaction
- thiol-ene and thiolyne reactions thiol-ene and thiolyne reactions
- azide-alkyne reactions Arseneault M et al
- pre-made dendrons are clicked onto high-density hydroxyl polymers.
- lick chemistry involves, for example, the coupling of two different moieties (e.g., a core group and a branching unit; or a branching unit and a surface group) via a 1,3-dipolar cycloaddition reaction between an alkyne moiety (or equivalent thereof) on the surface of the first moiety and an azide moiety (e.g., present on a triazine composition or equivalent thereof), or any active end group such as, for example, a primary amine end group, a hydroxyl end group, a carboxylic acid end group, a thiol end group, etc.) on the second moiety.
- dendrimer synthesis replies upon one or more reactions such as thiol-ene click reactions, thiol-yne click reactions, CuAAC, Diels-Alder click reactions, azide-alkyne click reactions, Michael Addition, epoxy opening, esterification, silane chemistry, and a combination thereof.
- reactions such as thiol-ene click reactions, thiol-yne click reactions, CuAAC, Diels-Alder click reactions, azide-alkyne click reactions, Michael Addition, epoxy opening, esterification, silane chemistry, and a combination thereof.
- methods involve one or more protection and deprotection steps of the function groups (e.g., hydroxyl groups) on the central core, branching units, and/or therapeutic, prophylactic or diagnostic agents to facilitate addition of branching units to generate desired dendrimer molecules, or addition of therapeutic, prophylactic or diagnostic agents to generate desired dendrimer conjugates.
- function groups e.g., hydroxyl groups
- they may be protected by formation of an ether, an ester, or an acetal.
- Other exemplary protection groups include Boc and Fmoc.
- Dendritic platforms can be used to make dendrimers of desired functionalities, i.e., with a high-density of surface hydroxyl groups by conjugating high-hydroxyl containing moieties such as 1 -thio-glycerol or pentaerythritol.
- Exemplary dendritic platforms such as polyamidoamine (PAMAM), poly (propylene imine) (PPI), poly-L-lysine, melamine, poly (etherhydroxylamine) (PEHAM), poly (esteramine) (PEA) and polyglycerol can be synthesized and explored.
- Dendrimers also can be prepared by combining two or more dendrons.
- Dendrons are wedge-shaped sections of dendrimers with reactive focal point functional groups.
- Many dendron scaffolds are commercially available. They come in 1, 2, 3, 4, 5, and 6th generations with, respectively, 2, 4, 8, 16, 32, and 64 reactive groups.
- one type of agents is linked to one type of dendron and a different type of agent is linked to another type of dendron.
- the two dendrons are then connected to form a dendrimer.
- the two dendrons can be linked via click chemistry i.e., a 1,3- dipolar cycloaddition reaction between an azide moiety on one dendron and alkyne moiety on another to form a triazole linker.
- glucose-based dendrimers are prepared using divergent methods, in which the dendrimer is assembled from a multifunctional core, which is extended outward by a series of reactions.
- the strategy involves the coupling of monomeric molecules that possesses reactive and protective groups with the multifunctional core moiety, which leads to stepwise addition of generations around the core followed by removal of protecting groups. Synthesis of exemplary dendrimers are shown in the examples.
- generation two dendrimer D2-Glu24-OH96 is propargylated at one or more terminal hydroxyl groups suitable for further conjugation to one or more molecules such as Cas9 nuclease.**
- one or more agents are covalently attached to the dendrimers.
- the agents are attached to the dendrimer via a linking moiety that is designed to be cleaved in vivo.
- the linking moiety can be designed to be cleaved hydrolytically, enzymatically, or combinations thereof, so as to provide for the sustained release of the agents in vivo. Both the composition of the linking moiety and its point of attachment to the agent, are selected so that cleavage of the linking moiety releases either an agent, or a suitable prodrug thereof.
- the composition of the linking moiety can also be selected in view of the desired release rate of the agents.
- the attachment occurs via one or more of disulfide, ester, ether, thioester, carbamate, carbonate, hydrazine, or amide linkages.
- the attachment occurs via an appropriate spacer that provides an ester bond or an amide bond between the agent and the dendrimer depending on the desired release kinetics of the agent.
- an ester bond is introduced for releasable form of agents.
- an amide bond is introduced for non-releasable form of agents.
- Linking moieties generally include one or more organic functional groups.
- suitable organic functional groups include secondary amides (-CONH-), tertiary amides (-CONR-), sulfonamide (-S(O)2-NR-), secondary carbamates (-OCONH-; -NHCOO-), tertiary carbamates (- OCONR-; -NRCOO-), carbonate (-O-C(O)-O-), ureas (-NHCONH-; - NRCONH-; -NHCONR-, -NRCONR-), carbinols (-CHOH-, -CROH-), disulfide groups, hydrazones, hydrazides, ethers (-O-), and esters (-COO-, - CH2O2C-, CHRO2C-), wherein R is an alkyl group, an aryl group, or a heterocyclic group.
- the identity of the one or more organic functional groups within the linking moiety is chosen in view of the desired release rate of the agents.
- the one or more organic functional groups can be selected to facilitate the covalent attachment of the agents to the dendrimers.
- the attachment can occur via an appropriate spacer that provides a disulfide bridge between the agent and the dendrimer.
- the dendrimer complexes are capable of rapid release of the agent in vivo by thiol exchange reactions, under the reduced conditions found in body.
- the linking moiety includes one or more of the organic functional groups described above in combination with a spacer group.
- the spacer group can be composed of any assembly of atoms, including oligomeric and polymeric chains; however, the total number of atoms in the spacer group is preferably between 3 and 200 atoms, more preferably between 3 and 150 atoms, more preferably between 3 and 100 atoms, most preferably between 3 and 50 atoms.
- suitable spacer groups include alkyl groups, heteroalkyl groups, alkylaryl groups, oligo- and polyethylene glycol chains, and oligo- and poly(amino acid) chains. Variation of the spacer group provides additional control over the release of the agents in vivo.
- one or more organic functional groups will generally be used to connect the spacer group to both the anti-inflammatory agent and the dendrimers.
- the optimal loading will necessarily depend on many factors, including the choice of agent, dendrimer structure and size, and tissues to be treated.
- Cas9 nuclease are conjugated to the dendrimer at a ratio of 1 : 1.
- optimal loading for any given agent, dendrimer, and site of target can be identified by routine methods, such as those described.
- conjugation of agents and/or linkers occurs through one or more surface and/or interior groups.
- dendrimer complexes retain an effective amount of surface functional groups for targeting to specific cell types, while conjugated to an effective amount of agents for treat, prevent, and/or image the disease or disorder.
- compositions including dendrimer-gene editing agent conjugates may be formulated in a conventional manner using one or more physiologically acceptable carriers, optionally including excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically, for oral, intranasal, subcutaneous, intraperitoneal, or intramuscular administration.
- the pharmaceutical compositions include glucose-dendrimer-gene editing agent conjugates.
- compositions are formulated for parenteral delivery.
- compositions are formulated for intravenous injection.
- the compositions will be formulated in sterile saline or buffered solution for injection into the tissues or cells to be treated.
- the compositions can be stored lyophilized in single use vials for rehydration immediately before use. Other means for rehydration and administration are known to those skilled in the art.
- excipients include solvents, diluents, pH modifying agents, preservatives, antioxidants, suspending agents, wetting agents, viscosity modifiers, tonicity agents, stabilizing agents, and combinations thereof.
- Suitable pharmaceutically acceptable excipients are preferably selected from materials which are generally recognized as safe (GRAS) and may be administered to an individual without causing undesirable biological side effects or unwanted interactions.
- pharmaceutically acceptable salts can be prepared by reaction of the free acid or base forms of an agent with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, non-aqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.
- Pharmaceutically acceptable salts include salts of an agent derived from inorganic acids, organic acids, alkali metal salts, and alkaline earth metal salts as well as salts formed by reaction of the drug with a suitable organic ligand (e.g. , quaternary ammonium salts).
- ophthalmic drugs sometimes administered in the form of a pharmaceutically acceptable salt include timolol maleate, brimonidine tartrate, and sodium diclofenac.
- compositions are preferably formulated in dosage unit form for ease of administration and uniformity of dosage.
- dosage unit form refers to a physically discrete unit of conjugate appropriate for the patient to be treated. It will be understood, however, that the total single administration of the compositions will be decided by the attending physician within the scope of sound medical judgment.
- the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model is also used to achieve a desirable concentration range and route of administration. Such information should then be useful to determine effective doses and routes for administration in humans.
- Therapeutic efficacy and toxicity of conjugates can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g..
- ED50 the dose is therapeutically effective in 50% of the population
- LD50 the dose is lethal to 50% of the population
- the dose ratio of toxic to therapeutic effects is the therapeutic index, and is expressed as the ratio, LD50/ED50.
- Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies can be used in formulating a range of dosages for human use.
- the compositions of glucose dendrimer are administered locally, for example, by injection directly into a site to be treated.
- the compositions are injected, topically applied, or otherwise administered directly into the vasculature onto vascular tissue at or adjacent to a site of injury, surgery, or implantation.
- the compositions are topically applied to vascular tissue that is exposed, during a surgical procedure.
- local administration causes an increased localized concentration of the compositions, which is greater than that which can be achieved by systemic administration.
- compositions formulated for administration by parenteral intramuscular, intraperitoneal, intravenous, or subcutaneous injection
- enteral routes of administration are described.
- compositions can be administered parenterally.
- parenteral administration and “administered parenterally” are art- recognized terms, and include modes of administration other than enteral and topical administration.
- the dendrimers can be administered orally, intranasally, subcutaneously, intraperitoneally, or intramuscularly.
- pharmaceutically acceptable carriers may be, for example, aqueous or non-aqueous solutions, suspensions, emulsions, or oils.
- Parenteral vehicles for subcutaneous, intravenous, intraarterial, or intramuscular injection
- non-aqueous solvents examples include propylene glycol, polyethylene glycol, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include, for example, water, alcoholic/aqueous solutions, cyclodextrins, emulsions or suspensions, including saline and buffered media.
- the dendrimers can also be administered in an emulsion, for example, water in oil.
- oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, fish-liver oil, sesame oil, cottonseed oil, com oil, olive, petrolatum, and mineral.
- Suitable fatty acids for use in parenteral formulations include, for example, oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
- Formulations suitable for parenteral administration can include antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
- Intravenous vehicles can include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose.
- water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycols or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions.
- injectable pharmaceutical carriers for injectable compositions are well-known to those of ordinary skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, I.B. Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Trissei, 15th ed., pages 622-630 (2009)).
- compositions can also be made into aerosol formulations (i.e., they can be "nebulized") to be administered via inhalation.
- Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and air.
- pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen, and air.
- the compounds are delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant.
- compositions can enable editing in the context of prokaryotic and eukaryotic cells, in vitro, ex vivo, and in vivo. In further embodiments, the compositions can enable gene editing in agricultural contexts, such as in plants.
- compositions can be used to ex vivo or in vivo gene editing.
- the methods typically include contacting a cell with an effective amount of dendrimer-gene editing agent composition to modify the cell’s genome. As discussed in more detail below, the contacting can occur ex vivo or in vivo.
- the method includes contacting a population of target cells with an effective amount of gene editing composition to modify the genomes of a sufficient number of cells to achieve a desired result e.g., therapeutic outcome or modified traits.
- the effective amount or therapeutically effective amount can be a dosage sufficient to treat, inhibit, or alleviate one or more symptoms of a disease or disorder, or to otherwise provide a desired pharmacologic and/or physiologic effect, for example, reducing, inhibiting, or reversing one or more of the underlying pathophysiological mechanisms underlying a disease or disorder.
- Formulation is made to suit the mode of administration.
- Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions containing the nucleic acids. The precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, clinical symptoms etc.). Exemplary symptoms, pharmacologic, and physiologic effects are discussed in more detail below.
- compositions can be administered or otherwise contacted with target cells once, twice, or three time daily; one, two, three, four, five, six, seven times a week, one, two, three, four, five, six, seven or eight times a month.
- the composition is administered every two or three days, or on average about 2 to about 4 times about week.
- compositions are administered in an amount effective to induce gene modification in at least one target allele to occur at frequency of at least 0.1, 0.2. 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25% of target cells.
- gene modification occurs in at least one target allele at a frequency of about 0.1-25%, or 0.5-25%, or 1-25% 2-25%, or 3-25%, or 4-25% or 5-25% or 6- 25%, or 7-25%, or 8-25%, or 9-25%, or 10-25%, 11-25%, or 12-25%, or 13%-25% or 14%-25% or 15-25%, or 2-20%, or 3-20%, or 4-20% or 5-20% or 6-20%, or 7-20%, or 8-20%, or 9-20%, or 10-20%, 11-20%, or 12-20%, or 13%-20% or I4%-20% or 15-20%, 2-15%, or 3-15%, or 4-15% or 5-15% or 6-15%, or 7-15%, or 8-15%, or 9-15%, or 10-15%, 11-15%, or 12-15%, or 13%-15% or 14%-15%.
- gene modification occurs in at least one target allele at a frequency of about 0.1% to about 10%, or about 0.2% to about 10%, or about 0.3% to about 10%, or about 0.4% to about 10%, or about 0.5% to about 10%, or about 0.6% to about 10%, or about 0.7% to about 10%, or about 0.8% to about 10%, or about 0.9% to about 10%, or about 1.0% to about 10% , or about 1.1% to about 10%, or about 1.1% to about 10%, 1.2% to about 10%, or about 1.3% to about 10%, or about 1 .4% to about 10%, or about 1 .5% to about 10%, or about 1.6% to about 10%, or about 1.7% to about 10%, or about 1.8% to about 10%, or about 1.9% to about 10%, or about 2.0% to about 10%, or about 2.5% to about 10% , or about 3.0% to about 10%, or about 3.5% to about 10%, or about 4.0% to about 10%, or about 4.5% to about 10%, or about 5.0% to about 10%.
- gene modification occurs with low off-target effects.
- off-target modification is undetectable using routine analysis.
- off-target incidents occur at a frequency of 0-1%, or 0-0.1%, or 0-0.01%, or 0-0.001%, or 0-0.0001%, or 0- 0000.1%, or 0-0.000001%.
- off-target modification occurs at a frequency that is about 10 2 , 10 3 , 10 4 , or 10 -fold lower than at the target site.
- the methods including a step of selecting a subject who is likely to benefit from treatment with the dendrimer-gene editing agent compositions.
- ex vivo gene therapy of cells is used for the treatment of a genetic disorder in a subject.
- cells are isolated from a subject and contacted ex vivo with the compositions to produce cells containing mutations in or adjacent to genes.
- the cells are isolated from the subject to be treated or from a syngeneic host.
- Target cells are removed from a subject prior to contacting with a gene editing composition and preferably a potentiating factor.
- the cells can be hematopoietic progenitor or stem cells.
- the target cells are CD34 + hematopoietic stem cells.
- HSCs Hematopoietic stem cells
- CD34+ cells are multipotent stem cells that give rise to all the blood cell types including erythrocytes. Therefore, CD34+ cells can be isolated from a patient with, for example, thalassemia, sickle cell disease, or a lysosomal storage disease, the mutant gene altered or repaired ex-vivo using the compositions and methods, and the cells reintroduced back into the patient as a treatment or a cure.
- Stem cells can be isolated and enriched by one of skill in the art. Methods for such isolation and enrichment of CD34 + and other cells are known in the art and disclosed, for example, in U.S. Patent Nos. 4,965,204; 4,714,680; 5,061,620; 5,643,741; 5,677,136; 5,716,827; 5,750,397 and 5,759,793.
- enriched indicates a proportion of a desirable element (e.g., hematopoietic progenitor and stem cells) which is higher than that found in the natural source of the cells.
- a composition of cells may be enriched over a natural source of the cells by at least one order of magnitude, preferably two or three orders, and more preferably 10, 100, 200 or 1000 orders of magnitude.
- CD34 + cells can be recovered from cord blood, bone marrow or from blood after cytokine mobilization effected by injecting the donor with hematopoietic growth factors such as granulocyte colony stimulating factor (G-CSF), granulocyte-monocyte colony stimulating factor (GM-CSF), stem cell factor (SCF) subcutaneously or intravenously in amounts sufficient to cause movement of hematopoietic stem cells from the bone marrow space into the peripheral circulation.
- G-CSF granulocyte colony stimulating factor
- GM-CSF granulocyte-monocyte colony stimulating factor
- SCF stem cell factor
- bone marrow cells may be obtained from any suitable source of bone marrow, e.g., tibiae, femora, spine, and other bone cavities.
- an appropriate solution may be used to flush the bone, which solution will be a balanced salt solution, conveniently supplemented with fetal calf serum or other naturally occurring factors, in conjunction with an acceptable buffer at low concentration, generally from about 5 to 25 rnM.
- Convenient buffers include Hepes, phosphate buffers, lactate buffers, etc.
- Cells can be selected by positive and negative selection techniques.
- Cells can be selected using commercially available antibodies which bind to hematopoietic progenitor or stem cell surface antigens, e.g., CD34, using methods known to those of skill in the art.
- the antibodies may be conjugated to magnetic beads and immunogenic procedures utilized to recover the desired cell type.
- Other techniques involve the use of fluorescence activated cell sorting (FACS).
- FACS fluorescence activated cell sorting
- the CD34 antigen which is found on progenitor cells within the hematopoietic system of non- leukemic individuals, is expressed on a population of cells recognized by the monoclonal antibody My-10 (i.e., express the CD34 antigen) and can be used to isolate stem cell for bone marrow transplantation.
- HB-8483 My-10 deposited with the American Type Culture Collection (Rockville, Md.) as HB-8483 is commercially available as anti-HPCA 1. Additionally, negative selection of differentiated and “dedicated” cells from human bone marrow can be utilized, to select against substantially any desired cell marker.
- progenitor or stem cells most preferably CD34 + cells, can be characterized as being any of CD3", CD7", CD8", CD10", CD14", CD15", CD19", CD20", CD33’, Class II HLA + and Thy-1 + .
- progenitor or stem cells may be propagated by growing in any suitable medium.
- progenitor or stem cells can be grown in conditioned medium from stromal cells, such as those that can be obtained from bone marrow or liver associated with the secretion of factors, or in medium including cell surface factors supporting the proliferation of stem cells.
- Stromal cells may be freed of hematopoietic cells employing appropriate monoclonal antibodies for removal of the undesired cells.
- the isolated cells are contacted ex vivo with a combination of triplexforming molecules and donor oligonucleotides in amounts effective to cause the desired mutations in or adjacent to genes in need of repair or alteration, for example the human beta-globin or a-L-iduronidase gene. These cells are referred to herein as modified cells.
- Methods for transfection of cells with oligonucleotides and peptide nucleic acids are well known in the art (Koppelhus, et al., Adv. Drug Deliv. Rev., 55(2): 267-280 (2003)). It may be desirable to synchronize the cells in S -phase to further increase the frequency of gene correction.
- the modified cells can be maintained or expanded in culture prior to administration to a subject.
- Culture conditions are generally known in the art depending on the cell type. Conditions for the maintenance of CD34 + in particular have been well studied, and several suitable methods are available.
- a common approach to ex vivo multi-potential hematopoietic cell expansion is to culture purified progenitor or stem cells in the presence of early-acting cytokines such as interleukin-3.
- TPO thrombopoietin
- SCF stem cell factor
- Flt-3L flt3 ligand
- cells can be maintained ex vivo in a nutritive medium (e.g., for minutes, hours, or 3, 6, 9, 13, or more days) including murine prolactin-like protein E (mPLP-E) or murine prolactin-like protein F (mPIP-F; collectively mPLP- E/IF) (U.S. Patent No. 6,261,841).
- a nutritive medium e.g., for minutes, hours, or 3, 6, 9, 13, or more days
- mPLP-E murine prolactin-like protein E
- mPIP-F murine prolactin-like protein F
- Cells can also be grown in serum-free medium, as described in U.S. Patent No. 5,945,337.
- the modified hematopoietic stem cells are differentiated ex vivo into CD4 + cells culture using specific combinations of interleukins and growth factors prior to administration to a subject using methods well known in the art.
- the cells may be expanded ex vivo in large numbers, preferably at least a 5-fold, more preferably at least a 10-fold and even more preferably at least a 20-fold expansion of cells compared to the original population of isolated hematopoietic stem cells.
- cells for ex vivo gene therapy can be dedifferentiated somatic cells.
- Somatic cells can be reprogrammed to become pluripotent stem-like cells that can be induced to become hematopoietic progenitor cells.
- the hematopoietic progenitor cells can then be treated with triplex-forming molecules and donor oligonucleotides as described above with respect to CD34 + cells to produce recombinant cells having one or more modified genes.
- Representative somatic cells that can be reprogrammed include, but are not limited to, fibroblasts, adipocytes, and muscles cells.
- Hematopoietic progenitor cells from induced stem- like cells have been successfully developed in the mouse (Hanna, et al., Science, 318:1920-1923 (2007)).
- somatic cells are harvested from a host.
- the somatic cells are autologous fibroblasts.
- the cells are cultured and transduced with vectors encoding Oct4, Sox2, Klf4, and c-Myc transcription factors.
- the transduced cells are cultured and screened for embryonic stem cell (ES) morphology and ES cell markers including, but not limited to, AP, SSEA1, and Nanog.
- ES embryonic stem cell
- the transduced ES cells are cultured and induced to produce induced stem- like cells. Cells are then screened for CD41 and c-kit markers (early hematopoietic progenitor markers) as well as markers for myeloid and erythroid differentiation.
- the modified hematopoietic stem cells or modified induced hematopoietic progenitor cells are then introduced into a subject. Delivery of the cells may be affected using various methods and includes most preferably intravenous administration by infusion as well as direct depot injection into periosteal, bone marrow and/or subcutaneous sites.
- the subject receiving the modified cells may be treated for bone marrow conditioning to enhance engraftment of the cells.
- the recipient may be treated to enhance engraftment, using a radiation or chemotherapeutic treatment prior to the administration of the cells.
- the cells Upon administration, the cells will generally require a period of time to engraft. Achieving significant engraftment of hematopoietic stem or progenitor cells typically takes weeks to months.
- modified hematopoietic stem cells A high percentage of engraftment of modified hematopoietic stem cells is not envisioned to be necessary to achieve significant prophylactic or therapeutic effect. It is expected that the engrafted cells will expand over time following engraftment to increase the percentage of modified cells. It is expected that engraftment of only a small number or small percentage of modified hematopoietic stem cells will be required to provide a prophylactic or therapeutic effect.
- the cells to be administered to a subject will be autologous, e.g., derived from the subject, or syngeneic.
- the guide RNA enables specific gene editing for ex vivo cell therapies, including CAR-T, CAR-NK, and CAR- macrophage editing.
- the guide RNA enables knockout and knock-in of one of more genes or gene segments in iPSC, ESC, mesenchymal stem cell, and stem-derived cell lines.
- compositions are administered directly to a subject for in vivo gene therapy.
- the compositions are typically delivered as a pharmaceutically acceptable formulation, via a route and in an amount that is effective for the intended gene therapy.
- the dendrimer composition in particular glucose dendrimers, selectively targets neurons, which play a key role in the pathogenesis of many disorders and conditions including neurodevelopmental, neurodegenerative diseases, and brain cancer. Therefore, in preferred embodiments, the dendrimer compositions, in particular glucose dendrimers are administered systemically, and cross the blood brain barrier (BBB) to selectively target or to become enriched within neurons, preferably within the nucleus of neurons of injured/hyperactive neurons.
- BBB blood brain barrier
- the dendrimer compositions are administered in vivo in a dosage unit amount effective to treat or alleviate one or more conditions or diseases in a subject.
- the one or more conditions or diseases is associated with one or more pathological conditions of neurons.
- the dendrimers deliver an effective amount of gene editing composition to specifically modify the genomes of a sufficient number of diseased neurons to achieve a therapeutic result.
- dendrimer-gene editing agent compositions are especially useful to treat genetic deficiencies, disorders, and diseases caused by mutations in single genes, for example, to correct genetic deficiencies, disorders, and diseases caused by point mutations.
- the compositions can be used for mutagenic repair that may restore the DNA sequence of the target gene to normal.
- the target sequence can be within the coding DNA sequence of the gene or within an intron.
- the target sequence can also be within DNA sequences that regulate expression of the target gene, including promoter or enhancer sequences.
- compositions are especially useful to treat monogenic diseases and polygenic diseases, where the dendrimer is conjugated or complexed to one or multiple sgRNA constructs.
- the oligonucleotide is useful for causing a mutation that inactivates the gene and terminates or reduces the uncontrolled proliferation of the cell.
- the oligonucleotide is also a useful anti-cancer agent for activating a repressor gene that has lost its ability to repress proliferation.
- the target gene can also be a gene that encodes an immune regulatory factor, such as Programmed cell death protein 1 (PD-1), in order to enhance the host’s immune response to a cancer.
- PD-1 Programmed cell death protein 1
- the gene modification technology can be designed to reduce or prevent expression of PD-1 and administered in an effective amount to do so. Therefore, in some embodiments, compositions are used to treat cancer.
- the compositions can be used as antiviral agents, for example, when designed to modify a specific a portion of a viral genome necessary for proper proliferation or function of the virus.
- the dendrimer composition in particular glucose dendrimers, selectively targets neurons, which play a key role in the pathogenesis of many disorders and conditions including neurodevelopmental, neurodegenerative diseases, and brain cancer.
- the dendrimer composition in particular glucose dendrimers, cross the blood brain barrier (BBB) and selectively target or enriched within neurons, preferably within the nucleus of neurons of injured/hyperactive neurons.
- BBB blood brain barrier
- the dendrimer composition enable targeted editing of a specific cell in the body, including reactive immune cells, including reactive microglia, macrophages, astrocytes, retinal pigment epithelial (RPE cells), enabled by the ability of the hydroxyl PAMAM dendrimers to target these cells.
- reactive immune cells including reactive microglia, macrophages, astrocytes, retinal pigment epithelial (RPE cells), enabled by the ability of the hydroxyl PAMAM dendrimers to target these cells.
- the dendrimer compositions are administered in a dosage unit amount effective to treat or alleviate conditions associated with the pathological conditions of neurons.
- the dendrimers deliver an effective amount of gene editing composition to specifically modify the genomes of a sufficient number of diseased neurons to achieve a therapeutic result.
- the dendrimer compositions are suitable for treating one or more diseases and conditions in the eye, the brain, and the nervous system, particularly those associated with pathological activation of neurons, microglia and/or astrocytes.
- the compositions and methods are also suitable for prophylactic use.
- the subject to be treated is a human. In some embodiments, the subject to be treated is a child, or an infant. All the methods can include the step of identifying and selecting a subject in need of treatment, or a subject who would benefit from administration with the described compositions.
- compositions and methods are suitable for treatment of one or more diseases and conditions in the eye.
- the eye disorder to be treated is age-related macular degeneration (AMD).
- Age-related macular degeneration (AMD) is a neurodegenerative, neuroinflammatory disease of the macula, which is responsible for central vision loss.
- the pathogenesis of age-related macular degeneration involves chronic neuroinflammation in the choroid (a blood vessel layer under the retina), the retinal pigment epithelium (RPE), a cell layer under the neurosensory retina, Bruch's membrane, and the neurosensory retina, itself.
- VEGF vascular endothelial growth factor
- dendrimer-Cas9 RNP is effective in editing VEGF gene.
- the composition is administered in an amount effective to permanently suppress VEGF secretion from human retinal cells.
- the eye disorder is a hereditary form of blindness are caused by a specific genetic mutation such as Leber congenital amaurosis, the most common cause of inherited childhood blindness.
- eye disorders that may be treated include amoebic keratitis, fungal keratitis, bacterial keratitis, viral keratitis, onchorcercal keratitis, bacterial keratoconjunctivitis, viral keratoconjunctivitis, corneal dystrophic diseases, Fuchs' endothelial dystrophy, meibomian gland dysfunction, anterior and posterior blepharitis, conjunctival hyperemia, conjunctival necrosis, cicatrical scaring and fibrosis, punctate epithelial keratopathy, filamentary keratitis, comeal erosions, thinning, ulcerations and perforations, Sjogren's syndrome, Stevens-Johnson syndrome, autoimmune dry eye diseases, environmental dry eye diseases, comeal neovascularization diseases, post-comeal transplant rejection prophylaxis and treatment, autoimmune uveitis, infectious uveitis, anterior uveitis, posterior u
- the dendrimer compositions and formulations are suitable for treatment of one or more neurological and neurodegenerative diseases.
- the disease or disorder is selected from, but not limited to, some psychiatric (e.g., depression, schizophrenia (SZ), alcohol use disorder, and morphine antinociceptive tolerance), neurological and neurodegenerative disorders e.g., Alzheimer’s disease (AD), Parkinson disease (PD), Amyotrophic Lateral Sclerosis (ALS)).
- the dendrimer complexes are used to treat Alzheimer’ s Disease (AD) or dementia.
- Neurodegenerative diseases are chronic progressive disorders of the nervous system that affect neurological and behavioral function and involve biochemical changes leading to distinct histopathologic and clinical syndromes (Hardy H, et al., Science. 1998;282: 1075-9). Abnormal proteins resistant to cellular degradation mechanisms accumulate within the cells. The pattern of neuronal loss is selective in the sense that one group gets affected, whereas others remain intact. Often, there is no clear inciting event for the disease.
- the diseases classically described as neurodegenerative are Alzheimer's disease, Huntington's disease, and Parkinson's disease.
- compositions and methods deliver an effective amount of gene editing composition for the treatment of a neurological or neurodegenerative disease or disorder or central nervous system disorder.
- the compositions and methods are effective in treating, and/or alleviating neuroinflammation associated with a neurological or neurodegenerative disease or disorder or central nervous system disorder.
- the methods typically include administering to the subject an effective amount of the composition to increase cognition or reduce a decline in cognition, increase a cognitive function or reduce a decline in a cognitive function, increase memory or reduce a decline in memory, increase the ability or capacity to learn or reduce a decline in the ability or capacity to learn, or a combination thereof.
- the neurological disease or disorder is Huntington’s disease, Amyotrophic Lateral Sclerosis (ALS), Alzheimer’s disease, Parkinson’ s disease, Childhood Cerebral Adrenal Leukodystrophy (ccALD), muscular dystrophy, Friedreich ataxia, and the spinocerebellar ataxias.
- ALS Amyotrophic Lateral Sclerosis
- ccALD Childhood Cerebral Adrenal Leukodystrophy
- muscular dystrophy Friedreich ataxia
- Friedreich ataxia the spinocerebellar ataxias.
- the disease or disorder is Duchenne’s muscular dystrophy, which is caused by mutations in the DMD gene, encoding for a protein necessary for the contraction of muscles.
- the disease or disorder is Huntington’ s disease.
- Huntington’ s disease is caused by an abnormal repetition of a certain DNA sequence within the huntingtin gene. Treating Huntington’s could be tricky, as any off-target effects of CRISPR in the brain could have very dangerous consequences.
- the composition of dendrimer-gene editing agent provides selective delivery to target cells with minimal off-targets.
- the disease or disorder is spinal muscular atrophy.
- Spinal muscular atrophy is an autosomal recessive neuromuscular disorder caused by mutations in the survival-motor-neuron 1 (SMN1) telomeric gene. Deficiencies in the ubiquitous SMN function affect multiple tissues and organs; however neuronal tissue is primarily sensitive, resulting in a-motor neuron degeneration in the ventral horn of the spinal cord with subsequent neuromuscular-junction dysfunction and proximal muscle weakness.
- the dendrimer-gene editing compositions are administered to increase SMN levels in the affected tissues for the treatment of spinal muscular atrophy, for example, by applying targeted genome editing technology to the human SMN locus in order to revert the SMN2 sequence to a SMNl-like sequence that may undergo proper splicing under the endogenous transcriptional control.
- compositions and methods can be used to treat subjects with a disease or disorder, such as Parkinson’s Disease (PD) and PD-related disorders, Amyotrophic Lateral Sclerosis (ALS), Prion Diseases such as Creutzfeldt- Jakob Disease, Corticobasal Degeneration, Frontotemporal Dementia, HIV-Related Cognitive Impairment, Mild
- a disease or disorder such as Parkinson’s Disease (PD) and PD-related disorders, Amyotrophic Lateral Sclerosis (ALS), Prion Diseases such as Creutzfeldt- Jakob Disease, Corticobasal Degeneration, Frontotemporal Dementia, HIV-Related Cognitive Impairment, Mild
- MND Motor Neuron Diseases
- Lewy Body Disease Alpers’ Disease, neuronal ceroid lipofuscinoses, Batten Disease, Cerebro- Oculo-Facio-Skeletal Syndrome, Corticobasal Degeneration, Gerstmann- Straussler-Scheinker Disease, Kuru, Leigh's Disease, Monomelic Amyotrophy, Multiple System Atrophy, Multiple System Atrophy With Orthostatic Hypotension (Shy-Drager Syndrome), Multiple Sclerosis (MS), Duchenne’s muscular dystrophy (DMD), Neurodegeneration with Brain Iron Accumulation, Opsoclonus Myoclonus, Posterior Cortical Atrophy, Primary Progressive Aphasia, Progressive Supranuclear Palsy, Vascular Dementia, Progressive Multifocal Leukoencephalopathy, Dementia with Lewy Bodies (DLB), Lacunar syndromes, Hydrocephalus, Wemicke-Korsakoff’s syndrome, post-encephalitic dementia, cancer and chemotherapy
- the disease or disorder is injection-localized amyloidosis, cerebral amyloid angiopathy, myopathy, neuropathy, brain trauma, frontotemporal dementia, Pick’s disease, multiple sclerosis, prion disorders, diabetes mellitus type 2, fatal familial insomnia, cardiac arrhythmias, isolated atrial amyloidosis, atherosclerosis, rheumatoid arthritis, familial amyloid polyneuropathy, hereditary non-neuropathic systemic amyloidosis, Finnish amyloidosis, lattice corneal dystrophy, systemic AL amyloidosis, neuronopathic Gaucher disease, or Down syndrome.
- the disease or disorder is Alzheimer’s disease or dementia.
- Neurodevelopmental disorder generally implies that the brain is not formed normally from the beginning. Abnormal regulation of fundamental neurodevelopmental processes may occur, or there may be disruption by insult that may take various forms. Autism and attention-deficit hyperactivity disorder have been classically described as neurodevelopmental disorders. Other include fragile X syndrome, Down syndrome, Tay-Sachs disease, Sandhoff disease, Niemann-Pick disease, and sphingolipidoses.
- compositions and methods can also be used for the treatment of a neurodevelopmental disorder, such as cerebral palsy. 4. Cancer
- compositions of dendrimers -gene editing agents are administered to a subject having a proliferative disease, such as a benign or malignant tumor.
- a proliferative disease such as a benign or malignant tumor.
- the subjects to be treated have been diagnosed with stage I, stage II, stage III, or stage IV cancer.
- cancer refers specifically to a malignant tumor.
- malignant tumors exhibit metastasis.
- small clusters of cancerous cells dislodge from a tumor, invade the blood or lymphatic vessels, and are carried to other tissues, where they continue to proliferate. In this way a primary tumor at one site can give rise to a secondary tumor at another site.
- compositions and methods are useful for treating subjects having benign or malignant tumors by delaying or inhibiting the growth of a tumor in a subject, reducing the growth or size of the tumor, inhibiting or reducing metastasis of the tumor, and/or inhibiting or reducing symptoms associated with tumor development or growth.
- Malignant tumors which may be treated are classified according to the embryonic origin of the tissue from which the tumor is derived.
- Carcinomas are tumors arising from endodermal or ectodermal tissues such as skin or the epithelial lining of internal organs and glands. The compositions are particularly effective in treating carcinomas.
- Sarcomas which arise less frequently, are derived from mesodermal connective tissues such as bone, fat, and cartilage.
- the leukemias and lymphomas are malignant tumors of hematopoietic ceils of the bone marrow. Leukemias proliferate as single cells, whereas lymphomas tend to grow as tumor masses. Malignant tumors may show up at numerous organs or tissues of the body to establish a cancer.
- the types of cancer that can be treated with the compositions and methods include, but are not limited to, cancers such as vascular cancer such as multiple myeloma, adenocarcinomas and sarcomas, of bone, bladder, brain, breast, cervical, colorectal, esophageal, kidney, liver, lung, nasopharangeal, pancreatic, prostate, skin, stomach, and uterine.
- cancers such as vascular cancer such as multiple myeloma, adenocarcinomas and sarcomas, of bone, bladder, brain, breast, cervical, colorectal, esophageal, kidney, liver, lung, nasopharangeal, pancreatic, prostate, skin, stomach, and uterine.
- the compositions are used to treat multiple cancer types concurrently.
- the compositions can also be used to treat metastases or tumors at multiple locations.
- tumor cells include tumor cells of cancers, including leukemias including, but not limited to, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemias such as myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia leukemias and myelodysplastic syndrome, chronic leukemias such as, but not limited to, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphomas such as, but not limited to, Hodgkin’s disease, non- Hodgkin’ s disease; multiple myelomas such as, but not limited to, smoldering multiple myeloma, non- secretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma and extramedullary plasmacytom
- Cancers that can be prevented, treated or otherwise diminished by the compositions include myxosarcoma, osteogenic sarcoma, endotheliosarcoma, lymphangioendotheliosarcoma, mesothelioma, synovioma, hemangioblastoma, epithelial carcinoma, cystadenocarcinoma, bronchogenic carcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, and gastric cancer (for a review of such disorders, see Fishman et al., 1985, Medicine, 2d Ed., J.B. Lippincott Co., Philadelphia and Murphy et al., 1997, Informed Decisions: The Complete Book of Cancer Diagnosis, Treatment, and Recovery, Viking Penguin, Penguin Books U.S.A., Inc., United States of America).
- the compositions are used for prophylactic use i.e., prevention, delay in onset, diminution, eradication, or delay in exacerbation of signs or symptoms after onset, and prevention of relapse.
- a therapeutically effective amount of the compositions or pharmaceutically acceptable salts thereof as described are administered to a subject prior to onset (e.g., before obvious signs of cancer), during early onset (e.g., upon initial signs and symptoms of cancer), or after an established development of cancer.
- Prophylactic administration can occur for several days to years prior to the manifestation of symptoms.
- Prophylactic administration can be used, for example, in the chemo- preventative treatment of subjects presenting precancerous lesions, those diagnosed with early- stage malignancies, and for subgroups with susceptibilities (e.g., family, racial, and/or occupational) to particular cancers.
- susceptibilities e.g., family, racial, and/or occupational
- Dosage and dosing regimens are dependent on the severity and location of the disorder or injury and/or methods of administration, as well as the specific agent being delivered. This can be determined by those skilled in the art.
- dosages are expressed in mg/kg, particularly when the expressed as an in vivo dosage of dendrimer-gene editing composition.
- doses would be in the range from microgram/kg up to about 100 mg/kg of body weight.
- Dosages can be, for example 0.01 mg/kg to about 1,000 mg/kg, or 0.5 mg/kg to about 1,000 mg/kg, or 1 mg/kg to about 1,000 mg/kg, or about 10 mg/kg to about 500 mg/kg, or about 20 mg/kg to about 500 mg/kg per dose, or 20 mg/kg to about 100 mg/kg per dose, or 25 mg/kg to about 75 mg/kg per dose, or about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 mg/kg per dose.
- the compositions of dendrimer-gene editing agents do not target or otherwise genetically modify non-target or healthy cells not within or associated with the diseased tissue, or do so at a reduced level compared to cells associated with a disease or disorder such as a cancer and/or proliferative disorder.
- dendrimer compositions are administered in an amount that leads to an improvement, or enhancement, function in an individual with a disease or disorder, such as a cancer and/or proliferative disorder.
- compositions can vary according to factors including the specific agent administered, the particular composition formulated, the mode of administration, and the age, weight, condition of the subject being treated, as well as the route of administration and the disease or disorder. Generally, for intravenous injection or infusion, the dosage will be lower than for oral administration.
- Dosage can vary and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the subject or patient. Persons of ordinary skill in the art can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages can vary depending on the relative potency of individual pharmaceutical compositions, and can generally be estimated based the effective dosages in in vitro and in vivo animal models.
- Dosage forms of the pharmaceutical composition including the dendrimer compositions are also provided.
- Dosage form refers to the physical form of a dose of a therapeutic compound, such as a capsule or vial, intended to be administered to a patient.
- the term “dosage unit” refers to the amount of the therapeutic compounds to be administered to a patient in a single dose.
- timing and frequency of administration will be adjusted to balance the efficacy of a given treatment or diagnostic schedule with the side effects of the given delivery system.
- dosages are administered daily, biweekly, weekly, every two weeks or less frequently in an amount to provide a therapeutically effective increase in the blood level of the therapeutic agent.
- the compositions may be delivered over a period of more than one hour, e.g., 3-10 hours, to produce a therapeutically effective dose within a 24-hour period.
- the compositions can be formulated for controlled release, wherein the composition is administered as a single dose that is repeated on a regimen of once a week, or less frequently.
- a dosing regimen can be any length of time sufficient to treat the disorder in the subject.
- the regimen includes one or more cycles of a round of therapy followed by a drug holiday e.g., no drug).
- the drug holiday can be 1, 2, 3, 4, 5, 6, or 7 days; or I, 2, 3, 4 weeks, or I, 2, 3, 4, 5, or 6 months.
- the therapeutic result of the composition including one or more gene editing compositions associated with or conjugated to a dendrimer can be compared to a control.
- Suitable controls are known in the art and include, for example, an untreated subject, or a placebo-treated subject.
- a typical control is a comparison of a condition or symptom of a subject prior to and after administration of glucose dendrimer compositions.
- the condition or symptom can be a biochemical, molecular, physiological, or pathological readout.
- the effect of the composition on a particular symptom, pharmacologic, or physiologic indicator can be compared to an untreated subject, or the condition of the subject prior to treatment.
- the symptom, pharmacologic, or physiologic indicator is measured in a subject prior to treatment, and again one or more times after treatment is initiated.
- the control is a reference level, or average determined based on measuring the symptom, pharmacologic, or physiologic indicator in one or more subjects that do not have the disease or condition to be treated (e.g. , healthy subjects).
- the effect of the treatment is compared to a conventional treatment that is known the art.
- an untreated control subject suffers from the same disease or condition as the treated subject.
- a control includes an equivalent amount of gene editing compositions delivered alone, or bound to dendrimers without glucose-based branching units such as dendrimers of a similar generation, molecular weight, and/or surface group density (e.g., hydroxyl groups).
- the compositions can be packaged in kit.
- the kit can include a single dose or a plurality of doses of a composition including one or more gene editing compositions associated with or conjugated to a dendrimer (e.g., one or more hydroxyl PAMAM dendrimers or glucose dendrimers as described in the Examples), and instructions for administering the compositions.
- a dendrimer e.g., one or more hydroxyl PAMAM dendrimers or glucose dendrimers as described in the Examples
- the instructions direct that an effective amount of the dendrimer composition be administered to an individual with a particular disease/disorder as indicated.
- the composition can be formulated as described above with reference to a particular treatment method and can be packaged in any convenient manner.
- FIG. 1 is a schematic showing stepwise synthesis of generation one (Gl) glucose dendrimer.
- FIG. 2 is a schematic showing stepwise synthesis of generation two (G2) glucose dendrimer using a highly efficient click chemistry approach.
- the GD synthesis was begun by reacting hexa-propargylated core with AB4, P-D-glucose-PEG4-azide building via click reaction to obtain generation 1 glucose dendrimer (GDI) FIG. 2.
- the OH groups on GDI were propargylated to obtain GD1-Acetylene24, which was reacted with P-D- glucose-PEG4-azide to obtain generation 2 (GD2) with 24 glucose moieties, providing 96 surface hydroxyl groups.
- the Cy5 fluorescent tag was attached on GD2 by propargylation of approximately 2-3 hydroxyl groups to produce alkyne containing GD2 dendrimer.
- the GD intermediates and final products were purified using dialysis and characterized using 1H NMR.
- GD2 dendrimer The physicochemical properties of GD2 dendrimer were also evaluated, as set forth in Table 1, below.
- the hexapropagylated core 1 was treated treated with AB4 building block ( ?-Glucose-PEG4-azide), 2 under anal click regents (CuAAC click reaction), catalytic amount of copper sulfate pentahydrate (CuSCL.SHiO) and sodium ascorbate in DMF:H20(l:l) to produce Gl-glucose-24-OAc, 3. Then compound 3 was treated under typical Zemplen conditions (to remove acetate groups) to obtain the desired product 4 (Gl-glucose).
- Gl glucose dendrimer has six surface glucose units (z. ⁇ ?., 24 surface hydroxyl groups) as shown in FIG. 1.
- generation one dendrimer Dl-acetylene24 is further reacted with AB4 P-D-glucose-PEG4-azide to provide generation 2 dendrimer with 24 glucose molecules containing 96 surface hydroxyl groups.
- Gl-glucose dendrimer 4 was treated with sodium hydride (60% dispersion in mineral oil) for 15 min at 0 °C and then treated with Propargyl bromide (80% w/w solution in toluene). The reaction was stirred at room temperature for 8 h to form compound 5. The compound 5 next treated with AB4 building block (fl-
- Glucose-PEG4-azide 2 under anal click regents (CuAAC click reaction), catalytic amount of copper sulfate pentahydrate (CUSO4.5H2O) and sodium ascorbate in DMF:H20(l:l) to produce G2-glucose-96-OAc, 6. And then compound 6 was reacted under typical Zemplen conditions to obtain the desired product 7 (G2-glucose).
- Example 2 Synthesis of Generation 2 Glucose dendrimer based CRISPR-Cas9-ribonucleoprotein.
- the GD2 Cas9 conjugation was conducted out using strain-promoted click chemistry strategy using tans-cyclooctene-tetrazine (TCO-Tz) chemistry, under mild catalyst free conditions.
- the Cas9-2NLS was functionalized with terminal tetrazine (Tz) while GD2 was functionalized with trans -cyclooctene (TCO.
- the G2 dendrimer D2-G1U24-OH96 is propargylated at one or more terminal hydroxyl groups suitable for further conjugation to one or more molecules such as Cas9 nuclease.
- the G2-glucose dendrimer was treated with sodium hydride (60% dispersion in mineral oil) at 0°C and addition of propagyl bromide at O°C-RT for 8 h to form compound 8.
- the resulted product 8 was reacted with azido-PEG2-amine (9) to form product 10.
- the product, 10 was labeled with Cy5 fluorophore and the resulted intermediate, 11 was conjugated with Pegylated trans-cyclooctene (TCO) to obtain functionalized Cy5-D-PEG4-TCO (13).
- TCO Pegylated trans-cyclooctene
- Reactions were performed in flame dried glassware under a positive pressure of Ar or N2 gas using dry solvents.
- Commercial grade reagents and anhydrous solvents were purchased from chemical suppliers and used without further purification.
- l-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC.HC1), N, N- diisoprpyl ethyl amine (DTPEA), 4-(dimethylamino)pyridine (DMAP) trifluoracetic acid (TFA), y-(Boc-amino)butyric acid (Boc-GABA-OH), anhydrous dichloromethane (DCM), N,N'-dimethylformamide (DMF) were purchased from Sigma-Aldrich (St.
- Cyanine 5 (Cy5)- mono-NHS ester was purchased from Amersham Bioscience-GE Healthcare.
- Cyanine 3 (Cy3) trans-cyclooctene (TCO) was purchased from AAT bioquest, Inc.
- Deuterated solvents dimethylsulfoxide (DMSO-tfo), water (D2O), and Chloroform (CDCI3) were purchased from Cambridge Isotope Laboratories Inc. (Andover, MA).
- Dialysis membranes were purchased from Spectrum Laboratories Inc. (Rancho Dominguez, CA, USA).
- Cas9 nuclease 2NLS, -S’. Pyrogenes, and all primers was purchased from SYNTHEGO Corporation (Redwood City, CA).
- the eluents were monitored at 210 nm using a photodiode array (PDA) detector, and fluorescently labeled conjugate was monitored at both 650 and 210 nm using fluorescence and PDI detectors respectively.
- HPLC elution was carried out with a 40 min linear gradient of 0%-90% HPLC grade acetonitrile (CH3CN) in water (containing 0.1% TFA) maintaining the flow rate at 1.0 mL/min.
- Cas9 protein was desalted prior to the MALDT analysis.
- the MALDI matrix 3,5-Dimethoxy-4-hydroxycinnamic acid (Sinapic acid) (10 mg/mL of Acetonitrile: water (1:1) with 0.1% trifluoracetic acid) was prepared freshly.
- Cas9 protein (2 pL) was deposited on the MALDI sample plate and then the matrix (2 pL) was deposited on the air-dried sample and allowed it to air dry for 10-20 min.
- the MALDI-TOF MS analysis was performed on a Voyager DE-STR MALDI-TOF operated in linear, positive ion mode.
- the particle size of dendrimer, and Cas9 conjugates were determined by dynamic light scattering (DLS) using a Zetasizer Nano ZS (Malvern instrument Ltd. Worchester, U.K) equipped with a 50 mW He-Ne laser (633 nm).
- the conjugates were dissolved in deionized water (18.2 Q) to make solutions with final concentration of 0.2 mg/mL.
- the solutions were filtered through a cellulose acetate membrane (0.45 m, PALL Life Science) and DLS measurements were performed in triplicate, at 25 °C with a scattering angle of 173°.
- FIG. 3A-3C are schematics showing stepwise synthesis of G2-Glucose-PEG4-TCO (3A) and the chemical structures of the intermediates TCO-PEG4-NHS ester (3B) and Cy5 (3C) used in the syntheses shown in FIG 4.
- the subscripted numbers in the formulas indicate the number of attachments per dendrimer
- FIG. 3 is a schematic showing Me-Tz attached Cas9 nuclease 2NLS (.S', pyogenes) and TCO attached glucose dendrimer reacting under physiological conditions to form Cy5-D-Cas9(2NLS) conjugate.
- FIG. 3 is a schematic showing click chemistry strategy using tans-cyclooctene-tetrazine (TCO-Tz) chemistry employed in making Cy5-D-Cas9(2NLS) conjugate.
- TCO-Tz tans-cyclooctene-tetrazine
- constructs of glucose dendrimer-Cas9 conjugates complexed with appropriate guide RNAs were prepared. Conjugates of dendrimers made of glucose and ethylene glycol building blocks that contain multiple glucose moieties on the surface are useful for targeted neuronal delivery of CRISPR-Cas9 ribonucleoproteins .
- FIG. 3 is a schematic showing stepwise synthesis of G2-Glucose- PEG4-TC0 and synthetic intermediates.
- the G2-glucose dendrimer was treated with sodium hydride (60% dispersion in mineral oil) at 0°C and propagyl bromide added at 0°C-RT for 8 h to form compound 8.
- the resulting product 8 was reacted with azido-PEG2-amine (9) to form product 10.
- the product 10 was labeled with Cy5 fluorophore and the resulting intermediate 11 was conjugated with Pegylated trans -cyclooctene (TCO) to obtain functionalized Cy5-D-PEG4-TCO 13.
- TCO Pegylated trans -cyclooctene
- GD2 Cas9 conjugation was successfully carried out using strain- promoted click chemistry strategy using tans-cyclooctene-tetrazine (TCO- Tz) chemistry, under mild catalyst free conditions.
- the Cas9-2NLS was functionalized with terminal tetrazine (Tz) while GD2 was functionalized with trans -cyclooctene (TCO) as previously described as PAMAM Hydroxyl dendrimer.
- Tz terminal tetrazine
- TCO trans -cyclooctene
- the successful synthesis of GD2-Cas9(2NLS) and the molecular weight of the conjugate was determined by MALDI-TOF as 183,413 Da.
- the peak at 183413 Da for Cy5-GD2-Cas9 in close agreement with the theoretical molecular weight of D-Cas9 of 172800 Da (FIG. 5).
- the generation-2 glucose dendrimer (GD2) is formed of 24 glucose molecules (96 surface hydroxyl groups) used for Cas9 conjugation.
- Glucose dendrimers are primarily made of glucose moieties comprising a central core of Di-pentaery tol and one or more branching units of monosaccharide glucose molecules.
- glucose dendrimers are primarily taken up by injured neurons and found to specifically target hyperexcitable neurons in both culture and in an in vivo mouse model.
- FIG. 5 is a MALDI-TOF of the Cy5-GD2-Cas9 of FIG. 4, confirming synthesis of the conjugate.
- Reactions were performed in flame dried glassware under a positive pressure of Ar or N2 gas using dry solvents.
- Commercial grade reagents and anhydrous solvents were purchased from chemical suppliers and used without further purification.
- PAMAM Ethylenediamine-core polyamidoamine
- EDC.HC1 A-diisoprpylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP) trifluoracetic acid (TFA), y- (Boc-amino)butyric acid (Boc-GABA-OH), anhydrous dichloromethane (DCM), N,N'-dimethylformamide (DMF) were purchased from Sigma- Aldrich (St. Louis, MO, USA). Cyanine 5 (Cy5)-mono-NHS ester was purchased from Amersham Bioscience-GE Healthcare.
- Cyanine 3 (Cy3) trans-cyclooctene (TCO) was purchased from AAT bioquest, Inc.
- Deuterated solvents dimethylsulfoxide (DMSO-de), water (D2O), and Chloroform (CDCh) were purchased from Cambridge Isotope Laboratories Inc. (Andover, MA).
- Dialysis membranes were purchased from Spectrum Laboratories Inc. (Rancho Dominguez, CA, USA).
- Cas9 nuclease 2NLS, .S’. Pyrogenes, and all primers was purchased from SYNTHEGO Corporation (Redwood City, CA).
- the eluents were monitored at 210 nm using a photodiode array (PDA) detector, and fluorescently labeled conjugate was monitored at both 650 and 210 nm using fluorescence and PDT detectors respectively.
- HPLC elution was carried out with a 40 min linear gradient of 0%-90% HPLC grade acetonitrile (CH3CN) in water (containing 0.1% TFA) maintaining the flow rate at 1.0 mL/min.
- CH3CN HPLC grade acetonitrile
- Cas9 protein was desalted prior to the MALDI analysis.
- the MALDI matrix 3,5-Dimethoxy-4-hydroxycinnamic acid (Sinapic acid) (10 mg/mL of Acetonitrile: water (1: 1) with 0.1% trifluoracetic acid) was prepared freshly.
- Cas9 protein (2 pL) was deposited on the MALDI sample plate and then the matrix (2 pL) was deposited on the air-dried sample and allowed it to air dry for 10-20 min.
- the MALDI-TOF MS analysis was performed on a Voyager DE-STR MALDI-TOF operated in linear, positive ion mode.
- the particle size of dendrimer, and Cas9 conjugates were determined by dynamic light scattering (DLS) using a Zetasizer Nano ZS (Malvern instrument Ltd. Worchester, U.K) equipped with a 50 mW He-Ne laser (633 nm).
- the conjugates were dissolved in deionized water (18.2 Q) to make solutions with final concentration of 0.2 mg/mL.
- the solutions were filtered through a cellulose acetate membrane (0.45 m, PALL Life Science) and DLS measurements were performed in triplicate, at 25 °C with a scattering angle of 173°.
- Cy5-D-PEG4-TCO conjugate was synthesized using PAMAM-G6- OH (D6-0H, 256 free hydroxyl groups) (Example 3).
- the lyophilized mono-functionalized D6-0H was functionalized with Boc protected amine by treatment of 4-n?r/-butoxycarbonylamino)butyric acid (Boc-GABA-OH) under jV-(3-dimethylaminopropyl)-N '-ethylcarbodiimide hydrochloride (EDC.HC1) and 4-(dimethylamino)pyridine (4-DMAP) in DMF for 36 h at room temperature to yield the Boc protected bifunctional dendrimer product.
- Boc-GABA-OH 4-n?r/-butoxycarbonylamino)butyric acid
- EDC.HC1 4-(dimethylamino)pyridine
- 4-DMAP 4-(dimethylamino)pyridine
- Boc groups were de-protected under mild acidic condition using trifluoroacetic acid (TFA) in dichloromethane (DCM) 1:4 to obtain bifunctionalized dendrimer.
- TFA trifluoroacetic acid
- DCM dichloromethane
- the excess TFA was removed by co-evaporation with methanol and resulted crude product was used for next step without further purification.
- the complete disappearance of Boc protons was confirmed by NMR while no ester hydrolysis was observed under this condition.
- the total number of amine groups was maintained at ⁇ 10.
- bifunctional dendrimer was treated with fluorescent dye Cy5 to yield dendrimer 4 with ⁇ l-2 successful Cy5 attachment at dendrimer surface.
- the dendrimer Cas9 conjugation was carried out using strain- promoted click chemistry strategy using tans-cyclooctene-tetrazine (TCO- Tz) chemistry, under mild catalyst free conditions (Kim, E. & Koo, H. Chem Sci 10, 7835-7851, (2019)).
- the Cas9-2NLS was functionalized with terminal tetrazine (Tz) while D6-0H was functionalized with transcyclooctene (TCO) for click reaction.
- TCO- Tz tans-cyclooctene-tetrazine
- the PEGylated trans-cyclooctene (PEG4-TCO) attached dendrimer 6 (61 pg in 200 pL PBS) was reacted with 8 via TCO-Tz click reaction to afford crude product 9.
- the resulting crude product was purified by ultrafiltration.
- the “Click chemistry reaction” used between 1 ,2,4,5-tettrazines (Tz) and trans-cyclooctenenes (TCO) proceeds via an inverse -electron demand Diels-Alder reaction (IEDDA) followed under mild physiological conditions to form dihydropyridazine bond.
- IEDDA inverse -electron demand Diels-Alder reaction
- the chemo- selective TCO-Tz ligation possess ultrafast kinetics (>800 M _1 s -1 ) unmatched by any other bio-orthogonal ligation pair.
- the click ligation was performed at near neutral pH, aqueous condition at room temperature.
- the ultrafast kinetics, selectivity, and long-term aqueous stability make TCO-Tz the ideal pair in low concentration dendrimer-Cas9 coupling reactions.
- the chemically synthesized D-Cas9(2NLS) was further purified by GE Healthcare Sephadex G-25 column and concentrated by ultrafiltration.
- D-Cas9(2NLS) sucessful synthesis of D-Cas9(2NLS) was confirmed by gel electrophorosis.
- the molecular weight was determined by MALDI-TOF.
- PAMAM G6 dendrimer shows peak at 57859 Da
- Cas9 shows peaks at 162884 Da (molecular ion peak), 81193 Da (M2 + ) and 54238 Da (M3 + )
- the peak at 213099 Da for D- Cas9 is in close agreement with the theoretical molecular weight of D-Cas9 of 225000. Changes in size before and after modifications were determined by DLS measurements.
- the hydrodynamic diameter of PAMAM-G6-0H is 4.6+1.2 nm, Cas9 9.5+1.1 nm, and D-Cas9 13.2+1.6 nm.
- the concentration of Cas9 in Cas9 protein and D-Cas9 constructs were determined using a NanoDrop 2000 (Thermofisher Scientific) from the absorbance at 280 nm. All other intermediates are charcterized using ! H NMR, MALDI-TOF, and HPLC.
- the GFPd2 expressing human embryonic kidney 293T (HEK293T) cell line was generously provided by the Green Lab (Institute for NanoBio Technology, and Translational Tissue Engineering Center, Johns Hopkins University). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, ATCC, Manassas, VA) supplemented with 10% (v/v) heat- inactivated fetal bovine serum (FBS, Invitrogen Corp., Carlsbad, CA), 1% penicillin/streptomycin (P/S, Invitrogen Corp., Carlsbad CA). Cell media was replaced with Opti-MEM (Thermo Scientific, Rockford, IL) for transfection studies. Cells were maintained at 37°C and 5% CO2 under humidified atmosphere.
- DMEM Dulbecco’s modified Eagle’s medium
- FBS Invitrogen Corp., Carlsbad, CA
- P/S penicillin/streptomycin
- Opti-MEM Thermo
- the ARPE-19 cells an immortal human Retinal pigmental epithelium cell line was also used for this study.
- Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, ATCC, Manassas, VA) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS, Invitrogen Corp., Carlsbad, CA), 1% penicillin/streptomycin (P/S, Invitrogen Corp., Carlsbad CA). Cells were maintained at 37° C and 5% CO2 under humidified atmosphere.
- DMEM Dulbecco’s modified Eagle’s medium
- FBS heat-inactivated fetal bovine serum
- P/S penicillin/streptomycin
- GFP expressing HEK-293T cells were seeded in glass-bottom culture dishes and grown for 24-48 h to 70-80% confluency.
- Cells were treated with Cy5 fluorescently labeled dendrimer (Cy5-D) and Cas9-conjugated Cy5- labaled dendrimer (Cy5-D-Cas9, 9) or Cy5-D-EGFP in DMEM supplemented with 1% P/S (serum free media). The cells were then washed with PBS (x3) and fixed in 5% formalin solution. Cells were incubated and confocal microscopic images were taken by Zeiss Axiovert 200 system equipped with an LSM 510-Meta confocal module.
- Image acquisition parameters were kept constant during the imaging. Images were processed by Zen 2011 software (Zeiss). The Z-stack images were analyzed using Zen software and the 3D surface rendering was done using Imaris Version 8.1 software (Bitplane USA, Concord, MA, USA)
- Live-cell images were taken with a Zeiss Axiovert 200 phase-contrast microscope (Carl Zeiss) at set time points. Threshold for the images were automated with the built-in Triangle method in ImageJ.
- Table 2 Conditions for D-Cas9/sgRNA and Cas9/sgRNA RNP complex preparation.
- Lipofection Lipofectamine transfection with Cas9 was performed according to manufactures protocol. Using 10 pg of Cas9, 5 pg of sgRNA and 3 pL of Lipofectamine 2000 in a total volume of 100 pL. The lipofection was conducted in Opti-MEM media without serum and an equal volume of growth media was added to the cells after 1 h of lipofection to minimize cytotoxicity.
- Cytotoxicity and cell viability were assayed by treating HEK293T GFP expressing cells in 96- well plates with different formulations of RNP constructs.
- Cells were seeded in 96-well plate (15,000 cells/well) and incubated 24 h to 40-50% confluency. Cells were treated with different concentrations of RNP. After 24 h of incubation, cell viability/cytotoxicity was determined using the WST-8 assay (Dojindo Molecular Technologies) following the manufacture’s protocol. Cells were replenished with 100 pL of fresh media and treated with 10 pL of WST-8 reagent. Then cells were incubated 37 °C for 3h and absorbance was measured at 450 nm.
- WST-8 tetrazolium salt is reduced by dehydrogenase in living cells, forming a yellow formazan dye which shows absorbance at 450 nm.
- concentration of the formazan dye is directly proportional to the density of viable cells. Relative cell viability was defined as the percent viability compared with untreated controls.
- GFP expressing HEK293 cell DNA from control (without D- Cas9/sgRNA RNP) or D-Cas9/sgRNA RNP treated cells was amplified with primers designed to only amplify the gene edited sequence.
- PCR was conducted using the forward primer (Forward primer- CTGGTCGAGCTGGACGGCGACG (SEQ ID NO:5)), reverse primer (Reverse primer-CACGAACTCCAGCAGGACCATG (SEQ ID NO:6)) according to the manufacturer’ s protocol.
- the PCR products were analyzed on a 1% (wt/vol) TBE agarose gel casted with SYBR safe (Thermo Fisher). Band intensities were measured using ImageJ (available on the world wide web at://imagej. nih.gov/ij/ ; National Institute of Health, Bethesda, MD, USA) and the percentage of indel formation was calculated using following equation:
- Indel% 100 - [1 - [1 - fCut] 1 ' 2 1
- f cu t cut fraction
- Cy5-D-Cas9(2NLS) treated cells were also assessed for subcellular localization of Cas9.
- Live GFP-expressing HEK 293 cells were imaged at different time points (24 h and 36 h) using confocal microscope.
- the Cy5-D- Cas9(2NLS) successfully internalized to cytosol and significant fraction of Cy5-D-Cas9(2NLS) translocated to nucleus for genome editing. After 36 h incubation, most of the dendrimer Cy5 signal (red fluorescence) was overlapped with nucleus (blue fluorescence).
- Cy5-D-Cas9(2NLS) is facilitated by nuclear localization signals (NLSs) fused to the recombinant Cas9 protein.
- NLSs nuclear localization signals
- Cy5-D-Cas9 (2NLS) undergoes glutathione mediated disulfide reduction to release Cas9 (2NLS) cargo to cytosol and later translocate to nucleus.
- dendrimer Cas9 conjugate effectively delivered to the cytosol or Cy5-D-Cas9(2NLS) conjugate directly entered to nucleus through nuclear pore complexes.
- FIG. 9 is a schematic showing routes of nucleus entry of Cy5-D- Cas9 (2NLS).
- Table 3 Different D-Cas9/sgRNA and Cas9/sgRNA RNP formulations used in the study.
- the loss of GFP fluorescence was measured 3 days after transfection via flow cytometry to assay the editing efficiency. Successful gene editing results in a loss of green fluorescence that can be detected through flow cytometry.
- the dendrimer-based delivery platform was compared with commercially available lipofectamine-based delivery vehicle Lipofectamine 2000 (Lipo).
- FIG. 10D is a bar graph showing percent gene-edited cells (GFP negative cells) in HEK293T cells treated with different formulations of Cas9/sgRNA and Lipo Cas9/sgRNA RNPs as indicated in Table 2. Percent cell viability was also measured by CCK-8 assay, in control cells, or cells treated with D-Cas9/sgRNA and Lipo Cas9/sgRNA RNPs.
- D-Cas9(sgRNA) RNP The dose response of D-Cas9(sgRNA) RNP was assessed in cell viability and cytotoxicity.
- GFP expressing cells were treated for 3 days with various formulations of Cy5-D-Cas9(2NLS)/ Cas9(2NLS) with sgRNA that target GFP.
- D-Cas9 RNP had a maximum efficiency at 10 pg/mL 1 of Cas9.
- T7 endonuclease I T7EI
- T7E1 T7 endonuclease I based genomic detection assay
- Thermos Fisher The GeneArt Genomic Cleavage Detection kit, Thermos Fisher
- T7E1 T7 endonuclease 1
- T7E1 T7 endonuclease 1
- VEGF A protein was quantified four days after transfection via flow cytometry to assay the editing efficiency.
- Alexa Fluor 488 Anti VEGFA antibody (abeam) was used according to manufacturer’ s protocol.
- the percent VEGF positive cells in ARPE-19 cells treated with D- Cas9/sgRNA and Lipo Cas9/sgRNA RNPs was compared to VEGF antibody treated and untreated cells using flow cytometry.
- the percent gene-edited cells (VEGF negative cells) in ARPE-19 cells treated with D-Cas9/sgRNA RNPs with either VEGF sgRNA- 1 or VEGF sgRNA-2 was compared to VEGF antibody treated (VEGF+) and untreated (VEGF-) ARPE-19 cells based on FACS analysis.
- Cy5-D-Cas9(2NLS) does not cause significant cytotoxicity in GFP expressing HEK 293 cells, whereas, consistent with literature results, Lipo RNAs shows significantly higher cytotoxicity (-20-25% cell death) (FIG. 10A-10D).
- the CRISPR-Cas9 RNP mediated genome editing to disrupt the VEGF-A gene was also studied in human RPE cell line, ARPE-19. Two different gRNAs were used to target VEGF-A gene.
- the VEGF-A is a diffusible mitogen that is secreted by RPE and other cells in the eye in response to hypoxic and inflammatory conditions (Yiu, G., et al., Investigative Ophthalmology & Visual Science 57, 5490-5497, (2016)). This study is a proof-of-concept genome engineering study that has high potential in ocular applications.
- FIG. 10B is an enlarged bar graph showing percent gene-edited cells (z. ⁇ ?., VEGF negative cells) in ARPE-19 cells treated with Cas9/sgRNA and Lipo Cas9/sgRNA RNPs.
- FIG. 10C is a bar graph showing percent gene-edited cells (i.e., VEGF negative cells) in ARPE-19 cells treated with different dosages of Cas9/sgRNA and Lipo Cas9/sgRNA RNPs as indicated.
- D-Cas9(sgRNA)/Lipo Cas9(sgRNA) RNP was assessed in ARPE-19 cells.
- VEGF expressing cells were treated for 3 days with various formulations of Cy5-D-Cas9(2NLS)/ Lipo Cas9(2NLS) with sgRNA that target VEGF (FIG. IOC).
- the gene editing efficiency was measured by flow cytometry to quantify the editing efficiency.
- D-Cas9 RNP for VEGFA had a maximum efficiency at 10 pg/rnL -1 of Cas9.
- the sgRNA- 1 (target sequence: 5'C*G*G*GGAGGAGGUGGUAGCUG3' (SEQ ID NO: 2)) against VEGFA showed significant gene editing capability compared to the SgRNA- 2 (target sequence: 5'G*C*C*GCCGGCCGGGGAGGAGG3' (SEQ ID NO: 3)) (FIG. 13A-13C).
- SgRNA- 2 target sequence: 5'G*C*C*GCCGGCCGGGGAGGAGG3' (SEQ ID NO: 3)
- Cy5-D- Cas9(2NLS) RNP with sgRNA-1 (10 pg/mL Cas9) induced (-20%) editing (FIG. 12A-12C).
- sgRNA-2 containing D-Cas9 RNP or Lipo Cas9 RNP did not induce any appreciable gene editing efficiency under the current treatment protocol.
- the gene editing efficiency was measured by flow cytometry to quantify the editing efficiency.
- hydroxyl PAMAM dendrimer conjugated CRISPR/Cas9 delivery system using highly specific inverse Diels-alder click reaction (lEDDA) was developed.
- the hydroxyl terminated PAMAM dendrimers are well-defined hyper branched polymeric nanoparticles found to preferentially target activated macrophages in inflammatory/neuroinflammatory models (Nance, E. et al., Journal of Neuroinflammation 14, 252, (2017); Turk, B. R. et al., Annals of Neurology 84, 452-462, (2016); Sharma, R. et al., J Control Release 323, 361-375, (2020); Mishra, M. K. et al.
- Cas9 (S. pyogenes) nuclease was covalently conjugated to generation 6 PAMAM dendrimer (PAMAM-G6-OH) via glutathione sensitive linker (Le Rhun, et al., RNA Biol 16, 380-389, (2019)).
- the sgRNA was later complexed with D-Cas9 to form D-Cas9(sgRNA) RNP complex.
- D-Cas9(sgRNA) complex undergoes reduction by intracellular glutathione, releasing the Cas9/sgRNA cargo and, ultimately translocating into the nucleus.
- nuclear translocation of CRISPR/Cas9 is obtained by a nuclear localization signal (NLS), a short sequence of amino acids that transport nuclear proteins into the nucleus.
- NLS nuclear localization signal
- the commercially available Cas9, that has 2NLS modifications was specially selected for this study.
- dendrimer-Cas9 conjugate can directly deliver CRISPR Cas9 RNP into an intracellular milieu in vitro.
- the dendrimer conjugated Cas9 RNPs demonstrated dose-dependent knockdown in green fluorescent protein (“GFP”) expressing HEK 293 cells in vitro.
- GFP green fluorescent protein
- the D-Cas9 RNPs targeting GFP gene in cells expressing stable form of GFP reporter resulted in near quantitative (-100 %) GFP knockout in HEK cells as quantified by flow cytometry.
- Control RNPs complexed with Lipofectamine 2000 yielded only -50% of gene editing efficacy in in vitro.
- D-Cas9 RNP was significantly less toxic than lipofectamine method in both ARPE-19 cells and HEK 293 cell lines.
- D-Cas9 (2NLS) RNP targeting VEGFA gene resulted in -20% VEGFA gene edited cell population.
- D-Cas9 RNP for both VEGFA and GFP genes had maximum efficiency at 10 pg/mL of Cas9.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Crystallography & Structural Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263391598P | 2022-07-22 | 2022-07-22 | |
| PCT/US2023/070818 WO2024020597A1 (en) | 2022-07-22 | 2023-07-24 | Dendrimer-enabled targeted intracellular crispr/cas system delivery and gene editing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4558173A1 true EP4558173A1 (en) | 2025-05-28 |
Family
ID=87576065
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP23755291.4A Pending EP4558173A1 (en) | 2022-07-22 | 2023-07-24 | Dendrimer-enabled targeted intracellular crispr/cas system delivery and gene editing |
Country Status (7)
| Country | Link |
|---|---|
| EP (1) | EP4558173A1 (en) |
| JP (1) | JP2025523965A (en) |
| KR (1) | KR20250042151A (en) |
| CN (1) | CN119584991A (en) |
| AU (1) | AU2023311477A1 (en) |
| CA (1) | CA3262625A1 (en) |
| WO (1) | WO2024020597A1 (en) |
Family Cites Families (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US150A (en) | 1837-03-25 | Island | ||
| US5436A (en) | 1848-02-08 | Air-heating furnace | ||
| US4714680B1 (en) | 1984-02-06 | 1995-06-27 | Univ Johns Hopkins | Human stem cells |
| US4965204A (en) | 1984-02-06 | 1990-10-23 | The Johns Hopkins University | Human stem cells and monoclonal antibodies |
| US5061620A (en) | 1990-03-30 | 1991-10-29 | Systemix, Inc. | Human hematopoietic stem cell |
| US5487994A (en) | 1992-04-03 | 1996-01-30 | The Johns Hopkins University | Insertion and deletion mutants of FokI restriction endonuclease |
| US5356802A (en) | 1992-04-03 | 1994-10-18 | The Johns Hopkins University | Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease |
| US5409813A (en) | 1993-09-30 | 1995-04-25 | Systemix, Inc. | Method for mammalian cell separation from a mixture of cell populations |
| US5677136A (en) | 1994-11-14 | 1997-10-14 | Systemix, Inc. | Methods of obtaining compositions enriched for hematopoietic stem cells, compositions derived therefrom and methods of use thereof |
| US5945337A (en) | 1996-10-18 | 1999-08-31 | Quality Biological, Inc. | Method for culturing CD34+ cells in a serum-free medium |
| GB9710809D0 (en) | 1997-05-23 | 1997-07-23 | Medical Res Council | Nucleic acid binding proteins |
| GB9710807D0 (en) | 1997-05-23 | 1997-07-23 | Medical Res Council | Nucleic acid binding proteins |
| US6140081A (en) | 1998-10-16 | 2000-10-31 | The Scripps Research Institute | Zinc finger binding domains for GNN |
| US6534261B1 (en) | 1999-01-12 | 2003-03-18 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
| US6453242B1 (en) | 1999-01-12 | 2002-09-17 | Sangamo Biosciences, Inc. | Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites |
| WO2001000788A2 (en) | 1999-06-25 | 2001-01-04 | Northwestern University | Compositions, kits, and methods for modulating survival and differentiation of multi-potential hematopoietic progenitor cells |
| US7067617B2 (en) | 2001-02-21 | 2006-06-27 | The Scripps Research Institute | Zinc finger binding domains for nucleotide sequence ANN |
| US20040197892A1 (en) | 2001-04-04 | 2004-10-07 | Michael Moore | Composition binding polypeptides |
| WO2003016496A2 (en) | 2001-08-20 | 2003-02-27 | The Scripps Research Institute | Zinc finger binding domains for cnn |
| EP1963499A4 (en) | 2005-11-28 | 2009-04-08 | Scripps Research Inst | DOMAINS BINDING ZINC FINGERS FOR TNN TRIPLET |
| US20070154989A1 (en) | 2006-01-03 | 2007-07-05 | The Scripps Research Institute | Zinc finger domains specifically binding agc |
| EP2214646B1 (en) | 2007-10-05 | 2021-06-23 | Wayne State University | Dendrimers for sustained release of compounds |
| WO2010147831A1 (en) | 2009-06-15 | 2010-12-23 | Wayne State University | Dendrimer based nanodevices for therapeutic and imaging purposes |
| NO2510096T3 (en) | 2009-12-10 | 2015-03-21 | ||
| CA2830052C (en) | 2010-03-31 | 2018-10-09 | Wayne State University | Injectable dendrimer hydrogel nanoparticles |
| LT3401400T (en) | 2012-05-25 | 2019-06-10 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| JP2015527889A (en) | 2012-07-25 | 2015-09-24 | ザ ブロード インスティテュート, インコーポレイテッド | Inducible DNA binding protein and genomic disruption tools and their applications |
| CA3035502A1 (en) | 2014-04-30 | 2015-11-05 | Kannan Rangaramanujam | Dendrimer compositions and their use in treatment of diseases of the eye |
| CN114392360A (en) | 2014-08-13 | 2022-04-26 | 约翰霍普金斯大学 | Dendrimer compositions and use in the treatment of neurological and CNS disorders |
| WO2016025741A1 (en) | 2014-08-13 | 2016-02-18 | The Johns Hopkins University | Selective dendrimer delivery to brain tumors |
| CA3082121C (en) | 2017-11-10 | 2023-01-24 | The Johns Hopkins University | Dendrimer delivery system and methods of use thereof |
-
2023
- 2023-07-24 AU AU2023311477A patent/AU2023311477A1/en active Pending
- 2023-07-24 WO PCT/US2023/070818 patent/WO2024020597A1/en not_active Ceased
- 2023-07-24 KR KR1020257003312A patent/KR20250042151A/en active Pending
- 2023-07-24 JP JP2025502880A patent/JP2025523965A/en active Pending
- 2023-07-24 EP EP23755291.4A patent/EP4558173A1/en active Pending
- 2023-07-24 CA CA3262625A patent/CA3262625A1/en active Pending
- 2023-07-24 CN CN202380055138.9A patent/CN119584991A/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| KR20250042151A (en) | 2025-03-26 |
| CN119584991A (en) | 2025-03-07 |
| JP2025523965A (en) | 2025-07-25 |
| WO2024020597A1 (en) | 2024-01-25 |
| CA3262625A1 (en) | 2024-01-25 |
| AU2023311477A1 (en) | 2025-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2022221454B2 (en) | Dendrimer delivery system and methods of use thereof | |
| ES2910550T3 (en) | Therapeutic conjugates with sulfated dendrimers for selection of intracellular targets | |
| CN115103690B (en) | Dendrimer compositions and methods for drug delivery to the eye | |
| US20250195672A1 (en) | Dendrimer compositions for targeted delivery of therapeutics to neurons | |
| US20220105202A1 (en) | Universal multi-functional gsh-responsive silica nanoparticles for delivery of biomolecules into cells | |
| US20250135012A1 (en) | Dendrimer conjugates of small molecule biologics for intracellular delivery | |
| Liyanage et al. | Efficient intracellular delivery of CRISPR-Cas9 ribonucleoproteins using dendrimer nanoparticles for robust genomic editing | |
| Zhang et al. | A zwitterionic polymer-inspired material mediated efficient CRISPR-Cas9 gene editing | |
| WO2024020597A1 (en) | Dendrimer-enabled targeted intracellular crispr/cas system delivery and gene editing | |
| WO2018109138A1 (en) | Cyclodextrin conjugates | |
| HK40123315A (en) | Dendrimer-enabled targeted intracellular crispr/cas system delivery and gene editing | |
| HK40119489A (en) | Dendrimer compositions for targeted delivery of therapeutics to neurons | |
| AU2021259868B2 (en) | Compositions and methods comprising dendrimers and therapeutic agents | |
| US20230338554A1 (en) | Galactosylated dendrimers for targeted intracellular delivery to hepatocytes | |
| Kannan et al. | Efficient Intracellular Delivery of Crispr-Cas9 Ribonucleoproteins Using Dendrimer Nanoparticles for Robust Genomic Editing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250206 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 40127399 Country of ref document: HK |